WorldWideScience

Sample records for directs metavinculin functions

  1. Directional outlyingness for multivariate functional data

    KAUST Repository

    Dai, Wenlin; Genton, Marc G.

    2018-01-01

    The direction of outlyingness is crucial to describing the centrality of multivariate functional data. Motivated by this idea, classical depth is generalized to directional outlyingness for functional data. Theoretical properties of functional

  2. Directional outlyingness for multivariate functional data

    KAUST Repository

    Dai, Wenlin

    2018-04-07

    The direction of outlyingness is crucial to describing the centrality of multivariate functional data. Motivated by this idea, classical depth is generalized to directional outlyingness for functional data. Theoretical properties of functional directional outlyingness are investigated and the total outlyingness can be naturally decomposed into two parts: magnitude outlyingness and shape outlyingness which represent the centrality of a curve for magnitude and shape, respectively. This decomposition serves as a visualization tool for the centrality of curves. Furthermore, an outlier detection procedure is proposed based on functional directional outlyingness. This criterion applies to both univariate and multivariate curves and simulation studies show that it outperforms competing methods. Weather and electrocardiogram data demonstrate the practical application of our proposed framework.

  3. Empirical validation of directed functional connectivity.

    Science.gov (United States)

    Mill, Ravi D; Bagic, Anto; Bostan, Andreea; Schneider, Walter; Cole, Michael W

    2017-02-01

    Mapping directions of influence in the human brain connectome represents the next phase in understanding its functional architecture. However, a host of methodological uncertainties have impeded the application of directed connectivity methods, which have primarily been validated via "ground truth" connectivity patterns embedded in simulated functional MRI (fMRI) and magneto-/electro-encephalography (MEG/EEG) datasets. Such simulations rely on many generative assumptions, and we hence utilized a different strategy involving empirical data in which a ground truth directed connectivity pattern could be anticipated with confidence. Specifically, we exploited the established "sensory reactivation" effect in episodic memory, in which retrieval of sensory information reactivates regions involved in perceiving that sensory modality. Subjects performed a paired associate task in separate fMRI and MEG sessions, in which a ground truth reversal in directed connectivity between auditory and visual sensory regions was instantiated across task conditions. This directed connectivity reversal was successfully recovered across different algorithms, including Granger causality and Bayes network (IMAGES) approaches, and across fMRI ("raw" and deconvolved) and source-modeled MEG. These results extend simulation studies of directed connectivity, and offer practical guidelines for the use of such methods in clarifying causal mechanisms of neural processing. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Directional output distance functions: endogenous directions based on exogenous normalization constraints

    Science.gov (United States)

    In this paper we develop a model for computing directional output distance functions with endogenously determined direction vectors. We show how this model is related to the slacks-based directional distance function introduced by Fare and Grosskopf and show how to use the slacks-based function to e...

  5. Direct functionalization of nanodiamonds with maleimide

    KAUST Repository

    El Tall, Omar

    2014-05-13

    Diamond materials span a wide range of attractive physical properties, including large mechanical resistance, high thermal conductivity, and tunable optoelectronic behavior when suitably doped. Down to the nanoscale, embedded diamond nanoparticles find use in surface coatings and nanocomposites and are promising building elements in nanophotonic device engineering. The nature of the solubilizing substituents and specific functional groups appended to the nanodiamond surface defines the function of the nanoparticle and in turn its field of applicability. Synthetic nanodiamonds prepared by detonation protocols, so-called detonation diamond nanoparticles (DDNP), are composed of primary nanocrystals (2-10 nm) and their aggregates. A detailed experimental section can be found in the Supporting Information; the XRD analysis of the GDNP(800) precursor confirmed the integrity of the diamond core upon thermal annealing.

  6. Direct functionalization of nanodiamonds with maleimide

    KAUST Repository

    El Tall, Omar; Hou, Yuanfang; Abou-Hamad, Edy; Raja, Inam Ul haq; Hedhili, Mohamed N.; Peng, Wei; Mahfouz, Remi; Bakr, Osman; Beaujuge, Pierre

    2014-01-01

    Diamond materials span a wide range of attractive physical properties, including large mechanical resistance, high thermal conductivity, and tunable optoelectronic behavior when suitably doped. Down to the nanoscale, embedded diamond nanoparticles find use in surface coatings and nanocomposites and are promising building elements in nanophotonic device engineering. The nature of the solubilizing substituents and specific functional groups appended to the nanodiamond surface defines the function of the nanoparticle and in turn its field of applicability. Synthetic nanodiamonds prepared by detonation protocols, so-called detonation diamond nanoparticles (DDNP), are composed of primary nanocrystals (2-10 nm) and their aggregates. A detailed experimental section can be found in the Supporting Information; the XRD analysis of the GDNP(800) precursor confirmed the integrity of the diamond core upon thermal annealing.

  7. Comparative study on spreading function for directional wave spectra

    Digital Repository Service at National Institute of Oceanography (India)

    Bhat, S.S.; Anand, N.M.; Nayak, B.U.

    -dimensional wave energy S(f) and the directional spreading function D(f, theta). This paper reviews various spreading functions proposed in the past for estimating the directional wave energy and presents their application to the Indian wave condition. It is found...

  8. Functional Behavior Assessment in Schools: Current Status and Future Directions

    Science.gov (United States)

    Anderson, Cynthia M.; Rodriguez, Billie Jo; Campbell, Amy

    2015-01-01

    Functional behavior assessment is becoming a commonly used practice in school settings. Accompanying this growth has been an increase in research on functional behavior assessment. We reviewed the extant literature on documenting indirect and direct methods of functional behavior assessment in school settings. To discern best practice guidelines…

  9. Lifetime information from correlation functions selected by directional cuts

    International Nuclear Information System (INIS)

    Gelbke, C.K.

    1995-01-01

    Two-particle correlation functions provide information on the space-time characteristics of the emitting source. In many cases, ambiguities of the relative magnitudes of source radius and lifetime can be reduced by analysis of correlation functions evaluated for specific directional cuts on the relative velocity of the coincident particle pair. Information on non-spherical breakup geometries is more difficult to extract. Examples of two-proton correlation functions in which directional cuts are employed to reduce existing space-time ambiguities for the emitting system are presented. (author). 50 refs., 10 figs

  10. Goal Direction and Effectiveness, Emotional Maturity, and Nuclear Family Functioning

    Science.gov (United States)

    Klever, Phillip

    2009-01-01

    Differentiation of self, a cornerstone concept in Bowen theory, has a profound influence over time on the functioning of the individual and his or her family unit. This 5-year longitudinal study tested this hypothesis with 50 developing nuclear families. The dimensions of differentiation of self that were examined were goal direction and…

  11. Pupils' Humour Directed at Teachers: Its Types and Functions

    Science.gov (United States)

    Šedová, Klára

    2013-01-01

    Based on an analysis of 137 texts written by pupils, this paper examines pupils' humour directed at teachers, its types and social functions. The collected data are divided into three categories that describe different modes of teachers as targets of pupils' humour. The first mode describes teachers as unintentionally comical, the second as duped…

  12. Developing Self-Directed Executive Functioning: Recent Findings and Future Directions

    Science.gov (United States)

    Barker, Jane E.; Munakata, Yuko

    2015-01-01

    How do children become increasingly self-directed across development, achieving their goals without help from others? How might such developments be impacted by societal changes in how children spend their time? Children's abilities to achieve their goals are supported by developing executive functions (EFs), cognitive processes that predict…

  13. Application of Patterson-function direct methods to materials characterization.

    Science.gov (United States)

    Rius, Jordi

    2014-09-01

    The aim of this article is a general description of the so-called Patterson-function direct methods (PFDM), from their origin to their present state. It covers a 20-year period of methodological contributions to crystal structure solution, most of them published in Acta Crystallographica Section A. The common feature of these variants of direct methods is the introduction of the experimental intensities in the form of the Fourier coefficients of origin-free Patterson-type functions, which allows the active use of both strong and weak reflections. The different optimization algorithms are discussed and their performances compared. This review focuses not only on those PFDM applications related to powder diffraction data but also on some recent results obtained with electron diffraction tomography data.

  14. Application of Patterson-function direct methods to materials characterization

    Directory of Open Access Journals (Sweden)

    Jordi Rius

    2014-09-01

    Full Text Available The aim of this article is a general description of the so-called Patterson-function direct methods (PFDM, from their origin to their present state. It covers a 20-year period of methodological contributions to crystal structure solution, most of them published in Acta Crystallographica Section A. The common feature of these variants of direct methods is the introduction of the experimental intensities in the form of the Fourier coefficients of origin-free Patterson-type functions, which allows the active use of both strong and weak reflections. The different optimization algorithms are discussed and their performances compared. This review focuses not only on those PFDM applications related to powder diffraction data but also on some recent results obtained with electron diffraction tomography data.

  15. Efficiency analysis of Chinese industry: A directional distance function approach

    International Nuclear Information System (INIS)

    Watanabe, Michio; Tanaka, Katsuya

    2007-01-01

    Two efficiency measures of Chinese industry were estimated at the provincial level from 1994 to 2002, using a directional output distance function. One is a traditional efficiency measure that considers only desirable output, while the other considers both desirable and undesirable outputs simultaneously. A comparison of the two measures revealed that efficiency levels are biased only if desirable output is considered. Five coastal provinces/municipalities that have attracted a large amount of foreign direct investment are found to be the most efficient when only desirable output is considered, and also when both desirable and undesirable outputs are considered. However, omitting undesirable output tends to lead to an overestimate of industrial efficiency levels in Shandong, Sichuan, and Hebei provinces. We also found that a province's industrial structure has significant effects on its efficiency levels

  16. Microtubules provide directional information for core PCP function

    Science.gov (United States)

    Matis, Maja; Russler-Germain, David A; Hu, Qie; Tomlin, Claire J; Axelrod, Jeffrey D

    2014-01-01

    Planar cell polarity (PCP) signaling controls the polarization of cells within the plane of an epithelium. Two molecular modules composed of Fat(Ft)/Dachsous(Ds)/Four-jointed(Fj) and a ‘PCP-core’ including Frizzled(Fz) and Dishevelled(Dsh) contribute to polarization of individual cells. How polarity is globally coordinated with tissue axes is unresolved. Consistent with previous results, we find that the Ft/Ds/Fj-module has an effect on a MT-cytoskeleton. Here, we provide evidence for the model that the Ft/Ds/Fj-module provides directional information to the core-module through this MT organizing function. We show Ft/Ds/Fj-dependent initial polarization of the apical MT-cytoskeleton prior to global alignment of the core-module, reveal that the anchoring of apical non-centrosomal MTs at apical junctions is polarized, observe that directional trafficking of vesicles containing Dsh depends on Ft, and demonstrate the feasibility of this model by mathematical simulation. Together, these results support the hypothesis that Ft/Ds/Fj provides a signal to orient core PCP function via MT polarization. DOI: http://dx.doi.org/10.7554/eLife.02893.001 PMID:25124458

  17. [Scientific potential of phenomics - functional direction of genetics].

    Science.gov (United States)

    Marasanov, A V; Valtseva, E A

    In this paper on the based on the integration of known theories, doctrines and concepts - principles of consistency and self-regulation of physiological functions (Pavlov I.P., 1950), the theory offunctional systems (Anokhin P.K., 1973), the theory of adaptive reactions (Selye H., 1960 ; Garkavi LKh et al, 1979), the doctrine of the dominant (Ukhtomsky A.A., 1966), doctrine on health (Baevsky R.M.), doctrine on the body type of the human by Merlin VS. conception on the “the interrelationship between the function and genetic apparatus” by Meyerson F.Z., Pshennikova M.G., Platonov V.N., and others, there is proposed to select phenomics - functional division of genetics considering the poolability of specific mechanisms of the body in an integral system of the adaptive act in favor of the development of a personalized approach to the diagnosis and prevention of non-communicable diseases, increasing life expectancy of working age into the particular scientific direction. The task of phenomics is the establishment of the phenotypic characteristics of the person, norms of the response of systems of his body, determination of the deviation of the level of the functioning of the each system from the norm of its response and the elaboration of the tactics for the correction of the functional state of the organism (the optimization of its life activity), with taking into account the directedness of the interaction of body systems. The description of the shaping of the mechanism of stereotyped response of the organism generated an important contribution to the development of phenomics. Stereotyped response being initiated by the non-specific response of the body is aimed at the shaping of the activity of its systems after a fashion of norms of the activity, promotes the recovery of the specificity of the body, plays an important role in the establishment of cause-effect relations of the disease.

  18. Dynamic prediction of cumulative incidence functions by direct binomial regression.

    Science.gov (United States)

    Grand, Mia K; de Witte, Theo J M; Putter, Hein

    2018-03-25

    In recent years there have been a series of advances in the field of dynamic prediction. Among those is the development of methods for dynamic prediction of the cumulative incidence function in a competing risk setting. These models enable the predictions to be updated as time progresses and more information becomes available, for example when a patient comes back for a follow-up visit after completing a year of treatment, the risk of death, and adverse events may have changed since treatment initiation. One approach to model the cumulative incidence function in competing risks is by direct binomial regression, where right censoring of the event times is handled by inverse probability of censoring weights. We extend the approach by combining it with landmarking to enable dynamic prediction of the cumulative incidence function. The proposed models are very flexible, as they allow the covariates to have complex time-varying effects, and we illustrate how to investigate possible time-varying structures using Wald tests. The models are fitted using generalized estimating equations. The method is applied to bone marrow transplant data and the performance is investigated in a simulation study. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Direct analysis of thymic function in children with Down's syndrome

    Directory of Open Access Journals (Sweden)

    Meschiari Liviana

    2005-02-01

    Full Text Available Abstract Background Down's syndrome (DS is characterized by several immunological defects, especially regarding T cell compartment. DS is considered the best example of accelerated ageing in humans. Direct observations of the thymus have shown that in DS this organ undergoes severe histological and morphological changes. However, no data on its capacity to generate T cells are present in the literature. Here, using a new technology based upon real time PCR, we have investigated the capacity of the thymus to produce and release newly generated T lymphocytes (the so called "recent thymic emigrants", RTE in children with DS. Methods We studied 8 children affected by DS, aged 2–7 years, compared with 8 age- and sex-matched healthy controls. Flow cytometry was used to determine different lymphocytes subsets. Real time PCR with the Taqman system was used to quantify the amount of RTE, i.e. peripheral blood lymphocytes that express the T cell receptor rearrangement excision circles (TREC. Results In comparison with control children, those with DS had a significant lower number of TREC+ peripheral blood cells. Moreover, in DS children but not in controls, a strong negative correlation between age and the levels of TREC+ cells was found. Conclusions The direct measure of thymic output indicates that the impairment of the organ results in a reduced production of newly generated T cells. This observation could suggest that cytokines able to modulate thymic function, such as interleukins, could be useful to improve the functionality of the organ and to treat the immunodeficiency present in DS subjects.

  20. Insights into the Functions of a Prophage Recombination Directionality Factor

    Directory of Open Access Journals (Sweden)

    Mireille Ansaldi

    2012-10-01

    Full Text Available Recombination directionality factors (RDFs, or excisionases, are essential players of prophage excisive recombination. Despite the essentially catalytic role of the integrase in both integrative and excisive recombination, RDFs are required to direct the reaction towards excision and to prevent re-integration of the prophage genome when entering a lytic cycle. KplE1, HK620 and numerous (prophages that integrate at the same site in enterobacteria genomes (such as the argW tRNA gene all share a highly conserved recombination module. This module comprises the attL and attR recombination sites and the RDF and integrase genes. The KplE1 RDF was named TorI after its initial identification as a negative regulator of the tor operon. However, it was characterized as an essential factor of excisive recombination. In this study, we designed an extensive random mutagenesis protocol of the torI gene and identified key residues involved in both functions of the TorI protein. We show that, in addition to TorI-TorR protein-protein interaction, TorI interacts in solution with the IntS integrase. Moreover, in vitro, TorR and IntS appear to compete for TorI binding. Finally, our mutagenesis results suggest that the C-terminal part of the TorI protein is dedicated to protein-protein interactions with both proteins TorR and IntS.

  1. Multiple-region directed functional connectivity based on phase delays.

    Science.gov (United States)

    Goelman, Gadi; Dan, Rotem

    2017-03-01

    Network analysis is increasingly advancing the field of neuroimaging. Neural networks are generally constructed from pairwise interactions with an assumption of linear relations between them. Here, a high-order statistical framework to calculate directed functional connectivity among multiple regions, using wavelet analysis and spectral coherence has been presented. The mathematical expression for 4 regions was derived and used to characterize a quartet of regions as a linear, combined (nonlinear), or disconnected network. Phase delays between regions were used to obtain network's temporal hierarchy and directionality. The validity of the mathematical derivation along with the effects of coupling strength and noise on its outcomes were studied by computer simulations of the Kuramoto model. The simulations demonstrated correct directionality for a large range of coupling strength and low sensitivity to Gaussian noise compared with pairwise coherences. The analysis was applied to resting-state fMRI data of 40 healthy young subjects to characterize the ventral visual system, motor system and default mode network (DMN). It was shown that the ventral visual system was predominantly composed of linear networks while the motor system and the DMN were composed of combined (nonlinear) networks. The ventral visual system exhibits its known temporal hierarchy, the motor system exhibits center ↔ out hierarchy and the DMN has dorsal ↔ ventral and anterior ↔ posterior organizations. The analysis can be applied in different disciplines such as seismology, or economy and in a variety of brain data including stimulus-driven fMRI, electrophysiology, EEG, and MEG, thus open new horizons in brain research. Hum Brain Mapp 38:1374-1386, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. Pd(II)-Catalyzed C–H Functionalizations Directed by Distal Weakly Coordinating Functional Groups

    Science.gov (United States)

    Li, Gang; Wan, Li; Zhang, Guofu; Leow, Dasheng; Spangler, Jillian

    2015-01-01

    Ortho-C(sp2)–H olefination and acetoxylation of broadly useful synthetic building blocks phenylacetyl Weinreb amides, esters, and ketones are developed without installing an additional directing group. The interplay between the distal weak coordination and the ligand-acceleration is crucial for these reactions to proceed under mild conditions. The tolerance of longer distance between the target C–H bonds and the directing functional groups also allows for the functionalizations of more distal C–H bonds in hydrocinnamoyl ketones, Weinreb amides and biphenyl Weinreb amides. Mechanistically, the coordination of these carbonyl groups and the bisdentate amino acid ligand with Pd(II) centers provides further evidence for our early hypothesis that the carbonyl groups of the potassium carboxylate is responsible for the directed C–H activation of carboxylic acids. PMID:25768039

  3. Direct effect of curcumin on porcine ovarian cell functions.

    Science.gov (United States)

    Kádasi, Attila; Maruniaková, Nora; Štochmaľová, Aneta; Bauer, Miroslav; Grossmann, Roland; Harrath, Abdel Halim; Kolesárová, Adriana; Sirotkin, Alexander V

    2017-07-01

    Curcuma longa Linn (L.) is a plant widely used in cooking (in curry powder a.o.) and in folk medicine, but its action on reproductive processes and its possible mechanisms of action remain to be investigated. The objective of this study was to examine the direct effects of curcumin, the major Curcuma longa L. molecule, on basic ovarian cell functions such as proliferation, apoptosis, viability and steroidogenesis. Porcine ovarian granulosa cells were cultured with and without curcumin (at doses of 0, 1, 10 and 100μg/ml of medium). Markers of proliferation (accumulation of PCNA) and apoptosis (accumulation of bax) were analyzed by immunocytochemistry. The expression of mRNA for PCNA and bax was detected by RT-PCR. Cell viability was detected by trypan blue exclusion test. Release of steroid hormones (progesterone and testosterone) was measured by enzyme immunoassay (EIA). It was observed that addition of curcumin reduced ovarian cell proliferation (expression of both PCNA and its mRNA), promoted apoptosis (accumulation of both bax and its mRNA), reduced cell viability, and stimulated both progesterone and testosterone release. These observations demonstrate the direct suppressive effect of Curcuma longa L./curcumin on female gonads via multiple mechanisms of action - suppression of ovarian cell proliferation and viability, promotion of their apoptosis (at the level of mRNA transcription and subsequent accumulation of promoters of genes regulating these activities) and release of anti-proliferative and pro-apoptotic progesterone and androgen. The potential anti-gonadal action of curcumin should be taken into account by consumers of Curcuma longa L.-containing products. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Direct transformation of silyl enol ethers into functionalized allenes.

    Science.gov (United States)

    Langer, P; Döring, M; Seyferth, D; Görls, H

    2001-02-02

    The first elimination reactions of silyl enol ethers to lithiated allenes are reported. These reactions allow a direct transformation of readily available silyl enol ethers into functionalized allenes. The action of three to four equivalents of lithium diisopropylamide (LDA) on silyl enol ethers results in the formation of lithiated allenes by initial allylic lithiation, subsequent elimination of a lithium silanolate, and finally, lithiation of the allene thus formed. Starting with amide-derived silyl imino ethers, lithiated ketenimines are obtained. A variety of reactions of the lithiated allenes with electrophiles (chlorosilanes, trimethylchlorostannane, dimethyl sulfate and ethanol) were carried out. Elimination of silanolate is observed only for substrates that contain the hindered SiMe2tBu or Si(iPr)3 moiety, but not for the SiMe3 group. The reaction of 1,1-dilithio-3,3-diphenylallene with ketones provides a convenient access to novel 1,1-di(hydroxymethyl)allenes which undergo a domino Nazarov-Friedel-Crafts reaction upon treatment with p-toluenesulfonic acid.

  5. Directional Scanning as a Function of Stimulus Characteristics, Reading Habits, and Directional Set

    Science.gov (United States)

    Nachshon, Israel; And Others

    1977-01-01

    "32 English readers and 32 Hebrew readers were shown stimuli with directional characteristics (English and Hebrew letters) and stimuli with no directional characteristics (arrays of different circles, bars, colors, and geometric figures) for scanning. The results showed that, while directional stimulus characteristics affected the direction…

  6. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-01-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response

  7. Reproductive function in mice exposed to ancestral and direct irradiation

    International Nuclear Information System (INIS)

    Nash, D.J.; Sprackling, L.S.

    1978-01-01

    Reproduction was studied in 13 inbred strains of mice that had been exposed continuously to 60 Co gamma radiation for varying numbers of generations. At weaning the mice were removed from the irradiation chamber and were tested for reproductive performance. Ancestral and direct levels of irradiation were determined for each animal. Each irradiated or control female was scored as fertile or sterile, and in utero litter counts were made in pregnant females that were dissected past the 10th day of pregnancy. The number of resorptions, dead embryos, and live embryos were counted, and the ratio of living embryos to the total number of embryos was determined for each litter. The overall fertility curves were sigmoid in the range of doses below those which caused complete sterility, which indicated some sort of cumulative damage. In 11 of the 13 strains studied, an increase in ancestral and/or direct irradiation led to significant decreases in fertility. The means of the number alive in the litters for the control and irradiated mice in each strain showed a definite trend toward fewer live mice in utero after irradiation. Least-squares analyses of variance were made to detect possible effects of any of six irradiation variables (ancestral linear, ancestral quadratic, ancestral cubic, direct linear, direct quadratic, or direct cubic) or of strain differences on total litter size and on ratio. Strain effects were significant in each instance. Litter size was more likely to be affected by radiation variables than ratios were

  8. Data Analysis Trumps Specialist Advice: How Direct Banks Function

    Directory of Open Access Journals (Sweden)

    Skiera Bernd

    2016-11-01

    Full Text Available Low interest rates and sluggish economic growth are not exactly ideal conditions for the financial services industry. Almost daily we are confronted with reports of inadequate capital bases, declining earnings, and layoffs at banks. But while many traditional retail banks are struggling with a business downturn, the direct bank market is enjoying steady and respectable growth despite a challenging environment. Dr. Schmidberger, Fully Authorized Representative at ING-DiBa Germany, offers us a glimpse behind the curtains of this direct bank. We will learn how data technology is used so that bank customers are (more satisfied.

  9. Contrasting the crospovidones functionality as excipients for direct compression

    Directory of Open Access Journals (Sweden)

    Daniel García Ramírez

    2015-03-01

    Full Text Available Specific values of technological properties of excipients allow the establishment of numerical parameters to define and compare their functionality. This study investigates the functionality of Polyplasdones XL and XL10. Parameters studied included tablet disintegration profiles, compactibility profiles and powder flow. The results allowed the establishment of quantitative surrogate functionalities of technological performance, such as absolute number, and as a value relative to the known microcrystalline cellulose type 102. Moreover, the establishment of an explicit functionality to improve the technological performance of two diluents and a model drug was investigated, as was setting up of these functionalities, as quantitative values, to determine the input variables of each material and its probable functionality in a drug product. Disintegration times of pure Polyplasdone XL and its admixtures were around half that of Polyplasdone XL10. The improvement in tablet compactibility was 25-50% greater for Polyplasdone XL10 than Polyplasdone XL. Crospovidones proportions of up to 10% have little effect on the flow properties of other powders, although pure Polyplasdone XL10 and its admixtures display compressibility indexes about 20% greater than Polyplasdone XL. The observed results are in line with a smaller particle size of Polyplasdone XL10 compared to Polyplasdone XL.

  10. Non-Neutralizing Antibodies Directed against HIV and Their Functions

    Directory of Open Access Journals (Sweden)

    Luzia M. Mayr

    2017-11-01

    Full Text Available B cells produce a plethora of anti-HIV antibodies (Abs but only few of them exhibit neutralizing activity. This was long considered a profound limitation for the enforcement of humoral immune responses against HIV-1 infection, especially since these neutralizing Abs (nAbs are extremely difficult to induce. However, increasing evidence shows that additional non-neutralizing Abs play a significant role in decreasing the viral load, leading to partial and sometimes even total protection. Mechanisms suspected to participate in protection are numerous. They involve the Fc domain of Abs as well as their Fab part, and consequently the induced Ab isotype will be determinant for their functions, as well as the quantity and quality of the Fc-receptors (FcRs expressed on immune cells. Fc-mediated inhibitory functions, such as Ab-dependent cellular cytotoxicity, antibody-dependent cellular phagocytosis, aggregation, and even immune activation have been proposed. However, as for nAbs, the non-neutralizing activities are limited to a subset of anti-HIV Abs. An improved in-depth characterization of the Abs displaying these functional responses is required for the development of new vaccination strategies, which aim to selectively trigger the B cells able to induce the right functional Ab combinations both at the right place and at the right time. This review summarizes our current knowledge on non-neutralizing functional inhibitory Abs and discusses the potential benefit of inducing them via vaccination. We also provide new insight into the roles of the FcγR-mediated Ab therapeutics in clinical trials for HIV diseases.

  11. Direct quantification of negatively charged functional groups on membrane surfaces

    KAUST Repository

    Tiraferri, Alberto

    2012-02-01

    Surface charge plays an important role in membrane-based separations of particulates, macromolecules, and dissolved ionic species. In this study, we present two experimental methods to determine the concentration of negatively charged functional groups at the surface of dense polymeric membranes. Both techniques consist of associating the membrane surface moieties with chemical probes, followed by quantification of the bound probes. Uranyl acetate and toluidine blue O dye, which interact with the membrane functional groups via complexation and electrostatic interaction, respectively, were used as probes. The amount of associated probes was quantified using liquid scintillation counting for uranium atoms and visible light spectroscopy for the toluidine blue dye. The techniques were validated using self-assembled monolayers of alkanethiols with known amounts of charged moieties. The surface density of negatively charged functional groups of hand-cast thin-film composite polyamide membranes, as well as commercial cellulose triacetate and polyamide membranes, was quantified under various conditions. Using both techniques, we measured a negatively charged functional group density of 20-30nm -2 for the hand-cast thin-film composite membranes. The ionization behavior of the membrane functional groups, determined from measurements with toluidine blue at varying pH, was consistent with published data for thin-film composite polyamide membranes. Similarly, the measured charge densities on commercial membranes were in general agreement with previous investigations. The relative simplicity of the two methods makes them a useful tool for quantifying the surface charge concentration of a variety of surfaces, including separation membranes. © 2011 Elsevier B.V.

  12. Executive functions, parental punishment, and aggression: Direct and moderated relations.

    Science.gov (United States)

    Fatima, Shameem; Sharif, Imran

    2017-12-01

    The main focus of the current study was to assess whether executive functions (EFs) moderate the effect of parental punishment on adolescent aggression. The sample were 370 participants (53% girls, 47% boys) enrolled at secondary and higher secondary levels and ranged in age between 13-19 years (M = 15.5, SD = 1.3). Participants were assessed on a self-report measure of aggression and two punishment measures, in addition to a demographic sheet. Then, they were individually assessed on four tests taken from the Delis-Kaplan Executive Functions System (D-KEFS) namely Trial Making Test (TMT), Design Fluency Test (DFT), Color Word Interference Test (CWIT), and Card Sorting Test (CST) to assess cognitive flexibility, nonverbal fluency, inhibition, and problem-solving ability, respectively. Correlation coefficients indicated that all four executive functioning measures and the two punishment measures were significantly correlated with aggression. Moderation analysis indicated that all EFs moderated the relationship between physical punishment and aggression, and only inhibition and problem-solving ability, but not cognitive flexibility and nonverbal fluency, moderated the relations between symbolic punishment and aggression. The findings support the hypothesis that EFs are protective personal factors that promote healthy adolescent adjustment in the presence of challenging environmental factors.

  13. Directed Differentiation of Zebrafish Pluripotent Embryonic Cells to Functional Cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Yao Xiao

    2016-09-01

    Full Text Available A cardiomyocyte differentiation in vitro system from zebrafish embryos remains to be established. Here, we have determined pluripotency window of zebrafish embryos by analyzing their gene-expression patterns of pluripotency factors together with markers of three germ layers, and have found that zebrafish undergoes a very narrow period of pluripotency maintenance from zygotic genome activation to a brief moment after oblong stage. Based on the pluripotency and a combination of appropriate conditions, we established a rapid and efficient method for cardiomyocyte generation in vitro from primary embryonic cells. The induced cardiomyocytes differentiated into functional and specific cardiomyocyte subtypes. Notably, these in vitro generated cardiomyocytes exhibited typical contractile kinetics and electrophysiological features. The system provides a new paradigm of cardiomyocyte differentiation from primary embryonic cells in zebrafish. The technology provides a new platform for the study of heart development and regeneration, in addition to drug discovery, disease modeling, and assessment of cardiotoxic agents.

  14. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-07-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  15. LXA4 actions direct fibroblast function and wound closure

    International Nuclear Information System (INIS)

    Herrera, Bruno S.; Kantarci, Alpdogan; Zarrough, Ahmed; Hasturk, Hatice; Leung, Kai P.; Van Dyke, Thomas E.

    2015-01-01

    Timely resolution of inflammation is crucial for normal wound healing. Resolution of inflammation is an active biological process regulated by specialized lipid mediators including the lipoxins and resolvins. Failure of resolution activity has a major negative impact on wound healing in chronic inflammatory diseases that is manifest as excess fibrosis and scarring. Lipoxins, including Lipoxin A 4 (LXA 4 ), have known anti-fibrotic and anti-scarring properties. The goal of this study was to elucidate the impact of LXA 4 on fibroblast function. Mouse fibroblasts (3T3 Mus musculus Swiss) were cultured for 72 h in the presence of TGF-β1, to induce fibroblast activation. The impact of exogenous TGF-β1 (1 ng/mL) on LXA 4 receptor expression (ALX/FPR2) was determined by flow cytometry. Fibroblast proliferation was measured by bromodeoxyuridine (BrdU) labeling and migration in a “scratch” assay wound model. Expression of α-smooth muscle actin (α-SMA), and collagen types I and III were measured by Western blot. We observed that TGF-β1 up-regulates LXA 4 receptor expression, enhances fibroblast proliferation, migration and scratch wound closure. α-SMA levels and Collagen type I and III deposition were also enhanced. LXA 4 slowed fibroblast migration and scratch wound closure at early time points (24 h), but wound closure was equal to TGF-β1 alone at 48 and 72 h. LXA 4 tended to slow fibroblast proliferation at both concentrations, but had no impact on α-SMA or collagen production by TGF-β1 stimulated fibroblasts. The generalizability of the actions of resolution molecules was examined in experiments repeated with resolvin D2 (RvD2) as the agonist. The activity of RvD2 mimicked the actions of LXA 4 in all assays, through an as yet unidentified receptor. The results suggest that mediators of resolution of inflammation enhance wound healing and limit fibrosis in part by modulating fibroblast function. - Highlights: • TGF-β1 up-regulates LXA 4 receptor (ALX

  16. Polymer density functional theory approach based on scaling second-order direct correlation function.

    Science.gov (United States)

    Zhou, Shiqi

    2006-06-01

    A second-order direct correlation function (DCF) from solving the polymer-RISM integral equation is scaled up or down by an equation of state for bulk polymer, the resultant scaling second-order DCF is in better agreement with corresponding simulation results than the un-scaling second-order DCF. When the scaling second-order DCF is imported into a recently proposed LTDFA-based polymer DFT approach, an originally associated adjustable but mathematically meaningless parameter now becomes mathematically meaningful, i.e., the numerical value lies now between 0 and 1. When the adjustable parameter-free version of the LTDFA is used instead of the LTDFA, i.e., the adjustable parameter is fixed at 0.5, the resultant parameter-free version of the scaling LTDFA-based polymer DFT is also in good agreement with the corresponding simulation data for density profiles. The parameter-free version of the scaling LTDFA-based polymer DFT is employed to investigate the density profiles of a freely jointed tangent hard sphere chain near a variable sized central hard sphere, again the predictions reproduce accurately the simulational results. Importance of the present adjustable parameter-free version lies in its combination with a recently proposed universal theoretical way, in the resultant formalism, the contact theorem is still met by the adjustable parameter associated with the theoretical way.

  17. A Scale Elasticity Measure for Directional Distance Function and its Dual

    OpenAIRE

    Valentin Zelenyuk

    2011-01-01

    In this paper we introduce a scale elasticity measure based on directional distance function for multi-output-multi-input technologies and explore its fundamental properties. Specifically, we derive necessary and sufficient condition for equivalence of the scale elasticity measure based on the directional distance function with the input oriented and output oriented scale elasticity measures. We also establish duality relationship between the scale elasticity measure based on the directional ...

  18. A Scale Elasticity Measure for Directional Distance Function and its Dual: Theory and DEA Estimation

    OpenAIRE

    Valentin Zelenyuk

    2012-01-01

    In this paper we focus on scale elasticity measure based on directional distance function for multi-output-multi-input technologies, explore its fundamental properties and show its equivalence with the input oriented and output oriented scale elasticity measures. We also establish duality relationship between the scale elasticity measure based on the directional distance function with scale elasticity measure based on the profit function. Finally, we discuss the estimation issues of the scale...

  19. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Mahayni, Malek A.

    2011-07-01

    Finding optimal paths in directed graphs is a wide area of research that has received much of attention in theoretical computer science due to its importance in many applications (e.g., computer networks and road maps). Many algorithms have been developed to solve the optimal paths problem with different kinds of graphs. An algorithm that solves the problem of paths’ optimization in directed graphs relative to different cost functions is described in [1]. It follows an approach extended from the dynamic programming approach as it solves the problem sequentially and works on directed graphs with positive weights and no loop edges. The aim of this thesis is to implement and evaluate that algorithm to find the optimal paths in directed graphs relative to two different cost functions ( , ). A possible interpretation of a directed graph is a network of roads so the weights for the function represent the length of roads, whereas the weights for the function represent a constraint of the width or weight of a vehicle. The optimization aim for those two functions is to minimize the cost relative to the function and maximize the constraint value associated with the function. This thesis also includes finding and proving the relation between the two different cost functions ( , ). When given a value of one function, we can find the best possible value for the other function. This relation is proven theoretically and also implemented and experimented using Matlab®[2].

  20. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Mahayni, Malek A.

    2011-01-01

    developed to solve the optimal paths problem with different kinds of graphs. An algorithm that solves the problem of paths’ optimization in directed graphs relative to different cost functions is described in [1]. It follows an approach extended from

  1. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Abubeker, Jewahir Ali; Chikalov, Igor; Hussain, Shahid; Moshkov, Mikhail

    2011-01-01

    This paper is devoted to the consideration of an algorithm for sequential optimization of paths in directed graphs relative to di_erent cost functions. The considered algorithm is based on an extension of dynamic programming which allows

  2. No direct association among respiratory function, disease control and family functioning in a sample of Mexican children with intermittent asthma.

    Science.gov (United States)

    Rodriguez-Orozco, Alain Raimundo; Núñez-Tapia, Rosa María; Ramírez-Silva, Armando; Gómez-Alonso, Carlos

    2013-05-15

    Asthma has been linked to family disfunctioning and poor control of the disease.This study was conducted to analyze the interactions between the level of intermittent asthma control, family functioning and respiratory function and between quality of life of asthmatic patients and their caregivers.7 to 15 years old children with intermittent asthma were included. Asthma Control Test Questionnaire, Pediatric Asthma Quality of Life Questionnaire (PAQLQ) test, and flowmetry were applied to children and Pediatric Asthma Caregiver´s Quatily of Life Questionnaire (PAQCLQ) and the Family Functioning Perception Test (FF-SIL) were applied to their parents.The most affected areas of family functioning in dysfunctional families were adaptability and permeability. A medium to high strength of association was founded between the emotional function of parents and the emotional function of children, R2=0.552. The most remarkable associations were among parents' limitation of activities and parents' emotional function (r=0.837), parents' limitation of activities and child's emotional function (r=0.722), parents' emotional role and limitation of activities (r=0.837), parents' emotional role and emotional functioning of children with asthma (r=0.743) and the limitation of activities of children with asthma and the emotional function of children with asthma (r=0.870).No direct associations were founded among respiratory function, disease control and family functioning in Mexican children with intermittent asthma and emotional function of parents and children were associated in both groups.

  3. Stimulating thought: a functional MRI study of transcranial direct current stimulation in schizophrenia.

    Science.gov (United States)

    Orlov, Natasza D; O'Daly, Owen; Tracy, Derek K; Daniju, Yusuf; Hodsoll, John; Valdearenas, Lorena; Rothwell, John; Shergill, Sukhi S

    2017-09-01

    Individuals with schizophrenia typically suffer a range of cognitive deficits, including prominent deficits in working memory and executive function. These difficulties are strongly predictive of functional outcomes, but there is a paucity of effective therapeutic interventions targeting these deficits. Transcranial direct current stimulation is a novel neuromodulatory technique with emerging evidence of potential pro-cognitive effects; however, there is limited understanding of its mechanism. This was a double-blind randomized sham controlled pilot study of transcranial direct current stimulation on a working memory (n-back) and executive function (Stroop) task in 28 individuals with schizophrenia using functional magnetic resonance imaging. Study participants received 30 min of real or sham transcranial direct current stimulation applied to the left frontal cortex. The 'real' and 'sham' groups did not differ in online working memory task performance, but the transcranial direct current stimulation group demonstrated significant improvement in performance at 24 h post-transcranial direct current stimulation. Transcranial direct current stimulation was associated with increased activation in the medial frontal cortex beneath the anode; showing a positive correlation with consolidated working memory performance 24 h post-stimulation. There was reduced activation in the left cerebellum in the transcranial direct current stimulation group, with no change in the middle frontal gyrus or parietal cortices. Improved performance on the executive function task was associated with reduced activity in the anterior cingulate cortex. Transcranial direct current stimulation modulated functional activation in local task-related regions, and in more distal nodes in the network. Transcranial direct current stimulation offers a potential novel approach to altering frontal cortical activity and exerting pro-cognitive effects in schizophrenia. © The Author (2017). Published by Oxford

  4. Less-structured time in children's daily lives predicts self-directed executive functioning.

    Science.gov (United States)

    Barker, Jane E; Semenov, Andrei D; Michaelson, Laura; Provan, Lindsay S; Snyder, Hannah R; Munakata, Yuko

    2014-01-01

    Executive functions (EFs) in childhood predict important life outcomes. Thus, there is great interest in attempts to improve EFs early in life. Many interventions are led by trained adults, including structured training activities in the lab, and less-structured activities implemented in schools. Such programs have yielded gains in children's externally-driven executive functioning, where they are instructed on what goal-directed actions to carry out and when. However, it is less clear how children's experiences relate to their development of self-directed executive functioning, where they must determine on their own what goal-directed actions to carry out and when. We hypothesized that time spent in less-structured activities would give children opportunities to practice self-directed executive functioning, and lead to benefits. To investigate this possibility, we collected information from parents about their 6-7 year-old children's daily, annual, and typical schedules. We categorized children's activities as "structured" or "less-structured" based on categorization schemes from prior studies on child leisure time use. We assessed children's self-directed executive functioning using a well-established verbal fluency task, in which children generate members of a category and can decide on their own when to switch from one subcategory to another. The more time that children spent in less-structured activities, the better their self-directed executive functioning. The opposite was true of structured activities, which predicted poorer self-directed executive functioning. These relationships were robust (holding across increasingly strict classifications of structured and less-structured time) and specific (time use did not predict externally-driven executive functioning). We discuss implications, caveats, and ways in which potential interpretations can be distinguished in future work, to advance an understanding of this fundamental aspect of growing up.

  5. Bacillus subtilis-based direct-fed microbials augment macrophage function in broiler chickens

    Science.gov (United States)

    The present study was conducted to evaluate the function of Bacillus subtilis-based direct-fed microbials (DFMs) on macrophage functions, i.e., nitric oxide (NO) production and phagocytosis in broiler chickens. DFMs used in this study were eight single strains designated as Bs2084, LSSAO1, 3AP4, Bs1...

  6. Direct fragmentation of quarkonia including Fermi motion using light-cone wave function

    Energy Technology Data Exchange (ETDEWEB)

    Nobary, M.A. Gomshi [Razi University, Department of Physics, Faculty of Science, Kermanshah (Iran); A.E.O.I., Center for Theoretical Physics and Mathematics, Tehran (Iran); Javadi, B. [Razi University, Department of Physics, Faculty of Science, Kermanshah (Iran)

    2005-07-01

    We investigate the effect of Fermi motion on the direct fragmentation of the J/{psi} and {upsilon} states employing a light-cone wave function. Consistent with such a wave function we set up the kinematics of a heavy quark fragmenting into quarkonia such that the Fermi motion of the constituents splits into a longitudinal as well as a transverse direction and thus calculate the fragmentation functions for these states. In the framework of our investigation, we estimate that the fragmentation probabilities of J/{psi} and {upsilon} may increase at least up to 14 percent when including this degree of freedom. (orig.)

  7. Ligand-accelerated non-directed C-H functionalization of arenes

    Science.gov (United States)

    Wang, Peng; Verma, Pritha; Xia, Guoqin; Shi, Jun; Qiao, Jennifer X.; Tao, Shiwei; Cheng, Peter T. W.; Poss, Michael A.; Farmer, Marcus E.; Yeung, Kap-Sun; Yu, Jin-Quan

    2017-11-01

    The directed activation of carbon-hydrogen bonds (C-H) is important in the development of synthetically useful reactions, owing to the proximity-induced reactivity and selectivity that is enabled by coordinating functional groups. Palladium-catalysed non-directed C-H activation could potentially enable further useful reactions, because it can reach more distant sites and be applied to substrates that do not contain appropriate directing groups; however, its development has faced substantial challenges associated with the lack of sufficiently active palladium catalysts. Currently used palladium catalysts are reactive only with electron-rich arenes, unless an excess of arene is used, which limits synthetic applications. Here we report a 2-pyridone ligand that binds to palladium and accelerates non-directed C-H functionalization with arene as the limiting reagent. This protocol is compatible with a broad range of aromatic substrates and we demonstrate direct functionalization of advanced synthetic intermediates, drug molecules and natural products that cannot be used in excessive quantities. We also developed C-H olefination and carboxylation protocols, demonstrating the applicability of our methodology to other transformations. The site selectivity in these transformations is governed by a combination of steric and electronic effects, with the pyridone ligand enhancing the influence of sterics on the selectivity, thus providing complementary selectivity to directed C-H functionalization.

  8. Temperature and directional dependences of the infrared dielectric function of free standing silicon nanowire

    Energy Technology Data Exchange (ETDEWEB)

    Kazan, M.; Bruyant, A.; Sedaghat, Z.; Arnaud, L.; Blaize, S.; Royer, P. [Laboratoire de Nanotechnologie et d' Instrumentation Optique, Institut Charles Delaunay, Universite de Technologie de Troyes, CNRS FRE 2848, 12 Rue Marie Curie, 10010 Troyes, Cedex (France)

    2011-03-15

    An approach to calculate the infrared dielectric function of semiconductor nanostructures is presented and applied to silicon (Si) nanowires (NW's). The phonon modes symmetries and frequencies are calculated by means of the elastic continuum medium theory. The modes strengths and damping are calculated from a model for lattice dynamics and perturbation theory. The data are used in anisotropic Lorentz oscillator model to generate the temperature and directional dependences of the infrared dielectric function of free standing Si NW's. Our results showed that in the direction perpendicular to the NW axis, the complex dielectric function is identical to that of bulk Si. However, along the NW axis, the infrared dielectric function is a strong function of the wavelength. (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  9. Directional resolution of head-related transfer functions required in binaural synthesis

    DEFF Research Database (Denmark)

    Minnaar, Pauli; Plogsties, Jan; Christensen, Flemming

    2005-01-01

    In binaural synthesis a virtual sound source is implemented by convolving an anechoic signal with a pair of head-related transfer functions (HRTFs). In order to represent all possible directions of the sound source with respect to the listener a discrete number of HRTFs are measured and interpola......In binaural synthesis a virtual sound source is implemented by convolving an anechoic signal with a pair of head-related transfer functions (HRTFs). In order to represent all possible directions of the sound source with respect to the listener a discrete number of HRTFs are measured...... and moving sound sources. A criterion was found that predicts the experimental results. This criterion was used to estimate the directional resolution required in binaural synthesis for all directions on the sphere around the head....

  10. The Direct Anterior Approach Does Not Increase Return to Function Following Hemiarthroplasty for Femoral Neck Fracture.

    Science.gov (United States)

    Carlson, Victor R; Ong, Alvin C; Orozco, Fabio R; Lutz, Rex W; Duque, Andres F; Post, Zachary D

    2017-11-01

    The purpose of this study was to evaluate functional outcomes for hemiarthroplasty using a direct anterior approach or a direct lateral approach for femoral neck fracture. This retrospective review used data collected from a single institution between 2006 and 2016. Eighty-five and 75 consecutive patients who underwent hemiarthroplasty via a direct anterior approach and a direct lateral approach, respectively, met inclusion criteria. All patients with femoral neck fractures were treated by 1 of 2 fellowship-trained orthopedic surgeons using the direct anterior approach or the direct lateral approach to hemiarthroplasty. Disposition, ambulation, and other perioperative surgical outcomes were compared between the cohorts. Compared with the direct lateral cohort, the direct anterior cohort had a shorter mean operative time (2.4 minutes, P<.01), a shorter mean length of hospital stay (2.7 days, P<.01), and a smaller mean decrease in hemoglobin postoperatively (0.7 g/dL, P<.01). No significant difference was observed between the cohorts for postoperative disposition, the number of feet ambulated on the second postoperative day, or the prevalence of ambulatory decline at 4- to 6-week and 4- to 6-month follow-up visits. Compared with the direct lateral approach, the direct anterior approach may benefit patients by small, but statistically significant, improvements in blood loss, surgical time, and length of hospital stay after hemiarthroplasty. However, the direct anterior approach does not appear to decrease the likelihood of transfer to a skilled nursing facility postoperatively or accelerate return to preoperative function. [Orthopedics. 2017; 40(6):e1055-e1061.]. Copyright 2017, SLACK Incorporated.

  11. Driving and driven architectures of directed small-world human brain functional networks.

    Directory of Open Access Journals (Sweden)

    Chaogan Yan

    Full Text Available Recently, increasing attention has been focused on the investigation of the human brain connectome that describes the patterns of structural and functional connectivity networks of the human brain. Many studies of the human connectome have demonstrated that the brain network follows a small-world topology with an intrinsically cohesive modular structure and includes several network hubs in the medial parietal regions. However, most of these studies have only focused on undirected connections between regions in which the directions of information flow are not taken into account. How the brain regions causally influence each other and how the directed network of human brain is topologically organized remain largely unknown. Here, we applied linear multivariate Granger causality analysis (GCA and graph theoretical approaches to a resting-state functional MRI dataset with a large cohort of young healthy participants (n = 86 to explore connectivity patterns of the population-based whole-brain functional directed network. This directed brain network exhibited prominent small-world properties, which obviously improved previous results of functional MRI studies showing weak small-world properties in the directed brain networks in terms of a kernel-based GCA and individual analysis. This brain network also showed significant modular structures associated with 5 well known subsystems: fronto-parietal, visual, paralimbic/limbic, subcortical and primary systems. Importantly, we identified several driving hubs predominantly located in the components of the attentional network (e.g., the inferior frontal gyrus, supplementary motor area, insula and fusiform gyrus and several driven hubs predominantly located in the components of the default mode network (e.g., the precuneus, posterior cingulate gyrus, medial prefrontal cortex and inferior parietal lobule. Further split-half analyses indicated that our results were highly reproducible between two

  12. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Abubeker, Jewahir Ali

    2011-05-14

    This paper is devoted to the consideration of an algorithm for sequential optimization of paths in directed graphs relative to di_erent cost functions. The considered algorithm is based on an extension of dynamic programming which allows to represent the initial set of paths and the set of optimal paths after each application of optimization procedure in the form of a directed acyclic graph.

  13. Design winds during ice storm as a function of direction for transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Chouinard, L. [McGill Univ., Montreal, PQ (Canada); Feknous, N. [SNC-Lavalin, Montreal, PQ (Canada); Sabourin, G. [Hydro-Quebec, Montreal, PQ (Canada)

    2005-07-01

    The effects of wind directionality are important considerations in the design of electric transmission lines. A procedure for the estimation of the probability distribution function of maximum wind speed as a function of direction was proposed. The procedure was applied to the sample of annual maximum wind speeds using the Gumbal distribution method and then used to estimate the maximum wind speed as a function of direction for the sample of maximum annual wind speeds, and maximum annual wind speeds during ice storms at 22 locations throughout Quebec. Wind direction obtained from the meteorological stations was recorded in 10 degrees sectors. The data set was used to obtain maximum wind speed for each year in each of 36 sectors. The joint probability distribution function was obtained by assuming that extreme distribution for non-directional winds was common to all directions during a season or period, as well as by assuming independence between wind speed and wind direction during a storm pattern. Structural effects were obtained by integrating the joint probability distribution with design equations. Results were then presented in the form of a ratio relative to the reference wind speed for each location. The procedure was demonstrated using a meteorological data set as well as glaze ice data from Quebec City, and covered a period of 30 years. Results indicated that a reduction factor of 25 per cent can be achieved on ice accumulations when overhead lines are directed parallel to dominant winds. It was concluded that the method will represent significant savings in the design and up-grading of existing lines. Further research will be conducted to address issues related to regional criteria and local adjustments for topographical features. 7 refs., 4 figs.

  14. Subjective cognitive complaints, psychosocial factors and nursing work function in nurses providing direct patient care.

    Science.gov (United States)

    Barbe, Tammy; Kimble, Laura P; Rubenstein, Cynthia

    2018-04-01

    The aim of this study was to examine relationships among subjective cognitive complaints, psychosocial factors and nursing work function in nurses providing direct patient care. Cognitive functioning is a critical component for nurses in the assurance of error prevention, identification and correction when caring for patients. Negative changes in nurses' cognitive and psychosocial functioning can adversely affect nursing care and patient outcomes. A descriptive correlational design with stratified random sampling. The sample included 96 nurses from the major geographic regions of the United States. Over 9 months in 2016-2017, data were collected using a web-based survey. Stepwise multiple linear regression analyses were used to examine relationships among subjective cognitive complaints, psychosocial factors and nursing work function. Overall, participants reported minimal work function impairment and low levels of subjective cognitive complaints, depression and stress. In multivariate analyses, depression was not associated with nurses' work function. However, perceived stress and subjective concerns about cognitive function were associated with greater impairment of work function. Nurses experiencing subjective cognitive complaints should be encouraged to address personal and environmental factors that are associated with their cognitive status. Additionally, stress reduction in nurses should be a high priority as a potential intervention to promote optimal functioning of nurses providing direct patient care. Healthcare institutions should integrate individual and institutional strategies to reduce factors contributing to workplace stress. © 2017 John Wiley & Sons Ltd.

  15. A method for the direct generation of comprehensive numerical solar building transfer functions

    Energy Technology Data Exchange (ETDEWEB)

    Chen, T.Y. [The Hong Kong Polytechnic University (China). Dept. of Building Services Engineering

    2003-02-01

    This paper describes a method for the direct generation of comprehensive numerical room transfer functions with any derived parameters as output, such as operative temperature or thermal load. Complex conductive, convective and radiant heat transfer processes, or any derived thermal parameters in buildings can be explicitly and precisely described by a generalized thermal network. This allows the s-transfer and z-transfer functions to be directly generated, using semi-symbolic analysis techniques, Cayley's expansion of determinant and Heaviside's expansion theorem. A simple algorithm is developed for finding the roots of the denominator in the inverse transform of the s-transfer functions, which ensures that no single root is missing. The techniques have been applied to generating the transfer functions of a passive solar room with floor heating. The example calculation demonstrates the high efficiency of the computational method. (author)

  16. Multi-function radar emitter identification based on stochastic syntax-directed translation schema

    OpenAIRE

    Liu, Haijun; Yu, Hongqi; Sun, Zhaolin; Diao, Jietao

    2014-01-01

    To cope with the problem of emitter identification caused by the radar words’ uncertainty of measured multi-function radar emitters, this paper proposes a new identification method based on stochastic syntax-directed translation schema (SSDTS). This method, which is deduced from the syntactic modeling of multi-function radars, considers the probabilities of radar phrases appearance in different radar modes as well as the probabilities of radar word errors occurrence in different radar phrases...

  17. Late-stage diversification of biologically active pyridazinones via a direct C-H functionalization strategy.

    Science.gov (United States)

    Li, Wei; Fan, Zhoulong; Geng, Kaijun; Xu, Youjun; Zhang, Ao

    2015-01-14

    Divergent C-H functionalization reactions (arylation, carboxylation, olefination, thiolation, acetoxylation, halogenation, naphthylation) using a pyridazinone moiety as an internal directing group were successfully established. This approach offers a late-stage, ortho-selective diversification of a biologically active pyridazinone scaffold. Seven series of novel pyridazinone analogues were synthesized conveniently as the synthetic precursors of potential sortase A (SrtA) inhibitors.

  18. A direct measurement of the baryonic mass function of galaxies & implications for the galactic baryon fraction

    NARCIS (Netherlands)

    Papastergis, Emmanouil; Cattaneo, Andrea; Huang, Shan; Giovanelli, Riccardo; Haynes, Martha P.

    2012-01-01

    We use both an HI-selected and an optically-selected galaxy sample to directly measure the abundance of galaxies as a function of their "baryonic" mass (stars + atomic gas). Stellar masses are calculated based on optical data from the Sloan Digital Sky Survey (SDSS) and atomic gas masses are

  19. Phenobarbital alters hepatic Mrp2 function by direct and indirect interactions

    NARCIS (Netherlands)

    Patel, NJ; Zamek-Gliszczynski, MJ; Zhang, PJ; Han, YH; Jansen, PLM; Meier, PJ; Stieger, B; Brouwer, KLR

    Phenobarbital (PB) treatment impairs the biliary excretion of some organic anions. One mechanism may involve direct competition for biliary excretion by PB and/or a PB metabolite. Alternatively, PB may alter the expression and/or function of hepatic organic anion transport proteins. The role of

  20. Phenobarbital alters hepatic Mrp2 function by direct and indirect interactions

    NARCIS (Netherlands)

    Patel, Nita J.; Zamek-Gliszczynski, Maciej J.; Zhang, Peijin; Han, Yong-Hae; Jansen, Peter L. M.; Meier, Peter J.; Stieger, Bruno; Brouwer, Kim L. R.

    2003-01-01

    Phenobarbital (PB) treatment impairs the biliary excretion of some organic anions. One mechanism may involve direct competition for biliary excretion by PB and/or a PB metabolite. Alternatively, PB may alter the expression and/or function of hepatic organic anion transport proteins. The role of

  1. Free vibration analysis of multi directional functionally graded circular and annular plates

    Energy Technology Data Exchange (ETDEWEB)

    Kermani, Iman Davoodi; Ghayour, Mostafa; Mirdamadi, Hamid Reza [Isfahan Univ. of Technology, Isfahan (Iran, Islamic Republic of)

    2012-11-15

    This paper addresses the free vibration of multi directional functionally graded circular and annular plates using a semianalytical/numerical method, called state space based differential quadrature method. Three-dimensional elasticity equations are derived for multi directional functionally graded plates and a solution is given by the semi-analytical/numerical method. This method gives an analytical solution along the thickness direction, using a state space method and a numerical solution using differential quadrature method. Some numerical examples are presented to show the accuracy and convergence of the method. The most of simulations of the present study have been validated by the existing literature. The non dimensional frequencies and corresponding displacements mode shapes are obtained. Then the influences of thickness ratio and graded indexes are demonstrated on the non dimensional natural frequencies.

  2. Direct Capture of Functional Proteins from Mammalian Plasma Membranes into Nanodiscs.

    Science.gov (United States)

    Roy, Jahnabi; Pondenis, Holly; Fan, Timothy M; Das, Aditi

    2015-10-20

    Mammalian plasma membrane proteins make up the largest class of drug targets yet are difficult to study in a cell free system because of their intransigent nature. Herein, we perform direct encapsulation of plasma membrane proteins derived from mammalian cells into a functional nanodisc library. Peptide fingerprinting was used to analyze the proteome of the incorporated proteins in nanodiscs and to further demonstrate that the lipid composition of the nanodiscs directly affects the class of protein that is incorporated. Furthermore, the functionality of the incorporated membrane proteome was evaluated by measuring the activity of membrane proteins: Na(+)/K(+)-ATPase and receptor tyrosine kinases. This work is the first report of the successful establishment and characterization of a cell free functional library of mammalian membrane proteins into nanodiscs.

  3. Strong Measurements Give a Better Direct Measurement of the Quantum Wave Function.

    Science.gov (United States)

    Vallone, Giuseppe; Dequal, Daniele

    2016-01-29

    Weak measurements have thus far been considered instrumental in the so-called direct measurement of the quantum wave function [4J. S. Lundeen, Nature (London) 474, 188 (2011).]. Here we show that a direct measurement of the wave function can be obtained by using measurements of arbitrary strength. In particular, in the case of strong measurements, i.e., those in which the coupling between the system and the measuring apparatus is maximum, we compared the precision and the accuracy of the two methods, by showing that strong measurements outperform weak measurements in both for arbitrary quantum states in most cases. We also give the exact expression of the difference between the original and reconstructed wave function obtained by the weak measurement approach; this will allow one to define the range of applicability of such a method.

  4. Functional relationship between cognitive representations of movement directions and visuomotor adaptation performance.

    Science.gov (United States)

    Lex, Heiko; Weigelt, Matthias; Knoblauch, Andreas; Schack, Thomas

    2012-12-01

    The aim of our study was to explore whether or not different types of learners in a sensorimotor task possess characteristically different cognitive representations. Participants' sensorimotor adaptation performance was measured with a pointing paradigm which used a distortion of the visual feedback in terms of a left-right reversal. The structure of cognitive representations was assessed using a newly established experimental method, the Cognitive Measurement of Represented Directions. A post hoc analysis revealed inter-individual differences in participants' adaptation performance, and three different skill levels (skilled, average, and poor adapters) have been defined. These differences in performance were correlated with the structure of participants' cognitive representations of movement directions. Analysis of these cognitive representations revealed performance advantages for participants possessing a global cognitive representation of movement directions (aligned to cardinal movement axes), rather than a local representation (aligned to each neighboring direction). Our findings are evidence that cognitive representation structures play a functional role in adaptation performance.

  5. Transcranial direct current stimulation for motor recovery of upper limb function after stroke.

    Science.gov (United States)

    Lüdemann-Podubecká, Jitka; Bösl, Kathrin; Rothhardt, Sandra; Verheyden, Geert; Nowak, Dennis Alexander

    2014-11-01

    Changes in neural processing after stroke have been postulated to impede recovery from stroke. Transcranial direct current stimulation has the potential to alter cortico-spinal excitability and thereby might be beneficial in stroke recovery. We review the pertinent literature prior to 30/09/2013 on transcranial direct current stimulation in promoting motor recovery of the affected upper limb after stroke. We found overall 23 trials (they included 523 participants). All stimulation protocols pride on interhemispheric imbalance model. In a comparative approach, methodology and effectiveness of (a) facilitation of the affected hemisphere, (b) inhibition of the unaffected hemisphere and (c) combined application of transcranial direct current stimulation over the affected and unaffected hemispheres to treat impaired hand function after stroke are presented. Transcranial direct current stimulation is associated with improvement of the affected upper limb after stroke, but current evidence does not support its routine use. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Bi-directional reflectance distribution function of a tungsten block for ITER divertor

    International Nuclear Information System (INIS)

    Iwamae, Atsushi; Ogawa, Hiroaki; Sugie, Tatsuo; Kusama, Yoshinori

    2012-02-01

    In order to investigate reflection properties on plasma-facing material in ITER, the bi-directional reflectance distribution function (BRDF) of a tungsten block sample has been measured. On the machining surface of the block, one-directional machining lines are engraved. Two laser diodes λ652 nm and λ473 nm were used to simulate H α and H β emissions, respectively. The reflected light is affected by the machining surface. The reflected light traces an arc when the incident light is injected in the parallel direction to the engraved line. On the other hand the reflected light traces a line shape when the incident light is injected in the perpendicular direction to the engraved lines. Ray tracing simulation qualitatively explains the experimental results. (author)

  7. High Dietary Fructose: Direct or Indirect Dangerous Factors Disturbing Tissue and Organ Functions.

    Science.gov (United States)

    Zhang, Dong-Mei; Jiao, Rui-Qing; Kong, Ling-Dong

    2017-03-29

    High dietary fructose is a major contributor to insulin resistance and metabolic syndrome, disturbing tissue and organ functions. Fructose is mainly absorbed into systemic circulation by glucose transporter 2 (GLUT2) and GLUT5, and metabolized in liver to produce glucose, lactate, triglyceride (TG), free fatty acid (FFA), uric acid (UA) and methylglyoxal (MG). Its extrahepatic absorption and metabolism also take place. High levels of these metabolites are the direct dangerous factors. During fructose metabolism, ATP depletion occurs and induces oxidative stress and inflammatory response, disturbing functions of local tissues and organs to overproduce inflammatory cytokine, adiponectin, leptin and endotoxin, which act as indirect dangerous factors. Fructose and its metabolites directly and/or indirectly cause oxidative stress, chronic inflammation, endothelial dysfunction, autophagy and increased intestinal permeability, and then further aggravate the metabolic syndrome with tissue and organ dysfunctions. Therefore, this review addresses fructose-induced metabolic syndrome, and the disturbance effects of direct and/or indirect dangerous factors on the functions of liver, adipose, pancreas islet, skeletal muscle, kidney, heart, brain and small intestine. It is important to find the potential correlations between direct and/or indirect risk factors and healthy problems under excess dietary fructose consumption.

  8. High Dietary Fructose: Direct or Indirect Dangerous Factors Disturbing Tissue and Organ Functions

    Directory of Open Access Journals (Sweden)

    Dong-Mei Zhang

    2017-03-01

    Full Text Available High dietary fructose is a major contributor to insulin resistance and metabolic syndrome, disturbing tissue and organ functions. Fructose is mainly absorbed into systemic circulation by glucose transporter 2 (GLUT2 and GLUT5, and metabolized in liver to produce glucose, lactate, triglyceride (TG, free fatty acid (FFA, uric acid (UA and methylglyoxal (MG. Its extrahepatic absorption and metabolism also take place. High levels of these metabolites are the direct dangerous factors. During fructose metabolism, ATP depletion occurs and induces oxidative stress and inflammatory response, disturbing functions of local tissues and organs to overproduce inflammatory cytokine, adiponectin, leptin and endotoxin, which act as indirect dangerous factors. Fructose and its metabolites directly and/or indirectly cause oxidative stress, chronic inflammation, endothelial dysfunction, autophagy and increased intestinal permeability, and then further aggravate the metabolic syndrome with tissue and organ dysfunctions. Therefore, this review addresses fructose-induced metabolic syndrome, and the disturbance effects of direct and/or indirect dangerous factors on the functions of liver, adipose, pancreas islet, skeletal muscle, kidney, heart, brain and small intestine. It is important to find the potential correlations between direct and/or indirect risk factors and healthy problems under excess dietary fructose consumption.

  9. Direct lineage reprogramming of mouse fibroblasts to functional midbrain dopaminergic neuronal progenitors

    Directory of Open Access Journals (Sweden)

    Han-Seop Kim

    2014-01-01

    Full Text Available The direct lineage reprogramming of somatic cells to other lineages by defined factors has led to innovative cell-fate-change approaches for providing patient-specific cells. Recent reports have demonstrated that four pluripotency factors (Oct4, Sox2, Klf4, and c-Myc are sufficient to directly reprogram fibroblasts to other specific cells, including induced neural stem cells (iNSCs. Here, we show that mouse fibroblasts can be directly reprogrammed into midbrain dopaminergic neuronal progenitors (DPs by temporal expression of the pluripotency factors and environment containing sonic hedgehog and fibroblast growth factor 8. Within thirteen days, self-renewing and functional induced DPs (iDPs were generated. Interestingly, the inhibition of both Jak and Gsk3β notably enhanced the iDP reprogramming efficiency. We confirmed the functionality of the iDPs by showing that the dopaminergic neurons generated from iDPs express midbrain markers, release dopamine, and show typical electrophysiological profiles. Our results demonstrate that the pluripotency factors-mediated direct reprogramming is an invaluable strategy for supplying functional and proliferating iDPs and may be useful for other neural progenitors required for disease modeling and cell therapies for neurodegenerative disorders.

  10. Molecular dynamics simulations of Gay-Berne nematic liquid crystal: Elastic properties from direct correlation functions

    International Nuclear Information System (INIS)

    Stelzer, J.; Trebin, H.R.; Longa, L.

    1994-08-01

    We report NVT and NPT molecular dynamics simulations of a Gay-Berne nematic liquid crystal using generalization of recently proposed algorithm by Toxvaerd [Phys. Rev. E47, 343, 1993]. On the basis of these simulations the Oseen-Zoher-Frank elastic constants K 11 , K 22 and K 33 as well as the surface constants K 13 and K 24 have been calculated within the framework of the direct correlation function approach of Lipkin et al. [J. Chem. Phys. 82, 472 (1985)]. The angular coefficients of the direct pair correlation function, which enter the final formulas, have been determined from the computer simulation data for the pair correlation function of the nematic by combining the Ornstein-Zernike relation and the Wienier-Hopf factorization scheme. The unoriented nematic approximation has been assumed when constructing the reference, isotropic state of Lipkin et al. By an extensive study of the model over a wide range of temperatures, densities and pressures a very detailed information has been provided about elastic behaviour of the Gay-Berne nematic. Interestingly, it is found that the results for the surface elastic constants are qualitatively different than those obtained with the help of analytical approximations for the isotropic, direct pair correlation function. For example, the values of the surface elastic constants are negative and an order of magnitude smaller than the bulk elasticity. (author). 30 refs, 9 figs

  11. A posteriori model validation for the temporal order of directed functional connectivity maps.

    Science.gov (United States)

    Beltz, Adriene M; Molenaar, Peter C M

    2015-01-01

    A posteriori model validation for the temporal order of neural directed functional connectivity maps is rare. This is striking because models that require sequential independence among residuals are regularly implemented. The aim of the current study was (a) to apply to directed functional connectivity maps of functional magnetic resonance imaging data an a posteriori model validation procedure (i.e., white noise tests of one-step-ahead prediction errors combined with decision criteria for revising the maps based upon Lagrange Multiplier tests), and (b) to demonstrate how the procedure applies to single-subject simulated, single-subject task-related, and multi-subject resting state data. Directed functional connectivity was determined by the unified structural equation model family of approaches in order to map contemporaneous and first order lagged connections among brain regions at the group- and individual-levels while incorporating external input, then white noise tests were run. Findings revealed that the validation procedure successfully detected unmodeled sequential dependencies among residuals and recovered higher order (greater than one) simulated connections, and that the procedure can accommodate task-related input. Findings also revealed that lags greater than one were present in resting state data: With a group-level network that contained only contemporaneous and first order connections, 44% of subjects required second order, individual-level connections in order to obtain maps with white noise residuals. Results have broad methodological relevance (e.g., temporal validation is necessary after directed functional connectivity analyses because the presence of unmodeled higher order sequential dependencies may bias parameter estimates) and substantive implications (e.g., higher order lags may be common in resting state data).

  12. A posteriori model validation for the temporal order of directed functional connectivity maps

    Directory of Open Access Journals (Sweden)

    Adriene M. Beltz

    2015-08-01

    Full Text Available A posteriori model validation for the temporal order of neural directed functional connectivity maps is rare. This is striking because models that require sequential independence among residuals are regularly implemented. The aim of the current study was (a to apply to directed functional connectivity maps of functional magnetic resonance imaging data an a posteriori model validation procedure (i.e., white noise tests of one-step-ahead prediction errors combined with decision criteria for revising the maps based upon Lagrange Multiplier tests, and (b to demonstrate how the procedure applies to single-subject simulated, single-subject task-related, and multi-subject resting state data. Directed functional connectivity was determined by the unified structural equation model family of approaches in order to map contemporaneous and first order lagged connections among brain regions at the group- and individual-levels while incorporating external input, then white noise tests were run. Findings revealed that the validation procedure successfully detected unmodeled sequential dependencies among residuals and recovered higher order (greater than one simulated connections, and that the procedure can accommodate task-related input. Findings also revealed that lags greater than one were present in resting state data: With a group-level network that contained only contemporaneous and first order connections, 44% of subjects required second order, individual-level connections in order to obtain maps with white noise residuals. Results have broad methodological relevance (e.g., temporal validation is necessary after directed functional connectivity analyses because the presence of unmodeled higher order sequential dependencies may bias parameter estimates and substantive implications (e.g., higher order lags may be common in resting state data.

  13. Total and Direct Correlation Function Integrals from Molecular Simulation of Binary Systems

    DEFF Research Database (Denmark)

    Wedberg, Nils Hejle Rasmus Ingemar; O’Connell, John P.; Peters, Günther H.J.

    2011-01-01

    The possibility for obtaining derivative properties for mixtures from integrals of spatial total and direct correlation functions obtained from molecular dynamics simulations is explored. Theoretically well-supported methods are examined to extend simulation radial distribution functions to long...... are consistent with an excess Helmholtz energy model fitted to available simulations. In addition, simulations of water/methanol and water/t-butanol mixtures have been carried out. The method yields results for partial molar volumes, activity coefficient derivatives, and individual correlation function integrals...... in reasonable agreement with smoothed experimental data. The proposed method for obtaining correlation function integrals is shown to perform at least as well as or better than two previously published approaches....

  14. A review of Green's function methods in computational fluid mechanics: Background, recent developments and future directions

    International Nuclear Information System (INIS)

    Dorning, J.

    1981-01-01

    The research and development over the past eight years on local Green's function methods for the high-accuracy, high-efficiency numerical solution of nuclear engineering problems is reviewed. The basic concepts and key ideas are presented by starting with an expository review of the original fully two-dimensional local Green's function methods developed for neutron diffusion and heat conduction, and continuing through the progressively more complicated and more efficient nodal Green's function methods for neutron diffusion, heat conduction and neutron transport to establish the background for the recent development of Green's function methods in computational fluid mechanics. Some of the impressive numerical results obtained via these classes of methods for nuclear engineering problems are briefly summarized. Finally, speculations are proffered on future directions in which the development of these types of methods in fluid mechanics and other areas might lead. (orig.) [de

  15. A joint probability density function of wind speed and direction for wind energy analysis

    International Nuclear Information System (INIS)

    Carta, Jose A.; Ramirez, Penelope; Bueno, Celia

    2008-01-01

    A very flexible joint probability density function of wind speed and direction is presented in this paper for use in wind energy analysis. A method that enables angular-linear distributions to be obtained with specified marginal distributions has been used for this purpose. For the marginal distribution of wind speed we use a singly truncated from below Normal-Weibull mixture distribution. The marginal distribution of wind direction comprises a finite mixture of von Mises distributions. The proposed model is applied in this paper to wind direction and wind speed hourly data recorded at several weather stations located in the Canary Islands (Spain). The suitability of the distributions is judged from the coefficient of determination R 2 . The conclusions reached are that the joint distribution proposed in this paper: (a) can represent unimodal, bimodal and bitangential wind speed frequency distributions, (b) takes into account the frequency of null winds, (c) represents the wind direction regimes in zones with several modes or prevailing wind directions, (d) takes into account the correlation between wind speeds and its directions. It can therefore be used in several tasks involved in the evaluation process of the wind resources available at a potential site. We also conclude that, in the case of the Canary Islands, the proposed model provides better fits in all the cases analysed than those obtained with the models used in the specialised literature on wind energy

  16. Analysis of Unsteady Propagation of Mode Ⅲ Crack in Arbitrary Direction in Functionally Graded Materials

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kwang Ho [Kyungpook National University, Daegu (Korea, Republic of); Cho, Sang Bong [Kyungnam University, Changwon (Korea, Republic of); Hawong, Jai Sug [Yeungnam University, Gyungsan (Korea, Republic of)

    2015-02-15

    The stress and displacement fields at the crack tip were studied during the unsteady propagation of a mode Ⅲ crack in a direction that was different from the property graduation direction in functionally graded materials (FGMs). The property graduation in FGMs was assumed based on the linearly varying shear modulus under a constant density and the exponentially varying shear modulus and density. To obtain the solution of the harmonic function, the general partial differential equation of the dynamic equilibrium equation was transformed into a Laplace equation. Based on the Laplace equation, the stress and displacement fields, which depended on the time rates of change in the crack tip speed and stress intensity factor, were obtained through an asymptotic analysis. Using the stress and displacement fields, the effects of the angled property variation on the stresses, displacements, and stress intensity factors are discussed.

  17. Direct decarbonylation of furfural to furan: A density functional theory study on Pt-graphene

    Science.gov (United States)

    Fellah, Mehmet Ferdi

    2017-05-01

    The catalytic mechanism of direct decarbonylation of furfural to furan on Pt graphene surface has been investigated by means of density functional theory (DFT) calculations. The main catalytic mechanism proposed in this study has six steps such as furfural adsorption, dissociation of H from adsorbed furfural, dissociation of carbon monoxide (molecularly) from adsorbed complex, furan formation and desorption of products. It has been concluded that the rate determining step for direct decarbonylation of furfural to furan is furan formation step and global activation barrier for this catalytic system is 82 kJ/mol consisting of zero point energy and thermal energy corrections. Pt-graphene structure has an important role on the catalytic decarbonylation of furfural to furan without any other reactants. This accordingly points out that Pt doped graphene structure might be an encouraging catalyst for direct decarbonylation of furfural to furan molecule as a valuable chemical material.

  18. Functioning of the direct subsidies system in Poland and other European Union countries

    Directory of Open Access Journals (Sweden)

    Renata Marks-Bielska

    2010-01-01

    Full Text Available The aim of the paper was to present the functioning of the direct subsidies system in Poland. Given the profitable nature of this instrument the particular attention has been paid to the disposal of funds received by agricultural producers in the region of Warmia and Mazury in the form of subsidies. There is no doubt that the direct payments represent an important aid instrument supporting agriculture within the frameworks of the first pillar of the Common Agricultural Policy. The survey revealed that subsidies have significantly contributed to the improvement of financial condition of farms. Funds received in the form of direct payments have been mainly spent on financing current expenditures and to purchase means of production used in the farms (72.88%.

  19. The RNA Exosome Channeling and Direct Access Conformations Have Distinct In Vivo Functions

    Directory of Open Access Journals (Sweden)

    Jaeil Han

    2016-09-01

    Full Text Available The RNA exosome is a 3′–5′ ribonuclease complex that is composed of nine core subunits and an essential catalytic subunit, Rrp44. Two distinct conformations of Rrp44 were revealed in previous structural studies, suggesting that Rrp44 may change its conformation to exert its function. In the channeling conformation, (Rrp44ch, RNA accesses the active site after traversing the central channel of the RNA exosome, whereas in the other conformation, (Rrp44da, RNA gains direct access to the active site. Here, we show that the Rrp44da exosome is important for nuclear function of the RNA exosome. Defects caused by disrupting the direct access conformation are distinct from those caused by channel-occluding mutations, indicating specific functions for each conformation. Our genetic analyses provide in vivo evidence that the RNA exosome employs a direct-access route to recruit specific substrates, indicating that the RNA exosome uses alternative conformations to act on different RNA substrates.

  20. Motivational foci and asthma medication tactics directed towards a functional day

    Directory of Open Access Journals (Sweden)

    Lötvall Jan

    2011-10-01

    Full Text Available Abstract Background There appears to be an obvious gap between a medical and patient adherence perspective. Deviating from a medication prescription could be regarded as fairly irrational, but with respect to patients' goals and/or concerns it could be seen as understandable. Thus, the aim was to elucidate adherence reasoning in relation to asthma medication. Methods This was a qualitative study; data collection and analysis procedures were conducted according to Grounded Theory methodology. Eighteen persons, aged 22 with asthma and regular asthma medication treatment, were interviewed. Results The emerged theoretical model illustrated that adherence to asthma medication was motivated by three foci, all directed towards a desired outcome in terms of a functional day as desired by the patient. A promotive focus was associated with the ambition to achieve a positive asthma outcome by being adherent either to the received prescription or to a self-adjusted dosage. A preventive focus was intended to ensure avoidance of a negative asthma outcome either by sticking to the prescription or by preventively overusing the medication. A permissive focus was associated with unstructured adherence behaviour in which medication intake was primarily triggered by asthma symptoms. Conclusions As all participants had consciously adopted functioning medication tactics that directed them towards the desired goal of a functional day. In an effort to bridge the gap between a patient- and a medical adherence perspective, patients need support in defining their desired functionality and guidance in developing a person-based medication tactic.

  1. Strategies for specifically directing metal functionalization of protein nanotubes: constructing protein coated silver nanowires

    International Nuclear Information System (INIS)

    Carreño-Fuentes, Liliana; Palomares, Laura A; Ramírez, Octavio T; Ascencio, Jorge A; Medina, Ariosto; Aguila, Sergio

    2013-01-01

    Biological molecules that self-assemble in the nanoscale range are useful multifunctional materials. Rotavirus VP6 protein self-assembles into tubular structures in the absence of other rotavirus proteins. Here, we present strategies for selectively directing metal functionalization to the lumen of VP6 nanotubes. The specific in situ metal reduction in the inner surface of nanotube walls was achieved by the simple modification of a method previously reported to functionalize the nanotube outer surface. Silver nanorods and nanowires as long as 1.5 μm were formed inside the nanotubes by coalescence of nanoparticles. Such one-dimensional structures were longer than others previously obtained using bioscaffolds. The interactions between silver ions and the nanotube were simulated to understand the conditions that allowed nanowire formation. Molecular docking showed that a naturally occurring arrangement of aspartate residues enabled the stabilization of silver ions on the internal surface of the VP6 nanotubes. This is the first time that such a spatial arrangement has been proposed for the nucleation of silver nanoparticles, opening the possibility of using such an array to direct functionalization of other biomolecules. These results demonstrate the natural capabilities of VP6 nanotubes to function as a versatile biotemplate for nanomaterials. (paper)

  2. Factor structure of overall autobiographical memory usage: the directive, self and social functions revisited.

    Science.gov (United States)

    Rasmussen, Anne S; Habermas, Tilmann

    2011-08-01

    According to theory, autobiographical memory serves three broad functions of overall usage: directive, self, and social. However, there is evidence to suggest that the tripartite model may be better conceptualised in terms of a four-factor model with two social functions. In the present study we examined the two models in Danish and German samples, using the Thinking About Life Experiences Questionnaire (TALE; Bluck, Alea, Habermas, & Rubin, 2005), which measures the overall usage of the three functions generalised across concrete memories. Confirmatory factor analysis supported the four-factor model and rejected the theoretical three-factor model in both samples. The results are discussed in relation to cultural differences in overall autobiographical memory usage as well as sharing versus non-sharing aspects of social remembering.

  3. Direct measurement of the biphoton Wigner function through two-photon interference

    Science.gov (United States)

    Douce, T.; Eckstein, A.; Walborn, S. P.; Khoury, A. Z.; Ducci, S.; Keller, A.; Coudreau, T.; Milman, P.

    2013-01-01

    The Hong-Ou-Mandel (HOM) experiment was a benchmark in quantum optics, evidencing the non–classical nature of photon pairs, later generalized to quantum systems with either bosonic or fermionic statistics. We show that a simple modification in the well-known and widely used HOM experiment provides the direct measurement of the Wigner function. We apply our results to one of the most reliable quantum systems, consisting of biphotons generated by parametric down conversion. A consequence of our results is that a negative value of the Wigner function is a sufficient condition for non-gaussian entanglement between two photons. In the general case, the Wigner function provides all the required information to infer entanglement using well known necessary and sufficient criteria. The present work offers a new vision of the HOM experiment that further develops its possibilities to realize fundamental tests of quantum mechanics using simple optical set-ups. PMID:24346262

  4. State feedback integral control for a rotary direct drive servo valve using a Lyapunov function approach.

    Science.gov (United States)

    Yu, Jue; Zhuang, Jian; Yu, Dehong

    2015-01-01

    This paper concerns a state feedback integral control using a Lyapunov function approach for a rotary direct drive servo valve (RDDV) while considering parameter uncertainties. Modeling of this RDDV servovalve reveals that its mechanical performance is deeply influenced by friction torques and flow torques; however, these torques are uncertain and mutable due to the nature of fluid flow. To eliminate load resistance and to achieve satisfactory position responses, this paper develops a state feedback control that integrates an integral action and a Lyapunov function. The integral action is introduced to address the nonzero steady-state error; in particular, the Lyapunov function is employed to improve control robustness by adjusting the varying parameters within their value ranges. This new controller also has the advantages of simple structure and ease of implementation. Simulation and experimental results demonstrate that the proposed controller can achieve higher control accuracy and stronger robustness. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  5. Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.

    Science.gov (United States)

    Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2017-09-28

    Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.

  6. Finite-size scaling functions for directed polymers confined between attracting walls

    Energy Technology Data Exchange (ETDEWEB)

    Owczarek, A L [Department of Mathematics and Statistics, University of Melbourne, Parkville, Victoria 3052 (Australia); Prellberg, T [School of Mathematical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom); Rechnitzer, A [Department of Mathematics, University of British Columbia, Vancouver, BC V6T 1Z2 (Canada)

    2008-01-25

    The exact solution of directed self-avoiding walks confined to a slit of finite width and interacting with the walls of the slit via an attractive potential has been recently calculated. The walks can be considered to model the polymer-induced steric stabilization and sensitized flocculation of colloidal dispersions. The large-width asymptotics led to a phase diagram different to that of a polymer attached to, and attracted to, a single wall. The question that arises is: Can one interpolate between the single wall and two wall cases? In this paper, we calculate the exact scaling functions for the partition function by considering the two variable asymptotics of the partition function for simultaneous large length and large width. Consequently, we find the scaling functions for the force induced by the polymer on the walls. We find that these scaling functions are given by elliptic {theta} functions. In some parts of the phase diagram there is more a complex crossover between the single wall and two wall cases and we elucidate how this happens.

  7. A two-level parallel direct search implementation for arbitrarily sized objective functions

    Energy Technology Data Exchange (ETDEWEB)

    Hutchinson, S.A.; Shadid, N.; Moffat, H.K. [Sandia National Labs., Albuquerque, NM (United States)] [and others

    1994-12-31

    In the past, many optimization schemes for massively parallel computers have attempted to achieve parallel efficiency using one of two methods. In the case of large and expensive objective function calculations, the optimization itself may be run in serial and the objective function calculations parallelized. In contrast, if the objective function calculations are relatively inexpensive and can be performed on a single processor, then the actual optimization routine itself may be parallelized. In this paper, a scheme based upon the Parallel Direct Search (PDS) technique is presented which allows the objective function calculations to be done on an arbitrarily large number (p{sub 2}) of processors. If, p, the number of processors available, is greater than or equal to 2p{sub 2} then the optimization may be parallelized as well. This allows for efficient use of computational resources since the objective function calculations can be performed on the number of processors that allow for peak parallel efficiency and then further speedup may be achieved by parallelizing the optimization. Results are presented for an optimization problem which involves the solution of a PDE using a finite-element algorithm as part of the objective function calculation. The optimum number of processors for the finite-element calculations is less than p/2. Thus, the PDS method is also parallelized. Performance comparisons are given for a nCUBE 2 implementation.

  8. Biomimetic hydrogels direct spinal progenitor cell differentiation and promote functional recovery after spinal cord injury

    Science.gov (United States)

    Geissler, Sydney A.; Sabin, Alexandra L.; Besser, Rachel R.; Gooden, Olivia M.; Shirk, Bryce D.; Nguyen, Quan M.; Khaing, Zin Z.; Schmidt, Christine E.

    2018-04-01

    Objective. Demyelination that results from disease or traumatic injury, such as spinal cord injury (SCI), can have a devastating effect on neural function and recovery. Many researchers are examining treatments to minimize demyelination by improving oligodendrocyte availability in vivo. Transplantation of stem and oligodendrocyte progenitor cells is a promising option, however, trials are plagued by undirected differentiation. Here we introduce a biomaterial that has been optimized to direct the differentiation of neural progenitor cells (NPCs) toward oligodendrocytes as a cell delivery vehicle after SCI. Approach. A collagen-based hydrogel was modified to mimic the mechanical properties of the neonatal spinal cord, and components present in the developing extracellular matrix were included to provide appropriate chemical cues to the NPCs to direct their differentiation toward oligodendrocytes. The hydrogel with cells was then transplanted into a unilateral cervical contusion model of SCI to examine the functional recovery with this treatment. Six behavioral tests and histological assessment were performed to examine the in vivo response to this treatment. Main results. Our results demonstrate that we can achieve a significant increase in oligodendrocyte differentiation of NPCs compared to standard culture conditions using a three-component biomaterial composed of collagen, hyaluronic acid, and laminin that has mechanical properties matched to those of neonatal neural tissue. Additionally, SCI rats with hydrogel transplants, with and without NPCs, showed functional recovery. Animals transplanted with hydrogels with NPCs showed significantly increased functional recovery over six weeks compared to the media control group. Significance. The three-component hydrogel presented here has the potential to provide cues to direct differentiation in vivo to encourage regeneration of the central nervous system.

  9. Anticlockwise or Clockwise? A Dynamic Perception-Action-Laterality Model for Directionality Bias in Visuospatial Functioning

    Science.gov (United States)

    Karim, A.K.M. Rezaul; Proulx, Michael J.; Likova, Lora T.

    2016-01-01

    Reviewing the relevant literature in visual psychophysics and visual neuroscience we propose a three-stage model of directionality bias in visuospatial functioning. We call this model the ‘Perception-Action-Laterality’ (PAL) hypothesis. We analyzed the research findings for a wide range of visuospatial tasks, showing that there are two major directionality trends: clockwise versus anticlockwise. It appears these preferences are combinatorial, such that a majority of people fall in the first category demonstrating a preference for stimuli/objects arranged from left-to-right rather than from right-to-left, while people in the second category show an opposite trend. These perceptual biases can guide sensorimotor integration and action, creating two corresponding turner groups in the population. In support of PAL, we propose another model explaining the origins of the biases– how the neurogenetic factors and the cultural factors interact in a biased competition framework to determine the direction and extent of biases. This dynamic model can explain not only the two major categories of biases, but also the unbiased, unreliably biased or mildly biased cases in visuosptial functioning. PMID:27350096

  10. Ku must load directly onto the chromosome end in order to mediate its telomeric functions.

    Directory of Open Access Journals (Sweden)

    Christopher R Lopez

    2011-08-01

    Full Text Available The Ku heterodimer associates with the Saccharomyces cerevisiae telomere, where it impacts several aspects of telomere structure and function. Although Ku avidly binds DNA ends via a preformed channel, its ability to associate with telomeres via this mechanism could be challenged by factors known to bind directly to the chromosome terminus. This has led to uncertainty as to whether Ku itself binds directly to telomeric ends and whether end association is crucial for Ku's telomeric functions. To address these questions, we constructed DNA end binding-defective Ku heterodimers by altering amino acid residues in Ku70 and Ku80 that were predicted to contact DNA. These mutants continued to associate with their known telomere-related partners, such as Sir4, a factor required for telomeric silencing, and TLC1, the RNA component of telomerase. Despite these interactions, we found that the Ku mutants had markedly reduced association with telomeric chromatin and null-like deficiencies for telomere end protection, length regulation, and silencing functions. In contrast to Ku null strains, the DNA end binding defective Ku mutants resulted in increased, rather than markedly decreased, imprecise end-joining proficiency at an induced double-strand break. This result further supports that it was the specific loss of Ku's telomere end binding that resulted in telomeric defects rather than global loss of Ku's functions. The extensive telomere defects observed in these mutants lead us to propose that Ku is an integral component of the terminal telomeric cap, where it promotes a specific architecture that is central to telomere function and maintenance.

  11. Ku must load directly onto the chromosome end in order to mediate its telomeric functions.

    Science.gov (United States)

    Lopez, Christopher R; Ribes-Zamora, Albert; Indiviglio, Sandra M; Williams, Christopher L; Haricharan, Svasti; Bertuch, Alison A

    2011-08-01

    The Ku heterodimer associates with the Saccharomyces cerevisiae telomere, where it impacts several aspects of telomere structure and function. Although Ku avidly binds DNA ends via a preformed channel, its ability to associate with telomeres via this mechanism could be challenged by factors known to bind directly to the chromosome terminus. This has led to uncertainty as to whether Ku itself binds directly to telomeric ends and whether end association is crucial for Ku's telomeric functions. To address these questions, we constructed DNA end binding-defective Ku heterodimers by altering amino acid residues in Ku70 and Ku80 that were predicted to contact DNA. These mutants continued to associate with their known telomere-related partners, such as Sir4, a factor required for telomeric silencing, and TLC1, the RNA component of telomerase. Despite these interactions, we found that the Ku mutants had markedly reduced association with telomeric chromatin and null-like deficiencies for telomere end protection, length regulation, and silencing functions. In contrast to Ku null strains, the DNA end binding defective Ku mutants resulted in increased, rather than markedly decreased, imprecise end-joining proficiency at an induced double-strand break. This result further supports that it was the specific loss of Ku's telomere end binding that resulted in telomeric defects rather than global loss of Ku's functions. The extensive telomere defects observed in these mutants lead us to propose that Ku is an integral component of the terminal telomeric cap, where it promotes a specific architecture that is central to telomere function and maintenance.

  12. Direct interactions of the five known Fanconi anaemia proteins suggest a common functional pathway.

    Science.gov (United States)

    Medhurst, A L; Huber, P A; Waisfisz, Q; de Winter , J P; Mathew, C G

    2001-02-15

    Fanconi anaemia (FA) is an autosomal recessive inherited disorder associated with a progressive aplastic anaemia, diverse congenital abnormalities and cancer. The condition is genetically heterogeneous, with at least seven complementation groups (A-G) described. Cells from individuals who are homozygous for mutations in FA genes are characterized by chromosomal instability and hypersensitivity to DNA interstrand crosslinking agents. These features suggest a possible role for the encoded proteins in the recognition or repair of these lesions, but neither their function nor whether they operate in a concerted or discrete functional pathways is known. The recent cloning of the FANCF and FANCE genes has allowed us to investigate the interaction of the proteins encoded by five of the seven complementation groups of FA. We used the yeast two-hybrid system and co-immunoprecipitation analysis to test the 10 possible pairs of proteins for direct interaction. In addition to the previously described binding of FANCA to FANCG, we now demonstrate direct interaction of FANCF with FANCG, of FANCC with FANCE and a weaker interaction of FANCE with both FANCA and FANCG. These findings show that the newly identified FANCE protein is an integral part of the FA pathway, and support the concept of a functional link between all known proteins encoded by the genes that are mutated in this disorder. These proteins may act either as a multimeric complex or by sequential recruitment of subsets of the proteins in a common pathway that protects the genomic integrity of mammalian cells.

  13. Clinical results and functional outcomes after direct intralaminar screw repair of spondylolysis.

    Science.gov (United States)

    Menga, Emmanuel N; Kebaish, Khaled M; Jain, Amit; Carrino, John A; Sponseller, Paul D

    2014-01-01

    Prospective analysis. Our objective was to analyze clinical and functional results of patients with spondylolysis treated via direct intralaminar screw fixation and autograft, a minimally invasive and motion-preserving surgery. Spondylolysis is usually treated nonoperatively; multiple surgical techniques are available when nonoperative measures fail. No studies evaluate the clinical and functional outcomes and their correlation with pars defect size and disc morphology on magnetic resonance imaging. We reviewed patients with spondylolysis treated with intralaminar screw fixation and bone grafting from 2000 through 2010. Of the 31 patients (mean age, 16 yr; range, 10-37 yr), 25 (81%) were competitive athletes. Preoperative computed tomographic scans were used to measure the pars defect size, and preoperative magnetic resonance images were graded using Pfirrmann classification for correlation with postoperative outcomes. Student t test was used for analysis (significance, P spondylolysis repair for persistent pain starting 18 months after intralaminar screw fixation, 2 patients sustained unilateral intralaminar screw fractures at L5, and 1 patient required irrigation and debridement for a superficial postoperative infection. There was no correlation among preoperative magnetic resonance imaging disc morphology, defect size on computed tomography, patient age, and clinical outcomes. Direct repair of spondylolysis with intralaminar screws offers a low profile, reliable treatment with good functional outcome and a low complication rate in active patients. 4.

  14. Direct electrical stimulation as an input gate into brain functional networks: principles, advantages and limitations.

    Science.gov (United States)

    Mandonnet, Emmanuel; Winkler, Peter A; Duffau, Hugues

    2010-02-01

    While the fundamental and clinical contribution of direct electrical stimulation (DES) of the brain is now well acknowledged, its advantages and limitations have not been re-evaluated for a long time. Here, we critically review exactly what DES can tell us about cerebral function. First, we show that DES is highly sensitive for detecting the cortical and axonal eloquent structures. Moreover, DES also provides a unique opportunity to study brain connectivity, since each area responsive to stimulation is in fact an input gate into a large-scale network rather than an isolated discrete functional site. DES, however, also has a limitation: its specificity is suboptimal. Indeed, DES may lead to interpretations that a structure is crucial because of the induction of a transient functional response when stimulated, whereas (1) this effect is caused by the backward spreading of the electro-stimulation along the network to an essential area and/or (2) the stimulated region can be functionally compensated owing to long-term brain plasticity mechanisms. In brief, although DES is still the gold standard for brain mapping, its combination with new methods such as perioperative neurofunctional imaging and biomathematical modeling is now mandatory, in order to clearly differentiate those networks that are actually indispensable to function from those that can be compensated.

  15. Wada-test, functional magnetic resonance imaging and direct electrical stimulation - brain mapping methods

    International Nuclear Information System (INIS)

    Minkin, K.; Tanova, R.; Busarski, A.; Penkov, M.; Penev, L.; Hadjidekov, V.

    2009-01-01

    Modern neurosurgery requires accurate preoperative and intraoperative localization of brain pathologies but also of brain functions. The presence of individual variations in healthy subjects and the shift of brain functions in brain diseases provoke the introduction of various methods for brain mapping. The aim of this paper was to analyze the most widespread methods for brain mapping: Wada-test, functional magnetic resonance imaging (fMRI) and intraoperative direct electrical stimulation (DES). This study included 4 patients with preoperative brain mapping using Wada-test and fMRI. Intraoperative mapping with DES during awake craniotomy was performed in one case. The histopathological diagnosis was low-grade glioma in 2 cases, cortical dysplasia (1 patient) and arteriovenous malformation (1 patient). The brain mapping permits total lesion resection in three of four patients. There was no new postoperative deficit despite surgery near or within functional brain areas. Brain plasticity provoking shift of eloquent areas from their usual locations was observed in two cases. The brain mapping methods allow surgery in eloquent brain areas recognized in the past as 'forbidden areas'. Each method has advantages and disadvantages. The precise location of brain functions and pathologies frequently requires combination of different brain mapping methods. (authors)

  16. SLAM-seq defines direct gene-regulatory functions of the BRD4-MYC axis.

    Science.gov (United States)

    Muhar, Matthias; Ebert, Anja; Neumann, Tobias; Umkehrer, Christian; Jude, Julian; Wieshofer, Corinna; Rescheneder, Philipp; Lipp, Jesse J; Herzog, Veronika A; Reichholf, Brian; Cisneros, David A; Hoffmann, Thomas; Schlapansky, Moritz F; Bhat, Pooja; von Haeseler, Arndt; Köcher, Thomas; Obenauf, Anna C; Popow, Johannes; Ameres, Stefan L; Zuber, Johannes

    2018-05-18

    Defining direct targets of transcription factors and regulatory pathways is key to understanding their roles in physiology and disease. We combined SLAM-seq [thiol(SH)-linked alkylation for the metabolic sequencing of RNA], a method for direct quantification of newly synthesized messenger RNAs (mRNAs), with pharmacological and chemical-genetic perturbation in order to define regulatory functions of two transcriptional hubs in cancer, BRD4 and MYC, and to interrogate direct responses to BET bromodomain inhibitors (BETis). We found that BRD4 acts as general coactivator of RNA polymerase II-dependent transcription, which is broadly repressed upon high-dose BETi treatment. At doses triggering selective effects in leukemia, BETis deregulate a small set of hypersensitive targets including MYC. In contrast to BRD4, MYC primarily acts as a selective transcriptional activator controlling metabolic processes such as ribosome biogenesis and de novo purine synthesis. Our study establishes a simple and scalable strategy to identify direct transcriptional targets of any gene or pathway. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  17. Directionality analysis on functional magnetic resonance imaging during motor task using Granger causality.

    Science.gov (United States)

    Anwar, A R; Muthalib, M; Perrey, S; Galka, A; Granert, O; Wolff, S; Deuschl, G; Raethjen, J; Heute, U; Muthuraman, M

    2012-01-01

    Directionality analysis of signals originating from different parts of brain during motor tasks has gained a lot of interest. Since brain activity can be recorded over time, methods of time series analysis can be applied to medical time series as well. Granger Causality is a method to find a causal relationship between time series. Such causality can be referred to as a directional connection and is not necessarily bidirectional. The aim of this study is to differentiate between different motor tasks on the basis of activation maps and also to understand the nature of connections present between different parts of the brain. In this paper, three different motor tasks (finger tapping, simple finger sequencing, and complex finger sequencing) are analyzed. Time series for each task were extracted from functional magnetic resonance imaging (fMRI) data, which have a very good spatial resolution and can look into the sub-cortical regions of the brain. Activation maps based on fMRI images show that, in case of complex finger sequencing, most parts of the brain are active, unlike finger tapping during which only limited regions show activity. Directionality analysis on time series extracted from contralateral motor cortex (CMC), supplementary motor area (SMA), and cerebellum (CER) show bidirectional connections between these parts of the brain. In case of simple finger sequencing and complex finger sequencing, the strongest connections originate from SMA and CMC, while connections originating from CER in either direction are the weakest ones in magnitude during all paradigms.

  18. Synthesis of phenanthridines via palladium-catalyzed picolinamide-directed sequential C–H functionalization

    Directory of Open Access Journals (Sweden)

    Ryan Pearson

    2013-05-01

    Full Text Available We report a new synthesis of phenanthridines based on palladium-catalyzed picolinamide-directed sequential C–H functionalization reactions starting from readily available benzylamine and aryl iodide precursors. Under the catalysis of Pd(OAc2, the ortho-C–H bond of benzylpicolinamides is first arylated with an aryl iodide. The resulting biaryl compound is then subjected to palladium-catalyzed picolinamide-directed intramolecular dehydrogenative C–H amination with PhI(OAc2 oxidant to form the corresponding cyclized dihydrophenanthridines. The benzylic position of these dihydrophenanthridines could be further oxidized with Cu(OAc2, removing the picolinamide group and providing phenathridine products. The cyclization and oxidation could be carried out in a single step and afford phenathridines in moderate to good yields.

  19. Directional loudness in an anechoic sound field, head-related transfer functions, and binaural summation

    DEFF Research Database (Denmark)

    Sivonen, Ville Pekka; Ellermeier, Wolfgang

    2006-01-01

    planes. Matches were obtained via a two-interval, adaptive forced-choice (2AFC) procedure for three center frequencies (0.4, 1 and 5 kHz) and two overall levels (45 and 65 dB SPL). The results showed that loudness is not constant over sound incidence angles, with directional sensitivity varying over......The effect of sound incidence angle on loudness was investigated using real sound sources positioned in an anechoic chamber. Eight normal-hearing listeners produced loudness matches between a frontal reference location and seven sources placed at other directions, both in the horizontal and median...... a range of up to 10 dB, exhibiting considerable frequency dependence, but only minor effects of overall level. The pattern of results varied substantially between subjects, but was largely accounted for by variations in individual head-related transfer functions. Modeling of binaural loudness based...

  20. Directional statistics-based reflectance model for isotropic bidirectional reflectance distribution functions.

    Science.gov (United States)

    Nishino, Ko; Lombardi, Stephen

    2011-01-01

    We introduce a novel parametric bidirectional reflectance distribution function (BRDF) model that can accurately encode a wide variety of real-world isotropic BRDFs with a small number of parameters. The key observation we make is that a BRDF may be viewed as a statistical distribution on a unit hemisphere. We derive a novel directional statistics distribution, which we refer to as the hemispherical exponential power distribution, and model real-world isotropic BRDFs as mixtures of it. We derive a canonical probabilistic method for estimating the parameters, including the number of components, of this novel directional statistics BRDF model. We show that the model captures the full spectrum of real-world isotropic BRDFs with high accuracy, but a small footprint. We also demonstrate the advantages of the novel BRDF model by showing its use for reflection component separation and for exploring the space of isotropic BRDFs.

  1. Identification of direct regulatory targets of the transcription factor Sox10 based on function and conservation

    Directory of Open Access Journals (Sweden)

    Lee Sanghyuk

    2008-09-01

    Full Text Available Abstract Background Sox10, a member of the Sry-related HMG-Box gene family, is a critical transcription factor for several important cell lineages, most notably the neural crest stem cells and the derivative peripheral glial cells and melanocytes. Thus far, only a handful of direct target genes are known for this transcription factor limiting our understanding of the biological network it governs. Results We describe identification of multiple direct regulatory target genes of Sox10 through a procedure based on function and conservation. By combining RNA interference technique and DNA microarray technology, we have identified a set of genes that show significant down-regulation upon introduction of Sox10 specific siRNA into Schwannoma cells. Subsequent comparative genomics analyses led to potential binding sites for Sox10 protein conserved across several mammalian species within the genomic region proximal to these genes. Multiple sites belonging to 4 different genes (proteolipid protein, Sox10, extracellular superoxide dismutase, and pleiotrophin were shown to directly interact with Sox10 by chromatin immunoprecipitation assay. We further confirmed the direct regulation through the identified cis-element for one of the genes, extracellular superoxide dismutase, using electrophoretic mobility shift assay and reporter assay. Conclusion In sum, the process of combining differential expression profiling and comparative genomics successfully led to further defining the role of Sox10, a critical transcription factor for the development of peripheral glia. Our strategy utilizing relatively accessible techniques and tools should be applicable to studying the function of other transcription factors.

  2. Functionalized Ormosil Scaffolds Processed by Direct Laser Polymerization for Application in Tissue Engineering

    DEFF Research Database (Denmark)

    Matei, A.; Schou, Jørgen; Canulescu, Stela

    The N,N’-(methacryloyloxyethyl triehtoxy silyl propyl carbamoyl-oxyhexyl)-urea hybrid methacrylate for applications in tissue engineering was synthesized and afterwards polymerized by direct laser polymerization using femtosecond laser pulses with the aim of using it for further applications...... in tissue engineering. The as-obtained scaffolds were modified either by low pressure argon plasma treatment or by using two different proteins (lysozyme, fibrinogen). For improved adhesion, the proteins were deposited by matrix assisted pulsed laser evaporation. The functionalized structures were tested...

  3. Chemoselective, Substrate-directed Fluorination of Functionalized Cyclopentane β-Amino Acids.

    Science.gov (United States)

    Kiss, Loránd; Nonn, Melinda; Sillanpää, Reijo; Haukka, Matti; Fustero, Santos; Fülöp, Ferenc

    2016-12-06

    This work describes a substrate-directed fluorination of some highly functionalized cyclopentane derivatives. The cyclic products incorporating CH 2 F or CHF 2 moieties in their structure have been synthesized from diexo- or diendo-norbornene β-amino acids following a stereocontrolled strategy. The synthetic study was based on an oxidative transformation of the ring carbon-carbon double bond of the norbornene β-amino acids, followed by transformation of the resulted "all cis" and "trans" diformyl intermediates by fluorination with "chemodifferentiation". © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Feasibility and acceptability of esophageal-directed hypnotherapy for functional heartburn.

    Science.gov (United States)

    Riehl, M E; Pandolfino, J E; Palsson, O S; Keefer, L

    2016-07-01

    Functional heartburn (FH) is a benign but burdensome condition characterized by painful, burning epigastric sensations in the absence of acid reflux or symptom-reflux correlation. Esophageal hypersensitivity and its psychological counterpart, esophageal hypervigilance (EHv) drive symptom experience. Hypnotherapy (HYP) is an established and preferred intervention for refractory symptoms in functional gastrointestinal disorders (FGIDs) and could be applied to FH. The objective of this study was to determine the feasibility, acceptability, and clinical utility of 7 weekly sessions of esophageal-directed HYP (EHYP) on heartburn symptoms, quality of life, and EHv. Similar to other work in FGIDs and regardless of hypnotizability, there were consistent and significant changes in heartburn symptoms, visceral anxiety, and quality of life and a trend for improvement in catastrophizing. We would recommend EHYP in FH patients who are either non-responsive to medications or who would prefer a lifestyle intervention. © 2015 International Society for Diseases of the Esophagus.

  5. The feasibility and acceptability of esophageal-directed hypnotherapy for functional heartburn

    Science.gov (United States)

    Riehl, M. E.; Pandolfino, J. E.; Palsson, O. S.; Keefer, L.

    2015-01-01

    SUMMARY Functional Heartburn (FH) is a benign but burdensome condition characterized by painful, burning epigastric sensations in the absence of acid reflux or symptom-reflux correlation. Esophageal hypersensitivity and its psychological counterpart, esophageal hypervigilance (EHv) drive symptom experience. Hypnotherapy (HYP) is an established and preferred intervention for refractory symptoms in functional gastrointestinal disorders (FGIDs) and could be applied to FH. The objective of this study was to determine the feasibility, acceptability and clinical utility of 7 weekly sessions of esophageal-directed hypnotherapy (EHYP) on heartburn symptoms, quality of life and EHv. Similar to other work in FGIDs and regardless of hypnotizability, there were consistent and significant changes in heartburn symptoms, visceral anxiety and quality of life and a trend for improvement in catastrophizing. We would recommend EHYP in FH patients who are either non-responsive to medications or who would prefer a lifestyle intervention. PMID:25824436

  6. Facilitation of Function and Manipulation Knowledge of Tools Using Transcranial Direct Current Stimulation (tDCS

    Directory of Open Access Journals (Sweden)

    Ryo Ishibashi

    2018-01-01

    Full Text Available Using a variety of tools is a common and essential component of modern human life. Patients with brain damage or neurological disorders frequently have cognitive deficits in their recognition and manipulation of tools. In this study, we focused on improving tool-related cognition using transcranial direct current stimulation (tDCS. Converging evidence from neuropsychology, neuroimaging and non- invasive brain stimulation has identified the anterior temporal lobe (ATL and inferior parietal lobule (IPL as brain regions supporting action semantics. We observed enhanced performance in tool cognition with anodal tDCS over ATL and IPL in two cognitive tasks that require rapid access to semantic knowledge about the function or manipulation of common tools. ATL stimulation improved access to both function and manipulation knowledge of tools. The effect of IPL stimulation showed a trend toward better manipulation judgments. Our findings support previous studies of tool semantics and provide a novel approach for manipulation of underlying circuits.

  7. Mena binds α5 integrin directly and modulates α5β1 function.

    Science.gov (United States)

    Gupton, Stephanie L; Riquelme, Daisy; Hughes-Alford, Shannon K; Tadros, Jenny; Rudina, Shireen S; Hynes, Richard O; Lauffenburger, Douglas; Gertler, Frank B

    2012-08-20

    Mena is an Ena/VASP family actin regulator with roles in cell migration, chemotaxis, cell-cell adhesion, tumor cell invasion, and metastasis. Although enriched in focal adhesions, Mena has no established function within these structures. We find that Mena forms an adhesion-regulated complex with α5β1 integrin, a fibronectin receptor involved in cell adhesion, motility, fibronectin fibrillogenesis, signaling, and growth factor receptor trafficking. Mena bound directly to the carboxy-terminal portion of the α5 cytoplasmic tail via a 91-residue region containing 13 five-residue "LERER" repeats. In fibroblasts, the Mena-α5 complex was required for "outside-in" α5β1 functions, including normal phosphorylation of FAK and paxillin and formation of fibrillar adhesions. It also supported fibrillogenesis and cell spreading and controlled cell migration speed. Thus, fibroblasts require Mena for multiple α5β1-dependent processes involving bidirectional interactions between the extracellular matrix and cytoplasmic focal adhesion proteins.

  8. Family conflict, autonomic nervous system functioning, and child adaptation: state of the science and future directions.

    Science.gov (United States)

    El-Sheikh, Mona; Erath, Stephen A

    2011-05-01

    The family is one of the primary contexts of child development. Marital and parent-child conflict (family conflict) are common and predict a wide range of negative behavioral and emotional outcomes in children. Thus, an important task for developmental researchers is to identify the processes through which family conflict contributes to children's psychological maladjustment, as well as vulnerability and protective factors in the context of family conflict. In the current paper, we aim to advance a conceptual model that focuses on indices of children's autonomic nervous system (ANS) functioning that increase vulnerability or provide protection against psychological maladjustment in the context of family conflict. In doing so, we provide a selective review that reflects the state of the science linking family conflict, children's ANS activity, and child psychological adjustment, and offer directions and guidance for future research. Our hope is to accelerate research at the intersection of family conflict and ANS functioning to advance understanding of risk and resilience among children.

  9. Strategies for Directing the Structure and Function of 3D Collagen Biomaterials across Length Scales

    Science.gov (United States)

    Walters, Brandan D.; Stegemann, Jan P.

    2013-01-01

    Collagen type I is a widely used natural biomaterial that has found utility in a variety of biological and medical applications. Its well characterized structure and role as an extracellular matrix protein make it a highly relevant material for controlling cell function and mimicking tissue properties. Collagen type I is abundant in a number of tissues, and can be isolated as a purified protein. This review focuses on hydrogel biomaterials made by reconstituting collagen type I from a solubilized form, with an emphasis on in vitro studies in which collagen structure can be controlled. The hierarchical structure of collagen from the nanoscale to the macroscale is described, with an emphasis on how structure is related to function across scales. Methods of reconstituting collagen into hydrogel materials are presented, including molding of macroscopic constructs, creation of microscale modules, and electrospinning of nanoscale fibers. The modification of collagen biomaterials to achieve desired structures and functions is also addressed, with particular emphasis on mechanical control of collagen structure, creation of collagen composite materials, and crosslinking of collagenous matrices. Biomaterials scientists have made remarkable progress in rationally designing collagen-based biomaterials and in applying them to both the study of biology and for therapeutic benefit. This broad review illustrates recent examples of techniques used to control collagen structure, and to thereby direct its biological and mechanical functions. PMID:24012608

  10. A nanobody directed to a functional epitope on VEGF, as a novel strategy for cancer treatment.

    Science.gov (United States)

    Farajpour, Zahra; Rahbarizadeh, Fatemeh; Kazemi, Bahram; Ahmadvand, Davoud

    2014-03-28

    Compelling evidence suggests that vascular endothelial growth factor (VEGF), due to its essential role in angiogenesis, is a critical target for cancer treatment. Neutralizing monoclonal antibodies against VEGF are important class of drugs used in cancer therapy. However, the cost of production, large size, and immunogenicity are main drawbacks of conventional monoclonal therapy. Nanobodies are the smallest antigen-binding antibody fragments, which occur naturally in camelidae. Because of their remarkable features, we decided to use an immune library of nanobody to direct phage display to recognition of novel functional epitopes on VEGF. Four rounds of selection were performed and six phage-displayed nanobodies were obtained from an immune phage library. The most reactive clone in whole-cell ELISA experiments, was purified and assessed in proliferation inhibition assay. Purified ZFR-5 not only blocked interaction of VEGF with its receptor in cell ELISA experiments, but also was able to significantly inhibit proliferation response of human umbilical vein endothelial cells to VEGF in a dose-dependent manner. Taken together, our study demonstrates that by using whole-cell ELISA experiments, nanobodies against antigenic regions included in interaction of VEGF with its receptors can be directed. Because of unique and intrinsic properties of a nanobody and the ability of selected nanobody for blocking the epitope that is important for biological function of VEGF, it represents novel potential drug candidate. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Abstract structure of partial function $*$-algebras over semi-direct product of locally compact groups

    Directory of Open Access Journals (Sweden)

    Arash Ghaani Farashahi

    2015-12-01

    Full Text Available This article presents a unified approach to the abstract notions of partial convolution and involution in $L^p$-function spaces over semi-direct product of locally compact groups. Let $H$ and $K$ be locally compact groups and $tau:Hto Aut(K$ be a continuous homomorphism.  Let $G_tau=Hltimes_tau K$ be the semi-direct product of $H$ and $K$ with respect to $tau$. We define left and right $tau$-convolution on $L^1(G_tau$ and we show that, with respect to each of them, the function space $L^1(G_tau$ is a Banach algebra. We define $tau$-convolution as a linear combination of the left and right $tau$-convolution and we show that the $tau$-convolution is commutative if and only if $K$ is abelian. We prove that there is a $tau$-involution on $L^1(G_tau$ such that with respect to the $tau$-involution and $tau$-convolution, $L^1(G_tau$ is a non-associative Banach $*$-algebra. It is also shown that when $K$ is abelian, the $tau$-involution and $tau$-convolution make $L^1(G_tau$ into a Jordan Banach $*$-algebra. Finally, we also present the generalized notation of $tau$-convolution for other $L^p$-spaces with $p>1$.

  12. Onsite-effects of dual-hemisphere versus conventional single-hemisphere transcranial direct current stimulation: A functional MRI study.

    Science.gov (United States)

    Kwon, Yong Hyun; Jang, Sung Ho

    2012-08-25

    We performed functional MRI examinations in six right-handed healthy subjects. During functional MRI scanning, transcranial direct current stimulation was delivered with the anode over the right primary sensorimotor cortex and the cathode over the left primary sensorimotor cortex using dual-hemispheric transcranial direct current stimulation. This was compared to a cathode over the left supraorbital area using conventional single-hemispheric transcranial direct current stimulation. Voxel counts and blood oxygenation level-dependent signal intensities in the right primary sensorimotor cortex regions were estimated and compared between the two transcranial direct current stimulation conditions. Our results showed that dual-hemispheric transcranial direct current stimulation induced greater cortical activities than single-hemispheric transcranial direct current stimulation. These findings suggest that dual-hemispheric transcranial direct current stimulation may provide more effective cortical stimulation than single-hemispheric transcranial direct current stimulation.

  13. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    Energy Technology Data Exchange (ETDEWEB)

    Caballero, David, E-mail: caballero@unistra.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Martinez, Elena [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Bausells, Joan [Centre Nacional de Microelectronica (CNM-IMB), CSIC, Campus UAB, 08193 Bellaterra (Spain); Errachid, Abdelhamid, E-mail: abdelhamid.errachid-el-salhi@univ-lyon1.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Universite Claude Bernard - Lyon 1, LSA - UMR 5180, 43 Bd du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Samitier, Josep [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. Black-Right-Pointing-Pointer Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. Black-Right-Pointing-Pointer Silicon nitride offers multiple advantages compared to other common materials. Black-Right-Pointing-Pointer The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si{sub 3}N{sub 4}) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si{sub 3}N{sub 4}-based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO{sub 2}/Si{sub 3}N{sub 4} structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10{sup -13}-10{sup -7} M were detected, showing a sensitivity of 0.128 {Omega} {mu}M{sup -1} and a limit of detection of 10{sup -14} M. The specificity of the sensor was also addressed by studying the

  14. Decreasing Striatopallidal Pathway Function Enhances Motivation by Energizing the Initiation of Goal-Directed Action

    Science.gov (United States)

    Carvalho Poyraz, Fernanda; Holzner, Eva; Bailey, Matthew R.; Meszaros, Jozsef; Kenney, Lindsay; Kheirbek, Mazen A.

    2016-01-01

    Altered dopamine D2 receptor (D2R) binding in the striatum has been associated with abnormal motivation in neuropsychiatric disorders, including schizophrenia. Here, we tested whether motivational deficits observed in mice with upregulated D2Rs (D2R-OEdev mice) are reversed by decreasing function of the striatopallidal “no-go” pathway. To this end, we expressed the Gαi-coupled designer receptor hM4D in adult striatopallidal neurons and activated the receptor with clozapine-N-oxide (CNO). Using a head-mounted miniature microscope we confirmed with calcium imaging in awake mice that hM4D activation by CNO inhibits striatopallidal function measured as disinhibited downstream activity in the globus pallidus. Mice were then tested in three operant tasks that address motivated behavior, the progressive ratio task, the progressive hold-down task, and outcome devaluation. Decreasing striatopallidal function in the dorsomedial striatum or nucleus accumbens core enhanced motivation in D2R-OEdev mice and control littermates. This effect was due to increased response initiation but came at the cost of goal-directed efficiency. Moreover, response vigor and the sensitivity to changes in reward value were not altered. Chronic activation of hM4D by administering CNO for 2 weeks in drinking water did not affect motivation due to a tolerance effect. However, the acute effect of CNO on motivation was reinstated after discontinuing chronic treatment for 48 h. Used as a therapeutic approach, striatopallidal inhibition should consider the risk of impairing goal-directed efficiency and behavioral desensitization. SIGNIFICANCE STATEMENT Motivation involves a directional component that allows subjects to efficiently select the behavior that will lead to an optimal outcome and an activational component that initiates and maintains the vigor and persistence of actions. Striatal output pathways modulate motivated behavior, but it remains unknown how these pathways regulate specific

  15. Decreasing Striatopallidal Pathway Function Enhances Motivation by Energizing the Initiation of Goal-Directed Action.

    Science.gov (United States)

    Carvalho Poyraz, Fernanda; Holzner, Eva; Bailey, Matthew R; Meszaros, Jozsef; Kenney, Lindsay; Kheirbek, Mazen A; Balsam, Peter D; Kellendonk, Christoph

    2016-06-01

    Altered dopamine D2 receptor (D2R) binding in the striatum has been associated with abnormal motivation in neuropsychiatric disorders, including schizophrenia. Here, we tested whether motivational deficits observed in mice with upregulated D2Rs (D2R-OEdev mice) are reversed by decreasing function of the striatopallidal "no-go" pathway. To this end, we expressed the Gαi-coupled designer receptor hM4D in adult striatopallidal neurons and activated the receptor with clozapine-N-oxide (CNO). Using a head-mounted miniature microscope we confirmed with calcium imaging in awake mice that hM4D activation by CNO inhibits striatopallidal function measured as disinhibited downstream activity in the globus pallidus. Mice were then tested in three operant tasks that address motivated behavior, the progressive ratio task, the progressive hold-down task, and outcome devaluation. Decreasing striatopallidal function in the dorsomedial striatum or nucleus accumbens core enhanced motivation in D2R-OEdev mice and control littermates. This effect was due to increased response initiation but came at the cost of goal-directed efficiency. Moreover, response vigor and the sensitivity to changes in reward value were not altered. Chronic activation of hM4D by administering CNO for 2 weeks in drinking water did not affect motivation due to a tolerance effect. However, the acute effect of CNO on motivation was reinstated after discontinuing chronic treatment for 48 h. Used as a therapeutic approach, striatopallidal inhibition should consider the risk of impairing goal-directed efficiency and behavioral desensitization. Motivation involves a directional component that allows subjects to efficiently select the behavior that will lead to an optimal outcome and an activational component that initiates and maintains the vigor and persistence of actions. Striatal output pathways modulate motivated behavior, but it remains unknown how these pathways regulate specific components of motivation. Here

  16. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    International Nuclear Information System (INIS)

    Caballero, David; Martinez, Elena; Bausells, Joan; Errachid, Abdelhamid; Samitier, Josep

    2012-01-01

    Highlights: ► An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. ► Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. ► Silicon nitride offers multiple advantages compared to other common materials. ► The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si 3 N 4 ) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si 3 N 4 -based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO 2 /Si 3 N 4 structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10 −13 –10 −7 M were detected, showing a sensitivity of 0.128 Ω μM −1 and a limit of detection of 10 −14 M. The specificity of the sensor was also addressed by studying the interferences with a similar protein, bovine serum albumin. The results obtained show that the antibodies were efficiently immobilized and the proteins

  17. Direct and indirect effects of copper-contaminated sediments on the functions of model freshwater ecosystems.

    Science.gov (United States)

    Gardham, Stephanie; Chariton, Anthony A; Hose, Grant C

    2015-01-01

    Copper is acutely toxic to, and directly affects, primary producers and decomposers, which are key players in essential processes such as the nutrient cycle in freshwater ecosystems. Even though the indirect effects of metals (for example effects due to changes in species interactions) may be more common than direct effects, little is known about the indirect effects of copper on primary producers and decomposers. The effects of copper on phytoplankton, macrophytes, periphyton and organic matter decomposition in an outdoor lentic mesocosm facility were assessed, and links between the responses examined. Copper directly decreased macrophyte growth, subsurface organic matter decomposition, and the potential for high phytoplankton Chlorophyll a concentrations. However, periphyton cover and organic matter decomposition on the surface of the sediment were stimulated by the presence of copper. These latter responses were attributed to indirect effects, due to a reduction in grazing pressure from snails, particularly Physa acuta, in the higher copper-contaminated mesocosms. This permitted the growth of periphyton and other heterotrophs, ultimately increasing decomposition at the sediment surface. The present study demonstrates the pronounced influence indirect effects may have on ecological function, findings that may not be observed in traditional laboratory studies (which utilize single species or simplistic communities).

  18. Direct conversion of human fibroblasts into functional osteoblasts by defined factors.

    Science.gov (United States)

    Yamamoto, Kenta; Kishida, Tsunao; Sato, Yoshiki; Nishioka, Keisuke; Ejima, Akika; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Yamamoto, Toshiro; Kanamura, Narisato; Mazda, Osam

    2015-05-12

    Osteoblasts produce calcified bone matrix and contribute to bone formation and remodeling. In this study, we established a procedure to directly convert human fibroblasts into osteoblasts by transducing some defined factors and culturing in osteogenic medium. Osteoblast-specific transcription factors, Runt-related transcription factor 2 (Runx2), and Osterix, in combination with Octamer-binding transcription factor 3/4 (Oct4) and L-Myc (RXOL) transduction, converted ∼ 80% of the fibroblasts into osteocalcin-producing cells. The directly converted osteoblasts (dOBs) induced by RXOL displayed a similar gene expression profile as normal human osteoblasts and contributed to bone repair after transplantation into immunodeficient mice at artificial bone defect lesions. The dOBs expressed endogenous Runx2 and Osterix, and did not require continuous expression of the exogenous genes to maintain their phenotype. Another combination, Oct4 plus L-Myc (OL), also induced fibroblasts to produce bone matrix, but the OL-transduced cells did not express Osterix and exhibited a more distant gene expression profile to osteoblasts compared with RXOL-transduced cells. These findings strongly suggest successful direct reprogramming of fibroblasts into functional osteoblasts by RXOL, a technology that may provide bone regeneration therapy against bone disorders.

  19. A nanobody directed to a functional epitope on VEGF, as a novel strategy for cancer treatment

    International Nuclear Information System (INIS)

    Farajpour, Zahra; Rahbarizadeh, Fatemeh; Kazemi, Bahram; Ahmadvand, Davoud

    2014-01-01

    Highlights: • A novel nanobody directed to antigenic regions on VEGF was identified. • Our nanobody was successfully purified. • Our nanobody significantly inhibited VEGF-induced proliferation of HUVECs in a dose dependent manner. - Abstract: Compelling evidence suggests that vascular endothelial growth factor (VEGF), due to its essential role in angiogenesis, is a critical target for cancer treatment. Neutralizing monoclonal antibodies against VEGF are important class of drugs used in cancer therapy. However, the cost of production, large size, and immunogenicity are main drawbacks of conventional monoclonal therapy. Nanobodies are the smallest antigen-binding antibody fragments, which occur naturally in camelidae. Because of their remarkable features, we decided to use an immune library of nanobody to direct phage display to recognition of novel functional epitopes on VEGF. Four rounds of selection were performed and six phage-displayed nanobodies were obtained from an immune phage library. The most reactive clone in whole-cell ELISA experiments, was purified and assessed in proliferation inhibition assay. Purified ZFR-5 not only blocked interaction of VEGF with its receptor in cell ELISA experiments, but also was able to significantly inhibit proliferation response of human umbilical vein endothelial cells to VEGF in a dose-dependent manner. Taken together, our study demonstrates that by using whole-cell ELISA experiments, nanobodies against antigenic regions included in interaction of VEGF with its receptors can be directed. Because of unique and intrinsic properties of a nanobody and the ability of selected nanobody for blocking the epitope that is important for biological function of VEGF, it represents novel potential drug candidate

  20. Measuring the CO2 shadow price for wastewater treatment: A directional distance function approach

    International Nuclear Information System (INIS)

    Molinos-Senante, María; Hanley, Nick; Sala-Garrido, Ramón

    2015-01-01

    Highlights: • The shadow price of CO 2 informs about the marginal abatement cost of this pollutant. • It is estimated the shadow price of CO 2 for wastewater treatment plants. • The shadow prices depend on the setting of the directional vectors of the distance function. • Sewage sludge treatment technology affects the CO 2 shadow price. - Abstract: The estimation of the value of carbon emissions has become a major research and policy topic since the establishment of the Kyoto Protocol. The shadow price of CO 2 provides information about the marginal abatement cost of this pollutant. It is an essential element in guiding environmental policy issues, since the CO 2 shadow price can be used when fixing carbon tax rates, in environmental cost-benefit analysis and in ascertaining an initial market price for a trading system. The water industry could play an important role in the reduction of greenhouse gas (GHG) emissions. This paper estimates the shadow price of CO 2 for a sample of wastewater treatment plants (WWTPs), using a parametric quadratic directional distance function. Following this, in a sensitivity analysis, the paper evaluates the impact of different settings of directional vectors on the shadow prices. Applying the Mann–Whitney and Kruskal–Wallis non-parametric tests, factors affecting CO 2 prices are investigated. The variation of CO 2 shadow prices across the WWTPs evaluated argues in favour of a market-based approach to CO 2 mitigation as opposed to command-and-control regulation. The paper argues that the estimation of the shadow price of CO 2 for non-power enterprises can provide incentives for reducing GHG emissions

  1. A nanobody directed to a functional epitope on VEGF, as a novel strategy for cancer treatment

    Energy Technology Data Exchange (ETDEWEB)

    Farajpour, Zahra [Department of Pharmaceutical Biotechnology, School of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran (Iran, Islamic Republic of); Rahbarizadeh, Fatemeh, E-mail: rahbarif@modares.ac.ir [Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Kazemi, Bahram [Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran (Iran, Islamic Republic of); Ahmadvand, Davoud [School of Allied Medical Sciences, Iran University of Medical Sciences, Tehran (Iran, Islamic Republic of)

    2014-03-28

    Highlights: • A novel nanobody directed to antigenic regions on VEGF was identified. • Our nanobody was successfully purified. • Our nanobody significantly inhibited VEGF-induced proliferation of HUVECs in a dose dependent manner. - Abstract: Compelling evidence suggests that vascular endothelial growth factor (VEGF), due to its essential role in angiogenesis, is a critical target for cancer treatment. Neutralizing monoclonal antibodies against VEGF are important class of drugs used in cancer therapy. However, the cost of production, large size, and immunogenicity are main drawbacks of conventional monoclonal therapy. Nanobodies are the smallest antigen-binding antibody fragments, which occur naturally in camelidae. Because of their remarkable features, we decided to use an immune library of nanobody to direct phage display to recognition of novel functional epitopes on VEGF. Four rounds of selection were performed and six phage-displayed nanobodies were obtained from an immune phage library. The most reactive clone in whole-cell ELISA experiments, was purified and assessed in proliferation inhibition assay. Purified ZFR-5 not only blocked interaction of VEGF with its receptor in cell ELISA experiments, but also was able to significantly inhibit proliferation response of human umbilical vein endothelial cells to VEGF in a dose-dependent manner. Taken together, our study demonstrates that by using whole-cell ELISA experiments, nanobodies against antigenic regions included in interaction of VEGF with its receptors can be directed. Because of unique and intrinsic properties of a nanobody and the ability of selected nanobody for blocking the epitope that is important for biological function of VEGF, it represents novel potential drug candidate.

  2. Theory for site-site pair distribution functions of molecular fluids. II. Approximations for the Percus--Yevick site-site direct correlation functions

    International Nuclear Information System (INIS)

    Johnson, E.

    1977-01-01

    A theory for site-site pair distribution functions of molecular fluids is derived from the Ornstein-Zernike equation. Atom-atom pair distribution functions of this theory which were obtained by using different approximations for the Percus-Yevick site-site direct correlation functions are compared

  3. Patient Health Record Systems Scope and Functionalities: Literature Review and Future Directions.

    Science.gov (United States)

    Bouayad, Lina; Ialynytchev, Anna; Padmanabhan, Balaji

    2017-11-15

    A new generation of user-centric information systems is emerging in health care as patient health record (PHR) systems. These systems create a platform supporting the new vision of health services that empowers patients and enables patient-provider communication, with the goal of improving health outcomes and reducing costs. This evolution has generated new sets of data and capabilities, providing opportunities and challenges at the user, system, and industry levels. The objective of our study was to assess PHR data types and functionalities through a review of the literature to inform the health care informatics community, and to provide recommendations for PHR design, research, and practice. We conducted a review of the literature to assess PHR data types and functionalities. We searched PubMed, Embase, and MEDLINE databases from 1966 to 2015 for studies of PHRs, resulting in 1822 articles, from which we selected a total of 106 articles for a detailed review of PHR data content. We present several key findings related to the scope and functionalities in PHR systems. We also present a functional taxonomy and chronological analysis of PHR data types and functionalities, to improve understanding and provide insights for future directions. Functional taxonomy analysis of the extracted data revealed the presence of new PHR data sources such as tracking devices and data types such as time-series data. Chronological data analysis showed an evolution of PHR system functionalities over time, from simple data access to data modification and, more recently, automated assessment, prediction, and recommendation. Efforts are needed to improve (1) PHR data quality through patient-centered user interface design and standardized patient-generated data guidelines, (2) data integrity through consolidation of various types and sources, (3) PHR functionality through application of new data analytics methods, and (4) metrics to evaluate clinical outcomes associated with automated PHR

  4. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    Energy Technology Data Exchange (ETDEWEB)

    Mascagni, Daniela Branco Tavares [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Miyazaki, Celina Massumi [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil); Cruz, Nilson Cristino da [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Leite de Moraes, Marli [Federal University of São Paulo, Unifesp, Campus São José dos Campos, SP (Brazil); Riul, Antonio [University of Campinas - Unicamp, Campinas, São Paulo (Brazil); Ferreira, Marystela, E-mail: marystela@ufscar.br [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil)

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L{sup ‐1} and sensitivity of 2.47 μA·cm{sup −2}·mmol{sup −1}·L for glucose with the (GPDDA/GPSS){sub 1}/(GPDDA/GOx){sub 2} architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  5. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    International Nuclear Information System (INIS)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; Cruz, Nilson Cristino da; Leite de Moraes, Marli; Riul, Antonio; Ferreira, Marystela

    2016-01-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L ‐1 and sensitivity of 2.47 μA·cm −2 ·mmol −1 ·L for glucose with the (GPDDA/GPSS) 1 /(GPDDA/GOx) 2 architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  6. Generating function rationality for anisotropic vicious walk configurations on the directed square lattice

    International Nuclear Information System (INIS)

    Bhatti, F M; Essam, J W

    2006-01-01

    Guttmann and Voege introduced a model of f-friendly walkers and argued that a generating function for the number of n-walker configurations making a total of k left steps is a rational function with denominator (1 - x n ) k+1 . They also found that for f = 0, 1 and 2 the sums of the numerator coefficients for watermelon configurations in which each of 3 walkers made w left steps were 3-dimensional Catalan numbers. Here it is shown that for n vicious walker (f = 0) watermelon configurations the m th coefficient of the numerator is the generalised Naryana number N(w, n, m) of Sulanke which is symmetric under interchange of w and n. The sums, C w,n , of these coefficients as a sequence indexed by w are n-dimensional Catalan numbers or w-dimensional Catalan numbers if indexed by n. The unexpected symmetry in n and w is seen to follow from duality. Inui and Katori introduced Fermi walk configurations which are non-crossing subsets of the directed random walks between opposite corners of a rectangular l x w grid. They related these to Bose configurations which biject to vicious walker watermelon configurations. Bose configurations include multisets. Here we consider generating functions for the numbers of configurations in which l and w are fixed. It is found that the maximum number of walks in a Fermi configuration is lw + 1 and the number of configurations corresponding to this number of walks is C l,w . This limit on the number of walks in a Fermi configuration leads to the rationality of the Bose generating function and by duality to the rationality of the generating function of Guttmann and Voege

  7. Generating function rationality for anisotropic vicious walk configurations on the directed square lattice

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, F M [Department of Mathematics, Lahore University of Management Sciences, Sector U, DHA, Lahore (Pakistan); Essam, J W [Department of Mathematics and Statistics, Royal Holloway College, University of London, Egham, Surrey TW20 0EX (United Kingdom)

    2006-06-15

    Guttmann and Voege introduced a model of f-friendly walkers and argued that a generating function for the number of n-walker configurations making a total of k left steps is a rational function with denominator (1 - x{sup n}){sup k+1}. They also found that for f = 0, 1 and 2 the sums of the numerator coefficients for watermelon configurations in which each of 3 walkers made w left steps were 3-dimensional Catalan numbers. Here it is shown that for n vicious walker (f = 0) watermelon configurations the m{sup th} coefficient of the numerator is the generalised Naryana number N(w, n, m) of Sulanke which is symmetric under interchange of w and n. The sums, C{sub w,n}, of these coefficients as a sequence indexed by w are n-dimensional Catalan numbers or w-dimensional Catalan numbers if indexed by n. The unexpected symmetry in n and w is seen to follow from duality. Inui and Katori introduced Fermi walk configurations which are non-crossing subsets of the directed random walks between opposite corners of a rectangular l x w grid. They related these to Bose configurations which biject to vicious walker watermelon configurations. Bose configurations include multisets. Here we consider generating functions for the numbers of configurations in which l and w are fixed. It is found that the maximum number of walks in a Fermi configuration is lw + 1 and the number of configurations corresponding to this number of walks is C{sub l,w}. This limit on the number of walks in a Fermi configuration leads to the rationality of the Bose generating function and by duality to the rationality of the generating function of Guttmann and Voege.

  8. Ultrasound assisted simultaneous reduction and direct functionalization of graphene oxide with thermal and cytotoxicity profile.

    Science.gov (United States)

    Maktedar, Shrikant S; Avashthi, Gopal; Singh, Man

    2017-01-01

    The new sonochemical approach for simultaneous reduction and direct functionalization of graphene oxide (GrO) has been developed. The GrO was functionalized with 2-Aminobenzoxazole (2-ABOZ) in twenty min with complete deletion of hazardous steps. The significance of ultrasound was exemplified with the comparative conventional methods. The newly prepared f-(2-ABOZ)GrO was extensively characterized with near edge X-ray absorption fine structure (NEXAFS) spectroscopy, 13 C solid state NMR, XPS, XRD, HRTEM, SAED, AFM, Raman, UV-vis, FTIR and TGA. The thermal stability of f-(2-ABOZ)GrO was confirmed with total percentage weight loss in TGA. The biological activity of f-(2-ABOZ)GrO was explored with MCF-7 and Vero cell lines. The inherent cytotoxicity was evaluated with SRB assay at 10, 20, 40 and 80μgmL -1 . The estimated cell viabilities were >78% with f-(2-ABOZ) GrO. A high cytocompatibility of f-(2-ABOZ)GrO was ensured with in vitro evaluation on living cell lines, and low toxicity of f-(2-ABOZ)GrO was confirmed its excellent biocompatibility. The morphological effect on Vero cell line evidently supports the formation of biocompatible f-(2-ABOZ)GrO. Therefore, f-(2-ABOZ)GrO was emerged as an advanced functional material for thermally stable biocompatible coatings. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Direct metal transfer printing on flexible substrate for fabricating optics functional devices

    Science.gov (United States)

    Jiang, Yingjie; Zhou, Xiaohong; Zhang, Feng; Shi, Zhenwu; Chen, Linsen; Peng, Changsi

    2015-11-01

    New functional materials and devices based on metal patterns can be widely used in many new and expanding industries,such as flat panel displays, alternative energy,sensors and so on. In this paper, we introduce a new transfer printing method for fabricating metal optics functional devices. This method can directly transfer a metal pattern from a polyethylene terephthalate (PET)supported UV or polydimethylsiloxane (PDMS) pattern to another PET substrate. Purely taking advantage of the anaerobic UV curing adhesive (a-UV) on PET substrate, metal film can be easily peeled off from micro/nano-structured surface. As a result, metal film on the protrusion can be selectively transferred onto the target substrate, to make it the metal functional surface. But which on the bottom can not be transferred. This method provides low cost fabrication of metal thin film devices by avoiding high cost lithography process. Compared with conventional approach, this method can get more smooth rough edges and has wider tolerance range for the original master mold. Future developments and potential applications of this metal transfer method will be addressed.

  10. Mechanical analysis of non-uniform bi-directional functionally graded intelligent micro-beams using modified couple stress theory

    Science.gov (United States)

    Bakhshi Khaniki, Hossein; Rajasekaran, Sundaramoorthy

    2018-05-01

    This study develops a comprehensive investigation on mechanical behavior of non-uniform bi-directional functionally graded beam sensors in the framework of modified couple stress theory. Material variation is modelled through both length and thickness directions using power-law, sigmoid and exponential functions. Moreover, beam is assumed with linear, exponential and parabolic cross-section variation through the length using power-law and sigmoid varying functions. Using these assumptions, a general model for microbeams is presented and formulated by employing Hamilton’s principle. Governing equations are solved using a mixed finite element method with Lagrangian interpolation technique, Gaussian quadrature method and Wilson’s Lagrangian multiplier method. It is shown that by using bi-directional functionally graded materials in nonuniform microbeams, mechanical behavior of such structures could be affected noticeably and scale parameter has a significant effect in changing the rigidity of nonuniform bi-directional functionally graded beams.

  11. Liquid direct correlation function, singlet densities and the theory of freezing

    International Nuclear Information System (INIS)

    March, N.H.; Tosi, M.P.

    1981-04-01

    We have examined the solutions for the singlet density rho(r) in the hierarchical equation connecting rho(r) with the liquid direct correlation function c(r). In addition to the homogeneous solution rho(r)=rhosub(liquid), we exhibit a periodic solution which can co-exist with the liquid solution. If the defining equation for this is linearized, we recover the bifurcation condition of Lovett and Buff. We stress the difference between the two treatments as that between first and second-order transitions. It turns out that the treatment presented here leads to the same periodic density as that derived, using the hypernetted chain approximation, by Ramakrishnan and Yussouff in their theory of freezing. Invoking that approximation is shown thereby to be inessential. (author)

  12. Direct Genesis of Functional Rodent and Human Schwann Cells from Skin Mesenchymal Precursors

    Directory of Open Access Journals (Sweden)

    Matthew P. Krause

    2014-07-01

    Full Text Available Recent reports of directed reprogramming have raised questions about the stability of cell lineages. Here, we have addressed this issue, focusing upon skin-derived precursors (SKPs, a dermally derived precursor cell. We show by lineage tracing that murine SKPs from dorsal skin originate from mesenchymal and not neural crest-derived cells. These mesenchymally derived SKPs can, without genetic manipulation, generate functional Schwann cells, a neural crest cell type, and are highly similar at the transcriptional level to Schwann cells isolated from the peripheral nerve. This is not a mouse-specific phenomenon, since human SKPs that are highly similar at the transcriptome level can be made from neural crest-derived facial and mesodermally derived foreskin dermis and the foreskin SKPs can make myelinating Schwann cells. Thus, nonneural crest-derived mesenchymal precursors can differentiate into bona fide peripheral glia in the absence of genetic manipulation, suggesting that developmentally defined lineage boundaries are more flexible than widely thought.

  13. Experimental analysis of bidirectional reflectance distribution function cross section conversion term in direction cosine space.

    Science.gov (United States)

    Butler, Samuel D; Nauyoks, Stephen E; Marciniak, Michael A

    2015-06-01

    Of the many classes of bidirectional reflectance distribution function (BRDF) models, two popular classes of models are the microfacet model and the linear systems diffraction model. The microfacet model has the benefit of speed and simplicity, as it uses geometric optics approximations, while linear systems theory uses a diffraction approach to compute the BRDF, at the expense of greater computational complexity. In this Letter, nongrazing BRDF measurements of rough and polished surface-reflecting materials at multiple incident angles are scaled by the microfacet cross section conversion term, but in the linear systems direction cosine space, resulting in great alignment of BRDF data at various incident angles in this space. This results in a predictive BRDF model for surface-reflecting materials at nongrazing angles, while avoiding some of the computational complexities in the linear systems diffraction model.

  14. Parametric study of development of Inconel-steel functionally graded materials by laser direct metal deposition

    International Nuclear Information System (INIS)

    Shah, Kamran; Haq, Izhar ul; Khan, Ashfaq; Shah, Shaukat Ali; Khan, Mushtaq; Pinkerton, Andrew J

    2014-01-01

    Highlights: • Functionally graded steel and nickel super-alloy structures have been developed. • Mechanical properties of FGMs can be controlled by process input parameters. • SDAS is strongly dependent on the laser power and powder mass flow rate. • Carbides provide a mechanism to control the hardness and wear resistance of FGM. • Tensile strength of FGM is dependent on the laser power and powder mass flow rate. - Abstract: Laser direct metal deposition (LDMD) has developed from a prototyping to a single and multiple metals manufacturing technique. It offers an opportunity to produce graded components, with differing elemental composition, phase and microstructure at different locations. In this work, continuously graded Stainless Steel 316L and Inconel 718 thin wall structures made by direct laser metal deposition process have been explored. The paper considers the effects of process parameters including laser power levels and powder mass flow rates of SS316L and Inconel 718 during the deposition of the Steel–Ni graded structures. Microstructure characterisation and phase identification are performed by optical microscopy and X-ray diffraction techniques. Mechanical testing, using methods such as hardness, wear resistance and tensile testing have been carried out on the structures. XRD results show the presence of the NbC and Fe 2 Nb phases formed during the deposition. The effect of experimental parameters on the microstructure and physical properties are determined and discussed. Work shows that mechanical properties can be controlled by input parameters and generation of carbides provides an opportunity to selectively control the hardness and wear resistance of the functionally graded material

  15. Electroejaculation functions primarily by direct activation of pelvic musculature: Perspectives from a porcine model

    Directory of Open Access Journals (Sweden)

    Adam M.R. Groh

    2018-03-01

    Full Text Available Ejaculatory dysfunction is a significant cause of infertility in men that have incurred spinal cord injury or iatrogenic lesions to the sympathetic nerves in the retroperitoneum. For such patients, electroejaculation – whereby a voltage is applied transrectally under general anesthesia – is a highly-effective procedure to obtain ejaculate. At present, however, there remains uncertainty as to the physiological mechanism by which electroejaculation prompts seminal emission in males with neurogenic anejaculation. Thus, in the present study, we aimed to determine, for the first time, whether electroejaculation functions by mimicking a neurophysiological response, or by directly activating local pelvic musculature. Using electroejaculation in a novel porcine model, we monitored the strength of contraction of the internal urethral sphincter (a smooth muscle involved in ejaculation before and after lesioning its sympathetic innervation with a combination of progressively-worsening surgical and pharmacological insults in three anesthetized boars (46.1 ± 7.4 kg. Importantly, prior to this investigation, we confirmed the comparative structural anatomy of the porcine model to humans through gross dissection and histological analysis of the infrarenal retroperitoneal sympathetic nerves and ganglia in 18 unembalmed boars. Prior to sacrifice, three of these boars underwent functional testing to confirm control of the internal urethral sphincter by the hypogastric nerves. Our results demonstrate that electroejaculation-induced contraction of the internal urethral sphincter was preserved following each progressive neural insult compared to the control state (p > 0.05. In contrast, these same insults resulted in paralysis/paresis of the internal urethral sphincter when its sympathetic innervation was directly stimulated with bipolar electrodes (p < 0.05. Taken together, our results provide the first empirical evidence to suggest that

  16. [The significance of directional preponderance in the evaluation of vestibular function in patients with vertigo].

    Science.gov (United States)

    Wang, J; Zhou, Y J; Yu, J; Gu, J

    2017-03-07

    Objective: To analyze the relationship between directional preponderance (DP), spontaneous nystagmus(SN) and vestibular disorders, and to investigate the significance of DP in directing peripheral vestibular function in patients with vertigo. Methods: This was a retrospective analysis of 394 cases diagnosed with peripheral vestibular disease accompanied by vertigo from March 2012 to June 2014 in the Outpatient Department of the Eye & ENT Hospital of Fudan University. Results of static and dynamic posture equilibrium tests, SN, unilateral weakness(UW), and DP in videonystagmography(VNG) were analyzed and compared. Results: The mean interval time between the last vertigo attack and examination in patients with SN or DP in caloric test were 4.4 d and 7.3 d respectively, and those without SN or DP were 18.3 d and 17.5 d respectively. The patients were divided into two groups according to DP results of caloric test. DP-normal group had 203 cases and DP-abnormal group had 191 cases. Spontaneous nystagmus was presented in 44 cases in the DP-normal group (21.67%) and four in the DP-abnormal group (2.09%). A significant difference was found between the two groups (χ 2 =35.27, P =0.000). Deficiency of vestibular function was noted in 165 cases in the DP-normal group (81.28%) and 123 (64.40%) in the DP-abnormal group in static and dynamic posture equilibrium tests. The difference between the two groups was statistically significant (χ 2 =14.26, P =0.000). Conclusion: Compared with DP-normal patients, DP-abnormal patients are more likely to have spontaneous nystagmus and balance disorders due to vestibular dysfunction.

  17. Prototyping chips in minutes: Direct Laser Plotting (DLP) of functional microfluidic structures

    KAUST Repository

    Wang, Limu

    2013-10-10

    We report a fast and simple prototyping method to fabricate polymer-based microfluidic chips using Direct Laser Plotting (DLP) technique, by which various functional micro-structures can be realized within minutes, in a mask-free and out-of-cleanroom fashion. A 2D Computer-Aid-Design (CAD) software was employed to layout the required micro-structures and micro-channels, a CO2 laser plotter was then used to construct the microstructures. The desired patterns can be plotted directly on PDMS substrates and bio-compatible polymer films by manipulating the strength and density of laser pulses. With the DLP technique, chip-embedded micro-electrodes, micro-mixers and 3D microfluidic chips with 5 layers, which normally require several days of work in a cleanroom facility, can be fabricated in minutes in common laboratory. This novel method can produce microfluidic channels with average feature size of 100 μm, while feature size of 50 μm or smaller is achievable by making use of the interference effect from laser impulsion. In this report, we present the optimized parameters for successful fabrication of 3D microchannels, micro-mixers and microfluidic chips for protein concentration measurements (Bovine Serum Albumine (BSA) test), and a novel procedure to pattern flexible embedding electrodes on PDMS-based microfluidic chips. DLP offers a convenient and low cost alternative to conventional microfluidic channel fabrication technique which relies on complicated and hazardous soft lithography process.

  18. Anisotropic dark matter distribution functions and impact on WIMP direct detection

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Schwetz, Thomas; Catena, Riccardo

    2013-01-01

    Dark matter N-body simulations suggest that the velocity distribution of dark matter is anisotropic. In this work we employ a mass model for the Milky Way whose parameters are determined from a fit to kinematical data. Then we adopt an ansatz for the dark matter phase space distribution which allows to construct self-consistent halo models which feature a degree of anisotropy as a function of the radius such as suggested by the simulations. The resulting velocity distributions are then used for an analysis of current data from dark matter direct detection experiments. We find that velocity distributions which are radially biased at large galactocentric distances (up to the virial radius) lead to an increased high velocity tail of the local dark matter distribution. This affects the interpretation of data from direct detection experiments, especially for dark matter masses around 10 GeV, since in this region the high velocity tail is sampled. We find that the allowed regions in the dark matter mass-cross section plane as indicated by possible hints for a dark matter signal reported by several experiments as well as conflicting exclusion limits from other experiments shift in a similar way when the halo model is varied. Hence, it is not possible to improve the consistency of the data by referring to anisotropic halo models of the type considered in this work

  19. Direct antigonadal activity of cannabinoids: suppression of rat granulosa cell functions.

    Science.gov (United States)

    Adashi, E Y; Jones, P B; Hsueh, A J

    1983-02-01

    The direct effects of delta 9-tetrahydrocannabinol (THC) and related cannabinoids on ovarian granulosa cells were studied in vitro. Granulosa cells from immature, hypophysectomized, estrogen-treated rats were cultured for 2 days in an androstenedione-supplemented medium in the presence or absence of follicle-stimulating hormone (FSH) (10 ng/ml) with or without cannabinoids. FSH treatment increased progesterone and estrogen biosynthesis, whereas concomitant treatment with THC led to a dose-dependent inhibition of the FSH-stimulated accumulation of progesterone and estrogen with ED50 values of 3.5 +/- 0.3 X 10(-7) and 1.8 +/- 0.2 X 10(-6) M, respectively. Treatment with related but nonpsychoactive cannabinoids (cannabidiol, cannabinol, cannabigerol, or cannabichromene) was equally effective. The THC-induced inhibition of progesterone production was reversible and was associated with an inhibition of pregnenolone biosynthesis and a decrease of 3 beta-hydroxysteroid dehydrogenase activity. In addition, treatment with THC brought about a dose-dependent inhibition of the FSH-induced increase in luteinizing hormone (LH) receptors. The inhibitory effects of THC were not associated with changes in cell number, protein content, or cell viability. Thus, THC exerts direct inhibitory effects on FSH-dependent functions related to steroidogenesis and the acquisition of LH receptors, all of which are essential to follicular maturation. Because plasma concentrations of THC similar to those used in this study have been reported in human beings, repeated exposure of female users to THC may lead to ovarian dysfunction, due in part, to the direct antigonadal activity to THC.

  20. Direct Functionalization of Nitrogen Heterocycles via Rh-Catalyzed C-H Bond Activation

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, Jared; Bergman, Robert; Ellman, Jonathan

    2008-02-04

    Nitrogen heterocycles are present in many compounds of enormous practical importance, ranging from pharmaceutical agents and biological probes to electroactive materials. Direct funtionalization of nitrogen heterocycles through C-H bond activation constitutes a powerful means of regioselectively introducing a variety of substituents with diverse functional groups onto the heterocycle scaffold. Working together, our two groups have developed a family of Rh-catalyzed heterocycle alkylation and arylation reactions that are notable for their high level of functional-group compatibility. This Account describes their work in this area, emphasizing the relevant mechanistic insights that enabled synthetic advances and distinguished the resulting transformations from other methods. They initially discovered an intramolecular Rh-catalyzed C-2-alkylation of azoles by alkenyl groups. That reaction provided access to a number of di-, tri-, and tetracyclic azole derivatives. They then developed conditions that exploited microwave heating to expedite these reactions. While investigating the mechanism of this transformation, they discovered that a novel substrate-derived Rh-N-heterocyclic carbene (NHC) complex was involved as an intermediate. They then synthesized analogous Rh-NHC complexes directly by treating precursors to the intermediate [RhCl(PCy{sub 3}){sub 2}] with N-methylbenzimidazole, 3-methyl-3,4-dihydroquinazolein, and 1-methyl-1,4-benzodiazepine-2-one. Extensive kinetic analysis and DFT calculations supported a mechanism for carbene formation in which the catalytically active RhCl(PCy{sub 3}){sub 2} fragment coordinates to the heterocycle before intramolecular activation of the C-H bond occurs. The resulting Rh-H intermediate ultimately tautomerizes to the observed carbene complex. With this mechanistic information and the discovery that acid co-catalysts accelerate the alkylation, they developed conditions that efficiently and intermolecularly alkylate a variety of

  1. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection.

    Science.gov (United States)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; da Cruz, Nilson Cristino; de Moraes, Marli Leite; Riul, Antonio; Ferreira, Marystela

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4μmol·L(-1) and sensitivity of 2.47μA·cm(-2)·mmol(-1)·L for glucose with the (GPDDA/GPSS)1/(GPDDA/GOx)2 architecture, whose thickness was 19.80±0.28nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Can Transcranial Direct Current Stimulation Improve Cognitive Functioning in Adults with Schizophrenia?

    Science.gov (United States)

    Schretlen, David J; van Steenburgh, Joseph J; Varvaris, Mark; Vannorsdall, Tracy D; Andrejczuk, Megan A; Gordon, Barry

    Cognitive impairment is nearly ubiquitous in schizophrenia. First-degree relatives of persons with schizophrenia often show similar but milder deficits. Current methods for the treatment of schizophrenia are often ineffective in cognitive remediation. Since transcranial direct current stimulation (tDCS) can enhance cognitive functioning in healthy adults, it might provide a viable option to enhance cognition in schizophrenia. We sought to explore whether tDCS can be tolerated by persons with schizophrenia and potentially improve their cognitive functioning. We examined the effects of anodal versus cathodal tDCS on working memory and other cognitive tasks in five outpatients with schizophrenia and six first-degree relatives of persons with schizophrenia. Each participant completed tasks thought to be mediated by the prefrontal cortex during two 30-minute sessions of tDCS to the left and right dorsolateral prefrontal cortex (DLPFC). Anodal stimulation over the left DLPFC improved performance relative to cathodal stimulation on measures of working memory and aspects of verbal fluency relevant to word retrieval. The patient group showed differential changes in novel design production without alteration of overall productivity, suggesting that tDCS might be capable of altering self-monitoring and executive control. All participants tolerated tDCS well. None withdrew from the study or experienced any adverse reaction. We conclude that adults with schizophrenia can tolerate tDCS while engaging in cognitive tasks and that tDCS can alter their performance.

  3. Patterned Arrays of Functional Lateral Heterostructures via Sequential Template-Directed Printing.

    Science.gov (United States)

    Li, Yifan; Su, Meng; Li, Zheng; Huang, Zhandong; Li, Fengyu; Pan, Qi; Ren, Wanjie; Hu, Xiaotian; Song, Yanlin

    2018-04-30

    The precise integration of microscale dots and lines with controllable interfacing connections is highly important for the fabrication of functional devices. To date, the solution-processible methods are used to fabricate the heterogeneous micropatterns for different materials. However, for increasingly miniaturized and multifunctional devices, it is extremely challenging to engineer the uncertain kinetics of a solution on the microstructures surfaces, resulting in uncontrollable interface connections and poor device performance. Here, a sequential template-directed printing process is demonstrated for the fabrication of arrayed microdots connected by microwires through the regulation of the Rayleigh-Taylor instability of material solution or suspension. Flexibility in the control of fluidic behaviors can realize precise interface connection between the micropatterns, including the microwires traversing, overlapping or connecting the microdots. Moreover, various morphologies such as circular, rhombic, or star-shaped microdots as well as straight, broken or curved microwires can be achieved. The lateral heterostructure printed with two different quantum dots displays bright dichromatic photoluminescence. The ammonia gas sensor printed by polyaniline and silver nanoparticles exhibits a rapid response time. This strategy can construct heterostructures in a facile manner by eliminating the uncertainty of the multimaterials interface connection, which will be promising for the development of novel lateral functional devices. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Principle of topography-directed inkjet printing for functional micro-tracks in flexible substrates

    Science.gov (United States)

    Keum, Chang-Min; Lee, In-Ho; Park, Hea-Lim; Kim, Chiwoo; Lüssem, Björn; Choi, Jong Sun; Lee, Sin-Doo

    2017-06-01

    We present a general principle of topography-directed (TD) inkjet printing for functional micro-tracks embedded in a flexible elastomer substrate. The essential features of the TD inkjet printing in a micro-structured substrate with periodic grooves and ridges are described in terms of the topographic parameters for the transformation from a single droplet to a filament or an edge-disjoint pattern of ink in the groove. Silver ink, being widely used for producing conductive wires by conventional inkjet printing, is utilized as a testbed in our study. The underlying mechanisms for the spreading and drying processes of ink drops under the topographic compartment can be understood in a two-dimensional parameter space of the aspect ratio of the groove and the contact angle of ink on the substrate. The wetting morphologies of ink droplets are described in an analytical model where the Laplace pressure and the mean curvature at the vapor/ink interface are taken into account. The first principle of the TD inkjet printing would be applicable for constructing a variety of functional micro-tracks with high pattern fidelity from different classes of solutions such as conducting polymers, organic semiconductors, and colloidal nanoparticles.

  5. Directive and incentive functions of affective action consequences: an ideomotor approach.

    Science.gov (United States)

    Eder, Andreas B; Rothermund, Klaus; De Houwer, Jan; Hommel, Bernhard

    2015-07-01

    Five experiments examined whether affective consequences become associated with the responses producing them and whether anticipations of positive and negative action outcomes influence action control differently. In a learning phase, one response produced pleasant and another response unpleasant visual effects. In a subsequent test phase, the same actions were carried out in response to a neutral feature of affective stimuli. Results showed that responses were faster when the irrelevant valence of the response cue matched the valence of the response outcome, but only when the responses still produced outcomes. These results suggest that affective action consequences have a directive function in that they facilitate the selection of the associated response over other responses, even when the response outcome is unpleasant (Experiment 4A). Results of another experiment showed that affective action consequences can also have an incentive function in that responses with pleasant outcomes are generally facilitated relative to responses with unpleasant outcomes. However, this motivational effect was seen only in a free-choice test (Experiment 5). The results suggest that behavioral impulses induced by ideomotor processes are constrained by the motivational evaluation of the anticipated action outcome. A model that integrates motivational factors into ideomotor theory is presented.

  6. Direct electrochemistry and electrocatalysis of a glucose oxidase-functionalized bioconjugate as a trace label for ultrasensitive detection of thrombin.

    Science.gov (United States)

    Bai, Lijuan; Yuan, Ruo; Chai, Yaqin; Yuan, Yali; Wang, Yan; Xie, Shunbi

    2012-11-18

    For the first time, a glucose oxidase-functionalized bioconjugate was prepared and served as a new trace label through its direct electrochemistry and electrocatalysis in a sandwich-type electrochemical aptasensor for ultrasensitive detection of thrombin.

  7. Direct assessment of lung function in COPD using CT densitometric measures

    International Nuclear Information System (INIS)

    Gu, Suicheng; Leader, Joseph; Gur, David; Pu, Jiantao; Zheng, Bin; Chen, Qihang; Sciurba, Frank; Kminski, Naftali

    2014-01-01

    To investigate whether lung function in patients with chronic obstructive pulmonary disease (COPD) can be directly predicted using CT densitometric measures and assess the underlying prediction errors as compared with the traditional spirometry-based measures. A total of 600 CT examinations were collected from a COPD study. In addition to the entire lung volume, the extent of emphysema depicted in each CT examination was quantified using density mask analysis (densitometry). The partial least square regression was used for constructing the prediction model, where a repeated random split-sample validation was employed. For each split, we randomly selected 400 CT exams for training (regression) purpose and the remaining 200 exams for assessing performance in prediction of lung function (e.g., FEV1 and FEV1/FVC) and disease severity. The absolute and percentage errors as well as their standard deviations were computed. The averaged percentage errors in prediction of FEV1, FEV1/FVC%, TLC, RV/TLC% and DLco% predicted were 33%, 17%, 9%, 18% and 23%, respectively. When classifying the exams in terms of disease severity grades using the CT measures, 37% of the subjects were correctly classified with no error and 83% of the exams were either correctly classified or classified into immediate neighboring categories. The linear weighted kappa and quadratic weighted kappa were 0.54 (moderate agreement) and 0.72 (substantial agreement), respectively. Despite the existence of certain prediction errors in quantitative assessment of lung function, the CT densitometric measures could be used to relatively reliably classify disease severity grade of COPD patients in terms of GOLD. (paper)

  8. Functional connections between activated and deactivated brain regions mediate emotional interference during externally directed cognition.

    Science.gov (United States)

    Di Plinio, Simone; Ferri, Francesca; Marzetti, Laura; Romani, Gian Luca; Northoff, Georg; Pizzella, Vittorio

    2018-04-24

    Recent evidence shows that task-deactivations are functionally relevant for cognitive performance. Indeed, higher cognitive engagement has been associated with higher suppression of activity in task-deactivated brain regions - usually ascribed to the Default Mode Network (DMN). Moreover, a negative correlation between these regions and areas actively engaged by the task is associated with better performance. DMN regions show positive modulation during autobiographical, social, and emotional tasks. However, it is not clear how processing of emotional stimuli affects the interplay between the DMN and executive brain regions. We studied this interplay in an fMRI experiment using emotional negative stimuli as distractors. Activity modulations induced by the emotional interference of negative stimuli were found in frontal, parietal, and visual areas, and were associated with modulations of functional connectivity between these task-activated areas and DMN regions. A worse performance was predicted both by lower activity in the superior parietal cortex and higher connectivity between visual areas and frontal DMN regions. Connectivity between right inferior frontal gyrus and several DMN regions in the left hemisphere was related to the behavioral performance. This relation was weaker in the negative than in the neutral condition, likely suggesting less functional inhibitions of DMN regions during emotional processing. These results show that both executive and DMN regions are crucial for the emotional interference process and suggest that DMN connections are related to the interplay between externally-directed and internally-focused processes. Among DMN regions, superior frontal gyrus may be a key node in regulating the interference triggered by emotional stimuli. © 2018 Wiley Periodicals, Inc.

  9. Sparse networks of directly coupled, polymorphic, and functional side chains in allosteric proteins.

    Science.gov (United States)

    Soltan Ghoraie, Laleh; Burkowski, Forbes; Zhu, Mu

    2015-03-01

    Recent studies have highlighted the role of coupled side-chain fluctuations alone in the allosteric behavior of proteins. Moreover, examination of X-ray crystallography data has recently revealed new information about the prevalence of alternate side-chain conformations (conformational polymorphism), and attempts have been made to uncover the hidden alternate conformations from X-ray data. Hence, new computational approaches are required that consider the polymorphic nature of the side chains, and incorporate the effects of this phenomenon in the study of information transmission and functional interactions of residues in a molecule. These studies can provide a more accurate understanding of the allosteric behavior. In this article, we first present a novel approach to generate an ensemble of conformations and an efficient computational method to extract direct couplings of side chains in allosteric proteins, and provide sparse network representations of the couplings. We take the side-chain conformational polymorphism into account, and show that by studying the intrinsic dynamics of an inactive structure, we are able to construct a network of functionally crucial residues. Second, we show that the proposed method is capable of providing a magnified view of the coupled and conformationally polymorphic residues. This model reveals couplings between the alternate conformations of a coupled residue pair. To the best of our knowledge, this is the first computational method for extracting networks of side chains' alternate conformations. Such networks help in providing a detailed image of side-chain dynamics in functionally important and conformationally polymorphic sites, such as binding and/or allosteric sites. © 2014 Wiley Periodicals, Inc.

  10. Comparison Effect of Direct Trocar and Veress Needle Entry Techniques on Gut Functions after Laparoscopic Procedures: Randomized Clinical Trial

    Directory of Open Access Journals (Sweden)

    Taylan Şenol

    2016-12-01

    CONCLUSION: Direct or Veress needle entry methods were both safe to create pneumoperitoneum with similar postoperative gastrointestinal functions except for earlier first flatulence in Veress needle group while direct trocar entry was found to be associated with favorable postoperative blood count and shorter duration to obtain enough intraperitoneal pressure.

  11. Classical density functional theory and the phase-field crystal method using a rational function to describe the two-body direct correlation function.

    Science.gov (United States)

    Pisutha-Arnond, N; Chan, V W L; Iyer, M; Gavini, V; Thornton, K

    2013-01-01

    We introduce a new approach to represent a two-body direct correlation function (DCF) in order to alleviate the computational demand of classical density functional theory (CDFT) and enhance the predictive capability of the phase-field crystal (PFC) method. The approach utilizes a rational function fit (RFF) to approximate the two-body DCF in Fourier space. We use the RFF to show that short-wavelength contributions of the two-body DCF play an important role in determining the thermodynamic properties of materials. We further show that using the RFF to empirically parametrize the two-body DCF allows us to obtain the thermodynamic properties of solids and liquids that agree with the results of CDFT simulations with the full two-body DCF without incurring significant computational costs. In addition, the RFF can also be used to improve the representation of the two-body DCF in the PFC method. Last, the RFF allows for a real-space reformulation of the CDFT and PFC method, which enables descriptions of nonperiodic systems and the use of nonuniform and adaptive grids.

  12. Anatomic and functional outcomes of pharmacomechanical and catheter-directed thrombolysis of iliofemoral deep venous thrombosis.

    Science.gov (United States)

    Hager, Eric; Yuo, Theodore; Avgerinos, Efthymios; Naddaf, Abdullah; Jeyabalan, Geetha; Marone, Luke; Chaer, Rabih

    2014-07-01

    Pharmacomechanical thrombolysis (PMT) and catheter-directed thrombolysis (CDT) are commonly used for the treatment of iliofemoral deep venous thrombosis (DVT). The purpose of this study was to examine the short- and long-term venous patency and venous valvular function as well as clinical outcomes of patients treated for iliofemoral DVT by PMT and CDT. A retrospective review of all patients with symptomatic DVT treated between 2006 and 2011 with PMT or CDT was performed. All patients were treated by local tissue plasminogen activator delivered with PMT or CDT. Patients were divided into two groups on the basis of initial treatment modality: patients treated by PMT alone (group 1), and those who underwent PMT and CDT or CDT alone (group 2). Group comorbidities, initial presenting symptoms, and Clinical, Etiologic, Anatomic, and Pathologic (CEAP) classification scores were compared. Postprocedural duplex ultrasound was used to assess valve function and treated vein patency rates. At all visits, Villalta and CEAP scores were recorded and compared. Group demographic and procedural results were analyzed by Fisher exact test for dichotomous variables and Kruskal-Wallis equality-of-populations rank test for the ordinal and continuous data. Kaplan-Meier survival estimates were used to assess preserved valve function as well as primary and secondary patency rates. There were 79 patients with 102 limbs treated for extensive iliofemoral DVT (median age, 51.5 years; range, 16.6-83.8 years). There were 18 patients in group 1 and 61 patients in group 2 (PMT + CDT [n = 54] or CDT alone [n = 7]). There were no differences in demographics or comorbidities between groups aside from malignant disease, which was more common in group 1 (35.3% vs 11.5%; P = .03). A total of 102 limbs were analyzed, 24 in group 1 and 78 in group 2. Patients in group 1 had a shorter symptom duration compared with group 2 (7 days vs 16 days; P = .011). The median number of procedures in group 1

  13. Effect of phase-encoding direction on group analysis of resting-state functional magnetic resonance imaging.

    Science.gov (United States)

    Mori, Yasuo; Miyata, Jun; Isobe, Masanori; Son, Shuraku; Yoshihara, Yujiro; Aso, Toshihiko; Kouchiyama, Takanori; Murai, Toshiya; Takahashi, Hidehiko

    2018-05-17

    Echo-planar imaging is a common technique used in functional magnetic resonance imaging (fMRI), however it suffers from image distortion and signal loss because of large susceptibility effects that are related to the phase-encoding direction of the scan. Despite this relationship, the majority of neuroimaging studies have not considered the influence of phase-encoding direction. Here, we aimed to clarify how phase-encoding direction can affect the outcome of an fMRI connectivity study of schizophrenia. Resting-state fMRI using anterior to posterior (A-P) and posterior to anterior (P-A) directions was used to examine 25 patients with schizophrenia (SC) and 37 matched healthy controls (HC). We conducted a functional connectivity analysis using independent component analysis and performed three group comparisons: A-P vs. P-A (all participants), SC vs. HC for the A-P and P-A datasets, and the interaction between phase-encoding direction and participant group. The estimated functional connectivity differed between the two phase-encoding directions in areas that were more extensive than those where signal loss has been reported. Although functional connectivity in the SC group was lower than that in the HC group for both directions, the A-P and P-A conditions did not exhibit the same specific pattern of differences. Further, we observed an interaction between participant group and the phase-encoding direction in the left temporo-parietal junction and left fusiform gyrus. Phase-encoding direction can influence the results of functional connectivity studies. Thus, appropriate selection and documentation of phase-encoding direction will be important in future resting-state fMRI studies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  14. Direct releases to the surface and associated complementary cumulative distribution functions in the 1996 performance assessment for the Waste Isolation Pilot Plant: direct brine release

    International Nuclear Information System (INIS)

    Stoelzel, D.M.; O'Brien, D.G.; Garner, J.W.; Helton, J.C.; Johnson, J.D.; Smith, L.N.

    2000-01-01

    The following topics related to the treatment of direct brine releases to the surface environment in the 1996 performance assessment for the Waste Isolation Pilot Plant (WIPP) are presented: (i) mathematical description of models; (ii) uncertainty and sensitivity analysis results arising from subjective (i.e. epistemic) uncertainty for individual releases; (iii) construction of complementary cumulative distribution functions (CCDFs) arising from stochastic (i.e. aleatory) uncertainty; and (iv) uncertainty and sensitivity analysis results for CCDFs. The presented analyses indicate that direct brine releases do not constitute a serious threat to the effectiveness of the WIPP as a disposal facility for transuranic waste. Even when the effects of uncertain analysis inputs are taken into account, the CCDFs for direct brine releases fall substantially to the left of the boundary line specified in the US Environmental Protection Agency's standard for the geologic disposal of radioactive waste (40 CFR 191, 40 CFR 194)

  15. Assessing eco-efficiency: A metafrontier directional distance function approach using life cycle analysis

    International Nuclear Information System (INIS)

    Beltrán-Esteve, Mercedes; Reig-Martínez, Ernest; Estruch-Guitart, Vicent

    2017-01-01

    Sustainability analysis requires a joint assessment of environmental, social and economic aspects of production processes. Here we propose the use of Life Cycle Analysis (LCA), a metafrontier (MF) directional distance function (DDF) approach, and Data Envelopment Analysis (DEA), to assess technological and managerial differences in eco-efficiency between production systems. We use LCA to compute six environmental and health impacts associated with the production processes of nearly 200 Spanish citrus farms belonging to organic and conventional farming systems. DEA is then employed to obtain joint economic-environmental farm's scores that we refer to as eco-efficiency. DDF allows us to determine farms' global eco-efficiency scores, as well as eco-efficiency scores with respect to specific environmental impacts. Furthermore, the use of an MF helps us to disentangle technological and managerial eco-inefficiencies by comparing the eco-efficiency of both farming systems with regards to a common benchmark. Our core results suggest that the shift from conventional to organic farming technology would allow a potential reduction in environmental impacts of 80% without resulting in any decline in economic performance. In contrast, as regards farmers' managerial capacities, both systems display quite similar mean scores.

  16. Two-Functional Direct Current Sputtered Silver-Containing Titanium Dioxide Thin Films

    Directory of Open Access Journals (Sweden)

    Ditta IB

    2009-01-01

    Full Text Available Abstract The article reports on structure, mechanical, optical, photocatalytic and biocidal properties of Ti–Ag–O films. The Ti–Ag–O films were reactively sputter-deposited from a composed Ti/Ag target at different partial pressures of oxygen on unheated glass substrate held on floating potentialU fl. It was found that addition of ~2 at.% of Ag into TiO2film has no negative influence on UV-induced hydrophilicity of TiO2film. Thick (~1,500 nm TiO2/Ag films containing (200 anatase phase exhibit the best hydrophilicity with water droplet contact angle (WDCA lower than 10° after UV irradiation for 20 min. Thick (~1,500 nm TiO2/Ag films exhibited a better UV-induced hydrophilicity compared to that of thinner (~700 nm TiO2/Ag films. Further it was found that hydrophilic TiO2/Ag films exhibit a strong biocidal effect under both the visible light and the UV irradiation with 100% killing efficiency ofEscherichia coliATCC 10536 after UV irradiation for 20 min. Reported results show that single layer of TiO2with Ag distributed in its whole volume exhibits, after UV irradiation, simultaneously two functions: (1 excellent hydrophilicity with WDCA < 10° and (2 strong power to killE. colieven under visible light due to direct toxicity of Ag.

  17. Assessing eco-efficiency: A metafrontier directional distance function approach using life cycle analysis

    Energy Technology Data Exchange (ETDEWEB)

    Beltrán-Esteve, Mercedes, E-mail: mercedes.beltran@uv.es [Department of Applied Economics II, University of Valencia (Spain); Reig-Martínez, Ernest [Department of Applied Economics II, University of Valencia, Ivie (Spain); Estruch-Guitart, Vicent [Department of Economy and Social Sciences, Polytechnic University of Valencia (Spain)

    2017-03-15

    Sustainability analysis requires a joint assessment of environmental, social and economic aspects of production processes. Here we propose the use of Life Cycle Analysis (LCA), a metafrontier (MF) directional distance function (DDF) approach, and Data Envelopment Analysis (DEA), to assess technological and managerial differences in eco-efficiency between production systems. We use LCA to compute six environmental and health impacts associated with the production processes of nearly 200 Spanish citrus farms belonging to organic and conventional farming systems. DEA is then employed to obtain joint economic-environmental farm's scores that we refer to as eco-efficiency. DDF allows us to determine farms' global eco-efficiency scores, as well as eco-efficiency scores with respect to specific environmental impacts. Furthermore, the use of an MF helps us to disentangle technological and managerial eco-inefficiencies by comparing the eco-efficiency of both farming systems with regards to a common benchmark. Our core results suggest that the shift from conventional to organic farming technology would allow a potential reduction in environmental impacts of 80% without resulting in any decline in economic performance. In contrast, as regards farmers' managerial capacities, both systems display quite similar mean scores.

  18. Marginal Abatement Cost of CO2 in China Based on Directional Distance Function: An Industry Perspective

    Directory of Open Access Journals (Sweden)

    Bowen Xiao

    2017-01-01

    Full Text Available Industrial sectors account for around 70% of the total energy-related CO2 emissions in China. It is of great importance to measure the potential for CO2 emissions reduction and calculate the carbon price in industrial sectors covered in the Emissions Trading Scheme and carbon tax. This paper employs the directional distance function to calculate the marginal abatement costs of CO2 emissions during 2005–2011 and makes a comparative analysis between our study and the relevant literature. Our empirical results show that the marginal abatement costs vary greatly from industry to industry: high marginal abatement costs occur in industries with low carbon intensity, and vice versa. In the application of the marginal abatement cost, the abatement distribution scheme with minimum cost is established under different abatement targets. The conclusions of abatement distribution scheme indicate that those heavy industries with low MACs and high carbon intensity should take more responsibility for emissions reduction and vice versa. Finally, the policy implications for marginal abatement cost are provided.

  19. Deposition of low sheet resistance indium tin oxide directly onto functional small molecules

    KAUST Repository

    Franklin, Joseph B.

    2014-11-01

    © 2014 Elsevier B.V. All rights reserved. We outline a methodology for depositing tin-doped indium oxide (ITO) directly onto semiconducting organic small molecule films for use as a transparent conducting oxide top-electrode. ITO films were grown using pulsed laser deposition onto copper(II)phthalocyanine (CuPc):buckminsterfullerene (C60) coated substrates. The ITO was deposited at a substrate temperature of 150 °C over a wide range of background oxygen pressures (Pd) (0.67-10 Pa). Deposition at 0.67 ≤ Pd ≤ 4.7 Pa led to delamination of the organic films owing to damage induced by the high energy ablated particles, at intermediate 4.7 ≤ Pd < 6.7 Pa pressures macroscopic cracking is observed in the ITO. Increasing Pd further, ≥ 6.7 Pa, supports the deposition of continuous, polycrystalline and highly transparent ITO films without damage to the CuPc:C60. The free carrier concentration of ITO is strongly influenced by Pd; hence growth at > 6.7 Pa induces a significant decrease in conductivity; with a minimum sheet resistance (Rs) of 145 /□ achieved for 300 nm thick ITO films. To reduce the Rs a multi-pressure deposition was implemented, resulting in the formation of polycrystalline, highly transparent ITO with an Rs of - 20/□ whilst maintaining the inherent functionality and integrity of the small molecule substrate.

  20. Deposition of low sheet resistance indium tin oxide directly onto functional small molecules

    KAUST Repository

    Franklin, Joseph B.; Fleet, Luke R.; Burgess, Claire H.; McLachlan, Martyn A.

    2014-01-01

    © 2014 Elsevier B.V. All rights reserved. We outline a methodology for depositing tin-doped indium oxide (ITO) directly onto semiconducting organic small molecule films for use as a transparent conducting oxide top-electrode. ITO films were grown using pulsed laser deposition onto copper(II)phthalocyanine (CuPc):buckminsterfullerene (C60) coated substrates. The ITO was deposited at a substrate temperature of 150 °C over a wide range of background oxygen pressures (Pd) (0.67-10 Pa). Deposition at 0.67 ≤ Pd ≤ 4.7 Pa led to delamination of the organic films owing to damage induced by the high energy ablated particles, at intermediate 4.7 ≤ Pd < 6.7 Pa pressures macroscopic cracking is observed in the ITO. Increasing Pd further, ≥ 6.7 Pa, supports the deposition of continuous, polycrystalline and highly transparent ITO films without damage to the CuPc:C60. The free carrier concentration of ITO is strongly influenced by Pd; hence growth at > 6.7 Pa induces a significant decrease in conductivity; with a minimum sheet resistance (Rs) of 145 /□ achieved for 300 nm thick ITO films. To reduce the Rs a multi-pressure deposition was implemented, resulting in the formation of polycrystalline, highly transparent ITO with an Rs of - 20/□ whilst maintaining the inherent functionality and integrity of the small molecule substrate.

  1. Caspase-2 associates with FAN through direct interaction and overlapping functionality.

    Science.gov (United States)

    Forsberg, Jeremy; Li, Xinge; Zamaraev, Aleksey V; Panaretakis, Theocharis; Zhivotovsky, Boris; Olsson, Magnus

    2018-05-23

    Caspase-2 has been implicated in diverse cellular processes, and the identification of factors with which it interacts has steadily increased. In the present study, we report a direct interaction between caspase-2 and factor associated with neutral sphingomyelinase activation (FAN) using yeast two-hybrid screening and co-immunoprecipitation. Further, stable suppression of caspase-2 expression in HEK293T and HeLa cells enabled a systematic investigation of putative novel enzyme functionalities, especially with respect to ceramide production, cell migration, IL-6 production and vesicular homeostasis, all of which have been previously reported to be associated with FAN. Lipidomics excluded the involvement of caspase-2 in the generation of ceramide species, but caspase-2-dependent deregulation of IL-6 release, vesicular size and delayed cell relocation supported an association between caspase-2 and FAN. Collectively, these data identify a novel caspase-2-interacting factor, FAN, and expand the role for the enzyme in seemingly non-apoptotic cellular mechanisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Direct atomic imaging and density functional theory study of the Au24Pd1 cluster catalyst.

    Science.gov (United States)

    Bruma, A; Negreiros, F R; Xie, S; Tsukuda, T; Johnston, R L; Fortunelli, A; Li, Z Y

    2013-10-21

    In this study we report a direct, atomic-resolution imaging of calcined Au24Pd1 clusters supported on multiwall carbon nanotubes by employing aberration-corrected scanning transmission electron microscopy. Using gold atoms as mass standards, we confirm the cluster size to be 25 ± 2, in agreement with the Au24Pd1(SR)18 precursor used in the synthesis. Concurrently, a Density-Functional/Basin-Hopping computational algorithm is employed to locate the low-energy configurations of free Au24Pd1 cluster. Cage structures surrounding a single core atom are found to be favored, with a slight preference for Pd to occupy the core site. The cluster shows a tendency toward elongated arrangements, consistent with experimental data. The degree of electron transfer from the Pd dopant to Au is quantified through a Löwdin charge analysis, suggesting that Pd may act as an electron promoter to the surrounding Au atoms when they are involved in catalytic reactions.

  3. Moving in the Right Direction: Evolution of Protein Structural Vibrations with Functional State and Mutation

    Science.gov (United States)

    Niessen, Katherine; Xu, Mengyang; Snell, Edward; Markelz, Andrea

    Long-range intramolecular vibrations may enable efficient access to functionally important conformations. We examine how these motions change with inhibitor binding and mutation using terahertz anisotropic absorption and molecular modeling. The measured anisotropic absorption dramatically changes with 3NAG inhibitor binding for wild type (WT) free chicken egg white lysozyme (CEWL). We examine the evolution of internal motions with binding using normal mode analysis to calculate an ensemble averaged vibrational density of states (VDOS) and isotropic and anisotropic absorptions for both WT and a two residue (R14 and H15) deletion mutant which has a 1.4 higher activity rate. While the VDOS and isotropic response are largely unchanged with inhibitor binding, the anisotropic response changes dramatically with binding. However, for the mutant the calculated unbound anisotropic absorption more closely resembles its bound spectrum, and it has increased calculated mean squared fluctuations in regions overlapping those in its bound state. These results indicate that the mutant's enhanced activity may be due to a shift in the direction of vibrations toward those of the bound state, increasing the sampling rate of the bound conformation.

  4. Directional preference and functional outcomes among subjects classified at high psychosocial risk using STarT.

    Science.gov (United States)

    Werneke, Mark W; Edmond, Susan; Young, Michelle; Grigsby, David; McClenahan, Brian; McGill, Troy

    2018-03-14

    Physiotherapy has an important role in managing patients with non-specific low back pain who experience elevated psychosocial distress or risk for chronic disability. In terms of evidence-based physiotherapy practice, cognitive-behavioural approaches for patients at high psychosocial risk are the recommended management to improve patient treatment outcomes. Evidence also suggests that directional preference (DP) is an important treatment effect modifier for prescribing specific exercises for patients to improve outcomes. Little is known about the influence of treatment techniques based on DP on outcomes for patients classified as high psychosocial risk using the Subgroups for Targeted Treatment (STarT) Back Screening Tool. This study aimed to examine the association between functional status (FS) at rehabilitation discharge for patients experiencing low back pain classified at high STarT psychosocial risk and whose symptoms showed a DP versus No-DP. High STarT risk patients (n = 138) completed intake surveys, that is, the lumbar FS of Focus On Therapeutic Outcomes, Inc., and STarT, and were evaluated for DP by physiotherapists credentialed in McKenzie methods. The FS measure of Focus On Therapeutic Outcomes, Inc., was repeated at discharge. DP and No-DP prevalence rates were calculated. Associations between first-visit DP and No-DP and change in FS were assessed using univariate and multivariate regression models controlling for 11 risk-adjusted variables. One hundred nine patients classified as high STarT risk had complete intake and discharge FS and DP data. Prevalence rate for DP was 65.1%. A significant and clinically important difference (7.98 FS points; p = .03) in change in function at discharge between DP and No-DP was observed after controlling for all confounding variables in the final model. Findings suggest that interventions matched to DP are effective for managing high psychological risk patients and may provide physiotherapists with an

  5. Direct evidence of impaired neuronal Na/K-ATPase pump function in alternating hemiplegia of childhood.

    Science.gov (United States)

    Simmons, Christine Q; Thompson, Christopher H; Cawthon, Bryan E; Westlake, Grant; Swoboda, Kathryn J; Kiskinis, Evangelos; Ess, Kevin C; George, Alfred L

    2018-03-19

    Mutations in ATP1A3 encoding the catalytic subunit of the Na/K-ATPase expressed in mammalian neurons cause alternating hemiplegia of childhood (AHC) as well as an expanding spectrum of other neurodevelopmental syndromes and neurological phenotypes. Most AHC cases are explained by de novo heterozygous ATP1A3 mutations, but the fundamental molecular and cellular consequences of these mutations in human neurons are not known. In this study, we investigated the electrophysiological properties of neurons generated from AHC patient-specific induced pluripotent stem cells (iPSCs) to ascertain functional disturbances underlying this neurological disease. Fibroblasts derived from two subjects with AHC, a male and a female, both heterozygous for the common ATP1A3 mutation G947R, were reprogrammed to iPSCs. Neuronal differentiation of iPSCs was initiated by neurogenin-2 (NGN2) induction followed by co-culture with mouse glial cells to promote maturation of cortical excitatory neurons. Whole-cell current clamp recording demonstrated that, compared with control iPSC-derived neurons, neurons differentiated from AHC iPSCs exhibited a significantly lower level of ouabain-sensitive outward current ('pump current'). This finding correlated with significantly depolarized potassium equilibrium potential and depolarized resting membrane potential in AHC neurons compared with control neurons. In this cellular model, we also observed a lower evoked action potential firing frequency when neurons were held at their resting potential. However, evoked action potential firing frequencies were not different between AHC and control neurons when the membrane potential was clamped to -80 mV. Impaired neuronal excitability could be explained by lower voltage-gated sodium channel availability at the depolarized membrane potential observed in AHC neurons. Our findings provide direct evidence of impaired neuronal Na/K-ATPase ion transport activity in human AHC neurons and demonstrate the potential

  6. Ant colony optimisation-direct cover: a hybrid ant colony direct cover technique for multi-level synthesis of multiple-valued logic functions

    Science.gov (United States)

    Abd-El-Barr, Mostafa

    2010-12-01

    The use of non-binary (multiple-valued) logic in the synthesis of digital systems can lead to savings in chip area. Advances in very large scale integration (VLSI) technology have enabled the successful implementation of multiple-valued logic (MVL) circuits. A number of heuristic algorithms for the synthesis of (near) minimal sum-of products (two-level) realisation of MVL functions have been reported in the literature. The direct cover (DC) technique is one such algorithm. The ant colony optimisation (ACO) algorithm is a meta-heuristic that uses constructive greediness to explore a large solution space in finding (near) optimal solutions. The ACO algorithm mimics the ant's behaviour in the real world in using the shortest path to reach food sources. We have previously introduced an ACO-based heuristic for the synthesis of two-level MVL functions. In this article, we introduce the ACO-DC hybrid technique for the synthesis of multi-level MVL functions. The basic idea is to use an ant to decompose a given MVL function into a number of levels and then synthesise each sub-function using a DC-based technique. The results obtained using the proposed approach are compared to those obtained using existing techniques reported in the literature. A benchmark set consisting of 50,000 randomly generated 2-variable 4-valued functions is used in the comparison. The results obtained using the proposed ACO-DC technique are shown to produce efficient realisation in terms of the average number of gates (as a measure of chip area) needed for the synthesis of a given MVL function.

  7. Sources of variation influencing concordance between functional MRI and direct cortical stimulation in brain tumor surgery

    Directory of Open Access Journals (Sweden)

    Melanie A Morrison

    2016-10-01

    Full Text Available Object: Preoperative functional magnetic resonance imaging (fMRI remains a promising method to aid in the surgical management of patients diagnosed with brain tumors. For patients that are candidates for awake craniotomies, surgical decisions can potentially be improved by fMRI but this depends on the level of concordance between preoperative brain maps and the maps provided by the gold standard intraoperative method, direct cortical stimulation (DCS. There have been numerous studies of the concordance between fMRI and DCS using sensitivity and specificity measures, however the results are variable across studies and the key factors influencing variability are not well understood. Thus, the present work addresses the influence of technical factors on fMRI and DCS concordance. Methods: Motor and language mapping data were collected for a group of glioma patients (n = 14 who underwent both preoperative fMRI and intraoperative DCS in an awake craniotomy procedure for tumor removal. Normative fMRI data were also acquired in a healthy control group (n = 12. The fMRI and DCS mapping data were co-registered; true positive (TP, true negative (TN, false positive (FP and false negative (FN occurrences were tabulated over the exposed brain surface. Sensitivity and specificity were measured for the total group, and the motor and language sub-groups. The influence of grid placement, fMRI statistical thresholding, and task standardization were assessed. Correlations between proportions of agreement and error were carefully scrutinized to evaluate concordance more in-depth. Results: Concordance was significantly better for motor versus language mapping. There was an inverse relationship between TP and TN with increasing statistical threshold, and FP dominated the total error. Sensitivity and specificity were reduced when tasks were not standardized across fMRI and DCS. Conclusions: Although the agreement between fMRI and DCS is good, variability is introduced

  8. Direct testing of the biasing effect of manipulations of endolymphatic pressure on cochlear mechanical function

    Science.gov (United States)

    LePage, Eric; Avan, Paul

    2015-12-01

    The history of cochlear mechanical investigations has been carried out in two largely separate sets of endeavours; those interested in auditory processing in animal models and those interested in the origin of adverse vestibular symptoms in humans. In respect of the first, mechanical vibratory data is considered pathological and not representative of pristine behaviour if it departs from the reigning model of sharp tuning and high hearing sensitivity. Conversely, when the description of the pathological behaviour is the focus, fluid movements responsible for hearing loss and vestibular symptoms dominate. Yet both extensive sets of data possess a common factor now being reconsidered for its potential to shed light on the mechanisms in general. The common factor is a mechanical bias — the departure of cochlear epithelial membranes from their usual resting position. In both cases the bias modulates hearing sensitivity and distorts tuning characteristics. Indeed several early sets of guinea pig mechanical data were dismissed as "pathological" when in hindsight, the primary effect influencing the data was not loss of outer hair cell function per se, but a mechanical bias unknowingly introduced in process of making the measurement. Such biases in the displacement of the basilar membrane from its position are common, and may be caused by low-frequency sounds (topically including infrasound) or by variations in fluid volume in the chambers particularly applying the case of endolymphatic hydrops. Most biases are quantified in terms of visualisation of fluid volume change, electric potential changes and otoacoustic emissions. Notably many previous studies have also searched for raised pressures with negative results. Yet these repeated findings are contrary to the widespread notion that, at least when homeostasis is lost, it is a rise in endolymphatic pressure which is responsible for membrane rupture and Meniere's attacks. This current investigation in Mongolian gerbils

  9. Spatial Statistics and Spatio-Temporal Data Covariance Functions and Directional Properties

    CERN Document Server

    Sherman, Michael

    2010-01-01

    In the spatial or space-time context, specifying the correct covariance function is important to obtain efficient predictions and to understand the underlying physical process of interest. There have been several books in recent years in the general area of spatial statistics. This book focuses on covariance and variogram functions, their role in prediction, and the proper choice of these functions in data applications. Presenting recent methods from 2004-2007 alongside more established methodology of assessing the usual assumptions on such functions such as isotropy, separability and symmetry

  10. The influence of prior knowledge on the retrieval-directed function of note taking in prior knowledge activation

    NARCIS (Netherlands)

    Wetzels, Sandra; Kester, Liesbeth; Van Merriënboer, Jeroen; Broers, Nick

    2010-01-01

    Wetzels, S. A. J., Kester, L., Van Merriënboer, J. J. G., & Broers, N. J. (2011). The influence of prior knowledge on the retrieval-directed function of note taking in prior knowledge activation. British Journal of Educational Psychology, 81(2), 274-291. doi: 10.1348/000709910X517425

  11. No Change in Rectal Sensitivity After Gut-Directed Hypnotherapy in Children With Functional Abdominal Pain or Irritable Bowel Syndrome

    NARCIS (Netherlands)

    Vlieger, A. M.; van den Berg, M. M.; Menko-Frankenhuis, C.; Bongers, M. E. J.; Tromp, E.; Benninga, M. A.

    2010-01-01

    OBJECTIVES: Gut-directed hypnotherapy (HT) has recently been shown to be highly effective in treating children with functional abdominal pain (FAP) and irritable bowel syndrome (IBS). This study was conducted to determine the extent to which this treatment success is because of an improvement in

  12. Gut-directed hypnotherapy for functional abdominal pain or irritable bowel syndrome in children: a systematic review

    NARCIS (Netherlands)

    Rutten, Juliette M. T. M.; Reitsma, Johannes B.; Vlieger, Arine M.; Benninga, Marc A.

    2013-01-01

    Gut directed hypnotherapy (HT) is shown to be effective in adult functional abdominal pain (FAP) and irritable bowel syndrome (IBS) patients. We performed a systematic review to assess efficacy of HT in paediatric FAP/IBS patients. We searched Medline, Embase, PsychINFO, Cumulative Index to Nursing

  13. Palladium-Catalyzed C-H Functionalization Using Guanidine as a Directing Group: Ortho Arylation and Olefination of Arylguanidines

    Science.gov (United States)

    Shao, Jiaan; Chen, Wenteng; Giulianotti, Marc A.; Houghten, Richard A.; Yu, Yongping

    2012-01-01

    Palladium-catalyzed C-H functionalization using guanidine as the directing group was achieved under mild reaction conditions. Various guanidine derivatives were produced in moderate to good yields by using simple unactivated arenes or ethyl acrylate as the source of arylation or olefination respectively. PMID:23095022

  14. Possibilistic Belief Functions Generated by Direct Products of Single Possibilistic Measures

    Czech Academy of Sciences Publication Activity Database

    Kramosil, Ivan

    1999-01-01

    Roč. 9, č. 6 (1999), s. 517-525 ISSN 1210-0552 R&D Projects: GA AV ČR IAA1030803 Institutional research plan: AV0Z1030915 Keywords : belief functions * belief revision * Dempster combination rule * possibilistic measures * possibilistic belief functions Subject RIV: BA - General Mathematics

  15. Functional Analysis and Treatment of Human-Directed Undesirable Behavior Exhibited by a Captive Chimpanzee

    Science.gov (United States)

    Martin, Allison L.; Bloomsmith, Mollie A.; Kelley, Michael E.; Marr, M. Jackson; Maple, Terry L.

    2011-01-01

    A functional analysis identified the reinforcer maintaining feces throwing and spitting exhibited by a captive adult chimpanzee ("Pan troglodytes"). The implementation of a function-based treatment combining extinction with differential reinforcement of an alternate behavior decreased levels of inappropriate behavior. These findings further…

  16. Preparing direct care nurses to function as research coordinators in a heart failure study.

    Science.gov (United States)

    Trocky, Nina M

    2017-09-19

    Nurses interviewed heart failure patients admitted to two rural hospitals, to learn what was important to them concerning their disease. Data from this study would inform a subsequent heart failure intervention study. The researchers gained a better appreciation of the role of direct care nurses in research coordination, recruitment and data collection. To describe lessons learned during this research about using direct care nurses as research coordinators. The direct care nurses were highly motivated and engaged in the research, identifying barriers and solutions to enrolling heart failure patients in the hospital. The researchers developed customised educational materials and data management documents to address the nurses' learning needs, ensuring compliance with protocol and the safety of participants. Nurse researchers can establish an effective partnership with direct care nurses when conducting research studies. To accommodate learning needs and workplace demands, securing protected time for nurses to complete training, budgeting for administrative support and monitoring recruitment data weekly, as opposed to monthly, may be considered. Direct care nurses can inform the design and conduct of research conducted in a hospital. ©2012 RCN Publishing Company Ltd. All rights reserved. Not to be copied, transmitted or recorded in any way, in whole or part, without prior permission of the publishers.

  17. Free vibration analysis of a rotary smart two directional functionally graded piezoelectric material in axial symmetry circular nanoplate

    Science.gov (United States)

    Mahinzare, Mohammad; Ranjbarpur, Hosein; Ghadiri, Majid

    2018-02-01

    In this article, free vibration of a rotating circular nanoplate made of two directional functionally graded piezo materials (two directional FGPM) is modeled based on the first shear deformation theory (FSDT). Based on the power-law model, electro-elastic properties of two directional FGP rotating circular nanoplates are supposed to change continuously along the thickness and radius. Employing the modified couple stress theory, the small size effect of the equations of the plate is considered. The governing equations of the first shear deformation theory (FSDT) for the studied plate are obtained based on Hamilton's principle; these equations are solved using differential quadrature method (DQM). It is shown that the vibration behavior of the plate is significantly affected by angular velocity, external electric voltage, size dependency and power-law index (thickness and radial directions).

  18. Opportunities and challenges for direct C–H functionalization of piperazines

    Directory of Open Access Journals (Sweden)

    Zhishi Ye

    2016-04-01

    Full Text Available Piperazine ranks within the top three most utilized N-heterocyclic moieties in FDA-approved small-molecule pharmaceuticals. Herein we summarize the current synthetic methods available to perform C–H functionalization on piperazines in order to lend structural diversity to this privileged drug scaffold. Multiple approaches such as those involving α-lithiation trapping, transition-metal-catalyzed α-C–H functionalizations, and photoredox catalysis are discussed. We also highlight the difficulties experienced when successful methods for α-C–H functionalization of acyclic amines and saturated mono-nitrogen heterocyclic compounds (such as piperidines and pyrrolidines were applied to piperazine substrates.

  19. Quantitative determination of acidic groups in functionalized graphene by direct titration

    Czech Academy of Sciences Publication Activity Database

    Ederer, J.; Janoš, P.; Ecorchard, Petra; Štengl, Václav; Bělčická, Zuzana; Šťastný, Martin; Pop-Georgievski, Ognen; Dohnal, V.

    2016-01-01

    Roč. 103, JUN (2016), s. 44-53 ISSN 1381-5148 R&D Projects: GA ČR(CZ) GA14-05146S Institutional support: RVO:61388980 ; RVO:61389013 Keywords : Acid-base titration * Carboxylic functional groups * Graphene oxide * Phenolic functional groups * Proton-binding model Subject RIV: CA - Inorganic Chemistry ; CD - Macromolecular Chemistry (UMCH-V) Impact factor: 3.151, year: 2016

  20. Impact of transcranial direct current stimulation (tDCS) on neuronal functions

    NARCIS (Netherlands)

    Das, S. (Suman); P.J. Holland (Peter); M.A. Frens (Maarten); O. Donchin (Opher)

    2016-01-01

    textabstractTranscranial direct current stimulation (tDCS), a non-invasive brain stimulation technique, modulates neuronal excitability by the application of a small electrical current. The low cost and ease of the technique has driven interest in potential clinical applications. However, outcomes

  1. Direct and indirect spino-cerebellar pathways: shared ideas but different functions in motor control

    Directory of Open Access Journals (Sweden)

    Juan eJiang

    2015-07-01

    Full Text Available The impressive precision of mammalian limb movements relies on internal feedback pathways that convey information about ongoing motor output to cerebellar circuits. The spino-cerebellar tracts (SCT in the cervical, thoracic and lumbar spinal cord have long been considered canonical neural substrates for the conveyance of internal feedback signals. Here we consider the distinct features of an indirect spino-cerebellar route, via the brainstem lateral reticular nucleus (LRN, and the implications of this pre-cerebellar ‘detour’ for the execution and evolution of limb motor control. Both direct and indirect spino-cerebellar pathways signal spinal interneuronal activity to the cerebellum during movements, but evidence suggests that direct SCT neurons are mainly modulated by rhythmic activity, whereas the LRN also receives information from systems active during postural adjustment, reaching and grasping. Thus, while direct and indirect spino-cerebellar circuits can both be regarded as internal copy pathways, it seems likely that the direct system is principally dedicated to rhythmic motor acts like locomotion, while the indirect system also provides a means of pre-cerebellar integration relevant to the execution and coordination of de

  2. The law of distribution of light beam direction fluctuations in telescopes. [normal density functions

    Science.gov (United States)

    Divinskiy, M. L.; Kolchinskiy, I. G.

    1974-01-01

    The distribution of deviations from mean star trail directions was studied on the basis of 105 star trails. It was found that about 93% of the trails yield a distribution in agreement with the normal law. About 4% of the star trails agree with the Charlier distribution.

  3. Direct estimation of functionals of density operators by local operations and classical communication

    International Nuclear Information System (INIS)

    Alves, Carolina Moura; Horodecki, Pawel; Oi, Daniel K. L.; Kwek, L. C.; Ekert, Artur K.

    2003-01-01

    We present a method of direct estimation of important properties of a shared bipartite quantum state, within the ''distant laboratories'' paradigm, using only local operations and classical communication. We apply this procedure to spectrum estimation of shared states, and locally implementable structural physical approximations to incompletely positive maps. This procedure can also be applied to the estimation of channel capacity and measures of entanglement

  4. Functionalized ormosil scaffolds processed by direct laser polymerization for application in tissue engineering

    DEFF Research Database (Denmark)

    Matei, A.; Schou, Jørgen; Canulescu, Stela

    2013-01-01

    Synthesized N,N′-(methacryloyloxyethyl triehtoxy silyl propyl carbamoyl-oxyhexyl)-urea hybrid methacrylate was polymerized by direct laser polymerization using femtosecond laser pulses with the aim of using it for subsequent applications in tissue engineering. The as-obtained scaffolds were...

  5. Estimating the population size and colony boundary of subterranean termites by using the density functions of directionally averaged capture probability.

    Science.gov (United States)

    Su, Nan-Yao; Lee, Sang-Hee

    2008-04-01

    Marked termites were released in a linear-connected foraging arena, and the spatial heterogeneity of their capture probabilities was averaged for both directions at distance r from release point to obtain a symmetrical distribution, from which the density function of directionally averaged capture probability P(x) was derived. We hypothesized that as marked termites move into the population and given sufficient time, the directionally averaged capture probability may reach an equilibrium P(e) over the distance r and thus satisfy the equal mixing assumption of the mark-recapture protocol. The equilibrium capture probability P(e) was used to estimate the population size N. The hypothesis was tested in a 50-m extended foraging arena to simulate the distance factor of field colonies of subterranean termites. Over the 42-d test period, the density functions of directionally averaged capture probability P(x) exhibited four phases: exponential decline phase, linear decline phase, equilibrium phase, and postequilibrium phase. The equilibrium capture probability P(e), derived as the intercept of the linear regression during the equilibrium phase, correctly projected N estimates that were not significantly different from the known number of workers in the arena. Because the area beneath the probability density function is a constant (50% in this study), preequilibrium regression parameters and P(e) were used to estimate the population boundary distance 1, which is the distance between the release point and the boundary beyond which the population is absent.

  6. Direct and indirect effects of nutritional status, physical function and cognitive function on activities of daily living in Japanese older adults requiring long-term care.

    Science.gov (United States)

    Kamo, Tomohiko; Nishida, Yuusuke

    2014-10-01

    To identify the direct and indirect effects of nutritional status, physical function, and cognitive function on activities of daily living in Japanese older adults requiring long-term care. In total, 179 participants aged ≥ 65 years who were eligible for long-term care insurance (mean age 85.5 ± 7.8 years) were recruited for this study. Nutritional status (Mini Nutritional Assessment, Short Form) and physical function (Short Physical Performance Battery) were examined. Activities of daily living, cognitive function and frailty were assessed using the Barthel Index, Mini-Mental State Examination and Clinical Frailty Scale, respectively. Path analysis was used to determine relationships between these factors and the activities of daily living. For Japanese older adults requiring long-term care, pathways were modeled for nutritional status, physical function and the activities of daily living. The total effect of nutritional status was 0.516 (Pphysical function on the activities of daily living was 0.458 (Pphysical function in aged Japanese people requiring long-term care. These findings suggest that maintaining good nutritional status and nutritional support might delay physical function decline, and prolong the activities of daily living. © 2013 Japan Geriatrics Society.

  7. Directly writing resistor, inductor and capacitor to composite functional circuits: a super-simple way for alternative electronics.

    Directory of Open Access Journals (Sweden)

    Yunxia Gao

    Full Text Available BACKGROUND: The current strategies for making electronic devices are generally time, water, material and energy consuming. Here, the direct writing of composite functional circuits through comprehensive use of GaIn10-based liquid metal inks and matching material is proposed and investigated, which is a rather easy going and cost effective electronics fabrication way compared with the conventional approaches. METHODS: Owing to its excellent adhesion and electrical properties, the liquid metal ink was demonstrated as a generalist in directly making various basic electronic components such as planar resistor, inductor and capacitor or their combination and thus composing circuits with expected electrical functions. For a precise control of the geometric sizes of the writing, a mask with a designed pattern was employed and demonstrated. Mechanisms for justifying the chemical components of the inks and the magnitudes of the target electronic elements so as to compose various practical circuits were disclosed. RESULTS: Fundamental tests on the electrical components including capacitor and inductor directly written on paper with working time up to 48 h and elevated temperature demonstrated their good stability and potential widespread adaptability especially when used in some high frequency circuits. As the first proof-of-concept experiment, a typical functional oscillating circuit including an integrated chip of 74HC04 with a supply voltage of 5 V, a capacitor of 10 nF and two resistors of 5 kΩ and 1 kΩ respectively was directly composed on paper through integrating specific electrical elements together, which presented an oscillation frequency of 8.8 kHz. CONCLUSIONS: The present method significantly extends the roles of the metal ink in recent works serving as only a single electrical conductor or interconnecting wires. It opens the way for directly writing out complex functional circuits or devices on different substrates. Such circuit

  8. Directly writing resistor, inductor and capacitor to composite functional circuits: a super-simple way for alternative electronics.

    Science.gov (United States)

    Gao, Yunxia; Li, Haiyan; Liu, Jing

    2013-01-01

    The current strategies for making electronic devices are generally time, water, material and energy consuming. Here, the direct writing of composite functional circuits through comprehensive use of GaIn10-based liquid metal inks and matching material is proposed and investigated, which is a rather easy going and cost effective electronics fabrication way compared with the conventional approaches. Owing to its excellent adhesion and electrical properties, the liquid metal ink was demonstrated as a generalist in directly making various basic electronic components such as planar resistor, inductor and capacitor or their combination and thus composing circuits with expected electrical functions. For a precise control of the geometric sizes of the writing, a mask with a designed pattern was employed and demonstrated. Mechanisms for justifying the chemical components of the inks and the magnitudes of the target electronic elements so as to compose various practical circuits were disclosed. Fundamental tests on the electrical components including capacitor and inductor directly written on paper with working time up to 48 h and elevated temperature demonstrated their good stability and potential widespread adaptability especially when used in some high frequency circuits. As the first proof-of-concept experiment, a typical functional oscillating circuit including an integrated chip of 74HC04 with a supply voltage of 5 V, a capacitor of 10 nF and two resistors of 5 kΩ and 1 kΩ respectively was directly composed on paper through integrating specific electrical elements together, which presented an oscillation frequency of 8.8 kHz. The present method significantly extends the roles of the metal ink in recent works serving as only a single electrical conductor or interconnecting wires. It opens the way for directly writing out complex functional circuits or devices on different substrates. Such circuit composition strategy has generalized purpose and can be extended to more

  9. Direct observation of syringeal muscle function in songbirds and a parrot

    DEFF Research Database (Denmark)

    Larsen, Ole Næsbye; Goller, Franz

    2002-01-01

    on the syrinx. Contraction of m. tracheobronchialis ventralis enlarges the syringeal lumen and thus increases airflow by abducting the LL but does not affect the ML. The largest syringeal muscle, m. syringealis ventralis, plays a minor role, if any, in direct aperture control and thus in gating airflow...... the LTMs further into the tracheal lumen but does not close the syringeal aperture fully. The intrinsic deep muscle, m. syringealis profundus, abducts the LTMs through cranio-laterad movement of a paired, protruding half-ring. The weakly developed extrinsic m. sternotrachealis seems to increase tension......The role of syringeal muscles in controlling the aperture of the avian vocal organ, the syrinx, was evaluated directly for the first time by observing and filming through an endoscope while electrically stimulating different muscle groups of anaesthetised birds. In songbirds (brown thrashers...

  10. International Workshop on Electronic Density Functional Theory : Recent Progress and New Directions

    CERN Document Server

    Vignale, Giovanni; Das, Mukunda

    1998-01-01

    This book is an outcome of the International Workshop on Electronic Density Functional Theory, held at Griffith University in Brisbane, Australia, in July 1996. Density functional theory, standing as it does at the boundary between the disciplines of physics, chemistry, and materials science, is a great mixer. Invited experts from North America, Europe, and Australia mingled with students from several disciplines, rapidly taking up the informal style for which Australia is famous. A list of participants is given at the end of the book. Density functional theory (DFT) is a subtle approach to the very difficult problem of predicting the behavior of many interacting particles. A major application is the study of many-electron systems. This was the workshop theme, embracing inter alia computational chemistry and condensed matter physics. DFT circumvents the more conceptually straightforward (but more computationally intensive) approach in which one solves the many-body Schrodinger equation. It relies instead on r...

  11. Transcription Factor Networks Directing the Development, Function, and Evolution of Innate Lymphoid Effectors

    Science.gov (United States)

    Kang, Joonsoo; Malhotra, Nidhi

    2015-01-01

    Mammalian lymphoid immunity is mediated by fast and slow responders to pathogens. Fast innate lymphocytes are active within hours after infections in mucosal tissues. Slow adaptive lymphocytes are conventional T and B cells with clonal antigen receptors that function days after pathogen exposure. A transcription factor (TF) regulatory network guiding early T cell development is at the core of effector function diversification in all innate lymphocytes, and the kinetics of immune responses is set by developmental programming. Operational units within the innate lymphoid system are not classified by the types of pathogen-sensing machineries but rather by discrete effector functions programmed by regulatory TF networks. Based on the evolutionary history of TFs of the regulatory networks, fast effectors likely arose earlier in the evolution of animals to fortify body barriers, and in mammals they often develop in fetal ontogeny prior to the establishment of fully competent adaptive immunity. PMID:25650177

  12. Directing Spinal Cord Plasticity: The Impact of Stretch Therapy on Functional Recovery After SCI

    Science.gov (United States)

    2017-03-01

    Grand Rounds, University of Louisville. October 8, 2015 Of Mice and Men: The bench to bedside efforts to improve the quality of life of people with...Charts: Please see attached QUAD chart. Appendices: Please see links above to published journal articles . Appendices 1-4 to follow. Directing Spinal...represents the mean peak extension and flexion, respectively, of the joint angles – standard deviation, and thus bar length represents the mean angular

  13. About the constructive and functional particularities of spark ignition engines with gasoline direct injection: experimental results

    Science.gov (United States)

    Niculae, M.; Ivan, F.; Neacsu, D.

    2017-08-01

    The paper aims to analyze and compare the environmental performances between a gasoline direct engine and a multi-point injection engine. There are analyzed the stages of emission formation during the New European Driving Cycle. The paper points out the dynamic, economic and environmental performances of spark ignition engines equipped with a GDI systems. Reason why, we believe the widespread implementation of this technology is today an immediate need.

  14. R&D IN FUNCTION OF DIRECT PUBLIC SUPPORTS TO SMEs: AN EXPLORATORY STUDY IN TURKEY

    OpenAIRE

    Filiz Giray; Mehmet Çınar; Simla Güzel

    2015-01-01

    The globalization has increased the importance of research and development (R&D) activity and of technological advancements, especially in information and communication technologies. This case is valid for small and medium-sized enterprises (SMEs) which have taken a crucial place in all economies. Since R&D activities have high costs and public features, these activities cannot be carried out by firm, especially SMEs’ fiscal sources. Direct supports play a key-role in most countries. In re...

  15. Direct 4D reconstruction of parametric images incorporating anato-functional joint entropy.

    Science.gov (United States)

    Tang, Jing; Kuwabara, Hiroto; Wong, Dean F; Rahmim, Arman

    2010-08-07

    We developed an anatomy-guided 4D closed-form algorithm to directly reconstruct parametric images from projection data for (nearly) irreversible tracers. Conventional methods consist of individually reconstructing 2D/3D PET data, followed by graphical analysis on the sequence of reconstructed image frames. The proposed direct reconstruction approach maintains the simplicity and accuracy of the expectation-maximization (EM) algorithm by extending the system matrix to include the relation between the parametric images and the measured data. A closed-form solution was achieved using a different hidden complete-data formulation within the EM framework. Furthermore, the proposed method was extended to maximum a posterior reconstruction via incorporation of MR image information, taking the joint entropy between MR and parametric PET features as the prior. Using realistic simulated noisy [(11)C]-naltrindole PET and MR brain images/data, the quantitative performance of the proposed methods was investigated. Significant improvements in terms of noise versus bias performance were demonstrated when performing direct parametric reconstruction, and additionally upon extending the algorithm to its Bayesian counterpart using the MR-PET joint entropy measure.

  16. Screening of several excipients for direct compression of tablets: A new perspective based on functional properties

    Directory of Open Access Journals (Sweden)

    John Rojas

    2013-01-01

    Full Text Available Excipients are widely used to formulate solid drug forms by direct compression. However, the powderforming and tableting properties of these excipients are affected by the presence of lubricants and active ingredients. In this study, a screening methodology was employed to test the performance of an excipient for direct compression. The effects of three lubricants (magnesium stearate, stearic acid and talc on the compressibility and compaction of these excipients were assessed by the compressibility index and lubricant sensitivity ratio, respectively. Likewise, the dilution potential in blends with a poorly compactible drug such as acetaminophen was also assessed. Finally, the elastic recovery of tablets was evaluated five days after production. All lubricants increased the compressibility of these excipients and improved their flowability. However, hydrophobic lubricants such as magnesium stearate had a marked negative effect on compactibility, especially in plastic-deforming and more regularlyshaped materials with a smooth surface such as Starch 1500. Alginic acid, rice and cassava starches had the largest elastic recovery (>5%, indicating a tendency to cap. Moreover, highly plastic deforming materials such as sorbitol and polyvinylpyrrolidone (PVP-K30 exhibited the best dilution potential (~10%, whereas alginic acid showed a very high value (~70%. In terms of performance, sorbitol, PVP-K30, Avicel PH-101, sodium alginate and pregelatinized starch were the most appropriate excipients for the direct compression of drugs.

  17. Direct vs. indirect pathway of hepatic glycogen synthesis as a function of glucose infusion rate

    International Nuclear Information System (INIS)

    Bagby, G.J.; Lang, C.H.; Johnson, J.L.; Blakesly, H.L.; Spitzer, J.J.

    1986-01-01

    This study was initiated to determine the influence of the rate of exogenous glucose administration on liver glycogen synthesis by the direct (glucose uptake and incorporation into glycogen) vs the indirect pathway (glucose degradation to 3-carbon intermediates, e.g., lactate, prior to incorporation into glycogen). Catheterized rats were fasted 2 days prior to receiving a 3 hr infusion of glucose at rates of 0 to 230 μmol/min/kg containing tracer [6- 3 H]- and [U- 14 C]-glucose. Plasma glucose (r = 0.80), insulin (r = 0.90) and lactate (r = 0.84) were correlated with glucose infusion rate. The rate of liver glycogen deposition (0.46 +/- 0.03 μmol/min/g) did not differ between a glucose infusion rate of 20 and 230 μmol/min/kg. At the lowest and highest glucose infusion rates hepatic glycogenesis accounted for 87 +/- 6 and 9 +/- 1% of the total glucose load, respectively. The percent contribution of the direct pathways to glycogen deposition ([ 3 H] specific activity in hepatic glycogen/[ 3 H] specific activity in plasma glucose) increased from 16 +/- 3 to 83 +/- 5% from lowest to highest glucose infusion rates (prevailing plasma glucose concentrations: 9 +/- 1 and 21 +/- 2 mM, respectively). The results indicate that the relative contribution of the direct and indirect pathways of glucogen synthesis are dependent upon the glucose load or plasma glucose concentration

  18. Wigner functions for a class of semi-direct product groups

    International Nuclear Information System (INIS)

    Krasowska, Anna E; Ali, S Twareque

    2003-01-01

    Following a general method proposed earlier, we construct here Wigner functions defined on coadjoint orbits of a class of semidirect product groups. The groups in question are such that their unitary duals consist purely of representations from the discrete series and each unitary irreducible representation is associated with a coadjoint orbit. The set of all coadjoint orbits (hence UIRs) is finite and their union is dense in the dual of the Lie algebra. The simple structure of the groups and the orbits enables us to compute the various quantities appearing in the definition of the Wigner function explicitly. A large number of examples, with potential use in image analysis, is worked out

  19. Directing functional chemistries on micropatterned conducting polymers for all-polymer cell analysis microsystems

    DEFF Research Database (Denmark)

    Lind, Johan Ulrik; Daugaard, Anders Egede; Andresen, Thomas Lars

    Micrometer scale electrical circuits of PEDOT (poly(3,4-dioxythiophene)) were created by locally oxidizing PEDOT thin films with an agarose stamp containing the oxidizing agent NaOCl. The oxidized PEDOT was removed completely by applying detergents. The process was sufficiently mild that chemical...... groups on the underlying substrate, such as azides or alkynes, were preserved for subsequent specific functionalization. Moreover entire PMOXA (poly(2-methyl-2-oxazoline)) films preventing cell binding could be hidden below the PEDOT and be re-exposed upon stamping, allowing for cell capturing...... microelectrodes on a cell non-adhesive background. Chemically functionalized PEDOT types permitted the introduction of multiple additional types of micropatterned chemistry....

  20. Functional studies of elongation factor Tu from Escherichia coli : Site-directed mutagenesis and antibiotic action

    NARCIS (Netherlands)

    Krab, Ivo Maarten

    2001-01-01

    This PhD thesis describes several studies into the structure and function of Escherichia coli Elongation Factor Tu (EF-Tu). EF-Tu plays a central role in the bacterial protein synthesis machinery as the carrier of "coded building blocks" for protein synthesis, aminoacylated tRNA (aa-tRNA). Without

  1. Direct and Indirect Drivers of Moss Community Structure, Function, and Associated Microfauna Across a Successional Gradient

    Science.gov (United States)

    Micael Jonsson; Paul Kardol; Michael J. Gundale; Sheel Bansal; Marie-Charlotte Nilsson; Daniel B. Metcalfe; David A. Wardle

    2015-01-01

    Relative to vascular plants, little is known about what factors control bryophyte communities or how they respond to successional and environmental changes. Bryophytes are abundant in boreal forests, thus changes in moss community composition and functional traits (for example, moisture and nutrient content; rates of photosynthesis and respiration) may have important...

  2. The risk function approach to profit maximizing estimation in direct mailing

    NARCIS (Netherlands)

    Muus, Lars; Scheer, Hiek van der; Wansbeek, Tom

    1999-01-01

    When the parameters of the model describing consumers' reaction to a mailing are known, addresses for a future mailing can be selected in a profit-maximizing way. Usually, these parameters are unknown and are to be estimated. Standard estimation are based on a quadratic loss function. In the present

  3. Digital circuit in CλaSH: functional specifications and type-directed synthesis

    NARCIS (Netherlands)

    Baaij, C.P.R.

    2015-01-01

    Over the last three decades, the number of transistors used in microchips has increased by three orders of magnitude, from millions to billions. The productivity of the designers, however, lags behind. Managing to implement complex algorithms, while keeping non-functional properties within desired

  4. Satellite orbits perturbed by direct solar radiation pressure: general expansion of the disturbing function

    International Nuclear Information System (INIS)

    Hughes, S.

    1977-01-01

    An expression is derived for the solar radiation pressure disturbing function on an Earth satellite orbit which takes into account the variation of the solar radiation flux with distance from the Sun's centre and the absorption of radiation by the satellite. This expression is then expanded in terms of the Keplerian elements of the satellite and solar orbits using Kaula's method (Astr. J.; 67:300 (1962)). The Kaula inclination functions are replaced by an equivalent set of modified Allan (Proc. R. Soc. A.; 288:60 (1965)) inclination functions. The resulting expression reduces to the form commonly used in solar radiation pressure perturbation studies (e.g. Aksnes, Cel. Mech.; 13:89 (1976)), when certain terms are neglected. If, as happens quite often in practice, a satellite's orbit is in near-resonance with certain of these neglected terms, these near-resonant terms can cause changes in the satellite's orbital elements comparable to those produced by the largest term in Aksnes's expression. A new expression for the solar radiation pressure disturbing function expansion is suggested for use in future studies of satellite orbits perturbed by solar radiation pressure. (author)

  5. Direct assignment of molecular vibrations via normal mode analysis of the neutron dynamic pair distribution function technique

    International Nuclear Information System (INIS)

    Fry-Petit, A. M.; Sheckelton, J. P.; McQueen, T. M.; Rebola, A. F.; Fennie, C. J.; Mourigal, M.; Valentine, M.; Drichko, N.

    2015-01-01

    For over a century, vibrational spectroscopy has enhanced the study of materials. Yet, assignment of particular molecular motions to vibrational excitations has relied on indirect methods. Here, we demonstrate that applying group theoretical methods to the dynamic pair distribution function analysis of neutron scattering data provides direct access to the individual atomic displacements responsible for these excitations. Applied to the molecule-based frustrated magnet with a potential magnetic valence-bond state, LiZn 2 Mo 3 O 8 , this approach allows direct assignment of the constrained rotational mode of Mo 3 O 13 clusters and internal modes of MoO 6 polyhedra. We anticipate that coupling this well known data analysis technique with dynamic pair distribution function analysis will have broad application in connecting structural dynamics to physical properties in a wide range of molecular and solid state systems

  6. Direct and indirect effects of attention and visual function on gait impairment in Parkinson's disease: influence of task and turning.

    Science.gov (United States)

    Stuart, Samuel; Galna, Brook; Delicato, Louise S; Lord, Sue; Rochester, Lynn

    2017-07-01

    Gait impairment is a core feature of Parkinson's disease (PD) which has been linked to cognitive and visual deficits, but interactions between these features are poorly understood. Monitoring saccades allows investigation of real-time cognitive and visual processes and their impact on gait when walking. This study explored: (i) saccade frequency when walking under different attentional manipulations of turning and dual-task; and (ii) direct and indirect relationships between saccades, gait impairment, vision and attention. Saccade frequency (number of fast eye movements per-second) was measured during gait in 60 PD and 40 age-matched control participants using a mobile eye-tracker. Saccade frequency was significantly reduced in PD compared to controls during all conditions. However, saccade frequency increased with a turn and decreased under dual-task for both groups. Poorer attention directly related to saccade frequency, visual function and gait impairment in PD, but not controls. Saccade frequency did not directly relate to gait in PD, but did in controls. Instead, saccade frequency and visual function deficit indirectly impacted gait impairment in PD, which was underpinned by their relationship with attention. In conclusion, our results suggest a vital role for attention with direct and indirect influences on gait impairment in PD. Attention directly impacted saccade frequency, visual function and gait impairment in PD, with connotations for falls. It also underpinned indirect impact of visual and saccadic impairment on gait. Attention therefore represents a key therapeutic target that should be considered in future research. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  7. Functional Magnetic Resonance Imaging of Goal-Directed Reaching in Children with Autism Spectrum Disorders: A Feasibility Study

    Directory of Open Access Journals (Sweden)

    Nicole M. G. Salowitz

    2014-04-01

    Full Text Available An unanswered question concerning the neural basis of autism spectrum disorders (ASD is how sensorimotor deficits in individuals with ASD are related to abnormalities of brain function. We previously described a robotic joystick and video game system that allows us to record functional magnetic resonance images (FMRI while adult humans make goal-directed wrist motions. We anticipated several challenges in extending this approach to studying goal-directed behaviors in children with ASD and in typically developing (TYP children. In particular we were concerned that children with autism may express increased levels of anxiety as compared to typically developing children due to the loud sounds and small enclosed space of the MRI scanner. We also were concerned that both groups of children might become restless during testing, leading to an unacceptable amount of head movement. Here we performed a pilot study evaluating the extent to which autistic and typically developing children exhibit anxiety during our experimental protocol as well as their ability to comply with task instructions. Our experimental controls were successful in minimizing group differences in drop-out due to anxiety. Kinematic performance and head motion also were similar across groups. Both groups of children engaged cortical regions (frontal, parietal, temporal, occipital while making goal-directed movements. In addition, the ASD group exhibited task-related correlations in subcortical regions (cerebellum, thalamus, whereas correlations in the TYP group did not reach statistical significance in subcortical regions. Four distinct regions in frontal cortex showed a significant group difference such that TYP children exhibited positive correlations between the hemodynamic response and movement, whereas children with ASD exhibited negative correlations. These findings demonstrate feasibility of simultaneous application of robotic manipulation and functional imaging to study goal-directed

  8. Direct cortical hemodynamic mapping of somatotopy of pig nostril sensation by functional near-infrared cortical imaging (fNCI).

    Science.gov (United States)

    Uga, Minako; Saito, Toshiyuki; Sano, Toshifumi; Yokota, Hidenori; Oguro, Keiji; Rizki, Edmi Edison; Mizutani, Tsutomu; Katura, Takusige; Dan, Ippeita; Watanabe, Eiju

    2014-05-01

    Functional near-infrared spectroscopy (fNIRS) is a neuroimaging technique for the noninvasive monitoring of human brain activation states utilizing the coupling between neural activity and regional cerebral hemodynamics. Illuminators and detectors, together constituting optodes, are placed on the scalp, but due to the presence of head tissues, an inter-optode distance of more than 2.5cm is necessary to detect cortical signals. Although direct cortical monitoring with fNIRS has been pursued, a high-resolution visualization of hemodynamic changes associated with sensory, motor and cognitive neural responses directly from the cortical surface has yet to be realized. To acquire robust information on the hemodynamics of the cortex, devoid of signal complications in transcranial measurement, we devised a functional near-infrared cortical imaging (fNCI) technique. Here we demonstrate the first direct functional measurement of temporal and spatial patterns of cortical hemodynamics using the fNCI technique. For fNCI, inter-optode distance was set at 5mm, and light leakage from illuminators was prevented by a special optode holder made of a light-shielding rubber sheet. fNCI successfully detected the somatotopy of pig nostril sensation, as assessed in comparison with concurrent and sequential somatosensory-evoked potential (SEP) measurements on the same stimulation sites. Accordingly, the fNCI system realized a direct cortical hemodynamic measurement with a spatial resolution comparable to that of SEP mapping on the rostral region of the pig brain. This study provides an important initial step toward realizing functional cortical hemodynamic monitoring during neurosurgery of human brains. Copyright © 2014. Published by Elsevier Inc.

  9. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    Energy Technology Data Exchange (ETDEWEB)

    Kowalewski, Markus, E-mail: mkowalew@uci.edu; Mukamel, Shaul, E-mail: smukamel@uci.edu [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States)

    2015-07-28

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings.

  10. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    International Nuclear Information System (INIS)

    Kowalewski, Markus; Mukamel, Shaul

    2015-01-01

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings

  11. Directed assembly of functional light harvesting antenna complexes onto chemically patterned surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Escalante, Maryana [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Maury, Pascale [Molecular Nanofabrication Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Bruinink, Christiaan M [Molecular Nanofabrication Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Werf, Kees van der [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Olsen, John D [Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN (United Kingdom); Timney, John A [Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN (United Kingdom); Huskens, Jurriaan [Molecular Nanofabrication Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Hunter, C Neil [Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN (United Kingdom); Subramaniam, Vinod [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Otto, Cees [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands)

    2008-01-16

    We report the directed assembly of the photosynthetic membrane proteins LH1 and LH2 isolated from the purple bacterium Rhodobacter sphaeroides onto chemically patterned substrates. Nanoimprint lithography was used to pattern discrete regions of amino- and fluoro-terminated or poly(ethylene glycol) self-assembled monolayers onto a glass substrate. Densely packed layers of assembled protein complexes were observed with atomic force microscopy. The protein complexes attached selectively to the amino-terminated regions by electrostatic interactions. Spectral images generated with a hybrid scanning probe and fluorescence microscope confirmed that the patterned proteins retained their native optical signatures.

  12. Directed assembly of functional light harvesting antenna complexes onto chemically patterned surfaces

    International Nuclear Information System (INIS)

    Escalante, Maryana; Maury, Pascale; Bruinink, Christiaan M; Werf, Kees van der; Olsen, John D; Timney, John A; Huskens, Jurriaan; Hunter, C Neil; Subramaniam, Vinod; Otto, Cees

    2008-01-01

    We report the directed assembly of the photosynthetic membrane proteins LH1 and LH2 isolated from the purple bacterium Rhodobacter sphaeroides onto chemically patterned substrates. Nanoimprint lithography was used to pattern discrete regions of amino- and fluoro-terminated or poly(ethylene glycol) self-assembled monolayers onto a glass substrate. Densely packed layers of assembled protein complexes were observed with atomic force microscopy. The protein complexes attached selectively to the amino-terminated regions by electrostatic interactions. Spectral images generated with a hybrid scanning probe and fluorescence microscope confirmed that the patterned proteins retained their native optical signatures

  13. A direct method to transform between expansions in the configuration state function and Slater determinant bases

    International Nuclear Information System (INIS)

    Olsen, Jeppe

    2014-01-01

    A novel algorithm is introduced for the transformation of wave functions between the bases of Slater determinants (SD) and configuration state functions (CSF) in the genealogical coupling scheme. By modifying the expansion coefficients as each electron is spin-coupled, rather than performing a single many-electron transformation, the large transformation matrix that plagues previous approaches is avoided and the required number of operations is drastically reduced. As an example of the efficiency of the algorithm, the transformation for a configuration with 30 unpaired electrons and singlet spin is discussed. For this case, the 10 × 10 6 coefficients in the CSF basis is obtained from the 150 × 10 6 coefficients in the SD basis in 1 min, which should be compared with the seven years that the previously employed method is estimated to require

  14. Direct α-C-H bond functionalization of unprotected cyclic amines

    Science.gov (United States)

    Chen, Weijie; Ma, Longle; Paul, Anirudra; Seidel, Daniel

    2018-02-01

    Cyclic amines are ubiquitous core structures of bioactive natural products and pharmaceutical drugs. Although the site-selective abstraction of C-H bonds is an attractive strategy for preparing valuable functionalized amines from their readily available parent heterocycles, this approach has largely been limited to substrates that require protection of the amine nitrogen atom. In addition, most methods rely on transition metals and are incompatible with the presence of amine N-H bonds. Here we introduce a protecting-group-free approach for the α-functionalization of cyclic secondary amines. An operationally simple one-pot procedure generates products via a process that involves intermolecular hydride transfer to generate an imine intermediate that is subsequently captured by a nucleophile, such as an alkyl or aryl lithium compound. Reactions are regioselective and stereospecific and enable the rapid preparation of bioactive amines, as exemplified by the facile synthesis of anabasine and (-)-solenopsin A.

  15. A functionalized superparamagnetic iron oxide colloid as a receptor directed MR contrast agent

    International Nuclear Information System (INIS)

    Josephson, L.; Groman, E.V.; Menz, E.; Lewis, J.M.; Bengele, H.

    1990-01-01

    We have synthesized a surface functionalized superparamagnetic iron oxide colloid whose clearance from the vascular compartment was inhibited by asialofetuin but not fetuin. Unlike other particulate or colloidal magnetic resonance (MR) contrast agents, the agent of the current communication is not withdrawn from the vascular compartment by cells of the macrophage-monocyte phagocytic system, as indicated by its selective increase in hepatic relaxation rates. Because of this we refer to this colloid as a hepatic selective (HS) MR contrast agent. At 20 mumol Fe/kg the HS MR agent darkened MR images of liver. The HS MR agent exhibited no acute toxicity when injected into rats at 1800 mumol Fe/kg. Based on these observations, surface functionalized superparamagnetic iron oxide colloids may be the basis of MR contrast agents internalized by receptor mediated endocytosis generally, and by the asialoglycoprotein receptor in particular

  16. New class of filter functions generated most directly by Christoffel-Darboux formula for Gegenbauer orthogonal polynomials

    Science.gov (United States)

    Ilić, Aleksandar D.; Pavlović, Vlastimir D.

    2011-01-01

    A new original formulation of all pole low-pass filter functions is proposed in this article. The starting point in solving the approximation problem is a direct application of the Christoffel-Darboux formula for the set of orthogonal polynomials, including Gegenbauer orthogonal polynomials in the finite interval [-1, +1] with the application of a weighting function with a single free parameter. A general solution for the filter functions is obtained in a compact explicit form, which is shown to enable generation of the Gegenbauer filter functions in a simple way by choosing the value of the free parameter. Moreover, the proposed solution with the same criterion of approximation could be used to generate Legendre and Chebyshev filter functions of the first and second kind as well. The examples of proposed filter functions of even (10th) and odd (11th) order are illustrated. The approximation is shown to yield a good compromise solution with respect to the filter frequency characteristics (magnitude as well as phase characteristics). The influence of tolerance of the filter critical component (inductor) on the proposed magnitude and group delay characteristics of a resistively terminated LC lossless ladder filter is analysed as well. The proposed filter functions are superior in terms of the excellent magnitude characteristic, which approximates an ideal filter almost perfectly over the entire pass-band range and exhibits the summed sensitivity function better than that of a Butterworth filter. In the article, we present the filter function solution that exhibits optimum amplitude as well as optimum group delay characteristics that are of crucial importance for implementation of digital processing as well as RF analogue parts of communication networks. Derivation of the other band range filter functions, which could be realised either by continuous or digital filters, is also generally possible with the procedure proposed in this article.

  17. Functional integration processes underlying the instruction-based learning of novel goal-directed behaviors.

    Science.gov (United States)

    Ruge, Hannes; Wolfensteller, Uta

    2013-03-01

    How does the human brain translate symbolic instructions into overt behavior? Previous studies suggested that this process relies on a rapid control transition from the lateral prefrontal cortex (LPFC) to the anterior striatum (aSTR) and premotor cortex (PMC). The present fMRI study investigated whether the transfer from symbolic to pragmatic stimulus-response (S-R) rules relies on changes in the functional coupling among these and other areas and to which extent action goal representations might get integrated within this symbolic-pragmatic transfer. Goal integration processes were examined by manipulating the contingency between actions and differential outcomes (i.e. action goals). We observed a rapid strengthening of the functional coupling between the LPFC and the basal ganglia (aSTR and putamen) and orbitofrontal cortex (OFC) as well as between the LPFC and the anterior dorsal PMC (pre-PMd), the anterior inferior parietal lobule (aIPL), and the posterior superior parietal lobule (pSPL). Importantly, only some of these functional integration processes were sensitive to the outcome contingency manipulation, including LPFC couplings with aSTR, OFC, aIPL, and pre-PMd. This suggests that the symbolic-pragmatic rule transfer is governed by principles of both, instrumental learning (increasingly tighter coupling between LPFC and aSTR/OFC) and ideomotor learning (increasingly tighter coupling between LPFC and aIPL/pre-PMd). By contrast, increased functional coupling between LPFC and putamen was insensitive to outcome contingency possibly indicating an early stage of habit formation under instructed learning conditions. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Group B streptococcal beta-hemolysin/cytolysin directly impairs cardiomyocyte viability and function.

    Directory of Open Access Journals (Sweden)

    Mary E Hensler

    Full Text Available BACKGROUND: Group B Streptococcus (GBS is a leading cause of neonatal sepsis where myocardial dysfunction is an important contributor to poor outcome. Here we study the effects of the GBS pore-forming beta-hemolysin/cytolysin (Bh/c exotoxin on cardiomyocyte viability, contractility, and calcium transients. METHODOLOGY/PRINCIPAL FINDINGS: HL-1 cardiomyocytes exposed to intact wild-type (WT or isogenic Deltabeta h/c mutant GBS, or to cell-free extracts from either strain, were assessed for viability by trypan blue exclusion and for apoptosis by TUNEL staining. Functionality of exposed cardiomyocytes was analyzed by visual quantitation of the rate and extent of contractility. Mitochondrial membrane polarization was measured in TMRE-loaded cells exposed to GBS beta h/c. Effects of GBS beta h/c on calcium transients were studied in fura-2AM-loaded primary rat ventricular cardiomyocytes. Exposure of HL-1 cardiomyocytes to either WT GBS or beta h/c extracts significantly reduced both rate and extent of contractility and later induced necrotic and apoptotic cell death. No effects on cardiomyocyte viability or function were observed after treatment with Deltabeta h/c mutant bacteria or extracts. The beta h/c toxin was associated with complete and rapid loss of detectable calcium transients in primary neonatal rat ventricular cardiomyocytes and induced a loss of mitochondrial membrane polarization. These effects on viability and function were abrogated by the beta h/c inhibitor, dipalmitoyl phosphatidylcholine (DPPC. CONCLUSIONS/SIGNIFICANCE: Our data show a rapid loss of cardiomyocyte viability and function induced by GBS beta h/c, and these deleterious effects are inhibited by DPPC, a normal constituent of human pulmonary surfactant.. These findings have clinical implications for the cardiac dysfunction observed in neonatal GBS infections.

  19. Autobiographically recalled emotional states impact forward gait initiation as a function of motivational direction.

    Science.gov (United States)

    Fawver, Bradley; Hass, Chris J; Park, Kyoungshin D; Janelle, Christopher M

    2014-12-01

    The impact of self-generated affective states on self-initiated motor behavior remains unspecified. The purpose of the current study was to determine how self-generated emotional states impact forward gait initiation. Participants recalled past emotional experiences (anger, fear, happy, sad, and neutral), "relived" those emotional memories before gait initiation (GI), and then walked ∼4 m across the laboratory floor. Kinetic and kinematic data revealed GI characteristics consistent with a motivational direction hypothesis. Specifically, participants produced greater posterior-lateral displacement and velocity of their center of pressure (COP) during the initial phase of GI after self-generation of happy and anger emotional states relative to sad ones. During the second phase of GI, greater medial displacement of COP was found during the happy condition compared with sad, greater velocity was occasioned during happy and angry trials compared with sad, and greater velocity was exhibited after happy compared with fear memories. Finally, greater anterior velocity was produced by participants during the final phase of GI for happy and angry memories compared with sad ones. Steady state kinetic and kinematic data when recalling happy and angry memories (longer, faster, and more forceful stepping behavior) followed the anticipatory postural adjustments noted during GI. Together the results from GI and steady state gait provide robust evidence that self-generated emotional states impact forward gait behavior based on motivational direction. Endogenous manipulations of emotional states hold promise for clinical and performance interventions aimed at improving self-initiated movement.

  20. A Review on Adducin from Functional to Pathological Mechanisms: Future Direction in Cancer

    Directory of Open Access Journals (Sweden)

    Karrie Mei-Yee Kiang

    2018-01-01

    Full Text Available Adducin (ADD is a family of membrane skeleton proteins including ADD1, ADD2, and ADD3 that are encoded by distinct genes on different chromosomes. Adducin is primarily responsible for the assembly of spectrin-actin network that provides physical support to the plasma membrane and mediates signal transduction in various cellular physiological processes upon regulation by protein kinase C-dependent and calcium/calmodulin-dependent pathways. Abnormal phosphorylation, genetic variations, and alternative splicing of adducin may contribute to alterations in cellular functions involved in pathogenic processes. These alterations are associated with a wide range of diseases including cancer. This paper begins with a discussion on how adducin partakes in the structural formation of membrane skeleton, its regulation, and related functional characteristics, followed by a review on the pathogenesis of hypertension, biliary atresia, and cancer with respect to increased disease susceptibility mediated by adducin polymorphism and/or dysregulation. Given the functional diversity of adducin in different cellular compartments, we aim to provide a knowledge base whereby its pathophysiological roles can be better understood. More importantly, we aim to provide novel insights that may be of significance in turning the adducin model to clinical application.

  1. Direct localization of poles of a meromorphic function from measurements on an incomplete boundary

    Science.gov (United States)

    Nara, Takaaki; Ando, Shigeru

    2010-01-01

    This paper proposes an algebraic method to reconstruct the positions of multiple poles in a meromorphic function field from measurements on an arbitrary simple arc in it. A novel issue is the exactness of the algorithm depending on whether the arc is open or closed, and whether it encloses or does not enclose the poles. We first obtain a differential equation that can equivalently determine the meromorphic function field. From it, we derive linear equations that relate the elementary symmetric polynomials of the pole positions to weighted integrals of the field along the simple arc and end-point terms of the arc when it is an open one. Eliminating the end-point terms based on an appropriate choice of weighting functions and a combination of the linear equations, we obtain a simple system of linear equations for solving the elementary symmetric polynomials. We also show that our algorithm can be applied to a 2D electric impedance tomography problem. The effects of the proximity of the poles, the number of measurements and noise on the localization accuracy are numerically examined.

  2. Fabrication of multi-functional silicon surface by direct laser writing

    Science.gov (United States)

    Verma, Ashwani Kumar; Soni, R. K.

    2018-05-01

    We present a simple, quick and one-step methodology based on nano-second laser direct writing for the fabrication of micro-nanostructures on silicon surface. The fabricated surfaces suppress the optical reflection by multiple reflection due to light trapping effect to a much lower value than polished silicon surface. These textured surfaces offer high enhancement ability after gold nanoparticle deposition and then explored for Surface Enhanced Raman Scattering (SERS) for specific molecular detection. The effect of laser scanning line interval on optical reflection and SERS signal enhancement ability was also investigated. Our results indicate that low optical reflection substrates exhibit uniform SERS enhancement with enhancement factor of the order of 106. Furthermore, this methodology provide an alternative approach for cost-effective large area fabrication with good control over feature size.

  3. Differential Toxicity of mDia Formin-Directed Functional Agonists and Antagonists in Developing Zebrafish

    Directory of Open Access Journals (Sweden)

    Hunter LeCorgne

    2018-04-01

    Full Text Available The mammalian Diaphanous-related (mDia formins are cytoskeletal regulators that assemble and, in some cases, bundle filamentous actin (F-actin, as well as stabilize microtubules. The development of small molecule antagonists and agonists that interrogate mDia formin function has allowed us to investigate the roles of formins in disease states. A small molecule inhibitor of FH2 domain (SMIFH2 inhibits mDia-dependent actin dynamics and abrogates tumor cell migration and cell division in vitro and ex vivo tissue explants. mDia formin activation with small molecule intramimics IMM01/02 and mDia2-DAD peptides inhibited glioblastoma motility and invasion in vitro and ex vivo rat brain slices. However, SMIFH2, IMMs, and mDia2 DAD efficacy in vivo remains largely unexplored and potential toxicity across a range of developmental phenotypes has not been thoroughly characterized. In this study, we performed an in vivo screen of early life-stage toxicity in Danio rerio zebrafish embryos 2 days post-fertilization (dpf in response to SMIFH2, IMM01/02, and mDia2 DAD. SMIFH2 at concentrations ≥5–10 μM induced significant defects in developing zebrafish, including shorter body lengths, tail curvature and defective tail cellularity, craniofacial malformations, pericardial edema, absent and/or compromised vasculature function and flow, depressed heart rates and increased mortality. Conversely, IMM and mDia2 DAD peptides were minimally toxic at concentrations up to 10–20 and 50 μM, respectively. SMIFH2's therapeutic potential may therefore be limited by its substantial in vivo toxicity at functional concentrations. mDia formin agonism with IMMs and mDia2 DADs may therefore be a more effective and less toxic anti-invasive therapeutic approach.

  4. Direct electrochemistry and electrocatalysis of lobetyolin via magnetic functionalized reduced graphene oxide film fabricated electrochemical sensor

    International Nuclear Information System (INIS)

    Sun, Bolu; Gou, Xiaodan; Bai, Ruibin; Abdelmoaty, Ahmed Attia Ahmed; Ma, Yuling; Zheng, Xiaoping; Hu, Fangdi

    2017-01-01

    A novel lobetyolin electrochemical sensor based on a magnetic functionalized reduced graphene oxide/Nafion nanohybrid film has been introduced in this work. The magnetic functionalized reduced graphene oxide was characterized by fourier transform infrared spectroscopy, atomic force microscope, X-ray diffraction, transmission electron microscopy and thermogravimetric analysis. The scanning electron microscopy characterized the morphology and microstructure of the prepared sensors, and the electrochemical effective surface areas of the prepared sensors were also calculated by chronocoulometry method. The electrochemical behavior of lobetyolin on the magnetic functionalized reduced graphene oxide/Nafion nanohybrid modified glassy carbon electrode was investigated by cyclic voltammetry and differential pulse voltammetry in a phosphate buffer solution of pH 6.0. The electron-transfer coefficient (α), electron transfer number (n), and electrode reaction rate constant (Κs) were calculated as 0.78, 0.73, and 4.63 s −1 , respectively. Under the optimized conditions, the sensor based on magnetic functionalized reduced graphene oxide/Nafion showed a linear voltammetric response to the lobetyolin concentration at 1.0 × 10 −7 to 1.0 × 10 −4 mol/L with detection limit (S/N = 3)of 4.3 × 10 −8 mol/L. The proposed sensor also displayed acceptable reproducibility, long-term stability, and high selectivity, and performs well for analysis of lobetyolin in real samples. The voltammetric sensor was successfully applied to detect lobetyolin in Codonopsis pilosula with recovery values in the range of 96.12% –102.66%. - Graphical abstract: Schematic diagram of the synthesis of MrGO hybrid and the fabrication process of the MrGO/Nafion/GCE for determination of lobetyolin. Display Omitted - Highlights: • The MrGO/Nafion@GCE electrochemical sensor was successfully fabricated. • The prepared MrGO was characterized by AFM, XRD, FTIR, VSM, TEM and SEM. • The proposed

  5. Direct electrochemistry and electrocatalysis of lobetyolin via magnetic functionalized reduced graphene oxide film fabricated electrochemical sensor

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Bolu [School of Pharmacy, Lanzhou University, Lanzhou 730000 (China); Gou, Xiaodan [School of Chemistry and Chemical Engineering, Nanjing University, 210046 (China); Bai, Ruibin; Abdelmoaty, Ahmed Attia Ahmed; Ma, Yuling; Zheng, Xiaoping [School of Pharmacy, Lanzhou University, Lanzhou 730000 (China); Hu, Fangdi, E-mail: hufd@lzu.edu.cn [School of Pharmacy, Lanzhou University, Lanzhou 730000 (China)

    2017-05-01

    A novel lobetyolin electrochemical sensor based on a magnetic functionalized reduced graphene oxide/Nafion nanohybrid film has been introduced in this work. The magnetic functionalized reduced graphene oxide was characterized by fourier transform infrared spectroscopy, atomic force microscope, X-ray diffraction, transmission electron microscopy and thermogravimetric analysis. The scanning electron microscopy characterized the morphology and microstructure of the prepared sensors, and the electrochemical effective surface areas of the prepared sensors were also calculated by chronocoulometry method. The electrochemical behavior of lobetyolin on the magnetic functionalized reduced graphene oxide/Nafion nanohybrid modified glassy carbon electrode was investigated by cyclic voltammetry and differential pulse voltammetry in a phosphate buffer solution of pH 6.0. The electron-transfer coefficient (α), electron transfer number (n), and electrode reaction rate constant (Κs) were calculated as 0.78, 0.73, and 4.63 s{sup −1}, respectively. Under the optimized conditions, the sensor based on magnetic functionalized reduced graphene oxide/Nafion showed a linear voltammetric response to the lobetyolin concentration at 1.0 × 10{sup −7} to 1.0 × 10{sup −4} mol/L with detection limit (S/N = 3)of 4.3 × 10{sup −8} mol/L. The proposed sensor also displayed acceptable reproducibility, long-term stability, and high selectivity, and performs well for analysis of lobetyolin in real samples. The voltammetric sensor was successfully applied to detect lobetyolin in Codonopsis pilosula with recovery values in the range of 96.12% –102.66%. - Graphical abstract: Schematic diagram of the synthesis of MrGO hybrid and the fabrication process of the MrGO/Nafion/GCE for determination of lobetyolin. Display Omitted - Highlights: • The MrGO/Nafion@GCE electrochemical sensor was successfully fabricated. • The prepared MrGO was characterized by AFM, XRD, FTIR, VSM, TEM and SEM.

  6. State of the Art in Transfer Functions for Direct Volume Rendering

    KAUST Repository

    Ljung, Patric; Krü ger, Jens; Groller, Eduard; Hadwiger, Markus; Hansen, Charles D.; Ynnerman, Anders

    2016-01-01

    A central topic in scientific visualization is the transfer function (TF) for volume rendering. The TF serves a fundamental role in translating scalar and multivariate data into color and opacity to express and reveal the relevant features present in the data studied. Beyond this core functionality, TFs also serve as a tool for encoding and utilizing domain knowledge and as an expression for visual design of material appearances. TFs also enable interactive volumetric exploration of complex data. The purpose of this state-of-the-art report (STAR) is to provide an overview of research into the various aspects of TFs, which lead to interpretation of the underlying data through the use of meaningful visual representations. The STAR classifies TF research into the following aspects: dimensionality, derived attributes, aggregated attributes, rendering aspects, automation, and user interfaces. The STAR concludes with some interesting research challenges that form the basis of an agenda for the development of next generation TF tools and methodologies. © 2016 The Author(s) Computer Graphics Forum © 2016 The Eurographics Association and John Wiley & Sons Ltd. Published by John Wiley & Sons Ltd.

  7. Construction of a fucoidan/laminin functional multilayer to direction vascular cell fate and promotion hemocompatibility

    International Nuclear Information System (INIS)

    Ye, Changrong; Wang, Yan; Su, Hong; Yang, Ping; Huang, Nan; Maitz, Manfred F.; Zhao, Anshan

    2016-01-01

    Surface biofunctional modification of cardiovascular stents is a versatile approach to reduce the adverse effects after implantation. In this work, a novel multifunctional coating was fabricated by coimmobilization of the sulfated polysaccharide of brown algae fucoidan and laminin to biomimic the vascular intimal conditions in order to support rapid endothelialization, prevent restenosis and improve hemocompatibility. The surface properties of the coating such as hydrophilicity, bonding density of biomolecules and stability were evaluated and optimized. According to the biocompatibility tests, the fucoidan/laminin multilayer coated surface displayed less platelet adhesion with favorable anticoagulant property. In addition, the fucoidan/laminin complex showed function to selectively regulate vascular cells growth behavior. The proliferation of endothelial cells (ECs) on the fucoidan/laminin biofunctional coating was significantly promoted. For the smooth muscle cells (SMCs), inhibitory effects on cell adhesion and proliferation were observed. In conclusion, the fucoidan/laminin biofunctional coating was successfully fabricated with desirable anticoagulant and endothelialization properties which show a promising application in the vascular devices such as vascular stents or grafts surface modification. - Highlights: • Construction of fucoidan/laminin functional multilayer to biomimic the basement membrane of vascular • The fucoidan/laminin complex demonstrates anti-coagulation property. • The fucoidan/laminin complex can selectively regulate EC and SMC growth behavior to prevent restenosis.

  8. Construction of a fucoidan/laminin functional multilayer to direction vascular cell fate and promotion hemocompatibility

    Energy Technology Data Exchange (ETDEWEB)

    Ye, Changrong; Wang, Yan; Su, Hong; Yang, Ping; Huang, Nan [Key Laboratory of Advanced Materials Technology of Ministry of Education, Department of Materials Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Maitz, Manfred F. [Leibniz Institute of Polymer Research Dresden, Max Bergmann Center of Biomaterials Dresden, Dresden 01069 (Germany); Zhao, Anshan [Key Laboratory of Advanced Materials Technology of Ministry of Education, Department of Materials Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China)

    2016-07-01

    Surface biofunctional modification of cardiovascular stents is a versatile approach to reduce the adverse effects after implantation. In this work, a novel multifunctional coating was fabricated by coimmobilization of the sulfated polysaccharide of brown algae fucoidan and laminin to biomimic the vascular intimal conditions in order to support rapid endothelialization, prevent restenosis and improve hemocompatibility. The surface properties of the coating such as hydrophilicity, bonding density of biomolecules and stability were evaluated and optimized. According to the biocompatibility tests, the fucoidan/laminin multilayer coated surface displayed less platelet adhesion with favorable anticoagulant property. In addition, the fucoidan/laminin complex showed function to selectively regulate vascular cells growth behavior. The proliferation of endothelial cells (ECs) on the fucoidan/laminin biofunctional coating was significantly promoted. For the smooth muscle cells (SMCs), inhibitory effects on cell adhesion and proliferation were observed. In conclusion, the fucoidan/laminin biofunctional coating was successfully fabricated with desirable anticoagulant and endothelialization properties which show a promising application in the vascular devices such as vascular stents or grafts surface modification. - Highlights: • Construction of fucoidan/laminin functional multilayer to biomimic the basement membrane of vascular • The fucoidan/laminin complex demonstrates anti-coagulation property. • The fucoidan/laminin complex can selectively regulate EC and SMC growth behavior to prevent restenosis.

  9. State of the Art in Transfer Functions for Direct Volume Rendering

    KAUST Repository

    Ljung, Patric

    2016-07-04

    A central topic in scientific visualization is the transfer function (TF) for volume rendering. The TF serves a fundamental role in translating scalar and multivariate data into color and opacity to express and reveal the relevant features present in the data studied. Beyond this core functionality, TFs also serve as a tool for encoding and utilizing domain knowledge and as an expression for visual design of material appearances. TFs also enable interactive volumetric exploration of complex data. The purpose of this state-of-the-art report (STAR) is to provide an overview of research into the various aspects of TFs, which lead to interpretation of the underlying data through the use of meaningful visual representations. The STAR classifies TF research into the following aspects: dimensionality, derived attributes, aggregated attributes, rendering aspects, automation, and user interfaces. The STAR concludes with some interesting research challenges that form the basis of an agenda for the development of next generation TF tools and methodologies. © 2016 The Author(s) Computer Graphics Forum © 2016 The Eurographics Association and John Wiley & Sons Ltd. Published by John Wiley & Sons Ltd.

  10. Different alterations in brain functional networks according to direct and indirect topological connections in patients with schizophrenia.

    Science.gov (United States)

    Park, Chang-Hyun; Lee, Seungyup; Kim, Taewon; Won, Wang Yeon; Lee, Kyoung-Uk

    2017-10-01

    Schizophrenia displays connectivity deficits in the brain, but the literature has shown inconsistent findings about alterations in global efficiency of brain functional networks. We supposed that such inconsistency at the whole brain level may be due to a mixture of different portions of global efficiency at sub-brain levels. Accordingly, we considered measuring portions of global efficiency in two aspects: spatial portions by considering sub-brain networks and topological portions by considering contributions to global efficiency according to direct and indirect topological connections. We proposed adjacency and indirect adjacency as new network parameters attributable to direct and indirect topological connections, respectively, and applied them to graph-theoretical analysis of brain functional networks constructed from resting state fMRI data of 22 patients with schizophrenia and 22 healthy controls. Group differences in the network parameters were observed not for whole brain and hemispheric networks, but for regional networks. Alterations in adjacency and indirect adjacency were in opposite directions, such that adjacency increased, but indirect adjacency decreased in patients with schizophrenia. Furthermore, over connections in frontal and parietal regions, increased adjacency was associated with more severe negative symptoms, while decreased adjacency was associated with more severe positive symptoms of schizophrenia. This finding indicates that connectivity deficits associated with positive and negative symptoms of schizophrenia may involve topologically different paths in the brain. In patients with schizophrenia, although changes in global efficiency may not be clearly shown, different alterations in brain functional networks according to direct and indirect topological connections could be revealed at the regional level. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Direct 3D cell-printing of human skin with functional transwell system.

    Science.gov (United States)

    Kim, Byoung Soo; Lee, Jung-Seob; Gao, Ge; Cho, Dong-Woo

    2017-06-06

    Three-dimensional (3D) cell-printing has been emerging as a promising technology with which to build up human skin models by enabling rapid and versatile design. Despite the technological advances, challenges remain in the development of fully functional models that recapitulate complexities in the native tissue. Moreover, although several approaches have been explored for the development of biomimetic human skin models, the present skin models based on multistep fabrication methods using polydimethylsiloxane chips and commercial transwell inserts could be tackled by leveraging 3D cell-printing technology. In this paper, we present a new 3D cell-printing strategy for engineering a 3D human skin model with a functional transwell system in a single-step process. A hybrid 3D cell-printing system was developed, allowing for the use of extrusion and inkjet modules at the same time. We began by revealing the significance of each module in engineering human skin models; by using the extrusion-dispensing module, we engineered a collagen-based construct with polycaprolactone (PCL) mesh that prevented the contraction of collagen during tissue maturation; the inkjet-based dispensing module was used to uniformly distribute keratinocytes. Taking these features together, we engineered a human skin model with a functional transwell system; the transwell system and fibroblast-populated dermis were consecutively fabricated by using the extrusion modules. Following this process, keratinocytes were uniformly distributed onto the engineered dermis by the inkjet module. Our transwell system indicates a supportive 3D construct composed of PCL, enabling the maturation of a skin model without the aid of commercial transwell inserts. This skin model revealed favorable biological characteristics that included a stabilized fibroblast-stretched dermis and stratified epidermis layers after 14 days. It was also observed that a 50 times reduction in cost was achieved and 10 times less medium was

  12. DIRECTIONS OF INCREASE OF EFFICIENCY OF FUNCTIONING OF THE INSTITUTION OF BANKRUPTCY

    Directory of Open Access Journals (Sweden)

    Antonina Nikolaevna Ryakhovskaya

    2016-01-01

    Full Text Available This article presents a synthesis of the experience of foreign government and corporate procurement management. Set out key aspects of the organization of procurement for government and corporate needs, disclosed issues of centralization and decentralization of procurement, as well as given clarification of the concept of "procurement management system" and structured the main elements that make up this system. The purpose / goal. The purpose of the work is to study the nature and characteristics of the functioning of government and corporate experience in procurement management, identifying problems and prospects of its development. Methodology. To perform this work were used legal, comparative and statistical analysis methods. Results. As part of the presentation of the present article the author has examined the nature, objectives and stages of public and corporate procurement management.

  13. Functional mapping of protein-protein interactions in an enzyme complex by directed evolution.

    Directory of Open Access Journals (Sweden)

    Kathrin Roderer

    Full Text Available The shikimate pathway enzyme chorismate mutase converts chorismate into prephenate, a precursor of Tyr and Phe. The intracellular chorismate mutase (MtCM of Mycobacterium tuberculosis is poorly active on its own, but becomes >100-fold more efficient upon formation of a complex with the first enzyme of the shikimate pathway, 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase (MtDS. The crystal structure of the enzyme complex revealed involvement of C-terminal MtCM residues with the MtDS interface. Here we employed evolutionary strategies to probe the tolerance to substitution of the C-terminal MtCM residues from positions 84-90. Variants with randomized positions were subjected to stringent selection in vivo requiring productive interactions with MtDS for survival. Sequence patterns identified in active library members coincide with residue conservation in natural chorismate mutases of the AroQδ subclass to which MtCM belongs. An Arg-Gly dyad at positions 85 and 86, invariant in AroQδ sequences, was intolerant to mutation, whereas Leu88 and Gly89 exhibited a preference for small and hydrophobic residues in functional MtCM-MtDS complexes. In the absence of MtDS, selection under relaxed conditions identifies positions 84-86 as MtCM integrity determinants, suggesting that the more C-terminal residues function in the activation by MtDS. Several MtCM variants, purified using a novel plasmid-based T7 RNA polymerase gene expression system, showed that a diminished ability to physically interact with MtDS correlates with reduced activatability and feedback regulatory control by Tyr and Phe. Mapping critical protein-protein interaction sites by evolutionary strategies may pinpoint promising targets for drugs that interfere with the activity of protein complexes.

  14. Functional mapping of protein-protein interactions in an enzyme complex by directed evolution.

    Science.gov (United States)

    Roderer, Kathrin; Neuenschwander, Martin; Codoni, Giosiana; Sasso, Severin; Gamper, Marianne; Kast, Peter

    2014-01-01

    The shikimate pathway enzyme chorismate mutase converts chorismate into prephenate, a precursor of Tyr and Phe. The intracellular chorismate mutase (MtCM) of Mycobacterium tuberculosis is poorly active on its own, but becomes >100-fold more efficient upon formation of a complex with the first enzyme of the shikimate pathway, 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase (MtDS). The crystal structure of the enzyme complex revealed involvement of C-terminal MtCM residues with the MtDS interface. Here we employed evolutionary strategies to probe the tolerance to substitution of the C-terminal MtCM residues from positions 84-90. Variants with randomized positions were subjected to stringent selection in vivo requiring productive interactions with MtDS for survival. Sequence patterns identified in active library members coincide with residue conservation in natural chorismate mutases of the AroQδ subclass to which MtCM belongs. An Arg-Gly dyad at positions 85 and 86, invariant in AroQδ sequences, was intolerant to mutation, whereas Leu88 and Gly89 exhibited a preference for small and hydrophobic residues in functional MtCM-MtDS complexes. In the absence of MtDS, selection under relaxed conditions identifies positions 84-86 as MtCM integrity determinants, suggesting that the more C-terminal residues function in the activation by MtDS. Several MtCM variants, purified using a novel plasmid-based T7 RNA polymerase gene expression system, showed that a diminished ability to physically interact with MtDS correlates with reduced activatability and feedback regulatory control by Tyr and Phe. Mapping critical protein-protein interaction sites by evolutionary strategies may pinpoint promising targets for drugs that interfere with the activity of protein complexes.

  15. Monetary reward magnitude effects on behavior and brain function during goal-directed behavior.

    Science.gov (United States)

    Rosell-Negre, P; Bustamante, J C; Fuentes-Claramonte, P; Costumero, V; Benabarre, S; Barrós-Loscertales, A

    2017-08-01

    Reward may modulate the cognitive processes required for goal achievement, while individual differences in personality may affect reward modulation. Our aim was to test how different monetary reward magnitudes modulate brain activation and performance during goal-directed behavior, and whether individual differences in reward sensitivity affect this modulation. For this purpose, we scanned 37 subjects with a parametric design in which we varied the magnitude of monetary rewards (€0, €0.01, €0.5, €1 or €1.5) in a blocked fashion while participants performed an interference counting-Stroop condition. The results showed that the brain activity of left dorsolateral prefrontal cortex (DLPFC) and the striatum were modulated by increasing and decreasing reward magnitudes, respectively. Behavioral performance improved as the magnitude of monetary reward increased while comparing the non reward (€0) condition to any other reward condition, or the lower €0.01 to any other reward condition, and this improvement was related with individual differences in reward sensitivity. In conclusion, the locus of influence of monetary incentives overlaps the activity of the regions commonly involved in cognitive control.

  16. A ROLE FOR INTERLEUKIN 8 IN DIRECT REGULATION OF T CELL FUNCTIONAL ACTIVITY

    Directory of Open Access Journals (Sweden)

    M. E. Meniailo

    2017-01-01

    Full Text Available CD3+T lymphocytes were isolated from normal donors by positive magnetic separation. Activation of the T cells with particles conjugated with antibodies to CD3, СD28 and СD2 molecules led to substantial increase in T cell production of interleukin-8 (IL-8. An interleukin-8 receptor (CXCR1, CD181 was initially expressed in 13.3% of T lymphocytes. Activation of T lymphocytes resulted into a detectable increase of CD181+ cell number among CD4+ naïve cells and CD4+ terminally-differentiated effector cells, and, conversely, into decrease of their number among CD4+ effector memory cells. Activation of T lymphocytes was assessed by membrane expression of CD25 molecule (receptor for IL-2. IL-8 (0.01-10.0 ng/ml was shown to markedly reduce activation of both CD4- and CD4+ effector memory T cells, as well as terminallydifferentiated T effectors, without significantly affecting activation of naive T lymphocytes and central memory T cells. IL-8 noticeably increased IL-2 production by activated Т cells, caused a reduced IL-10 production, and did not significantly affect the secretion of IFNγ and IL-4. The data obtained suggest a significance of IL-8 for direct regulation of adaptive T cell responses.

  17. Direct determination of resonance energy transfer in photolyase: structural alignment for the functional state.

    Science.gov (United States)

    Tan, Chuang; Guo, Lijun; Ai, Yuejie; Li, Jiang; Wang, Lijuan; Sancar, Aziz; Luo, Yi; Zhong, Dongping

    2014-11-13

    Photoantenna is essential to energy transduction in photoinduced biological machinery. A photoenzyme, photolyase, has a light-harvesting pigment of methenyltetrahydrofolate (MTHF) that transfers its excitation energy to the catalytic flavin cofactor FADH¯ to enhance DNA-repair efficiency. Here we report our systematic characterization and direct determination of the ultrafast dynamics of resonance energy transfer from excited MTHF to three flavin redox states in E. coli photolyase by capturing the intermediates formed through the energy transfer and thus excluding the electron-transfer quenching pathway. We observed 170 ps for excitation energy transferring to the fully reduced hydroquinone FADH¯, 20 ps to the fully oxidized FAD, and 18 ps to the neutral semiquinone FADH(•), and the corresponding orientation factors (κ(2)) were determined to be 2.84, 1.53 and 1.26, respectively, perfectly matching with our calculated theoretical values. Thus, under physiological conditions and over the course of evolution, photolyase has adopted the optimized orientation of its photopigment to efficiently convert solar energy for repair of damaged DNA.

  18. Implementation of the zooplankton functional response in plankton models: State of the art, recent challenges and future directions

    Science.gov (United States)

    Morozov, Andrew; Poggiale, Jean-Christophe; Cordoleani, Flora

    2012-09-01

    The conventional way of describing grazing in plankton models is based on a zooplankton functional response framework, according to which the consumption rate is computed as the product of a certain function of food (the functional response) and the density/biomass of herbivorous zooplankton. A large amount of literature on experimental feeding reports the existence of a zooplankton functional response in microcosms and small mesocosms, which goes a long way towards explaining the popularity of this framework both in mean-field (e.g. NPZD models) and spatially resolved models. On the other hand, the complex foraging behaviour of zooplankton (feeding cycles) as well as spatial heterogeneity of food and grazer distributions (plankton patchiness) across time and space scales raise questions as to the existence of a functional response of herbivores in vivo. In the current review, we discuss limitations of the ‘classical’ zooplankton functional response and consider possible ways to amend this framework to cope with the complexity of real planktonic ecosystems. Our general conclusion is that although the functional response of herbivores often does not exist in real ecosystems (especially in the form observed in the laboratory), this framework can be rather useful in modelling - but it does need some amendment which can be made based on various techniques of model reduction. We also show that the shape of the functional response depends on the spatial resolution (‘frame’) of the model. We argue that incorporating foraging behaviour and spatial heterogeneity in plankton models would not necessarily require the use of individual based modelling - an approach which is now becoming dominant in the literature. Finally, we list concrete future directions and challenges and emphasize the importance of a closer collaboration between plankton biologists and modellers in order to make further progress towards better descriptions of zooplankton grazing.

  19. Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

    Science.gov (United States)

    Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

    2018-04-01

    This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

  20. In situ sonochemical reduction and direct functionalization of graphene oxide: A robust approach with thermal and biomedical applications.

    Science.gov (United States)

    Maktedar, Shrikant S; Mehetre, Shantilal S; Avashthi, Gopal; Singh, Man

    2017-01-01

    The rapid, robust, scalable and non-hazardous sonochemical approach for in situ reduction and direct functionalization of graphene oxide has been developed for non-toxic biomedical applications. The graphene oxide (GrO) was directly functionalized with tryptamine (TA) without using any hazardous acylating and coupling reagents. The reaction was completed within 20min. An impact of ultrasound was inferred for a direct functionalization with other conventional methods. The evolved electronic states were confirmed with near edge X-ray absorption fine structure (NEXAFS). The direct covalent functionalization and formation of f-(TA) GrO was proven with FTIR, 13 C solid state NMR, XPS, XRD, Raman' HRTEM, AFM and TGA. The total percentage weight loss in TGA confirms an enhanced thermal stability of f-(TA) GrO. The f-(TA) GrO was further explored for an investigation of in vitro antimicrobial activity to ensure the health and environmental safety. An outstanding antibacterial activity of f-(TA) GrO was found against gram positive Staphylococcus aureus at MIC 128mgmL -1 . It confirms a suitability of f-(TA) GrO for thermally stable antibacterial coating. The f-(TA) GrO showed 39.14-48.9% antioxidant activities, evaluated with 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical assay. The inherent cytotoxicity of f-(TA) GrO was evaluated with SRB assay to living cells, MCF-7 and Vero. The estimated cell viabilities were >80% upon addition of f-(TA) GrO over a wide concentration range of 10-80μgmL -1 . The high cytocompatibility of f-(TA) GrO confirms the low toxicity and an excellent biocompatibility. The morphological effect on Vero cell line, evidently confirmed the biocompatibility of f-(TA) GrO. Therefore, f-(TA) GrO was emerged as an advanced functional biomaterial for thermal and biomedical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Cloning, Site-Directed Mutagenesis, and Functional Analysis of Active Residues in Lymantria dispar Chitinase.

    Science.gov (United States)

    Fan, Xiao-Jun; Yang, Chun; Zhang, Chang; Ren, Hui; Zhang, Jian-Dong

    2018-01-01

    Chitinases are glycosyl hydrolases that catalyze the hydrolysis of β-(1,4)-glycosidic bonds in chitin, the major structural polysaccharide presented in the cuticle and gut peritrophic matrix of insects. Two aspartate residues (D143, D145) and one tryptophan (W146) in the Lymantria dispar chitinase are highly conserved residues observed within the second conserved motif of the family 18 chitinase catalytic region. In this study, a chitinase cDNA, LdCht5, was cloned from L. dispar, and the roles of the three residues were investigated using site-directed mutagenesis and substituting them with three other amino acids. Seven mutant proteins, D143E, D145E, W146G, D143E/D145E, D143E/W146G, D145E/W146G, and D143E/D145E/W146G, as well as the wild-type enzyme, were produced using the baculovirus-insect cell line expression system. The enzymatic and kinetic properties of these mutant enzymes were measured using the oligosaccharide substrate MU-(GlcNAc) 3 . Among the seven mutants, the D145E, D143E/D145E, and D145E/W146G mutations kept some extant catalytic activity toward MU-(GlcNAc) 3 , while the D143E, W146G, D143E/W146G, and D143E/D145E/W146G mutant enzymes were inactivated. Compared with the mutant enzymes, the wild-type enzyme had higher values of k cat and k cat / K m . A study of the multiple point mutations in the second conserved catalytic region would help to elucidate the role of the critical residues and their relationships.

  2. LXA{sub 4} actions direct fibroblast function and wound closure

    Energy Technology Data Exchange (ETDEWEB)

    Herrera, Bruno S. [Department of Applied Oral Sciences, Center for Periodontology, The Forsyth Institute, Cambridge, MA (United States); Microbiology Branch, US Army Dental and Trauma Research Detachment, Institute of Surgical Research, JBSA Fort Sam Houston, TX (United States); Kantarci, Alpdogan; Zarrough, Ahmed; Hasturk, Hatice [Department of Applied Oral Sciences, Center for Periodontology, The Forsyth Institute, Cambridge, MA (United States); Leung, Kai P., E-mail: kai.p.leung.civ@mail.mil [Microbiology Branch, US Army Dental and Trauma Research Detachment, Institute of Surgical Research, JBSA Fort Sam Houston, TX (United States); Van Dyke, Thomas E., E-mail: tvandyke@forsyth.org [Department of Applied Oral Sciences, Center for Periodontology, The Forsyth Institute, Cambridge, MA (United States)

    2015-09-04

    Timely resolution of inflammation is crucial for normal wound healing. Resolution of inflammation is an active biological process regulated by specialized lipid mediators including the lipoxins and resolvins. Failure of resolution activity has a major negative impact on wound healing in chronic inflammatory diseases that is manifest as excess fibrosis and scarring. Lipoxins, including Lipoxin A{sub 4} (LXA{sub 4}), have known anti-fibrotic and anti-scarring properties. The goal of this study was to elucidate the impact of LXA{sub 4} on fibroblast function. Mouse fibroblasts (3T3 Mus musculus Swiss) were cultured for 72 h in the presence of TGF-β1, to induce fibroblast activation. The impact of exogenous TGF-β1 (1 ng/mL) on LXA{sub 4} receptor expression (ALX/FPR2) was determined by flow cytometry. Fibroblast proliferation was measured by bromodeoxyuridine (BrdU) labeling and migration in a “scratch” assay wound model. Expression of α-smooth muscle actin (α-SMA), and collagen types I and III were measured by Western blot. We observed that TGF-β1 up-regulates LXA{sub 4} receptor expression, enhances fibroblast proliferation, migration and scratch wound closure. α-SMA levels and Collagen type I and III deposition were also enhanced. LXA{sub 4} slowed fibroblast migration and scratch wound closure at early time points (24 h), but wound closure was equal to TGF-β1 alone at 48 and 72 h. LXA{sub 4} tended to slow fibroblast proliferation at both concentrations, but had no impact on α-SMA or collagen production by TGF-β1 stimulated fibroblasts. The generalizability of the actions of resolution molecules was examined in experiments repeated with resolvin D2 (RvD2) as the agonist. The activity of RvD2 mimicked the actions of LXA{sub 4} in all assays, through an as yet unidentified receptor. The results suggest that mediators of resolution of inflammation enhance wound healing and limit fibrosis in part by modulating fibroblast function. - Highlights: • TGF

  3. Effective NiMn Nanoparticles-Functionalized Carbon Felt as an Effective Anode for Direct Urea Fuel Cells

    Directory of Open Access Journals (Sweden)

    Nasser A. M. Barakat

    2018-05-01

    Full Text Available The internal resistances of fuel cells strongly affect the generated power. Basically, in the fuel cell, the anode can be prepared by deposition of a film from the functional electrocatalyst on a proper gas diffusion layer. Accordingly, an interfacial resistance for the electron transport is created between the two layers. Electrocatalyst-functionalized gas diffusion layer (GDL can distinctly reduce the interfacial resistance between the catalyst layer and the GDL. In this study, NiMn nanoparticles-decorated carbon felt is introduced as functionalized GDL to be exploited as a ready-made anode in a direct urea fuel cell. The proposed treated GDL was prepared by calcination of nickel acetate/manganese acetate-loaded carbon felt under an argon atmosphere at 850 °C. The physiochemical characterizations confirmed complete reduction for the utilized precursors and deposition of pristine NiMn nanoparticles on the carbon felt fiber. In passive direct urea fuel cells, investigation the performance of the functionalized GDLs indicated that the composition of the metal nanoparticles has to be optimized as the GDL obtained from 40 wt % manganese acetate reveals the maximum generated power density; 36 mW/m2 at room temperature and 0.5 M urea solution. Moreover, the electrochemical measurements proved that low urea solution concentration is preferred as utilizing 0.5 M solution resulted into generating higher power compared to 1.0 and 2.0 M solution. Overall, this study opens a new avenue toward functionalization of the GDL as a novel strategy to overcome the interfacial resistance between the electrocatalyst and the GDL.

  4. Direct Induction and Functional Maturation of Forebrain GABAergic Neurons from Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Alfred Xuyang Sun

    2016-08-01

    Full Text Available Gamma-aminobutyric acid (GABA-releasing interneurons play an important modulatory role in the cortex and have been implicated in multiple neurological disorders. Patient-derived interneurons could provide a foundation for studying the pathogenesis of these diseases as well as for identifying potential therapeutic targets. Here, we identified a set of genetic factors that could robustly induce human pluripotent stem cells (hPSCs into GABAergic neurons (iGNs with high efficiency. We demonstrated that the human iGNs express neurochemical markers and exhibit mature electrophysiological properties within 6–8 weeks. Furthermore, in vitro, iGNs could form functional synapses with other iGNs or with human-induced glutamatergic neurons (iENs. Upon transplantation into immunodeficient mice, human iGNs underwent synaptic maturation and integration into host neural circuits. Taken together, our rapid and highly efficient single-step protocol to generate iGNs may be useful to both mechanistic and translational studies of human interneurons.

  5. Genetic recombination is directed away from functional genomic elements in mice.

    Science.gov (United States)

    Brick, Kevin; Smagulova, Fatima; Khil, Pavel; Camerini-Otero, R Daniel; Petukhova, Galina V

    2012-05-13

    Genetic recombination occurs during meiosis, the key developmental programme of gametogenesis. Recombination in mammals has been recently linked to the activity of a histone H3 methyltransferase, PR domain containing 9 (PRDM9), the product of the only known speciation-associated gene in mammals. PRDM9 is thought to determine the preferred recombination sites--recombination hotspots--through sequence-specific binding of its highly polymorphic multi-Zn-finger domain. Nevertheless, Prdm9 knockout mice are proficient at initiating recombination. Here we map and analyse the genome-wide distribution of recombination initiation sites in Prdm9 knockout mice and in two mouse strains with different Prdm9 alleles and their F(1) hybrid. We show that PRDM9 determines the positions of practically all hotspots in the mouse genome, with the exception of the pseudo-autosomal region (PAR)--the only area of the genome that undergoes recombination in 100% of cells. Surprisingly, hotspots are still observed in Prdm9 knockout mice, and as in wild type, these hotspots are found at H3 lysine 4 (H3K4) trimethylation marks. However, in the absence of PRDM9, most recombination is initiated at promoters and at other sites of PRDM9-independent H3K4 trimethylation. Such sites are rarely targeted in wild-type mice, indicating an unexpected role of the PRDM9 protein in sequestering the recombination machinery away from gene-promoter regions and other functional genomic elements.

  6. Versatile Surface Functionalization of Metal-Organic Frameworks through Direct Metal Coordination with a Phenolic Lipid Enables Diverse Applications

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Wei [Univ. of New Mexico, Albuquerque, NM (United States); Xiang, Guolei [Univ. of Cambridge (United Kingdom); Shang, Jin [Univ. of Hong Kong (China); Guo, Jimin [Univ. of New Mexico, Albuquerque, NM (United States); Motevalli, Benyamin [Monash Univ., Clayton, VIC (Australia); Durfee, Paul [Univ. of New Mexico, Albuquerque, NM (United States); Agola, Jacob Ongudi [Univ. of New Mexico, Albuquerque, NM (United States); Coker, Eric N. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Brinker, C. Jeffrey [Univ. of New Mexico, Albuquerque, NM (United States); Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2018-02-22

    Here, a novel strategy for the versatile functionalization of the external surface of metal-organic frameworks (MOFs) has been developed based on the direct coordination of a phenolic-inspired lipid molecule DPGG (1,2-dipalmitoyl-sn-glycero-3-galloyl) with metal nodes/sites surrounding MOF surface. X-ray diffraction and Argon sorption analysis prove that the modified MOF particles retain their structural integrity and porosity after surface modification. Density functional theory calculations reveal that strong chelation strength between the metal sites and the galloyl head group of DPGG is the basic prerequisite for successful coating. Due to the pH-responsive nature of metal-phenol complexation, the modification process is reversible by simple washing in weak acidic water, showing an excellent regeneration ability for water-stable MOFs. Moreover, the colloidal stability of the modified MOFs in the nonpolar solvent allows them to be further organized into 2 dimensional MOF or MOF/polymer monolayers by evaporation-induced interfacial assembly conducted on an air/water interface. Lastly, the easy fusion of a second functional layer onto DPGG-modified MOF cores, enabled a series of MOF-based functional nanoarchitectures, such as MOFs encapsulated within hybrid supported lipid bilayers (so-called protocells), polyhedral core-shell structures, hybrid lipid-modified-plasmonic vesicles and multicomponent supraparticles with target functionalities, to be generated. for a wide range of applications.

  7. Three dimensional Free Vibration and Transient Analysis of Two Directional Functionally Graded Thick Cylindrical Panels Under Impact Loading

    Directory of Open Access Journals (Sweden)

    Hassan Zafarmand

    Full Text Available AbstractIn this paper three dimensional free vibration and transient response of a cylindrical panel made of two directional functionally graded materials (2D-FGMs based on three dimensional equations of elasticity and subjected to internal impact loading is considered. Material properties vary through both radial and axial directions continuously. The 3D graded finite element method (GFEM based on Rayleigh-Ritz energy formulation and Newmark direct integration method has been applied to solve the equations in space and time domains. The fundamental normalized natural frequency, time history of displacements and stresses in three directions and velocity of radial stress wave propagation for various values of span angel of cylindrical panel and different power law exponents have been investigated. The present results show that using 2D-FGMs leads to a more flexible design than conventional 1D-FGMs. The GFEM solution have been compared with the results of an FG thick hollow cylinder and an FG curved panel, where a good agreement between them is observed.

  8. Assessing the utility of phase-space-localized basis functions: Exploiting direct product structure and a new basis function selection procedure

    International Nuclear Information System (INIS)

    Brown, James; Carrington, Tucker

    2016-01-01

    In this paper we show that it is possible to use an iterative eigensolver in conjunction with Halverson and Poirier’s symmetrized Gaussian (SG) basis [T. Halverson and B. Poirier, J. Chem. Phys. 137, 224101 (2012)] to compute accurate vibrational energy levels of molecules with as many as five atoms. This is done, without storing and manipulating large matrices, by solving a regular eigenvalue problem that makes it possible to exploit direct-product structure. These ideas are combined with a new procedure for selecting which basis functions to use. The SG basis we work with is orders of magnitude smaller than the basis made by using a classical energy criterion. We find significant convergence errors in previous calculations with SG bases. For sum-of-product Hamiltonians, SG bases large enough to compute accurate levels are orders of magnitude larger than even simple pruned bases composed of products of harmonic oscillator functions.

  9. Assessing the utility of phase-space-localized basis functions: Exploiting direct product structure and a new basis function selection procedure.

    Science.gov (United States)

    Brown, James; Carrington, Tucker

    2016-06-28

    In this paper we show that it is possible to use an iterative eigensolver in conjunction with Halverson and Poirier's symmetrized Gaussian (SG) basis [T. Halverson and B. Poirier, J. Chem. Phys. 137, 224101 (2012)] to compute accurate vibrational energy levels of molecules with as many as five atoms. This is done, without storing and manipulating large matrices, by solving a regular eigenvalue problem that makes it possible to exploit direct-product structure. These ideas are combined with a new procedure for selecting which basis functions to use. The SG basis we work with is orders of magnitude smaller than the basis made by using a classical energy criterion. We find significant convergence errors in previous calculations with SG bases. For sum-of-product Hamiltonians, SG bases large enough to compute accurate levels are orders of magnitude larger than even simple pruned bases composed of products of harmonic oscillator functions.

  10. Nuclear HMGA1 nonhistone chromatin proteins directly influence mitochondrial transcription, maintenance, and function

    International Nuclear Information System (INIS)

    Dement, Gregory A.; Maloney, Scott C.; Reeves, Raymond

    2007-01-01

    We have previously demonstrated that HMGA1 proteins translocate from the nucleus to mitochondria and bind to mitochondrial DNA (mtDNA) at the D-loop control region [G.A. Dement, N.R. Treff, N.S. Magnuson, V. Franceschi, R. Reeves, Dynamic mitochondrial localization of nuclear transcription factor HMGA1, Exp. Cell Res. 307 (2005) 388-401.] [11]. To elucidate possible physiological roles for such binding, we employed methods to analyze mtDNA transcription, mitochondrial maintenance, and other organelle functions in transgenic human MCF-7 cells (HA7C) induced to over-express an HA-tagged HMGA1 protein and control (parental) MCF-7 cells. Quantitative real-time (RT) PCR analyses demonstrated that mtDNA levels were reduced approximately 2-fold in HMGA1 over-expressing HA7C cells and flow cytometric analyses further revealed that mitochondrial mass was significantly reduced in these cells. Cellular ATP levels were also reduced in HA7C cells and survival studies showed an increased sensitivity to killing by 2-deoxy-D-glucose, a glycolysis-specific inhibitor. Flow cytometric analyses revealed additional mitochondrial abnormalities in HA7C cells that are consistent with a cancerous phenotype: namely, increased reactive oxygen species (ROS) and increased mitochondrial membrane potential (ΔΨ m ). Additional RT-PCR analyses demonstrated that gene transcripts from both the heavy (ND2, COXI, ATP6) and light (ND6) strands of mtDNA were up-regulated approximately 3-fold in HA7C cells. Together, these mitochondrial changes are consistent with many previous reports and reveal several possible mechanisms by which HMGA1 over-expression, a common feature of naturally occurring cancers, may affect tumor progression

  11. Direct validation of atlas-based red nucleus identification for functional radiosurgery

    International Nuclear Information System (INIS)

    Stancanello, Joseph; Romanelli, Pantaleo; Sebastiano, Fabio; Modugno, Nicola; Muacevic, Alexander; Cerveri, Pietro; Esposito, Vincenzo; Ferrigno, Giancarlo; Uggeri, Fulvio; Cantore, Giampaolo

    2007-01-01

    Treatment targets in functional neurosurgery usually consist of selected structures within the thalamus and basal ganglia, which can be stimulated in order to affect specific brain pathways. Chronic electrical stimulation of these structures is a widely used approach for selected patients with advanced movement disorders. An alternative therapeutic solution consists of producing a lesion in the target nucleus, for example by means of radiosurgery, a noninvasive procedure, and this prevents the use of intraoperative microelectrode recording as a method for accurate target definition. The need to have accurate noninvasive localization of the target motivated our previous work on atlas-based identification; the aim of this present work is to provide additional validation of this approach based on the identification of the red nuclei (RN), which are located near the subthalamic nucleus (STN). Coordinates of RN were obtained from the Talairach and Tournoux (TT) atlas and transformed into the coordinates of the Montreal Neurological Institute (MNI) atlas, creating a mask representation of RN. The MNI atlas volume was nonrigidly registered onto the patient magnetic resonance imaging (MRI). This deformation field was then applied to the RN mask, providing its location on the patient MRI. Because RN are easily identifiable on 1.5 T T2-MRI images, they were manually delineated; the coordinates of the centers of mass of the manually and automatically identified structures were compared. Additionally, volumetric overlapping indices were calculated. Ten patients were examined by this technique. All indices indicated a high level of agreement between manually and automatically identified structures. These results not only confirm the accuracy of the method but also allow fine tuning of the automatic identification method to be performed

  12. Intensity and direction of competitive anxiety as a function of goal attainment expectation and competition goal generation.

    Science.gov (United States)

    O'Brien, M; Hanton, S; Mellalieu, S D

    2005-12-01

    Jones's control model was adopted to investigate differences in the labelling of symptoms associated with pre-competition anxiety and self-confidence as a function of goal attainment expectation and competition goal generation. Team sport performers (N = 96) were divided into outcome, performance and process goal groups. Anxiety intensity and direction, and self-confidence were then examined as a function of goal expectancy (positive or negative) and perceived input into goal production (input or no input). MANOVA and follow-up ANOVA supported the study predictions. Specifically, participants who reported positive expectations of goal achievement and indicated some input into the goal generation process experienced the most facilitative interpretations of cognitive symptoms and greater self-confidence. The results highlight the need to consider how goals are generated when attempting to foster a sense of control and help athletes cope with the psychological demands of competition.

  13. [1+1+3] Annulation of Diazoenals and Vinyl Azides: Direct Synthesis of Functionalized 1-Pyrrolines through Olefination.

    Science.gov (United States)

    Kanchupalli, Vinaykumar; Katukojvala, Sreenivas

    2018-05-04

    A dirhodium carboxylate catalyzed [1+1+3] annulation reaction of diazoenals and vinyl azides that gives synthetically important enal-functionalized 1-pyrroline derivatives was developed. The reaction involves a novel rhodium-catalyzed olefination of diazoenals with vinyl azides via electrophilic enal carbenoids, resulting in a new class of enal acrylates. The annulation reaction was used for the direct synthesis of valuable deuterated 1-pyrrolines. Structural diversification of the enal-functionalized 1-pyrrolines resulted in the biologically important pyrrolidine-fused oxaziridine, amino acid derivatives, and a 6-azabicyclo[3.2.1]octane motif present in polycyclic alkaloids. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Improvement of Left Ventricular Function by Permanent Direct His-Bundle Pacing in a Case with Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Yukiko Sashida, MD

    2006-01-01

    Full Text Available The patient was a 67-year-old female diagnosed with dilated cardiomyopathy. She had chronic atrial fibrillation (AF with bradycardia and low left ventricular function (left ventricular ejection fraction (LVEF 40%. She was admitted for congestive heart failure. She remained New York Heart Association (NYHA functional class III due to AF bradycardia. Pacemaker implantation was necessary for treatment of heart failure and administration of dose intensive β-blockers. As she had normal His-Purkinje activation, we examined the optimal pacing sites. Hemodynamics of His-bundle pacing and biventricular pacing were compared. Pulmonary capillary wedge pressure (PCWP was significantly lower on Hisbundle pacing than right ventricular (RV apical pacing and biventricular pacing (13mmHg, 19mmHg, and 19mmHg, respectively with an almost equal cardiac index. Based on the examination we implanted a permanent pacemaker for Direct His-bundle pacing (DHBP. After the DHBP implantation, the LVEF immediately improved from 40% to 55%, and BNP level decreased from 422 pg/ml to 42 pg/ml. The number of premature ventricular complex (PVC was decreased, and non sustained ventricular tachycardia (NSVT disappeared. Pacing threshold for His-bundle pacing has remained at the same level. His-bundle pacing has been maintained during 27 months and her long-term DHBP can improve cardiac function and the NYHA functional class.

  15. The difference between electrical microstimulation and direct electrical stimulation - towards new opportunities for innovative functional brain mapping?

    Science.gov (United States)

    Vincent, Marion; Rossel, Olivier; Hayashibe, Mitsuhiro; Herbet, Guillaume; Duffau, Hugues; Guiraud, David; Bonnetblanc, François

    2016-04-01

    Both electrical microstimulation (EMS) and direct electrical stimulation (DES) of the brain are used to perform functional brain mapping. EMS is applied to animal fundamental neuroscience experiments, whereas DES is performed in the operating theatre on neurosurgery patients. The objective of the present review was to shed new light on electrical stimulation techniques in brain mapping by comparing EMS and DES. There is much controversy as to whether the use of DES during wide-awake surgery is the 'gold standard' for studying the brain function. As part of this debate, it is sometimes wrongly assumed that EMS and DES induce similar effects in the nervous tissues and have comparable behavioural consequences. In fact, the respective stimulation parameters in EMS and DES are clearly different. More surprisingly, there is no solid biophysical rationale for setting the stimulation parameters in EMS and DES; this may be due to historical, methodological and technical constraints that have limited the experimental protocols and prompted the use of empirical methods. In contrast, the gap between EMS and DES highlights the potential for new experimental paradigms in electrical stimulation for functional brain mapping. In view of this gap and recent technical developments in stimulator design, it may now be time to move towards alternative, innovative protocols based on the functional stimulation of peripheral nerves (for which a more solid theoretical grounding exists).

  16. Functionally graded material of 304L stainless steel and inconel 625 fabricated by directed energy deposition: Characterization and thermodynamic modeling

    International Nuclear Information System (INIS)

    Carroll, Beth E.; Otis, Richard A.; Borgonia, John Paul; Suh, Jong-ook; Dillon, R. Peter; Shapiro, Andrew A.; Hofmann, Douglas C.; Liu, Zi-Kui; Beese, Allison M.

    2016-01-01

    Many engineering applications, particularly in extreme environments, require components with properties that vary with location in the part. Functionally graded materials (FGMs), which possess gradients in properties such as hardness or density, are a potential solution to address these requirements. The laser-based additive manufacturing process of directed energy deposition (DED) can be used to fabricate metallic parts with a gradient in composition by adjusting the volume fraction of metallic powders delivered to the melt pool as a function of position. As this is a fusion process, secondary phases may develop in the gradient zone during solidification that can result in undesirable properties in the part. This work describes experimental and thermodynamic studies of a component built from 304L stainless steel incrementally graded to Inconel 625. The microstructure, chemistry, phase composition, and microhardness as a function of position were characterized by microscopy, energy dispersive spectroscopy, X-ray diffraction, and microindentation. Particles of secondary phases were found in small amounts within cracks in the gradient zone. These were ascertained to consist of transition metal carbides by experimental results and thermodynamic calculations. The study provides a combined experimental and thermodynamic computational modeling approach toward the fabrication and evaluation of a functionally graded material made by DED additive manufacturing.

  17. Simulating real world functioning in schizophrenia using a naturalistic city environment and single-trial, goal-directed navigation

    Directory of Open Access Journals (Sweden)

    John A Zawadzki

    2013-11-01

    Full Text Available Objective: To develop a virtual reality platform that would serve as a functionally meaningful measure of cognition in schizophrenia that would complement standard batteries of cognitive tests during clinical trials for cognitive treatments in schizophrenia, be amenable to human neuroimaging research, yet lend itself to neurobiological comparison with rodent analogues.Method: Thirty-three patients with schizophrenia and 33 healthy controls matched for age, sex, video gaming experience and education completed eight rapid, single-trial virtual navigation tasks within a naturalistic virtual city. Four trials tested their ability to find different targets seen during the passive viewing of a closed path that led them around different city blocks. Four subsequent trials tested their ability to return to four different starting points after viewing a path that took them several blocks away from the starting position. Results: Individuals with schizophrenia had difficulties in way-finding, measured as distance travelled to find targets previously encountered within the virtual city. They were also more likely not to notice the target during passive viewing, less likely to find novel shortcuts to targets and more likely to become lost and fail completely in finding the target. Total travel distances across all eight trials strongly correlated (negatively with neurocognitive measures and, for 49 participants who completed the Quality of Life Scale, psychosocial functioning. Conclusion: Single-trial, goal-directed navigation in a naturalistic virtual environment is a functionally meaningful measure of cognitive functioning in schizophrenia.

  18. A Novel Modulation Function-Based Control of Modular Multilevel Converters for High Voltage Direct Current Transmission Systems

    Directory of Open Access Journals (Sweden)

    Majid Mehrasa

    2016-10-01

    Full Text Available In this paper, a novel modulation function-based method including analyses of the modulation index and phase is proposed for operation of modular multilevel converters (MMCs in high voltage direct current (HVDC transmission systems. The proposed modulation function-based control technique is developed based on thorough and precise analyses of all MMC voltages and currents in the a-b-c reference frame in which the alternating current (AC-side voltage is the first target to be obtained. Using the AC-side voltage, the combination of the MMC upper and lower arm voltages is achieved as the main structure of the proposed modulation function. The main contribution of this paper is to obtain two very simple new modulation functions to control MMC performance in different operating conditions. The features of the modulation function-based control technique are as follows: (1 this control technique is very simple and can be easily achieved in a-b-c reference frame without the need of using Park transformation; and (2 in addition, the inherent properties of the MMC model are considered in the proposed control technique. Considering these properties leads to constructing a control technique that is robust against MMC parameters changes and also is a very good tracking method for the components of MMC input currents. These features lead to improving the operation of MMC significantly, which can act as a rectifier in the HVDC structure. The simulation studies are conducted through MATLAB/SIMULINK software, and the results obtained verify the effectiveness of the proposed modulation function-based control technique.

  19. TU-G-BRA-02: Can We Extract Lung Function Directly From 4D-CT Without Deformable Image Registration?

    International Nuclear Information System (INIS)

    Kipritidis, J; Woodruff, H; Counter, W; Keall, P; Hofman, M; Siva, S; Callahan, J; Le Roux, P; Hardcastle, N

    2015-01-01

    Purpose: Dynamic CT ventilation imaging (CT-VI) visualizes air volume changes in the lung by evaluating breathing-induced lung motion using deformable image registration (DIR). Dynamic CT-VI could enable functionally adaptive lung cancer radiation therapy, but its sensitivity to DIR parameters poses challenges for validation. We hypothesize that a direct metric using CT parameters derived from Hounsfield units (HU) alone can provide similar ventilation images without DIR. We compare the accuracy of Direct and Dynamic CT-VIs versus positron emission tomography (PET) images of inhaled "6"8Ga-labelled nanoparticles (‘Galligas’). Methods: 25 patients with lung cancer underwent Galligas 4D-PET/CT scans prior to radiation therapy. For each patient we produced three CT- VIs. (i) Our novel method, Direct CT-VI, models blood-gas exchange as the product of air and tissue density at each lung voxel based on time-averaged 4D-CT HU values. Dynamic CT-VIs were produced by evaluating: (ii) regional HU changes, and (iii) regional volume changes between the exhale and inhale 4D-CT phase images using a validated B-spline DIR method. We assessed the accuracy of each CT-VI by computing the voxel-wise Spearman correlation with free-breathing Galligas PET, and also performed a visual analysis. Results: Surprisingly, Direct CT-VIs exhibited better global correlation with Galligas PET than either of the dynamic CT-VIs. The (mean ± SD) correlations were (0.55 ± 0.16), (0.41 ± 0.22) and (0.29 ± 0.27) for Direct, Dynamic HU-based and Dynamic volume-based CT-VIs respectively. Visual comparison of Direct CT-VI to PET demonstrated similarity for emphysema defects and ventral-to-dorsal gradients, but inability to identify decreased ventilation distal to tumor-obstruction. Conclusion: Our data supports the hypothesis that Direct CT-VIs are as accurate as Dynamic CT-VIs in terms of global correlation with Galligas PET. Visual analysis, however, demonstrated that different CT-VI algorithms

  20. TU-G-BRA-02: Can We Extract Lung Function Directly From 4D-CT Without Deformable Image Registration?

    Energy Technology Data Exchange (ETDEWEB)

    Kipritidis, J; Woodruff, H; Counter, W; Keall, P [University of Sydney, Sydney, NSW (Australia); Hofman, M; Siva, S; Callahan, J; Le Roux, P [Peter MacCallum Cancer Centre, Melbourne, VIC (Australia); Hardcastle, N [Royal North Shore Hospital, Sydney, NSW (Australia)

    2015-06-15

    Purpose: Dynamic CT ventilation imaging (CT-VI) visualizes air volume changes in the lung by evaluating breathing-induced lung motion using deformable image registration (DIR). Dynamic CT-VI could enable functionally adaptive lung cancer radiation therapy, but its sensitivity to DIR parameters poses challenges for validation. We hypothesize that a direct metric using CT parameters derived from Hounsfield units (HU) alone can provide similar ventilation images without DIR. We compare the accuracy of Direct and Dynamic CT-VIs versus positron emission tomography (PET) images of inhaled {sup 68}Ga-labelled nanoparticles (‘Galligas’). Methods: 25 patients with lung cancer underwent Galligas 4D-PET/CT scans prior to radiation therapy. For each patient we produced three CT- VIs. (i) Our novel method, Direct CT-VI, models blood-gas exchange as the product of air and tissue density at each lung voxel based on time-averaged 4D-CT HU values. Dynamic CT-VIs were produced by evaluating: (ii) regional HU changes, and (iii) regional volume changes between the exhale and inhale 4D-CT phase images using a validated B-spline DIR method. We assessed the accuracy of each CT-VI by computing the voxel-wise Spearman correlation with free-breathing Galligas PET, and also performed a visual analysis. Results: Surprisingly, Direct CT-VIs exhibited better global correlation with Galligas PET than either of the dynamic CT-VIs. The (mean ± SD) correlations were (0.55 ± 0.16), (0.41 ± 0.22) and (0.29 ± 0.27) for Direct, Dynamic HU-based and Dynamic volume-based CT-VIs respectively. Visual comparison of Direct CT-VI to PET demonstrated similarity for emphysema defects and ventral-to-dorsal gradients, but inability to identify decreased ventilation distal to tumor-obstruction. Conclusion: Our data supports the hypothesis that Direct CT-VIs are as accurate as Dynamic CT-VIs in terms of global correlation with Galligas PET. Visual analysis, however, demonstrated that different CT

  1. Direct detection of cysteine using functionalized BaTiO3 nanoparticles film based self-powered biosensor.

    Science.gov (United States)

    Selvarajan, Sophia; Alluri, Nagamalleswara Rao; Chandrasekhar, Arunkumar; Kim, Sang-Jae

    2017-05-15

    Simple, novel, and direct detection of clinically important biomolecules have continuous demand among scientific community as well as in market. Here, we report the first direct detection and facile fabrication of a cysteine-responsive, film-based, self-powered device. NH 2 functionalized BaTiO 3 nanoparticles (BT-NH 2 NPs) suspended in a three-dimensional matrix of an agarose (Ag) film, were used for cysteine detection. BaTiO 3 nanoparticles (BT NPs) semiconducting as well as piezoelectric properties were harnessed in this study. The changes in surface charge properties of the film with respect to cysteine concentrations were determined using a current-voltage (I-V) technique. The current response increased with cysteine concentration (linear concentration range=10µM-1mM). Based on the properties of the composite (BT/Ag), we created a self-powered cysteine sensor in which the output voltage from a piezoelectric nanogenerator was used to drive the sensor. The potential drop across the sensor was measured as a function of cysteine concentrations. Real-time analysis of sensor performance was carried out on urine samples by non-invasive method. This novel sensor demonstrated good selectivity, linear concentration range and detection limit of 10µM; acceptable for routine analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Direct Quantum Dynamics Using Grid-Based Wave Function Propagation and Machine-Learned Potential Energy Surfaces.

    Science.gov (United States)

    Richings, Gareth W; Habershon, Scott

    2017-09-12

    We describe a method for performing nuclear quantum dynamics calculations using standard, grid-based algorithms, including the multiconfiguration time-dependent Hartree (MCTDH) method, where the potential energy surface (PES) is calculated "on-the-fly". The method of Gaussian process regression (GPR) is used to construct a global representation of the PES using values of the energy at points distributed in molecular configuration space during the course of the wavepacket propagation. We demonstrate this direct dynamics approach for both an analytical PES function describing 3-dimensional proton transfer dynamics in malonaldehyde and for 2- and 6-dimensional quantum dynamics simulations of proton transfer in salicylaldimine. In the case of salicylaldimine we also perform calculations in which the PES is constructed using Hartree-Fock calculations through an interface to an ab initio electronic structure code. In all cases, the results of the quantum dynamics simulations are in excellent agreement with previous simulations of both systems yet do not require prior fitting of a PES at any stage. Our approach (implemented in a development version of the Quantics package) opens a route to performing accurate quantum dynamics simulations via wave function propagation of many-dimensional molecular systems in a direct and efficient manner.

  3. Alkaline direct ethanol fuel cell performance using alkali-impregnated polyvinyl alcohol/functionalized carbon nano-tube solid electrolytes

    Science.gov (United States)

    Huang, Chien-Yi; Lin, Jia-Shiun; Pan, Wen-Han; Shih, Chao-Ming; Liu, Ying-Ling; Lue, Shingjiang Jessie

    2016-01-01

    This study investigates the application of a polyvinyl alcohol (PVA)/functionalized carbon nano-tubes (m-CNTs) composite in alkaline direct ethanol fuel cells (ADEFC). The m-CNTs are functionalized with PVA using the ozone mediation method, and the PVA composite containing the modified CNTs is prepared. Adding m-CNT into the PVA matrix enhances the alkaline uptake and the ionic conductivity of the KOH-doped electrolyte. Meanwhile, the m-CNT-containing membrane exhibited a lower swelling ratio and suppressed ethanol permeability compared to the pristine PVA film. The optimal condition for the ADEFC is determined to be under operation at an anode feed of 3 M ethanol in a 5 M KOH solution (at a flow rate of 5 cm3 min-1) with a cathode feed of moisturized oxygen (with a flow rate of 100 cm3 min-1) and the KOH-doped PVA/m-CNT electrolyte. We achieved a peak power density value of 65 mW cm-2 at 60 °C, which is the highest among the ADEFC literature data and several times higher than the proton-exchange direct ethanol fuel cells using sulfonated membrane electrolytes. Therefore, the KOH-doped PVA/m-CNT electrolyte is a suitable solid electrolyte for ADEFCs and has potential for commercialization in alkaline fuel cell applications.

  4. Thermoelastic Theory for the Response of Materials Functionally Graded in Two Directions with Applications to the Free-Edge Problem

    Science.gov (United States)

    Aboudi, Jacob; Pindera, Marek-Jerzy; Arnold, Steven M.

    1995-01-01

    A recently developed micromechanical theory for the thermoelastic response of functionally graded composites with nonuniform fiber spacing in the through-thickness direction is further extended to enable analysis of material architectures characterized by arbitrarily nonuniform fiber spacing in two directions. In contrast to currently employed micromechanical approaches applied to functionally graded materials, which decouple the local and global effects by assuming the existence of a representative volume element at every point within the composite, the new theory explicitly couples the local and global effects. The analytical development is based on volumetric averaging of the various field quantities, together with imposition of boundary and interfacial conditions in an average sense. Results are presented that illustrate the capability of the derived theory to capture local stress gradients at the free edge of a laminated composite plate due to the application of a uniform temperature change. It is further shown that it is possible to reduce the magnitude of these stress concentrations by a proper management of the microstructure of the composite plies near the free edge. Thus by an appropriate tailoring of the microstructure it is possible to reduce or prevent the likelihood of delamination at free edges of standard composite laminates.

  5. Scenario-based energy efficiency and productivity in China: A non-radial directional distance function analysis

    International Nuclear Information System (INIS)

    Wang, H.; Zhou, P.; Zhou, D.Q.

    2013-01-01

    Improving energy efficiency and productivity is one of the most cost-effective ways for achieving the sustainable development target in China. This paper employs non-radial directional distance function approach to empirically investigate energy efficiency and energy productivity by including CO 2 emissions as an undesirable output. Three production scenarios, namely energy conservation (EC), energy conservation and emission reduction (ECER), and energy conservation, emission reduction and economic growth (ECEREG), are specified to assess China's energy efficiency and productivity growth during the period of Eleventh Five-Year Plan. Our empirical results show that there exist substantial differences in China's total-factor energy efficiency and productivity under different scenarios. Under the ECEREG scenario, the national average total-factor energy efficiency score was 0.6306 in 2005–2010, while the national average total-factor energy productivity increased by 0.27% annually during the period. The main driving force for energy productivity growth in China was energy technological change rather than energy efficiency change. - Highlights: • China's regional energy efficiency and productivity in 2005–2010 are evaluated. • Three production scenarios are considered. • Non-radial directional distance function with CO 2 emissions is employed. • Technological change is the main driver for China's energy productivity growth

  6. Realistic PIC modelling of laser-plasma interaction: a direct implicit method with adjustable damping and high order weight functions

    International Nuclear Information System (INIS)

    Drouin, M.

    2009-11-01

    This research thesis proposes a new formulation of the relativistic implicit direct method, based on the weak formulation of the wave equation which is solved by means of a Newton algorithm. The first part of this thesis deals with the properties of the explicit particle-in-cell (PIC) methods: properties and limitations of an explicit PIC code, linear analysis of a numerical plasma, numerical heating phenomenon, interest of a higher order interpolation function, and presentation of two applications in high density relativistic laser-plasma interaction. The second and main part of this report deals with adapting the direct implicit method to laser-plasma interaction: presentation of the state of the art, formulating of the direct implicit method, resolution of the wave equation. The third part concerns various numerical and physical validations of the ELIXIRS code: case of laser wave propagation in vacuum, demonstration of the adjustable damping which is a characteristic of the proposed algorithm, influence of space-time discretization on energy conservation, expansion of a thermal plasma in vacuum, two cases of plasma-beam unsteadiness in relativistic regime, and then a case of the overcritical laser-plasma interaction

  7. Electrochemically Functionalized Seamless Three-Dimensional Graphene-Carbon Nanotube Hybrid for Direct Electron Transfer of Glucose Oxidase and Bioelectrocatalysis.

    Science.gov (United States)

    Terse-Thakoor, Trupti; Komori, Kikuo; Ramnani, Pankaj; Lee, Ilkeun; Mulchandani, Ashok

    2015-12-01

    Three-dimensional seamless chemical vapor deposition (CVD) grown graphene-carbon nanotubes (G-CNT) hybrid film has been studied for its potential in achieving direct electron transfer (DET) of glucose oxidase (GOx) and its bioelectrocatalytic activity in glucose detection. A two-step CVD method was employed for the synthesis of seamless G-CNT hybrid film where CNTs are grown on already grown graphene film on copper foil using iron as a catalyst. Physical characterization using SEM and TEM show uniform dense coverage of multiwall carbon nanotubes (MWCNT) grown directly on graphene with seamless contacts. The G-CNT hybrid film was electrochemically modified to introduce oxygenated functional groups for DET favorable immobilization of GOx. Pristine and electrochemically functionalized G-CNT film was characterized by electrochemical impedance spectroscopy (EIS), cyclic voltammetry, X-ray photoelectron-spectroscopy, and Raman spectroscopy. The DET between GOx and electrochemically oxidized G-CNT electrode was studied using cyclic voltammetry which showed a pair of well-defined and quasi-reversible redox peaks with a formal potential of -459 mV at pH 7 corresponding to the redox site of GOx. The constructed electrode detected glucose concentration over the clinically relevant range of 2-8 mM with the highest sensitivity of 19.31 μA/mM/cm(2) compared to reported composite hybrid electrodes of graphene oxide and CNTs. Electrochemically functionalized CVD grown seamless G-CNT structure used in this work has potential to be used for development of artificial mediatorless redox enzyme based biosensors and biofuel cells.

  8. An Amphipathic Helix Directs Cellular Membrane Curvature Sensing and Function of the BAR Domain Protein PICK1.

    Science.gov (United States)

    Herlo, Rasmus; Lund, Viktor K; Lycas, Matthew D; Jansen, Anna M; Khelashvili, George; Andersen, Rita C; Bhatia, Vikram; Pedersen, Thomas S; Albornoz, Pedro B C; Johner, Niklaus; Ammendrup-Johnsen, Ina; Christensen, Nikolaj R; Erlendsson, Simon; Stoklund, Mikkel; Larsen, Jannik B; Weinstein, Harel; Kjærulff, Ole; Stamou, Dimitrios; Gether, Ulrik; Madsen, Kenneth L

    2018-05-15

    BAR domains are dimeric protein modules that sense, induce, and stabilize lipid membrane curvature. Here, we show that membrane curvature sensing (MCS) directs cellular localization and function of the BAR domain protein PICK1. In PICK1, and the homologous proteins ICA69 and arfaptin2, we identify an amphipathic helix N-terminal to the BAR domain that mediates MCS. Mutational disruption of the helix in PICK1 impaired MCS without affecting membrane binding per se. In insulin-producing INS-1E cells, super-resolution microscopy revealed that disruption of the helix selectively compromised PICK1 density on insulin granules of high curvature during their maturation. This was accompanied by reduced hormone storage in the INS-1E cells. In Drosophila, disruption of the helix compromised growth regulation. By demonstrating size-dependent binding on insulin granules, our finding highlights the function of MCS for BAR domain proteins in a biological context distinct from their function, e.g., at the plasma membrane during endocytosis. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Phospholipids as an alternative to direct covalent coupling: surface functionalization of nanoporous alumina for protein recognition and purification.

    Science.gov (United States)

    Lazzara, Thomas D; Behn, Daniela; Kliesch, Torben-Tobias; Janshoff, Andreas; Steinem, Claudia

    2012-01-15

    Anodic aluminum oxide (AAO) substrates with aligned, cylindrical, non-intersecting pores with diameters of 75 nm and depths of 3.5 or 10 μm were functionalized with lipid monolayers harboring different receptor lipids. AAO was first functionalized with dodecyl-trichlorosilane, followed by fusion of small unilamellar vesicles (SUVs) forming a lipid monolayer. The SUVs' lipid composition was transferred onto the AAO surface, allowing us to control the surface receptor density. Owing to the optical transparency of the AAO, the overall vesicle spreading process and subsequent protein binding to the receptor-doped lipid monolayers could be investigated in situ by optical waveguide spectroscopy (OWS). SUV spreading occurred at the pore-rim interface, followed by lateral diffusion of lipids within the pore-interior surface until homogeneous coverage was achieved with a lipid monolayer. The functionality of the system was demonstrated through streptavidin binding onto a biotin-DOPE containing POPC membrane, showing maximum protein coverage at 10 mol% of biotin-DOPE. The system enabled us to monitor in real-time the selective extraction of two histidine-tagged proteins, PIGEA14 (14 kDa) and ezrin (70 kDa), directly from cell lysate solutions using a DOGS-NTA(Ni)/DOPC (1:9) membrane. The purification process including protein binding and elution was monitored by OWS and confirmed by SDS-PAGE. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Influence of Functionality on Direct Arylation of Model Systems as a Route Toward Fluorinated Copolymers via Direct Arylation Polymerization (DArP)

    DEFF Research Database (Denmark)

    Livi, Francesco; Gobalasingham, Nemal S.; Bundgaard, Eva

    2015-01-01

    A screening of direct arylation conditions on amodel small molecule system is carried out to develop suitableconditions for the direct arylation polymerization (DArP) of fluorinatedcopolymers, which are incompatible with conditionspreviously utilized successfully for nonfluorinated systems. Themo......,4-phenylene)dithiophene. Polymers arefree of β-defects and significant homocoupling. This work furtherunderscores the attractive simplicity, relevance, and easeof DArP while reconfirming its broad compatibility withincreasingly popular fluorinated copolymers....

  11. Enhancement of Cortical Excitability and Lower Limb Motor Function in Patients With Stroke by Transcranial Direct Current Stimulation.

    Science.gov (United States)

    Chang, Min Cheol; Kim, Dae Yul; Park, Dae Hwan

    2015-01-01

    Motor dysfunction in the lower limbs is a common sequela in stroke patients. We used transcranial magnetic stimulation (TMS) to determine if applying transcranial direct current stimulation (tDCS) to the primary motor cortex helps enhance cortical excitability. Furthermore, we evaluate if combination anodal tDCS and conventional physical therapy improves motor function in the lower limbs. Twenty-four patients with early-stage stroke were randomly assigned to 2 groups: 1) the tDCS group, in which patients received 10 sessions of anodal tDCS and conventional physical therapy; and 2) the sham group, in which patients received 10 sessions of sham stimulation and conventional physical therapy. One day before and after intervention, the motor-evoked potential (MEP) of the affected tibialis anterior muscle was evaluated and motor function was assessed using the lower limb subscale of the Fugl-Meyer Assessment (FMA-LE), lower limb Motricity Index (MI-LE), Functional Ambulatory Category (FAC), Berg Balance Scale (BBS), and gait analysis. The MEPs in the tDCS group became shorter in latency and higher in amplitude after intervention in comparison with the sham group. Improvements in FMA-LE and MI-LE were greater in the tDCS group, but no significant differences in FAC or BBS scores were found. Also, the changes observed on the gait analyses did not significantly differ between the tDCS and sham groups. Combination anodal tDCS and conservative physical therapy appears to be a beneficial therapeutic modality for improving motor function in the lower limbs in patients with subacute stroke. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Eosin Y as a Direct Hydrogen Atom Transfer Photocatalyst for the Functionalization of C-H Bonds.

    Science.gov (United States)

    Fan, Xuan-Zi; Rong, Jia-Wei; Wu, Hao-Lin; Zhou, Quan; Deng, Hong-Ping; Tan, Jin Da; Xue, Cheng-Wen; Wu, Li-Zhu; Tao, Hai-Rong; Wu, Jie

    2018-05-02

    Eosin Y, a well-known economical alternative to metal catalysts in visible-light-driven single-electron transfer-based organic transformations, can behave as an effective direct hydrogen atom transfer catalyst for C-H activation. Using the alkylation of C-H bonds with electron-deficient alkenes as a model study revealed an extremely broad substrate scope, enabling easy access to a variety of important synthons. This eosin Y-based photocatalytic hydrogen atom transfer strategy is promising for diverse functionalization of a wide range of native C-H bonds in a green and sustainable manner. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Functional interaction between right parietal and bilateral frontal cortices during visual search tasks revealed using functional magnetic imaging and transcranial direct current stimulation.

    Directory of Open Access Journals (Sweden)

    Amanda Ellison

    Full Text Available The existence of a network of brain regions which are activated when one undertakes a difficult visual search task is well established. Two primary nodes on this network are right posterior parietal cortex (rPPC and right frontal eye fields. Both have been shown to be involved in the orientation of attention, but the contingency that the activity of one of these areas has on the other is less clear. We sought to investigate this question by using transcranial direct current stimulation (tDCS to selectively decrease activity in rPPC and then asking participants to perform a visual search task whilst undergoing functional magnetic resonance imaging. Comparison with a condition in which sham tDCS was applied revealed that cathodal tDCS over rPPC causes a selective bilateral decrease in frontal activity when performing a visual search task. This result demonstrates for the first time that premotor regions within the frontal lobe and rPPC are not only necessary to carry out a visual search task, but that they work together to bring about normal function.

  14. Echocardiographic assessment with right ventricular function improvement following ultrasound-accelerated catheter-directed thrombolytic therapy in submassive pulmonary embolism.

    Science.gov (United States)

    Doheny, Charles; Gonzalez, Lorena; Duchman, Stanley M; Varon, Joseph; Bechara, Carlos F; Cheung, Mathew; Lin, Peter H

    2018-06-01

    Introduction The objective of this study was to evaluate the efficacy of ultrasound-accelerated catheter-directed thrombolytic therapy in patients with submassive pulmonary embolism. Methods Clinical records of 46 patients with submassive pulmonary embolism who underwent ultrasound-accelerated catheter-directed pulmonary thrombolysis using tissue plasminogen activator, from 2007 to 2017, were analyzed. All patients experienced clinical symptoms with computed tomography evidence of pulmonary thrombus burden. Right ventricular dysfunction was present in all patients by echocardiographic finding of right ventricle-to-left ventricle ratio > 0.9. Treatment outcome, procedural complications, right ventricular pressures, and thrombus clearance were evaluated. Follow-up evaluation included echocardiographic assessment of right ventricle-to-left ventricle ratio at one month, six months, and one year. Results Technical success was achieved in all patients ( n = 46, 100%). Our patients received an average of 18.4 ± 4.7 mg of tissue plasminogen activator using ultrasound-accelerated thrombolytic catheter with an average infusion time of 16.5± 5.4 h. Clinical success was achieved in all patients (100%). Significant reduction of mean pulmonary artery pressure occurred following the treatment, which decreased from 36 ± 8 to 21 ± 5 mmHg ( p right ventricular dysfunction based on echocardiographic assessment. The right ventricle-to-left ventricle ratio decreased from 1.32 ± 0.18 to 0.91 ± 0.13 at the time of hospital discharge ( p right ventricular function remained improved at 6 months and 12 months of follow-up, as right ventricle-to-left ventricle ratio were 0.92 ± 0.14 ( p right ventricular function in patients with submassive pulmonary embolism.

  15. Nonlocal electron transport: direct and Greens function solution and comparison of our model with the SNB model

    Science.gov (United States)

    Colombant, Denis; Manheimer, Wallace; Schmitt, Andrew J.

    2013-10-01

    At least two models, ours and SNB (Schurtz-Nicolai-Busquet), and two methods of solution, direct numerical solution (DS) and Greens function (GF) are being used in multi-dimensional radiation hydrodynamics codes. We present results of a laser target implosion using both methods of solution. Although our model and SNB differ in some physical content, direct comparisons have been non-existent up to now. However a paper by Marocchino et al. has recently presented the results of two nanosecond-time-scale test problems, showing that the preheat calculated by the two models are different by about three orders of magnitude. We have rerun these problems and we find much less difference between the two than they do. One can show analytically that the results should be quite similar and are about an order of magnitude less than the maximum, and two orders of magnitude more than the minimum preheating in. We have been able to trace the somewhat different results back to the different physical assumptions made in each model. Work supported by DoE-NNSA and ONR.

  16. Direct interaction of TFIIB and the IE protein of equine herpesvirus 1 is required for maximal trans-activation function

    International Nuclear Information System (INIS)

    Albrecht, Randy A.; Jang, Hyung K.; Kim, Seong K.; O'Callaghan, Dennis J.

    2003-01-01

    Recently, we reported that the immediate-early (IE) protein of equine herpesvirus 1 (EHV-1) associates with transcription factor TFIIB [J. Virol. 75 (2001), 10219]. In the current study, the IE protein purified as a glutathione-S-transferase (GST) fusion protein was shown to interact directly with purified TFIIB in GST-pulldown assays. A panel of TFIIB mutants employed in protein-binding assays revealed that residues 125 to 174 within the first direct repeat of TFIIB mediate its interaction with the IE protein. This interaction is physiologically relevant as transient transfection assays demonstrated that (1) exogenous native TFIIB did not perturb IE protein function, and (2) ectopic expression of a TFIIB mutant that lacked the IE protein interactive domain significantly diminished the ability of the IE protein to trans-activate EHV-1 promoters. These results suggest that an interaction of the IE protein with TFIIB is an important aspect of the regulatory role of the IE protein in the trans-activation of EHV-1 promoters

  17. Does functional MRI detect activation in white matter? A review of emerging evidence, issues, and future directions

    Science.gov (United States)

    Gawryluk, Jodie R.; Mazerolle, Erin L.; D'Arcy, Ryan C. N.

    2014-01-01

    Functional magnetic resonance imaging (fMRI) is a non-invasive technique that allows for visualization of activated brain regions. Until recently, fMRI studies have focused on gray matter. There are two main reasons white matter fMRI remains controversial: (1) the blood oxygen level dependent (BOLD) fMRI signal depends on cerebral blood flow and volume, which are lower in white matter than gray matter and (2) fMRI signal has been associated with post-synaptic potentials (mainly localized in gray matter) as opposed to action potentials (the primary type of neural activity in white matter). Despite these observations, there is no direct evidence against measuring fMRI activation in white matter and reports of fMRI activation in white matter continue to increase. The questions underlying white matter fMRI activation are important. White matter fMRI activation has the potential to greatly expand the breadth of brain connectivity research, as well as improve the assessment and diagnosis of white matter and connectivity disorders. The current review provides an overview of the motivation to investigate white matter fMRI activation, as well as the published evidence of this phenomenon. We speculate on possible neurophysiologic bases of white matter fMRI signals, and discuss potential explanations for why reports of white matter fMRI activation are relatively scarce. We end with a discussion of future basic and clinical research directions in the study of white matter fMRI. PMID:25152709

  18. Inverse and direct transfer functions for the fatigue follow-up of piping systems submitted to stratification

    International Nuclear Information System (INIS)

    Guyette, M.; De Smet, M.

    1995-01-01

    In this paper we outline a methodology to assess the fatigue induced in piping systems submitted to thermal stratification. More specifically, the transformation from the measured outer wall temperature time histories to stress time histories in any point of the line is treated.By means of inverse transfer functions, the fluid temperature distribution is calculated from the outside wall temperatures measured in a limited number of temperature sections. Using direct transfer functions, the local stresses due to stratification may be determined as well as the pipe free curvatures and the pipe free axial strains. Using a finite beam element model of the line, the global response of the line (in terms of displacements or stresses) due to the applied curvatures, axial strains, end point displacements, internal pressure and possible contacts with the pipe environment may be determined.The method is illustrated for the surge lines of the Doel 2 and Doel 4 nuclear power plants. An excellent correlation is found between measured and calculated displacements. Typical stress time histories are shown for a plant cool down. ((orig.))

  19. Histological Evidence of the Osseointegration of Fractured Direct Metal Laser Sintering Implants Retrieved after 5 Years of Function

    Directory of Open Access Journals (Sweden)

    Francesco Mangano

    2017-01-01

    Full Text Available Background. Direct metal laser sintering (DMLS is an additive manufacturing technique that allows the fabrication of dental implants layer by layer through the laser fusion of titanium microparticles. The surface of DMLS implants is characterized by a high open porosity with interconnected pores of different sizes; therefore, it has the potential to enhance and accelerate bone healing. To date, however, there are no histologic/histomorphometric studies in the literature evaluating the interface between bone and DMLS implants in the long-term. Purpose. To evaluate the interface between bone and DMLS implants retrieved after 5 years of functional loading. Methods. Two fractured DMLS implants were retrieved from the human jaws, using a 5 mm trephine bur. Both the implants were clinically stable and functioned regularly before fracture. The specimens were processed for histologic/histomorphometric evaluation; the bone-to-implant contact (BIC% was calculated. Results. Compact, mature lamellar bone was found over most of the DMLS implants in close contact with the implant surface; the histomorphometric evaluation showed a mean BIC% of 66.1% (±4.5%. Conclusions. The present histologic/histomorphometric study showed that DMLS implants were well integrated in bone, after 5 years of loading, with the peri-implant bone undergoing continuous remodeling at the interface.

  20. Histological Evidence of the Osseointegration of Fractured Direct Metal Laser Sintering Implants Retrieved after 5 Years of Function

    Science.gov (United States)

    Piattelli, Adriano

    2017-01-01

    Background Direct metal laser sintering (DMLS) is an additive manufacturing technique that allows the fabrication of dental implants layer by layer through the laser fusion of titanium microparticles. The surface of DMLS implants is characterized by a high open porosity with interconnected pores of different sizes; therefore, it has the potential to enhance and accelerate bone healing. To date, however, there are no histologic/histomorphometric studies in the literature evaluating the interface between bone and DMLS implants in the long-term. Purpose To evaluate the interface between bone and DMLS implants retrieved after 5 years of functional loading. Methods Two fractured DMLS implants were retrieved from the human jaws, using a 5 mm trephine bur. Both the implants were clinically stable and functioned regularly before fracture. The specimens were processed for histologic/histomorphometric evaluation; the bone-to-implant contact (BIC%) was calculated. Results Compact, mature lamellar bone was found over most of the DMLS implants in close contact with the implant surface; the histomorphometric evaluation showed a mean BIC% of 66.1% (±4.5%). Conclusions The present histologic/histomorphometric study showed that DMLS implants were well integrated in bone, after 5 years of loading, with the peri-implant bone undergoing continuous remodeling at the interface. PMID:28929117

  1. Histological Evidence of the Osseointegration of Fractured Direct Metal Laser Sintering Implants Retrieved after 5 Years of Function.

    Science.gov (United States)

    Mangano, Francesco; Mangano, Carlo; Piattelli, Adriano; Iezzi, Giovanna

    2017-01-01

    Direct metal laser sintering (DMLS) is an additive manufacturing technique that allows the fabrication of dental implants layer by layer through the laser fusion of titanium microparticles. The surface of DMLS implants is characterized by a high open porosity with interconnected pores of different sizes; therefore, it has the potential to enhance and accelerate bone healing. To date, however, there are no histologic/histomorphometric studies in the literature evaluating the interface between bone and DMLS implants in the long-term. To evaluate the interface between bone and DMLS implants retrieved after 5 years of functional loading. Two fractured DMLS implants were retrieved from the human jaws, using a 5 mm trephine bur. Both the implants were clinically stable and functioned regularly before fracture. The specimens were processed for histologic/histomorphometric evaluation; the bone-to-implant contact (BIC%) was calculated. Compact, mature lamellar bone was found over most of the DMLS implants in close contact with the implant surface; the histomorphometric evaluation showed a mean BIC% of 66.1% (±4.5%). The present histologic/histomorphometric study showed that DMLS implants were well integrated in bone, after 5 years of loading, with the peri-implant bone undergoing continuous remodeling at the interface.

  2. Direct coupling of electromembrane extraction to mass spectrometry - Advancing the probe functionality toward measurements of zwitterionic drug metabolites.

    Science.gov (United States)

    Rye, Torstein Kige; Fuchs, David; Pedersen-Bjergaard, Stig; Petersen, Nickolaj Jacob

    2017-08-29

    A triple-flow electromembrane extraction (EME) probe was developed and coupled directly to electrospray-ionization mass spectrometry (ESI-MS). Metabolic reaction mixtures (pH 7.4) containing drug substances and related metabolites were continuously drawn (20 μL/min) into the EME probe in one flow channel, and mixed inside the probe with 7.5 μL min -1 of 1 M formic acid as make-up flow from a second flow channel. Following this acidification, the drug substances and their related metabolites were continuously extracted by EME at 400 V, across a supported liquid membrane (SLM) comprising 2-nitrophenyl octyl ether (and for some experiments containing 30% triphenyl phosphate (TPP)), and into 20 μL min -1 of formic acid as acceptor phase, which was introduced through a third flow channel. The acceptor phase was pumped directly to the MS system, and the ion intensity of extracted analytes was followed continuously as function of time. The triple-flow EME probe was used for co-extraction of positively charged parent drugs and their zwitterionic drug metabolites (hydroxyzine and its carboxylic acid metabolite cetirizine; and vortioxetine and its carboxylic acid metabolite Lu AA34443). While the zwitterionic metabolites could not be extracted at pH 7.4, it was shown that by acidifying the sample solution the zwitterionic metabolites could be extracted effectively. Various extraction parameters like make-up flow, extraction voltage and SLM composition were optimized for simultaneous extraction of parent drugs and metabolites. It was found that TPP added to the SLM improved extraction efficiencies of certain drug metabolites. Finally the optimized and characterized triple-flow EME probe was used for online studying the in-vitro metabolism of hydroxyzine and vortioxetine by rat liver microsomes. Due to the automated pre-extraction acidification of the rat liver microsomal solutions, it was possible to continuously monitor formation of the zwitterionic drug

  3. Transcranial direct current stimulation (tDCS) for improving function and activities of daily living in patients after stroke.

    Science.gov (United States)

    Elsner, Bernhard; Kugler, Joachim; Pohl, Marcus; Mehrholz, Jan

    2013-11-15

    Stroke is one of the leading causes of disability worldwide. Functional impairment resulting in poor performance in activities of daily living (ADLs) among stroke survivors is common. Current rehabilitation approaches have limited effectiveness in improving ADL performance and function after stroke, but a possible adjunct to stroke rehabilitation might be non-invasive brain stimulation by transcranial direct current stimulation (tDCS) to modulate cortical excitability and hence to improve ADL performance and function. To assess the effects of tDCS on generic activities of daily living (ADLs) and motor function in people with stroke. We searched the Cochrane Stroke Group Trials Register (March 2013), the Cochrane Central Register of Controlled Trials (CENTRAL) (The Cochrane Library, May 2013), MEDLINE (1948 to May 2013), EMBASE (1980 to May 2013), CINAHL (1982 to May 2013), AMED (1985 to May 2013), Science Citation Index (1899 to May 2013) and four additional databases. In an effort to identify further published, unpublished and ongoing trials, we searched trials registers and reference lists, handsearched conference proceedings and contacted authors and equipment manufacturers. We included only randomised controlled trials (RCTs) and randomised controlled cross-over trials (from which we analysed only the first period as a parallel-group design) that compared tDCS versus control in adults with stroke for improving ADL performance and function. Two review authors independently assessed trial quality (JM and MP) and extracted data (BE and JM). If necessary, we contacted study authors to ask for additional information. We collected information on dropouts and adverse events from the trial reports. We included 15 studies involving a total of 455 participants. Analysis of six studies involving 326 participants regarding our primary outcome, ADL, showed no evidence of an effect in favour of tDCS at the end of the intervention phase (mean difference (MD) 5.31 Barthel

  4. Functional characterization of Dihydroflavonol-4-reductase in anthocyanin biosynthesis of purple sweet potato underlies the direct evidence of anthocyanins function against abiotic stresses.

    Science.gov (United States)

    Wang, Hongxia; Fan, Weijuan; Li, Hong; Yang, Jun; Huang, Jirong; Zhang, Peng

    2013-01-01

    Dihydroflavonol-4-reductase (DFR) is a key enzyme in the catalysis of the stereospecific reduction of dihydroflavonols to leucoanthocyanidins in anthocyanin biosynthesis. In the purple sweet potato (Ipomoea batatas Lam.) cv. Ayamurasaki, expression of the IbDFR gene was strongly associated with anthocyanin accumulation in leaves, stems and roots. Overexpression of the IbDFR in Arabidopsis tt3 mutants fully complemented the pigmentation phenotype of the seed coat, cotyledon and hypocotyl. Downregulation of IbDFR expression in transgenic sweet potato (DFRi) using an RNAi approach dramatically reduced anthocyanin accumulation in young leaves, stems and storage roots. In contrast, the increase of flavonols quercetin-3-O-hexose-hexoside and quercetin-3-O-glucoside in the leaves and roots of DFRi plants is significant. Therefore, the metabolic pathway channeled greater flavonol influx in the DFRi plants when their anthocyanin and proanthocyanidin accumulation were decreased. These plants also displayed reduced antioxidant capacity compared to the wild type. After 24 h of cold treatment and 2 h recovery, the wild-type plants were almost fully restored to the initial phenotype compared to the slower recovery of DFRi plants, in which the levels of electrolyte leakage and hydrogen peroxide accumulation were dramatically increased. These results provide direct evidence of anthocyanins function in the protection against oxidative stress in the sweet potato. The molecular characterization of the IbDFR gene in the sweet potato not only confirms its important roles in flavonoid metabolism but also supports the protective function of anthocyanins of enhanced scavenging of reactive oxygen radicals in plants under stressful conditions.

  5. Functional characterization of Dihydroflavonol-4-reductase in anthocyanin biosynthesis of purple sweet potato underlies the direct evidence of anthocyanins function against abiotic stresses.

    Directory of Open Access Journals (Sweden)

    Hongxia Wang

    Full Text Available Dihydroflavonol-4-reductase (DFR is a key enzyme in the catalysis of the stereospecific reduction of dihydroflavonols to leucoanthocyanidins in anthocyanin biosynthesis. In the purple sweet potato (Ipomoea batatas Lam. cv. Ayamurasaki, expression of the IbDFR gene was strongly associated with anthocyanin accumulation in leaves, stems and roots. Overexpression of the IbDFR in Arabidopsis tt3 mutants fully complemented the pigmentation phenotype of the seed coat, cotyledon and hypocotyl. Downregulation of IbDFR expression in transgenic sweet potato (DFRi using an RNAi approach dramatically reduced anthocyanin accumulation in young leaves, stems and storage roots. In contrast, the increase of flavonols quercetin-3-O-hexose-hexoside and quercetin-3-O-glucoside in the leaves and roots of DFRi plants is significant. Therefore, the metabolic pathway channeled greater flavonol influx in the DFRi plants when their anthocyanin and proanthocyanidin accumulation were decreased. These plants also displayed reduced antioxidant capacity compared to the wild type. After 24 h of cold treatment and 2 h recovery, the wild-type plants were almost fully restored to the initial phenotype compared to the slower recovery of DFRi plants, in which the levels of electrolyte leakage and hydrogen peroxide accumulation were dramatically increased. These results provide direct evidence of anthocyanins function in the protection against oxidative stress in the sweet potato. The molecular characterization of the IbDFR gene in the sweet potato not only confirms its important roles in flavonoid metabolism but also supports the protective function of anthocyanins of enhanced scavenging of reactive oxygen radicals in plants under stressful conditions.

  6. Toward three-dimensional microelectronic systems: directed self-assembly of silicon microcubes via DNA surface functionalization.

    Science.gov (United States)

    Lämmerhardt, Nico; Merzsch, Stephan; Ledig, Johannes; Bora, Achyut; Waag, Andreas; Tornow, Marc; Mischnick, Petra

    2013-07-02

    The huge and intelligent processing power of three-dimensional (3D) biological "processors" like the human brain with clock speeds of only 0.1 kHz is an extremely fascinating property, which is based on a massively parallel interconnect strategy. Artificial silicon microprocessors are 7 orders of magnitude faster. Nevertheless, they do not show any indication of intelligent processing power, mostly due to their very limited interconnectivity. Massively parallel interconnectivity can only be realized in three dimensions. Three-dimensional artificial processors would therefore be at the root of fabricating artificially intelligent systems. A first step in this direction would be the self-assembly of silicon based building blocks into 3D structures. We report on the self-assembly of such building blocks by molecular recognition, and on the electrical characterization of the formed assemblies. First, planar silicon substrates were functionalized with self-assembling monolayers of 3-aminopropyltrimethoxysilane for coupling of oligonucleotides (single stranded DNA) with glutaric aldehyde. The oligonucleotide immobilization was confirmed and quantified by hybridization with fluorescence-labeled complementary oligonucleotides. After the individual processing steps, the samples were analyzed by contact angle measurements, ellipsometry, atomic force microscopy, and fluorescence microscopy. Patterned DNA-functionalized layers were fabricated by microcontact printing (μCP) and photolithography. Silicon microcubes of 3 μm edge length as model objects for first 3D self-assembly experiments were fabricated out of silicon-on-insulator (SOI) wafers by a combination of reactive ion etching (RIE) and selective wet etching. The microcubes were then surface-functionalized using the same protocol as on planar substrates, and their self-assembly was demonstrated both on patterned silicon surfaces (88% correctly placed cubes), and to cube aggregates by complementary DNA

  7. Direct laser metal deposition of WC/Co/Cr powder by means of the functionally graded materials strategy

    Science.gov (United States)

    Angelastro, A.; Campanelli, S. L.

    2017-12-01

    One of the many applications of direct laser metal deposition (DLMD) is the realization of multilayer thick coatings having particular mechanical characteristics, such as high hardness. The objective of this work was to obtain a thick, very hard and wear resistant coating, containing a high percentage of tungsten carbide (WC), on an AISI 304 stainless steel substrate. In order to achieve this result, a tungsten carbide-cobalt-chrome (WC/Co/Cr) powder was processed by the DLMD method. WC/Co/Cr is a composite widely used as a wear-resistant material for cutting tools, molds, coatings and other severe applications. Because of its high hardness, poor ductility and low thermal expansion coefficient, depositing this material directly on the stainless steel substrate is very difficult. In order to overcome this problem, the strategy of functionally graded materials (FGM) was used. Colmonoy 227-F nickel alloy was chosen for this purpose in order to generate a mixture with the WC/Co/Cr powder. Four different materials were deposited, layer by layer, by mixing Colmonoy 227-F with an increasing amount of WC/Co/Cr powders, until obtaining a thick surface coating with a maximum amount of WC of 77.4 wt%. For each powder mixture, a mathematical model was applied to calculate optimal values of translation speed and overlap percentages. A metallographic examination was performed in order to detect macro- and micro-structures of the different materials. Finally, Vickers micro-hardness was measured at various locations along the transverse section to appreciate the gradual increase of the FGM hardness, starting from the substrate and culminating at the top surface of the last deposited material.

  8. Direct Functionalization of an Acid-Terminated Nanodiamond with Azide: Enabling Access to 4-Substituted-1,2,3-Triazole-Functionalized Particles

    International Nuclear Information System (INIS)

    Kennedy, Zachary C.; Barrett, Christopher A.; Warner, Marvin G.

    2017-01-01

    Azides on the periphery of nanodiamond materials (ND) are of great utility because they have been shown to undergo Cu-catalyzed and Cu-free cycloaddition reactions with structurally diverse alkynes, affording particles tailored for applications in biology and materials science. However, current methods employed to access ND featuring azide groups typically require either harsh pretreatment procedures or multiple synthesis steps and use surface linking groups that may be susceptible to undesirable cleavage. Here in this paper we demonstrate an alternative single-step approach to producing linker-free, azide-functionalized ND. Our method was applied to low-cost, detonation-derived ND powders where surface carbonyl groups undergo silver-mediated decarboxylation and radical substitution with azide. ND with directly grafted azide groups were then treated with a variety of aliphatic, aromatic, and fluorescent alkynes to afford 1-(ND)-4-substituted-1,2,3-triazole materials under standard copper-catalyzed cycloaddition conditions. Surface modification steps were verified by characteristic infrared absorptions and elemental analyses. High loadings of triazole surface groups (up to 0.85 mmol g –1 ) were obtained as determined from thermogravimetric analysis. The azidation procedure disclosed is envisioned to become a valuable initial transformation in numerous future applications of ND.

  9. Direct Functionalization of an Acid-Terminated Nanodiamond with Azide: Enabling Access to 4-Substituted-1,2,3-Triazole-Functionalized Particles.

    Science.gov (United States)

    Kennedy, Zachary C; Barrett, Christopher A; Warner, Marvin G

    2017-03-21

    Azides on the periphery of nanodiamond materials (ND) are of great utility because they have been shown to undergo Cu-catalyzed and Cu-free cycloaddition reactions with structurally diverse alkynes, affording particles tailored for applications in biology and materials science. However, current methods employed to access ND featuring azide groups typically require either harsh pretreatment procedures or multiple synthesis steps and use surface linking groups that may be susceptible to undesirable cleavage. Here we demonstrate an alternative single-step approach to producing linker-free, azide-functionalized ND. Our method was applied to low-cost, detonation-derived ND powders where surface carbonyl groups undergo silver-mediated decarboxylation and radical substitution with azide. ND with directly grafted azide groups were then treated with a variety of aliphatic, aromatic, and fluorescent alkynes to afford 1-(ND)-4-substituted-1,2,3-triazole materials under standard copper-catalyzed cycloaddition conditions. Surface modification steps were verified by characteristic infrared absorptions and elemental analyses. High loadings of triazole surface groups (up to 0.85 mmol g -1 ) were obtained as determined from thermogravimetric analysis. The azidation procedure disclosed is envisioned to become a valuable initial transformation in numerous future applications of ND.

  10. Effect of readout direction in the edge profile on the modulation transfer function of computed radiographic systems by use of the edge method.

    Science.gov (United States)

    Tanaka, Nobukazu; Morishita, Junji; Tsuda, Norisato; Ohki, Masafumi

    2013-07-01

    We investigated the effect of the readout direction of the edge profile obtained by the edge method on the presampled modulation transfer function (MTF) in various computed radiographic (CR) systems. There were no differences in the MTFs derived from two edge profiles in the sub-scanning direction of four CR systems used in this study. On the other hand, the MTFs measured at a readout direction from the low (edge) to the high (direct exposure) exposure region were higher than those measured at a readout direction from the high to the low exposure region in the laser-beam scanning direction for three of the four CR systems. Although this phenomenon depends on the CR system, it is important to understand and indicate both MTFs at the two edge profiles in the laser-beam scanning direction for accurate assessment of the resolution property.

  11. Ordered self-assembled monolayers terminated with different chemical functional groups direct neural stem cell linage behaviours

    International Nuclear Information System (INIS)

    Yao, Shenglian; Liu, Xi; He, Jin; Wang, Xiumei; Wang, Ying; Cui, Fu-Zhai

    2016-01-01

    Neural stem cells (NSCs) have been a promising candidate for stem cell-based nerve tissue regeneration. Therefore, the design of idea biomaterials that deliver precise regulatory signals to control stem cell fate is currently a crucial issue that depends on a profound understanding of the interactions between NSCs with the surrounding micro-environment. In this work, self-assembled monolayers of alkanethiols on gold with different chemical groups, including hydroxyl (−OH), amino (−NH 2 ), carboxyl (−COOH) and methyl (−CH 3 ), were used as a simple model to study the effects of surface chemistry on NSC fate decisions. Contact angle measurement and x-ray photoelectron spectroscopy (XPS) examination implied that all types of alkanethiols self-assembled on gold into a close-packed phase structure with similar molecular densities. In this study, we evaluated NSC adhesion, migration and differentiation in response to different chemical functional groups cultured under serum-free conditions. Our studies showed that NSCs exhibited certain phenotypes with extreme sensitivity to surface chemical groups. Compared with other functional groups, the SAMs with hydroxyl end-groups provided the best micro-environment in promoting NSC migration and maintaining an undifferentiated or neuronal differentiation state.  −NH 2 surfaces directed neural stem cells into astrocytic lineages, while NSCs on  −COOH and  −CH 3 surfaces had a similar potency to differentiate into three nerve lineages. To further investigate the possible signaling pathway, the gene expression of integrin β1 and β4 were examined. The results indicated that a high expression of β1 integrin would probably have a tight correlation with the expression of nestin, which implied the stemness of NSCs, while β4 integrin seemed to correspond to the differentiated NSCs. The results presented here give useful information for the future design of biomaterials to regulate the preservation

  12. Structure-function insights into direct lipid transfer between membranes by Mmm1-Mdm12 of ERMES.

    Science.gov (United States)

    Kawano, Shin; Tamura, Yasushi; Kojima, Rieko; Bala, Siqin; Asai, Eri; Michel, Agnès H; Kornmann, Benoît; Riezman, Isabelle; Riezman, Howard; Sakae, Yoshitake; Okamoto, Yuko; Endo, Toshiya

    2018-03-05

    The endoplasmic reticulum (ER)-mitochondrial encounter structure (ERMES) physically links the membranes of the ER and mitochondria in yeast. Although the ER and mitochondria cooperate to synthesize glycerophospholipids, whether ERMES directly facilitates the lipid exchange between the two organelles remains controversial. Here, we compared the x-ray structures of an ERMES subunit Mdm12 from Kluyveromyces lactis with that of Mdm12 from Saccharomyces cerevisiae and found that both Mdm12 proteins possess a hydrophobic pocket for phospholipid binding. However in vitro lipid transfer assays showed that Mdm12 alone or an Mmm1 (another ERMES subunit) fusion protein exhibited only a weak lipid transfer activity between liposomes. In contrast, Mdm12 in a complex with Mmm1 mediated efficient lipid transfer between liposomes. Mutations in Mmm1 or Mdm12 impaired the lipid transfer activities of the Mdm12-Mmm1 complex and furthermore caused defective phosphatidylserine transport from the ER to mitochondrial membranes via ERMES in vitro. Therefore, the Mmm1-Mdm12 complex functions as a minimal unit that mediates lipid transfer between membranes. © 2018 Kawano et al.

  13. Printing low-melting-point alloy ink to directly make a solidified circuit or functional device with a heating pen.

    Science.gov (United States)

    Wang, Lei; Liu, Jing

    2014-12-08

    A new method to directly print out a solidified electronic circuit through low-melting-point metal ink is proposed. A functional pen with heating capability was fabricated. Several typical thermal properties of the alloy ink Bi 35 In 48.6 Sn 16 Zn 0.4 were measured and evaluated. Owing to the specifically selected melting point of the ink, which is slightly higher than room temperature, various electronic devices, graphics or circuits can be manufactured in a short period of time and then rapidly solidified by cooling in the surrounding air. The liquid-solid phase change mechanism of the written lines was experimentally characterized using a scanning electron microscope. In order to determine the matching substrate, wettability between the metal ink Bi 35 In 48.6 Sn 16 Zn 0.4 and several materials, including mica plate and silicone rubber, was investigated. The resistance-temperature curve of a printed resistor indicated its potential as a temperature control switch. Furthermore, the measured reflection coefficient of a printed double-diamond antenna accords well with the simulated result. With unique merits such as no pollution, no requirement for encapsulation and easy recycling, the present printing approach is an important supplement to current printed electronics and has enormous practical value in the future.

  14. Gut-directed hypnotherapy for functional abdominal pain or irritable bowel syndrome in children: a systematic review.

    Science.gov (United States)

    Rutten, Juliette M T M; Reitsma, Johannes B; Vlieger, Arine M; Benninga, Marc A

    2013-04-01

    Gut directed hypnotherapy (HT) is shown to be effective in adult functional abdominal pain (FAP) and irritable bowel syndrome (IBS) patients. We performed a systematic review to assess efficacy of HT in paediatric FAP/IBS patients. We searched Medline, Embase, PsychINFO, Cumulative Index to Nursing and Allied Health Literature databases and Cochrane Central Register of Controlled Trials for randomised controlled trials (RCT) in children with FAP or IBS, investigating efficacy of HT on the following outcomes: abdominal pain scores, quality of life, costs and school absenteeism. Three RCT comparing HT to a control treatment were included with sample sizes ranging from 22 to 52 children. We refrained from statistical pooling because of low number of studies and many differences in design and outcomes. Two studies examined HT performed by a therapist, one examined HT through self-exercises on audio CD. All trials showed statistically significantly greater improvement in abdominal pain scores among children receiving HT. One trial reported beneficial effects sustained after 1 year of follow-up. One trial reported statistically significant improvement in quality of life in the HT group. Two trials reported significant reductions in school absenteeism after HT. Therapeutic effects of HT seem superior to standard medical care in children with FAP or IBS. It remains difficult to quantify exact benefits. The need for more high quality research is evident.

  15. A methodological evaluation and predictive in silico investigation into the multi-functionality of arginine in directly compressed tablets.

    Science.gov (United States)

    ElShaer, Amr; Kaialy, Waseem; Akhtar, Noreen; Iyire, Affiong; Hussain, Tariq; Alany, Raid; Mohammed, Afzal R

    2015-10-01

    multi-functionality of ARG as filler, binder and disintegrant for directly compressed tablets. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Potential of direct metal deposition technology for manufacturing thick functionally graded coatings and parts for reactors components

    International Nuclear Information System (INIS)

    Thivillon, L.; Bertrand, Ph.; Laget, B.; Smurov, I.

    2009-01-01

    Direct metal deposition (DMD) is an automated 3D deposition process arising from laser cladding technology with co-axial powder injection to refine or refurbish parts. Recently DMD has been extended to manufacture large-size near-net-shape components. When applied for manufacturing new parts (or their refinement), DMD can provide tailored thermal properties, high corrosion resistance, tailored tribology, multifunctional performance and cost savings due to smart material combinations. In repair (refurbishment) operations, DMD can be applied for parts with a wide variety of geometries and sizes. In contrast to the current tool repair techniques such as tungsten inert gas (TIG), metal inert gas (MIG) and plasma welding, laser cladding technology by DMD offers a well-controlled heat-treated zone due to the high energy density of the laser beam. In addition, this technology may be used for preventative maintenance and design changes/up-grading. One of the advantages of DMD is the possibility to build functionally graded coatings (from 1 mm thickness and higher) and 3D multi-material objects (for example, 100 mm-sized monolithic rectangular) in a single-step manufacturing cycle by using up to 4-channel powder feeder. Approved materials are: Fe (including stainless steel), Ni and Co alloys, (Cu,Ni 10%), WC compounds, TiC compounds. The developed coatings/parts are characterized by low porosity (<1%), fine microstructure, and their microhardness is close to the benchmark value of wrought alloys after thermal treatment (Co-based alloy Stellite, Inox 316L, stainless steel 17-4PH). The intended applications concern cooling elements with complex geometry, friction joints under high temperature and load, light-weight mechanical support structures, hermetic joints, tubes with complex geometry, and tailored inside and outside surface properties, etc

  17. Use of functional near-infrared spectroscopy to monitor cortical plasticity induced by transcranial direct current stimulation

    Science.gov (United States)

    Khan, Bilal; Hervey, Nathan; Stowe, Ann; Hodics, Timea; Alexandrakis, George

    2013-03-01

    Electrical stimulation of the human cortex in conjunction with physical rehabilitation has been a valuable approach in facilitating the plasticity of the injured brain. One such method is transcranial direct current stimulation (tDCS) which is a non-invasive method to elicit neural stimulation by delivering current through electrodes placed on the scalp. In order to better understand the effects tDCS has on cortical plasticity, neuroimaging techniques have been used pre and post tDCS stimulation. Recently, neuroimaging methods have discovered changes in resting state cortical hemodynamics after the application of tDCS on human subjects. However, analysis of the cortical hemodynamic activity for a physical task during and post tDCS stimulation has not been studied to our knowledge. A viable and sensitive neuroimaging method to map changes in cortical hemodynamics during activation is functional near-infrared spectroscopy (fNIRS). In this study, the cortical activity during an event-related, left wrist curl task was mapped with fNIRS before, during, and after tDCS stimulation on eight healthy adults. Along with the fNIRS optodes, two electrodes were placed over the sensorimotor hand areas of both brain hemispheres to apply tDCS. Changes were found in both resting state cortical connectivity and cortical activation patterns that occurred during and after tDCS. Additionally, changes to surface electromyography (sEMG) measurements of the wrist flexor and extensor of both arms during the wrist curl movement, acquired concurrently with fNIRS, were analyzed and related to the transient cortical plastic changes induced by tDCS.

  18. No change in rectal sensitivity after gut-directed hypnotherapy in children with functional abdominal pain or irritable bowel syndrome.

    Science.gov (United States)

    Vlieger, A M; van den Berg, M M; Menko-Frankenhuis, C; Bongers, M E J; Tromp, E; Benninga, M A

    2010-01-01

    Gut-directed hypnotherapy (HT) has recently been shown to be highly effective in treating children with functional abdominal pain (FAP) and irritable bowel syndrome (IBS). This study was conducted to determine the extent to which this treatment success is because of an improvement in rectal sensitivity. A total of 46 patients (aged 8-18 years) with FAP (n=28) or IBS (n=18) were randomized to either 12 weeks of standard medical therapy (SMT) or HT. To assess rectal sensitivity, a pressure-controlled intermittent distension protocol (barostat) was performed before and after the therapy. Rectal sensitivity scores changed in SMT patients from 15.1+/-7.3 mm Hg at baseline to 18.6+/-8.5 mm Hg after 12 weeks of treatment (P=0.09) and in HT patients from 17.0+/-9.2 mm Hg to 22.5+/-10.1 mm Hg (P=0.09). The number of patients with rectal hypersensitivity decreased from 6 of 18 to 0 of 18 in the HT group (P=0.04) vs. 6 of 20 to 4 of 20 in the SMT group (P=0.67). No relationship was established between treatment success and rectal pain thresholds. Rectal sensitivity scores at baseline were not correlated with intensity, frequency, or duration of abdominal pain. Clinical success achieved with HT cannot be explained by improvement in rectal sensitivity. Furthermore, no association could be found between rectal barostat findings and clinical symptoms in children with FAP or IBS. Further studies are necessary to shed more light on both the role of rectal sensitivity in pediatric FAP and IBS and the mechanisms by which hypnotherapy results in improvement of clinical symptoms.

  19. Potential of direct metal deposition technology for manufacturing thick functionally graded coatings and parts for reactors components

    Energy Technology Data Exchange (ETDEWEB)

    Thivillon, L.; Bertrand, Ph.; Laget, B. [Ecole Nationale d' Ingenieurs de Saint-Etienne (ENISE), DIPI Laboratory, 58 rue Jean Parot, 42023 Saint-Etienne cedex 2 (France); Smurov, I. [Ecole Nationale d' Ingenieurs de Saint-Etienne (ENISE), DIPI Laboratory, 58 rue Jean Parot, 42023 Saint-Etienne cedex 2 (France)], E-mail: smurov@enise.fr

    2009-03-31

    Direct metal deposition (DMD) is an automated 3D deposition process arising from laser cladding technology with co-axial powder injection to refine or refurbish parts. Recently DMD has been extended to manufacture large-size near-net-shape components. When applied for manufacturing new parts (or their refinement), DMD can provide tailored thermal properties, high corrosion resistance, tailored tribology, multifunctional performance and cost savings due to smart material combinations. In repair (refurbishment) operations, DMD can be applied for parts with a wide variety of geometries and sizes. In contrast to the current tool repair techniques such as tungsten inert gas (TIG), metal inert gas (MIG) and plasma welding, laser cladding technology by DMD offers a well-controlled heat-treated zone due to the high energy density of the laser beam. In addition, this technology may be used for preventative maintenance and design changes/up-grading. One of the advantages of DMD is the possibility to build functionally graded coatings (from 1 mm thickness and higher) and 3D multi-material objects (for example, 100 mm-sized monolithic rectangular) in a single-step manufacturing cycle by using up to 4-channel powder feeder. Approved materials are: Fe (including stainless steel), Ni and Co alloys, (Cu,Ni 10%), WC compounds, TiC compounds. The developed coatings/parts are characterized by low porosity (<1%), fine microstructure, and their microhardness is close to the benchmark value of wrought alloys after thermal treatment (Co-based alloy Stellite, Inox 316L, stainless steel 17-4PH). The intended applications concern cooling elements with complex geometry, friction joints under high temperature and load, light-weight mechanical support structures, hermetic joints, tubes with complex geometry, and tailored inside and outside surface properties, etc.

  20. Potential of direct metal deposition technology for manufacturing thick functionally graded coatings and parts for reactors components

    Science.gov (United States)

    Thivillon, L.; Bertrand, Ph.; Laget, B.; Smurov, I.

    2009-03-01

    Direct metal deposition (DMD) is an automated 3D deposition process arising from laser cladding technology with co-axial powder injection to refine or refurbish parts. Recently DMD has been extended to manufacture large-size near-net-shape components. When applied for manufacturing new parts (or their refinement), DMD can provide tailored thermal properties, high corrosion resistance, tailored tribology, multifunctional performance and cost savings due to smart material combinations. In repair (refurbishment) operations, DMD can be applied for parts with a wide variety of geometries and sizes. In contrast to the current tool repair techniques such as tungsten inert gas (TIG), metal inert gas (MIG) and plasma welding, laser cladding technology by DMD offers a well-controlled heat-treated zone due to the high energy density of the laser beam. In addition, this technology may be used for preventative maintenance and design changes/up-grading. One of the advantages of DMD is the possibility to build functionally graded coatings (from 1 mm thickness and higher) and 3D multi-material objects (for example, 100 mm-sized monolithic rectangular) in a single-step manufacturing cycle by using up to 4-channel powder feeder. Approved materials are: Fe (including stainless steel), Ni and Co alloys, (Cu,Ni 10%), WC compounds, TiC compounds. The developed coatings/parts are characterized by low porosity (<1%), fine microstructure, and their microhardness is close to the benchmark value of wrought alloys after thermal treatment (Co-based alloy Stellite, Inox 316L, stainless steel 17-4PH). The intended applications concern cooling elements with complex geometry, friction joints under high temperature and load, light-weight mechanical support structures, hermetic joints, tubes with complex geometry, and tailored inside and outside surface properties, etc.

  1. The DNA repair endonuclease XPG interacts directly and functionally with the WRN helicase defective in Werner syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Trego, Kelly S.; Chernikova, Sophia B.; Davalos, Albert R.; Perry, J. Jefferson P.; Finger, L. David; Ng, Cliff; Tsai, Miaw-Sheue; Yannone, Steven M.; Tainer, John A.; Campisi, Judith; Cooper, Priscilla K.

    2011-04-20

    XPG is a structure-specific endonuclease required for nucleotide excision repair (NER). XPG incision defects result in the cancer-prone syndrome xeroderma pigmentosum, whereas truncating mutations of XPG cause the severe postnatal progeroid developmental disorder Cockayne syndrome. We show that XPG interacts directly with WRN protein, which is defective in the premature aging disorder Werner syndrome, and that the two proteins undergo similar sub-nuclear redistribution in S-phase and co-localize in nuclear foci. The co-localization was observed in mid- to late-S-phase, when WRN moves from nucleoli to nuclear foci that have been shown to contain protein markers of both stalled replication forks and telomeric proteins. We mapped the interaction between XPG and WRN to the C-terminal domains of each and show that interaction with the C-terminal domain of XPG strongly stimulates WRN helicase activity. WRN also possesses a competing DNA single-strand annealing activity that, combined with unwinding, has been shown to coordinate regression of model replication forks to form Holliday junction/chicken foot intermediate structures. We tested whether XPG stimulated WRN annealing activity and found that XPG itself has intrinsic strand annealing activity that requires the unstructured R- and C-terminal domains, but not the conserved catalytic core or endonuclease activity. Annealing by XPG is cooperative, rather than additive, with WRN annealing. Taken together, our results suggest a novel function for XPG in S-phase that is at least in part carried out coordinately with WRN, and which may contribute to the severity of the phenotypes that occur upon loss of XPG.

  2. Use of Random and Site-Directed Mutagenesis to Probe Protein Structure-Function Relationships: Applied Techniques in the Study of Helicobacter pylori.

    Science.gov (United States)

    Whitmire, Jeannette M; Merrell, D Scott

    2017-01-01

    Mutagenesis is a valuable tool to examine the structure-function relationships of bacterial proteins. As such, a wide variety of mutagenesis techniques and strategies have been developed. This chapter details a selection of random mutagenesis methods and site-directed mutagenesis procedures that can be applied to an array of bacterial species. Additionally, the direct application of the techniques to study the Helicobacter pylori Ferric Uptake Regulator (Fur) protein is described. The varied approaches illustrated herein allow the robust investigation of the structural-functional relationships within a protein of interest.

  3. Combined noninvasive language mapping by navigated transcranial magnetic stimulation and functional MRI and its comparison with direct cortical stimulation.

    Science.gov (United States)

    Ille, Sebastian; Sollmann, Nico; Hauck, Theresa; Maurer, Stefanie; Tanigawa, Noriko; Obermueller, Thomas; Negwer, Chiara; Droese, Doris; Zimmer, Claus; Meyer, Bernhard; Ringel, Florian; Krieg, Sandro M

    2015-07-01

    Repetitive navigated transcranial magnetic stimulation (rTMS) is now increasingly used for preoperative language mapping in patients with lesions in language-related areas of the brain. Yet its correlation with intraoperative direct cortical stimulation (DCS) has to be improved. To increase rTMS's specificity and positive predictive value, the authors aim to provide thresholds for rTMS's positive language areas. Moreover, they propose a protocol for combining rTMS with functional MRI (fMRI) to combine the strength of both methods. The authors performed multimodal language mapping in 35 patients with left-sided perisylvian lesions by using rTMS, fMRI, and DCS. The rTMS mappings were conducted with a picture-to-trigger interval (PTI, time between stimulus presentation and stimulation onset) of either 0 or 300 msec. The error rates (ERs; that is, the number of errors per number of stimulations) were calculated for each region of the cortical parcellation system (CPS). Subsequently, the rTMS mappings were analyzed through different error rate thresholds (ERT; that is, the ER at which a CPS region was defined as language positive in terms of rTMS), and the 2-out-of-3 rule (a stimulation site was defined as language positive in terms of rTMS if at least 2 out of 3 stimulations caused an error). As a second step, the authors combined the results of fMRI and rTMS in a predefined protocol of combined noninvasive mapping. To validate this noninvasive protocol, they correlated its results to DCS during awake surgery. The analysis by different rTMS ERTs obtained the highest correlation regarding sensitivity and a low rate of false positives for the ERTs of 15%, 20%, 25%, and the 2-out-of-3 rule. However, when comparing the combined fMRI and rTMS results with DCS, the authors observed an overall specificity of 83%, a positive predictive value of 51%, a sensitivity of 98%, and a negative predictive value of 95%. In comparison with fMRI, rTMS is a more sensitive but less specific

  4. Direct coupling of electromembrane extraction to mass spectrometry – Advancing the probe functionality toward measurements of zwitterionic drug metabolites

    DEFF Research Database (Denmark)

    Kige Rye, Torstein; Fuchs, David; Pedersen-Bjergaard, Stig

    2017-01-01

    A triple-flow electromembrane extraction (EME) probe was developed and coupled directly to electrospray-ionization mass spectrometry (ESI-MS). Metabolic reaction mixtures (pH 7.4) containing drug substances and related metabolites were continuously drawn (20 μL/min) into the EME probe in one flow......-nitrophenyl octyl ether (and for some experiments containing 30% triphenyl phosphate (TPP)), and into 20 μL min-1 of formic acid as acceptor phase, which was introduced through a third flow channel. The acceptor phase was pumped directly to the MS system, and the ion intensity of extracted analytes......, the system can potentially be used for direct analysis of various kinds of chemical reactions that have to be run at pH conditions unfavorable for direct analyte extractions....

  5. The direct and indirect effects of lurasidone monotherapy on functional improvement among patients with bipolar depression: results from a randomized placebo-controlled trial.

    Science.gov (United States)

    Rajagopalan, Krithika; Bacci, Elizabeth Dansie; Wyrwich, Kathleen W; Pikalov, Andrei; Loebel, Antony

    2016-12-01

    Bipolar depression is characterized by depressive symptoms and impairment in many areas of functioning, including work, family, and social life. The objective of this study was to assess the independent, direct effect of lurasidone treatment on functioning improvement, and examine the indirect effect of lurasidone treatment on functioning improvement, mediated through improvements in depression symptoms. Data from a 6-week placebo-controlled trial assessing the effect of lurasidone monotherapy versus placebo in patients with bipolar depression was used. Patient functioning was measured using the Sheehan disability scale (SDS). Descriptive statistics were used to assess the effect of lurasidone on improvement on the SDS total and domain scores (work/school, social, and family life), as well as number of days lost and unproductive due to symptoms. Path analyses evaluated the total effect (β1), as well as the indirect effect (β2×β3) and direct effect (β4) of lurasidone treatment on SDS total score change, using standardized beta path coefficients and baseline scores as covariates. The direct effect of treatment on SDS total score change and indirect effects accounting for mediation through depression improvement were examined for statistical significance and magnitude using MPlus. In this 6-week trial (N = 485), change scores from baseline to 6-weeks were significantly larger for both lurasidone treatment dosage groups versus placebo on the SDS total and all three SDS domain scores (p accounting for depression improvement. Results demonstrated statistically significant improvement in functioning among patients on lurasidone monotherapy compared to placebo. Improvement in functioning among patients on lurasidone was largely mediated through a reduction in depression symptoms, but lurasidone also had a medium and statistically significant independent direct effect in improving functioning.

  6. The Direct Impact of Team Cohesiveness and Athletes' Perception of Coaching Leadership Functions on Team Success in NCAA Division I Women's Basketball

    Science.gov (United States)

    Palmer, Mary E.

    2013-01-01

    This study investigated the direct impact of team cohesiveness and student-athletes' perceptions of coaching behavior/leadership functions on the success of NCAA Division I Women's basketball, based on the teams' win/loss records. The research collection was quantitative in nature. Statistical design and analysis provided justification for the use…

  7. Long-Term Follow-Up of Gut-Directed Hypnotherapy vs. Standard Care in Children With Functional Abdominal Pain or Irritable Bowel Syndrome

    NARCIS (Netherlands)

    Vlieger, Arine M.; Rutten, Juliette M. T. M.; Govers, Anita M. A. P.; Frankenhuis, Carla; Benninga, Marc A.

    2012-01-01

    OBJECTIVES: We previously showed that gut-directed hypnotherapy (HT) is highly effective in the treatment of children with functional abdominal pain (FAP) and irritable bowel syndrome (IBS). Aim of this follow-up study was to investigate the long-term effects of HT vs. standard medical treatment

  8. Comparison of ultraviolet Bi-directional Reflectance Distribution Function (BRDF) measurements of diffusers used in the calibration of the Total Ozone Mapping Spectrometer (TOMS)

    NARCIS (Netherlands)

    Butler, J.J.; Park, H.; Barnes, P.Y.; Early, E.A.; Eijk-Olij, C. van; Zoutman, A.E.; Buller-Leeuwen, S. van; Groote Schaarsberg, J.

    2002-01-01

    The measurement and long-term monitoring of global total ozone by ultraviolet albedo measuring satellite instruments require accurate and precise determination of the Bi-directional Reflectance Distribution Function (BRDF) of laboratory-based diffusers used in the pre-launch calibration of those

  9. Teaching a Child with Autism and Severe Language Delays to Reject: Direct and Indirect Effects of Functional Communication Training

    Science.gov (United States)

    Martin, Christian A.; Drasgow, Erik; Halle, James W.; Brucker, Jennifer M.

    2005-01-01

    We used functional communication training to teach Bob, a 10-year-old student with autism and severe language delays, to reject items by touching an icon. Our initial assessment revealed that Bob's behaviours serving a rejecting function consisted of pushing away, yelling, bear hugging-grabbing, and leaving. We used prompting, differential…

  10. Current direction-dependent modulation of human hand motor function by intermittent theta burst stimulation (iTBS).

    Science.gov (United States)

    Shirota, Yuichiro; Dhaka, Suman; Paulus, Walter; Sommer, Martin

    2017-05-22

    Transcranial magnetic stimulation (TMS) with different current directions can activate different sets of neurons. Current direction can also affect the results of repetitive TMS. To test the influence of uni-directional intermittent theta burst stimulation (iTBS) using different current directions, namely posteroanterior (PA) and anteroposterior (AP), on motor behaviour. In a cross-over design, PA- and AP-iTBS was applied over the left primary motor cortex in 19 healthy, right-handed volunteers. Performance of a finger-tapping task was recorded before and 0, 10, 20, and 30min after the iTBS. The task was conducted with the right and left hands separately at each time point. As a control, AP-iTBS with reduced intensity was applied to 14 participants in a separate session (AP weak condition). The finger-tapping count with the left hand was decreased after PA-iTBS. Neither AP- nor AP weak -iTBS altered the performance. Current direction had a significant impact on the after-effects of iTBS. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Standard deviation of wind direction as a function of time; three hours to five hundred seventy-six hours

    International Nuclear Information System (INIS)

    Culkowski, W.M.

    1976-01-01

    The standard deviation of horizontal wind direction sigma/sub theta/ increases with time of averaging up to a maximum value of 104 0 . The average standard deviation of horizontal wind directions averaged over periods of 3, 5, 10, 16, 24, 36, 48, 72, 144, 288, and 576 hours were calculated from wind data obtained from a 100 meter tower in the Oak Ridge area. For periods up to 100 hours, sigma/sub theta/ varies as t/sup .28/; after 100 hours sigma/sub theta/ varies as 6.5 ln t

  12. Derivation of the stellar luminosity function in the direction of the south galactic pole by a statistical method

    Energy Technology Data Exchange (ETDEWEB)

    Kipp, S L

    1981-12-01

    A method is developed to calculate absolute magnitude probability distributions for stars from a proper motion survey. This method uses ellipsoidal velocity distributions to predict tangential velocity distributions. The tangential velocity distributions are transformed into absolute magnitude distributions. The absolute magnitude distributions for the stars in a proper motion survey may be summed to produce a luminosity function. This method was applied to stars in the region of the south galactic pole and the resulting luminosity function is statistically identical to Luyten's 1968 luminosity function.

  13. Family history assessment of personality disorders: II. Association with measures of psychosocial functioning in direct evaluations with relatives.

    Science.gov (United States)

    Lara, M E; Ferro, T; Klein, D N

    1997-01-01

    To test the convergent validity of the Family History Interview for Personality Disorders (FHIPD), as well as the general utility of informants' reports of personality disorders, we explored the relationship between proband informant reports of Axis II diagnoses on the FHIPD and relative reports of various indices of psychosocial adjustment. Subjects were the first degree relatives (n = 454) of 224 probands participating in a family study of mood and personality disorders. Relatives provided information on the Structured Clinical Interview for DSM-III-R (SCID), the Personality Disorder Examination (PDE), and other variables reflecting aspects of psychosocial dysfunction that are common in personality disorders. Proband informants were interviewed about their relatives using the FHIPD Proband informant reports of personality disorders on the FHIPD were associated with a variety of forms of psychosocial dysfunction as determined in direct assessments with the relatives, even for those with no diagnosable Axis II psychopathology dysfunction as determined in direct assessments with the relatives, even for those with no diagnosable Axis II psychopathology on direct interview. These results support the convergent validity of the FHIPD, and suggest that informants may provide important information on Axis II psychopathology that is not obtained from direct interviews with the subjects themselves.

  14. Increased mitochondrial mass in cells with functionally compromised mitochondria after exposure to both direct gamma radiation and bystander factors.

    LENUS (Irish Health Repository)

    Nugent, Sharon M E

    2007-07-01

    The bystander effect describes radiation-like damage in unirradiated cells either in the vicinity of irradiated cells or exposed to medium from irradiated cells. This study aimed to further characterize the poorly understood mitochondrial response to both direct irradiation and bystander factor(s) in human keratinocytes (HPV-G) and Chinese hamster ovarian cells (CHO-K1). Oxygen consumption rates were determined during periods of state 4, state 3 and uncoupled respiration. Mitochondrial mass was determined using MitoTracker FM. CHO-K1 cells showed significantly reduced oxygen consumption rates 4 h after exposure to 5 Gy direct radiation and irradiated cell conditioned medium (ICCM) and an apparent recovery 12-24 h later. The apparent recovery was likely due to the substantial increase in mitochondrial mass observed in these cells as soon as 4 h after exposure. HPV-G cells, on the other hand, showed a sustained increase in oxygen consumption rates after ICCM exposure and a transient increase 4 h after exposure to 5 Gy direct radiation. A significant increase in mitochondrial mass per HPV-G cell was observed after exposure to both direct radiation and ICCM. These findings are indicative of a stress response to mitochondrial dysfunction that increases the number of mitochondria per cell.

  15. The Influence of Prior Knowledge on the Retrieval-Directed Function of Note Taking in Prior Knowledge Activation

    Science.gov (United States)

    Wetzels, Sandra A. J.; Kester, Liesbeth; van Merrienboer, Jeroen J. G.; Broers, Nick J.

    2011-01-01

    Background: Prior knowledge activation facilitates learning. Note taking during prior knowledge activation (i.e., note taking directed at retrieving information from memory) might facilitate the activation process by enabling learners to build an external representation of their prior knowledge. However, taking notes might be less effective in…

  16. Direct Synthesis of Fe3C-Functionalized Graphene by High Temperature Autoclave Pyrolysis for Oxygen Reduction

    DEFF Research Database (Denmark)

    Hu, Yang; Jensen, Jens Oluf; Zhang, Wei

    2014-01-01

    We present a novel approach to direct fabrication of few-layer graphene sheets with encapsulated Fe3C nanoparticles from pyrolysis of volatile non-graphitic precursors without any substrate. This one-step autoclave approach is facile and potentially scalable for production. Tested as an electroca...

  17. Palladium-Catalyzed Direct C-H Arylations of Dioxythiophenes Bearing Reactive Functional Groups: A Step-Economical Approach for Functional π-Conjugated Oligoarenes

    KAUST Repository

    Liu, Ching-Yuan

    2015-06-25

    A Pd-catalyzed and single-step C-H arylation of dioxythiophene derivates bearing unprotected reactive functional groups (-OH, -COOH, -N3) in a phosphine-free manner has been developed. Various dioxythiopene-based oligoarenes with extended π-conjugation are obtained with good yields (up to 90%). These oligoarenes display suitable optical properties (absorption and emission maxima, quantum yields) and contain reactive functional groups suitable for further conjugations with bioactive molecules. This new methodology is step economical (fewer synthetic steps), environmental friendly (no toxic metal-containing side-poducts) and the oligoarenes synthesized are potentially applicable for bio-labeling, bioimaging, and biosensing.

  18. Palladium-Catalyzed Direct C-H Arylations of Dioxythiophenes Bearing Reactive Functional Groups: A Step-Economical Approach for Functional π-Conjugated Oligoarenes

    KAUST Repository

    Liu, Ching-Yuan; Chong, Hui; Lin, Hsing-An; Yamashita, Yoshiro; Zheng, Bin; Huang, Kuo-Wei; Hashizume, Daisuke; Yu, Hsiao-hua

    2015-01-01

    A Pd-catalyzed and single-step C-H arylation of dioxythiophene derivates bearing unprotected reactive functional groups (-OH, -COOH, -N3) in a phosphine-free manner has been developed. Various dioxythiopene-based oligoarenes with extended π-conjugation are obtained with good yields (up to 90%). These oligoarenes display suitable optical properties (absorption and emission maxima, quantum yields) and contain reactive functional groups suitable for further conjugations with bioactive molecules. This new methodology is step economical (fewer synthetic steps), environmental friendly (no toxic metal-containing side-poducts) and the oligoarenes synthesized are potentially applicable for bio-labeling, bioimaging, and biosensing.

  19. Direct hyperpolarization of micro- and nanodiamonds for bioimaging applications - Considerations on particle size, functionalization and polarization loss

    Science.gov (United States)

    Kwiatkowski, Grzegorz; Jähnig, Fabian; Steinhauser, Jonas; Wespi, Patrick; Ernst, Matthias; Kozerke, Sebastian

    2018-01-01

    Due to the inherently long relaxation time of 13C spins in diamond, the nuclear polarization enhancement obtained with dynamic nuclear polarization can be preserved for a time on the order of about one hour, opening up an opportunity to use diamonds as a new class of long-lived contrast agents. The present communication explores the feasibility of using 13C spins in directly hyperpolarized diamonds for MR imaging including considerations for potential in vivo applications.

  20. Global modelling of direct and indirect effects of sea spray aerosol using a source function encapsulating wave state

    Directory of Open Access Journals (Sweden)

    A.-I. Partanen

    2014-11-01

    Full Text Available Recently developed parameterizations for the sea spray aerosol source flux, encapsulating wave state, and its organic fraction were incorporated into the aerosol–climate model ECHAM-HAMMOZ to investigate the direct and indirect radiative effects of sea spray aerosol particles. Our simulated global sea salt emission of 805 Tg yr−1 (uncertainty range 378–1233 Tg yr−1 was much lower than typically found in previous studies. Modelled sea salt and sodium ion concentrations agreed relatively well with measurements in the smaller size ranges at Mace Head (annual normalized mean model bias −13% for particles with vacuum aerodynamic diameter Dva Da Da Da −2, in contrast to previous studies. This positive effect was ascribed to the tendency of sea salt aerosol to suppress both the in-cloud supersaturation and the formation of cloud condensation nuclei from sulfate. These effects can be accounted for only in models with sufficiently detailed aerosol microphysics and physics-based parameterizations of cloud activation. However, due to a strong negative direct effect, the simulated effective radiative forcing (total radiative effect was −0.2 W m−2. The simulated radiative effects of the primary marine organic emissions were small, with a direct effect of 0.03 W m−2 and an indirect effect of −0.07 W m−2.

  1. From Green to Blue: Site-Directed Mutagenesis of the Green Fluorescent Protein to Teach Protein Structure-Function Relationships

    Science.gov (United States)

    Giron, Maria D.; Salto, Rafael

    2011-01-01

    Structure-function relationship studies in proteins are essential in modern Cell Biology. Laboratory exercises that allow students to familiarize themselves with basic mutagenesis techniques are essential in all Genetic Engineering courses to teach the relevance of protein structure. We have implemented a laboratory course based on the…

  2. The Role of Make-Believe Play in the Development of Executive Function: Status of Research and Future Directions

    Science.gov (United States)

    Berk, Laura E.; Meyers, Adena B.

    2013-01-01

    The authors discuss the association between make-believe play and the development of executive-function (EF) skills in young children. Some forty years ago, Lev S. Vygotsky first proposed that make-believe fosters the development of symbolic thought and self-regulation. Since then, a small body of research has produced evidence of an association…

  3. Contemporary Directions in Theories and Psychotherapeutic Strategies in Treatment of Personality Disorders: Relation to Level of Personality Functioning

    DEFF Research Database (Denmark)

    Simonsen, Sebastian; Simonsen, Erik

    2014-01-01

    In this commentary on treatment strategies for personality disorders, we analyze each of the cases and the problem of low motivation in terms of how they fit with the Level of Personality Functioning scale. We then show how patients vary in terms of both level and breadth of pathology. Three...

  4. Rapid changes in gene expression direct rapid shifts in intestinal form and function in the Burmese python after feeding.

    Science.gov (United States)

    Andrew, Audra L; Card, Daren C; Ruggiero, Robert P; Schield, Drew R; Adams, Richard H; Pollock, David D; Secor, Stephen M; Castoe, Todd A

    2015-05-01

    Snakes provide a unique and valuable model system for studying the extremes of physiological remodeling because of the ability of some species to rapidly upregulate organ form and function upon feeding. The predominant model species used to study such extreme responses has been the Burmese python because of the extreme nature of postfeeding response in this species. We analyzed the Burmese python intestine across a time series, before, during, and after feeding to understand the patterns and timing of changes in gene expression and their relationship to changes in intestinal form and function upon feeding. Our results indicate that >2,000 genes show significant changes in expression in the small intestine following feeding, including genes involved in intestinal morphology and function (e.g., hydrolases, microvillus proteins, trafficking and transport proteins), as well as genes involved in cell division and apoptosis. Extensive changes in gene expression occur surprisingly rapidly, within the first 6 h of feeding, coincide with changes in intestinal morphology, and effectively return to prefeeding levels within 10 days. Collectively, our results provide an unprecedented portrait of parallel changes in gene expression and intestinal morphology and physiology on a scale that is extreme both in the magnitude of changes, as well as in the incredibly short time frame of these changes, with up- and downregulation of expression and function occurring in the span of 10 days. Our results also identify conserved vertebrate signaling pathways that modulate these responses, which may suggest pathways for therapeutic modulation of intestinal function in humans. Copyright © 2015 the American Physiological Society.

  5. Direct repeat sequences are essential for function of the cis-acting locus of transfer (clt) of Streptomyces phaeochromogenes plasmid pJV1.

    Science.gov (United States)

    Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis

    2003-11-01

    The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.

  6. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Lin FO

    2016-10-01

    Full Text Available The Editor-in-Chief and Publisher of OncoTargets and Therapy have been alerted to unacceptable levels of duplication with another published paper: Zhang D, Ni Z, Xu X, and Xiao J. MiR-32 Functions as a Tumor Suppressor and Directly Targets EZH2 in Human Oral Squamous Cell Carcinoma. Medical Science Monitor. 20:2527–2535, 2014.Accordingly, we retract Lin FO, Yao LJ, Xiao J, Liu DF, and Ni ZY. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma. OncoTargets and Therapy. 2014;7:1583–1591.This Retraction relates to 

  7. Comparison of ultraviolet Bi-directional Reflectance Distribution Function (BRDF) measurements of diffusers used in the calibration of the Total Ozone Mapping Spectrometer (TOMS)

    OpenAIRE

    Butler, J.J.; Park, H.; Barnes, P.Y.; Early, E.A.; Eijk-Olij, C. van; Zoutman, A.E.; Buller-Leeuwen, S. van; Groote Schaarsberg, J.

    2002-01-01

    The measurement and long-term monitoring of global total ozone by ultraviolet albedo measuring satellite instruments require accurate and precise determination of the Bi-directional Reflectance Distribution Function (BRDF) of laboratory-based diffusers used in the pre-launch calibration of those instruments. To assess the ability of laboratories to provide accurate Ultra Violet (UV) diffuse BRDF measurements, a BRDF measurement comparison was initiated by the NASA Total Ozone Mapping Spectrom...

  8. Lack of direct evidence for a functional role of voltage-operated calcium channels in juxtaglomerular cells

    DEFF Research Database (Denmark)

    Kurtz, A; Skott, O; Chegini, S

    1990-01-01

    in patch-clamped nor in intact Furaester-loaded cells. Moreover, basal renin secretion from a preparation enriched in mouse juxtaglomerular cells and from rat glomeruli with attached juxtaglomerular cells was not inhibited when extracellular potassium was isoosmotically increased to 56 mmol/l. In mouse...... kidney slices, however, depolarizing potassium concentrations caused a delayed inhibition at 56 mmol/l and a delayed stimulation of renin secretion at 110 mmol/l. Taken together, our study does not provide direct evidence for a role of voltage-activated calcium channels in the regulation of calcium...

  9. Direct hyperpolarization of micro- and nanodiamonds for bioimaging applications - Considerations on particle size, functionalization and polarization loss.

    Science.gov (United States)

    Kwiatkowski, Grzegorz; Jähnig, Fabian; Steinhauser, Jonas; Wespi, Patrick; Ernst, Matthias; Kozerke, Sebastian

    2018-01-01

    Due to the inherently long relaxation time of 13 C spins in diamond, the nuclear polarization enhancement obtained with dynamic nuclear polarization can be preserved for a time on the order of about one hour, opening up an opportunity to use diamonds as a new class of long-lived contrast agents. The present communication explores the feasibility of using 13 C spins in directly hyperpolarized diamonds for MR imaging including considerations for potential in vivo applications. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Goal directed worry rules are associated with distinct patterns of amygdala functional connectivity and vagal modulation during perseverative cognition

    OpenAIRE

    Meeten, Frances; Davey, Graham C L; Makovac, Elena; Watson, David R.; Garfinkel, Sarah N.; Critchley, Hugo D.; Ottaviani, Cristina

    2016-01-01

    Excessive and uncontrollable worry is a defining feature of Generalized Anxiety Disorder (GAD). An important endeavor in the treatment of pathological worry is to understand why some people are unable to stop worrying once they have started. Worry perseveration is associated with a tendency to deploy goal-directed worry rules (known as “as many as can” worry rules; AMA). These require attention to the goal of the worry task and continuation of worry until the aims of the “worry bout” are achi...

  11. Rapid changes in gene expression direct rapid shifts in intestinal form and function in the Burmese python after feeding

    OpenAIRE

    Andrew, Audra L.; Card, Daren C.; Ruggiero, Robert P.; Schield, Drew R.; Adams, Richard H.; Pollock, David D.; Secor, Stephen M.; Castoe, Todd A.

    2015-01-01

    Snakes provide a unique and valuable model system for studying the extremes of physiological remodeling because of the ability of some species to rapidly upregulate organ form and function upon feeding. The predominant model species used to study such extreme responses has been the Burmese python because of the extreme nature of postfeeding response in this species. We analyzed the Burmese python intestine across a time series, before, during, and after feeding to understand the patterns and ...

  12. New Directions in 3D Medical Modeling: 3D-Printing Anatomy and Functions in Neurosurgical Planning

    OpenAIRE

    Gargiulo, Paolo; ?rnad?ttir, ?ris; G?slason, Magn?s; Edmunds, Kyle; ?lafsson, Ingvar

    2017-01-01

    This paper illustrates the feasibility and utility of combining cranial anatomy and brain function on the same 3D-printed model, as evidenced by a neurosurgical planning case study of a 29-year-old female patient with a low-grade frontal-lobe glioma. We herein report the rapid prototyping methodology utilized in conjunction with surgical navigation to prepare and plan a complex neurosurgery. The method introduced here combines CT and MRI images with DTI tractography, while using various image...

  13. Diiridium Bimetallic Complexes Function as a Redox Switch To Directly Split Carbonate into Carbon Monoxide and Oxygen.

    Science.gov (United States)

    Chen, Tsun-Ren; Wu, Fang-Siou; Lee, Hsiu-Pen; Chen, Kelvin H-C

    2016-03-23

    A pair of diiridium bimetallic complexes exhibit a special type of oxidation-reduction reaction that could directly split carbonate into carbon monoxide and molecular oxygen via a low-energy pathway needing no sacrificial reagent. One of the bimetallic complexes, Ir(III)(μ-Cl)2Ir(III), can catch carbonato group from carbonate and reduce it to CO. The second complex, the rare bimetallic complex Ir(IV)(μ-oxo)2Ir(IV), can react with chlorine to release O2 by the oxidation of oxygen ions with synergistic oxidative effect of iridium ions and chlorine atoms. The activation energy needed for the key reaction is quite low (∼20 kJ/mol), which is far less than the dissociation energy of the C═O bond in CO2 (∼750 kJ/mol). These diiridium bimetallic complexes could be applied as a redox switch to split carbonate or combined with well-known processes in the chemical industry to build up a catalytic system to directly split CO2 into CO and O2.

  14. Occlusal force is correlated with cognitive function directly as well as indirectly via food intake in community-dwelling older Japanese: From the SONIC study.

    Science.gov (United States)

    Ikebe, Kazunori; Gondo, Yasuyuki; Kamide, Kei; Masui, Yukie; Ishizaki, Taturo; Arai, Yasumichi; Inagaki, Hiroki; Nakagawa, Takeshi; Kabayama, Mai; Ryuno, Hirochika; Okubo, Hitomi; Takeshita, Hajime; Inomata, Chisato; Kurushima, Yuko; Mihara, Yusuke; Hatta, Kohdai; Fukutake, Motoyoshi; Enoki, Kaori; Ogawa, Taiji; Matsuda, Ken-Ichi; Sugimoto, Ken; Oguro, Ryosuke; Takami, Yoichi; Itoh, Norihisa; Takeya, Yasushi; Yamamoto, Koichi; Rakugi, Hiromi; Murakami, Shinya; Kitamura, Masahiro; Maeda, Yoshinobu

    2018-01-01

    Growing evidence suggests that oral health may be an important factor associated with cognitive function in aged populations. However, many previous studies on this topic used insensitive oral indicators or did not include certain essential covariates. Thus, we examined the association between occlusal force and cognitive function in a large sample of older adults, controlling for dietary intake, vascular risk factors, inflammatory biomarkers, depression, and genetic factors. In this cross-sectional study of older community-dwelling Japanese adults, we examined data collected from 994 persons aged 70 years and 968 persons aged 80 years. Cognitive function was measured using the Japanese version of the Montreal Cognitive Assessment (MoCA-J). Oral status and function were evaluated according to the number of remaining teeth, periodontal pocket depth, and maximal occlusal force. Associations between MoCA-J scores and occlusal force were investigated via bivariate and multivariate analyses. Education level, financial status, depression score, and intake of green and yellow vegetables, as well as number of teeth and occlusal force, were significantly correlated with MoCA-J scores in both age groups. Among individuals aged 80 years, CRP and periodontal status were weakly but significantly associated with MoCA-J score. After controlling for all significant variables via bivariate analyses, the correlation between maximal occlusal force and cognitive function persisted. A path analysis confirmed the hypothesis that cognitive function is associated with occlusal force directly as well as indirectly via food intake. After controlling for possible factors, maximal occlusal force was positively associated with cognitive function directly as well as indirectly through dietary intake.

  15. Polycystin 1 loss of function is directly linked to an imbalance in G-protein signaling in the kidney.

    Science.gov (United States)

    Zhang, Bo; Tran, Uyen; Wessely, Oliver

    2018-03-22

    The development of the kidney relies on the establishment and maintenance of a precise tubular diameter of its functional units, the nephrons. This process is disrupted in polycystic kidney disease (PKD), resulting in dilations of the nephron and renal cyst formation. In the course of exploring G-protein-coupled signaling in the Xenopus pronephric kidney, we discovered that loss of the G-protein α subunit, Gnas, results in a PKD phenotype. Polycystin 1, one of the genes mutated in human PKD, encodes a protein resembling a G-protein-coupled receptor. Furthermore, deletion of the G-protein-binding domain present in the intracellular C terminus of polycystin 1 impacts functionality. A comprehensive analysis of all the G-protein α subunits expressed in the Xenopus pronephric kidney demonstrates that polycystin 1 recruits a select subset of G-protein α subunits and that their knockdown - as in the case of Gnas - results in a PKD phenotype. Mechanistically, the phenotype is caused by increased endogenous G-protein β/γ signaling and can be reversed by pharmacological inhibitors as well as knocking down Gnb1. Together, our data support the hypothesis that G proteins are recruited to the intracellular domain of PKD1 and that this interaction is crucial for its function in the kidney. © 2018. Published by The Company of Biologists Ltd.

  16. Complementary Strategies for Directed C(sp3 )-H Functionalization: A Comparison of Transition-Metal-Catalyzed Activation, Hydrogen Atom Transfer, and Carbene/Nitrene Transfer.

    Science.gov (United States)

    Chu, John C K; Rovis, Tomislav

    2018-01-02

    The functionalization of C(sp 3 )-H bonds streamlines chemical synthesis by allowing the use of simple molecules and providing novel synthetic disconnections. Intensive recent efforts in the development of new reactions based on C-H functionalization have led to its wider adoption across a range of research areas. This Review discusses the strengths and weaknesses of three main approaches: transition-metal-catalyzed C-H activation, 1,n-hydrogen atom transfer, and transition-metal-catalyzed carbene/nitrene transfer, for the directed functionalization of unactivated C(sp 3 )-H bonds. For each strategy, the scope, the reactivity of different C-H bonds, the position of the reacting C-H bonds relative to the directing group, and stereochemical outcomes are illustrated with examples in the literature. The aim of this Review is to provide guidance for the use of C-H functionalization reactions and inspire future research in this area. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Changing the inhibitory specificity and function of Cucurbita maxima trypsin inhibitor-V by site-directed mutagenesis.

    Science.gov (United States)

    Wen, L; Lee, I; Chen, G; Huang, J K; Gong, Y; Krishnamoorthi, R

    1995-02-27

    Cucurbita maxima trypsin inhibitor-V (CMTI-V) is also a specific inhibitor of human blood coagulation factor beta-factor XIIa. A recombinant version of CMTI-V has allowed probing of roles of individual amino acid residues including the reactive site residue, lysine (P1), by site-directed mutagenesis. The K44R showed at least a 5-fold increase in inhibitory activity toward human beta-factor XIIa, while there was no change toward bovine trypsin. This result demonstrates that beta-factor-XIIa prefers an arginine residue over lysine residue, while trypsin is non-specific to lysine or arginine in its binding pocket. On the other hand, the specificity of CMTI-V could be changed from trypsin to chymotrypsin inhibition by mutation of the P1 residue to either leucine or methionine (K44L or K44M).

  18. Investigating the functional neuroanatomy of concrete and abstract word processing through direct electric stimulation (DES) during awake surgery.

    Science.gov (United States)

    Orena, E F; Caldiroli, D; Acerbi, F; Barazzetta, I; Papagno, C

    2018-06-05

    Neuropsychological, neuroimaging and electrophysiological studies demonstrate that abstract and concrete word processing relies not only on the activity of a common bilateral network but also on dedicated networks. The neuropsychological literature has shown that a selective sparing of abstract relative to concrete words can be documented in lesions of the left anterior temporal regions. We investigated concrete and abstract word processing in 10 patients undergoing direct electrical stimulation (DES) for brain mapping during awake surgery in the left hemisphere. A lexical decision and a concreteness judgment task were added to the neuropsychological assessment during intra-operative monitoring. On the concreteness judgment, DES delivered over the inferior frontal gyrus significantly decreased abstract word accuracy while accuracy for concrete words decreased when the anterior temporal cortex was stimulated. These results are consistent with a lexical-semantic model that distinguishes between concrete and abstract words related to different neural substrates in the left hemisphere.

  19. Direct synthesis of Fe3 C-functionalized graphene by high temperature autoclave pyrolysis for oxygen reduction.

    Science.gov (United States)

    Hu, Yang; Jensen, Jens Oluf; Zhang, Wei; Huang, Yunjie; Cleemann, Lars N; Xing, Wei; Bjerrum, Niels J; Li, Qingfeng

    2014-08-01

    We present a novel approach to direct fabrication of few-layer graphene sheets with encapsulated Fe3 C nanoparticles from pyrolysis of volatile non-graphitic precursors without any substrate. This one-step autoclave approach is facile and potentially scalable for production. Tested as an electrocatalyst, the graphene-based composite exhibited excellent catalytic activity towards the oxygen reduction reaction in alkaline solution with an onset potential of ca. 1.05 V (vs. the reversible hydrogen electrode) and a half-wave potential of 0.83 V, which is comparable to the commercial Pt/C catalyst. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. KSR1 is a functional protein kinase capable of serine autophosphorylation and direct phosphorylation of MEK1

    International Nuclear Information System (INIS)

    Goettel, Jeremy A.; Liang, Dongchun; Hilliard, Valda C.; Edelblum, Karen L.; Broadus, Matthew R.; Gould, Kathleen L.; Hanks, Steven K.; Polk, D. Brent

    2011-01-01

    The extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK) pathway is a highly conserved signaling pathway that regulates diverse cellular processes including differentiation, proliferation, and survival. Kinase suppressor of Ras-1 (KSR1) binds each of the three ERK cascade components to facilitate pathway activation. Even though KSR1 contains a C-terminal kinase domain, evidence supporting the catalytic function of KSR1 remains controversial. In this study, we produced recombinant wild-type or kinase-inactive (D683A/D700A) KSR1 proteins in Escherichia coli to test the hypothesis that KSR1 is a functional protein kinase. Recombinant wild-type KSR1, but not recombinant kinase-inactive KSR1, underwent autophosphorylation on serine residue(s), phosphorylated myelin basic protein (MBP) as a generic substrate, and phosphorylated recombinant kinase-inactive MAPK/ERK kinase-1 (MEK1). Furthermore, FLAG immunoprecipitates from KSR1 -/- colon epithelial cells stably expressing FLAG-tagged wild-type KSR1 (+KSR1), but not vector (+vector) or FLAG-tagged kinase-inactive KSR1 (+D683A/D700A), were able to phosphorylate kinase-inactive MEK1. Since TNF activates the ERK pathway in colon epithelial cells, we tested the biological effects of KSR1 in the survival response downstream of TNF. We found that +vector and +D683A/D700A cells underwent apoptosis when treated with TNF, whereas +KSR1 cells were resistant. However, +KSR1 cells were sensitized to TNF-induced cell loss in the absence of MEK kinase activity. These data provide clear evidence that KSR1 is a functional protein kinase, MEK1 is an in vitro substrate of KSR1, and the catalytic activities of both proteins are required for eliciting cell survival responses downstream of TNF.

  1. Direct interaction of beta-amyloid with Na,K-ATPase as a putative regulator of the enzyme function

    Science.gov (United States)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Adzhubei, Alexei A.; Burnysheva, Ksenia M.; Lakunina, Valentina A.; Kamanina, Yulia V.; Dergousova, Elena A.; Lopina, Olga D.; Ogunshola, Omolara O.; Bogdanova, Anna Yu.; Makarov, Alexander A.

    2016-06-01

    By maintaining the Na+ and K+ transmembrane gradient mammalian Na,K-ATPase acts as a key regulator of neuronal electrotonic properties. Na,K-ATPase has an important role in synaptic transmission and memory formation. Accumulation of beta-amyloid (Aβ) at the early stages of Alzheimer’s disease is accompanied by reduction of Na,K-ATPase functional activity. The molecular mechanism behind this phenomenon is not known. Here we show that the monomeric Aβ(1-42) forms a tight (Kd of 3 μM), enthalpy-driven equimolar complex with α1β1 Na,K-ATPase. The complex formation results in dose-dependent inhibition of the enzyme hydrolytic activity. The binding site of Aβ(1-42) is localized in the “gap” between the alpha- and beta-subunits of Na,K-ATPase, disrupting the enzyme functionality by preventing the subunits from shifting towards each other. Interaction of Na,K-ATPase with exogenous Aβ(1-42) leads to a pronounced decrease of the enzyme transport and hydrolytic activity and Src-kinase activation in neuroblastoma cells SH-SY5Y. This interaction allows regulation of Na,K-ATPase activity by short-term increase of the Aβ(1-42) level. However prolonged increase of Aβ(1-42) level under pathological conditions could lead to chronical inhibition of Na,K-ATPase and disruption of neuronal function. Taken together, our data suggest the role of beta-amyloid as a novel physiological regulator of Na,K-ATPase.

  2. A sonochemical approach to the direct surface functionalization of superparamagnetic iron oxide nanoparticles with (3-aminopropyl)triethoxysilane.

    Science.gov (United States)

    Sodipo, Bashiru Kayode; Aziz, Azlan Abdul

    2014-01-01

    We report a sonochemical method of functionalizing superparamagnetic iron oxide nanoparticles (SPION) with (3-aminopropyl)triethoxysilane (APTES). Mechanical stirring, localized hot spots and other unique conditions generated by an acoustic cavitation (sonochemical) process were found to induce a rapid silanization reaction between SPION and APTES. FTIR, XPS and XRD measurements were used to demonstrate the grafting of APTES on SPION. Compared to what was reported in literature, the results showed that the silanization reaction time was greatly minimized. More importantly, the product displayed superparamagnetic behaviour at room temperature with a more than 20% higher saturation magnetization.

  3. C-H functionalization directed by transformable nitrogen heterocycles: synthesis of ortho-oxygenated arylnaphthalenes from arylphthalazines.

    Science.gov (United States)

    Rastogi, Shiva K; Medellin, Derek C; Kornienko, Alexander

    2014-01-21

    Two protocols for oxygenation of aromatic C-H bonds ortho-positioned to the phthalazine ring were developed. The transannulation of the phthalazine ring to a naphthalene moiety by an Inverse Electron Demand Diels-Alder (IEDDA) reaction led to the synthesis of naphtho[2,1-c]chromenes, 1-(ortho-hydroxyaryl)naphthalenes and 6,7-dihydrobenzo[b]naphtho[1,2-d]oxepine. This new strategy based on the utilization of transformable nitrogen heterocycles in C-H functionalization chemistry can be potentially applicable to the synthesis of a broad range of biaryl compounds.

  4. Solvent Composition Directing Click-Functionalization at the Surface or in the Bulk of Azide-Modified PEDOT

    DEFF Research Database (Denmark)

    Lind, Johan Ulrik; Hansen, Thomas Steen; Daugaard, Anders Egede

    2011-01-01

    Thin films of the conducting polymer poly(3,4-(1-azidomethylethylene)dioxythiophene) tosylate (PEDOT−N3) can be functionalized by reaction with alkynated reagents in aqueous solutions. Reaction in pure water resulted in surface specific modification of PEDOT−N3 films, whereas both surface and bulk...... studies showed increasing film thickness with increasing DMSO content, with the measured thickness in pure DMSO being >250% of the thickness in pure water. A similar, but less pronounced, behavior was observed for unmodified poly(3,4-ethylenedioxythiophene) tosylate (PEDOT). High-density grafting...

  5. Direct Reprogramming of Human Bone Marrow Stromal Cells into Functional Renal Cells Using Cell-free Extracts

    Directory of Open Access Journals (Sweden)

    Evangelia Papadimou

    2015-04-01

    Full Text Available The application of cell-based therapies in regenerative medicine is gaining recognition. Here, we show that human bone marrow stromal cells (BMSCs, also known as bone-marrow-derived mesenchymal cells, can be reprogrammed into renal proximal tubular-like epithelial cells using cell-free extracts. Streptolysin-O-permeabilized BMSCs exposed to HK2-cell extracts underwent morphological changes—formation of “domes” and tubule-like structures—and acquired epithelial functional properties such as transepithelial-resistance, albumin-binding, and uptake and specific markers E-cadherin and aquaporin-1. Transmission electron microscopy revealed the presence of brush border microvilli and tight intercellular contacts. RNA sequencing showed tubular epithelial transcript abundance and revealed the upregulation of components of the EGFR pathway. Reprogrammed BMSCs integrated into self-forming kidney tissue and formed tubular structures. Reprogrammed BMSCs infused in immunodeficient mice with cisplatin-induced acute kidney injury engrafted into proximal tubuli, reduced renal injury and improved function. Thus, reprogrammed BMSCs are a promising cell resource for future cell therapy.

  6. Changes of Functional and Directed Resting-State Connectivity Are Associated with Neuronal Oscillations, ApoE Genotype and Amyloid Deposition in Mild Cognitive Impairment

    Directory of Open Access Journals (Sweden)

    Lars Michels

    2017-09-01

    Full Text Available The assessment of effects associated with cognitive impairment using electroencephalography (EEG power mapping allows the visualization of frequency-band specific local changes in oscillatory activity. In contrast, measures of coherence and dynamic source synchronization allow for the study of functional and effective connectivity, respectively. Yet, these measures have rarely been assessed in parallel in the context of mild cognitive impairment (MCI and furthermore it has not been examined if they are related to risk factors of Alzheimer’s disease (AD such as amyloid deposition and apolipoprotein ε4 (ApoE allele occurrence. Here, we investigated functional and directed connectivities with Renormalized Partial Directed Coherence (RPDC in 17 healthy controls (HC and 17 participants with MCI. Participants underwent ApoE-genotyping and Pittsburgh compound B positron emission tomography (PiB-PET to assess amyloid deposition. We observed lower spectral source power in MCI in the alpha and beta bands. Coherence was stronger in HC than MCI across different neuronal sources in the delta, theta, alpha, beta and gamma bands. The directed coherence analysis indicated lower information flow between fronto-temporal (including the hippocampus sources and unidirectional connectivity in MCI. In MCI, alpha and beta RPDC showed an inverse correlation to age and gender; global amyloid deposition was inversely correlated to alpha coherence, RPDC and beta and gamma coherence. Furthermore, the ApoE status was negatively correlated to alpha coherence and RPDC, beta RPDC and gamma coherence. A classification analysis of cognitive state revealed the highest accuracy using EEG power, coherence and RPDC as input. For this small but statistically robust (Bayesian power analyses sample, our results suggest that resting EEG related functional and directed connectivities are sensitive to the cognitive state and are linked to ApoE and amyloid burden.

  7. The direct, not V1-mediated, functional influence between the thalamus and middle temporal complex in the human brain is modulated by the speed of visual motion.

    Science.gov (United States)

    Gaglianese, A; Costagli, M; Ueno, K; Ricciardi, E; Bernardi, G; Pietrini, P; Cheng, K

    2015-01-22

    The main visual pathway that conveys motion information to the middle temporal complex (hMT+) originates from the primary visual cortex (V1), which, in turn, receives spatial and temporal features of the perceived stimuli from the lateral geniculate nucleus (LGN). In addition, visual motion information reaches hMT+ directly from the thalamus, bypassing the V1, through a direct pathway. We aimed at elucidating whether this direct route between LGN and hMT+ represents a 'fast lane' reserved to high-speed motion, as proposed previously, or it is merely involved in processing motion information irrespective of speeds. We evaluated functional magnetic resonance imaging (fMRI) responses elicited by moving visual stimuli and applied connectivity analyses to investigate the effect of motion speed on the causal influence between LGN and hMT+, independent of V1, using the Conditional Granger Causality (CGC) in the presence of slow and fast visual stimuli. Our results showed that at least part of the visual motion information from LGN reaches hMT+, bypassing V1, in response to both slow and fast motion speeds of the perceived stimuli. We also investigated whether motion speeds have different effects on the connections between LGN and functional subdivisions within hMT+: direct connections between LGN and MT-proper carry mainly slow motion information, while connections between LGN and MST carry mainly fast motion information. The existence of a parallel pathway that connects the LGN directly to hMT+ in response to both slow and fast speeds may explain why MT and MST can still respond in the presence of V1 lesions. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  8. Mitsunobu mischief: Neighbor-directed histidine N(π)–alkylation provides access to peptides containing selectively functionalized imidazolium heterocycles

    Science.gov (United States)

    Qian, Wen-Jian

    2015-01-01

    There are few methodologies that yield peptides containing His residues with selective N(π), N(π)-bis-alkylated imidazole rings. We have found that, under certain conditions, on-resin Mitsunobu coupling of alcohols with peptides having a N(π)-alkylated His residue results in selective and high-yield alkylation of the imidazole N(π) nitrogen. The reaction requires the presence of a proximal phosphoric, carboxylic or sulfonic acid, and proceeds through an apparent intramolecular mechanism involving Mitsunobu intermediates. These transformations have particular application to phosphopeptides, where “charge masking” of one phosphoryl anionic charge by the cationic histidine imidazolium ion is now possible. This chemistry opens selective access to peptides containing differentially functionalized imidazolium heterocycles, which provide access to new classes of peptides and peptide mimetics. PMID:25739367

  9. An in silico agent-based model demonstrates Reelin function in directing lamination of neurons during cortical development.

    Science.gov (United States)

    Caffrey, James R; Hughes, Barry D; Britto, Joanne M; Landman, Kerry A

    2014-01-01

    The characteristic six-layered appearance of the neocortex arises from the correct positioning of pyramidal neurons during development and alterations in this process can cause intellectual disabilities and developmental delay. Malformations in cortical development arise when neurons either fail to migrate properly from the germinal zones or fail to cease migration in the correct laminar position within the cortical plate. The Reelin signalling pathway is vital for correct neuronal positioning as loss of Reelin leads to a partially inverted cortex. The precise biological function of Reelin remains controversial and debate surrounds its role as a chemoattractant or stop signal for migrating neurons. To investigate this further we developed an in silico agent-based model of cortical layer formation. Using this model we tested four biologically plausible hypotheses for neuron motility and four biologically plausible hypotheses for the loss of neuron motility (conversion from migration). A matrix of 16 combinations of motility and conversion rules was applied against the known structure of mouse cortical layers in the wild-type cortex, the Reelin-null mutant, the Dab1-null mutant and a conditional Dab1 mutant. Using this approach, many combinations of motility and conversion mechanisms can be rejected. For example, the model does not support Reelin acting as a repelling or as a stopping signal. In contrast, the study lends very strong support to the notion that the glycoprotein Reelin acts as a chemoattractant for neurons. Furthermore, the most viable proposition for the conversion mechanism is one in which conversion is affected by a motile neuron sensing in the near vicinity neurons that have already converted. Therefore, this model helps elucidate the function of Reelin during neuronal migration and cortical development.

  10. Functional role of proteolytic cleavage at arginine-275 of human tissue plasminogen activator as assessed by site-directed mutagenesis

    International Nuclear Information System (INIS)

    Tate, K.M.; Higgins, D.L.; Holmes, W.E.; Winkler, M.E.; Heyneker, H.L.; Vehar, G.A.

    1987-01-01

    Activation of the zymogen form of a serine protease is associated with a conformational change that follows proteolysis at a specific site. Tissue-type plasminogen activator (t-PA) is homologous to mammalian serine proteases and contains an apparent activation cleavage site at arginine-275. To clarify the functional consequences of cleavage at arginine-275 of t-PA, site-specific mutagenesis was performed to convert arginine-275 to a glutamic acid. The mutant enzyme (designated Arg-275 → Glu t-PA) could be converted to the two-chain form by Staphylococcus aureus V8 protease but not by plasmin. The one-chain form was 8 times less active against the tripeptide substrate H-D-isoleucyl-L-prolyl-L-arginine-rho-nitroanilide (S-2288), and the ability of the enzyme to activate plasminogen in the absence of fibrinogen was reduced 20-50 times compared to the two-chain form. In contrast, one-chain Arg-275 → Glu t-PA has equal activity to the two-chain form when assayed in the presence of physiological levels of fibrinogen and plasminogen. Fibrin bound significantly more of the one-chain form of t-PA than the two-chain form for both the wild-type and mutated enzymes. One- and two-chain forms of the wild-type and mutated plasminogen activators slowly formed complexes with plasma protease inhibitors, although the one-chain forms showed decreased complex formation with → 2 -macroglobulin. The one-chain form of t-PA therefore is fully functional under physiologic conditions and has a increased fibrin binding compared to the two-chain form

  11. An in silico agent-based model demonstrates Reelin function in directing lamination of neurons during cortical development.

    Directory of Open Access Journals (Sweden)

    James R Caffrey

    Full Text Available The characteristic six-layered appearance of the neocortex arises from the correct positioning of pyramidal neurons during development and alterations in this process can cause intellectual disabilities and developmental delay. Malformations in cortical development arise when neurons either fail to migrate properly from the germinal zones or fail to cease migration in the correct laminar position within the cortical plate. The Reelin signalling pathway is vital for correct neuronal positioning as loss of Reelin leads to a partially inverted cortex. The precise biological function of Reelin remains controversial and debate surrounds its role as a chemoattractant or stop signal for migrating neurons. To investigate this further we developed an in silico agent-based model of cortical layer formation. Using this model we tested four biologically plausible hypotheses for neuron motility and four biologically plausible hypotheses for the loss of neuron motility (conversion from migration. A matrix of 16 combinations of motility and conversion rules was applied against the known structure of mouse cortical layers in the wild-type cortex, the Reelin-null mutant, the Dab1-null mutant and a conditional Dab1 mutant. Using this approach, many combinations of motility and conversion mechanisms can be rejected. For example, the model does not support Reelin acting as a repelling or as a stopping signal. In contrast, the study lends very strong support to the notion that the glycoprotein Reelin acts as a chemoattractant for neurons. Furthermore, the most viable proposition for the conversion mechanism is one in which conversion is affected by a motile neuron sensing in the near vicinity neurons that have already converted. Therefore, this model helps elucidate the function of Reelin during neuronal migration and cortical development.

  12. Direct electric current treatment modifies mitochondrial function and lipid body content in the A549 cancer cell line.

    Science.gov (United States)

    Holandino, Carla; Teixeira, Cesar Augusto Antunes; de Oliveira, Felipe Alves Gomes; Barbosa, Gleyce Moreno; Siqueira, Camila Monteiro; Messeder, Douglas Jardim; de Aguiar, Fernanda Silva; da Veiga, Venicio Feo; Girard-Dias, Wendell; Miranda, Kildare; Galina, Antonio; Capella, Marcia Alves Marques; Morales, Marcelo Marcos

    2016-10-01

    Electrochemical therapy (EChT) entails treatment of solid tumors with direct electric current (DC). This work evaluated the specific effects of anodic flow generated by DC on biochemical and metabolic features of the A549 human lung cancer cell line. Apoptosis was evaluated on the basis of caspase-3 activity and mitochondrial transmembrane potential dissipation. Cell morphology was analyzed using transmission electron microscopy, and lipid droplets were studied through morphometric analysis and X-ray qualitative elemental microanalysis. High-resolution respirometry was used to assess mitochondrial respiratory parameters. Results indicated A549 viability decreased in a dose-dependent manner with a prominent drop between 18 and 24h after treatment (ppotential. Furthermore, treated cells demonstrated important ultrastructural mitochondria damage and a three-fold increase in the cytoplasmic lipid bodies' number, quantified by morphometrical analyses. Conversely, 24h after treatment, the cells presented a two-fold increase of residual oxygen consumption, accounting for 45.3% of basal oxygen consumption. These results show remarkable alterations promoted by anodic flow on human lung cancer cells which are possibly involved with the antitumoral effects of EChT. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Changes in Functional Connectivity Associated with Direct Training and Generalization Effects of a Theory-Based Generative Naming Treatment

    Directory of Open Access Journals (Sweden)

    Swathi Kiran

    2014-04-01

    Nine PWA improved on the trained abstract words; seven PWA also showed generalization to concrete words in the same context-category. The region with the highest node degree in the trained abstract network across PWA was left inferior frontal gyrus pars triangularis (L IFGtri; while the highest node degree in the generalized concrete network was left precentral gyrus. Regions that showed increased connectivity for both training and generalization included L IFGtri, right middle frontal gyrus (MFG, and bilateral angular gyrus. Regions that showed increased connectivity regardless of whether or not treatment was given and whether or not treatment was successful included left MFG and bilateral superior frontal gyrus. Additionally, PWA who generalized showed more left than right hemisphere changes in both abstract and concrete networks; while PWA who improved on the trained abstract words, but did not generalize to concrete words showed more left than right hemisphere changes for the abstract network, but more right than left hemisphere changes for the concrete network. These results suggest that (a direct training and generalization are tapping into similar neural mechanisms, and (b changes in the left hemisphere coincide with better treatment outcomes.

  14. Experimental study of the response functions of direct-reading instruments measuring surface-area concentration of airborne nanostructured particles

    International Nuclear Information System (INIS)

    Bau, Sebastien; Witschger, Olivier; Gensdarmes, Francois; Thomas, Dominique

    2009-01-01

    An increasing number of experimental and theoretical studies focus on airborne nanoparticles (NP) in relation with many aspects of risk assessment to move forward our understanding of the hazards, the actual exposures in the workplace, and the limits of engineering controls and personal protective equipment with regard to NP. As a consequence, generating airborne NP with controlled properties constitutes an important challenge. In parallel, toxicological studies have been carried out, and most of them support the concept that surface-area could be a relevant metric for characterizing exposure to airborne NP. To provide NP surface-area concentration measurements, some direct-reading instruments have been designed, based on attachment rate of unipolar ions to NP by diffusion. However, very few information is available concerning the performances of these instruments and the parameters that could affect their responses. In this context, our work aims at characterizing the actual available instruments providing airborne NP surface-area concentration. The instruments (a- LQ1-DC, Matter Engineering; b-AeroTrak x2122 9000, TSI; c- NSAM, TSI model 3550;) are thought to be relevant for further workplace exposure characterization and monitoring. To achieve our work, an experimental facility (named CAIMAN) was specially designed, built and characterized.

  15. Direct Reprogramming of Adult Human Somatic Stem Cells Into Functional Neurons Using Sox2, Ascl1, and Neurog2

    Directory of Open Access Journals (Sweden)

    Jessica Alves de Medeiros Araújo

    2018-06-01

    Full Text Available Reprogramming of somatic cells into induced pluripotent stem cells (iPS or directly into cells from a different lineage, including neurons, has revolutionized research in regenerative medicine in recent years. Mesenchymal stem cells are good candidates for lineage reprogramming and autologous transplantation, since they can be easily isolated from accessible sources in adult humans, such as bone marrow and dental tissues. Here, we demonstrate that expression of the transcription factors (TFs SRY (sex determining region Y-box 2 (Sox2, Mammalian achaete-scute homolog 1 (Ascl1, or Neurogenin 2 (Neurog2 is sufficient for reprogramming human umbilical cord mesenchymal stem cells (hUCMSC into induced neurons (iNs. Furthermore, the combination of Sox2/Ascl1 or Sox2/Neurog2 is sufficient to reprogram up to 50% of transfected hUCMSCs into iNs showing electrical properties of mature neurons and establishing synaptic contacts with co-culture primary neurons. Finally, we show evidence supporting the notion that different combinations of TFs (Sox2/Ascl1 and Sox2/Neurog2 may induce multiple and overlapping neuronal phenotypes in lineage-reprogrammed iNs, suggesting that neuronal fate is determined by a combination of signals involving the TFs used for reprogramming but also the internal state of the converted cell. Altogether, the data presented here contribute to the advancement of techniques aiming at obtaining specific neuronal phenotypes from lineage-converted human somatic cells to treat neurological disorders.

  16. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  17. The Effects of Transcranial Direct Current Stimulation (tDCS on Psychomotor and Visual Perception Functions Related to Driving Skills

    Directory of Open Access Journals (Sweden)

    Alexander Brunnauer

    2018-01-01

    Full Text Available Objective: It could be demonstrated that anodal transcranial direct current stimulation (tDCS of the left dorsolateral prefrontal cortex (DLPFC enhances accuracy in working memory tasks and reaction time in healthy adults and thus may also have an influence on complex everyday tasks like driving a car. However, no studies have applied tDCS to psychomotor skills related to a standard driving test so far.Methods: 10 female and 5 male healthy adults without any medication and history of psychiatric or neurological illness were randomly assigned to two groups receiving active and sham stimulation in a double blind, cross-over study design. Standardized computerized psychomotor tests according to the German guidelines for road and traffic safety were administered at baseline. Then they performed the same tests during an anodal or sham tDCS of the left DLPFC in two separated sessions.Results: No significant improvements in skills related to driving performance like visual perception, stress tolerance, concentration, and vigilance could be shown after left anodal prefrontal tDCS. Side effects were low and did not differ between active and sham stimulation.Conclusions: The findings of our study indicate that left prefrontal tDCS may not alter driving skills affording more automated action patterns but as shown in previous studies may have an influence on driving behavior requiring executive control processes. This however has to be proved in future studies and within greater samples.

  18. MRI anatomical mapping and direct stereotactic targeting in the subthalamic region: functional and anatomical correspondence in Parkinson's disease

    International Nuclear Information System (INIS)

    Lemaire, Jean-Jacques; Coste, Jerome; Ouchchane, Lemlih; Hemm, Simone; Derost, Philippe; Ulla, Miguel; Durif, Franck; Siadoux, Severine; Gabrillargues, Jean; Chazal, Jean

    2007-01-01

    Object Relationships between clinical effects, anatomy, and electrophysiology are not fully understood in DBS of the subthalamic region in Parkinson's disease. We proposed an anatomic study based on direct image-guided stereotactic surgery with a multiple source data analysis. Materials and Methods A manual anatomic mapping was realized on coronal 1.5-Tesla MRI of 15 patients. Biological data were collected under local anesthesia: the spontaneous neuron activities and the clinical efficiency and the appearance of adverse effects. They were related to relevant current values (mA), the benefit threshold (bt, minimal current leading an clear efficiency), the adverse effect threshold (at, minimal current leading an adverse effect) and the stimulation margin (sm = at - bt); they were matched with anatomy. Results We found consistent relationships between anatomy and biological data. The optimal stimulation parameters (low bt + high sm) were noted in the dorsolateral STN. The highest spontaneous neuron activity was found in the ventromedial STN. Dorsolateral (sensorimotor) STN seems the main DBS effector. The highest spontaneous neuron activity seems related to the anterior (rostral) ventromedial (limbic) STN. Conclusion 1.5 Tesla images provide sufficiently detailed subthalamic anatomy for image-guided stereotactic surgery and may aid in understanding DBS mechanisms. (orig.)

  19. Experimental study of the response functions of direct-reading instruments measuring surface-area concentration of airborne nanostructured particles

    Energy Technology Data Exchange (ETDEWEB)

    Bau, Sebastien; Witschger, Olivier [Institut National de Recherche et de Securite, INRS, Laboratoire de Metrologie des Aerosols, Rue du Morvan, CS 60027, 54519 Vandoeuvre Cedex (France); Gensdarmes, Francois [Institut de Radioprotection et de Surete Nucleaire, IRSN, Laboratoire de Physique et de Metrologie des Aerosols, BP 68, 91192 Gif-sur-Yvette Cedex (France); Thomas, Dominique [Laboratoire des Sciences du Genie Chimique, LSGC/CNRS, Nancy Universite, BP 2041, 54001 Nancy Cedex (France)], E-mail: sebastien.bau@inrs.fr

    2009-05-01

    An increasing number of experimental and theoretical studies focus on airborne nanoparticles (NP) in relation with many aspects of risk assessment to move forward our understanding of the hazards, the actual exposures in the workplace, and the limits of engineering controls and personal protective equipment with regard to NP. As a consequence, generating airborne NP with controlled properties constitutes an important challenge. In parallel, toxicological studies have been carried out, and most of them support the concept that surface-area could be a relevant metric for characterizing exposure to airborne NP. To provide NP surface-area concentration measurements, some direct-reading instruments have been designed, based on attachment rate of unipolar ions to NP by diffusion. However, very few information is available concerning the performances of these instruments and the parameters that could affect their responses. In this context, our work aims at characterizing the actual available instruments providing airborne NP surface-area concentration. The instruments (a- LQ1-DC, Matter Engineering; b-AeroTrak{sup x2122} 9000, TSI; c- NSAM, TSI model 3550;) are thought to be relevant for further workplace exposure characterization and monitoring. To achieve our work, an experimental facility (named CAIMAN) was specially designed, built and characterized.

  20. Separating Direct and Indirect Turbofan Engine Combustion Noise While Estimating Post-Combustion (Post-Flame) Residence Time Using the Correlation Function

    Science.gov (United States)

    Miles, Jeffrey Hilton

    2011-01-01

    A previous investigation on the presence of direct and indirect combustion noise for a full-scale turbofan engine using a far-field microphone at 130 is extended by also examining signals obtained at two additional downstream directions using far-field microphones at 110 deg and 160 deg. A generalized cross-correlation function technique is used to study the change in propagation time to the far field of the combined direct and indirect combustion noise signal as a sequence of low-pass filters are applied. The filtering procedure used produces no phase distortion. As the low-pass filter frequency is decreased, the travel time increases because the relative amount of direct combustion noise is reduced. The indirect combustion noise signal travels more slowly because in the combustor entropy fluctuations move with the flow velocity, which is slow compared to the local speed of sound. The indirect combustion noise signal travels at acoustic velocities after reaching the turbine and being converted into an acoustic signal. The direct combustion noise is always propagating at acoustic velocities. The results show that the estimated indirect combustion noise time delay values (post-combustion residence times) measured at each angle are fairly consistent with one another for a relevant range of operating conditions and demonstrate source separation of a mixture of direct and indirect combustion noise. The results may lead to a better idea about the acoustics in the combustor and may help develop and validate improved reduced-order physics-based methods for predicting turbofan engine core noise.

  1. DC-Analyzer-facilitated combinatorial strategy for rapid directed evolution of functional enzymes with multiple mutagenesis sites.

    Science.gov (United States)

    Wang, Xiong; Zheng, Kai; Zheng, Huayu; Nie, Hongli; Yang, Zujun; Tang, Lixia

    2014-12-20

    Iterative saturation mutagenesis (ISM) has been shown to be a powerful method for directed evolution. In this study, the approach was modified (termed M-ISM) by combining the single-site saturation mutagenesis method with a DC-Analyzer-facilitated combinatorial strategy, aiming to evolve novel biocatalysts efficiently in the case where multiple sites are targeted simultaneously. Initially, all target sites were explored individually by constructing single-site saturation mutagenesis libraries. Next, the top two to four variants in each library were selected and combined using the DC-Analyzer-facilitated combinatorial strategy. In addition to site-saturation mutagenesis, iterative saturation mutagenesis also needed to be performed. The advantages of M-ISM over ISM were that the screening effort is greatly reduced, and the entire M-ISM procedure was less time-consuming. The M-ISM strategy was successfully applied to the randomization of halohydrin dehalogenase from Agrobacterium radiobacter AD1 (HheC) when five interesting sites were targeted simultaneously. After screening 900 clones in total, six positive mutants were obtained. These mutants exhibited 4.0- to 9.3-fold higher k(cat) values than did the wild-type HheC toward 1,3-dichloro-2-propanol. However, with the ISM strategy, the best hit showed a 5.9-fold higher k(cat) value toward 1,3-DCP than the wild-type HheC, which was obtained after screening 4000 clones from four rounds of mutagenesis. Therefore, M-ISM could serve as a simple and efficient version of ISM for the randomization of target genes with multiple positions of interest.

  2. Direct enzyme assay evidence confirms aldehyde reductase function of Ydr541cp and Ygl039wp from Saccharomyces cerevisiae.

    Science.gov (United States)

    Moon, Jaewoong; Liu, Z Lewis

    2015-04-01

    The aldehyde reductase gene ARI1 is a recently characterized member of an intermediate subfamily within the short-chain dehydrogenase/reductase (SDR) superfamily that clarified mechanisms of in situ detoxification of 2-furaldehyde and 5-hydroxymethyl-2-furaldehyde by Saccharomyces cerevisiae. Uncharacterized open reading frames (ORFs) are common among tolerant candidate genes identified for lignocellulose-to-advanced biofuels conversion. This study presents partially purified proteins of two ORFs, YDR541C and YGL039W, and direct enzyme assay evidence against aldehyde-inhibitory compounds commonly encountered during lignocellulosic biomass fermentation processes. Each of the partially purified proteins encoded by these ORFs showed a molecular mass of approximately 38 kDa, similar to Ari1p, a protein encoded by aldehyde reductase gene. Both proteins demonstrated strong aldehyde reduction activities toward 14 aldehyde substrates, with high levels of reduction activity for Ydr541cp toward both aromatic and aliphatic aldehydes. While Ydr541cp was observed to have a significantly higher specific enzyme activity at 20 U/mg using co-factor NADPH, Ygl039wp displayed a NADH preference at 25 U/mg in reduction of butylaldehyde. Amino acid sequence analysis identified a characteristic catalytic triad, Ser, Tyr and Lys; a conserved catalytic motif of Tyr-X-X-X-Lys; and a cofactor-binding sequence motif, Gly-X-X-Gly-X-X-Ala, near the N-terminus that are shared by Ydr541cp, Ygl039wp, Yol151wp/GRE2 and Ari1p. Findings of aldehyde reductase genes contribute to the yeast gene annotation and aids development of the next-generation biocatalyst for advanced biofuels production. Copyright © 2015 John Wiley & Sons, Ltd.

  3. Functionalized Graphitic Carbon Nitride for Metal-free, Flexible and Rewritable Nonvolatile Memory Device via Direct Laser-Writing

    Science.gov (United States)

    Zhao, Fei; Cheng, Huhu; Hu, Yue; Song, Long; Zhang, Zhipan; Jiang, Lan; Qu, Liangti

    2014-01-01

    Graphitic carbon nitride nanosheet (g-C3N4-NS) has layered structure similar with graphene nanosheet and presents unusual physicochemical properties due to the s-triazine fragments. But their electronic and electrochemical applications are limited by the relatively poor conductivity. The current work provides the first example that atomically thick g-C3N4-NSs are the ideal candidate as the active insulator layer with tunable conductivity for achieving the high performance memory devices with electrical bistability. Unlike in conventional memory diodes, the g-C3N4-NSs based devices combined with graphene layer electrodes are flexible, metal-free and low cost. The functionalized g-C3N4-NSs exhibit desirable dispersibility and dielectricity which support the all-solution fabrication and high performance of the memory diodes. Moreover, the flexible memory diodes are conveniently fabricated through the fast laser writing process on graphene oxide/g-C3N4-NSs/graphene oxide thin film. The obtained devices not only have the nonvolatile electrical bistability with great retention and endurance, but also show the rewritable memory effect with a reliable ON/OFF ratio of up to 105, which is the highest among all the metal-free flexible memory diodes reported so far, and even higher than those of metal-containing devices. PMID:25073687

  4. New Directions in 3D Medical Modeling: 3D-Printing Anatomy and Functions in Neurosurgical Planning

    Science.gov (United States)

    Árnadóttir, Íris; Gíslason, Magnús; Ólafsson, Ingvar

    2017-01-01

    This paper illustrates the feasibility and utility of combining cranial anatomy and brain function on the same 3D-printed model, as evidenced by a neurosurgical planning case study of a 29-year-old female patient with a low-grade frontal-lobe glioma. We herein report the rapid prototyping methodology utilized in conjunction with surgical navigation to prepare and plan a complex neurosurgery. The method introduced here combines CT and MRI images with DTI tractography, while using various image segmentation protocols to 3D model the skull base, tumor, and five eloquent fiber tracts. This 3D model is rapid-prototyped and coregistered with patient images and a reported surgical navigation system, establishing a clear link between the printed model and surgical navigation. This methodology highlights the potential for advanced neurosurgical preparation, which can begin before the patient enters the operation theatre. Moreover, the work presented here demonstrates the workflow developed at the National University Hospital of Iceland, Landspitali, focusing on the processes of anatomy segmentation, fiber tract extrapolation, MRI/CT registration, and 3D printing. Furthermore, we present a qualitative and quantitative assessment for fiber tract generation in a case study where these processes are applied in the preparation of brain tumor resection surgery. PMID:29065569

  5. Iron(III) diethylenetriaminepentaacetic acid complex on polyallylamine functionalized multiwalled carbon nanotubes: immobilization, direct electrochemistry and electrocatalysis.

    Science.gov (United States)

    Liu, Hailing; Cui, Yanyun; Li, Pan; Zhou, Yiming; Zhu, Xiaoshu; Tang, Yawen; Chen, Yu; Lu, Tianhong

    2013-05-07

    A nonenzymatic iron(III) diethylenetriaminepentaacetic acid (Fe(III)-DETPA) complex based amperometric sensor for the analytical determination of hydrogen peroxide was developed. By combining the electrostatic interaction between the Fe(III)-DETPA complex and polyallylamine (PAH) functionalized multiwalled carbon nanotubes (MWCNTs) as well as the ionotropic crosslinking interaction between PAH and ethylenediamine-tetramethylene phosphonic acid (EDTMP), the electroactive Fe(III)-DETPA complex was successfully incorporated within the MWCNT matrix, and firmly immobilized on the Au substrate electrode. The fabricated electrochemical sensor was characterized with scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electrochemical methods. The influences of solution pH and ionic strength on the electrochemical sensor were investigated. The prepared electrochemical sensor had a fast response to hydrogen peroxide (<3 s) and an excellent linear range of concentration from 1.25 × 10(-8) to 4.75 × 10(-3) M with a detection limit of 6.3 × 10(-9) M under the optimum conditions.

  6. New Directions in 3D Medical Modeling: 3D-Printing Anatomy and Functions in Neurosurgical Planning

    Directory of Open Access Journals (Sweden)

    Paolo Gargiulo

    2017-01-01

    Full Text Available This paper illustrates the feasibility and utility of combining cranial anatomy and brain function on the same 3D-printed model, as evidenced by a neurosurgical planning case study of a 29-year-old female patient with a low-grade frontal-lobe glioma. We herein report the rapid prototyping methodology utilized in conjunction with surgical navigation to prepare and plan a complex neurosurgery. The method introduced here combines CT and MRI images with DTI tractography, while using various image segmentation protocols to 3D model the skull base, tumor, and five eloquent fiber tracts. This 3D model is rapid-prototyped and coregistered with patient images and a reported surgical navigation system, establishing a clear link between the printed model and surgical navigation. This methodology highlights the potential for advanced neurosurgical preparation, which can begin before the patient enters the operation theatre. Moreover, the work presented here demonstrates the workflow developed at the National University Hospital of Iceland, Landspitali, focusing on the processes of anatomy segmentation, fiber tract extrapolation, MRI/CT registration, and 3D printing. Furthermore, we present a qualitative and quantitative assessment for fiber tract generation in a case study where these processes are applied in the preparation of brain tumor resection surgery.

  7. Functionalized Graphitic Carbon Nitride for Metal-free, Flexible and Rewritable Nonvolatile Memory Device via Direct Laser-Writing

    Science.gov (United States)

    Zhao, Fei; Cheng, Huhu; Hu, Yue; Song, Long; Zhang, Zhipan; Jiang, Lan; Qu, Liangti

    2014-07-01

    Graphitic carbon nitride nanosheet (g-C3N4-NS) has layered structure similar with graphene nanosheet and presents unusual physicochemical properties due to the s-triazine fragments. But their electronic and electrochemical applications are limited by the relatively poor conductivity. The current work provides the first example that atomically thick g-C3N4-NSs are the ideal candidate as the active insulator layer with tunable conductivity for achieving the high performance memory devices with electrical bistability. Unlike in conventional memory diodes, the g-C3N4-NSs based devices combined with graphene layer electrodes are flexible, metal-free and low cost. The functionalized g-C3N4-NSs exhibit desirable dispersibility and dielectricity which support the all-solution fabrication and high performance of the memory diodes. Moreover, the flexible memory diodes are conveniently fabricated through the fast laser writing process on graphene oxide/g-C3N4-NSs/graphene oxide thin film. The obtained devices not only have the nonvolatile electrical bistability with great retention and endurance, but also show the rewritable memory effect with a reliable ON/OFF ratio of up to 105, which is the highest among all the metal-free flexible memory diodes reported so far, and even higher than those of metal-containing devices.

  8. Constraint-Induced Movement Therapy Combined with Transcranial Direct Current Stimulation over Premotor Cortex Improves Motor Function in Severe Stroke: A Pilot Randomized Controlled Trial

    Directory of Open Access Journals (Sweden)

    Suellen M. Andrade

    2017-01-01

    Full Text Available Objective. We compared the effects of transcranial direct current stimulation at different cortical sites (premotor and motor primary cortex combined with constraint-induced movement therapy for treatment of stroke patients. Design. Sixty patients were randomly distributed into 3 groups: Group A, anodal stimulation on premotor cortex and constraint-induced movement therapy; Group B, anodal stimulation on primary motor cortex and constraint-induced movement therapy; Group C, sham stimulation and constraint-induced movement therapy. Evaluations involved analysis of functional independence, motor recovery, spasticity, gross motor function, and muscle strength. Results. A significant improvement in primary outcome (functional independence after treatment in the premotor group followed by primary motor group and sham group was observed. The same pattern of improvement was highlighted among all secondary outcome measures regarding the superior performance of the premotor group over primary motor and sham groups. Conclusions. Premotor cortex can contribute to motor function in patients with severe functional disabilities in early stages of stroke. This study was registered in ClinicalTrials.gov database (NCT 02628561.

  9. PKR is a novel functional direct player that coordinates skeletal muscle differentiation via p38MAPK/AKT pathways.

    Science.gov (United States)

    Alisi, A; Spaziani, A; Anticoli, S; Ghidinelli, M; Balsano, C

    2008-03-01

    Myogenic differentiation is a highly orchestrated multistep process controlled by extracellular growth factors that modulate largely unknown signals into the cell affecting the muscle-transcription program. P38MAPK-dependent signalling, as well as PI3K/Akt pathway, has a key role in the control of muscle gene expression at different stages during the myogenic process. P38MAPK affects the activities of transcription factors, such as MyoD and myogenin, and contributes, together with PI3K/Akt pathway, to control the early and late steps of myogenic differentiation. The aim of our work was to better define the role of PKR, a dsRNA-activated protein kinase, as potential component in the differentiation program of C2C12 murine myogenic cells and to correlate its activity with p38MAPK and PI3K/Akt myogenic regulatory pathways. Here, we demonstrate that PKR is an essential component of the muscle development machinery and forms a functional complex with p38MAPK and/or Akt, contributing to muscle differentiation of committed myogenic cells in vitro. Inhibition of endogenous PKR activity by a specific (si)RNA and a PKR dominant-negative interferes with the myogenic program of C2C12 cells, causing a delay in activation of myogenic specific genes and inducing the formation of thinner myofibers. In addition, the construction of three PKR mutants allowed us to demonstrate that both N and C-terminal regions of PKR are critical for the interaction with p38MAPK and Akt. The novel discovered complex permits PKR to timely regulate the inhibition/activation of p38MAPK and Akt, controlling in this way the different steps characterizing skeletal muscle differentiation.

  10. Effect of Transcranial Direct Current Stimulation on Severely Affected Arm-Hand Motor Function in Patients After an Acute Ischemic Stroke: A Pilot Randomized Control Trial.

    Science.gov (United States)

    Rabadi, Meheroz H; Aston, Christopher E

    2017-10-01

    The aim of this article was to determine whether cathodal transcranial direct current stimulation (c-tDCS) to unaffected primary motor cortex (PMC) plus conventional occupational therapy (OT) improves functional motor recovery of the affected arm hand in patients after an acute ischemic stroke compared with sham transcranial direct current stimulation plus conventional OT. In this prospective, randomized, double-blinded, sham-controlled trial of 16 severe, acute ischemic stroke patients with severe arm-hand weakness were randomly assigned to either experimental (c-tDCS plus OT; n = 8) or control (sham transcranial direct current stimulation plus OT; n = 8) groups. All patients received a standard 3-hr in-patient rehabilitation therapy, plus an additional ten 30-min sessions of tDCS. During each session, 1 mA of cathodal stimulation to the unaffected PMC is performed followed by the patient's scheduled OT. The primary outcome measure was change in Action Research Arm Test (ARAT) total and subscores on discharge. Application of c-tDCS to unaffected PMC resulted in a clinically relevant 10-point improvement in the affected arm-hand function based on ARAT total score compared with a 2-point improvement in the control group. Application of 30-min of c-tDCS to the unaffected PMC showed a 10-point improvement in the ARAT score. This corresponds to a large effect size in improvement of affected arm-hand function in patients with severe, acute ischemic stroke. Although not statistically significant, this suggests that larger studies, enrolling at least 25 patients in each group, and with a longer follow-up are warranted.

  11. A validation of a ray-tracing tool used to generate bi-directional scattering distribution functions for complex fenestration systems

    DEFF Research Database (Denmark)

    McNeil, A.; Jonsson, C.J.; Appelfeld, David

    2013-01-01

    , or daylighting systems. However, such tools require users to provide bi-directional scattering distribution function (BSDF) data that describe the solar-optical performance of the CFS. A free, open-source Radiance tool genBSDF enables users to generate BSDF data for arbitrary CFS. Prior to genBSDF, BSDF data.......We explain the basis and use of the genBSDF tool and validate the tool by comparing results for four different cases to BSDF data produced via alternate methods. This validation demonstrates that BSDFs created with genBSDF are comparable to BSDFs generated analytically using TracePro and by measurement...

  12. [Direct osteosynthesis of instable Gehweiler Type III atlas fractures. Presentation of a dorsoventral osteosynthesis of instable atlas fractures while maintaining function].

    Science.gov (United States)

    Böhm, H; Kayser, R; El Saghir, H; Heyde, C-E

    2006-09-01

    This retrospective study evaluates eight patients with unstable fractures of the atlas vertebra, treated operatively in the Central Clinic Bad Berka between January 1995 and December 2001. In all cases, we were confronted with unstable and dislocated type III fractures according to Gehweiler, caused by an injured transverse ligament. Mean age was 34 years (range 20-49) in two women and six men. We introduce a new technique of direct reconstruction of the atlas vertebra. This technique leads to a stable ring construct that allows compression osteosynthesis of the fracture. Spinal fusion can be avoided, as can postoperative immobilization, since sufficient stability for functional postoperative treatment is achievable. The follow-up control 38 months (range 6-75) after surgery showed solid bony fusion in all cases, in one case after revision surgery. All patients showed good functional results, there was no need for analgesics and all patients could be reintegrated into their former occupation.

  13. Direct observation of quark-hadron duality in the free neutron F2 structure function

    Energy Technology Data Exchange (ETDEWEB)

    Niculescu, I. [James Madison Univ., Harrisonburg, VA (United States); Niculescu, G. [James Madison Univ., Harrisonburg, VA (United States); Melnitchouk, W. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Arrington, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Christy, M. E. [Hampton Univ., Hampton, VA (United States); Ent, R. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Griffioen, K. A. [College of William and Mary, Williamsburg, VA (United States); Kalantarians, N. [Hampton Univ., Hampton, VA (United States); Keppel, C. E. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Kuhn, S. [Old Dominion Univ., Norfolk, VA (United States); Tkachenko, S. [Univ. of Virginia, Charlottesville, VA (United States); Zhang, J. [Univ. of Virginia, Charlottesville, VA (United States)

    2015-05-21

    Using data from the recent BONuS experiment at Jefferson Lab, which utilized a novel spectator tagging technique to extract the inclusive electron-free neutron scattering cross section, we obtain the first direct observation of quark-hadron duality in the neutron F2 structure function. In addition, the data are used to reconstruct the lowest few (N = 2, 4 and 6) moments of F2 in the three prominent nucleon resonance regions, as well as the moments integrated over the entire resonance region. Comparison with moments computed from global parametrizations of parton distribution functions suggest that quark--hadron duality holds locally for the neutron in the second and third resonance regions down to Q2 ≈ 1 GeV2, with violations possibly up to 20% observed in the first resonance region.

  14. The development of a semi-structured home interview (CHIF) to directly assess function in cognitively impaired elderly people in two cultures

    Science.gov (United States)

    Hendrie, H. C.; Lane, K. A.; Ogunniyi, A.; Baiyewu, O.; Gureje, O.; Evans, R.; Smith-Gamble, V.; Pettaway, M.; Unverzagt, F. W.; Gao, S.; Hall, K. S.

    2010-01-01

    Background Assessing function is a crucial element in the diagnosis of dementia. This information is usually obtained from key informants. However, reliable informants are not always available. Methods A 10-item semi-structured home interview (the CHIF, or Clinician Home-based Interview to assess Function) to assess function primarily by measuring instrumental activities of daily living directly was developed and tested for inter-rater reliability and validity as part of the Indianapolis–Ibadan dementia project. The primary validity measurements were correlations between scores on the CHIF and independently gathered scores on the Blessed Dementia Scale (from informants) and the Mini-mental State Examination (MMSE). Sensitivities and specificities of scores on the CHIF and receiver operator characteristic (ROC) curves were constructed with dementia as the dependent variable. Results Inter-rater reliability for the CHIF was high (Pearson’s correlation coefficient 0.99 in Indianapolis and 0.87 in Ibadan). Internal consistency, in both samples, was good (Cronbach’s α 0.95 in Indianapolis and 0.83 in Ibadan). Scores on the CHIF correlated well with the Blessed Dementia scores at both sites (−0.71, p < 0.0001 for Indianapolis and −0.56, p < 0.0001 for Ibadan) and with the MMSE (0.75, p < 0.0001 for Indianapolis and 0.44, p < 0.0001 for Ibadan). For all items at both sites, the subjects without dementia performed significantly better than those with dementia. The area under the ROC curve for dementia diagnosis was 0.965 for Indianapolis and 0.925 for Ibadan. Conclusion The CHIF is a useful instrument to assess function directly in elderly participants in international studies, particularly in the absence of reliable informants. PMID:16640794

  15. Functional mapping of the fission yeast DNA polymerase δ B-subunit Cdc1 by site-directed and random pentapeptide insertion mutagenesis

    Directory of Open Access Journals (Sweden)

    Gray Fiona C

    2009-08-01

    Full Text Available Abstract Background DNA polymerase δ plays an essential role in chromosomal DNA replication in eukaryotic cells, being responsible for synthesising the bulk of the lagging strand. In fission yeast, Pol δ is a heterotetrameric enzyme comprising four evolutionarily well-conserved proteins: the catalytic subunit Pol3 and three smaller subunits Cdc1, Cdc27 and Cdm1. Pol3 binds directly to the B-subunit, Cdc1, which in turn binds the C-subunit, Cdc27. Human Pol δ comprises the same four subunits, and the crystal structure was recently reported of a complex of human p50 and the N-terminal domain of p66, the human orthologues of Cdc1 and Cdc27, respectively. Results To gain insights into the structure and function of Cdc1, random and directed mutagenesis techniques were used to create a collection of thirty alleles encoding mutant Cdc1 proteins. Each allele was tested for function in fission yeast and for binding of the altered protein to Pol3 and Cdc27 using the two-hybrid system. Additionally, the locations of the amino acid changes in each protein were mapped onto the three-dimensional structure of human p50. The results obtained from these studies identify amino acid residues and regions within the Cdc1 protein that are essential for interaction with Pol3 and Cdc27 and for in vivo function. Mutations specifically defective in Pol3-Cdc1 interactions allow the identification of a possible Pol3 binding surface on Cdc1. Conclusion In the absence of a three-dimensional structure of the entire Pol δ complex, the results of this study highlight regions in Cdc1 that are vital for protein function in vivo and provide valuable clues to possible protein-protein interaction surfaces on the Cdc1 protein that will be important targets for further study.

  16. Assortative mating and directional or stabilizing selection for a non-linear function of traits in Tribolium.

    Science.gov (United States)

    Campo, J L; Gil, M G

    1993-01-12

    Assortative or random mating following selection in either direction on a non-linear index (experiment 1) or stabilizing selection for pupal length (experiment 2) were carried out for five generations in two lines of Tribolium castaneum (A and R, respectively), with three replicates each. The selected proportion was 25% in all lines. In experiment 1, the selection criterion was designed to increase the aggregate value of adult weight and the first- and second-order powers of pupal length. The A and R lines gave significant responses for the aggregate value (184 ± 6 and 161 ± 14, respectively), pupal length (0.74 ± 0.02 and 0.64 ± 0.05, respectively), and adult weight (0.79 ± 0.03 and 0.78 ± 0.12, respectively). Although the A line was not significantly better than the R line, there was a consistent advantage for assortative mating over random mating, the mean response for aggregate value and pupal length being approximately 1.15 times greater for the A line. In experiment 2 the selection criterion was the square of the deviation from the mean pupal length (stabilizing selection); both lines did not show any change for pupal length. The phenotypic variance showed a significant decrease in the A and R lines, due to a decrease in between-family variance. The assortatively and randomly mated lines were similar for these changes in phenotypic variation. RESUMEN: Aparemiento clasificado y selección direccional o estabilizante para una función no lineal en Tribolium. Dos líneas de Tribolium castaneum fueron seleccionadas direccionalmente para un índice no lineal (experimento 1) o estabilizantemente para longitud de pupa (experimento 2), apareando los animales seleccionados clasificadamente (A) o aleatoriamente (R). Había tres repeticiones por experimento y línea, siendo la proporción de selección el 25%. En el experimento 1, el objetivo de selección incluía el peso adulto así como la longitud de pupa y su cuadrado. Ambas líneas dieron respuesta

  17. Direct electrochemical sensing of glucose using glucose oxidase immobilized on functionalized carbon nanotubes via a novel metal chelate-based affinity method

    International Nuclear Information System (INIS)

    Tu, X.; Zhao, Y.; Luo, S.; Luo, X.; Feng, L.

    2012-01-01

    We report on a novel amperometric glassy carbon biosensing electrode for glucose. It is based on the immobilization of a highly sensitive glucose oxidase (GOx) by affinity interaction on carbon nanotubes (CNTs) functionalized with iminodiacetic acid and metal chelates. The new technique for immobilization is exploiting the affinity of Co(II) ions to the histidine and cysteine moieties on the surface of GOx. The direct electrochemistry of immobilized GOx revealed that the functionalized CNTs greatly improve the direct electron transfer between GOx and the surface of the electrode to give a pair of well-defined and almost reversible redox peaks and undergoes fast heterogeneous electron transfer with a rate constant (k s) of 0. 59 s -1 . The GOx immobilized in this way fully retained its activity for the oxidation of glucose. The resulting biosensor is capable of detecting glucose at levels as low as 0.01 mM, and has excellent operational stability (with no decrease in the activity of enzyme over a 10 days period). The method of immobilizing GOx is easy and also provides a model technique for potential use with other redox enzymes and proteins. (author)

  18. Direct navigation on 3D rotational x-ray data acquired with a mobile propeller C-arm: accuracy and application in functional endoscopic sinus surgery

    International Nuclear Information System (INIS)

    Kraats, Everine B van de; Carelsen, Bart; Fokkens, Wytske J; Boon, Sjirk N; Noordhoek, Niels; Niessen, Wiro J; Walsum, Theo van

    2005-01-01

    Recently, three-dimensional (3D) rotational x-ray imaging has been combined with navigation technology, enabling direct 3D navigation for minimally invasive image guided interventions. In this study, phantom experiments are used to determine the accuracy of such a navigation set-up for a mobile C-arm with propeller motion. After calibration of the C-arm system, the accuracy is evaluated by pinpointing divots on a special-purpose phantom with known geometry. This evaluation is performed both with and without C-arm motion in between calibration and registration for navigation. The variation caused by each of the individual transformations in the calibration and registration process is also studied. The feasibility of direct navigation on 3D rotational x-ray images for functional endoscopic sinus surgery has been evaluated in a cadaver navigation experiment. Navigation accuracy was approximately 1.0 mm, which is sufficient for functional endoscopic sinus surgery. C-arm motion in between calibration and registration slightly degraded the registration accuracy by approximately 0.3 mm. Standard deviations of each of the transformations were in the range 0.15-0.31 mm. In the cadaver experiment, the navigation images were considered in good correspondence with the endoscopic images by an experienced ENT surgeon. Availability of 3D localization information provided by the navigation system was considered valuable by the ENT surgeon

  19. Direct Coaptation of the Phrenic Nerve With the Posterior Division of the Lower Trunk to Restore Finger and Elbow Extension Function in Patients With Total Brachial Plexus Injuries.

    Science.gov (United States)

    Wang, Shu-feng; Li, Peng-cheng; Xue, Yun-hao; Zou, Ji-yao; Li, Wen-jun; Li, Yucheng

    2016-02-01

    To overcome the mismatch in nerve sizes in phrenic nerve transfer to the radial nerve for elbow and finger extension reanimation for patients with total brachial plexus injuries (TBPI), a selective neurotization procedure was designed. To investigate the long-term results of phrenic nerve transfer to the posterior division of the lower trunk with direct coaptation in restoring elbow and finger extension after TBPI. Phrenic nerve was transferred to and directly coapted with the posterior division of the lower trunk in 27 patients with TBPI. Seven patients were <18 years old (adolescent group), and the remaining 20 patients ≥18 years (adult group). Postoperative mean follow-up period was 54 ± 9 months (range, 48-85 months). The motor function attained M3 or greater in 81.5% of patients for elbow extension and in 48% of patients for finger extension. The percentage of patients who regained M3 or greater muscle power of finger extension in the adolescent group and the adult group was 71.4%, and 40%, respectively. Meanwhile, 85.7% in the adolescent group and 80% in the adult group achieved M3 or greater muscle power of elbow extension. There were no significant differences between the 2 groups. The elbow extension and finger extension were synchronous contractions and did not become independent of respiratory effort. This procedure simultaneously and effectively restores the function of elbow and finger extension in patients after TBPI. However, the patients could not do elbow and finger extension separately.

  20. Permanent magnetic field, direct electric field, and infrared to reduce blood glucose level and hepatic function in mus musculus with diabetic mellitus

    Science.gov (United States)

    Suhariningsih; Basuki Notobroto, Hari; Winarni, Dwi; Achmad Hussein, Saikhu; Anggono Prijo, Tri

    2017-05-01

    Blood contains several electrolytes with positive (cation) and negative (anion) ion load. Both electrolytes deliver impulse synergistically adjusting body needs. Those electrolytes give specific effect to external disturbance such as electric, magnetic, even infrared field. A study has been conducted to reduce blood glucose level and liver function, in type 2 Diabetes Mellitus patients, using Biophysics concept which uses combination therapy of permanent magnetic field, electric field, and infrared. This study used 48 healthy mice (mus musculus), male, age 3-4 weeks, with approximately 25-30 g in weight. Mice was fed with lard as high fat diet orally, before Streptozotocin (STZ) induction become diabetic mice. Therapy was conducted by putting mice in a chamber that emits the combination of permanent magnetic field, electric field, and infrared, every day for 1 hour for 28 days. There were 4 combinations of therapy/treatment, namely: (1) permanent magnetic field, direct electric field, and infrared; (2) permanent magnetic field, direct electric field, without infrared; (3) permanent magnetic field, alternating electric field, and infrared; and (4) permanent magnetic field, alternating electric field, without infrared. The results of therapy show that every combination is able to reduce blood glucose level, AST, and ALT. However, the best result is by using combination of permanent magnetic field, direct electric field, and infrared.

  1. Permanent magnetic field, direct electric field, and infrared to reduce blood glucose level and hepatic function in mus musculus with diabetic mellitus

    International Nuclear Information System (INIS)

    Suhariningsih; Prijo, Tri Anggono; Notobroto, Hari Basuki; Winarni, Dwi; Hussein, Saikhu Achmad

    2017-01-01

    Blood contains several electrolytes with positive (cation) and negative (anion) ion load. Both electrolytes deliver impulse synergistically adjusting body needs. Those electrolytes give specific effect to external disturbance such as electric, magnetic, even infrared field. A study has been conducted to reduce blood glucose level and liver function, in type 2 Diabetes Mellitus patients, using Biophysics concept which uses combination therapy of permanent magnetic field, electric field, and infrared. This study used 48 healthy mice ( mus musculus ), male, age 3-4 weeks, with approximately 25-30 g in weight. Mice was fed with lard as high fat diet orally, before Streptozotocin (STZ) induction become diabetic mice. Therapy was conducted by putting mice in a chamber that emits the combination of permanent magnetic field, electric field, and infrared, every day for 1 hour for 28 days. There were 4 combinations of therapy/treatment, namely: (1) permanent magnetic field, direct electric field, and infrared; (2) permanent magnetic field, direct electric field, without infrared; (3) permanent magnetic field, alternating electric field, and infrared; and (4) permanent magnetic field, alternating electric field, without infrared. The results of therapy show that every combination is able to reduce blood glucose level, AST, and ALT. However, the best result is by using combination of permanent magnetic field, direct electric field, and infrared. (paper)

  2. Optimization of the quantitative direct solid total-reflection X-ray fluorescence analysis of glass microspheres functionalized with Zr organometallic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Ruiz, Ramon, E-mail: ramon.fernandez@uam.e [Servicio Interdepartamental de Investigacion, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, E-28049, Madrid (Spain); Andres, Roman; Jesus, Ernesto de [Departamento de Quimica Inorganica, Universidad de Alcala, Campus Universitario, 28871, Alcala de Henares, Madrid (Spain); Terreros, Pilar [Instituto de Catalisis y Petroleo-Quimica, CSIC, Cantoblanco, 28049, Madrid (Spain)

    2010-06-15

    Quantitative determination of Zr in the system constituted by quartz microspheres functionalized with two kinds of organometallic compounds has been studied due to the importance of the correct quantization of the Zr from a catalytic point of view. Two parallel approximations were done, i.e. acid leaching and direct solid quantization. To validate the acid leaching TXRF measures, ICP-MS analysis were carried out. The results obtained by means of the optimization of the quantitative direct solid procedure show that, with a previous particle size distribution modification, TXRF obtain the same analytical results as ICP-MS and TXRF by acid leaching way but without previous chemical acid manipulation. This fact implies an important improvement for the analysis time, reagents costs and analysis facility and it proves again the versatility of TXRF to solve analytical problems in an easy, quick and accurate way. Additionally and for the direct solid TXRF measurements, a deeper study was done to evaluate the intrinsic analytical parameters of the Zr TXRF analysis of this material. So, the influence of the particle size distributions (modified by means of a high power ultrasound probe) with respect to uncertainty and detection limits for Zr were developed. The main analytical conclusion was the strong correlation between the average particle sizes and the TXRF analytical parameters of Zr measurements, i.e. concentration, accuracy, uncertainty and detection limits.

  3. Adrenergic Blockade Bi-directionally and Asymmetrically Alters Functional Brain-Heart Communication and Prolongs Electrical Activities of the Brain and Heart during Asphyxic Cardiac Arrest

    Science.gov (United States)

    Tian, Fangyun; Liu, Tiecheng; Xu, Gang; Li, Duan; Ghazi, Talha; Shick, Trevor; Sajjad, Azeem; Wang, Michael M.; Farrehi, Peter; Borjigin, Jimo

    2018-01-01

    Sudden cardiac arrest is a leading cause of death in the United States. The neurophysiological mechanism underlying sudden death is not well understood. Previously we have shown that the brain is highly stimulated in dying animals and that asphyxia-induced death could be delayed by blocking the intact brain-heart neuronal connection. These studies suggest that the autonomic nervous system plays an important role in mediating sudden cardiac arrest. In this study, we tested the effectiveness of phentolamine and atenolol, individually or combined, in prolonging functionality of the vital organs in CO2-mediated asphyxic cardiac arrest model. Rats received either saline, phentolamine, atenolol, or phentolamine plus atenolol, 30 min before the onset of asphyxia. Electrocardiogram (ECG) and electroencephalogram (EEG) signals were simultaneously collected from each rat during the entire process and investigated for cardiac and brain functions using a battery of analytic tools. We found that adrenergic blockade significantly suppressed the initial decline of cardiac output, prolonged electrical activities of both brain and heart, asymmetrically altered functional connectivity within the brain, and altered, bi-directionally and asymmetrically, functional, and effective connectivity between the brain and heart. The protective effects of adrenergic blockers paralleled the suppression of brain and heart connectivity, especially in the right hemisphere associated with central regulation of sympathetic function. Collectively, our results demonstrate that blockade of brain-heart connection via alpha- and beta-adrenergic blockers significantly prolonged the detectable activities of both the heart and the brain in asphyxic rat. The beneficial effects of combined alpha and beta blockers may help extend the survival of cardiac arrest patients. PMID:29487541

  4. Adrenergic Blockade Bi-directionally and Asymmetrically Alters Functional Brain-Heart Communication and Prolongs Electrical Activities of the Brain and Heart during Asphyxic Cardiac Arrest

    Directory of Open Access Journals (Sweden)

    Fangyun Tian

    2018-02-01

    Full Text Available Sudden cardiac arrest is a leading cause of death in the United States. The neurophysiological mechanism underlying sudden death is not well understood. Previously we have shown that the brain is highly stimulated in dying animals and that asphyxia-induced death could be delayed by blocking the intact brain-heart neuronal connection. These studies suggest that the autonomic nervous system plays an important role in mediating sudden cardiac arrest. In this study, we tested the effectiveness of phentolamine and atenolol, individually or combined, in prolonging functionality of the vital organs in CO2-mediated asphyxic cardiac arrest model. Rats received either saline, phentolamine, atenolol, or phentolamine plus atenolol, 30 min before the onset of asphyxia. Electrocardiogram (ECG and electroencephalogram (EEG signals were simultaneously collected from each rat during the entire process and investigated for cardiac and brain functions using a battery of analytic tools. We found that adrenergic blockade significantly suppressed the initial decline of cardiac output, prolonged electrical activities of both brain and heart, asymmetrically altered functional connectivity within the brain, and altered, bi-directionally and asymmetrically, functional, and effective connectivity between the brain and heart. The protective effects of adrenergic blockers paralleled the suppression of brain and heart connectivity, especially in the right hemisphere associated with central regulation of sympathetic function. Collectively, our results demonstrate that blockade of brain-heart connection via alpha- and beta-adrenergic blockers significantly prolonged the detectable activities of both the heart and the brain in asphyxic rat. The beneficial effects of combined alpha and beta blockers may help extend the survival of cardiac arrest patients.

  5. Directional patterns of cross frequency phase and amplitude coupling within the resting state mimic patterns of fMRI functional connectivity

    Science.gov (United States)

    Weaver, Kurt E.; Wander, Jeremiah D.; Ko, Andrew L.; Casimo, Kaitlyn; Grabowski, Thomas J.; Ojemann, Jeffrey G.; Darvas, Felix

    2016-01-01

    Functional imaging investigations into the brain's resting state interactions have yielded a wealth of insight into the intrinsic and dynamic neural architecture supporting cognition and behavior. Electrophysiological studies however have highlighted the fact that synchrony across large-scale cortical systems is composed of spontaneous interactions occurring at timescales beyond the traditional resolution of fMRI, a feature that limits the capacity of fMRI to draw inference on the true directional relationship between network nodes. To approach the question of directionality in resting state signals, we recorded resting state functional MRI (rsfMRI) and electrocorticography (ECoG) from four human subjects undergoing invasive epilepsy monitoring. Using a seed-point based approach, we employed phase-amplitude coupling (PAC) and biPhase Locking Values (bPLV), two measures of cross-frequency coupling (CFC) to explore both outgoing and incoming connections between the seed and all non-seed, site electrodes. We observed robust PAC between a wide range of low-frequency phase and high frequency amplitude estimates. However, significant bPLV, a CFC measure of phase-phase synchrony, was only observed at specific narrow low and high frequency bandwidths. Furthermore, the spatial patterns of outgoing PAC connectivity were most closely associated with the rsfMRI connectivity maps. Our results support the hypothesis that PAC is relatively ubiquitous phenomenon serving as a mechanism for coordinating high-frequency amplitudes across distant neuronal assemblies even in absence of overt task structure. Additionally, we demonstrate that the spatial distribution of a seed-point rsfMRI sensorimotor network is strikingly similar to specific patterns of directional PAC. Specifically, the high frequency activities of distal patches of cortex owning membership in a rsfMRI sensorimotor network were most likely to be entrained to the phase of a low frequency rhythm engendered from the

  6. Mitochondrial bioenergetics during the initiation of mercuric chloride-induced renal injury. I. Direct effects of in vitro mercuric chloride on renal cortical mitochondrial function

    Energy Technology Data Exchange (ETDEWEB)

    Weinberg, J.M. (Veterans Administration Medical Center, Ann Arbor, MI); Harding, P.G.; Humes, H.D.

    1982-01-01

    Increasing data suggest that mitochondrial dysfunction may be an important early component of nephrotoxin-induced changes in renal cell function and viability. This study was designed to obtain more detailed information about the effects on several basic bioenergetic parameters of the direct interaction of Hg/sup 2 +/ with renal cortical mitochondria in vitro as a necessary prelude to studies of mitochondrial functional changes after treatment with mercuric chloride in vivo. Beginning at a threshhold level of 2 nmol of Hg/sup 2 +//mg of mitochondrial protein Hg/sup 2 +/ induced marked stimulation of State 4 respiration, mild inhibition of State 3 respiration, and 2,4-dinitrophenol uncoupled respiration, a striking increase in atractyloside-insensitive ADP uptake and stimulation of both basal- and Mg/sup 2 +/-activated oligomycin-sensitive mitochondrial ATPase activity. These effects of Hg/sup 2 +/ could be prevented and reversed by the sulfhydryl reagent dithioerythritol and by albumin but were not affected by Mg/sup 2 +/. Detailed studies on the addition of HgCl/sub 2/ to the preparation at different stages of the mitochondrial isolation procedure demonstrated that the presence of other proteins decreased mitochondrial Hg/sup 2 +/ binding, that the Hg/sup 2 +/ was not readily washed off the mitochondria by nonprotein-containing solutions, and that prolonged exposure of mitochondria to Hg/sup 2 +/ during the isolation procedure did not markedly alter its functional effects on their reversibility as assessed on the final mitochondrial preparation. These data provide an important basis for critically assessing the changes in function of mitochondria isolated after in vivo treatment with mercuric chloride.

  7. Relating hearing loss and executive functions to hearing aid users’ preference for, and speech recognition with, different combinations of binaural noise reduction and microphone directionality

    Directory of Open Access Journals (Sweden)

    Tobias eNeher

    2014-12-01

    Full Text Available Knowledge of how executive functions relate to preferred hearing aid (HA processing is sparse and seemingly inconsistent with related knowledge for speech recognition outcomes. This study thus aimed to find out if (1 performance on a measure of reading span (RS is related to preferred binaural noise reduction (NR strength, (2 similar relations exist for two different, nonverbal measures of executive function, (3 pure-tone average hearing loss (PTA, signal-to-noise ratio (SNR, and microphone directionality (DIR also influence preferred NR strength, and (4 preference and speech recognition outcomes are similar. Sixty elderly HA users took part. Six HA conditions consisting of omnidirectional or cardioid microphones followed by inactive, moderate, or strong binaural NR as well as linear amplification were tested. Outcome was assessed at fixed SNRs using headphone simulations of a frontal target talker in a busy cafeteria. Analyses showed positive effects of active NR and DIR on preference, and negative and positive effects of, respectively, strong NR and DIR on speech recognition. Also, while moderate NR was the most preferred NR setting overall, preference for strong NR increased with SNR. No relation between RS and preference was found. However, larger PTA was related to weaker preference for inactive NR and stronger preference for strong NR for both microphone modes. Equivalent (but weaker relations between worse performance on one nonverbal measure of executive function and the HA conditions without DIR were found. For speech recognition, there were relations between HA condition, PTA, and RS, but their pattern differed from that for preference. Altogether, these results indicate that, while moderate NR works well in general, a notable proportion of HA users prefer stronger NR. Furthermore, PTA and executive functions can account for some of the variability in preference for, and speech recognition with, different binaural NR and DIR settings.

  8. Direct releases to the surface and associated complementary cumulative distribution functions in the 1996 performance assessment for the Waste Isolation Pilot Plant: cuttings, cavings and spallings

    International Nuclear Information System (INIS)

    Berglund, J.W.; Garner, J.W.; Helton, J.C.; Johnson, J.D.; Smith, L.N.

    2000-01-01

    The following topics related to the treatment of cuttings, cavings and spallings releases to the surface environment in the 1996 performance assessment for the Waste Isolation Pilot Plant (WIPP) are presented: (i) mathematical description of models; (ii) uncertainty and sensitivity analysis results arising from subjective (i.e. epistemic) uncertainty for individual releases; (iii) construction of complementary cumulative distribution functions (CCDFs) arising from stochastic (i.e. aleatory) uncertainty; and (iv) uncertainty and sensitivity analysis results for CCDFs. The presented results indicate that direct releases due to cuttings, cavings and spallings do not constitute a serious threat to the effectiveness of the WIPP as a disposal facility for transuranic waste. Even when the effects of uncertain analysis inputs are taken into account, the CCDFs for cuttings, cavings and spallings releases fall substantially to the left of the boundary line specified in the US Environmental Protection Agency's standard for the geologic disposal of radioactive waste (40 CFR 191, 40 CFR 194)

  9. Solar Wind Halo Formation by the Scattering of the Strahl via Direct Cluster/PEACE Observations of the 3D Velocity Distribution Function

    Science.gov (United States)

    Figueroa-Vinas, Adolfo; Gurgiolo, Chris A.; Nieves-Chinchilla, Teresa; Goldstein, Melvyn L.

    2010-01-01

    It has been suggested by a number of authors that the solar wind electron halo can be formed by the scattering of the strahl. On frequent occasions we have observed in electron angular skymaps (Phi/Theta-plots) of the electron 3D velocity distribution functions) a bursty-filament of particles connecting the strahl to the solar wind core-halo. These are seen over a very limited energy range. When the magnetic field is well off the nominal solar wind flow direction such filaments are inconsistent with any local forces and are probably the result of strong scattering. Furthermore, observations indicates that the strahl component is frequently and significantly anisotropic (Tper/Tpal approx.2). This provides a possible free energy source for the excitation of whistler waves as a possible scattering mechanism. The empirical observational evidence between the halo and the strahl suggests that the strahl population may be, at least in part, the source of the halo component.

  10. Direct releases to the surface and associated complementary cumulative distribution functions in the 1996 performance assessment for the Waste Isolation Pilot Plant: Cuttings, cavings and spallings

    International Nuclear Information System (INIS)

    Berglund, J.W.; Garner, J.W.; Helton, Jon Craig; Johnson, J.D.; Smith, L.N.; Anderson, R.P.

    2000-01-01

    The following topics related to the treatment of cuttings, cavings and spallings releases to the surface environment in the 1996 performance assessment for the Waste Isolation Pilot Plant (WIPP) are presented: (1) mathematical description of models. (2) uncertainty and sensitivity analysis results arising from subjective (i.e., epistemic) uncertainty for individual releases, (3) construction of complementary cumulative distribution functions (CCDFs) arising from stochastic (i.e., aleatory) uncertainty, and (4) uncertainty and sensitivity analysis results for CCDFs. The presented results indicate that direct releases due to cuttings, cavings and spallings do not constitute a serious threat to the effectiveness of the WIPP as a disposal facility for transuranic waste. Even when the effects of uncertain analysis inputs are taken into account, the CCDFs for cuttings, cavings and spallings releases fall substantially to the left of the boundary line specified in the US Environmental Protection Agency standard for the geologic disposal of radioactive waste (40 CFR 191, 40 CFR 194)

  11. Energy efficiency in the European Union: What can be learned from the joint application of directional distance functions and slacks-based measures?

    International Nuclear Information System (INIS)

    Gómez-Calvet, Roberto; Conesa, David; Gómez-Calvet, Ana Rosa; Tortosa-Ausina, Emili

    2014-01-01

    Highlights: • We analyze the efficiency of electricity and derived heat generation in the European Union (EU). • We consider both desirable and undesirable outputs. • In our specifications both directional distance functions and slacks-based measure models are used. • Results show remarkable efficiency differences among EU countries. • This would call for further intensification of harmonization environmental policies in the EU. - Abstract: Over the last few years concerns have increased about the energy mix in many countries. These concerns have been of greater magnitude for countries with a common energy regulation such as European Union (EU) member states. An important aspect to take into account when choosing a given energy mix is the efficiency involved in its generation. In this context, the present study analyzes the efficiency with which electricity and derived heat was produced in 25 EU member states over the last decade. This analysis considers not only the inputs and outputs involved but, more importantly, which undesirable by-products were generated during the production process, a relevant issue for EU climate policy. To this end, two nonparametric frontier models are applied: first, a Directional Distance Function (DDF), based on Briec’s (1997) [16] proposal and, second, a modified version of Tone’s (2001) [51] Slacks-Based Measure (SBM) model, both of which are especially appropriate in this particular context due to their treatment of undesirable outputs. Results are partly innovative since, with few exceptions, applications on this issue are relatively scarce. From a policy implications’ point of view, our achievements are also interesting because they reveal remarkable efficiency differences among EU countries: those countries from the latest EU enlargements account for the lowest efficiencies, with large opportunities for improvement in CO 2 abatement and primary energy saving. Results also show stable efficiencies along the

  12. Fundamental Evaluation of Adaptation and Human Capabilities in a Condition Using a System to Give a User an Artificial Oculomotor Function to Control Directions of Both Eyes Independently

    Directory of Open Access Journals (Sweden)

    Fumio Mizuno

    2011-10-01

    Full Text Available To investigate flexible adaptation of visual system, we developed a system to provide a user an artificial oculomotor function to control directions of both eyes. The system named “Virtual Chameleon” consists of two CCD cameras independently controlled and a head-mounted display. The user can control each tracking directions of two cameras with sensors set to both hands so that the user can get independent arbitrary view fields for both eyes. We performed fundamental experiments to evaluate capability to evaluate adaptation to use of Virtual Chameleon and effects on the user's capabilities. Eleven healthy volunteers with normal and corrected-to-normal vision participated in the experiments. The experiments were tests to find out each position of targets put in both side of a subject. In the experiments, a condition using Virtual Chameleon and a condition without it was adopted. We obtained accuracy rates and time intervals to find out target positions as experimental results. The experiments showed all of volunteers became able to actively control independent visual axes and correctly understood two different views by using Virtual Chameleon, even though two independent view fields yielded binocular rivalry to volunteers and binocular rivalry reduced human capabilities compared to cases without Virtual Chameleon.

  13. Potentiation of motor sub-networks for motor control but not working memory: Interaction of dACC and SMA revealed by resting-state directed functional connectivity

    Science.gov (United States)

    Diwadkar, Vaibhav A.; Asemi, Avisa; Burgess, Ashley; Chowdury, Asadur; Bressler, Steven L.

    2017-01-01

    The dorsal Anterior Cingulate Cortex (dACC) and the Supplementary Motor Area (SMA) are known to interact during motor coordination behavior. We previously discovered that the directional influences underlying this interaction in a visuo-motor coordination task are asymmetric, with the dACC→SMA influence being significantly greater than that in the reverse direction. To assess the specificity of this effect, here we undertook an analysis of the interaction between dACC and SMA in two distinct contexts. In addition to the motor coordination task, we also assessed these effects during a (n-back) working memory task. We applied directed functional connectivity analysis to these two task paradigms, and also to the rest condition of each paradigm, in which rest blocks were interspersed with task blocks. We report here that the previously known asymmetric interaction between dACC and SMA, with dACC→SMA dominating, was significantly larger in the motor coordination task than the memory task. Moreover the asymmetry between dACC and SMA was reversed during the rest condition of the motor coordination task, but not of the working memory task. In sum, the dACC→SMA influence was significantly greater in the motor task than the memory task condition, and the SMA→dACC influence was significantly greater in the motor rest than the memory rest condition. We interpret these results as suggesting that the potentiation of motor sub-networks during the motor rest condition supports the motor control of SMA by dACC during the active motor task condition. PMID:28278267

  14. Regulation and functions of the lms homeobox gene during development of embryonic lateral transverse muscles and direct flight muscles in Drosophila.

    Directory of Open Access Journals (Sweden)

    Dominik Müller

    Full Text Available BACKGROUND: Patterning and differentiation of developing musculatures require elaborate networks of transcriptional regulation. In Drosophila, significant progress has been made into identifying the regulators of muscle development and defining their interactive networks. One major family of transcription factors involved in these processes consists of homeodomain proteins. In flies, several members of this family serve as muscle identity genes to specify the fates of individual muscles, or groups thereof, during embryonic and/or adult muscle development. Herein, we report on the expression and function of a new Drosophila homeobox gene during both embryonic and adult muscle development. METHODOLOGY/PRINCIPAL FINDINGS: The newly described homeobox gene, termed lateral muscles scarcer (lms, which has yet uncharacterized orthologs in other invertebrates and primitive chordates but not in vertebrates, is expressed exclusively in subsets of developing muscle tissues. In embryos, lms is expressed specifically in the four lateral transverse (LT muscles and their founder cells in each hemisegment, whereas in larval wing imaginal discs, it is expressed in myoblasts that develop into direct flight muscles (DFMs, which are important for proper wing positioning. We have analyzed the regulatory inputs of various other muscle identity genes with overlapping or complementary expression patterns towards the cell type specific regulation of lms expression. Further we demonstrate that lms null mutants exhibit reduced numbers of embryonic LT muscles, and null mutant adults feature held-out-wing phenotypes. We provide a detailed description of the pattern and morphology of the direct flight muscles in the wild type and lms mutant flies by using the recently-developed ultramicroscopy and show that, in the mutants, all DFMs are present and present normal morphologies. CONCLUSIONS/SIGNIFICANCE: We have identified the homeobox gene lms as a new muscle identity gene

  15. Use of functional near-infrared spectroscopy to evaluate the effects of anodal transcranial direct current stimulation on brain connectivity in motor-related cortex

    Science.gov (United States)

    Yan, Jiaqing; Wei, Yun; Wang, Yinghua; Xu, Gang; Li, Zheng; Li, Xiaoli

    2015-04-01

    Transcranial direct current stimulation (tDCS) is a noninvasive, safe and convenient neuro-modulatory technique in neurological rehabilitation, treatment, and other aspects of brain disorders. However, evaluating the effects of tDCS is still difficult. We aimed to evaluate the effects of tDCS using hemodynamic changes using functional near-infrared spectroscopy (fNIRS). Five healthy participants were employed and anodal tDCS was applied to the left motor-related cortex, with cathodes positioned on the right dorsolateral supraorbital area. fNIRS data were collected from the right motor-related area at the same time. Functional connectivity (FC) between intracortical regions was calculated between fNIRS channels using a minimum variance distortion-less response magnitude squared coherence (MVDR-MSC) method. The levels of Oxy-HbO change and the FC between channels during the prestimulation, stimulation, and poststimulation stages were compared. Results showed no significant level difference, but the FC measured by MVDR-MSC significantly decreased during tDCS compared with pre-tDCS and post-tDCS, although the FC difference between pre-tDCS and post-tDCS was not significant. We conclude that coherence calculated from resting state fNIRS may be a useful tool for evaluating the effects of anodal tDCS and optimizing parameters for tDCS application.

  16. Prefronto–cerebellar transcranial direct current stimulation improves visuospatial memory, executive functions, and neurological soft signs in patients with euthymic bipolar disorder

    Directory of Open Access Journals (Sweden)

    Minichino A

    2015-08-01

    Full Text Available Amedeo Minichino, Francesco Saverio Bersani, Laura Bernabei, Francesco Spagnoli, Lucilla Vergnani, Alessandra Corrado, Ines Taddei, Massimo Biondi, Roberto Delle Chiaie Department of Neurology and Psychiatry, Sapienza University of Rome, Rome, Italy Objective: The aim of the study was to improve neuropsychological functioning of euthymic patients with bipolar disorder (BD using transcranial direct current stimulation (tDCS applied to cerebellar and prefrontal cortices.Methods: Twenty-five BD outpatients underwent prefrontal (anodal and cerebellar (cathodal tDCS for 3 consecutive weeks. All participants were assessed through the Rey Complex Figure Test delay and copy and the Neurological Examination Scale at baseline and after therapy with tDCS.Results: After tDCS treatment, patients showed significant improvements in visuospatial memory tasks. Patients with worse baseline cognitive performances also showed a significant improvement in executive functioning tasks. Neurological Examination Scale total score and motor coordination subscale significantly improved.Conclusion: Prefrontal-excitatory and cerebellar-inhibitory stimulations in euthymic BD patients may lead to better neurocognitive performances. This improvement could result from the modulation of prefronto–thalamic–cerebellar circuit activity pattern, which can be disrupted in BD. Keywords: cerebellum, dorsolateral prefrontal cortex, neuropsychology, cognition 

  17. The in utero programming effect of increased maternal androgens and a direct fetal intervention on liver and metabolic function in adult sheep.

    Science.gov (United States)

    Hogg, Kirsten; Wood, Charlotte; McNeilly, Alan S; Duncan, W Colin

    2011-01-01

    Epigenetic changes in response to external stimuli are fast emerging as common underlying causes for the pre-disposition to adult disease. Prenatal androgenization is one such model that results in reproductive and metabolic features that are present in conditions such as polycystic ovary syndrome (PCOS). We examined the effect of prenatal androgens on liver function and metabolism of adult sheep. As non-alcoholic fatty liver disease is increased in PCOS we hypothesized that this, and other important liver pathways including metabolic function, insulin-like growth factor (IGF) and steroid receptivity, would be affected. Pregnant ewes received vehicle control (C; n = 5) or testosterone propionate (TP; n = 9) twice weekly (100 mg; i.m) from d62-102 (gestation 147 days). In a novel treatment paradigm, a second cohort received a direct C (n = 4) or TP (20 mg; n = 7) fetal injection at d62 and d82. In adults, maternal TP exposure resulted in increased insulin secretion to glucose load (Pfetal intervention (C and TP) led to early fatty liver changes in all animals without differential changes in insulin secretion. Furthermore, hepatic phosphoenolpyruvate carboxykinase (PEPCK) was up-regulated in the fetal controls (Pfetal TP (Pfetal TP exposure. Adult liver metabolism and signaling can be altered by early exposure to sex steroids implicating epigenetic regulation of metabolic disturbances that are common in PCOS.

  18. Apo-states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain

    Science.gov (United States)

    Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.

    2013-01-01

    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053

  19. Apo states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain.

    Science.gov (United States)

    Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L

    2013-09-09

    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Gut-directed hypnotherapy in children with irritable bowel syndrome or functional abdominal pain (syndrome): A randomized controlled trial on self exercises at home using CD versus individual therapy by qualified therapists

    NARCIS (Netherlands)

    J.M.T.M. Rutten (Juliette); A.M. Vlieger (Arine M.); C. Frankenhuis (Carla); E.K. George (Elvira K.); M. Groeneweg (Michael); O.F. Norbruis (Obbe); W.E. Tjon A ten; H. Van Wering (Herbert); M.G.W. Dijkgraaf (Marcel); M.P. Merkus; M.A. Benninga (Marc)

    2014-01-01

    textabstractBackground: Irritable bowel syndrome (IBS) and functional abdominal pain (syndrome) (FAP(S)) are common pediatric disorders, characterized by chronic or recurrent abdominal pain. Treatment is challenging, especially in children with persisting symptoms. Gut-directed hypnotherapy (HT)

  1. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  2. Assessment of functional capacity in women with fibromyalgia: direct and self-reported methods. DOI: 10.5007/1980-0037.2011v13n4p292

    Directory of Open Access Journals (Sweden)

    Diogo Homann

    2011-08-01

    Full Text Available Fibromyalgia can limit activities of daily living (ADLs performance and has a negative impact on the quality of life of these patients. The objective of this study was to evaluate the association between direct and indirect methods for the assessment of functional capacity and their relationship with some features of fibromyalgia. Thirty-eight women with a diagnosis of fibromyalgia participated in the study. Functional capacity was assessed by the Health Assessment Questionnaire (HAQ, distance in the six-minute walk test (6MWT, and handgrip strength (HGS. Pain was rated on a visual analog scale. The Fibromyalgia Impact Questionnaire (FIQ was applied to assess the impact on quality of life. Body mass index and waist circumference were also evaluated. Pearson’s correlation test was used for parametric data and Spearman’s correlation test for nonparametric data. Multiple regressions were also performed. Pain intensity was high in the patients (median: 9.5. The 6MWT distance was correlated with HAQ score (r=-0.55, p<0.01 and HGS (r=0.34, p<0.01. Pain was correlated with HGS (r=-0.41, p<0.01, HAQ score (r=0.62, p<0.01, and FIQ (r =0.66, p<0.01. Pain intensity explained 40% of the variation in HAQ scores. This variation increased to 60% after inclusion of 6MWT distance. In conclusion, pain seems to compromise HGS, ADLs and quality of life in women with fibromyalgia. The lower performance in the 6MWT might be explained by high body mass index. Taking into account pain, the HAQ seems to be an appropriate tool for the assessment of functional capacity in women with fibromyalgia.

  3. Assessment of functional capacity in women with fibromyalgia: direct and self-reported methods. DOI: 10.5007/1980-0037.2011v13n4p292

    Directory of Open Access Journals (Sweden)

    Diogo Homann

    2011-06-01

    Full Text Available Fibromyalgia can limit activities of daily living (ADLs performance and has a negative impact on the quality of life of these patients. The objective of this study was to evaluate the association between direct and indirect methods for the assessment of functional capacity and their relationship with some features of fibromyalgia. Thirty-eight women with a diagnosis of fibromyalgia participated in the study. Functional capacity was assessed by the Health Assessment Questionnaire (HAQ, distance in the six-minute walk test (6MWT, and handgrip strength (HGS. Pain was rated on a visual analog scale. The Fibromyalgia Impact Questionnaire (FIQ was applied to assess the impact on quality of life. Body mass index and waist circumference were also evaluated. Pearson’s correlation test was used for parametric data and Spearman’s correlation test for nonparametric data. Multiple regressions were also performed. Pain intensity was high in the patients (median: 9.5. The 6MWT distance was correlated with HAQ score (r=-0.55, p<0.01 and HGS (r=0.34, p<0.01. Pain was correlated with HGS (r=-0.41, p<0.01, HAQ score (r=0.62, p<0.01, and FIQ (r =0.66, p<0.01. Pain intensity explained 40% of the variation in HAQ scores. This variation increased to 60% after inclusion of 6MWT distance. In conclusion, pain seems to compromise HGS, ADLs and quality of life in women with fibromyalgia. The lower performance in the 6MWT might be explained by high body mass index. Taking into account pain, the HAQ seems to be an appropriate tool for the assessment of functional capacity in women with fibromyalgia.

  4. Site-directed fluorescence labeling reveals a revised N-terminal membrane topology and functional periplasmic residues in the Escherichia coli cell division protein FtsK.

    Science.gov (United States)

    Berezuk, Alison M; Goodyear, Mara; Khursigara, Cezar M

    2014-08-22

    In Escherichia coli, FtsK is a large integral membrane protein that coordinates chromosome segregation and cell division. The N-terminal domain of FtsK (FtsKN) is essential for division, and the C terminus (FtsKC) is a well characterized DNA translocase. Although the function of FtsKN is unknown, it is suggested that FtsK acts as a checkpoint to ensure DNA is properly segregated before septation. This may occur through modulation of protein interactions between FtsKN and other division proteins in both the periplasm and cytoplasm; thus, a clear understanding of how FtsKN is positioned in the membrane is required to characterize these interactions. The membrane topology of FtsKN was initially determined using site-directed reporter fusions; however, questions regarding this topology persist. Here, we report a revised membrane topology generated by site-directed fluorescence labeling. The revised topology confirms the presence of four transmembrane segments and reveals a newly identified periplasmic loop between the third and fourth transmembrane domains. Within this loop, four residues were identified that, when mutated, resulted in the appearance of cellular voids. High resolution transmission electron microscopy of these voids showed asymmetric division of the cytoplasm in the absence of outer membrane invagination or visible cell wall ingrowth. This uncoupling reveals a novel role for FtsK in linking cell envelope septation events and yields further evidence for FtsK as a critical checkpoint of cell division. The revised topology of FtsKN also provides an important platform for future studies on essential interactions required for this process. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Direct effects of exendin-(9,39) and GLP-1-(9,36)amide on insulin action, β-cell function, and glucose metabolism in nondiabetic subjects.

    Science.gov (United States)

    Sathananthan, Matheni; Farrugia, Luca P; Miles, John M; Piccinini, Francesca; Dalla Man, Chiara; Zinsmeister, Alan R; Cobelli, Claudio; Rizza, Robert A; Vella, Adrian

    2013-08-01

    Exendin-(9,39) is a competitive antagonist of glucagon-like peptide-1 (GLP-1) at its receptor. However, it is unclear if it has direct and unique effects of its own. We tested the hypothesis that exendin-(9,39) and GLP-1-(9,36)amide have direct effects on hormone secretion and β-cell function as well as glucose metabolism in healthy subjects. Glucose containing [3-(3)H]glucose was infused to mimic the systemic appearance of glucose after a meal. Saline, GLP-1-(9,36)amide, or exendin-(9,39) at 30 pmol/kg/min (Ex 30) or 300 pmol/kg/min (Ex 300) were infused in random order on separate days. Integrated glucose concentrations were slightly but significantly increased by exendin-(9,39) (365 ± 43 vs. 383 ± 35 vs. 492 ± 49 vs. 337 ± 50 mmol per 6 h, saline, Ex 30, Ex 300, and GLP-1-[9,36]amide, respectively; P = 0.05). Insulin secretion did not differ among groups. However, insulin action was lowered by exendin-(9,39) (25 ± 4 vs. 20 ± 4 vs. 18 ± 3 vs. 21 ± 4 10(-4) dL/kg[min per μU/mL]; P = 0.02), resulting in a lower disposition index (DI) during exendin-(9,39) infusion (1,118 ± 118 vs. 816 ± 83 vs. 725 ± 127 vs. 955 ± 166 10(-14) dL/kg/min(2) per pmol/L; P = 0.003). Endogenous glucose production and glucose disappearance did not differ significantly among groups. We conclude that exendin-(9,39), but not GLP-1-(9,36)amide, decreases insulin action and DI in healthy humans.

  6. Long-term follow-up of gut-directed hypnotherapy vs. standard care in children with functional abdominal pain or irritable bowel syndrome.

    Science.gov (United States)

    Vlieger, Arine M; Rutten, Juliette M T M; Govers, Anita M A P; Frankenhuis, Carla; Benninga, Marc A

    2012-04-01

    We previously showed that gut-directed hypnotherapy (HT) is highly effective in the treatment of children with functional abdominal pain (FAP) and irritable bowel syndrome (IBS). Aim of this follow-up study was to investigate the long-term effects of HT vs. standard medical treatment plus supportive therapy (SMT). All 52 participants of our previous randomized controlled trial (RCT) were invited to complete a standardized abdominal pain diary, on which pain frequency and pain intensity were scored. Furthermore, the Children's Somatization Inventory (CSI) and a general quality of life (QOL) questionnaire were filled out. Clinical remission was defined as > 80% improvement in pain scores compared with baseline. All 27 HT patients and 22 out of 25 SMT patients participated in this study. Two patients of the SMT group were lost to follow-up and one refused to participate. After a mean duration of 4.8 years follow-up (3.4-6.7), HT was still highly superior to conventional therapy with 68 vs. 20% of the patients in remission after treatment (P = 0.005). Pain intensity and pain frequency scores at follow-up were 2.8 and 2.3, respectively, in the HT group compared with 7.3 and 7.1 in the SMT group (P < 0.01). Also, somatization scores were lower in the HT group (15.2 vs. 22.8; P = 0.04). No differences were found in QOL, doctors' visits, and missed days of school or work between the two groups. The beneficial effects of gut-directed HT are long lasting in children with FAP or IBS with two thirds still in remission almost 5 years after treatment, making it a highly valuable therapeutic option.

  7. Synthesis of 1,3-di(4-amino-1-pyridinium)propane ionic liquid functionalized graphene nanosheets and its application in direct electrochemistry of hemoglobin

    International Nuclear Information System (INIS)

    Li, Rui; Liu, Changxian; Ma, Ming; Wang, Zhengguo; Zhan, Guoqing; Li, Buhai; Wang, Xian; Fang, Huaifang; Zhang, Huijuan; Li, Chunya

    2013-01-01

    Highlights: ► 1,3-Di(4-amino-1-pyridinium)propane tetrafluoroborate ionic liquid was successfully synthesized. ► Ionic liquid modified graphene nanosheets were successfully prepared and fully characterized. ► Hb was immobilized on the as-prepared graphene–ionic liquid nanosheets. ► Direct electrochemistry of Hb was succeeded. ► Biocatalysis of Hb towards H 2 O 2 was demonstrated, and was used in H 2 O 2 determination. -- Abstract: 1,3-Di(4-amino-1-pyridinium)propane tetrafluoroborate (DAPPT) ionic liquid was successfully synthesized, and was used as a modifier to functionalize graphene nanosheets through covalent binding of amino groups and epoxy groups in an alkaline solution. The as-prepared graphene-DAPPT nanosheets (Gr-DAPPT) were confirmed with transmission electron microscopy (TEM), X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), UV/vis and FTIR spectroscopy. A biocompatible platform based on Gr-DAPPT was constructed for the immobilization of hemoglobin (Hb) through a cross-linking step with chitosan and glutaraldehyde. The direct electron transfer and bioelectrocatalytic reaction of Hb immobilized on Gr-DAPPT surface were achieved. A pair of reversible redox peaks of hemoglobin was observed, and bioelectrocatalytic activity toward the reduction of H 2 O 2 was also demonstrated, displaying a potential application for the fabrication of novel biosensors to sense H 2 O 2 . Such results indicated that Gr-DAPPT based interface would be a promising platform for biomacromolecular immobilization and biosensor preparation

  8. The in utero programming effect of increased maternal androgens and a direct fetal intervention on liver and metabolic function in adult sheep.

    Directory of Open Access Journals (Sweden)

    Kirsten Hogg

    Full Text Available Epigenetic changes in response to external stimuli are fast emerging as common underlying causes for the pre-disposition to adult disease. Prenatal androgenization is one such model that results in reproductive and metabolic features that are present in conditions such as polycystic ovary syndrome (PCOS. We examined the effect of prenatal androgens on liver function and metabolism of adult sheep. As non-alcoholic fatty liver disease is increased in PCOS we hypothesized that this, and other important liver pathways including metabolic function, insulin-like growth factor (IGF and steroid receptivity, would be affected. Pregnant ewes received vehicle control (C; n = 5 or testosterone propionate (TP; n = 9 twice weekly (100 mg; i.m from d62-102 (gestation 147 days. In a novel treatment paradigm, a second cohort received a direct C (n = 4 or TP (20 mg; n = 7 fetal injection at d62 and d82. In adults, maternal TP exposure resulted in increased insulin secretion to glucose load (P<0.05 and the histological presence of fatty liver (P<0.05 independent of central obesity. Additionally, hepatic androgen receptor (AR; P<0.05, glucocorticoid receptor (GR; P<0.05, UDP- glucose ceramide glucosyltransferase (UGCG; P<0.05 and IGF1 (P<0.01 expression were upregulated. The direct fetal intervention (C and TP led to early fatty liver changes in all animals without differential changes in insulin secretion. Furthermore, hepatic phosphoenolpyruvate carboxykinase (PEPCK was up-regulated in the fetal controls (P<0.05 and this was opposed by fetal TP (P<0.05. Hepatic estrogen receptor (ERα; P<0.05 and mitogen activated protein kinase kinase 4 (MAP2K4; P<0.05 were increased following fetal TP exposure. Adult liver metabolism and signaling can be altered by early exposure to sex steroids implicating epigenetic regulation of metabolic disturbances that are common in PCOS.

  9. Transcranial direct current stimulation (tDCS) for improving capacity in activities and arm function after stroke: a network meta-analysis of randomised controlled trials.

    Science.gov (United States)

    Elsner, Bernhard; Kwakkel, Gert; Kugler, Joachim; Mehrholz, Jan

    2017-09-13

    Transcranial Direct Current Stimulation (tDCS) is an emerging approach for improving capacity in activities of daily living (ADL) and upper limb function after stroke. However, it remains unclear what type of tDCS stimulation is most effective. Our aim was to give an overview of the evidence network regarding the efficacy and safety of tDCS and to estimate the effectiveness of the different stimulation types. We performed a systematic review of randomised trials using network meta-analysis (NMA), searching the following databases until 5 July 2016: Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE, EMBASE, CINAHL, AMED, Web of Science, and four other databases. We included studies with adult people with stroke. We compared any kind of active tDCS (anodal, cathodal, or dual, that is applying anodal and cathodal tDCS concurrently) regarding improvement of our primary outcome of ADL capacity, versus control, after stroke. CRD42016042055. We included 26 studies with 754 participants. Our NMA showed evidence of an effect of cathodal tDCS in improving our primary outcome, that of ADL capacity (standardized mean difference, SMD = 0.42; 95% CI 0.14 to 0.70). tDCS did not improve our secondary outcome, that of arm function, measured by the Fugl-Meyer upper extremity assessment (FM-UE). There was no difference in safety between tDCS and its control interventions, measured by the number of dropouts and adverse events. Comparing different forms of tDCS shows that cathodal tDCS is the most promising treatment option to improve ADL capacity in people with stroke.

  10. Additive manufacturing technology (direct metal laser sintering) as a novel approach to fabricate functionally graded titanium implants: preliminary investigation of fabrication parameters.

    Science.gov (United States)

    Lin, Wei-Shao; Starr, Thomas L; Harris, Bryan T; Zandinejad, Amirali; Morton, Dean

    2013-01-01

    This article describes the preliminary findings of the mechanical properties of functionally graded titanium with controlled distribution of porosity and a reduced Young's modulus on the basis of a computeraided design (CAD) file, using the rapid-prototyping, direct metal laser sintering (DMLS) technique. Sixty specimens of Ti-6Al-4V were created using a DMLS machine (M270) following the standard for tensile testing of metals. One group was fabricated with only 170 W of laser energy to create fully dense specimens (control group). The remaining specimens all featured an outer fully dense "skin" layer and a partially sintered porous inner "core" region. The outer "skin" of each specimen was scanned at 170 W and set at a thickness of 0.35, 1.00, or 1.50 mm for different specimen groups. The inner "core" of each specimen was scanned at a lower laser power (43 or 85 W). The partially sintered core was clearly visible in all specimens, with somewhat greater porosity with the lower laser power. However, the amount of porosity in the core region was not related to the laser power alone; thinner skin layers resulted in higher porosity for the same power values in the core structure. The lowest Young's modulus achieved, 35 GPa, is close to that of bone and was achieved with a laser power of 43 W and a skin thickness of 0.35 mm, producing a core that comprised 74% of the total volume. Additive manufacturing technology may provide an efficient alternative way to fabricate customized dental implants based on a CAD file with a functionally graded structure that may minimize stress shielding and improve the long-term performance of dental implants.

  11. Subcortical surgical anatomy of the lateral frontal region: human white matter dissection and correlations with functional insights provided by intraoperative direct brain stimulation: laboratory investigation.

    Science.gov (United States)

    De Benedictis, Alessandro; Sarubbo, Silvio; Duffau, Hugues

    2012-12-01

    Recent neuroimaging and surgical results support the crucial role of white matter in mediating motor and higher-level processing within the frontal lobe, while suggesting the limited compensatory capacity after damage to subcortical structures. Consequently, an accurate knowledge of the anatomofunctional organization of the pathways running within this region is mandatory for planning safe and effective surgical approaches to different diseases. The aim of this dissection study was to improve the neurosurgeon's awareness of the subcortical anatomofunctional architecture for a lateral approach to the frontal region, to optimize both resection and postoperative outcome. Ten human hemispheres (5 left, 5 right) were dissected according to the Klingler technique. Proceeding lateromedially, the main association and projection tracts as well as the deeper basal structures were identified. The authors describe the anatomy and the relationships among the exposed structures in both a systematic and topographical surgical perspective. Structural results were also correlated to the functional responses obtained during resections of infiltrative frontal tumors guided by direct cortico-subcortical electrostimulation with patients in the awake condition. The eloquent boundaries crucial for a safe frontal lobectomy or an extensive lesionectomy are as follows: 1) the motor cortex; 2) the pyramidal tract and premotor fibers in the posterior and posteromedial part of the surgical field; 3) the inferior frontooccipital fascicle and the superior longitudinal fascicle posterolaterally; and 4) underneath the inferior frontal gyrus, the head of the caudate nucleus, and the tip of the frontal horn of the lateral ventricle in the depth. Optimization of results following brain surgery, especially within the frontal lobe, requires a perfect knowledge of functional anatomy, not only at the cortical level but also with regard to subcortical white matter connectivity.

  12. Effects of cathodal trans-spinal direct current stimulation on lower urinary tract function in normal and spinal cord injury mice with overactive bladder

    Science.gov (United States)

    Ahmed, Zaghloul

    2017-10-01

    Objective. Lower urinary tract (LUT) dysfunction is a monumental problem affecting quality of life following neurotrauma, such as spinal cord injury (SCI). Proper function of the bladder and its associated structures depends on coordinated activity of the neuronal circuitry in the spinal cord and brain. Disconnection between the spinal and brain centers controlling the LUT causes fundamental changes in the mechanisms involved in the micturition and storage reflexes. We investigated the effects of cathodal trans-spinal direct current stimulation (c-tsDCS) of the lumbosacral spine on bladder and external urinary sphincter (EUS) functions. Approach. We used cystometry and electromyography (EMG), in mice with and without SCI. Main results. c-tsDCS caused initiation of the micturition reflex in urethane-anesthetized normal mice with depressed micturition reflexes. This effect was associated with normalized EUS-EMG activity. Moreover, in urethane-anesthetized normal mice with expressed micturition reflexes, c-tsDCS increased the firing frequency, amplitude, and duration of EUS-EMG activity. These effects were associated with increased maximum intravesical pressure (P max) and intercontraction interval (ICI). In conscious normal animals, c-tsDCS caused significant increases in P max, ICI, threshold pressure (P thres), baseline pressure (P base), and number and amplitude of non-voiding contractions (NVCnumb and P im, respectively). In conscious mice with severe contusive SCI and overactive bladder, c-tsDCS increased P max, ICI, and P thres, but decreased P base, NVCnumb, and P im. c-tsDCS reduced the detrusor-overactivity/cystometry ratio, which is a measure of bladder overactivity associated with renal deterioration. Significance. These results indicate that c-tsDCS induces robust modulation of the lumbosacral spinal-cord circuitry that controls the LUT.

  13. Aliskiren, a Direct Renin Inhibitor, Improves Vascular Endothelial Function in Patients on Hemodialysis Independent of Antihypertensive Effect ∼ a Pilot Study∼

    Directory of Open Access Journals (Sweden)

    Hidekazu Moriya

    2013-05-01

    Full Text Available Aims: Aliskiren inhibits the first step in the renin-angiotensin system (RAS and recently has been shown to modulate vascular diseases via RAS-dependent and independent pathways. This study aimed to determine the effect of aliskiren-associated direct renin inhibition on endothelial function in patients on hemodialysis via flow-mediated dilatation (FMD and platelet-derived microparticles (PDMP, as biomarkers of atherosclerosis. Methods: A 12-week prospective study was performed with 24 patients on hemodialysis who were administered 150 mg orally aliskiren once daily for 12 weeks. Results: No significant difference were observed between pre-dialysis, home, and weekly averaged blood pressure at baseline and at 12 weeks (151.5 ± 8.5/80.9 ± 12.9 mmHg vs 150.3 ± 15.3/78.9 ± 21.2 mmHg, 151.4 ± 9.7/82.3 ± 14.7 mmHg vs 151.2 ± 17.7/81.4 ± 10.6 mmHg, and 156.0 ± 18.3/81.9 ± 9.4 mmHg vs 152.5 ± 18.9/81.7 ± 12.3 mmHg, respectively. FMD significantly increased from 2.54% ± 1.45% at baseline to 3.11% ± 1.37% at 12 weeks (P = 0.0267, and PDMP significantly decreased from 13.9 ± 5.8 U/mL at baseline to 10.9 ± 4.5 U/mL at 12 weeks (P = 0.0002. Conclusion: Aliskiren improved vascular endothelial function and platelet-endothelium activation in patients on hemodialysis independent of antihypertensive effect.

  14. Exploring the efficacy of a 5-day course of transcranial direct current stimulation (TDCS) on depression and memory function in patients with well-controlled temporal lobe epilepsy.

    Science.gov (United States)

    Liu, Anli; Bryant, Andrew; Jefferson, Ashlie; Friedman, Daniel; Minhas, Preet; Barnard, Sarah; Barr, William; Thesen, Thomas; O'Connor, Margaret; Shafi, Mouhsin; Herman, Susan; Devinsky, Orrin; Pascual-Leone, Alvaro; Schachter, Steven

    2016-02-01

    Depression and memory dysfunction significantly impact the quality of life of patients with epilepsy. Current therapies for these cognitive and psychiatric comorbidities are limited. We explored the efficacy and safety of transcranial direct current stimulation (TDCS) for treating depression and memory dysfunction in patients with temporal lobe epilepsy (TLE). Thirty-seven (37) adults with well-controlled TLE were enrolled in a double-blinded, sham-controlled, randomized, parallel-group study of 5 days of fixed-dose (2 mA, 20 min) TDCS. Subjects were randomized to receive either real or sham TDCS, both delivered over the left dorsolateral prefrontal cortex. Patients received neuropsychological testing and a 20-minute scalp EEG at baseline immediately after the TDCS course and at 2- and 4-week follow-up. There was improvement in depression scores immediately after real TDCS, but not sham TDCS, as measured by changes in the Beck Depression Inventory (BDI change: -1.68 vs. 1.27, pTDCS as a safe and well-tolerated nonpharmacologic approach to improving depressive symptoms in patients with well-controlled TLE. However, there were no changes in memory function immediately following or persisting after a stimulation course. Further studies may determine optimal stimulation parameters for maximal mood benefit. Copyright © 2015. Published by Elsevier Inc.

  15. A stock market forecasting model combining two-directional two-dimensional principal component analysis and radial basis function neural network.

    Science.gov (United States)

    Guo, Zhiqiang; Wang, Huaiqing; Yang, Jie; Miller, David J

    2015-01-01

    In this paper, we propose and implement a hybrid model combining two-directional two-dimensional principal component analysis ((2D)2PCA) and a Radial Basis Function Neural Network (RBFNN) to forecast stock market behavior. First, 36 stock market technical variables are selected as the input features, and a sliding window is used to obtain the input data of the model. Next, (2D)2PCA is utilized to reduce the dimension of the data and extract its intrinsic features. Finally, an RBFNN accepts the data processed by (2D)2PCA to forecast the next day's stock price or movement. The proposed model is used on the Shanghai stock market index, and the experiments show that the model achieves a good level of fitness. The proposed model is then compared with one that uses the traditional dimension reduction method principal component analysis (PCA) and independent component analysis (ICA). The empirical results show that the proposed model outperforms the PCA-based model, as well as alternative models based on ICA and on the multilayer perceptron.

  16. HTLV-1 Tax Functions as a Ubiquitin E3 Ligase for Direct IKK Activation via Synthesis of Mixed-Linkage Polyubiquitin Chains.

    Science.gov (United States)

    Wang, Chong; Long, Wenying; Peng, Chao; Hu, Lin; Zhang, Qiong; Wu, Ailing; Zhang, Xiaoqing; Duan, Xiaotao; Wong, Catherine C L; Tanaka, Yuetsu; Xia, Zongping

    2016-04-01

    The HTLV-1 oncoprotein Tax plays a key role in CD4+ T cell transformation by promoting cell proliferation and survival, mainly through permanent activation of the NK-κB pathway and induction of many NF-κB target genes. Elucidating the underlying molecular mechanism is therefore critical in understanding HTLV-1-mediated transformation. Current studies have suggested multiple but controversial mechanisms regarding Tax-induced IKK activation mainly due to blending of primary Tax-induced IKK activation events and secondary IKK activation events induced by cytokines secreted by the primary Tax-induced IKK-NF-κB activation events. We reconstituted Tax-stimulated IKK activation in a cell-free system to dissect the essential cellular components for primary IKK activation by Tax and studied the underlying biochemical mechanism. We found that Tax is a putative E3 ubiquitin ligase, which, together with UbcH2, UhcH5c, or UbcH7, catalyzes the assembly of free mixed-linkage polyubiquitin chains. These free mixed-linkage polyubiquitin chains are then responsible for direct IKK activation by binding to the NEMO subunit of IKK. Our studies revealed the biochemical function of Tax in the process of IKK activation, which utilizes the minimal cellular ubiquitination components for NF-κB activation.

  17. Direct modeling of the electrochemistry in the three-phase boundary of solid oxide fuel cell anodes by density functional theory: a critical overview.

    Science.gov (United States)

    Shishkin, M; Ziegler, T

    2014-02-07

    The first principles modeling of electrochemical reactions has proven useful for the development of efficient, durable and low cost solid oxide full cells (SOFCs). In this account we focus on recent advances in modeling of structural, electronic and catalytic properties of the SOFC anodes based on density functional theory (DFT) first principle calculations. As a starting point, we highlight that the adequate analysis of cell electrochemistry generally requires modeling of chemical reactions at the metal/oxide interface rather than on individual metal or oxide surfaces. The atomic models of Ni/YSZ and Ni/CeO2 interfaces, required for DFT simulations of reactions on SOFC anodes are discussed next, together with the analysis of the electronic structure of these interfaces. Then we proceed to DFT-based findings on charge transfer mechanisms during redox reactions on these two anodes. We provide a comparison of the electronic properties of Ni/YSZ and Ni/CeO2 interfaces and present an interpretation of their different chemical performances. Subsequently we discuss the computed energy pathways of fuel oxidation mechanisms, obtained by various groups to date. We also discuss the results of DFT studies combined with microkinetic modeling as well as the results of kinetic Monte Carlo simulations. In conclusion we summarize the key findings of DFT modeling of metal/oxide interfaces to date and highlight possible directions in the future modeling of SOFC anodes.

  18. HTLV-1 Tax Functions as a Ubiquitin E3 Ligase for Direct IKK Activation via Synthesis of Mixed-Linkage Polyubiquitin Chains.

    Directory of Open Access Journals (Sweden)

    Chong Wang

    2016-04-01

    Full Text Available The HTLV-1 oncoprotein Tax plays a key role in CD4+ T cell transformation by promoting cell proliferation and survival, mainly through permanent activation of the NK-κB pathway and induction of many NF-κB target genes. Elucidating the underlying molecular mechanism is therefore critical in understanding HTLV-1-mediated transformation. Current studies have suggested multiple but controversial mechanisms regarding Tax-induced IKK activation mainly due to blending of primary Tax-induced IKK activation events and secondary IKK activation events induced by cytokines secreted by the primary Tax-induced IKK-NF-κB activation events. We reconstituted Tax-stimulated IKK activation in a cell-free system to dissect the essential cellular components for primary IKK activation by Tax and studied the underlying biochemical mechanism. We found that Tax is a putative E3 ubiquitin ligase, which, together with UbcH2, UhcH5c, or UbcH7, catalyzes the assembly of free mixed-linkage polyubiquitin chains. These free mixed-linkage polyubiquitin chains are then responsible for direct IKK activation by binding to the NEMO subunit of IKK. Our studies revealed the biochemical function of Tax in the process of IKK activation, which utilizes the minimal cellular ubiquitination components for NF-κB activation.

  19. Characterization of pore-expanded amino-functionalized mesoporous silicas directly synthesized with dimethyldecylamine and its application for decolorization of sulphonated azo dyes

    International Nuclear Information System (INIS)

    Yang Hong; Feng Qiyan

    2010-01-01

    With dimethyldecylamine (DMDA) as the expander, a new kind of pore-expanded amino-functionalized mesoporous silicas (PEAFMS) was directly synthesized under mild alkali condition. The characteristics of PEAFMS sample demonstrated that the presence of DMDA markedly augmented the average pore diameter (19.04 nm) and strongly enhanced its decolorization ability. Subsequently, acid mordant dark yellow GG (YGG) and reactive red violet X-2R (RVX) were chosen to assess its adsorption capacity for sulphonated azo dyes. The effect of initial pH was investigated and the decolorization mechanism was illuminated. Three isotherms were conducted and the goodness of fit increased as the following order: Freundlich < Langmuir < Redlich-Peterson. The maximum adsorption capacities of YGG and RVX onto PEAFMS were 1.967 and 0.957 mmol/g, respectively. Adsorption kinetic processes were better predicted by the pseudo-second-order rate equation than the pseudo-first-order one. Adsorption thermodynamic results suggested that the adsorption behavior of both dyes onto PEAFMS was spontaneous with the chemical nature. In addition, the regeneration of PEAFMS was proved to be feasible using NaOH as the strippant. After five cycles, PEAFMS still possessed a favorable adsorption capacity for dyes. It is safely concluded that PEAFMS could be a potential adsorbent for the dye removal from wastewater.

  20. Highly effective and CO-tolerant PtRu electrocatalysts supported on poly(ethyleneimine) functionalized carbon nanotubes for direct methanol fuel cells

    International Nuclear Information System (INIS)

    Cheng, Yi; Jiang, San Ping

    2013-01-01

    A highly efficient and CO tolerant PtRu electrocatalysts supported on amino-rich, cationic poly(ethyleneimine) polyelectrolyte functionalized multi-walled carbon nanotubes (PtRu/PEI-MWCNTs) has been developed. The catalysts were characterized by thermogravimetric analysis, Raman spectroscopy, cyclic voltammograms, CO stripping, chronoamperometry, transmission electron microscopy (TEM) and X-ray diffraction (XRD). The PtRu particles with average size ∼2.5 nm are well dispersed on PEI-MWCNTs. The peak current for the methanol oxidation reaction on 40% PtRu/PEI-MWCNTs is 636mAmg Pt −1 , 5.7 times higher than 112mA mg Pt −1 measured on the 40% PtRu supported on acid treated MWCNTs (PtRu/AO-MWCNTs) under identical conditions. PtRu/PEI-MWCNTs catalysts exhibit a superior electrocatalytic activity and stability for the methanol oxidation reaction due to its high tolerance toward CO poisoning as compared with PtRu/AO-MWCNTs for direct methanol fuel cells

  1. Wearable functional Near Infrared Spectroscopy (fNIRS and transcranial Direct Current Stimulation (tDCS: Expanding Vistas for Neurocognitive Augmentation

    Directory of Open Access Journals (Sweden)

    Ryan eMcKendrick

    2015-03-01

    Full Text Available Contemporary studies with transcranial direct current stimulation (tDCS provide a growing base of evidence for enhancing cognition through the non-invasive delivery of weak electric currents to the brain. The main effect of tDCS is to modulate cortical excitability depending on the polarity of the applied current. However, the underlying mechanism of neuromodulation is not well understood. A new generation of functional near infrared spectroscopy (fNIRS systems is described that are miniaturized, portable, and include wearable sensors. These developments provide an opportunity to couple fNIRS with tDCS, consistent with a neuroergonomics approach for joint neuroimaging and neurostimulation investigations of cognition in complex tasks and in naturalistic conditions. The effects of tDCS on complex task performance and the use of fNIRS for monitoring cognitive workload during task performance are described. Also explained is how fNIRS + tDCS can be used simultaneously for assessing spatial working memory. Mobile optical brain imaging is a promising neuroimaging tool that has the potential to complement tDCS for realistic applications in natural settings.

  2. Measuring the Total-Factor Carbon Emission Performance of Industrial Land Use in China Based on the Global Directional Distance Function and Non-Radial Luenberger Productivity Index

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2016-04-01

    Full Text Available Industry is a major contributor to carbon emissions in China, and industrial land is an important input to industrial production. Therefore, a detailed analysis of the carbon emission performance of industrial land use is necessary for making reasonable carbon reduction policies that promote the sustainable use of industrial land. This paper aims to analyze the dynamic changes in the total-factor carbon emission performance of industrial land use (TCPIL in China by applying a global directional distance function (DDF and non-radial Luenberger productivity index. The empirical results show that the eastern region enjoys better TCPIL than the central and western regions, but the regional gaps in TCPIL are narrowing. The growth in NLCPILs (non-radial Luenberger carbon emission performance of industrial land use in the eastern and central regions is mainly driven by technological progress, whereas efficiency improvements contribute more to the growth of NLCPIL in the western region. The provinces in the eastern region have the most innovative and environmentally-friendly production technologies. The results of the analysis of the influencing factors show implications for improving the NLCPIL, including more investment in industrial research and development (R&D, the implementation of carbon emission reduction policies, reduction in the use of fossil energy, especially coal, in the process of industrial production, actively learning about foreign advanced technology, properly solving the problem of surplus labor in industry and the expansion of industrial development.

  3. Focalised stimulation using high definition transcranial direct current stimulation (HD-tDCS) to investigate declarative verbal learning and memory functioning.

    Science.gov (United States)

    Nikolin, Stevan; Loo, Colleen K; Bai, Siwei; Dokos, Socrates; Martin, Donel M

    2015-08-15

    Declarative verbal learning and memory are known to be lateralised to the dominant hemisphere and to be subserved by a network of structures, including those located in frontal and temporal regions. These structures support critical components of verbal memory, including working memory, encoding, and retrieval. Their relative functional importance in facilitating declarative verbal learning and memory, however, remains unclear. To investigate the different functional roles of these structures in subserving declarative verbal learning and memory performance by applying a more focal form of transcranial direct current stimulation, "High Definition tDCS" (HD-tDCS). Additionally, we sought to examine HD-tDCS effects and electrical field intensity distributions using computer modelling. HD-tDCS was administered to the left dorsolateral prefrontal cortex (LDLPFC), planum temporale (PT), and left medial temporal lobe (LMTL) to stimulate the hippocampus, during learning on a declarative verbal memory task. Sixteen healthy participants completed a single blind, intra-individual cross-over, sham-controlled study which used a Latin Square experimental design. Cognitive effects on working memory and sustained attention were additionally examined. HD-tDCS to the LDLPFC significantly improved the rate of verbal learning (p=0.03, η(2)=0.29) and speed of responding during working memory performance (p=0.02, η(2)=0.35), but not accuracy (p=0.12, η(2)=0.16). No effect of tDCS on verbal learning, retention, or retrieval was found for stimulation targeted to the LMTL or the PT. Secondary analyses revealed that LMTL stimulation resulted in increased recency (p=0.02, η(2)=0.31) and reduced mid-list learning effects (p=0.01, η(2)=0.39), suggesting an inhibitory effect on learning. HD-tDCS to the LDLPFC facilitates the rate of verbal learning and improved efficiency of working memory may underlie performance effects. This focal method of administrating tDCS has potential for probing

  4. Chronic social stress induces peripheral and central immune activation, blunted mesolimbic dopamine function, and reduced reward-directed behaviour in mice

    Directory of Open Access Journals (Sweden)

    Giorgio Bergamini

    2018-02-01

    Full Text Available Psychosocial stress is a major risk factor for depression, stress leads to peripheral and central immune activation, immune activation is associated with blunted dopamine (DA neural function, DA function underlies reward interest, and reduced reward interest is a core symptom of depression. These states might be inter-independent in a complex causal pathway. Whilst animal-model evidence exists for some specific steps in the pathway, there is currently no animal model in which it has been demonstrated that social stress leads to each of these immune, neural and behavioural states. Such a model would provide important existential evidence for the complex pathway and would enable the study of causality and mediating mechanisms at specific steps in the pathway. Therefore, in the present mouse study we investigated for effects of 15-day resident-intruder chronic social stress (CSS on each of these states. Relative to controls, CSS mice exhibited higher spleen levels of granulocytes, inflammatory monocytes and T helper 17 cells; plasma levels of inducible nitric oxide synthase; and liver expression of genes encoding kynurenine pathway enzymes. CSS led in the ventral tegmental area to higher levels of kynurenine and the microglia markers Iba1 and Cd11b and higher binding activity of DA D1 receptor; and in the nucleus accumbens (NAcc to higher kynurenine, lower DA turnover and lower c-fos expression. Pharmacological challenge with DA reuptake inhibitor identified attenuation of DA stimulatory effects on locomotor activity and NAcc c-fos expression in CSS mice. In behavioural tests of operant responding for sucrose reward validated as sensitive assays for NAcc DA function, CSS mice exhibited less reward-directed behaviour. Therefore, this mouse study demonstrates that a chronic social stressor leads to changes in each of the immune, neural and behavioural states proposed to mediate between stress and disruption of DA-dependent reward processing. The

  5. Direct Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Austern, N. [University of Pittsburgh, Pittsburgh, PA (United States)

    1963-01-15

    In order to give a unified presentation of one point of view, these lectures are devoted only to a detailed development of the standard theories of direct reactions, starting from basic principles. Discussion is given of the present status of the theories, of the techniques used for practical calculation, and of possible future developments. The direct interaction (DI) aspects of a reaction are those which involve only a few of the many degrees of freedom of a nucleus. In fact the minimum number of degrees of freedom which must be involved in a reaction are those required to describe the initial and final channels, and DI studies typically consider these degrees of freedom and no others. Because of this simplicity DI theories may be worked out in painstaking detail. DI processes concern only part of the wave function for a problem. The other part involves complicated excitations of many degrees of freedom, and gives the compound nucleus (CN) effects. While it is extremely interesting to learn how to separate DI and CN effects in an orderly manner, if they are both present in a reaction, no suitable method has yet been found. Instead, current work stresses the kinds of reactions and the kinds of final states in which DI effects dominate and in which CN effects may almost be forgotten. The DI cross-sections which are studied are often extremely large, comparable to elastic scattering cross-sections. (author)

  6. Controlling the directionality of charge transfer in phthalocyaninato zinc sensitizer for a dye-sensitized solar cell: density functional theory studies.

    Science.gov (United States)

    Wan, Liang; Qi, Dongdong; Zhang, Yuexing; Jiang, Jianzhuang

    2011-01-28

    Density functional theory (DFT) calculation on the molecular structures, charge distribution, molecular orbitals, electronic absorption spectra of a series of eight unsymmetrical phthalocyaninato zinc complexes with one peripheral (E)-2-cyano-3-(5-vinylthiophen-2-yl) acrylic acid substituent at 2 or 3 position as an electron-withdrawing group and a different number of electron-donating amino groups at the remaining peripheral positions (9, 10, 16, 17, 23, 24) of the phthalocyanine ring, namely ZnPc-β-A, ZnPc-β-A-I-NH(2), ZnPc-β-A-II-NH(2), ZnPc-β-A-III-NH(2), ZnPc-β-A-I,II-NH(2), ZnPc-β-A-I,III-NH(2), ZnPc-β-A-II,III-NH(2), and ZnPc-β-A-I,II,III-NH(2), reveals the effects of amino groups on the charge transfer properties of these phthalocyanine derivatives with a typical D-π-A electronic structure. The introduction of amino groups was revealed altering of the atomic charge distribution, lifting the frontier molecular orbital level, red-shift of the near-IR bands in the electronic absorption spectra, and finally resulting in enhanced charge transfer directionality for the phthalocyanine compounds. Along with the increase of the peripheral amino groups at the phthalocyanine ring from 0, 2, 4, to 6, the dihedral angle between the phthalocyanine ring and the average plane of the (E)-2-cyano-3-(5-vinylthiophen-2-yl) acrylic acid substituent increases from 0 to 3.3° in an irregular manner. This is in good contrast to the regular and significant change in the charge distribution, destabilization of frontier orbital energies, and red shift of near-IR bands of phthalocyanine compounds along the same order. In addition, comparative studies indicate the smaller effect of incorporating two amino groups onto the 16 and 17 than on 9 and 10 or 23 and 24 peripheral positions of the phthalocyanine ring onto the aforementioned electronic properties, suggesting the least effect on tuning the charge transfer property of the phthalocyanine compound via introducing two

  7. Test-retest reliability of prefrontal transcranial Direct Current Stimulation (tDCS) effects on functional MRI connectivity in healthy subjects.

    Science.gov (United States)

    Wörsching, Jana; Padberg, Frank; Helbich, Konstantin; Hasan, Alkomiet; Koch, Lena; Goerigk, Stephan; Stoecklein, Sophia; Ertl-Wagner, Birgit; Keeser, Daniel

    2017-07-15

    Transcranial Direct Current Stimulation (tDCS) of the prefrontal cortex (PFC) can be used for probing functional brain connectivity and meets general interest as novel therapeutic intervention in psychiatric and neurological disorders. Along with a more extensive use, it is important to understand the interplay between neural systems and stimulation protocols requiring basic methodological work. Here, we examined the test-retest (TRT) characteristics of tDCS-induced modulations in resting-state functional-connectivity MRI (RS fcMRI). Twenty healthy subjects received 20minutes of either active or sham tDCS of the dorsolateral PFC (2mA, anode over F3 and cathode over F4, international 10-20 system), preceded and ensued by a RS fcMRI (10minutes each). All subject underwent three tDCS sessions with one-week intervals in between. Effects of tDCS on RS fcMRI were determined at an individual as well as at a group level using both ROI-based and independent-component analyses (ICA). To evaluate the TRT reliability of individual active-tDCS and sham effects on RS fcMRI, voxel-wise intra-class correlation coefficients (ICC) of post-tDCS maps between testing sessions were calculated. For both approaches, results revealed low reliability of RS fcMRI after active tDCS (ICC (2,1) = -0.09 - 0.16). Reliability of RS fcMRI (baselines only) was low to moderate for ROI-derived (ICC (2,1) = 0.13 - 0.50) and low for ICA-derived connectivity (ICC (2,1) = 0.19 - 0.34). Thus, for ROI-based analyses, the distribution of voxel-wise ICC was shifted to lower TRT reliability after active, but not after sham tDCS, for which the distribution was similar to baseline. The intra-individual variation observed here resembles variability of tDCS effects in motor regions and may be one reason why in this study robust tDCS effects at a group level were missing. The data can be used for appropriately designing large scale studies investigating methodological issues such as sources of variability and

  8. Non-linear effects of transcranial direct current stimulation as a function of individual baseline performance: Evidence from biparietal tDCS influence on lateralized attention bias.

    Science.gov (United States)

    Benwell, Christopher S Y; Learmonth, Gemma; Miniussi, Carlo; Harvey, Monika; Thut, Gregor

    2015-08-01

    Transcranial direct current stimulation (tDCS) is a well-established technique for non-invasive brain stimulation (NIBS). However, the technique suffers from a high variability in outcome, some of which is likely explained by the state of the brain at tDCS-delivery but for which explanatory, mechanistic models are lacking. Here, we tested the effects of bi-parietal tDCS on perceptual line bisection as a function of tDCS current strength (1 mA vs 2 mA) and individual baseline discrimination sensitivity (a measure associated with intrinsic uncertainty/signal-to-noise balance). Our main findings were threefold. We replicated a previous finding (Giglia et al., 2011) of a rightward shift in subjective midpoint after Left anode/Right cathode tDCS over parietal cortex (sham-controlled). We found this effect to be weak over our entire sample (n = 38), but to be substantial in a subset of participants when they were split according to tDCS-intensity and baseline performance. This was due to a complex, nonlinear interaction between these two factors. Our data lend further support to the notion of state-dependency in NIBS which suggests outcome to depend on the endogenous balance between task-informative 'signal' and task-uninformative 'noise' at baseline. The results highlight the strong influence of individual differences and variations in experimental parameters on tDCS outcome, and the importance of fostering knowledge on the factors influencing tDCS outcome across cognitive domains. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Impairment of preoperative language mapping by lesion location: a functional magnetic resonance imaging, navigated transcranial magnetic stimulation, and direct cortical stimulation study.

    Science.gov (United States)

    Ille, Sebastian; Sollmann, Nico; Hauck, Theresa; Maurer, Stefanie; Tanigawa, Noriko; Obermueller, Thomas; Negwer, Chiara; Droese, Doris; Boeckh-Behrens, Tobias; Meyer, Bernhard; Ringel, Florian; Krieg, Sandro M

    2015-08-01

    Language mapping by repetitive navigated transcranial magnetic stimulation (rTMS) is increasingly used and has already replaced functional MRI (fMRI) in some institutions for preoperative mapping of neurosurgical patients. Yet some factors affect the concordance of both methods with direct cortical stimulation (DCS), most likely by lesions affecting cortical oxygenation levels. Therefore, the impairment of the accuracy of rTMS and fMRI was analyzed and compared with DCS during awake surgery in patients with intraparenchymal lesions. Language mapping was performed by DCS, rTMS, and fMRI using an object-naming task in 27 patients with left-sided perisylvian lesions, and the induced language errors of each method were assigned to the cortical parcellation system. Subsequently, the receiver operating characteristics were calculated for rTMS and fMRI and compared with DCS as ground truth for regions with (w/) and without (w/o) the lesion in the mapped regions. The w/ subgroup revealed a sensitivity of 100% (w/o 100%), a specificity of 8% (w/o 5%), a positive predictive value of 34% (w/o: 53%), and a negative predictive value (NPV) of 100% (w/o: 100%) for the comparison of rTMS versus DCS. Findings for the comparison of fMRI versus DCS within the w/ subgroup revealed a sensitivity of 32% (w/o: 62%), a specificity of 88% (w/o: 60%), a positive predictive value of 56% (w/o: 62%), and a NPV of 73% (w/o: 60%). Although strengths and weaknesses exist for both rTMS and fMRI, the results show that rTMS is less affected by a brain lesion than fMRI, especially when performing mapping of language-negative cortical regions based on sensitivity and NPV.

  10. Direct anti-inflammatory effects of granulocyte colony-stimulating factor (G-CSF) on activation and functional properties of human T cell subpopulations in vitro.

    Science.gov (United States)

    Malashchenko, Vladimir Vladimirovich; Meniailo, Maxsim Evgenievich; Shmarov, Viacheslav Anatolievich; Gazatova, Natalia Dinislamovna; Melashchenko, Olga Borisovna; Goncharov, Andrei Gennadievich; Seledtsova, Galina Victorovna; Seledtsov, Victor Ivanovich

    2018-03-01

    We investigated the direct effects of human granulocyte colony-stimulating factor (G-CSF) on functionality of human T-cell subsets. CD3 + T-lymphocytes were isolated from blood of healthy donors by positive magnetic separation. T cell activation with particles conjugated with antibodies (Abs) to human CD3, CD28 and CD2 molecules increased the proportion of cells expressing G-CSF receptor (G-CSFR, CD114) in all T cell subpopulations studied (CD45RA + /CD197 + naive T cells, CD45RA - /CD197 + central memory T cells, CD45RA - /CD197 - effector memory T cells and CD45RA + /CD197 - terminally differentiated effector T cells). Upon T-cell activation in vitro, G-CSF (10.0 ng/ml) significantly and specifically enhanced the proportion of CD114 + T cells in central memory CD4 + T cell compartment. A dilution series of G-CSF (range, 0.1-10.0 ng/ml) was tested, with no effect on the expression of CD25 (interleukin-2 receptor α-chain) on activated T cells. Meanwhile, G-CSF treatment enhanced the proportion of CD38 + T cells in CD4 + naïve T cell, effector memory T cell and terminally differentiated effector T cell subsets, as well as in CD4 - central memory T cells and terminally differentiated effector T cells. G-CSF did not affect IL-2 production by T cells; relatively low concentrations of G-CSF down-regulated INF-γ production, while high concentrations of this cytokine up-regulated IL-4 production in activated T cells. The data obtained suggests that G-CSF could play a significant role both in preventing the development of excessive and potentially damaging inflammatory reactivity, and in constraining the expansion of potentially cytodestructive T cells. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Regional energy efficiency, carbon emission performance and technology gaps in China: A meta-frontier non-radial directional distance function analysis

    International Nuclear Information System (INIS)

    Yao, Xin; Zhou, Hongchen; Zhang, Aizhen; Li, Aijun

    2015-01-01

    At present, China is the largest primary energy consumer and carbon emitter in the world. Meantime, China is a large transitional economy with significant regional gaps. Against such backgrounds, the calculated results of energy and carbon performance indicators may be biased, without considering heterogeneity across regions. To this end, after incorporating region-heterogeneity, this paper provides detailed information, regarding energy efficiency, carbon emission performance and the potential of carbon emission reductions from regional perspectives, which may be important and useful for policy makers. Our main findings are as follows. Firstly, there is significant group-heterogeneity across regions in China, in terms of energy efficiency and carbon emission performance. Secondly, there are no considerable differences between total-factor and single-factor performance indices, since there is limited substitutability between energy inputs and other production inputs. Finally, significant carbon emission reductions can be made by “catching up” for regions with low energy efficiency and carbon emission performance. Looking ahead, the Chinese government should adopt measures to promote improvements in terms of energy efficiency and carbon emission performance in the short term. -- Highlights: •We adopt a meta-frontier non-radial directional distance function analysis. •We provide detailed information regarding energy and carbon emission performance. •We find that there is significant region-heterogeneity in China. •There are no large differences between total- and single-factor performance indices. •It can make great contributions to carbon emission reductions by “catching up”

  12. Is there a difference between the energy and CO_2 emission performance for China’s thermal power industry? A bootstrapped directional distance function approach

    International Nuclear Information System (INIS)

    Duan, Na; Guo, Jun-Peng; Xie, Bai-Chen

    2016-01-01

    Highlights: • Evaluate the energy and CO_2 emission performance of China’s thermal power industry. • Perform statistical inferences for the estimates of efficiency and productivity indexes. • There exist differences between the energy and CO_2 emission performance. • Technological progress is the main driving force for productivity improvement. - Abstract: A scientific evaluation of the energy efficiency and CO_2 emission performance of the thermal power industry could not only provide valuable information for reducing energy consumption and carbon emissions but also serve as a tool to estimate the effectiveness of relevant policy reforms. Considering the opposite effects of energy conservation and carbon emission reduction on generation cost, this study respectively measures the energy and CO_2 emission performance of the thermal power industries in China’s 30 provincial administrative regions during the period 2005–2012 from both static and dynamic perspectives. We implement the bootstrap method for the directional distance function to correct the possible estimate bias and test the significance of productivity changes where the weak disposability of undesirable outputs is also integrated. The empirical analysis leads to the following conclusions. The bootstrapping results could provide us with much valuable information because the initial estimates might result from sampling noise rather than reveal the real variations. In addition, some differences do exist between the energy and CO_2 emission performance of China’s thermal power industry. Furthermore, technological progress is the main driving force for energy and CO_2 emission productivity improvement and it works better for the former.

  13. Performance of direct ethanol fuel cells as function of using of compressed air; Desempenho de celulas a combustivel com alimentacao direta de etanol em funcao do uso de ar comprimido

    Energy Technology Data Exchange (ETDEWEB)

    Belchor, P.M. [UFRGS - Universidade Federal do Rio Grande do Sul, Porto Alegre, RS (Brazil); Berns, B.A.; Ferreira, R.C.; Goldbach, A.; Carpenter, D. [FURB - Fundacao Universidade Regional de Blumenau, Blumenau, SC (Brazil)

    2010-07-01

    This paper compared the performance of a direct ethanol fuel cell (CCADE) cathode feeding with air replacing the pure oxygen. The results have shown that the small decreasing of the yield of the cell under both practical and experimental situations, by the use of air replacing pure oxygen, it completely acceptable as function of great diminishing of operational costs. (author)

  14. Gut-directed hypnotherapy in children with irritable bowel syndrome or functional abdominal pain (syndrome): a randomized controlled trial on self exercises at home using CD versus individual therapy by qualified therapists

    NARCIS (Netherlands)

    Rutten, Juliette M. T. M.; Vlieger, Arine M.; Frankenhuis, Carla; George, Elvira K.; Groeneweg, Michael; Norbruis, Obbe F.; Tjon A ten, Walther; van Wering, Herbert; Dijkgraaf, Marcel G. W.; Merkus, Maruschka P.; Benninga, Marc A.

    2014-01-01

    Irritable bowel syndrome (IBS) and functional abdominal pain (syndrome) (FAP(S)) are common pediatric disorders, characterized by chronic or recurrent abdominal pain. Treatment is challenging, especially in children with persisting symptoms. Gut-directed hypnotherapy (HT) performed by a therapist

  15. Direct Democracy

    DEFF Research Database (Denmark)

    Beramendi, Virginia; Ellis, Andrew; Kaufman, Bruno

    While many books on direct democracy have a regional or national approach, or simply focus on one of the many mechanisms associated with direct democracy, this Handbook delves into a global comparison of direct democracy mechanisms, including referendums, citizens' initiatives, agenda initiatives...... learned. In addition, the uniquely comprehensive world survey outlines direct democracy provisions in 214 countries and territories and indicates which, if any, of these provisions are used by each country or territory at both the national and sub-national levels. Furthermore, the world survey includes...

  16. THE ANALYSIS OF ANALYTICAL FUNCTIONS FOR APPROXIMATIVE DO-ALL MAGNETIC CHARACTERISTIC OF DIRECT – CURRENT AND UNDULATED – CURRENT TRACTION MOTORS

    Directory of Open Access Journals (Sweden)

    H. K. Hetman

    2011-01-01

    Full Text Available A number of functions for approximating the universal magnetic curve and its derivatives, their accuracy and conformity to the requirements put forward by the authors have been studied.

  17. SUN1 splice variants, SUN1_888, SUN1_785, and predominant SUN1_916, variably function in directional cell migration

    OpenAIRE

    Nishioka, Yu; Imaizumi, Hiromasa; Imada, Junko; Katahira, Jun; Matsuura, Nariaki; Hieda, Miki

    2016-01-01

    The LINC complex is a multifunctional protein complex that is involved in various processes at the nuclear envelope, such as nuclear migration, mechanotransduction and chromatin tethering in the meiotic phase. However, it remains unknown how these functions are regulated in different cell contexts. An inner nuclear membrane component of the LINC complex, SUN1, is ubiquitously expressed. The human SUN1 gene produces over 10 variants by alternative splicing. Although functions of SUN1 are relat...

  18. Fair Balance? An Analysis of the Functional Equivalence of Risk and Benefit Information in Prescription Drug Direct-to-Consumer Television Advertising

    Science.gov (United States)

    Baird-Harris, Kay

    2009-01-01

    Prescription drug direct-to-consumer advertising (DTCA) has been a subject of controversy in recent years. Though government regulations require equivalent prominence of risks and benefits, there is concern about the ability of consumers with limited health literacy to fully comprehend the risks and benefits associated with drug use. Evaluating…

  19. A Review of Research on Direct-Care Staff Data Collection Regarding the Severity and Function of Challenging Behavior in Individuals with Intellectual and Developmental Disabilities

    Science.gov (United States)

    Madsen, Emily K.; Peck, Janelle A.; Valdovinos, Maria G.

    2016-01-01

    In working with individuals with intellectual and developmental disabilities (IDDs), it is direct care staff who are often required to collect data on individuals' behavior which is used as the basis for implementation of empirically based approaches for intervention and treatment. Due to limited resources, indirect and descriptive measures of…

  20. Direct functionalization of pristine single-walled carbon nanotubes by diazonium-based method with various five-membered S- or N- heteroaromatic amines

    International Nuclear Information System (INIS)

    Leinonen, Heli; Lajunen, Marja

    2012-01-01

    Reactivity of five-membered, variously substituted, heteroaromatic diazonium salts was studied toward pristine single-walled carbon nanotubes (SWCNTs), prepared by high-pressure CO conversion (HiPCO) method. Average size range of individual HiPCO SWCNTs was 0.8–1.2 nm (diameter) and 100–1,000 nm (length). Functionalizations were performed by a one-pot diazotization–dediazotization method with methyl-2-aminothiophene-3-carboxylate, 2-aminothiophene-3-carbonitrile, 2-aminoimidazole sulfate, or 3-aminopyrazole in acetic acid using sodium nitrite at room temperature or by heating. According to Raman and Fourier transform infrared spectroscopy, all used heterocyclic diazonium salts formed a covalent bond with SWCNTs and yielded new kinds of five-membered heterocycle-functionalized SWCNTs. Methyl-2-thiophenyl-3-carboxylate-functionalized SWCNTs formed a highly soluble, stable dispersion in tetrahydrofuran (THF), 3-pyrazoyl-functionalized SWCNTs in ethanol, and 2-imidazoyl- or 2-thiophenyl-3-carbonitrile-functionalized SWCNTs in ethanol and THF. The thermogravimetric analysis as well as energy-filtered transmission electron microscopy imaging of the products confirmed the successful functionalization of SWCNTs.

  1. Direct functionalization of pristine single-walled carbon nanotubes by diazonium-based method with various five-membered S- or N- heteroaromatic amines

    Energy Technology Data Exchange (ETDEWEB)

    Leinonen, Heli; Lajunen, Marja, E-mail: marja.lajunen@oulu.fi [University of Oulu, Department of Chemistry (Finland)

    2012-09-15

    Reactivity of five-membered, variously substituted, heteroaromatic diazonium salts was studied toward pristine single-walled carbon nanotubes (SWCNTs), prepared by high-pressure CO conversion (HiPCO) method. Average size range of individual HiPCO SWCNTs was 0.8-1.2 nm (diameter) and 100-1,000 nm (length). Functionalizations were performed by a one-pot diazotization-dediazotization method with methyl-2-aminothiophene-3-carboxylate, 2-aminothiophene-3-carbonitrile, 2-aminoimidazole sulfate, or 3-aminopyrazole in acetic acid using sodium nitrite at room temperature or by heating. According to Raman and Fourier transform infrared spectroscopy, all used heterocyclic diazonium salts formed a covalent bond with SWCNTs and yielded new kinds of five-membered heterocycle-functionalized SWCNTs. Methyl-2-thiophenyl-3-carboxylate-functionalized SWCNTs formed a highly soluble, stable dispersion in tetrahydrofuran (THF), 3-pyrazoyl-functionalized SWCNTs in ethanol, and 2-imidazoyl- or 2-thiophenyl-3-carbonitrile-functionalized SWCNTs in ethanol and THF. The thermogravimetric analysis as well as energy-filtered transmission electron microscopy imaging of the products confirmed the successful functionalization of SWCNTs.

  2. Direct functionalization of pristine single-walled carbon nanotubes by diazonium-based method with various five-membered S- or N- heteroaromatic amines

    Science.gov (United States)

    Leinonen, Heli; Lajunen, Marja

    2012-09-01

    Reactivity of five-membered, variously substituted, heteroaromatic diazonium salts was studied toward pristine single-walled carbon nanotubes (SWCNTs), prepared by high-pressure CO conversion (HiPCO) method. Average size range of individual HiPCO SWCNTs was 0.8-1.2 nm (diameter) and 100-1,000 nm (length). Functionalizations were performed by a one-pot diazotization-dediazotization method with methyl-2-aminothiophene-3-carboxylate, 2-aminothiophene-3-carbonitrile, 2-aminoimidazole sulfate, or 3-aminopyrazole in acetic acid using sodium nitrite at room temperature or by heating. According to Raman and Fourier transform infrared spectroscopy, all used heterocyclic diazonium salts formed a covalent bond with SWCNTs and yielded new kinds of five-membered heterocycle-functionalized SWCNTs. Methyl-2-thiophenyl-3-carboxylate-functionalized SWCNTs formed a highly soluble, stable dispersion in tetrahydrofuran (THF), 3-pyrazoyl-functionalized SWCNTs in ethanol, and 2-imidazoyl- or 2-thiophenyl-3-carbonitrile-functionalized SWCNTs in ethanol and THF. The thermogravimetric analysis as well as energy-filtered transmission electron microscopy imaging of the products confirmed the successful functionalization of SWCNTs.

  3. A Fab fragment directed against the neural cell adhesion molecule L1 enhances functional recovery after injury of the adult mouse spinal cord.

    Science.gov (United States)

    Loers, Gabriele; Cui, Yi-Fang; Neumaier, Irmgard; Schachner, Melitta; Skerra, Arne

    2014-06-15

    Lack of permissive mechanisms and abundance of inhibitory molecules in the lesioned central nervous system of adult mammals contribute to the failure of functional recovery, which leads to severe disabilities in motor functions or pain. Previous studies have indicated that the neural cell adhesion molecule L1 constitutes a viable target to promote regeneration. In the present study, we describe the cloning, functional expression in Escherichia coli cells and purification of a recombinant αL1 Fab fragment that binds to L1 with comparable activity as the function-triggering monoclonal antibody 557.B6 and induces neurite outgrowth and neuronal survival in cultured neurons, despite its monovalent function. Infusion of αL1 Fab into the lesioned spinal cord of mice enhanced functional recovery after thoracic spinal cord compression injury. αL1 Fab treatment resulted in reduced scar volume, enhanced number of tyrosine hydroxylase-positive axons and increased linear density of VGLUT1 (vesicular glutamate transporter 1) on motoneurons. Furthermore, the number and soma size of ChAT (choline acetyltransferase)-positive motoneurons and the linear density of ChAT-positive boutons on motoneurons as well as parvalbumin-positive interneurons in the lumbar spinal cord were elevated. Stimulation of endogenous L1 by application of the αL1 Fab opens new avenues for recombinant antibody technology, offering prospects for therapeutic applications after traumatic nervous system lesions.

  4. Directing 101.

    Science.gov (United States)

    Pintoff, Ernest

    Providing an introduction to anyone considering directing as a field of study or career, this book takes a broad look at the process of directing and encourages students and professionals alike to look outside of the movie industry for inspiration. Chapters in the book discuss selecting and acquiring material; budgeting and financing; casting and…

  5. Photoelectron Spectroscopy of CdSe Nanocrystals in the Gas Phase: A Direct Measure of the Evanescent Electron Wave Function of Quantum Dots

    Science.gov (United States)

    2013-01-01

    researchers have used ultrafast transient absorption spectros - copy to show that the charge separation rate of Type II core− shell QDs depends on the extent...the first direct measurement of the evanescent electron density of the QD exciton. We use ultrafast two-photon photoelectron spectros - copy (2PPE) to...clusters are well preserved after the aerosol system, as observed using UV − visible spectroscopy (Supporting Information Figure S1). The isolation of the

  6. A Simple Catalytic Mechanism for the Direct Coupling of α-Carbonyls with Functionalized Amines: A One-Step Synthesis of Plavix

    OpenAIRE

    Evans, Ryan W.; Zbieg, Jason R.; Zhu, Shaolin; Li, Wei; MacMillan, David W. C.

    2013-01-01

    The direct α-amination of ketones, esters, and aldehydes has been accomplished via copper catalysis. In the presence of catalytic copper(II) bromide, a diverse range of carbonyl and amine substrates undergo fragment coupling to produce synthetically useful α-amino substituted motifs. The transformation is proposed to proceed via a catalytically generated α-bromo carbonyl species; nucleophilic displacement of the bromide by the amine then delivers the α-amino carbonyl adduct while the catalyst...

  7. Corolla chirality does not contribute to directed pollen movement in Hypericum perforatum (Hypericaceae): mirror image pinwheel flowers function as radially symmetric flowers in pollination.

    Science.gov (United States)

    Diller, Carolina; Fenster, Charles B

    2016-07-01

    Corolla chirality, the pinwheel arrangement of petals within a flower, is found throughout the core eudicots. In 15 families, different chiral type flowers (i.e., right or left rotated corolla) exist on the same plant, and this condition is referred to as unfixed/enantiomorphic corolla chirality. There are no investigations on the significance of unfixed floral chirality on directed pollen movement even though analogous mirror image floral designs, for example, enantiostyly, has evolved in response to selection to direct pollinator and pollen movement. Here, we examine the role of corolla chirality on directing pollen transfer, pollinator behavior, and its potential influence on disassortative mating. We quantified pollen transfer and pollinator behavior and movement for both right and left rotated flowers in two populations of Hypericum perforatum. In addition, we quantified the number of right and left rotated flowers at the individual level. Pollinators were indifferent to corolla chirality resulting in no difference in pollen deposition between right and left flowers. Corolla chirality had no effect on pollinator and pollen movement between and within chiral morphs. Unlike other mirror image floral designs, corolla chirality appears to play no role in promoting disassortative mating in this species.

  8. NOA36 Protein Contains a Highly Conserved Nucleolar Localization Signal Capable of Directing Functional Proteins to the Nucleolus, in Mammalian Cells

    Science.gov (United States)

    de Melo, Ivan S.; Jimenez-Nuñez, Maria D.; Iglesias, Concepción; Campos-Caro, Antonio; Moreno-Sanchez, David; Ruiz, Felix A.; Bolívar, Jorge

    2013-01-01

    NOA36/ZNF330 is an evolutionarily well-preserved protein present in the nucleolus and mitochondria of mammalian cells. We have previously reported that the pro-apoptotic activity of this protein is mediated by a characteristic cysteine-rich domain. We now demonstrate that the nucleolar localization of NOA36 is due to a highly-conserved nucleolar localization signal (NoLS) present in residues 1–33. This NoLS is a sequence containing three clusters of two or three basic amino acids. We fused the amino terminal of NOA36 to eGFP in order to characterize this putative NoLS. We show that a cluster of three lysine residues at positions 3 to 5 within this sequence is critical for the nucleolar localization. We also demonstrate that the sequence as found in human is capable of directing eGFP to the nucleolus in several mammal, fish and insect cells. Moreover, this NoLS is capable of specifically directing the cytosolic yeast enzyme polyphosphatase to the target of the nucleolus of HeLa cells, wherein its enzymatic activity was detected. This NoLS could therefore serve as a very useful tool as a nucleolar marker and for directing particular proteins to the nucleolus in distant animal species. PMID:23516598

  9. Direct Binding between Pre-S1 and TRP-like Domains in TRPP Channels Mediates Gating and Functional Regulation by PIP2

    OpenAIRE

    Wang Zheng; Ruiqi Cai; Laura Hofmann; Vasyl Nesin; Qiaolin Hu; Wentong Long; Mohammad Fatehi; Xiong Liu; Shaimaa Hussein; Tim Kong; Jingru Li; Peter E. Light; Jingfeng Tang; Veit Flockerzi; Leonidas Tsiokas

    2018-01-01

    Transient receptor potential (TRP) channels are regulated by diverse stimuli comprising thermal, chemical, and mechanical modalities. They are also commonly regulated by phosphatidylinositol-4,5-bisphosphate (PIP2), with underlying mechanisms largely unknown. We here revealed an intramolecular interaction of the TRPP3 N and C termini (N-C) that is functionally essential. The interaction was mediated by aromatic Trp81 in pre-S1 domain and cationic Lys568 in TRP-like domain. Structure-function ...

  10. Lightness functions

    DEFF Research Database (Denmark)

    Campi, Stefano; Gardner, Richard; Gronchi, Paolo

    2012-01-01

    Variants of the brightness function of a convex body K in n-dimensional Euclidean are investigated. The Lambertian lightness function L(K; v , w ) gives the total reflected light resulting from illumination by a light source at infinity in the direction w that is visible when looking...... in the direction v . The partial brightness function R( K ; v , w ) gives the area of the projection orthogonal to v of the portion of the surface of K that is both illuminated by a light source from the direction w and visible when looking in the direction v . A class of functions called lightness functions...... is introduced that includes L(K;.) and R(K;.) as special cases. Much of the theory of the brightness function like uniqueness, stability, and the existence and properties of convex bodies of maximal and minimal volume with finitely many function values equal to those of a given convex body, is extended...

  11. The Toolbox for Uncovering the Functions of Legionella Dot/Icm Type IVb Secretion System Effectors: Current State and Future Directions

    Directory of Open Access Journals (Sweden)

    Gunnar N. Schroeder

    2018-01-01

    Full Text Available The defective in organelle trafficking/intracellular multiplication (Dot/Icm Type IVb secretion system (T4SS is the essential virulence factor for the intracellular life style and pathogenicity of Legionella species. Screens demonstrated that an individual L. pneumophila strain can use the Dot/Icm T4SS to translocate an unprecedented number of more than 300 proteins into host cells, where these, so called Icm/Dot-translocated substrates (IDTS or effectors, manipulate host cell functions to the benefit of the bacteria. Bioinformatic analysis of the pan-genus genome predicts at least 608 orthologous groups of putative effectors. Deciphering the function of these effectors is key to understanding Legionella pathogenesis; however, the analysis is challenging. Substantial functional redundancy renders classical, phenotypic screening of single gene deletion mutants mostly ineffective. Here, I review experimental approaches that were successfully used to identify, validate and functionally characterize T4SS effectors and highlight new methods, which promise to facilitate unlocking the secrets of Legionella's extraordinary weapons arsenal.

  12. The Secret Agent Society Social-Emotional Skills Program for Children with a High-Functioning Autism Spectrum Disorder: A Parent-Directed Trial

    Science.gov (United States)

    Sofronoff, Kate; Silva, Jenni; Beaumont, Renae

    2017-01-01

    This study evaluated a parent-delivered social and emotional skills intervention--the Secret Agent Society (SAS) for children with high-functioning autism spectrum disorders (HF-ASD). The study was a pre-post follow-up design with an 8-week baseline period and 6-week follow-up period. Participants were 38 parents and 41 children recruited from…

  13. The Co-Occurring Development of Executive Function Skills and Receptive Vocabulary in Preschool-Aged Children: A Look at the Direction of the Developmental Pathways

    Science.gov (United States)

    Weiland, Christina; Barata, M. Clara; Yoshikawa, Hirokazu

    2014-01-01

    Despite consensus in the developmental literature regarding the role of executive function (EF) skills in supporting the development of language skills during the preschool years, we know relatively little about the associations between EF skills, including all EF components, and vocabulary skills among preschool-aged children. In this paper, we…

  14. Directing Creativity

    DEFF Research Database (Denmark)

    Darsø, Lotte; Ibbotson, Piers

    2008-01-01

    In this article we argue that leaders facing complex challenges can learn from the arts, specifically that leaders can learn by examining how theatre directors direct creativity through creative constraints. We suggest that perceiving creativity as a boundary phenomenon is helpful for directing it....... Like leaders, who are caught in paradoxical situations where they have to manage production and logistics simultaneously with making space for creativity and innovation, theatre directors need to find the delicate balance between on one hand renewal of perceptions, acting and interaction...... and on the other hand getting ready for the opening night. We conclude that the art of directing creativity is linked to developing competencies of conscious presence, attention and vigilance, whereas the craft of directing creativity concerns communication, framing and choice....

  15. Direct Heat

    Energy Technology Data Exchange (ETDEWEB)

    Lienau, P J

    1990-01-01

    Potential resources and applications of earth heat in the form of geothermal energy are large. United States direct uses amount to 2,100 MWt thermal and worldwide 8,850 MWt above a reference temperature of 35 degrees Celsius. Space and district heating are the major direct uses of geothermal energy. Equipment employed in direct use projects is of standard manufacture and includes downhole and circulation pumps, transmission and distribution pipelines, heat exchangers and convectors, heat pumps and chillers. Direct uses of earth heat discussed are space and district heating, greenhouse heating and fish farming, process and industrial applications. The economic feasibility of direct use projects is governed by site specific factors such as location of user and resource, resource quality, system load factor and load density, as well as financing. Examples are presented of district heating in Klamath Falls, and Elko. Further developments of direct uses of geothermal energy will depend on matching user needs to the resource, and improving load factors and load density.

  16. Directing the breathing behavior of pillared-layered metal-organic frameworks via a systematic library of functionalized linkers bearing flexible substituents.

    Science.gov (United States)

    Henke, Sebastian; Schneemann, Andreas; Wütscher, Annika; Fischer, Roland A

    2012-06-06

    Flexible metal-organic frameworks (MOFs), also referred to as soft porous crystals (SPCs), show reversible structural transitions dependent on the nature and quantity of adsorbed guest molecules. In recent studies it has been reported that covalent functionalization of the organic linker can influence or even integrate framework flexibility ("breathing") in MOFs. However, rational fine-tuning of such responsive properties is very desirable but challenging as well. Here we present a powerful approach for the targeted manipulation of responsiveness and framework flexibility of an important family of pillared-layered MOFs based on the parent structure [Zn(2)(bdc)(2)(dabco)](n) (bdc = 1,4-benzenedicarboxylate; dabco = 1,4-diazabicyclo[2.2.2]octane). A library of functionalized bdc-type linkers (fu-bdc), which bear additional dangling side groups at different positions of the benzene core (alkoxy groups of varying chain length with diverse functionalities and polarity), was generated. Synthesis of the materials [Zn(2)(fu-bdc)(2)(dabco)](n) yields the respective collection of highly responsive MOFs. The parent MOF is only weakly flexible; however, the substituted frameworks of [Zn(2)(fu-bdc)(2)(dabco)](n) contract drastically upon guest removal and expand again upon adsorption of DMF (N,N-dimethylformamide), EtOH, or CO(2), etc., while N(2) is hardly adsorbed and does not open the narrow-pored form. These "breathing" dynamics are attributed to the dangling side chains that act as immobilized "guests", which interact with mobile guest molecules as well as with themselves and with the framework backbone. The structural details of the guest-free, contracted form and the gas sorption behavior (phase transition pressure, hysteresis loop) are highly dependent on the nature of the substituent at the linker and can therefore be adjusted using our approach. Combining our library of functionalized linkers with the concept of mixed-component MOFs (solid solutions) offers very rich

  17. The efficacy of modified direct lateral versus posterior approach on gait function and hip muscle strength after primary total hip arthroplasty at 12months follow-up

    DEFF Research Database (Denmark)

    Rosenlund, Signe; Broeng, Leif; Overgaard, Søren

    2016-01-01

    -spatial parameters and range of motion. Isometric maximal hip muscle strength in abduction, flexion and extension was also tested. FINDINGS: Post-operatively, no between-group difference in gait function was observed. However, both hip abductor and flexor muscle strength improved more in the posterior approach group......BACKGROUND: The lateral and the posterior approach are the most commonly used procedures for total hip arthroplasty. Due to the detachment of the hip abductors, lateral approach is claimed to cause reduced hip muscle strength and altered gait pattern. However, this has not been investigated...... in a randomised controlled trial. The aim was to compare the efficacy of total hip arthroplasty performed by lateral or posterior approach on gait function and hip muscle strength up to 12months post-operatively. We hypothesised that posterior approach would be superior to lateral approach. METHODS: Forty...

  18. Nanostructure-Directed Chemical Sensing: The IHSAB Principle and the Effect of Nitrogen and Sulfur Functionalization on Metal Oxide Decorated Interface Response

    Directory of Open Access Journals (Sweden)

    James L. Gole

    2013-08-01

    Full Text Available The response matrix, as metal oxide nanostructure decorated n-type semiconductor interfaces are modified in situ through direct amination and through treatment with organic sulfides and thiols, is demonstrated. Nanostructured TiO2, SnOx, NiO and CuxO (x = 1,2, in order of decreasing Lewis acidity, are deposited to a porous silicon interface to direct a dominant electron transduction process for reversible chemical sensing in the absence of significant chemical bond formation. The metal oxide sensing sites can be modified to decrease their Lewis acidity in a process appearing to substitute nitrogen or sulfur, providing a weak interaction to form the oxynitrides and oxysulfides. Treatment with triethylamine and diethyl sulfide decreases the Lewis acidity of the metal oxide sites. Treatment with acidic ethane thiol modifies the sensor response in an opposite sense, suggesting that there are thiol (SH groups present on the surface that provide a Brønsted acidity to the surface. The in situ modification of the metal oxides deposited to the interface changes the reversible interaction with the analytes, NH3 and NO. The observed change for either the more basic oxynitrides or oxysulfides or the apparent Brønsted acid sites produced from the interaction of the thiols do not represent a simple increase in surface basicity or acidity, but appear to involve a change in molecular electronic structure, which is well explained using the recently developed inverse hard and soft acids and bases (IHSAB model.

  19. Novel sulfonated poly (ether ether ketone)/phosphonic acid-functionalized titania nanohybrid membrane by an in situ method for direct methanol fuel cells

    Science.gov (United States)

    Wu, Hong; Cao, Ying; Li, Zhen; He, Guangwei; Jiang, Zhongyi

    2015-01-01

    Sulfonated poly (ether ether ketone)/phosphonic acid-functionalized titania nanohybrid membranes are prepared by an in situ method using titanium tetrachloride (TiCl4) as inorganic precursor and amino trimethylene phosphonic acid (ATMP) as modifier. Phosphonic acid-functionalized titania nanoparticles with a uniform particle size of ∼50 nm are formed and dispersed homogeneously in the SPEEK matrix with good interfacial compatibility. Accordingly, the nanohybrid membranes display remarkably enhanced proton conduction property due to the incorporation of additional sites for proton transport and the formation of well-connected channels by bridging the hydrophilic domains in SPEEK matrix. The nanohybrid membrane with 6 wt. % of phosphonic acid-functionalized titania nanoparticles exhibits the highest proton conductivity of 0.334 S cm-1 at 65 °C and 100% RH, which is 63.7% higher than that of pristine SPEEK membrane. Furthermore, the as-prepared nanohybrid membranes also show elevated thermal and mechanical stabilities as well as decreased methanol permeability.

  20. Directed polymers versus directed percolation

    Science.gov (United States)

    Halpin-Healy, Timothy

    1998-10-01

    Universality plays a central role within the rubric of modern statistical mechanics, wherein an insightful continuum formulation rises above irrelevant microscopic details, capturing essential scaling behaviors. Nevertheless, occasions do arise where the lattice or another discrete aspect can constitute a formidable legacy. Directed polymers in random media, along with its close sibling, directed percolation, provide an intriguing case in point. Indeed, the deep blood relation between these two models may have sabotaged past efforts to fully characterize the Kardar-Parisi-Zhang universality class, to which the directed polymer belongs.

  1. Meeting the future metro network challenges and requirements by adopting programmable S-BVT with direct-detection and PDM functionality

    Science.gov (United States)

    Nadal, Laia; Svaluto Moreolo, Michela; Fàbrega, Josep M.; Vílchez, F. Javier

    2017-07-01

    In this paper, we propose an advanced programmable sliceable-bandwidth variable transceiver (S-BVT) with polarization division multiplexing (PDM) capability as a key enabler to fulfill the requirements for future 5G networks. Thanks to its cost-effective optoelectronic front-end based on orthogonal frequency division multiplexing (OFDM) technology and direct-detection (DD), the proposed S-BVT becomes suitable for next generation highly flexible and scalable metro networks. Polarization beam splitters (PBSs) and controllers (PCs), available on-demand, are included at the transceivers and at the network nodes, further enhancing the system flexibility and promoting an efficient use of the spectrum. 40G-100G PDM transmission has been experimentally demonstrated, within a 4-node photonic mesh network (ADRENALINE testbed), implementing a simplified equalization process.

  2. Antibody fragments directed against different portions of the human neural cell adhesion molecule L1 act as inhibitors or activators of L1 function.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available The neural cell adhesion molecule L1 plays important roles in neuronal migration and survival, neuritogenesis and synaptogenesis. L1 has also been found in tumors of different origins, with levels of L1 expression correlating positively with the metastatic potential of tumors. To select antibodies targeting the varied functions of L1, we screened the Tomlinson library of recombinant human antibody fragments to identify antibodies binding to recombinant human L1 protein comprising the entire extracellular domain of human L1. We obtained four L1 binding single-chain variable fragment antibodies (scFvs, named I4, I6, I13, and I27 and showed by enzyme-linked immunosorbent assay (ELISA that scFvs I4 and I6 have high affinity to the immunoglobulin-like (Ig domains 1-4 of L1, while scFvs I13 and I27 bind strongly to the fibronectin type III homologous (Fn domains 1-3 of L1. Application of scFvs I4 and I6 to human SK-N-SH neuroblastoma cells reduced proliferation and transmigration of these cells. Treatment of SK-N-SH cells with scFvs I13 and I27 enhanced cell proliferation and migration, neurite outgrowth, and protected against the toxic effects of H(2O(2 by increasing the ratio of Bcl-2/Bax. In addition, scFvs I4 and I6 inhibited and scFvs I13 and I27 promoted phosphorylation of src and Erk. Our findings indicate that scFvs reacting with the immunoglobulin-like domains 1-4 inhibit L1 functions, whereas scFvs interacting with the fibronectin type III domains 1-3 trigger L1 functions of cultured neuroblastoma cells.

  3. Nickel-Catalyzed C–O Bond-Cleaving Alkylation of Esters: Direct Replacement of the Ester Moiety by Functionalized Alkyl Chains

    KAUST Repository

    Liu, Xiangqian; Jia, Jiaqi; Rueping, Magnus

    2017-01-01

    Two efficient protocols for the nickel-catalyzed aryl–alkyl cross-coupling reactions using esters as coupling components have been established. The methods enable the selective oxidative addition of nickel to acyl C–O and aryl C–O bonds and allow the aryl–alkyl cross-coupling via decarbonylative bond cleavage or through cleavage of a C–O bond with high efficiency and good functional group compatibility. The protocols allow the streamlined, unconventional utilization of widespread ester groups and their precursors, carboxylic acids and phenols, in synthetic organic chemistry.

  4. Nickel-Catalyzed C–O Bond-Cleaving Alkylation of Esters: Direct Replacement of the Ester Moiety by Functionalized Alkyl Chains

    KAUST Repository

    Liu, Xiangqian

    2017-06-07

    Two efficient protocols for the nickel-catalyzed aryl–alkyl cross-coupling reactions using esters as coupling components have been established. The methods enable the selective oxidative addition of nickel to acyl C–O and aryl C–O bonds and allow the aryl–alkyl cross-coupling via decarbonylative bond cleavage or through cleavage of a C–O bond with high efficiency and good functional group compatibility. The protocols allow the streamlined, unconventional utilization of widespread ester groups and their precursors, carboxylic acids and phenols, in synthetic organic chemistry.

  5. Direct Binding between Pre-S1 and TRP-like Domains in TRPP Channels Mediates Gating and Functional Regulation by PIP2.

    Science.gov (United States)

    Zheng, Wang; Cai, Ruiqi; Hofmann, Laura; Nesin, Vasyl; Hu, Qiaolin; Long, Wentong; Fatehi, Mohammad; Liu, Xiong; Hussein, Shaimaa; Kong, Tim; Li, Jingru; Light, Peter E; Tang, Jingfeng; Flockerzi, Veit; Tsiokas, Leonidas; Chen, Xing-Zhen

    2018-02-06

    Transient receptor potential (TRP) channels are regulated by diverse stimuli comprising thermal, chemical, and mechanical modalities. They are also commonly regulated by phosphatidylinositol-4,5-bisphosphate (PIP2), with underlying mechanisms largely unknown. We here revealed an intramolecular interaction of the TRPP3 N and C termini (N-C) that is functionally essential. The interaction was mediated by aromatic Trp81 in pre-S1 domain and cationic Lys568 in TRP-like domain. Structure-function analyses revealed similar N-C interaction in TRPP2 as well as TRPM8/-V1/-C4 via highly conserved tryptophan and lysine/arginine residues. PIP2 bound to cationic residues in TRPP3, including K568, thereby disrupting the N-C interaction and negatively regulating TRPP3. PIP2 had similar negative effects on TRPP2. Interestingly, we found that PIP2 facilitates the N-C interaction in TRPM8/-V1, resulting in channel potentiation. The intramolecular N-C interaction might represent a shared mechanism underlying the gating and PIP2 regulation of TRP channels. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Template-directed formation of functional complex metal-oxide nanostructures by combination of sol-gel processing and spin coating

    International Nuclear Information System (INIS)

    Choi, Y.C.; Kim, J.; Bu, S.D.

    2006-01-01

    We report the template-based formation of functional complex metal-oxide nanostructures by a combination of sol-gel processing and spin coating. This method employs the spin-coating of a sol-gel solution into an anodic aluminum oxide membrane (SSAM). Various metal-oxide nanowires and nanotubes with a high aspect-ratio were prepared. The aspect-ratios of the PbO 2 nanowires and Pb(Zr 0.52 Ti 0.48 )O 3 nanowires were about 300 and 400, respectively, and their diameters were about 50 nm. The fabricated PbTiO 3 nanotubes have a relatively constant wall thickness of about 20 nm with an outer diameter of about 60 nm. The deposition time for all of the fabricated metal-oxide nanowires and nanotubes is less than 120 s, which is far shorter than those required in both the sol-gel dipping and sol-gel electrophoretic methods. These results indicate that the SSAM method can be a versatile pathway to prepare functional complex metal-oxide nanowires and nanotubes with a high aspect-ratio. The possible formation process for the one-dimensional nanostructures by SSAM is discussed

  7. Direct Binding between Pre-S1 and TRP-like Domains in TRPP Channels Mediates Gating and Functional Regulation by PIP2

    Directory of Open Access Journals (Sweden)

    Wang Zheng

    2018-02-01

    Full Text Available Transient receptor potential (TRP channels are regulated by diverse stimuli comprising thermal, chemical, and mechanical modalities. They are also commonly regulated by phosphatidylinositol-4,5-bisphosphate (PIP2, with underlying mechanisms largely unknown. We here revealed an intramolecular interaction of the TRPP3 N and C termini (N-C that is functionally essential. The interaction was mediated by aromatic Trp81 in pre-S1 domain and cationic Lys568 in TRP-like domain. Structure-function analyses revealed similar N-C interaction in TRPP2 as well as TRPM8/-V1/-C4 via highly conserved tryptophan and lysine/arginine residues. PIP2 bound to cationic residues in TRPP3, including K568, thereby disrupting the N-C interaction and negatively regulating TRPP3. PIP2 had similar negative effects on TRPP2. Interestingly, we found that PIP2 facilitates the N-C interaction in TRPM8/-V1, resulting in channel potentiation. The intramolecular N-C interaction might represent a shared mechanism underlying the gating and PIP2 regulation of TRP channels.

  8. Arginine kinase in Toxocara canis: Exon-intron organization, functional analysis of site-directed mutants and evaluation of putative enzyme inhibitors.

    Science.gov (United States)

    Wickramasinghe, Susiji; Yatawara, Lalani; Nagataki, Mitsuru; Agatsuma, Takeshi

    2016-10-01

    To determine exon/intron organization of the Toxocara canis (T. canis) AK (TCAK) and to test green and black tea and several other chemicals against the activity of recombinant TCAK in the guanidino-specific region by site-directed mutants. Amplification of genomic DNA fragments containing introns was carried out by PCRs. The open-reading frame (1200 bp) of TCAK (wild type) was cloned into the BamH1/SalI site of pMAL-c2X. The maltose-binding protein-TCAK fusion protein was expressed in Escherichia coli TB1 cells. The purity of the expressed enzyme was verified by SDS-PAGE. Mutations were introduced into the guanidino-specific region and other areas of pMAL/TCAK by PCR. Enzyme activity was measured with an NADH-linked assay at 25 °C for the forward reaction (phosphagen synthesis). Arginine kinase in T. canis has a seven-exon/six-intron gene structure. The lengths of the introns ranged from 542 bp to 2 500 bp. All introns begin with gt and end with ag. Furthermore, we measured the enzyme activity of site-directed mutants of the recombinant TCAK. The K m value of the mutant (Alanine to Serine) decreased indicating a higher affinity for substrate arginine than the wild-type. The K m value of the mutant (Serine to Glycine) increased to 0.19 mM. The K m value (0.19 mM) of the double mutant (Alanine-Serine to Serine-Glycine) was slightly greater than in the wild-type (0.12 mM). In addition, several other chemicals were tested; including plant extract Azadiracta indica (A. indica), an aminoglycoside antibiotic (aminosidine), a citrus flavonoid glycoside (rutin) and a commercially available catechin mixture against TCAK. Green and black tea (1:10 dilution) produced 15% and 25% inhibition of TCAK, respectively. The extract of A. indica produced 5% inhibition of TCAK. Moreover, green and black tea produced a non-competitive type of inhibition and A. indica produced a mixed-type of inhibition on TCAK. Arginine kinase in T. canis has a seven-exon/six-intron gene

  9. Adenylyl cyclase-5 in the dorsal striatum function as a molecular switch for the generation of behavioral preferences for cue-directed food choices.

    Science.gov (United States)

    Kim, Hannah; Kim, Tae-Kyung; Kim, Ji-Eun; Park, Jin-Young; Lee, Yunjin; Kang, Minkyung; Kim, Kyoung-Shim; Han, Pyung-Lim

    2014-11-07

    Behavioral choices in habits and innate behaviors occur automatically in the absence of conscious selection. These behaviors are not easily modified by learning. Similar types of behaviors also occur in various mental illnesses including drug addiction, obsessive-compulsive disorder, schizophrenia, and autism. However, underlying mechanisms are not clearly understood. In the present study, we investigated the molecular mechanisms regulating unconditioned preferred behaviors in food-choices. Mice lacking adenylyl cyclase-5 (AC5 KO mice), which is preferentially expressed in the dorsal striatum, consumed food pellets nearly one after another in cages. AC5 KO mice showed aversive behaviors to bitter tasting quinine, but they compulsively chose quinine-containing AC5 KO-pellets over fresh pellets. The unusual food-choice behaviors in AC5 KO mice were due to the gain of behavioral preferences for food pellets containing an olfactory cue, which wild-type mice normally ignored. Such food-choice behaviors in AC5 KO mice disappeared when whiskers were trimmed. Conversely, whisker trimming in wildtype mice induced behavioral preferences for AC5 KO food pellets, indicating that preferred food-choices were not learned through prior experience. Both AC5 KO mice and wildtype mice with trimmed whiskers had increased glutamatergic input from the barrel cortex into the dorsal striatum, resulting in an increase in the mGluR1-dependent signaling cascade. The siRNA-mediated inhibition of mGluR1 in the dorsal striatum in AC5 KO mice and wildtype mice with trimmed whiskers abolished preferred choices for AC5 KO food pellets, whereas siRNA-mediated inhibition of mGluR3 glutamate receptors in the dorsal striatum in wildtype mice induced behavioral preferences for AC5 KO food pellets, thus mimicking AC5 KO phenotypes. Our results show that the gain and loss of behavioral preferences for a specific cue-directed option were regulated by specific cellular factors in the dorsal striatum, such

  10. Direct marketing

    Directory of Open Access Journals (Sweden)

    Čičić Muris

    2002-01-01

    Full Text Available Direct Marketing (DM is usually treated as unworthy activity, with actions at the edge of legality and activities minded cheating. Despite obvious problems regarding ethics and privacy threat, DM with its size, importance and role in a concept of integrated marketing communication deserves respect and sufficient analysis and review

  11. Plant functional types in Earth system models: past experiences and future directions for application of dynamic vegetation models in high-latitude ecosystems.

    Science.gov (United States)

    Wullschleger, Stan D; Epstein, Howard E; Box, Elgene O; Euskirchen, Eugénie S; Goswami, Santonu; Iversen, Colleen M; Kattge, Jens; Norby, Richard J; van Bodegom, Peter M; Xu, Xiaofeng

    2014-07-01

    Earth system models describe the physical, chemical and biological processes that govern our global climate. While it is difficult to single out one component as being more important than another in these sophisticated models, terrestrial vegetation is a critical player in the biogeochemical and biophysical dynamics of the Earth system. There is much debate, however, as to how plant diversity and function should be represented in these models. Plant functional types (PFTs) have been adopted by modellers to represent broad groupings of plant species that share similar characteristics (e.g. growth form) and roles (e.g. photosynthetic pathway) in ecosystem function. In this review, the PFT concept is traced from its origin in the early 1800s to its current use in regional and global dynamic vegetation models (DVMs). Special attention is given to the representation and parameterization of PFTs and to validation and benchmarking of predicted patterns of vegetation distribution in high-latitude ecosystems. These ecosystems are sensitive to changing climate and thus provide a useful test case for model-based simulations of past, current and future distribution of vegetation. Models that incorporate the PFT concept predict many of the emerging patterns of vegetation change in tundra and boreal forests, given known processes of tree mortality, treeline migration and shrub expansion. However, representation of above- and especially below-ground traits for specific PFTs continues to be problematic. Potential solutions include developing trait databases and replacing fixed parameters for PFTs with formulations based on trait co-variance and empirical trait-environment relationships. Surprisingly, despite being important to land-atmosphere interactions of carbon, water and energy, PFTs such as moss and lichen are largely absent from DVMs. Close collaboration among those involved in modelling with the disciplines of taxonomy, biogeography, ecology and remote sensing will be

  12. Functional electrical stimulation and ankle foot orthoses provide equivalent therapeutic effects on foot drop: A meta-analysis providing direction for future research

    Directory of Open Access Journals (Sweden)

    Sarah Prenton

    2017-10-01

    Full Text Available Objective: To compare the randomized controlled trial evidence for therapeutic effects on walking of functional electrical stimulation and ankle foot orthoses for foot drop caused by central nervous system conditions. Data sources: MEDLINE, CINAHL, Cochrane Central Register of Controlled Trials, REHABDATA, PEDro, NIHR Centre for Reviews and Dissemination, Scopus and clinicaltrials.gov. Study selection: One reviewer screened titles/abstracts. Two independent reviewers then screened the full articles. Data extraction: One reviewer extracted data, another screened for accuracy. Risk of bias was assessed by 2 independent reviewers using the Cochrane Risk of Bias Tool. Data synthesis: Eight papers were eligible; 7 involving participants with stroke and 1 involving participants with cerebral palsy. Two papes reporting different measures from the same trial were grouped, resulting in 7 synthesized randomized controlled trials (n= 464. Meta-analysis of walking speed at final assessment (p = 0.46, for stroke participants (p = 0.54 and after 4–6 weeks’ use (p = 0.49 showed equal improvement for both devices. Conclusion: Functional electrical stimulation and ankle foot orthoses have an equally positive therapeutic effect on walking speed in non-progressive central nervous system diagnoses. The current randomized controlled trial evidence base does not show whether this improvement translates into the user’s own environment or reveal the mechanisms that achieve that change. Future studies should focus on measuring activity, muscle activity and gait kinematics. They should also report specific device details, capture sustained therapeutic effects and involve a variety of central nervous system diagnoses.

  13. Dual function of Lactobacillus kefiri DH5 in preventing high-fat-diet-induced obesity: direct reduction of cholesterol and upregulation of PPAR-α in adipose tissue.

    Science.gov (United States)

    Kim, Dong-Hyeon; Jeong, Dana; Kang, Il-Byeong; Kim, Hyunsook; Song, Kwang-Young; Seo, Kun-Ho

    2017-11-01

    Kefir consumption inhibits the development of obesity and non-alcoholic fatty liver disease (NALFD) in mice fed 60% high-fat diet (HFD). To identify the key contributor of this effect, we isolated lactic acid bacteria (LAB) from kefir and examined their anti-obesity properties from in vitro screening and in vivo validation. Thirteen kefir LAB isolates were subjected to survivability test using artificial gastrointestinal environment and cholesterol-reducing assay. Lactobacillus kefiri DH5 showed 100% survivability in gastrointestinal environments and reduced 51.6% of cholesterol; thus, this strain was selected for in vivo experiment. Compared to the HFD-saline group, the HFD-DH5 group showed significantly lower body weight (34.68 versus 31.10 g; p kefiri DH5 administration significantly modulated gut microbiota of HFD-fed mice. The hepatic steatosis was significantly milder (Lesion score, 2.1 versus 1.2; p kefiri DH5 upregulated PPAR-α, FABP4, and CPT1 expression in the epididymal adipose tissues (2.29-, 1.77-, and 2.05-fold change, respectively), suggesting a reduction in adiposity by stimulating fatty acid oxidation. L. kefiri DH5 exerts anti-obesity effects by direct reduction of cholesterol in the lumen and upregulation of PPAR-α gene in adipose tissues. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Mouse Mammary Tumor Virus Promoter-Containing Retroviral Promoter Conversion Vectors for Gene-Directed Enzyme Prodrug Therapy are Functional in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Reinhard Klein

    2008-01-01

    Full Text Available Gene directed-enzyme prodrug therapy (GDEPT is an approach for sensitization of tumor cells to an enzymatically activated, otherwise nontoxic, prodrug. Cytochrome P450 2B1 (CYP2B1 metabolizes the prodrugs cyclophosphamide (CPA and ifosfamide (IFA to produce the cytotoxic substances phosphoramide mustard and isophosphoramide mustard as well as the byproduct acrolein. We have constructed a retroviral promoter conversion (ProCon vector for breast cancer GDEPT. The vector allows expression of CYP2B1 from the mouse mammary tumor virus (MMTV promoter known to be active in the mammary glands of transgenic animals. It is anticipated to be used for the generation of encapsulated viral vector producing cells which, when placed inside or close to a tumor, will act as suppliers of the therapeutic CYP2B1 protein as well as of the therapeutic vector itself. The generated vector was effectively packaged by virus producing cells and allowed the production of high levels of enzymatically active CYP2B1 in infected cells which sensitized them to killing upon treatment with both IFA and CPA. Determination of the respective IC50 values demonstrated that the effective IFA dose was reduced by sixteen folds. Infection efficiencies in vivo were determined using a reporter gene-bearing vector in a mammary cancer cell-derived xenograft tumor mouse model.

  15. The influence of oscillating electromagnetic fields on membrane structure and function: Synthetic liposome and natural membrane bilayer systems with direct application to the controlled delivery of chemical agents

    International Nuclear Information System (INIS)

    Liburdy, R.P.; de Manincor, D.; Fingado, B.

    1989-09-01

    Investigations have been conducted to determine if an imposed electromagnetic field can influence membrane transport, and ion and drug permeability in both synthetic and natural cell membrane systems. Microwave fields enhance accumulation of sodium in the lymphocyte and induce protein shedding at Tc. Microwaves also trigger membrane permeability of liposome systems under specific field exposure conditions. Sensitivity varies in a defined way in bilayers displaying a membrane structural phase transition temperature, Tc; maximal release was observed at or near Tc. Significantly, liposome systems without a membrane phase transition were also found to experience permeability increases but, in contrast, this response was temperature independent. The above results indicate that field-enhanced drug release occurs in liposome vesicles that possess a Tc as well as non-Tc liposomes. Additional studies extend non-Tc liposome responses to the in vivo case in which microwaves trigger Gentamicin release from a liposome ''depot'' placed subcutaneously in the rat hind leg. In addition, evidence is provided that cell surface sequestered liposomes can be triggered by microwave fields to release drugs directly into target cells. 24 refs., 6 figs

  16. Targeting interleukin-11 receptor in leukemia and lymphoma: A functional ligand-directed study and hematopathology analysis of patient-derived specimens

    Science.gov (United States)

    Karjalainen, Katja; Jaalouk, Diana E.; Bueso-Ramos, Carlos; Bover, Laura; Sun, Yan; Kuniyasu, Akihiko; Driessen, Wouter H. P.; Cardó-Vila, Marina; Rietz, Cecilia; Zurita, Amado J.; O’Brien, Susan; Kantarjian, Hagop M.; Cortes, Jorge E.; Calin, George A.; Koivunen, Erkki; Arap, Wadih; Pasqualini, Renata

    2015-01-01

    Purpose The interleukin-11 receptor (IL-11R) is an established molecular target in primary tumors of bone, such as osteosarcoma, and in secondary bone metastases from solid tumors such as prostate cancer. However, its potential role in management of hematopoietic malignancies has not yet been determined. Here we evaluated the IL-11R as a candidate therapeutic target in human leukemia and lymphoma. Experimental Design and Results First, we show that the IL-11R protein is expressed in a variety of human leukemia- and lymphoma derived cell lines and in a large panel of bone marrow samples from leukemia and lymphoma patients, while expression is absent from non-malignant control bone marrow. Moreover, a targeted peptidomimetic prototype (termed BMTP-11) specifically bound to leukemia and lymphoma cell membranes, induced ligand-receptor internalization mediated by the IL-11R, and resulted in a specific dose-dependent cell death induction in these cells. Finally, a pilot drug lead-optimization program yielded a new myristoylated BMTP-11 analog with an apparent improved anti-leukemia cell profile. Conclusion These results indicate (i) that the IL-11R is a suitable cell surface target for ligand-directed applications in human leukemia and lymphoma and (ii) that BMTP-11 and its derivatives have translational potential against this group of malignant diseases. PMID:25779950

  17. Targeting IL11 Receptor in Leukemia and Lymphoma: A Functional Ligand-Directed Study and Hematopathology Analysis of Patient-Derived Specimens.

    Science.gov (United States)

    Karjalainen, Katja; Jaalouk, Diana E; Bueso-Ramos, Carlos; Bover, Laura; Sun, Yan; Kuniyasu, Akihiko; Driessen, Wouter H P; Cardó-Vila, Marina; Rietz, Cecilia; Zurita, Amado J; O'Brien, Susan; Kantarjian, Hagop M; Cortes, Jorge E; Calin, George A; Koivunen, Erkki; Arap, Wadih; Pasqualini, Renata

    2015-07-01

    The IL11 receptor (IL11R) is an established molecular target in primary tumors of bone, such as osteosarcoma, and in secondary bone metastases from solid tumors, such as prostate cancer. However, its potential role in management of hematopoietic malignancies has not yet been determined. Here, we evaluated the IL11R as a candidate therapeutic target in human leukemia and lymphoma. First, we show that the IL11R protein is expressed in a variety of human leukemia- and lymphoma-derived cell lines and in a large panel of bone marrow samples from leukemia and lymphoma patients, whereas expression is absent from nonmalignant control bone marrow. Moreover, a targeted peptidomimetic prototype (termed BMTP-11), specifically bound to leukemia and lymphoma cell membranes, induced ligand-receptor internalization mediated by the IL11R, and resulted in a specific dose-dependent cell death induction in these cells. Finally, a pilot drug lead-optimization program yielded a new myristoylated BMTP-11 analogue with an apparent improved antileukemia cell profile. These results indicate (i) that the IL11R is a suitable cell surface target for ligand-directed applications in human leukemia and lymphoma and (ii) that BMTP-11 and its derivatives have translational potential against this group of malignant diseases. ©2015 American Association for Cancer Research.

  18. Mechanism of adenylate kinase. Demonstration of a functional relationship between aspartate 93 and Mg2+ by site-directed mutagenesis and proton, phosphorus-31, and magnesium-25 NMR

    International Nuclear Information System (INIS)

    Yan, Honggao; Tsai, Mingdaw

    1991-01-01

    Earlier magnetic resonance studies suggested no direct interaction between Mg 2+ ions and adenylate kinase (AK) in the AK·MgATP (adenosine 5'-triphosphate) complex. However, recent NMR studies concluded that the carboxylate of aspartate 119 accepts a hydrogen bond from a water ligand of the bound Mg 2+ ion in the muscle AK · MgATP complex. On the other hand, in the 2.6-angstrom crystal structure of the yeast AK·MgAP 5 A [P 1 , P 5 -bis(5'-adenosyl)pentaphosphate] complex, the Mg 2+ ion is in proximity to aspartate 93. Substitution of Asp-93 with alanine resulted in no change in dissociation constants, 4-fold increases in K m , and a 650-fold decrease in k cat . Notable changes have been observed in the chemical shifts of the aromatic protons of histidine 36 and a few other aromatic residues. However, the results of detailed analyses of the free enzymes and the AK·MgAP 5 A complexes by one- and two-dimensional NMR suggested that the changes are due to localized perturbations. Thus it is concluded that Asp-93 stabilizes the transition state by ca. 3.9 kcal/mol. Other results raised the question of whether Mg 2+ could bind to D93A·nucleotide complexes, which was then probed by 25 MgNMR. The results suggest that Mg 2+ does bind to the D93A·AP 5 A complex, but possibly only weakly

  19. Pharmacological and functional characterisation of the wild-type and site-directed mutants of the human H1 histamine receptor stably expressed in CHO cells.

    Science.gov (United States)

    Moguilevsky, N; Varsalona, F; Guillaume, J P; Noyer, M; Gillard, M; Daliers, J; Henichart, J P; Bollen, A

    1995-01-01

    A cDNA clone for the human histamine H1 receptor was isolated from a lung cDNA library and stably expressed in CHO cells. The recombinant receptor protein present in the cell membranes, displayed the functional and binding characteristics of histamine H1 receptors. Mutation of Ser155 to Ala in the fourth transmembrane domain did not significantly change the affinity of the receptor for histamine and H1 antagonists. However, mutation of the fifth transmembrane Asn198 to Ala resulted in a dramatic decrease of the affinity for histamine binding, and for the histamine-induced polyphosphoinositides breakdown, whereas the affinity towards antagonists was not significantly modified. In addition, mutation of another fifth transmembrane amino acid, Thr194 to Ala also diminished, but to a lesser extent, the affinity for histamine. These data led us to propose a molecular model for histamine interaction with the human H1 receptor. In this model, the amide moiety of Asn198 and the hydroxyl group of Thr194 are involved in hydrogen bonding with the nitrogen atoms of the imidazole ring of histamine. Moreover, mutation of Thr194 to Ala demonstrated that this residue is responsible for the discrimination between enantiomers of cetirizine.

  20. Effect of the co-spun anode functional layer on the performance of the direct-methane microtubular solid oxide fuel cells

    Science.gov (United States)

    Meng, Xiuxia; Gong, Xun; Yin, Yimei; Yang, Naitao; Tan, Xiaoyao; Ma, Zi-Feng

    2014-02-01

    NiO-YSZ/porous YSZ (NiO-YSZ/p-YSZ) dual-layer hollow fibers have been fabricated by a co-spinning-sintering method, on which a dense YSZ films has been formed by a dip-coating and sintering process. A LSM-YSZ ink has been dip-coated on the dense YSZ films as cathode, while the Cu-CeO2 carbon-resistant catalyst has been impregnated in the p-YSZ layer to form double-anode supported micro tubular fuel cells (MT-SOFCs). The thickness of the Ni-YSZ layer, so called anode functional layer (AFL), is controlled from 74 μm to 13 μm by varying the spinning rates of the NiO-YSZ dopes. The maximum power density of an MT-SOFC, which is fabricated based on a thin co-spun AFL, reaches 566 mW cm-2 operated at 850 °C fed with dry methane, and is stably operated for 85 h without power declination.

  1. Direct laser metal sintering as a new approach to fabrication of an isoelastic functionally graded material for manufacture of porous titanium dental implants.

    Science.gov (United States)

    Traini, T; Mangano, C; Sammons, R L; Mangano, F; Macchi, A; Piattelli, A

    2008-11-01

    This work focuses on a titanium alloy implants incorporating a gradient of porosity, from the inner core to the outer surface, obtained by laser sintering of metal powder. Surface appearance, microstructure, composition, mechanical properties and fractography were evaluated. All the specimens were prepared by a selective laser sintering procedure using a Ti-6Al-4V alloy powder with a particle size of 1-10 microm. The morphological and chemical analyses were performed by SEM and energy dispersive X-ray spectroscopy. The flexure strength was determined by a three-point bend test using a universal testing machine. The surface roughness was investigated using a confocal scanning laser microscope. The surface roughness variation was statistically evaluated by use of a Chi square test. A p value of metal core consisted of columnar beta grains with alpha and beta laths within the grains. The alloy was composed of 90.08% Ti, 5.67% Al and 4.25% V. The Young's modulus of the inner core material was 104+/-7.7 GPa; while that of the outer porous material was 77+/-3.5 GPa. The fracture face showed a dimpled appearance typical of ductile fracture. In conclusion, laser metal sintering proved to be an efficient means of construction of dental implants with a functionally graded material which is better adapted to the elastic properties of the bone. Such implants should minimize stress shielding effects and improve long-term performance.

  2. First-year university Physics students’ knowledge about direct current circuits: probing improvement in understanding as a function of teaching and learning interventions

    Science.gov (United States)

    Newman, Richard; van der Ventel, Brandon; Hanekom, Crischelle

    2017-07-01

    Probing university students’ understanding of direct-current (DC) resistive circuits is still a field of active physics education research. We report here on a study we conducted of this understanding, where the cohort consisted of students in a large-enrollment first-year physics module. This is a non-calculus based physics module for students in the life sciences stream. The study involved 366 students enrolled in the physics (bio) 154 module at Stellenbosch University in 2015. Students’ understanding of DC resistive circuits was probed by means of a standardized test instrument. The instrument comprises 29 multiple choice questions that students have to answer in ~40 min. Students were required to first complete the standardized test at the start of semester (July 2015). For ease of reference we call this test the pre-test. Students answered the pre-test having no university-level formal exposure to DC circuits in theory or practice. The pre-test therefore served to probe students’ school level knowledge of DC circuits. As the sem