WorldWideScience

Sample records for directs metavinculin functions

  1. Directional output distance functions: endogenous directions based on exogenous normalization constraints

    Science.gov (United States)

    In this paper we develop a model for computing directional output distance functions with endogenously determined direction vectors. We show how this model is related to the slacks-based directional distance function introduced by Fare and Grosskopf and show how to use the slacks-based function to e...

  2. Directional outlyingness for multivariate functional data

    KAUST Repository

    Dai, Wenlin; Genton, Marc G.

    2018-01-01

    The direction of outlyingness is crucial to describing the centrality of multivariate functional data. Motivated by this idea, classical depth is generalized to directional outlyingness for functional data. Theoretical properties of functional

  3. Directional outlyingness for multivariate functional data

    KAUST Repository

    Dai, Wenlin

    2018-04-07

    The direction of outlyingness is crucial to describing the centrality of multivariate functional data. Motivated by this idea, classical depth is generalized to directional outlyingness for functional data. Theoretical properties of functional directional outlyingness are investigated and the total outlyingness can be naturally decomposed into two parts: magnitude outlyingness and shape outlyingness which represent the centrality of a curve for magnitude and shape, respectively. This decomposition serves as a visualization tool for the centrality of curves. Furthermore, an outlier detection procedure is proposed based on functional directional outlyingness. This criterion applies to both univariate and multivariate curves and simulation studies show that it outperforms competing methods. Weather and electrocardiogram data demonstrate the practical application of our proposed framework.

  4. Empirical validation of directed functional connectivity.

    Science.gov (United States)

    Mill, Ravi D; Bagic, Anto; Bostan, Andreea; Schneider, Walter; Cole, Michael W

    2017-02-01

    Mapping directions of influence in the human brain connectome represents the next phase in understanding its functional architecture. However, a host of methodological uncertainties have impeded the application of directed connectivity methods, which have primarily been validated via "ground truth" connectivity patterns embedded in simulated functional MRI (fMRI) and magneto-/electro-encephalography (MEG/EEG) datasets. Such simulations rely on many generative assumptions, and we hence utilized a different strategy involving empirical data in which a ground truth directed connectivity pattern could be anticipated with confidence. Specifically, we exploited the established "sensory reactivation" effect in episodic memory, in which retrieval of sensory information reactivates regions involved in perceiving that sensory modality. Subjects performed a paired associate task in separate fMRI and MEG sessions, in which a ground truth reversal in directed connectivity between auditory and visual sensory regions was instantiated across task conditions. This directed connectivity reversal was successfully recovered across different algorithms, including Granger causality and Bayes network (IMAGES) approaches, and across fMRI ("raw" and deconvolved) and source-modeled MEG. These results extend simulation studies of directed connectivity, and offer practical guidelines for the use of such methods in clarifying causal mechanisms of neural processing. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Comparative study on spreading function for directional wave spectra

    Digital Repository Service at National Institute of Oceanography (India)

    Bhat, S.S.; Anand, N.M.; Nayak, B.U.

    -dimensional wave energy S(f) and the directional spreading function D(f, theta). This paper reviews various spreading functions proposed in the past for estimating the directional wave energy and presents their application to the Indian wave condition. It is found...

  6. Ligand-accelerated non-directed C-H functionalization of arenes

    Science.gov (United States)

    Wang, Peng; Verma, Pritha; Xia, Guoqin; Shi, Jun; Qiao, Jennifer X.; Tao, Shiwei; Cheng, Peter T. W.; Poss, Michael A.; Farmer, Marcus E.; Yeung, Kap-Sun; Yu, Jin-Quan

    2017-11-01

    The directed activation of carbon-hydrogen bonds (C-H) is important in the development of synthetically useful reactions, owing to the proximity-induced reactivity and selectivity that is enabled by coordinating functional groups. Palladium-catalysed non-directed C-H activation could potentially enable further useful reactions, because it can reach more distant sites and be applied to substrates that do not contain appropriate directing groups; however, its development has faced substantial challenges associated with the lack of sufficiently active palladium catalysts. Currently used palladium catalysts are reactive only with electron-rich arenes, unless an excess of arene is used, which limits synthetic applications. Here we report a 2-pyridone ligand that binds to palladium and accelerates non-directed C-H functionalization with arene as the limiting reagent. This protocol is compatible with a broad range of aromatic substrates and we demonstrate direct functionalization of advanced synthetic intermediates, drug molecules and natural products that cannot be used in excessive quantities. We also developed C-H olefination and carboxylation protocols, demonstrating the applicability of our methodology to other transformations. The site selectivity in these transformations is governed by a combination of steric and electronic effects, with the pyridone ligand enhancing the influence of sterics on the selectivity, thus providing complementary selectivity to directed C-H functionalization.

  7. Developing Self-Directed Executive Functioning: Recent Findings and Future Directions

    Science.gov (United States)

    Barker, Jane E.; Munakata, Yuko

    2015-01-01

    How do children become increasingly self-directed across development, achieving their goals without help from others? How might such developments be impacted by societal changes in how children spend their time? Children's abilities to achieve their goals are supported by developing executive functions (EFs), cognitive processes that predict…

  8. Lifetime information from correlation functions selected by directional cuts

    International Nuclear Information System (INIS)

    Gelbke, C.K.

    1995-01-01

    Two-particle correlation functions provide information on the space-time characteristics of the emitting source. In many cases, ambiguities of the relative magnitudes of source radius and lifetime can be reduced by analysis of correlation functions evaluated for specific directional cuts on the relative velocity of the coincident particle pair. Information on non-spherical breakup geometries is more difficult to extract. Examples of two-proton correlation functions in which directional cuts are employed to reduce existing space-time ambiguities for the emitting system are presented. (author). 50 refs., 10 figs

  9. Pd(II)-Catalyzed C–H Functionalizations Directed by Distal Weakly Coordinating Functional Groups

    Science.gov (United States)

    Li, Gang; Wan, Li; Zhang, Guofu; Leow, Dasheng; Spangler, Jillian

    2015-01-01

    Ortho-C(sp2)–H olefination and acetoxylation of broadly useful synthetic building blocks phenylacetyl Weinreb amides, esters, and ketones are developed without installing an additional directing group. The interplay between the distal weak coordination and the ligand-acceleration is crucial for these reactions to proceed under mild conditions. The tolerance of longer distance between the target C–H bonds and the directing functional groups also allows for the functionalizations of more distal C–H bonds in hydrocinnamoyl ketones, Weinreb amides and biphenyl Weinreb amides. Mechanistically, the coordination of these carbonyl groups and the bisdentate amino acid ligand with Pd(II) centers provides further evidence for our early hypothesis that the carbonyl groups of the potassium carboxylate is responsible for the directed C–H activation of carboxylic acids. PMID:25768039

  10. A Scale Elasticity Measure for Directional Distance Function and its Dual

    OpenAIRE

    Valentin Zelenyuk

    2011-01-01

    In this paper we introduce a scale elasticity measure based on directional distance function for multi-output-multi-input technologies and explore its fundamental properties. Specifically, we derive necessary and sufficient condition for equivalence of the scale elasticity measure based on the directional distance function with the input oriented and output oriented scale elasticity measures. We also establish duality relationship between the scale elasticity measure based on the directional ...

  11. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Mahayni, Malek A.

    2011-07-01

    Finding optimal paths in directed graphs is a wide area of research that has received much of attention in theoretical computer science due to its importance in many applications (e.g., computer networks and road maps). Many algorithms have been developed to solve the optimal paths problem with different kinds of graphs. An algorithm that solves the problem of paths’ optimization in directed graphs relative to different cost functions is described in [1]. It follows an approach extended from the dynamic programming approach as it solves the problem sequentially and works on directed graphs with positive weights and no loop edges. The aim of this thesis is to implement and evaluate that algorithm to find the optimal paths in directed graphs relative to two different cost functions ( , ). A possible interpretation of a directed graph is a network of roads so the weights for the function represent the length of roads, whereas the weights for the function represent a constraint of the width or weight of a vehicle. The optimization aim for those two functions is to minimize the cost relative to the function and maximize the constraint value associated with the function. This thesis also includes finding and proving the relation between the two different cost functions ( , ). When given a value of one function, we can find the best possible value for the other function. This relation is proven theoretically and also implemented and experimented using Matlab®[2].

  12. Less-structured time in children's daily lives predicts self-directed executive functioning.

    Science.gov (United States)

    Barker, Jane E; Semenov, Andrei D; Michaelson, Laura; Provan, Lindsay S; Snyder, Hannah R; Munakata, Yuko

    2014-01-01

    Executive functions (EFs) in childhood predict important life outcomes. Thus, there is great interest in attempts to improve EFs early in life. Many interventions are led by trained adults, including structured training activities in the lab, and less-structured activities implemented in schools. Such programs have yielded gains in children's externally-driven executive functioning, where they are instructed on what goal-directed actions to carry out and when. However, it is less clear how children's experiences relate to their development of self-directed executive functioning, where they must determine on their own what goal-directed actions to carry out and when. We hypothesized that time spent in less-structured activities would give children opportunities to practice self-directed executive functioning, and lead to benefits. To investigate this possibility, we collected information from parents about their 6-7 year-old children's daily, annual, and typical schedules. We categorized children's activities as "structured" or "less-structured" based on categorization schemes from prior studies on child leisure time use. We assessed children's self-directed executive functioning using a well-established verbal fluency task, in which children generate members of a category and can decide on their own when to switch from one subcategory to another. The more time that children spent in less-structured activities, the better their self-directed executive functioning. The opposite was true of structured activities, which predicted poorer self-directed executive functioning. These relationships were robust (holding across increasingly strict classifications of structured and less-structured time) and specific (time use did not predict externally-driven executive functioning). We discuss implications, caveats, and ways in which potential interpretations can be distinguished in future work, to advance an understanding of this fundamental aspect of growing up.

  13. Functional Behavior Assessment in Schools: Current Status and Future Directions

    Science.gov (United States)

    Anderson, Cynthia M.; Rodriguez, Billie Jo; Campbell, Amy

    2015-01-01

    Functional behavior assessment is becoming a commonly used practice in school settings. Accompanying this growth has been an increase in research on functional behavior assessment. We reviewed the extant literature on documenting indirect and direct methods of functional behavior assessment in school settings. To discern best practice guidelines…

  14. Stimulating thought: a functional MRI study of transcranial direct current stimulation in schizophrenia.

    Science.gov (United States)

    Orlov, Natasza D; O'Daly, Owen; Tracy, Derek K; Daniju, Yusuf; Hodsoll, John; Valdearenas, Lorena; Rothwell, John; Shergill, Sukhi S

    2017-09-01

    Individuals with schizophrenia typically suffer a range of cognitive deficits, including prominent deficits in working memory and executive function. These difficulties are strongly predictive of functional outcomes, but there is a paucity of effective therapeutic interventions targeting these deficits. Transcranial direct current stimulation is a novel neuromodulatory technique with emerging evidence of potential pro-cognitive effects; however, there is limited understanding of its mechanism. This was a double-blind randomized sham controlled pilot study of transcranial direct current stimulation on a working memory (n-back) and executive function (Stroop) task in 28 individuals with schizophrenia using functional magnetic resonance imaging. Study participants received 30 min of real or sham transcranial direct current stimulation applied to the left frontal cortex. The 'real' and 'sham' groups did not differ in online working memory task performance, but the transcranial direct current stimulation group demonstrated significant improvement in performance at 24 h post-transcranial direct current stimulation. Transcranial direct current stimulation was associated with increased activation in the medial frontal cortex beneath the anode; showing a positive correlation with consolidated working memory performance 24 h post-stimulation. There was reduced activation in the left cerebellum in the transcranial direct current stimulation group, with no change in the middle frontal gyrus or parietal cortices. Improved performance on the executive function task was associated with reduced activity in the anterior cingulate cortex. Transcranial direct current stimulation modulated functional activation in local task-related regions, and in more distal nodes in the network. Transcranial direct current stimulation offers a potential novel approach to altering frontal cortical activity and exerting pro-cognitive effects in schizophrenia. © The Author (2017). Published by Oxford

  15. Application of Patterson-function direct methods to materials characterization.

    Science.gov (United States)

    Rius, Jordi

    2014-09-01

    The aim of this article is a general description of the so-called Patterson-function direct methods (PFDM), from their origin to their present state. It covers a 20-year period of methodological contributions to crystal structure solution, most of them published in Acta Crystallographica Section A. The common feature of these variants of direct methods is the introduction of the experimental intensities in the form of the Fourier coefficients of origin-free Patterson-type functions, which allows the active use of both strong and weak reflections. The different optimization algorithms are discussed and their performances compared. This review focuses not only on those PFDM applications related to powder diffraction data but also on some recent results obtained with electron diffraction tomography data.

  16. Application of Patterson-function direct methods to materials characterization

    Directory of Open Access Journals (Sweden)

    Jordi Rius

    2014-09-01

    Full Text Available The aim of this article is a general description of the so-called Patterson-function direct methods (PFDM, from their origin to their present state. It covers a 20-year period of methodological contributions to crystal structure solution, most of them published in Acta Crystallographica Section A. The common feature of these variants of direct methods is the introduction of the experimental intensities in the form of the Fourier coefficients of origin-free Patterson-type functions, which allows the active use of both strong and weak reflections. The different optimization algorithms are discussed and their performances compared. This review focuses not only on those PFDM applications related to powder diffraction data but also on some recent results obtained with electron diffraction tomography data.

  17. Directional resolution of head-related transfer functions required in binaural synthesis

    DEFF Research Database (Denmark)

    Minnaar, Pauli; Plogsties, Jan; Christensen, Flemming

    2005-01-01

    In binaural synthesis a virtual sound source is implemented by convolving an anechoic signal with a pair of head-related transfer functions (HRTFs). In order to represent all possible directions of the sound source with respect to the listener a discrete number of HRTFs are measured and interpola......In binaural synthesis a virtual sound source is implemented by convolving an anechoic signal with a pair of head-related transfer functions (HRTFs). In order to represent all possible directions of the sound source with respect to the listener a discrete number of HRTFs are measured...... and moving sound sources. A criterion was found that predicts the experimental results. This criterion was used to estimate the directional resolution required in binaural synthesis for all directions on the sphere around the head....

  18. Driving and driven architectures of directed small-world human brain functional networks.

    Directory of Open Access Journals (Sweden)

    Chaogan Yan

    Full Text Available Recently, increasing attention has been focused on the investigation of the human brain connectome that describes the patterns of structural and functional connectivity networks of the human brain. Many studies of the human connectome have demonstrated that the brain network follows a small-world topology with an intrinsically cohesive modular structure and includes several network hubs in the medial parietal regions. However, most of these studies have only focused on undirected connections between regions in which the directions of information flow are not taken into account. How the brain regions causally influence each other and how the directed network of human brain is topologically organized remain largely unknown. Here, we applied linear multivariate Granger causality analysis (GCA and graph theoretical approaches to a resting-state functional MRI dataset with a large cohort of young healthy participants (n = 86 to explore connectivity patterns of the population-based whole-brain functional directed network. This directed brain network exhibited prominent small-world properties, which obviously improved previous results of functional MRI studies showing weak small-world properties in the directed brain networks in terms of a kernel-based GCA and individual analysis. This brain network also showed significant modular structures associated with 5 well known subsystems: fronto-parietal, visual, paralimbic/limbic, subcortical and primary systems. Importantly, we identified several driving hubs predominantly located in the components of the attentional network (e.g., the inferior frontal gyrus, supplementary motor area, insula and fusiform gyrus and several driven hubs predominantly located in the components of the default mode network (e.g., the precuneus, posterior cingulate gyrus, medial prefrontal cortex and inferior parietal lobule. Further split-half analyses indicated that our results were highly reproducible between two

  19. Direct Capture of Functional Proteins from Mammalian Plasma Membranes into Nanodiscs.

    Science.gov (United States)

    Roy, Jahnabi; Pondenis, Holly; Fan, Timothy M; Das, Aditi

    2015-10-20

    Mammalian plasma membrane proteins make up the largest class of drug targets yet are difficult to study in a cell free system because of their intransigent nature. Herein, we perform direct encapsulation of plasma membrane proteins derived from mammalian cells into a functional nanodisc library. Peptide fingerprinting was used to analyze the proteome of the incorporated proteins in nanodiscs and to further demonstrate that the lipid composition of the nanodiscs directly affects the class of protein that is incorporated. Furthermore, the functionality of the incorporated membrane proteome was evaluated by measuring the activity of membrane proteins: Na(+)/K(+)-ATPase and receptor tyrosine kinases. This work is the first report of the successful establishment and characterization of a cell free functional library of mammalian membrane proteins into nanodiscs.

  20. Direct fragmentation of quarkonia including Fermi motion using light-cone wave function

    Energy Technology Data Exchange (ETDEWEB)

    Nobary, M.A. Gomshi [Razi University, Department of Physics, Faculty of Science, Kermanshah (Iran); A.E.O.I., Center for Theoretical Physics and Mathematics, Tehran (Iran); Javadi, B. [Razi University, Department of Physics, Faculty of Science, Kermanshah (Iran)

    2005-07-01

    We investigate the effect of Fermi motion on the direct fragmentation of the J/{psi} and {upsilon} states employing a light-cone wave function. Consistent with such a wave function we set up the kinematics of a heavy quark fragmenting into quarkonia such that the Fermi motion of the constituents splits into a longitudinal as well as a transverse direction and thus calculate the fragmentation functions for these states. In the framework of our investigation, we estimate that the fragmentation probabilities of J/{psi} and {upsilon} may increase at least up to 14 percent when including this degree of freedom. (orig.)

  1. Microtubules provide directional information for core PCP function

    Science.gov (United States)

    Matis, Maja; Russler-Germain, David A; Hu, Qie; Tomlin, Claire J; Axelrod, Jeffrey D

    2014-01-01

    Planar cell polarity (PCP) signaling controls the polarization of cells within the plane of an epithelium. Two molecular modules composed of Fat(Ft)/Dachsous(Ds)/Four-jointed(Fj) and a ‘PCP-core’ including Frizzled(Fz) and Dishevelled(Dsh) contribute to polarization of individual cells. How polarity is globally coordinated with tissue axes is unresolved. Consistent with previous results, we find that the Ft/Ds/Fj-module has an effect on a MT-cytoskeleton. Here, we provide evidence for the model that the Ft/Ds/Fj-module provides directional information to the core-module through this MT organizing function. We show Ft/Ds/Fj-dependent initial polarization of the apical MT-cytoskeleton prior to global alignment of the core-module, reveal that the anchoring of apical non-centrosomal MTs at apical junctions is polarized, observe that directional trafficking of vesicles containing Dsh depends on Ft, and demonstrate the feasibility of this model by mathematical simulation. Together, these results support the hypothesis that Ft/Ds/Fj provides a signal to orient core PCP function via MT polarization. DOI: http://dx.doi.org/10.7554/eLife.02893.001 PMID:25124458

  2. Direct lineage reprogramming of mouse fibroblasts to functional midbrain dopaminergic neuronal progenitors

    Directory of Open Access Journals (Sweden)

    Han-Seop Kim

    2014-01-01

    Full Text Available The direct lineage reprogramming of somatic cells to other lineages by defined factors has led to innovative cell-fate-change approaches for providing patient-specific cells. Recent reports have demonstrated that four pluripotency factors (Oct4, Sox2, Klf4, and c-Myc are sufficient to directly reprogram fibroblasts to other specific cells, including induced neural stem cells (iNSCs. Here, we show that mouse fibroblasts can be directly reprogrammed into midbrain dopaminergic neuronal progenitors (DPs by temporal expression of the pluripotency factors and environment containing sonic hedgehog and fibroblast growth factor 8. Within thirteen days, self-renewing and functional induced DPs (iDPs were generated. Interestingly, the inhibition of both Jak and Gsk3β notably enhanced the iDP reprogramming efficiency. We confirmed the functionality of the iDPs by showing that the dopaminergic neurons generated from iDPs express midbrain markers, release dopamine, and show typical electrophysiological profiles. Our results demonstrate that the pluripotency factors-mediated direct reprogramming is an invaluable strategy for supplying functional and proliferating iDPs and may be useful for other neural progenitors required for disease modeling and cell therapies for neurodegenerative disorders.

  3. Design winds during ice storm as a function of direction for transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Chouinard, L. [McGill Univ., Montreal, PQ (Canada); Feknous, N. [SNC-Lavalin, Montreal, PQ (Canada); Sabourin, G. [Hydro-Quebec, Montreal, PQ (Canada)

    2005-07-01

    The effects of wind directionality are important considerations in the design of electric transmission lines. A procedure for the estimation of the probability distribution function of maximum wind speed as a function of direction was proposed. The procedure was applied to the sample of annual maximum wind speeds using the Gumbal distribution method and then used to estimate the maximum wind speed as a function of direction for the sample of maximum annual wind speeds, and maximum annual wind speeds during ice storms at 22 locations throughout Quebec. Wind direction obtained from the meteorological stations was recorded in 10 degrees sectors. The data set was used to obtain maximum wind speed for each year in each of 36 sectors. The joint probability distribution function was obtained by assuming that extreme distribution for non-directional winds was common to all directions during a season or period, as well as by assuming independence between wind speed and wind direction during a storm pattern. Structural effects were obtained by integrating the joint probability distribution with design equations. Results were then presented in the form of a ratio relative to the reference wind speed for each location. The procedure was demonstrated using a meteorological data set as well as glaze ice data from Quebec City, and covered a period of 30 years. Results indicated that a reduction factor of 25 per cent can be achieved on ice accumulations when overhead lines are directed parallel to dominant winds. It was concluded that the method will represent significant savings in the design and up-grading of existing lines. Further research will be conducted to address issues related to regional criteria and local adjustments for topographical features. 7 refs., 4 figs.

  4. Pupils' Humour Directed at Teachers: Its Types and Functions

    Science.gov (United States)

    Šedová, Klára

    2013-01-01

    Based on an analysis of 137 texts written by pupils, this paper examines pupils' humour directed at teachers, its types and social functions. The collected data are divided into three categories that describe different modes of teachers as targets of pupils' humour. The first mode describes teachers as unintentionally comical, the second as duped…

  5. Effect of phase-encoding direction on group analysis of resting-state functional magnetic resonance imaging.

    Science.gov (United States)

    Mori, Yasuo; Miyata, Jun; Isobe, Masanori; Son, Shuraku; Yoshihara, Yujiro; Aso, Toshihiko; Kouchiyama, Takanori; Murai, Toshiya; Takahashi, Hidehiko

    2018-05-17

    Echo-planar imaging is a common technique used in functional magnetic resonance imaging (fMRI), however it suffers from image distortion and signal loss because of large susceptibility effects that are related to the phase-encoding direction of the scan. Despite this relationship, the majority of neuroimaging studies have not considered the influence of phase-encoding direction. Here, we aimed to clarify how phase-encoding direction can affect the outcome of an fMRI connectivity study of schizophrenia. Resting-state fMRI using anterior to posterior (A-P) and posterior to anterior (P-A) directions was used to examine 25 patients with schizophrenia (SC) and 37 matched healthy controls (HC). We conducted a functional connectivity analysis using independent component analysis and performed three group comparisons: A-P vs. P-A (all participants), SC vs. HC for the A-P and P-A datasets, and the interaction between phase-encoding direction and participant group. The estimated functional connectivity differed between the two phase-encoding directions in areas that were more extensive than those where signal loss has been reported. Although functional connectivity in the SC group was lower than that in the HC group for both directions, the A-P and P-A conditions did not exhibit the same specific pattern of differences. Further, we observed an interaction between participant group and the phase-encoding direction in the left temporo-parietal junction and left fusiform gyrus. Phase-encoding direction can influence the results of functional connectivity studies. Thus, appropriate selection and documentation of phase-encoding direction will be important in future resting-state fMRI studies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  6. Free vibration analysis of multi directional functionally graded circular and annular plates

    Energy Technology Data Exchange (ETDEWEB)

    Kermani, Iman Davoodi; Ghayour, Mostafa; Mirdamadi, Hamid Reza [Isfahan Univ. of Technology, Isfahan (Iran, Islamic Republic of)

    2012-11-15

    This paper addresses the free vibration of multi directional functionally graded circular and annular plates using a semianalytical/numerical method, called state space based differential quadrature method. Three-dimensional elasticity equations are derived for multi directional functionally graded plates and a solution is given by the semi-analytical/numerical method. This method gives an analytical solution along the thickness direction, using a state space method and a numerical solution using differential quadrature method. Some numerical examples are presented to show the accuracy and convergence of the method. The most of simulations of the present study have been validated by the existing literature. The non dimensional frequencies and corresponding displacements mode shapes are obtained. Then the influences of thickness ratio and graded indexes are demonstrated on the non dimensional natural frequencies.

  7. High Dietary Fructose: Direct or Indirect Dangerous Factors Disturbing Tissue and Organ Functions.

    Science.gov (United States)

    Zhang, Dong-Mei; Jiao, Rui-Qing; Kong, Ling-Dong

    2017-03-29

    High dietary fructose is a major contributor to insulin resistance and metabolic syndrome, disturbing tissue and organ functions. Fructose is mainly absorbed into systemic circulation by glucose transporter 2 (GLUT2) and GLUT5, and metabolized in liver to produce glucose, lactate, triglyceride (TG), free fatty acid (FFA), uric acid (UA) and methylglyoxal (MG). Its extrahepatic absorption and metabolism also take place. High levels of these metabolites are the direct dangerous factors. During fructose metabolism, ATP depletion occurs and induces oxidative stress and inflammatory response, disturbing functions of local tissues and organs to overproduce inflammatory cytokine, adiponectin, leptin and endotoxin, which act as indirect dangerous factors. Fructose and its metabolites directly and/or indirectly cause oxidative stress, chronic inflammation, endothelial dysfunction, autophagy and increased intestinal permeability, and then further aggravate the metabolic syndrome with tissue and organ dysfunctions. Therefore, this review addresses fructose-induced metabolic syndrome, and the disturbance effects of direct and/or indirect dangerous factors on the functions of liver, adipose, pancreas islet, skeletal muscle, kidney, heart, brain and small intestine. It is important to find the potential correlations between direct and/or indirect risk factors and healthy problems under excess dietary fructose consumption.

  8. High Dietary Fructose: Direct or Indirect Dangerous Factors Disturbing Tissue and Organ Functions

    Directory of Open Access Journals (Sweden)

    Dong-Mei Zhang

    2017-03-01

    Full Text Available High dietary fructose is a major contributor to insulin resistance and metabolic syndrome, disturbing tissue and organ functions. Fructose is mainly absorbed into systemic circulation by glucose transporter 2 (GLUT2 and GLUT5, and metabolized in liver to produce glucose, lactate, triglyceride (TG, free fatty acid (FFA, uric acid (UA and methylglyoxal (MG. Its extrahepatic absorption and metabolism also take place. High levels of these metabolites are the direct dangerous factors. During fructose metabolism, ATP depletion occurs and induces oxidative stress and inflammatory response, disturbing functions of local tissues and organs to overproduce inflammatory cytokine, adiponectin, leptin and endotoxin, which act as indirect dangerous factors. Fructose and its metabolites directly and/or indirectly cause oxidative stress, chronic inflammation, endothelial dysfunction, autophagy and increased intestinal permeability, and then further aggravate the metabolic syndrome with tissue and organ dysfunctions. Therefore, this review addresses fructose-induced metabolic syndrome, and the disturbance effects of direct and/or indirect dangerous factors on the functions of liver, adipose, pancreas islet, skeletal muscle, kidney, heart, brain and small intestine. It is important to find the potential correlations between direct and/or indirect risk factors and healthy problems under excess dietary fructose consumption.

  9. Bacillus subtilis-based direct-fed microbials augment macrophage function in broiler chickens

    Science.gov (United States)

    The present study was conducted to evaluate the function of Bacillus subtilis-based direct-fed microbials (DFMs) on macrophage functions, i.e., nitric oxide (NO) production and phagocytosis in broiler chickens. DFMs used in this study were eight single strains designated as Bs2084, LSSAO1, 3AP4, Bs1...

  10. Strong Measurements Give a Better Direct Measurement of the Quantum Wave Function.

    Science.gov (United States)

    Vallone, Giuseppe; Dequal, Daniele

    2016-01-29

    Weak measurements have thus far been considered instrumental in the so-called direct measurement of the quantum wave function [4J. S. Lundeen, Nature (London) 474, 188 (2011).]. Here we show that a direct measurement of the wave function can be obtained by using measurements of arbitrary strength. In particular, in the case of strong measurements, i.e., those in which the coupling between the system and the measuring apparatus is maximum, we compared the precision and the accuracy of the two methods, by showing that strong measurements outperform weak measurements in both for arbitrary quantum states in most cases. We also give the exact expression of the difference between the original and reconstructed wave function obtained by the weak measurement approach; this will allow one to define the range of applicability of such a method.

  11. A Scale Elasticity Measure for Directional Distance Function and its Dual: Theory and DEA Estimation

    OpenAIRE

    Valentin Zelenyuk

    2012-01-01

    In this paper we focus on scale elasticity measure based on directional distance function for multi-output-multi-input technologies, explore its fundamental properties and show its equivalence with the input oriented and output oriented scale elasticity measures. We also establish duality relationship between the scale elasticity measure based on the directional distance function with scale elasticity measure based on the profit function. Finally, we discuss the estimation issues of the scale...

  12. A method for the direct generation of comprehensive numerical solar building transfer functions

    Energy Technology Data Exchange (ETDEWEB)

    Chen, T.Y. [The Hong Kong Polytechnic University (China). Dept. of Building Services Engineering

    2003-02-01

    This paper describes a method for the direct generation of comprehensive numerical room transfer functions with any derived parameters as output, such as operative temperature or thermal load. Complex conductive, convective and radiant heat transfer processes, or any derived thermal parameters in buildings can be explicitly and precisely described by a generalized thermal network. This allows the s-transfer and z-transfer functions to be directly generated, using semi-symbolic analysis techniques, Cayley's expansion of determinant and Heaviside's expansion theorem. A simple algorithm is developed for finding the roots of the denominator in the inverse transform of the s-transfer functions, which ensures that no single root is missing. The techniques have been applied to generating the transfer functions of a passive solar room with floor heating. The example calculation demonstrates the high efficiency of the computational method. (author)

  13. A posteriori model validation for the temporal order of directed functional connectivity maps.

    Science.gov (United States)

    Beltz, Adriene M; Molenaar, Peter C M

    2015-01-01

    A posteriori model validation for the temporal order of neural directed functional connectivity maps is rare. This is striking because models that require sequential independence among residuals are regularly implemented. The aim of the current study was (a) to apply to directed functional connectivity maps of functional magnetic resonance imaging data an a posteriori model validation procedure (i.e., white noise tests of one-step-ahead prediction errors combined with decision criteria for revising the maps based upon Lagrange Multiplier tests), and (b) to demonstrate how the procedure applies to single-subject simulated, single-subject task-related, and multi-subject resting state data. Directed functional connectivity was determined by the unified structural equation model family of approaches in order to map contemporaneous and first order lagged connections among brain regions at the group- and individual-levels while incorporating external input, then white noise tests were run. Findings revealed that the validation procedure successfully detected unmodeled sequential dependencies among residuals and recovered higher order (greater than one) simulated connections, and that the procedure can accommodate task-related input. Findings also revealed that lags greater than one were present in resting state data: With a group-level network that contained only contemporaneous and first order connections, 44% of subjects required second order, individual-level connections in order to obtain maps with white noise residuals. Results have broad methodological relevance (e.g., temporal validation is necessary after directed functional connectivity analyses because the presence of unmodeled higher order sequential dependencies may bias parameter estimates) and substantive implications (e.g., higher order lags may be common in resting state data).

  14. A posteriori model validation for the temporal order of directed functional connectivity maps

    Directory of Open Access Journals (Sweden)

    Adriene M. Beltz

    2015-08-01

    Full Text Available A posteriori model validation for the temporal order of neural directed functional connectivity maps is rare. This is striking because models that require sequential independence among residuals are regularly implemented. The aim of the current study was (a to apply to directed functional connectivity maps of functional magnetic resonance imaging data an a posteriori model validation procedure (i.e., white noise tests of one-step-ahead prediction errors combined with decision criteria for revising the maps based upon Lagrange Multiplier tests, and (b to demonstrate how the procedure applies to single-subject simulated, single-subject task-related, and multi-subject resting state data. Directed functional connectivity was determined by the unified structural equation model family of approaches in order to map contemporaneous and first order lagged connections among brain regions at the group- and individual-levels while incorporating external input, then white noise tests were run. Findings revealed that the validation procedure successfully detected unmodeled sequential dependencies among residuals and recovered higher order (greater than one simulated connections, and that the procedure can accommodate task-related input. Findings also revealed that lags greater than one were present in resting state data: With a group-level network that contained only contemporaneous and first order connections, 44% of subjects required second order, individual-level connections in order to obtain maps with white noise residuals. Results have broad methodological relevance (e.g., temporal validation is necessary after directed functional connectivity analyses because the presence of unmodeled higher order sequential dependencies may bias parameter estimates and substantive implications (e.g., higher order lags may be common in resting state data.

  15. Temperature and directional dependences of the infrared dielectric function of free standing silicon nanowire

    Energy Technology Data Exchange (ETDEWEB)

    Kazan, M.; Bruyant, A.; Sedaghat, Z.; Arnaud, L.; Blaize, S.; Royer, P. [Laboratoire de Nanotechnologie et d' Instrumentation Optique, Institut Charles Delaunay, Universite de Technologie de Troyes, CNRS FRE 2848, 12 Rue Marie Curie, 10010 Troyes, Cedex (France)

    2011-03-15

    An approach to calculate the infrared dielectric function of semiconductor nanostructures is presented and applied to silicon (Si) nanowires (NW's). The phonon modes symmetries and frequencies are calculated by means of the elastic continuum medium theory. The modes strengths and damping are calculated from a model for lattice dynamics and perturbation theory. The data are used in anisotropic Lorentz oscillator model to generate the temperature and directional dependences of the infrared dielectric function of free standing Si NW's. Our results showed that in the direction perpendicular to the NW axis, the complex dielectric function is identical to that of bulk Si. However, along the NW axis, the infrared dielectric function is a strong function of the wavelength. (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  16. Goal Direction and Effectiveness, Emotional Maturity, and Nuclear Family Functioning

    Science.gov (United States)

    Klever, Phillip

    2009-01-01

    Differentiation of self, a cornerstone concept in Bowen theory, has a profound influence over time on the functioning of the individual and his or her family unit. This 5-year longitudinal study tested this hypothesis with 50 developing nuclear families. The dimensions of differentiation of self that were examined were goal direction and…

  17. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Abubeker, Jewahir Ali

    2011-05-14

    This paper is devoted to the consideration of an algorithm for sequential optimization of paths in directed graphs relative to di_erent cost functions. The considered algorithm is based on an extension of dynamic programming which allows to represent the initial set of paths and the set of optimal paths after each application of optimization procedure in the form of a directed acyclic graph.

  18. Theory for site-site pair distribution functions of molecular fluids. II. Approximations for the Percus--Yevick site-site direct correlation functions

    International Nuclear Information System (INIS)

    Johnson, E.

    1977-01-01

    A theory for site-site pair distribution functions of molecular fluids is derived from the Ornstein-Zernike equation. Atom-atom pair distribution functions of this theory which were obtained by using different approximations for the Percus-Yevick site-site direct correlation functions are compared

  19. Mechanical analysis of non-uniform bi-directional functionally graded intelligent micro-beams using modified couple stress theory

    Science.gov (United States)

    Bakhshi Khaniki, Hossein; Rajasekaran, Sundaramoorthy

    2018-05-01

    This study develops a comprehensive investigation on mechanical behavior of non-uniform bi-directional functionally graded beam sensors in the framework of modified couple stress theory. Material variation is modelled through both length and thickness directions using power-law, sigmoid and exponential functions. Moreover, beam is assumed with linear, exponential and parabolic cross-section variation through the length using power-law and sigmoid varying functions. Using these assumptions, a general model for microbeams is presented and formulated by employing Hamilton’s principle. Governing equations are solved using a mixed finite element method with Lagrangian interpolation technique, Gaussian quadrature method and Wilson’s Lagrangian multiplier method. It is shown that by using bi-directional functionally graded materials in nonuniform microbeams, mechanical behavior of such structures could be affected noticeably and scale parameter has a significant effect in changing the rigidity of nonuniform bi-directional functionally graded beams.

  20. Phenobarbital alters hepatic Mrp2 function by direct and indirect interactions

    NARCIS (Netherlands)

    Patel, NJ; Zamek-Gliszczynski, MJ; Zhang, PJ; Han, YH; Jansen, PLM; Meier, PJ; Stieger, B; Brouwer, KLR

    Phenobarbital (PB) treatment impairs the biliary excretion of some organic anions. One mechanism may involve direct competition for biliary excretion by PB and/or a PB metabolite. Alternatively, PB may alter the expression and/or function of hepatic organic anion transport proteins. The role of

  1. Phenobarbital alters hepatic Mrp2 function by direct and indirect interactions

    NARCIS (Netherlands)

    Patel, Nita J.; Zamek-Gliszczynski, Maciej J.; Zhang, Peijin; Han, Yong-Hae; Jansen, Peter L. M.; Meier, Peter J.; Stieger, Bruno; Brouwer, Kim L. R.

    2003-01-01

    Phenobarbital (PB) treatment impairs the biliary excretion of some organic anions. One mechanism may involve direct competition for biliary excretion by PB and/or a PB metabolite. Alternatively, PB may alter the expression and/or function of hepatic organic anion transport proteins. The role of

  2. The RNA Exosome Channeling and Direct Access Conformations Have Distinct In Vivo Functions

    Directory of Open Access Journals (Sweden)

    Jaeil Han

    2016-09-01

    Full Text Available The RNA exosome is a 3′–5′ ribonuclease complex that is composed of nine core subunits and an essential catalytic subunit, Rrp44. Two distinct conformations of Rrp44 were revealed in previous structural studies, suggesting that Rrp44 may change its conformation to exert its function. In the channeling conformation, (Rrp44ch, RNA accesses the active site after traversing the central channel of the RNA exosome, whereas in the other conformation, (Rrp44da, RNA gains direct access to the active site. Here, we show that the Rrp44da exosome is important for nuclear function of the RNA exosome. Defects caused by disrupting the direct access conformation are distinct from those caused by channel-occluding mutations, indicating specific functions for each conformation. Our genetic analyses provide in vivo evidence that the RNA exosome employs a direct-access route to recruit specific substrates, indicating that the RNA exosome uses alternative conformations to act on different RNA substrates.

  3. Bi-directional reflectance distribution function of a tungsten block for ITER divertor

    International Nuclear Information System (INIS)

    Iwamae, Atsushi; Ogawa, Hiroaki; Sugie, Tatsuo; Kusama, Yoshinori

    2012-02-01

    In order to investigate reflection properties on plasma-facing material in ITER, the bi-directional reflectance distribution function (BRDF) of a tungsten block sample has been measured. On the machining surface of the block, one-directional machining lines are engraved. Two laser diodes λ652 nm and λ473 nm were used to simulate H α and H β emissions, respectively. The reflected light is affected by the machining surface. The reflected light traces an arc when the incident light is injected in the parallel direction to the engraved line. On the other hand the reflected light traces a line shape when the incident light is injected in the perpendicular direction to the engraved lines. Ray tracing simulation qualitatively explains the experimental results. (author)

  4. Motivational foci and asthma medication tactics directed towards a functional day

    Directory of Open Access Journals (Sweden)

    Lötvall Jan

    2011-10-01

    Full Text Available Abstract Background There appears to be an obvious gap between a medical and patient adherence perspective. Deviating from a medication prescription could be regarded as fairly irrational, but with respect to patients' goals and/or concerns it could be seen as understandable. Thus, the aim was to elucidate adherence reasoning in relation to asthma medication. Methods This was a qualitative study; data collection and analysis procedures were conducted according to Grounded Theory methodology. Eighteen persons, aged 22 with asthma and regular asthma medication treatment, were interviewed. Results The emerged theoretical model illustrated that adherence to asthma medication was motivated by three foci, all directed towards a desired outcome in terms of a functional day as desired by the patient. A promotive focus was associated with the ambition to achieve a positive asthma outcome by being adherent either to the received prescription or to a self-adjusted dosage. A preventive focus was intended to ensure avoidance of a negative asthma outcome either by sticking to the prescription or by preventively overusing the medication. A permissive focus was associated with unstructured adherence behaviour in which medication intake was primarily triggered by asthma symptoms. Conclusions As all participants had consciously adopted functioning medication tactics that directed them towards the desired goal of a functional day. In an effort to bridge the gap between a patient- and a medical adherence perspective, patients need support in defining their desired functionality and guidance in developing a person-based medication tactic.

  5. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Abubeker, Jewahir Ali; Chikalov, Igor; Hussain, Shahid; Moshkov, Mikhail

    2011-01-01

    This paper is devoted to the consideration of an algorithm for sequential optimization of paths in directed graphs relative to di_erent cost functions. The considered algorithm is based on an extension of dynamic programming which allows

  6. [Scientific potential of phenomics - functional direction of genetics].

    Science.gov (United States)

    Marasanov, A V; Valtseva, E A

    In this paper on the based on the integration of known theories, doctrines and concepts - principles of consistency and self-regulation of physiological functions (Pavlov I.P., 1950), the theory offunctional systems (Anokhin P.K., 1973), the theory of adaptive reactions (Selye H., 1960 ; Garkavi LKh et al, 1979), the doctrine of the dominant (Ukhtomsky A.A., 1966), doctrine on health (Baevsky R.M.), doctrine on the body type of the human by Merlin VS. conception on the “the interrelationship between the function and genetic apparatus” by Meyerson F.Z., Pshennikova M.G., Platonov V.N., and others, there is proposed to select phenomics - functional division of genetics considering the poolability of specific mechanisms of the body in an integral system of the adaptive act in favor of the development of a personalized approach to the diagnosis and prevention of non-communicable diseases, increasing life expectancy of working age into the particular scientific direction. The task of phenomics is the establishment of the phenotypic characteristics of the person, norms of the response of systems of his body, determination of the deviation of the level of the functioning of the each system from the norm of its response and the elaboration of the tactics for the correction of the functional state of the organism (the optimization of its life activity), with taking into account the directedness of the interaction of body systems. The description of the shaping of the mechanism of stereotyped response of the organism generated an important contribution to the development of phenomics. Stereotyped response being initiated by the non-specific response of the body is aimed at the shaping of the activity of its systems after a fashion of norms of the activity, promotes the recovery of the specificity of the body, plays an important role in the establishment of cause-effect relations of the disease.

  7. Multi-function radar emitter identification based on stochastic syntax-directed translation schema

    OpenAIRE

    Liu, Haijun; Yu, Hongqi; Sun, Zhaolin; Diao, Jietao

    2014-01-01

    To cope with the problem of emitter identification caused by the radar words’ uncertainty of measured multi-function radar emitters, this paper proposes a new identification method based on stochastic syntax-directed translation schema (SSDTS). This method, which is deduced from the syntactic modeling of multi-function radars, considers the probabilities of radar phrases appearance in different radar modes as well as the probabilities of radar word errors occurrence in different radar phrases...

  8. Total and Direct Correlation Function Integrals from Molecular Simulation of Binary Systems

    DEFF Research Database (Denmark)

    Wedberg, Nils Hejle Rasmus Ingemar; O’Connell, John P.; Peters, Günther H.J.

    2011-01-01

    The possibility for obtaining derivative properties for mixtures from integrals of spatial total and direct correlation functions obtained from molecular dynamics simulations is explored. Theoretically well-supported methods are examined to extend simulation radial distribution functions to long...... are consistent with an excess Helmholtz energy model fitted to available simulations. In addition, simulations of water/methanol and water/t-butanol mixtures have been carried out. The method yields results for partial molar volumes, activity coefficient derivatives, and individual correlation function integrals...... in reasonable agreement with smoothed experimental data. The proposed method for obtaining correlation function integrals is shown to perform at least as well as or better than two previously published approaches....

  9. Sequential Optimization of Paths in Directed Graphs Relative to Different Cost Functions

    KAUST Repository

    Mahayni, Malek A.

    2011-01-01

    developed to solve the optimal paths problem with different kinds of graphs. An algorithm that solves the problem of paths’ optimization in directed graphs relative to different cost functions is described in [1]. It follows an approach extended from

  10. Finite-size scaling functions for directed polymers confined between attracting walls

    Energy Technology Data Exchange (ETDEWEB)

    Owczarek, A L [Department of Mathematics and Statistics, University of Melbourne, Parkville, Victoria 3052 (Australia); Prellberg, T [School of Mathematical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom); Rechnitzer, A [Department of Mathematics, University of British Columbia, Vancouver, BC V6T 1Z2 (Canada)

    2008-01-25

    The exact solution of directed self-avoiding walks confined to a slit of finite width and interacting with the walls of the slit via an attractive potential has been recently calculated. The walks can be considered to model the polymer-induced steric stabilization and sensitized flocculation of colloidal dispersions. The large-width asymptotics led to a phase diagram different to that of a polymer attached to, and attracted to, a single wall. The question that arises is: Can one interpolate between the single wall and two wall cases? In this paper, we calculate the exact scaling functions for the partition function by considering the two variable asymptotics of the partition function for simultaneous large length and large width. Consequently, we find the scaling functions for the force induced by the polymer on the walls. We find that these scaling functions are given by elliptic {theta} functions. In some parts of the phase diagram there is more a complex crossover between the single wall and two wall cases and we elucidate how this happens.

  11. Onsite-effects of dual-hemisphere versus conventional single-hemisphere transcranial direct current stimulation: A functional MRI study.

    Science.gov (United States)

    Kwon, Yong Hyun; Jang, Sung Ho

    2012-08-25

    We performed functional MRI examinations in six right-handed healthy subjects. During functional MRI scanning, transcranial direct current stimulation was delivered with the anode over the right primary sensorimotor cortex and the cathode over the left primary sensorimotor cortex using dual-hemispheric transcranial direct current stimulation. This was compared to a cathode over the left supraorbital area using conventional single-hemispheric transcranial direct current stimulation. Voxel counts and blood oxygenation level-dependent signal intensities in the right primary sensorimotor cortex regions were estimated and compared between the two transcranial direct current stimulation conditions. Our results showed that dual-hemispheric transcranial direct current stimulation induced greater cortical activities than single-hemispheric transcranial direct current stimulation. These findings suggest that dual-hemispheric transcranial direct current stimulation may provide more effective cortical stimulation than single-hemispheric transcranial direct current stimulation.

  12. Efficiency analysis of Chinese industry: A directional distance function approach

    International Nuclear Information System (INIS)

    Watanabe, Michio; Tanaka, Katsuya

    2007-01-01

    Two efficiency measures of Chinese industry were estimated at the provincial level from 1994 to 2002, using a directional output distance function. One is a traditional efficiency measure that considers only desirable output, while the other considers both desirable and undesirable outputs simultaneously. A comparison of the two measures revealed that efficiency levels are biased only if desirable output is considered. Five coastal provinces/municipalities that have attracted a large amount of foreign direct investment are found to be the most efficient when only desirable output is considered, and also when both desirable and undesirable outputs are considered. However, omitting undesirable output tends to lead to an overestimate of industrial efficiency levels in Shandong, Sichuan, and Hebei provinces. We also found that a province's industrial structure has significant effects on its efficiency levels

  13. Functional relationship between cognitive representations of movement directions and visuomotor adaptation performance.

    Science.gov (United States)

    Lex, Heiko; Weigelt, Matthias; Knoblauch, Andreas; Schack, Thomas

    2012-12-01

    The aim of our study was to explore whether or not different types of learners in a sensorimotor task possess characteristically different cognitive representations. Participants' sensorimotor adaptation performance was measured with a pointing paradigm which used a distortion of the visual feedback in terms of a left-right reversal. The structure of cognitive representations was assessed using a newly established experimental method, the Cognitive Measurement of Represented Directions. A post hoc analysis revealed inter-individual differences in participants' adaptation performance, and three different skill levels (skilled, average, and poor adapters) have been defined. These differences in performance were correlated with the structure of participants' cognitive representations of movement directions. Analysis of these cognitive representations revealed performance advantages for participants possessing a global cognitive representation of movement directions (aligned to cardinal movement axes), rather than a local representation (aligned to each neighboring direction). Our findings are evidence that cognitive representation structures play a functional role in adaptation performance.

  14. Subjective cognitive complaints, psychosocial factors and nursing work function in nurses providing direct patient care.

    Science.gov (United States)

    Barbe, Tammy; Kimble, Laura P; Rubenstein, Cynthia

    2018-04-01

    The aim of this study was to examine relationships among subjective cognitive complaints, psychosocial factors and nursing work function in nurses providing direct patient care. Cognitive functioning is a critical component for nurses in the assurance of error prevention, identification and correction when caring for patients. Negative changes in nurses' cognitive and psychosocial functioning can adversely affect nursing care and patient outcomes. A descriptive correlational design with stratified random sampling. The sample included 96 nurses from the major geographic regions of the United States. Over 9 months in 2016-2017, data were collected using a web-based survey. Stepwise multiple linear regression analyses were used to examine relationships among subjective cognitive complaints, psychosocial factors and nursing work function. Overall, participants reported minimal work function impairment and low levels of subjective cognitive complaints, depression and stress. In multivariate analyses, depression was not associated with nurses' work function. However, perceived stress and subjective concerns about cognitive function were associated with greater impairment of work function. Nurses experiencing subjective cognitive complaints should be encouraged to address personal and environmental factors that are associated with their cognitive status. Additionally, stress reduction in nurses should be a high priority as a potential intervention to promote optimal functioning of nurses providing direct patient care. Healthcare institutions should integrate individual and institutional strategies to reduce factors contributing to workplace stress. © 2017 John Wiley & Sons Ltd.

  15. Direct measurement of the biphoton Wigner function through two-photon interference

    Science.gov (United States)

    Douce, T.; Eckstein, A.; Walborn, S. P.; Khoury, A. Z.; Ducci, S.; Keller, A.; Coudreau, T.; Milman, P.

    2013-01-01

    The Hong-Ou-Mandel (HOM) experiment was a benchmark in quantum optics, evidencing the non–classical nature of photon pairs, later generalized to quantum systems with either bosonic or fermionic statistics. We show that a simple modification in the well-known and widely used HOM experiment provides the direct measurement of the Wigner function. We apply our results to one of the most reliable quantum systems, consisting of biphotons generated by parametric down conversion. A consequence of our results is that a negative value of the Wigner function is a sufficient condition for non-gaussian entanglement between two photons. In the general case, the Wigner function provides all the required information to infer entanglement using well known necessary and sufficient criteria. The present work offers a new vision of the HOM experiment that further develops its possibilities to realize fundamental tests of quantum mechanics using simple optical set-ups. PMID:24346262

  16. Chemoselective, Substrate-directed Fluorination of Functionalized Cyclopentane β-Amino Acids.

    Science.gov (United States)

    Kiss, Loránd; Nonn, Melinda; Sillanpää, Reijo; Haukka, Matti; Fustero, Santos; Fülöp, Ferenc

    2016-12-06

    This work describes a substrate-directed fluorination of some highly functionalized cyclopentane derivatives. The cyclic products incorporating CH 2 F or CHF 2 moieties in their structure have been synthesized from diexo- or diendo-norbornene β-amino acids following a stereocontrolled strategy. The synthetic study was based on an oxidative transformation of the ring carbon-carbon double bond of the norbornene β-amino acids, followed by transformation of the resulted "all cis" and "trans" diformyl intermediates by fluorination with "chemodifferentiation". © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Molecular dynamics simulations of Gay-Berne nematic liquid crystal: Elastic properties from direct correlation functions

    International Nuclear Information System (INIS)

    Stelzer, J.; Trebin, H.R.; Longa, L.

    1994-08-01

    We report NVT and NPT molecular dynamics simulations of a Gay-Berne nematic liquid crystal using generalization of recently proposed algorithm by Toxvaerd [Phys. Rev. E47, 343, 1993]. On the basis of these simulations the Oseen-Zoher-Frank elastic constants K 11 , K 22 and K 33 as well as the surface constants K 13 and K 24 have been calculated within the framework of the direct correlation function approach of Lipkin et al. [J. Chem. Phys. 82, 472 (1985)]. The angular coefficients of the direct pair correlation function, which enter the final formulas, have been determined from the computer simulation data for the pair correlation function of the nematic by combining the Ornstein-Zernike relation and the Wienier-Hopf factorization scheme. The unoriented nematic approximation has been assumed when constructing the reference, isotropic state of Lipkin et al. By an extensive study of the model over a wide range of temperatures, densities and pressures a very detailed information has been provided about elastic behaviour of the Gay-Berne nematic. Interestingly, it is found that the results for the surface elastic constants are qualitatively different than those obtained with the help of analytical approximations for the isotropic, direct pair correlation function. For example, the values of the surface elastic constants are negative and an order of magnitude smaller than the bulk elasticity. (author). 30 refs, 9 figs

  18. Clinical results and functional outcomes after direct intralaminar screw repair of spondylolysis.

    Science.gov (United States)

    Menga, Emmanuel N; Kebaish, Khaled M; Jain, Amit; Carrino, John A; Sponseller, Paul D

    2014-01-01

    Prospective analysis. Our objective was to analyze clinical and functional results of patients with spondylolysis treated via direct intralaminar screw fixation and autograft, a minimally invasive and motion-preserving surgery. Spondylolysis is usually treated nonoperatively; multiple surgical techniques are available when nonoperative measures fail. No studies evaluate the clinical and functional outcomes and their correlation with pars defect size and disc morphology on magnetic resonance imaging. We reviewed patients with spondylolysis treated with intralaminar screw fixation and bone grafting from 2000 through 2010. Of the 31 patients (mean age, 16 yr; range, 10-37 yr), 25 (81%) were competitive athletes. Preoperative computed tomographic scans were used to measure the pars defect size, and preoperative magnetic resonance images were graded using Pfirrmann classification for correlation with postoperative outcomes. Student t test was used for analysis (significance, P spondylolysis repair for persistent pain starting 18 months after intralaminar screw fixation, 2 patients sustained unilateral intralaminar screw fractures at L5, and 1 patient required irrigation and debridement for a superficial postoperative infection. There was no correlation among preoperative magnetic resonance imaging disc morphology, defect size on computed tomography, patient age, and clinical outcomes. Direct repair of spondylolysis with intralaminar screws offers a low profile, reliable treatment with good functional outcome and a low complication rate in active patients. 4.

  19. The Direct Anterior Approach Does Not Increase Return to Function Following Hemiarthroplasty for Femoral Neck Fracture.

    Science.gov (United States)

    Carlson, Victor R; Ong, Alvin C; Orozco, Fabio R; Lutz, Rex W; Duque, Andres F; Post, Zachary D

    2017-11-01

    The purpose of this study was to evaluate functional outcomes for hemiarthroplasty using a direct anterior approach or a direct lateral approach for femoral neck fracture. This retrospective review used data collected from a single institution between 2006 and 2016. Eighty-five and 75 consecutive patients who underwent hemiarthroplasty via a direct anterior approach and a direct lateral approach, respectively, met inclusion criteria. All patients with femoral neck fractures were treated by 1 of 2 fellowship-trained orthopedic surgeons using the direct anterior approach or the direct lateral approach to hemiarthroplasty. Disposition, ambulation, and other perioperative surgical outcomes were compared between the cohorts. Compared with the direct lateral cohort, the direct anterior cohort had a shorter mean operative time (2.4 minutes, P<.01), a shorter mean length of hospital stay (2.7 days, P<.01), and a smaller mean decrease in hemoglobin postoperatively (0.7 g/dL, P<.01). No significant difference was observed between the cohorts for postoperative disposition, the number of feet ambulated on the second postoperative day, or the prevalence of ambulatory decline at 4- to 6-week and 4- to 6-month follow-up visits. Compared with the direct lateral approach, the direct anterior approach may benefit patients by small, but statistically significant, improvements in blood loss, surgical time, and length of hospital stay after hemiarthroplasty. However, the direct anterior approach does not appear to decrease the likelihood of transfer to a skilled nursing facility postoperatively or accelerate return to preoperative function. [Orthopedics. 2017; 40(6):e1055-e1061.]. Copyright 2017, SLACK Incorporated.

  20. Dynamic prediction of cumulative incidence functions by direct binomial regression.

    Science.gov (United States)

    Grand, Mia K; de Witte, Theo J M; Putter, Hein

    2018-03-25

    In recent years there have been a series of advances in the field of dynamic prediction. Among those is the development of methods for dynamic prediction of the cumulative incidence function in a competing risk setting. These models enable the predictions to be updated as time progresses and more information becomes available, for example when a patient comes back for a follow-up visit after completing a year of treatment, the risk of death, and adverse events may have changed since treatment initiation. One approach to model the cumulative incidence function in competing risks is by direct binomial regression, where right censoring of the event times is handled by inverse probability of censoring weights. We extend the approach by combining it with landmarking to enable dynamic prediction of the cumulative incidence function. The proposed models are very flexible, as they allow the covariates to have complex time-varying effects, and we illustrate how to investigate possible time-varying structures using Wald tests. The models are fitted using generalized estimating equations. The method is applied to bone marrow transplant data and the performance is investigated in a simulation study. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Functioning of the direct subsidies system in Poland and other European Union countries

    Directory of Open Access Journals (Sweden)

    Renata Marks-Bielska

    2010-01-01

    Full Text Available The aim of the paper was to present the functioning of the direct subsidies system in Poland. Given the profitable nature of this instrument the particular attention has been paid to the disposal of funds received by agricultural producers in the region of Warmia and Mazury in the form of subsidies. There is no doubt that the direct payments represent an important aid instrument supporting agriculture within the frameworks of the first pillar of the Common Agricultural Policy. The survey revealed that subsidies have significantly contributed to the improvement of financial condition of farms. Funds received in the form of direct payments have been mainly spent on financing current expenditures and to purchase means of production used in the farms (72.88%.

  2. Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.

    Science.gov (United States)

    Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2017-09-28

    Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.

  3. Direct analysis of thymic function in children with Down's syndrome

    Directory of Open Access Journals (Sweden)

    Meschiari Liviana

    2005-02-01

    Full Text Available Abstract Background Down's syndrome (DS is characterized by several immunological defects, especially regarding T cell compartment. DS is considered the best example of accelerated ageing in humans. Direct observations of the thymus have shown that in DS this organ undergoes severe histological and morphological changes. However, no data on its capacity to generate T cells are present in the literature. Here, using a new technology based upon real time PCR, we have investigated the capacity of the thymus to produce and release newly generated T lymphocytes (the so called "recent thymic emigrants", RTE in children with DS. Methods We studied 8 children affected by DS, aged 2–7 years, compared with 8 age- and sex-matched healthy controls. Flow cytometry was used to determine different lymphocytes subsets. Real time PCR with the Taqman system was used to quantify the amount of RTE, i.e. peripheral blood lymphocytes that express the T cell receptor rearrangement excision circles (TREC. Results In comparison with control children, those with DS had a significant lower number of TREC+ peripheral blood cells. Moreover, in DS children but not in controls, a strong negative correlation between age and the levels of TREC+ cells was found. Conclusions The direct measure of thymic output indicates that the impairment of the organ results in a reduced production of newly generated T cells. This observation could suggest that cytokines able to modulate thymic function, such as interleukins, could be useful to improve the functionality of the organ and to treat the immunodeficiency present in DS subjects.

  4. Feasibility and acceptability of esophageal-directed hypnotherapy for functional heartburn.

    Science.gov (United States)

    Riehl, M E; Pandolfino, J E; Palsson, O S; Keefer, L

    2016-07-01

    Functional heartburn (FH) is a benign but burdensome condition characterized by painful, burning epigastric sensations in the absence of acid reflux or symptom-reflux correlation. Esophageal hypersensitivity and its psychological counterpart, esophageal hypervigilance (EHv) drive symptom experience. Hypnotherapy (HYP) is an established and preferred intervention for refractory symptoms in functional gastrointestinal disorders (FGIDs) and could be applied to FH. The objective of this study was to determine the feasibility, acceptability, and clinical utility of 7 weekly sessions of esophageal-directed HYP (EHYP) on heartburn symptoms, quality of life, and EHv. Similar to other work in FGIDs and regardless of hypnotizability, there were consistent and significant changes in heartburn symptoms, visceral anxiety, and quality of life and a trend for improvement in catastrophizing. We would recommend EHYP in FH patients who are either non-responsive to medications or who would prefer a lifestyle intervention. © 2015 International Society for Diseases of the Esophagus.

  5. Transcranial direct current stimulation for motor recovery of upper limb function after stroke.

    Science.gov (United States)

    Lüdemann-Podubecká, Jitka; Bösl, Kathrin; Rothhardt, Sandra; Verheyden, Geert; Nowak, Dennis Alexander

    2014-11-01

    Changes in neural processing after stroke have been postulated to impede recovery from stroke. Transcranial direct current stimulation has the potential to alter cortico-spinal excitability and thereby might be beneficial in stroke recovery. We review the pertinent literature prior to 30/09/2013 on transcranial direct current stimulation in promoting motor recovery of the affected upper limb after stroke. We found overall 23 trials (they included 523 participants). All stimulation protocols pride on interhemispheric imbalance model. In a comparative approach, methodology and effectiveness of (a) facilitation of the affected hemisphere, (b) inhibition of the unaffected hemisphere and (c) combined application of transcranial direct current stimulation over the affected and unaffected hemispheres to treat impaired hand function after stroke are presented. Transcranial direct current stimulation is associated with improvement of the affected upper limb after stroke, but current evidence does not support its routine use. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Strategies for specifically directing metal functionalization of protein nanotubes: constructing protein coated silver nanowires

    International Nuclear Information System (INIS)

    Carreño-Fuentes, Liliana; Palomares, Laura A; Ramírez, Octavio T; Ascencio, Jorge A; Medina, Ariosto; Aguila, Sergio

    2013-01-01

    Biological molecules that self-assemble in the nanoscale range are useful multifunctional materials. Rotavirus VP6 protein self-assembles into tubular structures in the absence of other rotavirus proteins. Here, we present strategies for selectively directing metal functionalization to the lumen of VP6 nanotubes. The specific in situ metal reduction in the inner surface of nanotube walls was achieved by the simple modification of a method previously reported to functionalize the nanotube outer surface. Silver nanorods and nanowires as long as 1.5 μm were formed inside the nanotubes by coalescence of nanoparticles. Such one-dimensional structures were longer than others previously obtained using bioscaffolds. The interactions between silver ions and the nanotube were simulated to understand the conditions that allowed nanowire formation. Molecular docking showed that a naturally occurring arrangement of aspartate residues enabled the stabilization of silver ions on the internal surface of the VP6 nanotubes. This is the first time that such a spatial arrangement has been proposed for the nucleation of silver nanoparticles, opening the possibility of using such an array to direct functionalization of other biomolecules. These results demonstrate the natural capabilities of VP6 nanotubes to function as a versatile biotemplate for nanomaterials. (paper)

  7. Direct conversion of human fibroblasts into functional osteoblasts by defined factors.

    Science.gov (United States)

    Yamamoto, Kenta; Kishida, Tsunao; Sato, Yoshiki; Nishioka, Keisuke; Ejima, Akika; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Yamamoto, Toshiro; Kanamura, Narisato; Mazda, Osam

    2015-05-12

    Osteoblasts produce calcified bone matrix and contribute to bone formation and remodeling. In this study, we established a procedure to directly convert human fibroblasts into osteoblasts by transducing some defined factors and culturing in osteogenic medium. Osteoblast-specific transcription factors, Runt-related transcription factor 2 (Runx2), and Osterix, in combination with Octamer-binding transcription factor 3/4 (Oct4) and L-Myc (RXOL) transduction, converted ∼ 80% of the fibroblasts into osteocalcin-producing cells. The directly converted osteoblasts (dOBs) induced by RXOL displayed a similar gene expression profile as normal human osteoblasts and contributed to bone repair after transplantation into immunodeficient mice at artificial bone defect lesions. The dOBs expressed endogenous Runx2 and Osterix, and did not require continuous expression of the exogenous genes to maintain their phenotype. Another combination, Oct4 plus L-Myc (OL), also induced fibroblasts to produce bone matrix, but the OL-transduced cells did not express Osterix and exhibited a more distant gene expression profile to osteoblasts compared with RXOL-transduced cells. These findings strongly suggest successful direct reprogramming of fibroblasts into functional osteoblasts by RXOL, a technology that may provide bone regeneration therapy against bone disorders.

  8. Multiple-region directed functional connectivity based on phase delays.

    Science.gov (United States)

    Goelman, Gadi; Dan, Rotem

    2017-03-01

    Network analysis is increasingly advancing the field of neuroimaging. Neural networks are generally constructed from pairwise interactions with an assumption of linear relations between them. Here, a high-order statistical framework to calculate directed functional connectivity among multiple regions, using wavelet analysis and spectral coherence has been presented. The mathematical expression for 4 regions was derived and used to characterize a quartet of regions as a linear, combined (nonlinear), or disconnected network. Phase delays between regions were used to obtain network's temporal hierarchy and directionality. The validity of the mathematical derivation along with the effects of coupling strength and noise on its outcomes were studied by computer simulations of the Kuramoto model. The simulations demonstrated correct directionality for a large range of coupling strength and low sensitivity to Gaussian noise compared with pairwise coherences. The analysis was applied to resting-state fMRI data of 40 healthy young subjects to characterize the ventral visual system, motor system and default mode network (DMN). It was shown that the ventral visual system was predominantly composed of linear networks while the motor system and the DMN were composed of combined (nonlinear) networks. The ventral visual system exhibits its known temporal hierarchy, the motor system exhibits center ↔ out hierarchy and the DMN has dorsal ↔ ventral and anterior ↔ posterior organizations. The analysis can be applied in different disciplines such as seismology, or economy and in a variety of brain data including stimulus-driven fMRI, electrophysiology, EEG, and MEG, thus open new horizons in brain research. Hum Brain Mapp 38:1374-1386, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Synthesis of phenanthridines via palladium-catalyzed picolinamide-directed sequential C–H functionalization

    Directory of Open Access Journals (Sweden)

    Ryan Pearson

    2013-05-01

    Full Text Available We report a new synthesis of phenanthridines based on palladium-catalyzed picolinamide-directed sequential C–H functionalization reactions starting from readily available benzylamine and aryl iodide precursors. Under the catalysis of Pd(OAc2, the ortho-C–H bond of benzylpicolinamides is first arylated with an aryl iodide. The resulting biaryl compound is then subjected to palladium-catalyzed picolinamide-directed intramolecular dehydrogenative C–H amination with PhI(OAc2 oxidant to form the corresponding cyclized dihydrophenanthridines. The benzylic position of these dihydrophenanthridines could be further oxidized with Cu(OAc2, removing the picolinamide group and providing phenathridine products. The cyclization and oxidation could be carried out in a single step and afford phenathridines in moderate to good yields.

  10. Directional statistics-based reflectance model for isotropic bidirectional reflectance distribution functions.

    Science.gov (United States)

    Nishino, Ko; Lombardi, Stephen

    2011-01-01

    We introduce a novel parametric bidirectional reflectance distribution function (BRDF) model that can accurately encode a wide variety of real-world isotropic BRDFs with a small number of parameters. The key observation we make is that a BRDF may be viewed as a statistical distribution on a unit hemisphere. We derive a novel directional statistics distribution, which we refer to as the hemispherical exponential power distribution, and model real-world isotropic BRDFs as mixtures of it. We derive a canonical probabilistic method for estimating the parameters, including the number of components, of this novel directional statistics BRDF model. We show that the model captures the full spectrum of real-world isotropic BRDFs with high accuracy, but a small footprint. We also demonstrate the advantages of the novel BRDF model by showing its use for reflection component separation and for exploring the space of isotropic BRDFs.

  11. Directional Scanning as a Function of Stimulus Characteristics, Reading Habits, and Directional Set

    Science.gov (United States)

    Nachshon, Israel; And Others

    1977-01-01

    "32 English readers and 32 Hebrew readers were shown stimuli with directional characteristics (English and Hebrew letters) and stimuli with no directional characteristics (arrays of different circles, bars, colors, and geometric figures) for scanning. The results showed that, while directional stimulus characteristics affected the direction…

  12. Anticlockwise or Clockwise? A Dynamic Perception-Action-Laterality Model for Directionality Bias in Visuospatial Functioning

    Science.gov (United States)

    Karim, A.K.M. Rezaul; Proulx, Michael J.; Likova, Lora T.

    2016-01-01

    Reviewing the relevant literature in visual psychophysics and visual neuroscience we propose a three-stage model of directionality bias in visuospatial functioning. We call this model the ‘Perception-Action-Laterality’ (PAL) hypothesis. We analyzed the research findings for a wide range of visuospatial tasks, showing that there are two major directionality trends: clockwise versus anticlockwise. It appears these preferences are combinatorial, such that a majority of people fall in the first category demonstrating a preference for stimuli/objects arranged from left-to-right rather than from right-to-left, while people in the second category show an opposite trend. These perceptual biases can guide sensorimotor integration and action, creating two corresponding turner groups in the population. In support of PAL, we propose another model explaining the origins of the biases– how the neurogenetic factors and the cultural factors interact in a biased competition framework to determine the direction and extent of biases. This dynamic model can explain not only the two major categories of biases, but also the unbiased, unreliably biased or mildly biased cases in visuosptial functioning. PMID:27350096

  13. Directly writing resistor, inductor and capacitor to composite functional circuits: a super-simple way for alternative electronics.

    Science.gov (United States)

    Gao, Yunxia; Li, Haiyan; Liu, Jing

    2013-01-01

    The current strategies for making electronic devices are generally time, water, material and energy consuming. Here, the direct writing of composite functional circuits through comprehensive use of GaIn10-based liquid metal inks and matching material is proposed and investigated, which is a rather easy going and cost effective electronics fabrication way compared with the conventional approaches. Owing to its excellent adhesion and electrical properties, the liquid metal ink was demonstrated as a generalist in directly making various basic electronic components such as planar resistor, inductor and capacitor or their combination and thus composing circuits with expected electrical functions. For a precise control of the geometric sizes of the writing, a mask with a designed pattern was employed and demonstrated. Mechanisms for justifying the chemical components of the inks and the magnitudes of the target electronic elements so as to compose various practical circuits were disclosed. Fundamental tests on the electrical components including capacitor and inductor directly written on paper with working time up to 48 h and elevated temperature demonstrated their good stability and potential widespread adaptability especially when used in some high frequency circuits. As the first proof-of-concept experiment, a typical functional oscillating circuit including an integrated chip of 74HC04 with a supply voltage of 5 V, a capacitor of 10 nF and two resistors of 5 kΩ and 1 kΩ respectively was directly composed on paper through integrating specific electrical elements together, which presented an oscillation frequency of 8.8 kHz. The present method significantly extends the roles of the metal ink in recent works serving as only a single electrical conductor or interconnecting wires. It opens the way for directly writing out complex functional circuits or devices on different substrates. Such circuit composition strategy has generalized purpose and can be extended to more

  14. A two-level parallel direct search implementation for arbitrarily sized objective functions

    Energy Technology Data Exchange (ETDEWEB)

    Hutchinson, S.A.; Shadid, N.; Moffat, H.K. [Sandia National Labs., Albuquerque, NM (United States)] [and others

    1994-12-31

    In the past, many optimization schemes for massively parallel computers have attempted to achieve parallel efficiency using one of two methods. In the case of large and expensive objective function calculations, the optimization itself may be run in serial and the objective function calculations parallelized. In contrast, if the objective function calculations are relatively inexpensive and can be performed on a single processor, then the actual optimization routine itself may be parallelized. In this paper, a scheme based upon the Parallel Direct Search (PDS) technique is presented which allows the objective function calculations to be done on an arbitrarily large number (p{sub 2}) of processors. If, p, the number of processors available, is greater than or equal to 2p{sub 2} then the optimization may be parallelized as well. This allows for efficient use of computational resources since the objective function calculations can be performed on the number of processors that allow for peak parallel efficiency and then further speedup may be achieved by parallelizing the optimization. Results are presented for an optimization problem which involves the solution of a PDE using a finite-element algorithm as part of the objective function calculation. The optimum number of processors for the finite-element calculations is less than p/2. Thus, the PDS method is also parallelized. Performance comparisons are given for a nCUBE 2 implementation.

  15. The feasibility and acceptability of esophageal-directed hypnotherapy for functional heartburn

    Science.gov (United States)

    Riehl, M. E.; Pandolfino, J. E.; Palsson, O. S.; Keefer, L.

    2015-01-01

    SUMMARY Functional Heartburn (FH) is a benign but burdensome condition characterized by painful, burning epigastric sensations in the absence of acid reflux or symptom-reflux correlation. Esophageal hypersensitivity and its psychological counterpart, esophageal hypervigilance (EHv) drive symptom experience. Hypnotherapy (HYP) is an established and preferred intervention for refractory symptoms in functional gastrointestinal disorders (FGIDs) and could be applied to FH. The objective of this study was to determine the feasibility, acceptability and clinical utility of 7 weekly sessions of esophageal-directed hypnotherapy (EHYP) on heartburn symptoms, quality of life and EHv. Similar to other work in FGIDs and regardless of hypnotizability, there were consistent and significant changes in heartburn symptoms, visceral anxiety and quality of life and a trend for improvement in catastrophizing. We would recommend EHYP in FH patients who are either non-responsive to medications or who would prefer a lifestyle intervention. PMID:25824436

  16. Direct Functionalization of Nitrogen Heterocycles via Rh-Catalyzed C-H Bond Activation

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, Jared; Bergman, Robert; Ellman, Jonathan

    2008-02-04

    Nitrogen heterocycles are present in many compounds of enormous practical importance, ranging from pharmaceutical agents and biological probes to electroactive materials. Direct funtionalization of nitrogen heterocycles through C-H bond activation constitutes a powerful means of regioselectively introducing a variety of substituents with diverse functional groups onto the heterocycle scaffold. Working together, our two groups have developed a family of Rh-catalyzed heterocycle alkylation and arylation reactions that are notable for their high level of functional-group compatibility. This Account describes their work in this area, emphasizing the relevant mechanistic insights that enabled synthetic advances and distinguished the resulting transformations from other methods. They initially discovered an intramolecular Rh-catalyzed C-2-alkylation of azoles by alkenyl groups. That reaction provided access to a number of di-, tri-, and tetracyclic azole derivatives. They then developed conditions that exploited microwave heating to expedite these reactions. While investigating the mechanism of this transformation, they discovered that a novel substrate-derived Rh-N-heterocyclic carbene (NHC) complex was involved as an intermediate. They then synthesized analogous Rh-NHC complexes directly by treating precursors to the intermediate [RhCl(PCy{sub 3}){sub 2}] with N-methylbenzimidazole, 3-methyl-3,4-dihydroquinazolein, and 1-methyl-1,4-benzodiazepine-2-one. Extensive kinetic analysis and DFT calculations supported a mechanism for carbene formation in which the catalytically active RhCl(PCy{sub 3}){sub 2} fragment coordinates to the heterocycle before intramolecular activation of the C-H bond occurs. The resulting Rh-H intermediate ultimately tautomerizes to the observed carbene complex. With this mechanistic information and the discovery that acid co-catalysts accelerate the alkylation, they developed conditions that efficiently and intermolecularly alkylate a variety of

  17. Biomimetic hydrogels direct spinal progenitor cell differentiation and promote functional recovery after spinal cord injury

    Science.gov (United States)

    Geissler, Sydney A.; Sabin, Alexandra L.; Besser, Rachel R.; Gooden, Olivia M.; Shirk, Bryce D.; Nguyen, Quan M.; Khaing, Zin Z.; Schmidt, Christine E.

    2018-04-01

    Objective. Demyelination that results from disease or traumatic injury, such as spinal cord injury (SCI), can have a devastating effect on neural function and recovery. Many researchers are examining treatments to minimize demyelination by improving oligodendrocyte availability in vivo. Transplantation of stem and oligodendrocyte progenitor cells is a promising option, however, trials are plagued by undirected differentiation. Here we introduce a biomaterial that has been optimized to direct the differentiation of neural progenitor cells (NPCs) toward oligodendrocytes as a cell delivery vehicle after SCI. Approach. A collagen-based hydrogel was modified to mimic the mechanical properties of the neonatal spinal cord, and components present in the developing extracellular matrix were included to provide appropriate chemical cues to the NPCs to direct their differentiation toward oligodendrocytes. The hydrogel with cells was then transplanted into a unilateral cervical contusion model of SCI to examine the functional recovery with this treatment. Six behavioral tests and histological assessment were performed to examine the in vivo response to this treatment. Main results. Our results demonstrate that we can achieve a significant increase in oligodendrocyte differentiation of NPCs compared to standard culture conditions using a three-component biomaterial composed of collagen, hyaluronic acid, and laminin that has mechanical properties matched to those of neonatal neural tissue. Additionally, SCI rats with hydrogel transplants, with and without NPCs, showed functional recovery. Animals transplanted with hydrogels with NPCs showed significantly increased functional recovery over six weeks compared to the media control group. Significance. The three-component hydrogel presented here has the potential to provide cues to direct differentiation in vivo to encourage regeneration of the central nervous system.

  18. No direct association among respiratory function, disease control and family functioning in a sample of Mexican children with intermittent asthma.

    Science.gov (United States)

    Rodriguez-Orozco, Alain Raimundo; Núñez-Tapia, Rosa María; Ramírez-Silva, Armando; Gómez-Alonso, Carlos

    2013-05-15

    Asthma has been linked to family disfunctioning and poor control of the disease.This study was conducted to analyze the interactions between the level of intermittent asthma control, family functioning and respiratory function and between quality of life of asthmatic patients and their caregivers.7 to 15 years old children with intermittent asthma were included. Asthma Control Test Questionnaire, Pediatric Asthma Quality of Life Questionnaire (PAQLQ) test, and flowmetry were applied to children and Pediatric Asthma Caregiver´s Quatily of Life Questionnaire (PAQCLQ) and the Family Functioning Perception Test (FF-SIL) were applied to their parents.The most affected areas of family functioning in dysfunctional families were adaptability and permeability. A medium to high strength of association was founded between the emotional function of parents and the emotional function of children, R2=0.552. The most remarkable associations were among parents' limitation of activities and parents' emotional function (r=0.837), parents' limitation of activities and child's emotional function (r=0.722), parents' emotional role and limitation of activities (r=0.837), parents' emotional role and emotional functioning of children with asthma (r=0.743) and the limitation of activities of children with asthma and the emotional function of children with asthma (r=0.870).No direct associations were founded among respiratory function, disease control and family functioning in Mexican children with intermittent asthma and emotional function of parents and children were associated in both groups.

  19. Classical density functional theory and the phase-field crystal method using a rational function to describe the two-body direct correlation function.

    Science.gov (United States)

    Pisutha-Arnond, N; Chan, V W L; Iyer, M; Gavini, V; Thornton, K

    2013-01-01

    We introduce a new approach to represent a two-body direct correlation function (DCF) in order to alleviate the computational demand of classical density functional theory (CDFT) and enhance the predictive capability of the phase-field crystal (PFC) method. The approach utilizes a rational function fit (RFF) to approximate the two-body DCF in Fourier space. We use the RFF to show that short-wavelength contributions of the two-body DCF play an important role in determining the thermodynamic properties of materials. We further show that using the RFF to empirically parametrize the two-body DCF allows us to obtain the thermodynamic properties of solids and liquids that agree with the results of CDFT simulations with the full two-body DCF without incurring significant computational costs. In addition, the RFF can also be used to improve the representation of the two-body DCF in the PFC method. Last, the RFF allows for a real-space reformulation of the CDFT and PFC method, which enables descriptions of nonperiodic systems and the use of nonuniform and adaptive grids.

  20. Analysis of Unsteady Propagation of Mode Ⅲ Crack in Arbitrary Direction in Functionally Graded Materials

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kwang Ho [Kyungpook National University, Daegu (Korea, Republic of); Cho, Sang Bong [Kyungnam University, Changwon (Korea, Republic of); Hawong, Jai Sug [Yeungnam University, Gyungsan (Korea, Republic of)

    2015-02-15

    The stress and displacement fields at the crack tip were studied during the unsteady propagation of a mode Ⅲ crack in a direction that was different from the property graduation direction in functionally graded materials (FGMs). The property graduation in FGMs was assumed based on the linearly varying shear modulus under a constant density and the exponentially varying shear modulus and density. To obtain the solution of the harmonic function, the general partial differential equation of the dynamic equilibrium equation was transformed into a Laplace equation. Based on the Laplace equation, the stress and displacement fields, which depended on the time rates of change in the crack tip speed and stress intensity factor, were obtained through an asymptotic analysis. Using the stress and displacement fields, the effects of the angled property variation on the stresses, displacements, and stress intensity factors are discussed.

  1. SLAM-seq defines direct gene-regulatory functions of the BRD4-MYC axis.

    Science.gov (United States)

    Muhar, Matthias; Ebert, Anja; Neumann, Tobias; Umkehrer, Christian; Jude, Julian; Wieshofer, Corinna; Rescheneder, Philipp; Lipp, Jesse J; Herzog, Veronika A; Reichholf, Brian; Cisneros, David A; Hoffmann, Thomas; Schlapansky, Moritz F; Bhat, Pooja; von Haeseler, Arndt; Köcher, Thomas; Obenauf, Anna C; Popow, Johannes; Ameres, Stefan L; Zuber, Johannes

    2018-05-18

    Defining direct targets of transcription factors and regulatory pathways is key to understanding their roles in physiology and disease. We combined SLAM-seq [thiol(SH)-linked alkylation for the metabolic sequencing of RNA], a method for direct quantification of newly synthesized messenger RNAs (mRNAs), with pharmacological and chemical-genetic perturbation in order to define regulatory functions of two transcriptional hubs in cancer, BRD4 and MYC, and to interrogate direct responses to BET bromodomain inhibitors (BETis). We found that BRD4 acts as general coactivator of RNA polymerase II-dependent transcription, which is broadly repressed upon high-dose BETi treatment. At doses triggering selective effects in leukemia, BETis deregulate a small set of hypersensitive targets including MYC. In contrast to BRD4, MYC primarily acts as a selective transcriptional activator controlling metabolic processes such as ribosome biogenesis and de novo purine synthesis. Our study establishes a simple and scalable strategy to identify direct transcriptional targets of any gene or pathway. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  2. Wada-test, functional magnetic resonance imaging and direct electrical stimulation - brain mapping methods

    International Nuclear Information System (INIS)

    Minkin, K.; Tanova, R.; Busarski, A.; Penkov, M.; Penev, L.; Hadjidekov, V.

    2009-01-01

    Modern neurosurgery requires accurate preoperative and intraoperative localization of brain pathologies but also of brain functions. The presence of individual variations in healthy subjects and the shift of brain functions in brain diseases provoke the introduction of various methods for brain mapping. The aim of this paper was to analyze the most widespread methods for brain mapping: Wada-test, functional magnetic resonance imaging (fMRI) and intraoperative direct electrical stimulation (DES). This study included 4 patients with preoperative brain mapping using Wada-test and fMRI. Intraoperative mapping with DES during awake craniotomy was performed in one case. The histopathological diagnosis was low-grade glioma in 2 cases, cortical dysplasia (1 patient) and arteriovenous malformation (1 patient). The brain mapping permits total lesion resection in three of four patients. There was no new postoperative deficit despite surgery near or within functional brain areas. Brain plasticity provoking shift of eloquent areas from their usual locations was observed in two cases. The brain mapping methods allow surgery in eloquent brain areas recognized in the past as 'forbidden areas'. Each method has advantages and disadvantages. The precise location of brain functions and pathologies frequently requires combination of different brain mapping methods. (authors)

  3. Direct metal transfer printing on flexible substrate for fabricating optics functional devices

    Science.gov (United States)

    Jiang, Yingjie; Zhou, Xiaohong; Zhang, Feng; Shi, Zhenwu; Chen, Linsen; Peng, Changsi

    2015-11-01

    New functional materials and devices based on metal patterns can be widely used in many new and expanding industries,such as flat panel displays, alternative energy,sensors and so on. In this paper, we introduce a new transfer printing method for fabricating metal optics functional devices. This method can directly transfer a metal pattern from a polyethylene terephthalate (PET)supported UV or polydimethylsiloxane (PDMS) pattern to another PET substrate. Purely taking advantage of the anaerobic UV curing adhesive (a-UV) on PET substrate, metal film can be easily peeled off from micro/nano-structured surface. As a result, metal film on the protrusion can be selectively transferred onto the target substrate, to make it the metal functional surface. But which on the bottom can not be transferred. This method provides low cost fabrication of metal thin film devices by avoiding high cost lithography process. Compared with conventional approach, this method can get more smooth rough edges and has wider tolerance range for the original master mold. Future developments and potential applications of this metal transfer method will be addressed.

  4. Factor structure of overall autobiographical memory usage: the directive, self and social functions revisited.

    Science.gov (United States)

    Rasmussen, Anne S; Habermas, Tilmann

    2011-08-01

    According to theory, autobiographical memory serves three broad functions of overall usage: directive, self, and social. However, there is evidence to suggest that the tripartite model may be better conceptualised in terms of a four-factor model with two social functions. In the present study we examined the two models in Danish and German samples, using the Thinking About Life Experiences Questionnaire (TALE; Bluck, Alea, Habermas, & Rubin, 2005), which measures the overall usage of the three functions generalised across concrete memories. Confirmatory factor analysis supported the four-factor model and rejected the theoretical three-factor model in both samples. The results are discussed in relation to cultural differences in overall autobiographical memory usage as well as sharing versus non-sharing aspects of social remembering.

  5. Directly writing resistor, inductor and capacitor to composite functional circuits: a super-simple way for alternative electronics.

    Directory of Open Access Journals (Sweden)

    Yunxia Gao

    Full Text Available BACKGROUND: The current strategies for making electronic devices are generally time, water, material and energy consuming. Here, the direct writing of composite functional circuits through comprehensive use of GaIn10-based liquid metal inks and matching material is proposed and investigated, which is a rather easy going and cost effective electronics fabrication way compared with the conventional approaches. METHODS: Owing to its excellent adhesion and electrical properties, the liquid metal ink was demonstrated as a generalist in directly making various basic electronic components such as planar resistor, inductor and capacitor or their combination and thus composing circuits with expected electrical functions. For a precise control of the geometric sizes of the writing, a mask with a designed pattern was employed and demonstrated. Mechanisms for justifying the chemical components of the inks and the magnitudes of the target electronic elements so as to compose various practical circuits were disclosed. RESULTS: Fundamental tests on the electrical components including capacitor and inductor directly written on paper with working time up to 48 h and elevated temperature demonstrated their good stability and potential widespread adaptability especially when used in some high frequency circuits. As the first proof-of-concept experiment, a typical functional oscillating circuit including an integrated chip of 74HC04 with a supply voltage of 5 V, a capacitor of 10 nF and two resistors of 5 kΩ and 1 kΩ respectively was directly composed on paper through integrating specific electrical elements together, which presented an oscillation frequency of 8.8 kHz. CONCLUSIONS: The present method significantly extends the roles of the metal ink in recent works serving as only a single electrical conductor or interconnecting wires. It opens the way for directly writing out complex functional circuits or devices on different substrates. Such circuit

  6. Late-stage diversification of biologically active pyridazinones via a direct C-H functionalization strategy.

    Science.gov (United States)

    Li, Wei; Fan, Zhoulong; Geng, Kaijun; Xu, Youjun; Zhang, Ao

    2015-01-14

    Divergent C-H functionalization reactions (arylation, carboxylation, olefination, thiolation, acetoxylation, halogenation, naphthylation) using a pyridazinone moiety as an internal directing group were successfully established. This approach offers a late-stage, ortho-selective diversification of a biologically active pyridazinone scaffold. Seven series of novel pyridazinone analogues were synthesized conveniently as the synthetic precursors of potential sortase A (SrtA) inhibitors.

  7. Ku must load directly onto the chromosome end in order to mediate its telomeric functions.

    Directory of Open Access Journals (Sweden)

    Christopher R Lopez

    2011-08-01

    Full Text Available The Ku heterodimer associates with the Saccharomyces cerevisiae telomere, where it impacts several aspects of telomere structure and function. Although Ku avidly binds DNA ends via a preformed channel, its ability to associate with telomeres via this mechanism could be challenged by factors known to bind directly to the chromosome terminus. This has led to uncertainty as to whether Ku itself binds directly to telomeric ends and whether end association is crucial for Ku's telomeric functions. To address these questions, we constructed DNA end binding-defective Ku heterodimers by altering amino acid residues in Ku70 and Ku80 that were predicted to contact DNA. These mutants continued to associate with their known telomere-related partners, such as Sir4, a factor required for telomeric silencing, and TLC1, the RNA component of telomerase. Despite these interactions, we found that the Ku mutants had markedly reduced association with telomeric chromatin and null-like deficiencies for telomere end protection, length regulation, and silencing functions. In contrast to Ku null strains, the DNA end binding defective Ku mutants resulted in increased, rather than markedly decreased, imprecise end-joining proficiency at an induced double-strand break. This result further supports that it was the specific loss of Ku's telomere end binding that resulted in telomeric defects rather than global loss of Ku's functions. The extensive telomere defects observed in these mutants lead us to propose that Ku is an integral component of the terminal telomeric cap, where it promotes a specific architecture that is central to telomere function and maintenance.

  8. Ku must load directly onto the chromosome end in order to mediate its telomeric functions.

    Science.gov (United States)

    Lopez, Christopher R; Ribes-Zamora, Albert; Indiviglio, Sandra M; Williams, Christopher L; Haricharan, Svasti; Bertuch, Alison A

    2011-08-01

    The Ku heterodimer associates with the Saccharomyces cerevisiae telomere, where it impacts several aspects of telomere structure and function. Although Ku avidly binds DNA ends via a preformed channel, its ability to associate with telomeres via this mechanism could be challenged by factors known to bind directly to the chromosome terminus. This has led to uncertainty as to whether Ku itself binds directly to telomeric ends and whether end association is crucial for Ku's telomeric functions. To address these questions, we constructed DNA end binding-defective Ku heterodimers by altering amino acid residues in Ku70 and Ku80 that were predicted to contact DNA. These mutants continued to associate with their known telomere-related partners, such as Sir4, a factor required for telomeric silencing, and TLC1, the RNA component of telomerase. Despite these interactions, we found that the Ku mutants had markedly reduced association with telomeric chromatin and null-like deficiencies for telomere end protection, length regulation, and silencing functions. In contrast to Ku null strains, the DNA end binding defective Ku mutants resulted in increased, rather than markedly decreased, imprecise end-joining proficiency at an induced double-strand break. This result further supports that it was the specific loss of Ku's telomere end binding that resulted in telomeric defects rather than global loss of Ku's functions. The extensive telomere defects observed in these mutants lead us to propose that Ku is an integral component of the terminal telomeric cap, where it promotes a specific architecture that is central to telomere function and maintenance.

  9. In situ sonochemical reduction and direct functionalization of graphene oxide: A robust approach with thermal and biomedical applications.

    Science.gov (United States)

    Maktedar, Shrikant S; Mehetre, Shantilal S; Avashthi, Gopal; Singh, Man

    2017-01-01

    The rapid, robust, scalable and non-hazardous sonochemical approach for in situ reduction and direct functionalization of graphene oxide has been developed for non-toxic biomedical applications. The graphene oxide (GrO) was directly functionalized with tryptamine (TA) without using any hazardous acylating and coupling reagents. The reaction was completed within 20min. An impact of ultrasound was inferred for a direct functionalization with other conventional methods. The evolved electronic states were confirmed with near edge X-ray absorption fine structure (NEXAFS). The direct covalent functionalization and formation of f-(TA) GrO was proven with FTIR, 13 C solid state NMR, XPS, XRD, Raman' HRTEM, AFM and TGA. The total percentage weight loss in TGA confirms an enhanced thermal stability of f-(TA) GrO. The f-(TA) GrO was further explored for an investigation of in vitro antimicrobial activity to ensure the health and environmental safety. An outstanding antibacterial activity of f-(TA) GrO was found against gram positive Staphylococcus aureus at MIC 128mgmL -1 . It confirms a suitability of f-(TA) GrO for thermally stable antibacterial coating. The f-(TA) GrO showed 39.14-48.9% antioxidant activities, evaluated with 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical assay. The inherent cytotoxicity of f-(TA) GrO was evaluated with SRB assay to living cells, MCF-7 and Vero. The estimated cell viabilities were >80% upon addition of f-(TA) GrO over a wide concentration range of 10-80μgmL -1 . The high cytocompatibility of f-(TA) GrO confirms the low toxicity and an excellent biocompatibility. The morphological effect on Vero cell line, evidently confirmed the biocompatibility of f-(TA) GrO. Therefore, f-(TA) GrO was emerged as an advanced functional biomaterial for thermal and biomedical applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Direct cortical hemodynamic mapping of somatotopy of pig nostril sensation by functional near-infrared cortical imaging (fNCI).

    Science.gov (United States)

    Uga, Minako; Saito, Toshiyuki; Sano, Toshifumi; Yokota, Hidenori; Oguro, Keiji; Rizki, Edmi Edison; Mizutani, Tsutomu; Katura, Takusige; Dan, Ippeita; Watanabe, Eiju

    2014-05-01

    Functional near-infrared spectroscopy (fNIRS) is a neuroimaging technique for the noninvasive monitoring of human brain activation states utilizing the coupling between neural activity and regional cerebral hemodynamics. Illuminators and detectors, together constituting optodes, are placed on the scalp, but due to the presence of head tissues, an inter-optode distance of more than 2.5cm is necessary to detect cortical signals. Although direct cortical monitoring with fNIRS has been pursued, a high-resolution visualization of hemodynamic changes associated with sensory, motor and cognitive neural responses directly from the cortical surface has yet to be realized. To acquire robust information on the hemodynamics of the cortex, devoid of signal complications in transcranial measurement, we devised a functional near-infrared cortical imaging (fNCI) technique. Here we demonstrate the first direct functional measurement of temporal and spatial patterns of cortical hemodynamics using the fNCI technique. For fNCI, inter-optode distance was set at 5mm, and light leakage from illuminators was prevented by a special optode holder made of a light-shielding rubber sheet. fNCI successfully detected the somatotopy of pig nostril sensation, as assessed in comparison with concurrent and sequential somatosensory-evoked potential (SEP) measurements on the same stimulation sites. Accordingly, the fNCI system realized a direct cortical hemodynamic measurement with a spatial resolution comparable to that of SEP mapping on the rostral region of the pig brain. This study provides an important initial step toward realizing functional cortical hemodynamic monitoring during neurosurgery of human brains. Copyright © 2014. Published by Elsevier Inc.

  11. Direct transformation of silyl enol ethers into functionalized allenes.

    Science.gov (United States)

    Langer, P; Döring, M; Seyferth, D; Görls, H

    2001-02-02

    The first elimination reactions of silyl enol ethers to lithiated allenes are reported. These reactions allow a direct transformation of readily available silyl enol ethers into functionalized allenes. The action of three to four equivalents of lithium diisopropylamide (LDA) on silyl enol ethers results in the formation of lithiated allenes by initial allylic lithiation, subsequent elimination of a lithium silanolate, and finally, lithiation of the allene thus formed. Starting with amide-derived silyl imino ethers, lithiated ketenimines are obtained. A variety of reactions of the lithiated allenes with electrophiles (chlorosilanes, trimethylchlorostannane, dimethyl sulfate and ethanol) were carried out. Elimination of silanolate is observed only for substrates that contain the hindered SiMe2tBu or Si(iPr)3 moiety, but not for the SiMe3 group. The reaction of 1,1-dilithio-3,3-diphenylallene with ketones provides a convenient access to novel 1,1-di(hydroxymethyl)allenes which undergo a domino Nazarov-Friedel-Crafts reaction upon treatment with p-toluenesulfonic acid.

  12. Direct decarbonylation of furfural to furan: A density functional theory study on Pt-graphene

    Science.gov (United States)

    Fellah, Mehmet Ferdi

    2017-05-01

    The catalytic mechanism of direct decarbonylation of furfural to furan on Pt graphene surface has been investigated by means of density functional theory (DFT) calculations. The main catalytic mechanism proposed in this study has six steps such as furfural adsorption, dissociation of H from adsorbed furfural, dissociation of carbon monoxide (molecularly) from adsorbed complex, furan formation and desorption of products. It has been concluded that the rate determining step for direct decarbonylation of furfural to furan is furan formation step and global activation barrier for this catalytic system is 82 kJ/mol consisting of zero point energy and thermal energy corrections. Pt-graphene structure has an important role on the catalytic decarbonylation of furfural to furan without any other reactants. This accordingly points out that Pt doped graphene structure might be an encouraging catalyst for direct decarbonylation of furfural to furan molecule as a valuable chemical material.

  13. Insights into the Functions of a Prophage Recombination Directionality Factor

    Directory of Open Access Journals (Sweden)

    Mireille Ansaldi

    2012-10-01

    Full Text Available Recombination directionality factors (RDFs, or excisionases, are essential players of prophage excisive recombination. Despite the essentially catalytic role of the integrase in both integrative and excisive recombination, RDFs are required to direct the reaction towards excision and to prevent re-integration of the prophage genome when entering a lytic cycle. KplE1, HK620 and numerous (prophages that integrate at the same site in enterobacteria genomes (such as the argW tRNA gene all share a highly conserved recombination module. This module comprises the attL and attR recombination sites and the RDF and integrase genes. The KplE1 RDF was named TorI after its initial identification as a negative regulator of the tor operon. However, it was characterized as an essential factor of excisive recombination. In this study, we designed an extensive random mutagenesis protocol of the torI gene and identified key residues involved in both functions of the TorI protein. We show that, in addition to TorI-TorR protein-protein interaction, TorI interacts in solution with the IntS integrase. Moreover, in vitro, TorR and IntS appear to compete for TorI binding. Finally, our mutagenesis results suggest that the C-terminal part of the TorI protein is dedicated to protein-protein interactions with both proteins TorR and IntS.

  14. Different alterations in brain functional networks according to direct and indirect topological connections in patients with schizophrenia.

    Science.gov (United States)

    Park, Chang-Hyun; Lee, Seungyup; Kim, Taewon; Won, Wang Yeon; Lee, Kyoung-Uk

    2017-10-01

    Schizophrenia displays connectivity deficits in the brain, but the literature has shown inconsistent findings about alterations in global efficiency of brain functional networks. We supposed that such inconsistency at the whole brain level may be due to a mixture of different portions of global efficiency at sub-brain levels. Accordingly, we considered measuring portions of global efficiency in two aspects: spatial portions by considering sub-brain networks and topological portions by considering contributions to global efficiency according to direct and indirect topological connections. We proposed adjacency and indirect adjacency as new network parameters attributable to direct and indirect topological connections, respectively, and applied them to graph-theoretical analysis of brain functional networks constructed from resting state fMRI data of 22 patients with schizophrenia and 22 healthy controls. Group differences in the network parameters were observed not for whole brain and hemispheric networks, but for regional networks. Alterations in adjacency and indirect adjacency were in opposite directions, such that adjacency increased, but indirect adjacency decreased in patients with schizophrenia. Furthermore, over connections in frontal and parietal regions, increased adjacency was associated with more severe negative symptoms, while decreased adjacency was associated with more severe positive symptoms of schizophrenia. This finding indicates that connectivity deficits associated with positive and negative symptoms of schizophrenia may involve topologically different paths in the brain. In patients with schizophrenia, although changes in global efficiency may not be clearly shown, different alterations in brain functional networks according to direct and indirect topological connections could be revealed at the regional level. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Ant colony optimisation-direct cover: a hybrid ant colony direct cover technique for multi-level synthesis of multiple-valued logic functions

    Science.gov (United States)

    Abd-El-Barr, Mostafa

    2010-12-01

    The use of non-binary (multiple-valued) logic in the synthesis of digital systems can lead to savings in chip area. Advances in very large scale integration (VLSI) technology have enabled the successful implementation of multiple-valued logic (MVL) circuits. A number of heuristic algorithms for the synthesis of (near) minimal sum-of products (two-level) realisation of MVL functions have been reported in the literature. The direct cover (DC) technique is one such algorithm. The ant colony optimisation (ACO) algorithm is a meta-heuristic that uses constructive greediness to explore a large solution space in finding (near) optimal solutions. The ACO algorithm mimics the ant's behaviour in the real world in using the shortest path to reach food sources. We have previously introduced an ACO-based heuristic for the synthesis of two-level MVL functions. In this article, we introduce the ACO-DC hybrid technique for the synthesis of multi-level MVL functions. The basic idea is to use an ant to decompose a given MVL function into a number of levels and then synthesise each sub-function using a DC-based technique. The results obtained using the proposed approach are compared to those obtained using existing techniques reported in the literature. A benchmark set consisting of 50,000 randomly generated 2-variable 4-valued functions is used in the comparison. The results obtained using the proposed ACO-DC technique are shown to produce efficient realisation in terms of the average number of gates (as a measure of chip area) needed for the synthesis of a given MVL function.

  16. Direct interactions of the five known Fanconi anaemia proteins suggest a common functional pathway.

    Science.gov (United States)

    Medhurst, A L; Huber, P A; Waisfisz, Q; de Winter , J P; Mathew, C G

    2001-02-15

    Fanconi anaemia (FA) is an autosomal recessive inherited disorder associated with a progressive aplastic anaemia, diverse congenital abnormalities and cancer. The condition is genetically heterogeneous, with at least seven complementation groups (A-G) described. Cells from individuals who are homozygous for mutations in FA genes are characterized by chromosomal instability and hypersensitivity to DNA interstrand crosslinking agents. These features suggest a possible role for the encoded proteins in the recognition or repair of these lesions, but neither their function nor whether they operate in a concerted or discrete functional pathways is known. The recent cloning of the FANCF and FANCE genes has allowed us to investigate the interaction of the proteins encoded by five of the seven complementation groups of FA. We used the yeast two-hybrid system and co-immunoprecipitation analysis to test the 10 possible pairs of proteins for direct interaction. In addition to the previously described binding of FANCA to FANCG, we now demonstrate direct interaction of FANCF with FANCG, of FANCC with FANCE and a weaker interaction of FANCE with both FANCA and FANCG. These findings show that the newly identified FANCE protein is an integral part of the FA pathway, and support the concept of a functional link between all known proteins encoded by the genes that are mutated in this disorder. These proteins may act either as a multimeric complex or by sequential recruitment of subsets of the proteins in a common pathway that protects the genomic integrity of mammalian cells.

  17. A joint probability density function of wind speed and direction for wind energy analysis

    International Nuclear Information System (INIS)

    Carta, Jose A.; Ramirez, Penelope; Bueno, Celia

    2008-01-01

    A very flexible joint probability density function of wind speed and direction is presented in this paper for use in wind energy analysis. A method that enables angular-linear distributions to be obtained with specified marginal distributions has been used for this purpose. For the marginal distribution of wind speed we use a singly truncated from below Normal-Weibull mixture distribution. The marginal distribution of wind direction comprises a finite mixture of von Mises distributions. The proposed model is applied in this paper to wind direction and wind speed hourly data recorded at several weather stations located in the Canary Islands (Spain). The suitability of the distributions is judged from the coefficient of determination R 2 . The conclusions reached are that the joint distribution proposed in this paper: (a) can represent unimodal, bimodal and bitangential wind speed frequency distributions, (b) takes into account the frequency of null winds, (c) represents the wind direction regimes in zones with several modes or prevailing wind directions, (d) takes into account the correlation between wind speeds and its directions. It can therefore be used in several tasks involved in the evaluation process of the wind resources available at a potential site. We also conclude that, in the case of the Canary Islands, the proposed model provides better fits in all the cases analysed than those obtained with the models used in the specialised literature on wind energy

  18. Direct effect of curcumin on porcine ovarian cell functions.

    Science.gov (United States)

    Kádasi, Attila; Maruniaková, Nora; Štochmaľová, Aneta; Bauer, Miroslav; Grossmann, Roland; Harrath, Abdel Halim; Kolesárová, Adriana; Sirotkin, Alexander V

    2017-07-01

    Curcuma longa Linn (L.) is a plant widely used in cooking (in curry powder a.o.) and in folk medicine, but its action on reproductive processes and its possible mechanisms of action remain to be investigated. The objective of this study was to examine the direct effects of curcumin, the major Curcuma longa L. molecule, on basic ovarian cell functions such as proliferation, apoptosis, viability and steroidogenesis. Porcine ovarian granulosa cells were cultured with and without curcumin (at doses of 0, 1, 10 and 100μg/ml of medium). Markers of proliferation (accumulation of PCNA) and apoptosis (accumulation of bax) were analyzed by immunocytochemistry. The expression of mRNA for PCNA and bax was detected by RT-PCR. Cell viability was detected by trypan blue exclusion test. Release of steroid hormones (progesterone and testosterone) was measured by enzyme immunoassay (EIA). It was observed that addition of curcumin reduced ovarian cell proliferation (expression of both PCNA and its mRNA), promoted apoptosis (accumulation of both bax and its mRNA), reduced cell viability, and stimulated both progesterone and testosterone release. These observations demonstrate the direct suppressive effect of Curcuma longa L./curcumin on female gonads via multiple mechanisms of action - suppression of ovarian cell proliferation and viability, promotion of their apoptosis (at the level of mRNA transcription and subsequent accumulation of promoters of genes regulating these activities) and release of anti-proliferative and pro-apoptotic progesterone and androgen. The potential anti-gonadal action of curcumin should be taken into account by consumers of Curcuma longa L.-containing products. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Direct antigonadal activity of cannabinoids: suppression of rat granulosa cell functions.

    Science.gov (United States)

    Adashi, E Y; Jones, P B; Hsueh, A J

    1983-02-01

    The direct effects of delta 9-tetrahydrocannabinol (THC) and related cannabinoids on ovarian granulosa cells were studied in vitro. Granulosa cells from immature, hypophysectomized, estrogen-treated rats were cultured for 2 days in an androstenedione-supplemented medium in the presence or absence of follicle-stimulating hormone (FSH) (10 ng/ml) with or without cannabinoids. FSH treatment increased progesterone and estrogen biosynthesis, whereas concomitant treatment with THC led to a dose-dependent inhibition of the FSH-stimulated accumulation of progesterone and estrogen with ED50 values of 3.5 +/- 0.3 X 10(-7) and 1.8 +/- 0.2 X 10(-6) M, respectively. Treatment with related but nonpsychoactive cannabinoids (cannabidiol, cannabinol, cannabigerol, or cannabichromene) was equally effective. The THC-induced inhibition of progesterone production was reversible and was associated with an inhibition of pregnenolone biosynthesis and a decrease of 3 beta-hydroxysteroid dehydrogenase activity. In addition, treatment with THC brought about a dose-dependent inhibition of the FSH-induced increase in luteinizing hormone (LH) receptors. The inhibitory effects of THC were not associated with changes in cell number, protein content, or cell viability. Thus, THC exerts direct inhibitory effects on FSH-dependent functions related to steroidogenesis and the acquisition of LH receptors, all of which are essential to follicular maturation. Because plasma concentrations of THC similar to those used in this study have been reported in human beings, repeated exposure of female users to THC may lead to ovarian dysfunction, due in part, to the direct antigonadal activity to THC.

  20. Patient Health Record Systems Scope and Functionalities: Literature Review and Future Directions.

    Science.gov (United States)

    Bouayad, Lina; Ialynytchev, Anna; Padmanabhan, Balaji

    2017-11-15

    A new generation of user-centric information systems is emerging in health care as patient health record (PHR) systems. These systems create a platform supporting the new vision of health services that empowers patients and enables patient-provider communication, with the goal of improving health outcomes and reducing costs. This evolution has generated new sets of data and capabilities, providing opportunities and challenges at the user, system, and industry levels. The objective of our study was to assess PHR data types and functionalities through a review of the literature to inform the health care informatics community, and to provide recommendations for PHR design, research, and practice. We conducted a review of the literature to assess PHR data types and functionalities. We searched PubMed, Embase, and MEDLINE databases from 1966 to 2015 for studies of PHRs, resulting in 1822 articles, from which we selected a total of 106 articles for a detailed review of PHR data content. We present several key findings related to the scope and functionalities in PHR systems. We also present a functional taxonomy and chronological analysis of PHR data types and functionalities, to improve understanding and provide insights for future directions. Functional taxonomy analysis of the extracted data revealed the presence of new PHR data sources such as tracking devices and data types such as time-series data. Chronological data analysis showed an evolution of PHR system functionalities over time, from simple data access to data modification and, more recently, automated assessment, prediction, and recommendation. Efforts are needed to improve (1) PHR data quality through patient-centered user interface design and standardized patient-generated data guidelines, (2) data integrity through consolidation of various types and sources, (3) PHR functionality through application of new data analytics methods, and (4) metrics to evaluate clinical outcomes associated with automated PHR

  1. Comparison Effect of Direct Trocar and Veress Needle Entry Techniques on Gut Functions after Laparoscopic Procedures: Randomized Clinical Trial

    Directory of Open Access Journals (Sweden)

    Taylan Şenol

    2016-12-01

    CONCLUSION: Direct or Veress needle entry methods were both safe to create pneumoperitoneum with similar postoperative gastrointestinal functions except for earlier first flatulence in Veress needle group while direct trocar entry was found to be associated with favorable postoperative blood count and shorter duration to obtain enough intraperitoneal pressure.

  2. Decreasing Striatopallidal Pathway Function Enhances Motivation by Energizing the Initiation of Goal-Directed Action

    Science.gov (United States)

    Carvalho Poyraz, Fernanda; Holzner, Eva; Bailey, Matthew R.; Meszaros, Jozsef; Kenney, Lindsay; Kheirbek, Mazen A.

    2016-01-01

    Altered dopamine D2 receptor (D2R) binding in the striatum has been associated with abnormal motivation in neuropsychiatric disorders, including schizophrenia. Here, we tested whether motivational deficits observed in mice with upregulated D2Rs (D2R-OEdev mice) are reversed by decreasing function of the striatopallidal “no-go” pathway. To this end, we expressed the Gαi-coupled designer receptor hM4D in adult striatopallidal neurons and activated the receptor with clozapine-N-oxide (CNO). Using a head-mounted miniature microscope we confirmed with calcium imaging in awake mice that hM4D activation by CNO inhibits striatopallidal function measured as disinhibited downstream activity in the globus pallidus. Mice were then tested in three operant tasks that address motivated behavior, the progressive ratio task, the progressive hold-down task, and outcome devaluation. Decreasing striatopallidal function in the dorsomedial striatum or nucleus accumbens core enhanced motivation in D2R-OEdev mice and control littermates. This effect was due to increased response initiation but came at the cost of goal-directed efficiency. Moreover, response vigor and the sensitivity to changes in reward value were not altered. Chronic activation of hM4D by administering CNO for 2 weeks in drinking water did not affect motivation due to a tolerance effect. However, the acute effect of CNO on motivation was reinstated after discontinuing chronic treatment for 48 h. Used as a therapeutic approach, striatopallidal inhibition should consider the risk of impairing goal-directed efficiency and behavioral desensitization. SIGNIFICANCE STATEMENT Motivation involves a directional component that allows subjects to efficiently select the behavior that will lead to an optimal outcome and an activational component that initiates and maintains the vigor and persistence of actions. Striatal output pathways modulate motivated behavior, but it remains unknown how these pathways regulate specific

  3. Decreasing Striatopallidal Pathway Function Enhances Motivation by Energizing the Initiation of Goal-Directed Action.

    Science.gov (United States)

    Carvalho Poyraz, Fernanda; Holzner, Eva; Bailey, Matthew R; Meszaros, Jozsef; Kenney, Lindsay; Kheirbek, Mazen A; Balsam, Peter D; Kellendonk, Christoph

    2016-06-01

    Altered dopamine D2 receptor (D2R) binding in the striatum has been associated with abnormal motivation in neuropsychiatric disorders, including schizophrenia. Here, we tested whether motivational deficits observed in mice with upregulated D2Rs (D2R-OEdev mice) are reversed by decreasing function of the striatopallidal "no-go" pathway. To this end, we expressed the Gαi-coupled designer receptor hM4D in adult striatopallidal neurons and activated the receptor with clozapine-N-oxide (CNO). Using a head-mounted miniature microscope we confirmed with calcium imaging in awake mice that hM4D activation by CNO inhibits striatopallidal function measured as disinhibited downstream activity in the globus pallidus. Mice were then tested in three operant tasks that address motivated behavior, the progressive ratio task, the progressive hold-down task, and outcome devaluation. Decreasing striatopallidal function in the dorsomedial striatum or nucleus accumbens core enhanced motivation in D2R-OEdev mice and control littermates. This effect was due to increased response initiation but came at the cost of goal-directed efficiency. Moreover, response vigor and the sensitivity to changes in reward value were not altered. Chronic activation of hM4D by administering CNO for 2 weeks in drinking water did not affect motivation due to a tolerance effect. However, the acute effect of CNO on motivation was reinstated after discontinuing chronic treatment for 48 h. Used as a therapeutic approach, striatopallidal inhibition should consider the risk of impairing goal-directed efficiency and behavioral desensitization. Motivation involves a directional component that allows subjects to efficiently select the behavior that will lead to an optimal outcome and an activational component that initiates and maintains the vigor and persistence of actions. Striatal output pathways modulate motivated behavior, but it remains unknown how these pathways regulate specific components of motivation. Here

  4. Functionalized Ormosil Scaffolds Processed by Direct Laser Polymerization for Application in Tissue Engineering

    DEFF Research Database (Denmark)

    Matei, A.; Schou, Jørgen; Canulescu, Stela

    The N,N’-(methacryloyloxyethyl triehtoxy silyl propyl carbamoyl-oxyhexyl)-urea hybrid methacrylate for applications in tissue engineering was synthesized and afterwards polymerized by direct laser polymerization using femtosecond laser pulses with the aim of using it for further applications...... in tissue engineering. The as-obtained scaffolds were modified either by low pressure argon plasma treatment or by using two different proteins (lysozyme, fibrinogen). For improved adhesion, the proteins were deposited by matrix assisted pulsed laser evaporation. The functionalized structures were tested...

  5. Directive and incentive functions of affective action consequences: an ideomotor approach.

    Science.gov (United States)

    Eder, Andreas B; Rothermund, Klaus; De Houwer, Jan; Hommel, Bernhard

    2015-07-01

    Five experiments examined whether affective consequences become associated with the responses producing them and whether anticipations of positive and negative action outcomes influence action control differently. In a learning phase, one response produced pleasant and another response unpleasant visual effects. In a subsequent test phase, the same actions were carried out in response to a neutral feature of affective stimuli. Results showed that responses were faster when the irrelevant valence of the response cue matched the valence of the response outcome, but only when the responses still produced outcomes. These results suggest that affective action consequences have a directive function in that they facilitate the selection of the associated response over other responses, even when the response outcome is unpleasant (Experiment 4A). Results of another experiment showed that affective action consequences can also have an incentive function in that responses with pleasant outcomes are generally facilitated relative to responses with unpleasant outcomes. However, this motivational effect was seen only in a free-choice test (Experiment 5). The results suggest that behavioral impulses induced by ideomotor processes are constrained by the motivational evaluation of the anticipated action outcome. A model that integrates motivational factors into ideomotor theory is presented.

  6. Effective NiMn Nanoparticles-Functionalized Carbon Felt as an Effective Anode for Direct Urea Fuel Cells

    Directory of Open Access Journals (Sweden)

    Nasser A. M. Barakat

    2018-05-01

    Full Text Available The internal resistances of fuel cells strongly affect the generated power. Basically, in the fuel cell, the anode can be prepared by deposition of a film from the functional electrocatalyst on a proper gas diffusion layer. Accordingly, an interfacial resistance for the electron transport is created between the two layers. Electrocatalyst-functionalized gas diffusion layer (GDL can distinctly reduce the interfacial resistance between the catalyst layer and the GDL. In this study, NiMn nanoparticles-decorated carbon felt is introduced as functionalized GDL to be exploited as a ready-made anode in a direct urea fuel cell. The proposed treated GDL was prepared by calcination of nickel acetate/manganese acetate-loaded carbon felt under an argon atmosphere at 850 °C. The physiochemical characterizations confirmed complete reduction for the utilized precursors and deposition of pristine NiMn nanoparticles on the carbon felt fiber. In passive direct urea fuel cells, investigation the performance of the functionalized GDLs indicated that the composition of the metal nanoparticles has to be optimized as the GDL obtained from 40 wt % manganese acetate reveals the maximum generated power density; 36 mW/m2 at room temperature and 0.5 M urea solution. Moreover, the electrochemical measurements proved that low urea solution concentration is preferred as utilizing 0.5 M solution resulted into generating higher power compared to 1.0 and 2.0 M solution. Overall, this study opens a new avenue toward functionalization of the GDL as a novel strategy to overcome the interfacial resistance between the electrocatalyst and the GDL.

  7. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    Energy Technology Data Exchange (ETDEWEB)

    Caballero, David, E-mail: caballero@unistra.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Martinez, Elena [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Bausells, Joan [Centre Nacional de Microelectronica (CNM-IMB), CSIC, Campus UAB, 08193 Bellaterra (Spain); Errachid, Abdelhamid, E-mail: abdelhamid.errachid-el-salhi@univ-lyon1.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Universite Claude Bernard - Lyon 1, LSA - UMR 5180, 43 Bd du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Samitier, Josep [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. Black-Right-Pointing-Pointer Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. Black-Right-Pointing-Pointer Silicon nitride offers multiple advantages compared to other common materials. Black-Right-Pointing-Pointer The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si{sub 3}N{sub 4}) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si{sub 3}N{sub 4}-based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO{sub 2}/Si{sub 3}N{sub 4} structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10{sup -13}-10{sup -7} M were detected, showing a sensitivity of 0.128 {Omega} {mu}M{sup -1} and a limit of detection of 10{sup -14} M. The specificity of the sensor was also addressed by studying the

  8. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    International Nuclear Information System (INIS)

    Caballero, David; Martinez, Elena; Bausells, Joan; Errachid, Abdelhamid; Samitier, Josep

    2012-01-01

    Highlights: ► An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. ► Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. ► Silicon nitride offers multiple advantages compared to other common materials. ► The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si 3 N 4 ) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si 3 N 4 -based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO 2 /Si 3 N 4 structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10 −13 –10 −7 M were detected, showing a sensitivity of 0.128 Ω μM −1 and a limit of detection of 10 −14 M. The specificity of the sensor was also addressed by studying the interferences with a similar protein, bovine serum albumin. The results obtained show that the antibodies were efficiently immobilized and the proteins

  9. Liquid direct correlation function, singlet densities and the theory of freezing

    International Nuclear Information System (INIS)

    March, N.H.; Tosi, M.P.

    1981-04-01

    We have examined the solutions for the singlet density rho(r) in the hierarchical equation connecting rho(r) with the liquid direct correlation function c(r). In addition to the homogeneous solution rho(r)=rhosub(liquid), we exhibit a periodic solution which can co-exist with the liquid solution. If the defining equation for this is linearized, we recover the bifurcation condition of Lovett and Buff. We stress the difference between the two treatments as that between first and second-order transitions. It turns out that the treatment presented here leads to the same periodic density as that derived, using the hypernetted chain approximation, by Ramakrishnan and Yussouff in their theory of freezing. Invoking that approximation is shown thereby to be inessential. (author)

  10. Functional Magnetic Resonance Imaging of Goal-Directed Reaching in Children with Autism Spectrum Disorders: A Feasibility Study

    Directory of Open Access Journals (Sweden)

    Nicole M. G. Salowitz

    2014-04-01

    Full Text Available An unanswered question concerning the neural basis of autism spectrum disorders (ASD is how sensorimotor deficits in individuals with ASD are related to abnormalities of brain function. We previously described a robotic joystick and video game system that allows us to record functional magnetic resonance images (FMRI while adult humans make goal-directed wrist motions. We anticipated several challenges in extending this approach to studying goal-directed behaviors in children with ASD and in typically developing (TYP children. In particular we were concerned that children with autism may express increased levels of anxiety as compared to typically developing children due to the loud sounds and small enclosed space of the MRI scanner. We also were concerned that both groups of children might become restless during testing, leading to an unacceptable amount of head movement. Here we performed a pilot study evaluating the extent to which autistic and typically developing children exhibit anxiety during our experimental protocol as well as their ability to comply with task instructions. Our experimental controls were successful in minimizing group differences in drop-out due to anxiety. Kinematic performance and head motion also were similar across groups. Both groups of children engaged cortical regions (frontal, parietal, temporal, occipital while making goal-directed movements. In addition, the ASD group exhibited task-related correlations in subcortical regions (cerebellum, thalamus, whereas correlations in the TYP group did not reach statistical significance in subcortical regions. Four distinct regions in frontal cortex showed a significant group difference such that TYP children exhibited positive correlations between the hemodynamic response and movement, whereas children with ASD exhibited negative correlations. These findings demonstrate feasibility of simultaneous application of robotic manipulation and functional imaging to study goal-directed

  11. Gut-directed hypnotherapy for functional abdominal pain or irritable bowel syndrome in children: a systematic review

    NARCIS (Netherlands)

    Rutten, Juliette M. T. M.; Reitsma, Johannes B.; Vlieger, Arine M.; Benninga, Marc A.

    2013-01-01

    Gut directed hypnotherapy (HT) is shown to be effective in adult functional abdominal pain (FAP) and irritable bowel syndrome (IBS) patients. We performed a systematic review to assess efficacy of HT in paediatric FAP/IBS patients. We searched Medline, Embase, PsychINFO, Cumulative Index to Nursing

  12. Directionality analysis on functional magnetic resonance imaging during motor task using Granger causality.

    Science.gov (United States)

    Anwar, A R; Muthalib, M; Perrey, S; Galka, A; Granert, O; Wolff, S; Deuschl, G; Raethjen, J; Heute, U; Muthuraman, M

    2012-01-01

    Directionality analysis of signals originating from different parts of brain during motor tasks has gained a lot of interest. Since brain activity can be recorded over time, methods of time series analysis can be applied to medical time series as well. Granger Causality is a method to find a causal relationship between time series. Such causality can be referred to as a directional connection and is not necessarily bidirectional. The aim of this study is to differentiate between different motor tasks on the basis of activation maps and also to understand the nature of connections present between different parts of the brain. In this paper, three different motor tasks (finger tapping, simple finger sequencing, and complex finger sequencing) are analyzed. Time series for each task were extracted from functional magnetic resonance imaging (fMRI) data, which have a very good spatial resolution and can look into the sub-cortical regions of the brain. Activation maps based on fMRI images show that, in case of complex finger sequencing, most parts of the brain are active, unlike finger tapping during which only limited regions show activity. Directionality analysis on time series extracted from contralateral motor cortex (CMC), supplementary motor area (SMA), and cerebellum (CER) show bidirectional connections between these parts of the brain. In case of simple finger sequencing and complex finger sequencing, the strongest connections originate from SMA and CMC, while connections originating from CER in either direction are the weakest ones in magnitude during all paradigms.

  13. Abstract structure of partial function $*$-algebras over semi-direct product of locally compact groups

    Directory of Open Access Journals (Sweden)

    Arash Ghaani Farashahi

    2015-12-01

    Full Text Available This article presents a unified approach to the abstract notions of partial convolution and involution in $L^p$-function spaces over semi-direct product of locally compact groups. Let $H$ and $K$ be locally compact groups and $tau:Hto Aut(K$ be a continuous homomorphism.  Let $G_tau=Hltimes_tau K$ be the semi-direct product of $H$ and $K$ with respect to $tau$. We define left and right $tau$-convolution on $L^1(G_tau$ and we show that, with respect to each of them, the function space $L^1(G_tau$ is a Banach algebra. We define $tau$-convolution as a linear combination of the left and right $tau$-convolution and we show that the $tau$-convolution is commutative if and only if $K$ is abelian. We prove that there is a $tau$-involution on $L^1(G_tau$ such that with respect to the $tau$-involution and $tau$-convolution, $L^1(G_tau$ is a non-associative Banach $*$-algebra. It is also shown that when $K$ is abelian, the $tau$-involution and $tau$-convolution make $L^1(G_tau$ into a Jordan Banach $*$-algebra. Finally, we also present the generalized notation of $tau$-convolution for other $L^p$-spaces with $p>1$.

  14. Measuring the CO2 shadow price for wastewater treatment: A directional distance function approach

    International Nuclear Information System (INIS)

    Molinos-Senante, María; Hanley, Nick; Sala-Garrido, Ramón

    2015-01-01

    Highlights: • The shadow price of CO 2 informs about the marginal abatement cost of this pollutant. • It is estimated the shadow price of CO 2 for wastewater treatment plants. • The shadow prices depend on the setting of the directional vectors of the distance function. • Sewage sludge treatment technology affects the CO 2 shadow price. - Abstract: The estimation of the value of carbon emissions has become a major research and policy topic since the establishment of the Kyoto Protocol. The shadow price of CO 2 provides information about the marginal abatement cost of this pollutant. It is an essential element in guiding environmental policy issues, since the CO 2 shadow price can be used when fixing carbon tax rates, in environmental cost-benefit analysis and in ascertaining an initial market price for a trading system. The water industry could play an important role in the reduction of greenhouse gas (GHG) emissions. This paper estimates the shadow price of CO 2 for a sample of wastewater treatment plants (WWTPs), using a parametric quadratic directional distance function. Following this, in a sensitivity analysis, the paper evaluates the impact of different settings of directional vectors on the shadow prices. Applying the Mann–Whitney and Kruskal–Wallis non-parametric tests, factors affecting CO 2 prices are investigated. The variation of CO 2 shadow prices across the WWTPs evaluated argues in favour of a market-based approach to CO 2 mitigation as opposed to command-and-control regulation. The paper argues that the estimation of the shadow price of CO 2 for non-power enterprises can provide incentives for reducing GHG emissions

  15. A direct measurement of the baryonic mass function of galaxies & implications for the galactic baryon fraction

    NARCIS (Netherlands)

    Papastergis, Emmanouil; Cattaneo, Andrea; Huang, Shan; Giovanelli, Riccardo; Haynes, Martha P.

    2012-01-01

    We use both an HI-selected and an optically-selected galaxy sample to directly measure the abundance of galaxies as a function of their "baryonic" mass (stars + atomic gas). Stellar masses are calculated based on optical data from the Sloan Digital Sky Survey (SDSS) and atomic gas masses are

  16. Direct assignment of molecular vibrations via normal mode analysis of the neutron dynamic pair distribution function technique

    International Nuclear Information System (INIS)

    Fry-Petit, A. M.; Sheckelton, J. P.; McQueen, T. M.; Rebola, A. F.; Fennie, C. J.; Mourigal, M.; Valentine, M.; Drichko, N.

    2015-01-01

    For over a century, vibrational spectroscopy has enhanced the study of materials. Yet, assignment of particular molecular motions to vibrational excitations has relied on indirect methods. Here, we demonstrate that applying group theoretical methods to the dynamic pair distribution function analysis of neutron scattering data provides direct access to the individual atomic displacements responsible for these excitations. Applied to the molecule-based frustrated magnet with a potential magnetic valence-bond state, LiZn 2 Mo 3 O 8 , this approach allows direct assignment of the constrained rotational mode of Mo 3 O 13 clusters and internal modes of MoO 6 polyhedra. We anticipate that coupling this well known data analysis technique with dynamic pair distribution function analysis will have broad application in connecting structural dynamics to physical properties in a wide range of molecular and solid state systems

  17. Identification of direct regulatory targets of the transcription factor Sox10 based on function and conservation

    Directory of Open Access Journals (Sweden)

    Lee Sanghyuk

    2008-09-01

    Full Text Available Abstract Background Sox10, a member of the Sry-related HMG-Box gene family, is a critical transcription factor for several important cell lineages, most notably the neural crest stem cells and the derivative peripheral glial cells and melanocytes. Thus far, only a handful of direct target genes are known for this transcription factor limiting our understanding of the biological network it governs. Results We describe identification of multiple direct regulatory target genes of Sox10 through a procedure based on function and conservation. By combining RNA interference technique and DNA microarray technology, we have identified a set of genes that show significant down-regulation upon introduction of Sox10 specific siRNA into Schwannoma cells. Subsequent comparative genomics analyses led to potential binding sites for Sox10 protein conserved across several mammalian species within the genomic region proximal to these genes. Multiple sites belonging to 4 different genes (proteolipid protein, Sox10, extracellular superoxide dismutase, and pleiotrophin were shown to directly interact with Sox10 by chromatin immunoprecipitation assay. We further confirmed the direct regulation through the identified cis-element for one of the genes, extracellular superoxide dismutase, using electrophoretic mobility shift assay and reporter assay. Conclusion In sum, the process of combining differential expression profiling and comparative genomics successfully led to further defining the role of Sox10, a critical transcription factor for the development of peripheral glia. Our strategy utilizing relatively accessible techniques and tools should be applicable to studying the function of other transcription factors.

  18. Direct assessment of lung function in COPD using CT densitometric measures

    International Nuclear Information System (INIS)

    Gu, Suicheng; Leader, Joseph; Gur, David; Pu, Jiantao; Zheng, Bin; Chen, Qihang; Sciurba, Frank; Kminski, Naftali

    2014-01-01

    To investigate whether lung function in patients with chronic obstructive pulmonary disease (COPD) can be directly predicted using CT densitometric measures and assess the underlying prediction errors as compared with the traditional spirometry-based measures. A total of 600 CT examinations were collected from a COPD study. In addition to the entire lung volume, the extent of emphysema depicted in each CT examination was quantified using density mask analysis (densitometry). The partial least square regression was used for constructing the prediction model, where a repeated random split-sample validation was employed. For each split, we randomly selected 400 CT exams for training (regression) purpose and the remaining 200 exams for assessing performance in prediction of lung function (e.g., FEV1 and FEV1/FVC) and disease severity. The absolute and percentage errors as well as their standard deviations were computed. The averaged percentage errors in prediction of FEV1, FEV1/FVC%, TLC, RV/TLC% and DLco% predicted were 33%, 17%, 9%, 18% and 23%, respectively. When classifying the exams in terms of disease severity grades using the CT measures, 37% of the subjects were correctly classified with no error and 83% of the exams were either correctly classified or classified into immediate neighboring categories. The linear weighted kappa and quadratic weighted kappa were 0.54 (moderate agreement) and 0.72 (substantial agreement), respectively. Despite the existence of certain prediction errors in quantitative assessment of lung function, the CT densitometric measures could be used to relatively reliably classify disease severity grade of COPD patients in terms of GOLD. (paper)

  19. A review of Green's function methods in computational fluid mechanics: Background, recent developments and future directions

    International Nuclear Information System (INIS)

    Dorning, J.

    1981-01-01

    The research and development over the past eight years on local Green's function methods for the high-accuracy, high-efficiency numerical solution of nuclear engineering problems is reviewed. The basic concepts and key ideas are presented by starting with an expository review of the original fully two-dimensional local Green's function methods developed for neutron diffusion and heat conduction, and continuing through the progressively more complicated and more efficient nodal Green's function methods for neutron diffusion, heat conduction and neutron transport to establish the background for the recent development of Green's function methods in computational fluid mechanics. Some of the impressive numerical results obtained via these classes of methods for nuclear engineering problems are briefly summarized. Finally, speculations are proffered on future directions in which the development of these types of methods in fluid mechanics and other areas might lead. (orig.) [de

  20. Direct releases to the surface and associated complementary cumulative distribution functions in the 1996 performance assessment for the Waste Isolation Pilot Plant: direct brine release

    International Nuclear Information System (INIS)

    Stoelzel, D.M.; O'Brien, D.G.; Garner, J.W.; Helton, J.C.; Johnson, J.D.; Smith, L.N.

    2000-01-01

    The following topics related to the treatment of direct brine releases to the surface environment in the 1996 performance assessment for the Waste Isolation Pilot Plant (WIPP) are presented: (i) mathematical description of models; (ii) uncertainty and sensitivity analysis results arising from subjective (i.e. epistemic) uncertainty for individual releases; (iii) construction of complementary cumulative distribution functions (CCDFs) arising from stochastic (i.e. aleatory) uncertainty; and (iv) uncertainty and sensitivity analysis results for CCDFs. The presented analyses indicate that direct brine releases do not constitute a serious threat to the effectiveness of the WIPP as a disposal facility for transuranic waste. Even when the effects of uncertain analysis inputs are taken into account, the CCDFs for direct brine releases fall substantially to the left of the boundary line specified in the US Environmental Protection Agency's standard for the geologic disposal of radioactive waste (40 CFR 191, 40 CFR 194)

  1. Patterned Arrays of Functional Lateral Heterostructures via Sequential Template-Directed Printing.

    Science.gov (United States)

    Li, Yifan; Su, Meng; Li, Zheng; Huang, Zhandong; Li, Fengyu; Pan, Qi; Ren, Wanjie; Hu, Xiaotian; Song, Yanlin

    2018-04-30

    The precise integration of microscale dots and lines with controllable interfacing connections is highly important for the fabrication of functional devices. To date, the solution-processible methods are used to fabricate the heterogeneous micropatterns for different materials. However, for increasingly miniaturized and multifunctional devices, it is extremely challenging to engineer the uncertain kinetics of a solution on the microstructures surfaces, resulting in uncontrollable interface connections and poor device performance. Here, a sequential template-directed printing process is demonstrated for the fabrication of arrayed microdots connected by microwires through the regulation of the Rayleigh-Taylor instability of material solution or suspension. Flexibility in the control of fluidic behaviors can realize precise interface connection between the micropatterns, including the microwires traversing, overlapping or connecting the microdots. Moreover, various morphologies such as circular, rhombic, or star-shaped microdots as well as straight, broken or curved microwires can be achieved. The lateral heterostructure printed with two different quantum dots displays bright dichromatic photoluminescence. The ammonia gas sensor printed by polyaniline and silver nanoparticles exhibits a rapid response time. This strategy can construct heterostructures in a facile manner by eliminating the uncertainty of the multimaterials interface connection, which will be promising for the development of novel lateral functional devices. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Directional loudness in an anechoic sound field, head-related transfer functions, and binaural summation

    DEFF Research Database (Denmark)

    Sivonen, Ville Pekka; Ellermeier, Wolfgang

    2006-01-01

    planes. Matches were obtained via a two-interval, adaptive forced-choice (2AFC) procedure for three center frequencies (0.4, 1 and 5 kHz) and two overall levels (45 and 65 dB SPL). The results showed that loudness is not constant over sound incidence angles, with directional sensitivity varying over......The effect of sound incidence angle on loudness was investigated using real sound sources positioned in an anechoic chamber. Eight normal-hearing listeners produced loudness matches between a frontal reference location and seven sources placed at other directions, both in the horizontal and median...... a range of up to 10 dB, exhibiting considerable frequency dependence, but only minor effects of overall level. The pattern of results varied substantially between subjects, but was largely accounted for by variations in individual head-related transfer functions. Modeling of binaural loudness based...

  3. Anisotropic dark matter distribution functions and impact on WIMP direct detection

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Schwetz, Thomas; Catena, Riccardo

    2013-01-01

    Dark matter N-body simulations suggest that the velocity distribution of dark matter is anisotropic. In this work we employ a mass model for the Milky Way whose parameters are determined from a fit to kinematical data. Then we adopt an ansatz for the dark matter phase space distribution which allows to construct self-consistent halo models which feature a degree of anisotropy as a function of the radius such as suggested by the simulations. The resulting velocity distributions are then used for an analysis of current data from dark matter direct detection experiments. We find that velocity distributions which are radially biased at large galactocentric distances (up to the virial radius) lead to an increased high velocity tail of the local dark matter distribution. This affects the interpretation of data from direct detection experiments, especially for dark matter masses around 10 GeV, since in this region the high velocity tail is sampled. We find that the allowed regions in the dark matter mass-cross section plane as indicated by possible hints for a dark matter signal reported by several experiments as well as conflicting exclusion limits from other experiments shift in a similar way when the halo model is varied. Hence, it is not possible to improve the consistency of the data by referring to anisotropic halo models of the type considered in this work

  4. Assessing the utility of phase-space-localized basis functions: Exploiting direct product structure and a new basis function selection procedure.

    Science.gov (United States)

    Brown, James; Carrington, Tucker

    2016-06-28

    In this paper we show that it is possible to use an iterative eigensolver in conjunction with Halverson and Poirier's symmetrized Gaussian (SG) basis [T. Halverson and B. Poirier, J. Chem. Phys. 137, 224101 (2012)] to compute accurate vibrational energy levels of molecules with as many as five atoms. This is done, without storing and manipulating large matrices, by solving a regular eigenvalue problem that makes it possible to exploit direct-product structure. These ideas are combined with a new procedure for selecting which basis functions to use. The SG basis we work with is orders of magnitude smaller than the basis made by using a classical energy criterion. We find significant convergence errors in previous calculations with SG bases. For sum-of-product Hamiltonians, SG bases large enough to compute accurate levels are orders of magnitude larger than even simple pruned bases composed of products of harmonic oscillator functions.

  5. Assessing the utility of phase-space-localized basis functions: Exploiting direct product structure and a new basis function selection procedure

    International Nuclear Information System (INIS)

    Brown, James; Carrington, Tucker

    2016-01-01

    In this paper we show that it is possible to use an iterative eigensolver in conjunction with Halverson and Poirier’s symmetrized Gaussian (SG) basis [T. Halverson and B. Poirier, J. Chem. Phys. 137, 224101 (2012)] to compute accurate vibrational energy levels of molecules with as many as five atoms. This is done, without storing and manipulating large matrices, by solving a regular eigenvalue problem that makes it possible to exploit direct-product structure. These ideas are combined with a new procedure for selecting which basis functions to use. The SG basis we work with is orders of magnitude smaller than the basis made by using a classical energy criterion. We find significant convergence errors in previous calculations with SG bases. For sum-of-product Hamiltonians, SG bases large enough to compute accurate levels are orders of magnitude larger than even simple pruned bases composed of products of harmonic oscillator functions.

  6. Palladium-Catalyzed C-H Functionalization Using Guanidine as a Directing Group: Ortho Arylation and Olefination of Arylguanidines

    Science.gov (United States)

    Shao, Jiaan; Chen, Wenteng; Giulianotti, Marc A.; Houghten, Richard A.; Yu, Yongping

    2012-01-01

    Palladium-catalyzed C-H functionalization using guanidine as the directing group was achieved under mild reaction conditions. Various guanidine derivatives were produced in moderate to good yields by using simple unactivated arenes or ethyl acrylate as the source of arylation or olefination respectively. PMID:23095022

  7. Polymer density functional theory approach based on scaling second-order direct correlation function.

    Science.gov (United States)

    Zhou, Shiqi

    2006-06-01

    A second-order direct correlation function (DCF) from solving the polymer-RISM integral equation is scaled up or down by an equation of state for bulk polymer, the resultant scaling second-order DCF is in better agreement with corresponding simulation results than the un-scaling second-order DCF. When the scaling second-order DCF is imported into a recently proposed LTDFA-based polymer DFT approach, an originally associated adjustable but mathematically meaningless parameter now becomes mathematically meaningful, i.e., the numerical value lies now between 0 and 1. When the adjustable parameter-free version of the LTDFA is used instead of the LTDFA, i.e., the adjustable parameter is fixed at 0.5, the resultant parameter-free version of the scaling LTDFA-based polymer DFT is also in good agreement with the corresponding simulation data for density profiles. The parameter-free version of the scaling LTDFA-based polymer DFT is employed to investigate the density profiles of a freely jointed tangent hard sphere chain near a variable sized central hard sphere, again the predictions reproduce accurately the simulational results. Importance of the present adjustable parameter-free version lies in its combination with a recently proposed universal theoretical way, in the resultant formalism, the contact theorem is still met by the adjustable parameter associated with the theoretical way.

  8. Mena binds α5 integrin directly and modulates α5β1 function.

    Science.gov (United States)

    Gupton, Stephanie L; Riquelme, Daisy; Hughes-Alford, Shannon K; Tadros, Jenny; Rudina, Shireen S; Hynes, Richard O; Lauffenburger, Douglas; Gertler, Frank B

    2012-08-20

    Mena is an Ena/VASP family actin regulator with roles in cell migration, chemotaxis, cell-cell adhesion, tumor cell invasion, and metastasis. Although enriched in focal adhesions, Mena has no established function within these structures. We find that Mena forms an adhesion-regulated complex with α5β1 integrin, a fibronectin receptor involved in cell adhesion, motility, fibronectin fibrillogenesis, signaling, and growth factor receptor trafficking. Mena bound directly to the carboxy-terminal portion of the α5 cytoplasmic tail via a 91-residue region containing 13 five-residue "LERER" repeats. In fibroblasts, the Mena-α5 complex was required for "outside-in" α5β1 functions, including normal phosphorylation of FAK and paxillin and formation of fibrillar adhesions. It also supported fibrillogenesis and cell spreading and controlled cell migration speed. Thus, fibroblasts require Mena for multiple α5β1-dependent processes involving bidirectional interactions between the extracellular matrix and cytoplasmic focal adhesion proteins.

  9. Direct and indirect effects of attention and visual function on gait impairment in Parkinson's disease: influence of task and turning.

    Science.gov (United States)

    Stuart, Samuel; Galna, Brook; Delicato, Louise S; Lord, Sue; Rochester, Lynn

    2017-07-01

    Gait impairment is a core feature of Parkinson's disease (PD) which has been linked to cognitive and visual deficits, but interactions between these features are poorly understood. Monitoring saccades allows investigation of real-time cognitive and visual processes and their impact on gait when walking. This study explored: (i) saccade frequency when walking under different attentional manipulations of turning and dual-task; and (ii) direct and indirect relationships between saccades, gait impairment, vision and attention. Saccade frequency (number of fast eye movements per-second) was measured during gait in 60 PD and 40 age-matched control participants using a mobile eye-tracker. Saccade frequency was significantly reduced in PD compared to controls during all conditions. However, saccade frequency increased with a turn and decreased under dual-task for both groups. Poorer attention directly related to saccade frequency, visual function and gait impairment in PD, but not controls. Saccade frequency did not directly relate to gait in PD, but did in controls. Instead, saccade frequency and visual function deficit indirectly impacted gait impairment in PD, which was underpinned by their relationship with attention. In conclusion, our results suggest a vital role for attention with direct and indirect influences on gait impairment in PD. Attention directly impacted saccade frequency, visual function and gait impairment in PD, with connotations for falls. It also underpinned indirect impact of visual and saccadic impairment on gait. Attention therefore represents a key therapeutic target that should be considered in future research. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  10. Use of Random and Site-Directed Mutagenesis to Probe Protein Structure-Function Relationships: Applied Techniques in the Study of Helicobacter pylori.

    Science.gov (United States)

    Whitmire, Jeannette M; Merrell, D Scott

    2017-01-01

    Mutagenesis is a valuable tool to examine the structure-function relationships of bacterial proteins. As such, a wide variety of mutagenesis techniques and strategies have been developed. This chapter details a selection of random mutagenesis methods and site-directed mutagenesis procedures that can be applied to an array of bacterial species. Additionally, the direct application of the techniques to study the Helicobacter pylori Ferric Uptake Regulator (Fur) protein is described. The varied approaches illustrated herein allow the robust investigation of the structural-functional relationships within a protein of interest.

  11. Free vibration analysis of a rotary smart two directional functionally graded piezoelectric material in axial symmetry circular nanoplate

    Science.gov (United States)

    Mahinzare, Mohammad; Ranjbarpur, Hosein; Ghadiri, Majid

    2018-02-01

    In this article, free vibration of a rotating circular nanoplate made of two directional functionally graded piezo materials (two directional FGPM) is modeled based on the first shear deformation theory (FSDT). Based on the power-law model, electro-elastic properties of two directional FGP rotating circular nanoplates are supposed to change continuously along the thickness and radius. Employing the modified couple stress theory, the small size effect of the equations of the plate is considered. The governing equations of the first shear deformation theory (FSDT) for the studied plate are obtained based on Hamilton's principle; these equations are solved using differential quadrature method (DQM). It is shown that the vibration behavior of the plate is significantly affected by angular velocity, external electric voltage, size dependency and power-law index (thickness and radial directions).

  12. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-01-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response

  13. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Lin FO

    2016-10-01

    Full Text Available The Editor-in-Chief and Publisher of OncoTargets and Therapy have been alerted to unacceptable levels of duplication with another published paper: Zhang D, Ni Z, Xu X, and Xiao J. MiR-32 Functions as a Tumor Suppressor and Directly Targets EZH2 in Human Oral Squamous Cell Carcinoma. Medical Science Monitor. 20:2527–2535, 2014.Accordingly, we retract Lin FO, Yao LJ, Xiao J, Liu DF, and Ni ZY. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma. OncoTargets and Therapy. 2014;7:1583–1591.This Retraction relates to 

  14. Direct Quantum Dynamics Using Grid-Based Wave Function Propagation and Machine-Learned Potential Energy Surfaces.

    Science.gov (United States)

    Richings, Gareth W; Habershon, Scott

    2017-09-12

    We describe a method for performing nuclear quantum dynamics calculations using standard, grid-based algorithms, including the multiconfiguration time-dependent Hartree (MCTDH) method, where the potential energy surface (PES) is calculated "on-the-fly". The method of Gaussian process regression (GPR) is used to construct a global representation of the PES using values of the energy at points distributed in molecular configuration space during the course of the wavepacket propagation. We demonstrate this direct dynamics approach for both an analytical PES function describing 3-dimensional proton transfer dynamics in malonaldehyde and for 2- and 6-dimensional quantum dynamics simulations of proton transfer in salicylaldimine. In the case of salicylaldimine we also perform calculations in which the PES is constructed using Hartree-Fock calculations through an interface to an ab initio electronic structure code. In all cases, the results of the quantum dynamics simulations are in excellent agreement with previous simulations of both systems yet do not require prior fitting of a PES at any stage. Our approach (implemented in a development version of the Quantics package) opens a route to performing accurate quantum dynamics simulations via wave function propagation of many-dimensional molecular systems in a direct and efficient manner.

  15. Scenario-based energy efficiency and productivity in China: A non-radial directional distance function analysis

    International Nuclear Information System (INIS)

    Wang, H.; Zhou, P.; Zhou, D.Q.

    2013-01-01

    Improving energy efficiency and productivity is one of the most cost-effective ways for achieving the sustainable development target in China. This paper employs non-radial directional distance function approach to empirically investigate energy efficiency and energy productivity by including CO 2 emissions as an undesirable output. Three production scenarios, namely energy conservation (EC), energy conservation and emission reduction (ECER), and energy conservation, emission reduction and economic growth (ECEREG), are specified to assess China's energy efficiency and productivity growth during the period of Eleventh Five-Year Plan. Our empirical results show that there exist substantial differences in China's total-factor energy efficiency and productivity under different scenarios. Under the ECEREG scenario, the national average total-factor energy efficiency score was 0.6306 in 2005–2010, while the national average total-factor energy productivity increased by 0.27% annually during the period. The main driving force for energy productivity growth in China was energy technological change rather than energy efficiency change. - Highlights: • China's regional energy efficiency and productivity in 2005–2010 are evaluated. • Three production scenarios are considered. • Non-radial directional distance function with CO 2 emissions is employed. • Technological change is the main driver for China's energy productivity growth

  16. The influence of prior knowledge on the retrieval-directed function of note taking in prior knowledge activation

    NARCIS (Netherlands)

    Wetzels, Sandra; Kester, Liesbeth; Van Merriënboer, Jeroen; Broers, Nick

    2010-01-01

    Wetzels, S. A. J., Kester, L., Van Merriënboer, J. J. G., & Broers, N. J. (2011). The influence of prior knowledge on the retrieval-directed function of note taking in prior knowledge activation. British Journal of Educational Psychology, 81(2), 274-291. doi: 10.1348/000709910X517425

  17. Direct functionalization of nanodiamonds with maleimide

    KAUST Repository

    El Tall, Omar

    2014-05-13

    Diamond materials span a wide range of attractive physical properties, including large mechanical resistance, high thermal conductivity, and tunable optoelectronic behavior when suitably doped. Down to the nanoscale, embedded diamond nanoparticles find use in surface coatings and nanocomposites and are promising building elements in nanophotonic device engineering. The nature of the solubilizing substituents and specific functional groups appended to the nanodiamond surface defines the function of the nanoparticle and in turn its field of applicability. Synthetic nanodiamonds prepared by detonation protocols, so-called detonation diamond nanoparticles (DDNP), are composed of primary nanocrystals (2-10 nm) and their aggregates. A detailed experimental section can be found in the Supporting Information; the XRD analysis of the GDNP(800) precursor confirmed the integrity of the diamond core upon thermal annealing.

  18. Direct functionalization of nanodiamonds with maleimide

    KAUST Repository

    El Tall, Omar; Hou, Yuanfang; Abou-Hamad, Edy; Raja, Inam Ul haq; Hedhili, Mohamed N.; Peng, Wei; Mahfouz, Remi; Bakr, Osman; Beaujuge, Pierre

    2014-01-01

    Diamond materials span a wide range of attractive physical properties, including large mechanical resistance, high thermal conductivity, and tunable optoelectronic behavior when suitably doped. Down to the nanoscale, embedded diamond nanoparticles find use in surface coatings and nanocomposites and are promising building elements in nanophotonic device engineering. The nature of the solubilizing substituents and specific functional groups appended to the nanodiamond surface defines the function of the nanoparticle and in turn its field of applicability. Synthetic nanodiamonds prepared by detonation protocols, so-called detonation diamond nanoparticles (DDNP), are composed of primary nanocrystals (2-10 nm) and their aggregates. A detailed experimental section can be found in the Supporting Information; the XRD analysis of the GDNP(800) precursor confirmed the integrity of the diamond core upon thermal annealing.

  19. Direct and indirect effects of nutritional status, physical function and cognitive function on activities of daily living in Japanese older adults requiring long-term care.

    Science.gov (United States)

    Kamo, Tomohiko; Nishida, Yuusuke

    2014-10-01

    To identify the direct and indirect effects of nutritional status, physical function, and cognitive function on activities of daily living in Japanese older adults requiring long-term care. In total, 179 participants aged ≥ 65 years who were eligible for long-term care insurance (mean age 85.5 ± 7.8 years) were recruited for this study. Nutritional status (Mini Nutritional Assessment, Short Form) and physical function (Short Physical Performance Battery) were examined. Activities of daily living, cognitive function and frailty were assessed using the Barthel Index, Mini-Mental State Examination and Clinical Frailty Scale, respectively. Path analysis was used to determine relationships between these factors and the activities of daily living. For Japanese older adults requiring long-term care, pathways were modeled for nutritional status, physical function and the activities of daily living. The total effect of nutritional status was 0.516 (Pphysical function on the activities of daily living was 0.458 (Pphysical function in aged Japanese people requiring long-term care. These findings suggest that maintaining good nutritional status and nutritional support might delay physical function decline, and prolong the activities of daily living. © 2013 Japan Geriatrics Society.

  20. Estimating the population size and colony boundary of subterranean termites by using the density functions of directionally averaged capture probability.

    Science.gov (United States)

    Su, Nan-Yao; Lee, Sang-Hee

    2008-04-01

    Marked termites were released in a linear-connected foraging arena, and the spatial heterogeneity of their capture probabilities was averaged for both directions at distance r from release point to obtain a symmetrical distribution, from which the density function of directionally averaged capture probability P(x) was derived. We hypothesized that as marked termites move into the population and given sufficient time, the directionally averaged capture probability may reach an equilibrium P(e) over the distance r and thus satisfy the equal mixing assumption of the mark-recapture protocol. The equilibrium capture probability P(e) was used to estimate the population size N. The hypothesis was tested in a 50-m extended foraging arena to simulate the distance factor of field colonies of subterranean termites. Over the 42-d test period, the density functions of directionally averaged capture probability P(x) exhibited four phases: exponential decline phase, linear decline phase, equilibrium phase, and postequilibrium phase. The equilibrium capture probability P(e), derived as the intercept of the linear regression during the equilibrium phase, correctly projected N estimates that were not significantly different from the known number of workers in the arena. Because the area beneath the probability density function is a constant (50% in this study), preequilibrium regression parameters and P(e) were used to estimate the population boundary distance 1, which is the distance between the release point and the boundary beyond which the population is absent.

  1. Direct electrical stimulation as an input gate into brain functional networks: principles, advantages and limitations.

    Science.gov (United States)

    Mandonnet, Emmanuel; Winkler, Peter A; Duffau, Hugues

    2010-02-01

    While the fundamental and clinical contribution of direct electrical stimulation (DES) of the brain is now well acknowledged, its advantages and limitations have not been re-evaluated for a long time. Here, we critically review exactly what DES can tell us about cerebral function. First, we show that DES is highly sensitive for detecting the cortical and axonal eloquent structures. Moreover, DES also provides a unique opportunity to study brain connectivity, since each area responsive to stimulation is in fact an input gate into a large-scale network rather than an isolated discrete functional site. DES, however, also has a limitation: its specificity is suboptimal. Indeed, DES may lead to interpretations that a structure is crucial because of the induction of a transient functional response when stimulated, whereas (1) this effect is caused by the backward spreading of the electro-stimulation along the network to an essential area and/or (2) the stimulated region can be functionally compensated owing to long-term brain plasticity mechanisms. In brief, although DES is still the gold standard for brain mapping, its combination with new methods such as perioperative neurofunctional imaging and biomathematical modeling is now mandatory, in order to clearly differentiate those networks that are actually indispensable to function from those that can be compensated.

  2. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    Energy Technology Data Exchange (ETDEWEB)

    Mascagni, Daniela Branco Tavares [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Miyazaki, Celina Massumi [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil); Cruz, Nilson Cristino da [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Leite de Moraes, Marli [Federal University of São Paulo, Unifesp, Campus São José dos Campos, SP (Brazil); Riul, Antonio [University of Campinas - Unicamp, Campinas, São Paulo (Brazil); Ferreira, Marystela, E-mail: marystela@ufscar.br [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil)

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L{sup ‐1} and sensitivity of 2.47 μA·cm{sup −2}·mmol{sup −1}·L for glucose with the (GPDDA/GPSS){sub 1}/(GPDDA/GOx){sub 2} architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  3. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    International Nuclear Information System (INIS)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; Cruz, Nilson Cristino da; Leite de Moraes, Marli; Riul, Antonio; Ferreira, Marystela

    2016-01-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L ‐1 and sensitivity of 2.47 μA·cm −2 ·mmol −1 ·L for glucose with the (GPDDA/GPSS) 1 /(GPDDA/GOx) 2 architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  4. The direct and indirect effects of lurasidone monotherapy on functional improvement among patients with bipolar depression: results from a randomized placebo-controlled trial.

    Science.gov (United States)

    Rajagopalan, Krithika; Bacci, Elizabeth Dansie; Wyrwich, Kathleen W; Pikalov, Andrei; Loebel, Antony

    2016-12-01

    Bipolar depression is characterized by depressive symptoms and impairment in many areas of functioning, including work, family, and social life. The objective of this study was to assess the independent, direct effect of lurasidone treatment on functioning improvement, and examine the indirect effect of lurasidone treatment on functioning improvement, mediated through improvements in depression symptoms. Data from a 6-week placebo-controlled trial assessing the effect of lurasidone monotherapy versus placebo in patients with bipolar depression was used. Patient functioning was measured using the Sheehan disability scale (SDS). Descriptive statistics were used to assess the effect of lurasidone on improvement on the SDS total and domain scores (work/school, social, and family life), as well as number of days lost and unproductive due to symptoms. Path analyses evaluated the total effect (β1), as well as the indirect effect (β2×β3) and direct effect (β4) of lurasidone treatment on SDS total score change, using standardized beta path coefficients and baseline scores as covariates. The direct effect of treatment on SDS total score change and indirect effects accounting for mediation through depression improvement were examined for statistical significance and magnitude using MPlus. In this 6-week trial (N = 485), change scores from baseline to 6-weeks were significantly larger for both lurasidone treatment dosage groups versus placebo on the SDS total and all three SDS domain scores (p accounting for depression improvement. Results demonstrated statistically significant improvement in functioning among patients on lurasidone monotherapy compared to placebo. Improvement in functioning among patients on lurasidone was largely mediated through a reduction in depression symptoms, but lurasidone also had a medium and statistically significant independent direct effect in improving functioning.

  5. Generating function rationality for anisotropic vicious walk configurations on the directed square lattice

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, F M [Department of Mathematics, Lahore University of Management Sciences, Sector U, DHA, Lahore (Pakistan); Essam, J W [Department of Mathematics and Statistics, Royal Holloway College, University of London, Egham, Surrey TW20 0EX (United Kingdom)

    2006-06-15

    Guttmann and Voege introduced a model of f-friendly walkers and argued that a generating function for the number of n-walker configurations making a total of k left steps is a rational function with denominator (1 - x{sup n}){sup k+1}. They also found that for f = 0, 1 and 2 the sums of the numerator coefficients for watermelon configurations in which each of 3 walkers made w left steps were 3-dimensional Catalan numbers. Here it is shown that for n vicious walker (f = 0) watermelon configurations the m{sup th} coefficient of the numerator is the generalised Naryana number N(w, n, m) of Sulanke which is symmetric under interchange of w and n. The sums, C{sub w,n}, of these coefficients as a sequence indexed by w are n-dimensional Catalan numbers or w-dimensional Catalan numbers if indexed by n. The unexpected symmetry in n and w is seen to follow from duality. Inui and Katori introduced Fermi walk configurations which are non-crossing subsets of the directed random walks between opposite corners of a rectangular l x w grid. They related these to Bose configurations which biject to vicious walker watermelon configurations. Bose configurations include multisets. Here we consider generating functions for the numbers of configurations in which l and w are fixed. It is found that the maximum number of walks in a Fermi configuration is lw + 1 and the number of configurations corresponding to this number of walks is C{sub l,w}. This limit on the number of walks in a Fermi configuration leads to the rationality of the Bose generating function and by duality to the rationality of the generating function of Guttmann and Voege.

  6. Generating function rationality for anisotropic vicious walk configurations on the directed square lattice

    International Nuclear Information System (INIS)

    Bhatti, F M; Essam, J W

    2006-01-01

    Guttmann and Voege introduced a model of f-friendly walkers and argued that a generating function for the number of n-walker configurations making a total of k left steps is a rational function with denominator (1 - x n ) k+1 . They also found that for f = 0, 1 and 2 the sums of the numerator coefficients for watermelon configurations in which each of 3 walkers made w left steps were 3-dimensional Catalan numbers. Here it is shown that for n vicious walker (f = 0) watermelon configurations the m th coefficient of the numerator is the generalised Naryana number N(w, n, m) of Sulanke which is symmetric under interchange of w and n. The sums, C w,n , of these coefficients as a sequence indexed by w are n-dimensional Catalan numbers or w-dimensional Catalan numbers if indexed by n. The unexpected symmetry in n and w is seen to follow from duality. Inui and Katori introduced Fermi walk configurations which are non-crossing subsets of the directed random walks between opposite corners of a rectangular l x w grid. They related these to Bose configurations which biject to vicious walker watermelon configurations. Bose configurations include multisets. Here we consider generating functions for the numbers of configurations in which l and w are fixed. It is found that the maximum number of walks in a Fermi configuration is lw + 1 and the number of configurations corresponding to this number of walks is C l,w . This limit on the number of walks in a Fermi configuration leads to the rationality of the Bose generating function and by duality to the rationality of the generating function of Guttmann and Voege

  7. Direct electrochemistry and electrocatalysis of a glucose oxidase-functionalized bioconjugate as a trace label for ultrasensitive detection of thrombin.

    Science.gov (United States)

    Bai, Lijuan; Yuan, Ruo; Chai, Yaqin; Yuan, Yali; Wang, Yan; Xie, Shunbi

    2012-11-18

    For the first time, a glucose oxidase-functionalized bioconjugate was prepared and served as a new trace label through its direct electrochemistry and electrocatalysis in a sandwich-type electrochemical aptasensor for ultrasensitive detection of thrombin.

  8. A nanobody directed to a functional epitope on VEGF, as a novel strategy for cancer treatment

    International Nuclear Information System (INIS)

    Farajpour, Zahra; Rahbarizadeh, Fatemeh; Kazemi, Bahram; Ahmadvand, Davoud

    2014-01-01

    Highlights: • A novel nanobody directed to antigenic regions on VEGF was identified. • Our nanobody was successfully purified. • Our nanobody significantly inhibited VEGF-induced proliferation of HUVECs in a dose dependent manner. - Abstract: Compelling evidence suggests that vascular endothelial growth factor (VEGF), due to its essential role in angiogenesis, is a critical target for cancer treatment. Neutralizing monoclonal antibodies against VEGF are important class of drugs used in cancer therapy. However, the cost of production, large size, and immunogenicity are main drawbacks of conventional monoclonal therapy. Nanobodies are the smallest antigen-binding antibody fragments, which occur naturally in camelidae. Because of their remarkable features, we decided to use an immune library of nanobody to direct phage display to recognition of novel functional epitopes on VEGF. Four rounds of selection were performed and six phage-displayed nanobodies were obtained from an immune phage library. The most reactive clone in whole-cell ELISA experiments, was purified and assessed in proliferation inhibition assay. Purified ZFR-5 not only blocked interaction of VEGF with its receptor in cell ELISA experiments, but also was able to significantly inhibit proliferation response of human umbilical vein endothelial cells to VEGF in a dose-dependent manner. Taken together, our study demonstrates that by using whole-cell ELISA experiments, nanobodies against antigenic regions included in interaction of VEGF with its receptors can be directed. Because of unique and intrinsic properties of a nanobody and the ability of selected nanobody for blocking the epitope that is important for biological function of VEGF, it represents novel potential drug candidate

  9. A nanobody directed to a functional epitope on VEGF, as a novel strategy for cancer treatment

    Energy Technology Data Exchange (ETDEWEB)

    Farajpour, Zahra [Department of Pharmaceutical Biotechnology, School of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran (Iran, Islamic Republic of); Rahbarizadeh, Fatemeh, E-mail: rahbarif@modares.ac.ir [Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Kazemi, Bahram [Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran (Iran, Islamic Republic of); Ahmadvand, Davoud [School of Allied Medical Sciences, Iran University of Medical Sciences, Tehran (Iran, Islamic Republic of)

    2014-03-28

    Highlights: • A novel nanobody directed to antigenic regions on VEGF was identified. • Our nanobody was successfully purified. • Our nanobody significantly inhibited VEGF-induced proliferation of HUVECs in a dose dependent manner. - Abstract: Compelling evidence suggests that vascular endothelial growth factor (VEGF), due to its essential role in angiogenesis, is a critical target for cancer treatment. Neutralizing monoclonal antibodies against VEGF are important class of drugs used in cancer therapy. However, the cost of production, large size, and immunogenicity are main drawbacks of conventional monoclonal therapy. Nanobodies are the smallest antigen-binding antibody fragments, which occur naturally in camelidae. Because of their remarkable features, we decided to use an immune library of nanobody to direct phage display to recognition of novel functional epitopes on VEGF. Four rounds of selection were performed and six phage-displayed nanobodies were obtained from an immune phage library. The most reactive clone in whole-cell ELISA experiments, was purified and assessed in proliferation inhibition assay. Purified ZFR-5 not only blocked interaction of VEGF with its receptor in cell ELISA experiments, but also was able to significantly inhibit proliferation response of human umbilical vein endothelial cells to VEGF in a dose-dependent manner. Taken together, our study demonstrates that by using whole-cell ELISA experiments, nanobodies against antigenic regions included in interaction of VEGF with its receptors can be directed. Because of unique and intrinsic properties of a nanobody and the ability of selected nanobody for blocking the epitope that is important for biological function of VEGF, it represents novel potential drug candidate.

  10. Caspase-2 associates with FAN through direct interaction and overlapping functionality.

    Science.gov (United States)

    Forsberg, Jeremy; Li, Xinge; Zamaraev, Aleksey V; Panaretakis, Theocharis; Zhivotovsky, Boris; Olsson, Magnus

    2018-05-23

    Caspase-2 has been implicated in diverse cellular processes, and the identification of factors with which it interacts has steadily increased. In the present study, we report a direct interaction between caspase-2 and factor associated with neutral sphingomyelinase activation (FAN) using yeast two-hybrid screening and co-immunoprecipitation. Further, stable suppression of caspase-2 expression in HEK293T and HeLa cells enabled a systematic investigation of putative novel enzyme functionalities, especially with respect to ceramide production, cell migration, IL-6 production and vesicular homeostasis, all of which have been previously reported to be associated with FAN. Lipidomics excluded the involvement of caspase-2 in the generation of ceramide species, but caspase-2-dependent deregulation of IL-6 release, vesicular size and delayed cell relocation supported an association between caspase-2 and FAN. Collectively, these data identify a novel caspase-2-interacting factor, FAN, and expand the role for the enzyme in seemingly non-apoptotic cellular mechanisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

    Science.gov (United States)

    Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

    2018-04-01

    This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

  12. Lightness functions

    DEFF Research Database (Denmark)

    Campi, Stefano; Gardner, Richard; Gronchi, Paolo

    2012-01-01

    Variants of the brightness function of a convex body K in n-dimensional Euclidean are investigated. The Lambertian lightness function L(K; v , w ) gives the total reflected light resulting from illumination by a light source at infinity in the direction w that is visible when looking...... in the direction v . The partial brightness function R( K ; v , w ) gives the area of the projection orthogonal to v of the portion of the surface of K that is both illuminated by a light source from the direction w and visible when looking in the direction v . A class of functions called lightness functions...... is introduced that includes L(K;.) and R(K;.) as special cases. Much of the theory of the brightness function like uniqueness, stability, and the existence and properties of convex bodies of maximal and minimal volume with finitely many function values equal to those of a given convex body, is extended...

  13. Direct detection of cysteine using functionalized BaTiO3 nanoparticles film based self-powered biosensor.

    Science.gov (United States)

    Selvarajan, Sophia; Alluri, Nagamalleswara Rao; Chandrasekhar, Arunkumar; Kim, Sang-Jae

    2017-05-15

    Simple, novel, and direct detection of clinically important biomolecules have continuous demand among scientific community as well as in market. Here, we report the first direct detection and facile fabrication of a cysteine-responsive, film-based, self-powered device. NH 2 functionalized BaTiO 3 nanoparticles (BT-NH 2 NPs) suspended in a three-dimensional matrix of an agarose (Ag) film, were used for cysteine detection. BaTiO 3 nanoparticles (BT NPs) semiconducting as well as piezoelectric properties were harnessed in this study. The changes in surface charge properties of the film with respect to cysteine concentrations were determined using a current-voltage (I-V) technique. The current response increased with cysteine concentration (linear concentration range=10µM-1mM). Based on the properties of the composite (BT/Ag), we created a self-powered cysteine sensor in which the output voltage from a piezoelectric nanogenerator was used to drive the sensor. The potential drop across the sensor was measured as a function of cysteine concentrations. Real-time analysis of sensor performance was carried out on urine samples by non-invasive method. This novel sensor demonstrated good selectivity, linear concentration range and detection limit of 10µM; acceptable for routine analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. State feedback integral control for a rotary direct drive servo valve using a Lyapunov function approach.

    Science.gov (United States)

    Yu, Jue; Zhuang, Jian; Yu, Dehong

    2015-01-01

    This paper concerns a state feedback integral control using a Lyapunov function approach for a rotary direct drive servo valve (RDDV) while considering parameter uncertainties. Modeling of this RDDV servovalve reveals that its mechanical performance is deeply influenced by friction torques and flow torques; however, these torques are uncertain and mutable due to the nature of fluid flow. To eliminate load resistance and to achieve satisfactory position responses, this paper develops a state feedback control that integrates an integral action and a Lyapunov function. The integral action is introduced to address the nonzero steady-state error; in particular, the Lyapunov function is employed to improve control robustness by adjusting the varying parameters within their value ranges. This new controller also has the advantages of simple structure and ease of implementation. Simulation and experimental results demonstrate that the proposed controller can achieve higher control accuracy and stronger robustness. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  15. Principle of topography-directed inkjet printing for functional micro-tracks in flexible substrates

    Science.gov (United States)

    Keum, Chang-Min; Lee, In-Ho; Park, Hea-Lim; Kim, Chiwoo; Lüssem, Björn; Choi, Jong Sun; Lee, Sin-Doo

    2017-06-01

    We present a general principle of topography-directed (TD) inkjet printing for functional micro-tracks embedded in a flexible elastomer substrate. The essential features of the TD inkjet printing in a micro-structured substrate with periodic grooves and ridges are described in terms of the topographic parameters for the transformation from a single droplet to a filament or an edge-disjoint pattern of ink in the groove. Silver ink, being widely used for producing conductive wires by conventional inkjet printing, is utilized as a testbed in our study. The underlying mechanisms for the spreading and drying processes of ink drops under the topographic compartment can be understood in a two-dimensional parameter space of the aspect ratio of the groove and the contact angle of ink on the substrate. The wetting morphologies of ink droplets are described in an analytical model where the Laplace pressure and the mean curvature at the vapor/ink interface are taken into account. The first principle of the TD inkjet printing would be applicable for constructing a variety of functional micro-tracks with high pattern fidelity from different classes of solutions such as conducting polymers, organic semiconductors, and colloidal nanoparticles.

  16. [1+1+3] Annulation of Diazoenals and Vinyl Azides: Direct Synthesis of Functionalized 1-Pyrrolines through Olefination.

    Science.gov (United States)

    Kanchupalli, Vinaykumar; Katukojvala, Sreenivas

    2018-05-04

    A dirhodium carboxylate catalyzed [1+1+3] annulation reaction of diazoenals and vinyl azides that gives synthetically important enal-functionalized 1-pyrroline derivatives was developed. The reaction involves a novel rhodium-catalyzed olefination of diazoenals with vinyl azides via electrophilic enal carbenoids, resulting in a new class of enal acrylates. The annulation reaction was used for the direct synthesis of valuable deuterated 1-pyrrolines. Structural diversification of the enal-functionalized 1-pyrrolines resulted in the biologically important pyrrolidine-fused oxaziridine, amino acid derivatives, and a 6-azabicyclo[3.2.1]octane motif present in polycyclic alkaloids. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Memoization in Type-Directed Partial Evaluation

    DEFF Research Database (Denmark)

    Balat, Vincent; Danvy, Olivier

    2002-01-01

    We use a code generator—type-directed partial evaluation— to verify conversions between isomorphic types, or more precisely to verify that a composite function is the identity function at some complicated type. A typed functional language such as ML provides a natural support to express the funct......We use a code generator—type-directed partial evaluation— to verify conversions between isomorphic types, or more precisely to verify that a composite function is the identity function at some complicated type. A typed functional language such as ML provides a natural support to express...... originate in the handling of sums, which uses delimited continuations. We successfully eliminate these redundancies by extending type-directed partial evaluation with memoization capabilities. The result only works for pure functional programs, but it provides an unexpected use of code generation...... and it yields orders-of-magnitude improvements both in time and in space for type isomorphisms. Basic Research in Computer Science (www. brics. dk), funded by the Danish National Research Foundation....

  18. Direct and indirect effects of copper-contaminated sediments on the functions of model freshwater ecosystems.

    Science.gov (United States)

    Gardham, Stephanie; Chariton, Anthony A; Hose, Grant C

    2015-01-01

    Copper is acutely toxic to, and directly affects, primary producers and decomposers, which are key players in essential processes such as the nutrient cycle in freshwater ecosystems. Even though the indirect effects of metals (for example effects due to changes in species interactions) may be more common than direct effects, little is known about the indirect effects of copper on primary producers and decomposers. The effects of copper on phytoplankton, macrophytes, periphyton and organic matter decomposition in an outdoor lentic mesocosm facility were assessed, and links between the responses examined. Copper directly decreased macrophyte growth, subsurface organic matter decomposition, and the potential for high phytoplankton Chlorophyll a concentrations. However, periphyton cover and organic matter decomposition on the surface of the sediment were stimulated by the presence of copper. These latter responses were attributed to indirect effects, due to a reduction in grazing pressure from snails, particularly Physa acuta, in the higher copper-contaminated mesocosms. This permitted the growth of periphyton and other heterotrophs, ultimately increasing decomposition at the sediment surface. The present study demonstrates the pronounced influence indirect effects may have on ecological function, findings that may not be observed in traditional laboratory studies (which utilize single species or simplistic communities).

  19. Prototyping chips in minutes: Direct Laser Plotting (DLP) of functional microfluidic structures

    KAUST Repository

    Wang, Limu

    2013-10-10

    We report a fast and simple prototyping method to fabricate polymer-based microfluidic chips using Direct Laser Plotting (DLP) technique, by which various functional micro-structures can be realized within minutes, in a mask-free and out-of-cleanroom fashion. A 2D Computer-Aid-Design (CAD) software was employed to layout the required micro-structures and micro-channels, a CO2 laser plotter was then used to construct the microstructures. The desired patterns can be plotted directly on PDMS substrates and bio-compatible polymer films by manipulating the strength and density of laser pulses. With the DLP technique, chip-embedded micro-electrodes, micro-mixers and 3D microfluidic chips with 5 layers, which normally require several days of work in a cleanroom facility, can be fabricated in minutes in common laboratory. This novel method can produce microfluidic channels with average feature size of 100 μm, while feature size of 50 μm or smaller is achievable by making use of the interference effect from laser impulsion. In this report, we present the optimized parameters for successful fabrication of 3D microchannels, micro-mixers and microfluidic chips for protein concentration measurements (Bovine Serum Albumine (BSA) test), and a novel procedure to pattern flexible embedding electrodes on PDMS-based microfluidic chips. DLP offers a convenient and low cost alternative to conventional microfluidic channel fabrication technique which relies on complicated and hazardous soft lithography process.

  20. No Change in Rectal Sensitivity After Gut-Directed Hypnotherapy in Children With Functional Abdominal Pain or Irritable Bowel Syndrome

    NARCIS (Netherlands)

    Vlieger, A. M.; van den Berg, M. M.; Menko-Frankenhuis, C.; Bongers, M. E. J.; Tromp, E.; Benninga, M. A.

    2010-01-01

    OBJECTIVES: Gut-directed hypnotherapy (HT) has recently been shown to be highly effective in treating children with functional abdominal pain (FAP) and irritable bowel syndrome (IBS). This study was conducted to determine the extent to which this treatment success is because of an improvement in

  1. New class of filter functions generated most directly by Christoffel-Darboux formula for Gegenbauer orthogonal polynomials

    Science.gov (United States)

    Ilić, Aleksandar D.; Pavlović, Vlastimir D.

    2011-01-01

    A new original formulation of all pole low-pass filter functions is proposed in this article. The starting point in solving the approximation problem is a direct application of the Christoffel-Darboux formula for the set of orthogonal polynomials, including Gegenbauer orthogonal polynomials in the finite interval [-1, +1] with the application of a weighting function with a single free parameter. A general solution for the filter functions is obtained in a compact explicit form, which is shown to enable generation of the Gegenbauer filter functions in a simple way by choosing the value of the free parameter. Moreover, the proposed solution with the same criterion of approximation could be used to generate Legendre and Chebyshev filter functions of the first and second kind as well. The examples of proposed filter functions of even (10th) and odd (11th) order are illustrated. The approximation is shown to yield a good compromise solution with respect to the filter frequency characteristics (magnitude as well as phase characteristics). The influence of tolerance of the filter critical component (inductor) on the proposed magnitude and group delay characteristics of a resistively terminated LC lossless ladder filter is analysed as well. The proposed filter functions are superior in terms of the excellent magnitude characteristic, which approximates an ideal filter almost perfectly over the entire pass-band range and exhibits the summed sensitivity function better than that of a Butterworth filter. In the article, we present the filter function solution that exhibits optimum amplitude as well as optimum group delay characteristics that are of crucial importance for implementation of digital processing as well as RF analogue parts of communication networks. Derivation of the other band range filter functions, which could be realised either by continuous or digital filters, is also generally possible with the procedure proposed in this article.

  2. Strategies for Directing the Structure and Function of 3D Collagen Biomaterials across Length Scales

    Science.gov (United States)

    Walters, Brandan D.; Stegemann, Jan P.

    2013-01-01

    Collagen type I is a widely used natural biomaterial that has found utility in a variety of biological and medical applications. Its well characterized structure and role as an extracellular matrix protein make it a highly relevant material for controlling cell function and mimicking tissue properties. Collagen type I is abundant in a number of tissues, and can be isolated as a purified protein. This review focuses on hydrogel biomaterials made by reconstituting collagen type I from a solubilized form, with an emphasis on in vitro studies in which collagen structure can be controlled. The hierarchical structure of collagen from the nanoscale to the macroscale is described, with an emphasis on how structure is related to function across scales. Methods of reconstituting collagen into hydrogel materials are presented, including molding of macroscopic constructs, creation of microscale modules, and electrospinning of nanoscale fibers. The modification of collagen biomaterials to achieve desired structures and functions is also addressed, with particular emphasis on mechanical control of collagen structure, creation of collagen composite materials, and crosslinking of collagenous matrices. Biomaterials scientists have made remarkable progress in rationally designing collagen-based biomaterials and in applying them to both the study of biology and for therapeutic benefit. This broad review illustrates recent examples of techniques used to control collagen structure, and to thereby direct its biological and mechanical functions. PMID:24012608

  3. Three dimensional Free Vibration and Transient Analysis of Two Directional Functionally Graded Thick Cylindrical Panels Under Impact Loading

    Directory of Open Access Journals (Sweden)

    Hassan Zafarmand

    Full Text Available AbstractIn this paper three dimensional free vibration and transient response of a cylindrical panel made of two directional functionally graded materials (2D-FGMs based on three dimensional equations of elasticity and subjected to internal impact loading is considered. Material properties vary through both radial and axial directions continuously. The 3D graded finite element method (GFEM based on Rayleigh-Ritz energy formulation and Newmark direct integration method has been applied to solve the equations in space and time domains. The fundamental normalized natural frequency, time history of displacements and stresses in three directions and velocity of radial stress wave propagation for various values of span angel of cylindrical panel and different power law exponents have been investigated. The present results show that using 2D-FGMs leads to a more flexible design than conventional 1D-FGMs. The GFEM solution have been compared with the results of an FG thick hollow cylinder and an FG curved panel, where a good agreement between them is observed.

  4. Type-Directed Partial Evaluation

    DEFF Research Database (Denmark)

    Danvy, Olivier

    1998-01-01

    Type-directed partial evaluation uses a normalization function to achieve partial evaluation. These lecture notes review its background, foundations, practice, and applications. Of specific interest is the modular technique of offline and online type-directed partial evaluation in Standard ML...

  5. Type-Directed Partial Evaluation

    DEFF Research Database (Denmark)

    Danvy, Olivier

    1998-01-01

    Type-directed partial evaluation uses a normalization function to achieve partial evaluation. These lecture notes review its background, foundations, practice, and applications. Of specific interest is the modular technique of offline and online type-directed partial evaluation in Standard ML of ...

  6. Sparse networks of directly coupled, polymorphic, and functional side chains in allosteric proteins.

    Science.gov (United States)

    Soltan Ghoraie, Laleh; Burkowski, Forbes; Zhu, Mu

    2015-03-01

    Recent studies have highlighted the role of coupled side-chain fluctuations alone in the allosteric behavior of proteins. Moreover, examination of X-ray crystallography data has recently revealed new information about the prevalence of alternate side-chain conformations (conformational polymorphism), and attempts have been made to uncover the hidden alternate conformations from X-ray data. Hence, new computational approaches are required that consider the polymorphic nature of the side chains, and incorporate the effects of this phenomenon in the study of information transmission and functional interactions of residues in a molecule. These studies can provide a more accurate understanding of the allosteric behavior. In this article, we first present a novel approach to generate an ensemble of conformations and an efficient computational method to extract direct couplings of side chains in allosteric proteins, and provide sparse network representations of the couplings. We take the side-chain conformational polymorphism into account, and show that by studying the intrinsic dynamics of an inactive structure, we are able to construct a network of functionally crucial residues. Second, we show that the proposed method is capable of providing a magnified view of the coupled and conformationally polymorphic residues. This model reveals couplings between the alternate conformations of a coupled residue pair. To the best of our knowledge, this is the first computational method for extracting networks of side chains' alternate conformations. Such networks help in providing a detailed image of side-chain dynamics in functionally important and conformationally polymorphic sites, such as binding and/or allosteric sites. © 2014 Wiley Periodicals, Inc.

  7. Parametric study of development of Inconel-steel functionally graded materials by laser direct metal deposition

    International Nuclear Information System (INIS)

    Shah, Kamran; Haq, Izhar ul; Khan, Ashfaq; Shah, Shaukat Ali; Khan, Mushtaq; Pinkerton, Andrew J

    2014-01-01

    Highlights: • Functionally graded steel and nickel super-alloy structures have been developed. • Mechanical properties of FGMs can be controlled by process input parameters. • SDAS is strongly dependent on the laser power and powder mass flow rate. • Carbides provide a mechanism to control the hardness and wear resistance of FGM. • Tensile strength of FGM is dependent on the laser power and powder mass flow rate. - Abstract: Laser direct metal deposition (LDMD) has developed from a prototyping to a single and multiple metals manufacturing technique. It offers an opportunity to produce graded components, with differing elemental composition, phase and microstructure at different locations. In this work, continuously graded Stainless Steel 316L and Inconel 718 thin wall structures made by direct laser metal deposition process have been explored. The paper considers the effects of process parameters including laser power levels and powder mass flow rates of SS316L and Inconel 718 during the deposition of the Steel–Ni graded structures. Microstructure characterisation and phase identification are performed by optical microscopy and X-ray diffraction techniques. Mechanical testing, using methods such as hardness, wear resistance and tensile testing have been carried out on the structures. XRD results show the presence of the NbC and Fe 2 Nb phases formed during the deposition. The effect of experimental parameters on the microstructure and physical properties are determined and discussed. Work shows that mechanical properties can be controlled by input parameters and generation of carbides provides an opportunity to selectively control the hardness and wear resistance of the functionally graded material

  8. Electroejaculation functions primarily by direct activation of pelvic musculature: Perspectives from a porcine model

    Directory of Open Access Journals (Sweden)

    Adam M.R. Groh

    2018-03-01

    Full Text Available Ejaculatory dysfunction is a significant cause of infertility in men that have incurred spinal cord injury or iatrogenic lesions to the sympathetic nerves in the retroperitoneum. For such patients, electroejaculation – whereby a voltage is applied transrectally under general anesthesia – is a highly-effective procedure to obtain ejaculate. At present, however, there remains uncertainty as to the physiological mechanism by which electroejaculation prompts seminal emission in males with neurogenic anejaculation. Thus, in the present study, we aimed to determine, for the first time, whether electroejaculation functions by mimicking a neurophysiological response, or by directly activating local pelvic musculature. Using electroejaculation in a novel porcine model, we monitored the strength of contraction of the internal urethral sphincter (a smooth muscle involved in ejaculation before and after lesioning its sympathetic innervation with a combination of progressively-worsening surgical and pharmacological insults in three anesthetized boars (46.1 ± 7.4 kg. Importantly, prior to this investigation, we confirmed the comparative structural anatomy of the porcine model to humans through gross dissection and histological analysis of the infrarenal retroperitoneal sympathetic nerves and ganglia in 18 unembalmed boars. Prior to sacrifice, three of these boars underwent functional testing to confirm control of the internal urethral sphincter by the hypogastric nerves. Our results demonstrate that electroejaculation-induced contraction of the internal urethral sphincter was preserved following each progressive neural insult compared to the control state (p > 0.05. In contrast, these same insults resulted in paralysis/paresis of the internal urethral sphincter when its sympathetic innervation was directly stimulated with bipolar electrodes (p < 0.05. Taken together, our results provide the first empirical evidence to suggest that

  9. Complementary Strategies for Directed C(sp3 )-H Functionalization: A Comparison of Transition-Metal-Catalyzed Activation, Hydrogen Atom Transfer, and Carbene/Nitrene Transfer.

    Science.gov (United States)

    Chu, John C K; Rovis, Tomislav

    2018-01-02

    The functionalization of C(sp 3 )-H bonds streamlines chemical synthesis by allowing the use of simple molecules and providing novel synthetic disconnections. Intensive recent efforts in the development of new reactions based on C-H functionalization have led to its wider adoption across a range of research areas. This Review discusses the strengths and weaknesses of three main approaches: transition-metal-catalyzed C-H activation, 1,n-hydrogen atom transfer, and transition-metal-catalyzed carbene/nitrene transfer, for the directed functionalization of unactivated C(sp 3 )-H bonds. For each strategy, the scope, the reactivity of different C-H bonds, the position of the reacting C-H bonds relative to the directing group, and stereochemical outcomes are illustrated with examples in the literature. The aim of this Review is to provide guidance for the use of C-H functionalization reactions and inspire future research in this area. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Facilitation of Function and Manipulation Knowledge of Tools Using Transcranial Direct Current Stimulation (tDCS

    Directory of Open Access Journals (Sweden)

    Ryo Ishibashi

    2018-01-01

    Full Text Available Using a variety of tools is a common and essential component of modern human life. Patients with brain damage or neurological disorders frequently have cognitive deficits in their recognition and manipulation of tools. In this study, we focused on improving tool-related cognition using transcranial direct current stimulation (tDCS. Converging evidence from neuropsychology, neuroimaging and non- invasive brain stimulation has identified the anterior temporal lobe (ATL and inferior parietal lobule (IPL as brain regions supporting action semantics. We observed enhanced performance in tool cognition with anodal tDCS over ATL and IPL in two cognitive tasks that require rapid access to semantic knowledge about the function or manipulation of common tools. ATL stimulation improved access to both function and manipulation knowledge of tools. The effect of IPL stimulation showed a trend toward better manipulation judgments. Our findings support previous studies of tool semantics and provide a novel approach for manipulation of underlying circuits.

  11. Can Transcranial Direct Current Stimulation Improve Cognitive Functioning in Adults with Schizophrenia?

    Science.gov (United States)

    Schretlen, David J; van Steenburgh, Joseph J; Varvaris, Mark; Vannorsdall, Tracy D; Andrejczuk, Megan A; Gordon, Barry

    Cognitive impairment is nearly ubiquitous in schizophrenia. First-degree relatives of persons with schizophrenia often show similar but milder deficits. Current methods for the treatment of schizophrenia are often ineffective in cognitive remediation. Since transcranial direct current stimulation (tDCS) can enhance cognitive functioning in healthy adults, it might provide a viable option to enhance cognition in schizophrenia. We sought to explore whether tDCS can be tolerated by persons with schizophrenia and potentially improve their cognitive functioning. We examined the effects of anodal versus cathodal tDCS on working memory and other cognitive tasks in five outpatients with schizophrenia and six first-degree relatives of persons with schizophrenia. Each participant completed tasks thought to be mediated by the prefrontal cortex during two 30-minute sessions of tDCS to the left and right dorsolateral prefrontal cortex (DLPFC). Anodal stimulation over the left DLPFC improved performance relative to cathodal stimulation on measures of working memory and aspects of verbal fluency relevant to word retrieval. The patient group showed differential changes in novel design production without alteration of overall productivity, suggesting that tDCS might be capable of altering self-monitoring and executive control. All participants tolerated tDCS well. None withdrew from the study or experienced any adverse reaction. We conclude that adults with schizophrenia can tolerate tDCS while engaging in cognitive tasks and that tDCS can alter their performance.

  12. Alkaline direct ethanol fuel cell performance using alkali-impregnated polyvinyl alcohol/functionalized carbon nano-tube solid electrolytes

    Science.gov (United States)

    Huang, Chien-Yi; Lin, Jia-Shiun; Pan, Wen-Han; Shih, Chao-Ming; Liu, Ying-Ling; Lue, Shingjiang Jessie

    2016-01-01

    This study investigates the application of a polyvinyl alcohol (PVA)/functionalized carbon nano-tubes (m-CNTs) composite in alkaline direct ethanol fuel cells (ADEFC). The m-CNTs are functionalized with PVA using the ozone mediation method, and the PVA composite containing the modified CNTs is prepared. Adding m-CNT into the PVA matrix enhances the alkaline uptake and the ionic conductivity of the KOH-doped electrolyte. Meanwhile, the m-CNT-containing membrane exhibited a lower swelling ratio and suppressed ethanol permeability compared to the pristine PVA film. The optimal condition for the ADEFC is determined to be under operation at an anode feed of 3 M ethanol in a 5 M KOH solution (at a flow rate of 5 cm3 min-1) with a cathode feed of moisturized oxygen (with a flow rate of 100 cm3 min-1) and the KOH-doped PVA/m-CNT electrolyte. We achieved a peak power density value of 65 mW cm-2 at 60 °C, which is the highest among the ADEFC literature data and several times higher than the proton-exchange direct ethanol fuel cells using sulfonated membrane electrolytes. Therefore, the KOH-doped PVA/m-CNT electrolyte is a suitable solid electrolyte for ADEFCs and has potential for commercialization in alkaline fuel cell applications.

  13. Data Analysis Trumps Specialist Advice: How Direct Banks Function

    Directory of Open Access Journals (Sweden)

    Skiera Bernd

    2016-11-01

    Full Text Available Low interest rates and sluggish economic growth are not exactly ideal conditions for the financial services industry. Almost daily we are confronted with reports of inadequate capital bases, declining earnings, and layoffs at banks. But while many traditional retail banks are struggling with a business downturn, the direct bank market is enjoying steady and respectable growth despite a challenging environment. Dr. Schmidberger, Fully Authorized Representative at ING-DiBa Germany, offers us a glimpse behind the curtains of this direct bank. We will learn how data technology is used so that bank customers are (more satisfied.

  14. A nanobody directed to a functional epitope on VEGF, as a novel strategy for cancer treatment.

    Science.gov (United States)

    Farajpour, Zahra; Rahbarizadeh, Fatemeh; Kazemi, Bahram; Ahmadvand, Davoud

    2014-03-28

    Compelling evidence suggests that vascular endothelial growth factor (VEGF), due to its essential role in angiogenesis, is a critical target for cancer treatment. Neutralizing monoclonal antibodies against VEGF are important class of drugs used in cancer therapy. However, the cost of production, large size, and immunogenicity are main drawbacks of conventional monoclonal therapy. Nanobodies are the smallest antigen-binding antibody fragments, which occur naturally in camelidae. Because of their remarkable features, we decided to use an immune library of nanobody to direct phage display to recognition of novel functional epitopes on VEGF. Four rounds of selection were performed and six phage-displayed nanobodies were obtained from an immune phage library. The most reactive clone in whole-cell ELISA experiments, was purified and assessed in proliferation inhibition assay. Purified ZFR-5 not only blocked interaction of VEGF with its receptor in cell ELISA experiments, but also was able to significantly inhibit proliferation response of human umbilical vein endothelial cells to VEGF in a dose-dependent manner. Taken together, our study demonstrates that by using whole-cell ELISA experiments, nanobodies against antigenic regions included in interaction of VEGF with its receptors can be directed. Because of unique and intrinsic properties of a nanobody and the ability of selected nanobody for blocking the epitope that is important for biological function of VEGF, it represents novel potential drug candidate. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Reproductive function in mice exposed to ancestral and direct irradiation

    International Nuclear Information System (INIS)

    Nash, D.J.; Sprackling, L.S.

    1978-01-01

    Reproduction was studied in 13 inbred strains of mice that had been exposed continuously to 60 Co gamma radiation for varying numbers of generations. At weaning the mice were removed from the irradiation chamber and were tested for reproductive performance. Ancestral and direct levels of irradiation were determined for each animal. Each irradiated or control female was scored as fertile or sterile, and in utero litter counts were made in pregnant females that were dissected past the 10th day of pregnancy. The number of resorptions, dead embryos, and live embryos were counted, and the ratio of living embryos to the total number of embryos was determined for each litter. The overall fertility curves were sigmoid in the range of doses below those which caused complete sterility, which indicated some sort of cumulative damage. In 11 of the 13 strains studied, an increase in ancestral and/or direct irradiation led to significant decreases in fertility. The means of the number alive in the litters for the control and irradiated mice in each strain showed a definite trend toward fewer live mice in utero after irradiation. Least-squares analyses of variance were made to detect possible effects of any of six irradiation variables (ancestral linear, ancestral quadratic, ancestral cubic, direct linear, direct quadratic, or direct cubic) or of strain differences on total litter size and on ratio. Strain effects were significant in each instance. Litter size was more likely to be affected by radiation variables than ratios were

  16. Contrasting the crospovidones functionality as excipients for direct compression

    Directory of Open Access Journals (Sweden)

    Daniel García Ramírez

    2015-03-01

    Full Text Available Specific values of technological properties of excipients allow the establishment of numerical parameters to define and compare their functionality. This study investigates the functionality of Polyplasdones XL and XL10. Parameters studied included tablet disintegration profiles, compactibility profiles and powder flow. The results allowed the establishment of quantitative surrogate functionalities of technological performance, such as absolute number, and as a value relative to the known microcrystalline cellulose type 102. Moreover, the establishment of an explicit functionality to improve the technological performance of two diluents and a model drug was investigated, as was setting up of these functionalities, as quantitative values, to determine the input variables of each material and its probable functionality in a drug product. Disintegration times of pure Polyplasdone XL and its admixtures were around half that of Polyplasdone XL10. The improvement in tablet compactibility was 25-50% greater for Polyplasdone XL10 than Polyplasdone XL. Crospovidones proportions of up to 10% have little effect on the flow properties of other powders, although pure Polyplasdone XL10 and its admixtures display compressibility indexes about 20% greater than Polyplasdone XL. The observed results are in line with a smaller particle size of Polyplasdone XL10 compared to Polyplasdone XL.

  17. [The significance of directional preponderance in the evaluation of vestibular function in patients with vertigo].

    Science.gov (United States)

    Wang, J; Zhou, Y J; Yu, J; Gu, J

    2017-03-07

    Objective: To analyze the relationship between directional preponderance (DP), spontaneous nystagmus(SN) and vestibular disorders, and to investigate the significance of DP in directing peripheral vestibular function in patients with vertigo. Methods: This was a retrospective analysis of 394 cases diagnosed with peripheral vestibular disease accompanied by vertigo from March 2012 to June 2014 in the Outpatient Department of the Eye & ENT Hospital of Fudan University. Results of static and dynamic posture equilibrium tests, SN, unilateral weakness(UW), and DP in videonystagmography(VNG) were analyzed and compared. Results: The mean interval time between the last vertigo attack and examination in patients with SN or DP in caloric test were 4.4 d and 7.3 d respectively, and those without SN or DP were 18.3 d and 17.5 d respectively. The patients were divided into two groups according to DP results of caloric test. DP-normal group had 203 cases and DP-abnormal group had 191 cases. Spontaneous nystagmus was presented in 44 cases in the DP-normal group (21.67%) and four in the DP-abnormal group (2.09%). A significant difference was found between the two groups (χ 2 =35.27, P =0.000). Deficiency of vestibular function was noted in 165 cases in the DP-normal group (81.28%) and 123 (64.40%) in the DP-abnormal group in static and dynamic posture equilibrium tests. The difference between the two groups was statistically significant (χ 2 =14.26, P =0.000). Conclusion: Compared with DP-normal patients, DP-abnormal patients are more likely to have spontaneous nystagmus and balance disorders due to vestibular dysfunction.

  18. Effect of readout direction in the edge profile on the modulation transfer function of computed radiographic systems by use of the edge method.

    Science.gov (United States)

    Tanaka, Nobukazu; Morishita, Junji; Tsuda, Norisato; Ohki, Masafumi

    2013-07-01

    We investigated the effect of the readout direction of the edge profile obtained by the edge method on the presampled modulation transfer function (MTF) in various computed radiographic (CR) systems. There were no differences in the MTFs derived from two edge profiles in the sub-scanning direction of four CR systems used in this study. On the other hand, the MTFs measured at a readout direction from the low (edge) to the high (direct exposure) exposure region were higher than those measured at a readout direction from the high to the low exposure region in the laser-beam scanning direction for three of the four CR systems. Although this phenomenon depends on the CR system, it is important to understand and indicate both MTFs at the two edge profiles in the laser-beam scanning direction for accurate assessment of the resolution property.

  19. Verification of the directivity index and other measures of directivity in predicting directional benefit

    Science.gov (United States)

    Dittberner, Andrew; Bentler, Ruth

    2005-09-01

    The relationship between various directivity measures and subject performance with directional microphone hearing aids was determined. Test devices included first- and second-order directional microphones. Recordings of sentences and noise (Hearing in Noise Test, HINT) were made through each test device in simple, complex, and anisotropic background noise conditions. Twenty-six subjects, with normal hearing, were administered the HINT test recordings, and directional benefit was computed. These measures were correlated to theoretical, free-field, and KEMAR DI values, as well as front-to-back ratios, in situ SNRs, and a newly proposed Db-SNR, wherein a predictive value of the SNR improvement is calculated as a function of the noise source incidence. The different predictive scores showed high correlation to the measured directional benefit scores in the complex (diffuse-like) background noise condition (r=0.89-0.97, pThe Db-SNR approach and the in situ SNR measures provided excellent prediction of subject performance in all background noise conditions (0.85-0.97, pthe predictive measures could account for the effects of reverberation on the speech signal (r=0.35-0.40, p<0.05).

  20. Electrochemically Functionalized Seamless Three-Dimensional Graphene-Carbon Nanotube Hybrid for Direct Electron Transfer of Glucose Oxidase and Bioelectrocatalysis.

    Science.gov (United States)

    Terse-Thakoor, Trupti; Komori, Kikuo; Ramnani, Pankaj; Lee, Ilkeun; Mulchandani, Ashok

    2015-12-01

    Three-dimensional seamless chemical vapor deposition (CVD) grown graphene-carbon nanotubes (G-CNT) hybrid film has been studied for its potential in achieving direct electron transfer (DET) of glucose oxidase (GOx) and its bioelectrocatalytic activity in glucose detection. A two-step CVD method was employed for the synthesis of seamless G-CNT hybrid film where CNTs are grown on already grown graphene film on copper foil using iron as a catalyst. Physical characterization using SEM and TEM show uniform dense coverage of multiwall carbon nanotubes (MWCNT) grown directly on graphene with seamless contacts. The G-CNT hybrid film was electrochemically modified to introduce oxygenated functional groups for DET favorable immobilization of GOx. Pristine and electrochemically functionalized G-CNT film was characterized by electrochemical impedance spectroscopy (EIS), cyclic voltammetry, X-ray photoelectron-spectroscopy, and Raman spectroscopy. The DET between GOx and electrochemically oxidized G-CNT electrode was studied using cyclic voltammetry which showed a pair of well-defined and quasi-reversible redox peaks with a formal potential of -459 mV at pH 7 corresponding to the redox site of GOx. The constructed electrode detected glucose concentration over the clinically relevant range of 2-8 mM with the highest sensitivity of 19.31 μA/mM/cm(2) compared to reported composite hybrid electrodes of graphene oxide and CNTs. Electrochemically functionalized CVD grown seamless G-CNT structure used in this work has potential to be used for development of artificial mediatorless redox enzyme based biosensors and biofuel cells.

  1. Ultrasound assisted simultaneous reduction and direct functionalization of graphene oxide with thermal and cytotoxicity profile.

    Science.gov (United States)

    Maktedar, Shrikant S; Avashthi, Gopal; Singh, Man

    2017-01-01

    The new sonochemical approach for simultaneous reduction and direct functionalization of graphene oxide (GrO) has been developed. The GrO was functionalized with 2-Aminobenzoxazole (2-ABOZ) in twenty min with complete deletion of hazardous steps. The significance of ultrasound was exemplified with the comparative conventional methods. The newly prepared f-(2-ABOZ)GrO was extensively characterized with near edge X-ray absorption fine structure (NEXAFS) spectroscopy, 13 C solid state NMR, XPS, XRD, HRTEM, SAED, AFM, Raman, UV-vis, FTIR and TGA. The thermal stability of f-(2-ABOZ)GrO was confirmed with total percentage weight loss in TGA. The biological activity of f-(2-ABOZ)GrO was explored with MCF-7 and Vero cell lines. The inherent cytotoxicity was evaluated with SRB assay at 10, 20, 40 and 80μgmL -1 . The estimated cell viabilities were >78% with f-(2-ABOZ) GrO. A high cytocompatibility of f-(2-ABOZ)GrO was ensured with in vitro evaluation on living cell lines, and low toxicity of f-(2-ABOZ)GrO was confirmed its excellent biocompatibility. The morphological effect on Vero cell line evidently supports the formation of biocompatible f-(2-ABOZ)GrO. Therefore, f-(2-ABOZ)GrO was emerged as an advanced functional material for thermally stable biocompatible coatings. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. An Amphipathic Helix Directs Cellular Membrane Curvature Sensing and Function of the BAR Domain Protein PICK1.

    Science.gov (United States)

    Herlo, Rasmus; Lund, Viktor K; Lycas, Matthew D; Jansen, Anna M; Khelashvili, George; Andersen, Rita C; Bhatia, Vikram; Pedersen, Thomas S; Albornoz, Pedro B C; Johner, Niklaus; Ammendrup-Johnsen, Ina; Christensen, Nikolaj R; Erlendsson, Simon; Stoklund, Mikkel; Larsen, Jannik B; Weinstein, Harel; Kjærulff, Ole; Stamou, Dimitrios; Gether, Ulrik; Madsen, Kenneth L

    2018-05-15

    BAR domains are dimeric protein modules that sense, induce, and stabilize lipid membrane curvature. Here, we show that membrane curvature sensing (MCS) directs cellular localization and function of the BAR domain protein PICK1. In PICK1, and the homologous proteins ICA69 and arfaptin2, we identify an amphipathic helix N-terminal to the BAR domain that mediates MCS. Mutational disruption of the helix in PICK1 impaired MCS without affecting membrane binding per se. In insulin-producing INS-1E cells, super-resolution microscopy revealed that disruption of the helix selectively compromised PICK1 density on insulin granules of high curvature during their maturation. This was accompanied by reduced hormone storage in the INS-1E cells. In Drosophila, disruption of the helix compromised growth regulation. By demonstrating size-dependent binding on insulin granules, our finding highlights the function of MCS for BAR domain proteins in a biological context distinct from their function, e.g., at the plasma membrane during endocytosis. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. DIRECTIVE SPEECH ACTS REALIZATION OF INDONESIAN EFL TEACHER

    Directory of Open Access Journals (Sweden)

    Cucu Suhartini

    2015-06-01

    Full Text Available This research examines the types and functions of directive speech act performed by an Indonesian EFL teacher in one senior high school in Kuningan, Indonesia. This study uses qualitative method. The data of this research were taken from the video transcription which contains directives spoken by the EFL teacher and analyzed based on Kreidler’s (1998 theory. The findings show that there are three types of directives used by the teacher. They are commands, requests, and suggestions. The most frequent type of directives performed is commands with 233 occurrences (94.8%. It was also found that there are five functions seized by the directives, they are elicitation, instruction, advice, threat, and attention-getter. The most frequent function of directives used is elicitation with 108 occurrences (44%. From the findings, it is concluded that the using of commands shows teacher’s dominance. Yet, this type of directives is not easily understood by the students. Therefore, it is suggested that the teacher should use other types of directives more, such as requests and suggestions, to encourage students’ participation.

  4. Family conflict, autonomic nervous system functioning, and child adaptation: state of the science and future directions.

    Science.gov (United States)

    El-Sheikh, Mona; Erath, Stephen A

    2011-05-01

    The family is one of the primary contexts of child development. Marital and parent-child conflict (family conflict) are common and predict a wide range of negative behavioral and emotional outcomes in children. Thus, an important task for developmental researchers is to identify the processes through which family conflict contributes to children's psychological maladjustment, as well as vulnerability and protective factors in the context of family conflict. In the current paper, we aim to advance a conceptual model that focuses on indices of children's autonomic nervous system (ANS) functioning that increase vulnerability or provide protection against psychological maladjustment in the context of family conflict. In doing so, we provide a selective review that reflects the state of the science linking family conflict, children's ANS activity, and child psychological adjustment, and offer directions and guidance for future research. Our hope is to accelerate research at the intersection of family conflict and ANS functioning to advance understanding of risk and resilience among children.

  5. Intensity and direction of competitive anxiety as a function of goal attainment expectation and competition goal generation.

    Science.gov (United States)

    O'Brien, M; Hanton, S; Mellalieu, S D

    2005-12-01

    Jones's control model was adopted to investigate differences in the labelling of symptoms associated with pre-competition anxiety and self-confidence as a function of goal attainment expectation and competition goal generation. Team sport performers (N = 96) were divided into outcome, performance and process goal groups. Anxiety intensity and direction, and self-confidence were then examined as a function of goal expectancy (positive or negative) and perceived input into goal production (input or no input). MANOVA and follow-up ANOVA supported the study predictions. Specifically, participants who reported positive expectations of goal achievement and indicated some input into the goal generation process experienced the most facilitative interpretations of cognitive symptoms and greater self-confidence. The results highlight the need to consider how goals are generated when attempting to foster a sense of control and help athletes cope with the psychological demands of competition.

  6. Functional interaction between right parietal and bilateral frontal cortices during visual search tasks revealed using functional magnetic imaging and transcranial direct current stimulation.

    Directory of Open Access Journals (Sweden)

    Amanda Ellison

    Full Text Available The existence of a network of brain regions which are activated when one undertakes a difficult visual search task is well established. Two primary nodes on this network are right posterior parietal cortex (rPPC and right frontal eye fields. Both have been shown to be involved in the orientation of attention, but the contingency that the activity of one of these areas has on the other is less clear. We sought to investigate this question by using transcranial direct current stimulation (tDCS to selectively decrease activity in rPPC and then asking participants to perform a visual search task whilst undergoing functional magnetic resonance imaging. Comparison with a condition in which sham tDCS was applied revealed that cathodal tDCS over rPPC causes a selective bilateral decrease in frontal activity when performing a visual search task. This result demonstrates for the first time that premotor regions within the frontal lobe and rPPC are not only necessary to carry out a visual search task, but that they work together to bring about normal function.

  7. A Novel Modulation Function-Based Control of Modular Multilevel Converters for High Voltage Direct Current Transmission Systems

    Directory of Open Access Journals (Sweden)

    Majid Mehrasa

    2016-10-01

    Full Text Available In this paper, a novel modulation function-based method including analyses of the modulation index and phase is proposed for operation of modular multilevel converters (MMCs in high voltage direct current (HVDC transmission systems. The proposed modulation function-based control technique is developed based on thorough and precise analyses of all MMC voltages and currents in the a-b-c reference frame in which the alternating current (AC-side voltage is the first target to be obtained. Using the AC-side voltage, the combination of the MMC upper and lower arm voltages is achieved as the main structure of the proposed modulation function. The main contribution of this paper is to obtain two very simple new modulation functions to control MMC performance in different operating conditions. The features of the modulation function-based control technique are as follows: (1 this control technique is very simple and can be easily achieved in a-b-c reference frame without the need of using Park transformation; and (2 in addition, the inherent properties of the MMC model are considered in the proposed control technique. Considering these properties leads to constructing a control technique that is robust against MMC parameters changes and also is a very good tracking method for the components of MMC input currents. These features lead to improving the operation of MMC significantly, which can act as a rectifier in the HVDC structure. The simulation studies are conducted through MATLAB/SIMULINK software, and the results obtained verify the effectiveness of the proposed modulation function-based control technique.

  8. Direct Genesis of Functional Rodent and Human Schwann Cells from Skin Mesenchymal Precursors

    Directory of Open Access Journals (Sweden)

    Matthew P. Krause

    2014-07-01

    Full Text Available Recent reports of directed reprogramming have raised questions about the stability of cell lineages. Here, we have addressed this issue, focusing upon skin-derived precursors (SKPs, a dermally derived precursor cell. We show by lineage tracing that murine SKPs from dorsal skin originate from mesenchymal and not neural crest-derived cells. These mesenchymally derived SKPs can, without genetic manipulation, generate functional Schwann cells, a neural crest cell type, and are highly similar at the transcriptional level to Schwann cells isolated from the peripheral nerve. This is not a mouse-specific phenomenon, since human SKPs that are highly similar at the transcriptome level can be made from neural crest-derived facial and mesodermally derived foreskin dermis and the foreskin SKPs can make myelinating Schwann cells. Thus, nonneural crest-derived mesenchymal precursors can differentiate into bona fide peripheral glia in the absence of genetic manipulation, suggesting that developmentally defined lineage boundaries are more flexible than widely thought.

  9. Long-Term Follow-Up of Gut-Directed Hypnotherapy vs. Standard Care in Children With Functional Abdominal Pain or Irritable Bowel Syndrome

    NARCIS (Netherlands)

    Vlieger, Arine M.; Rutten, Juliette M. T. M.; Govers, Anita M. A. P.; Frankenhuis, Carla; Benninga, Marc A.

    2012-01-01

    OBJECTIVES: We previously showed that gut-directed hypnotherapy (HT) is highly effective in the treatment of children with functional abdominal pain (FAP) and irritable bowel syndrome (IBS). Aim of this follow-up study was to investigate the long-term effects of HT vs. standard medical treatment

  10. Direct photons in WA98

    CERN Document Server

    Aggarwal, M M; Ahammed, Z; Angelis, Aris L S; Antonenko, V G; Arefev, V; Astakhov, V A; Avdeichikov, V; Awes, T C; Baba, P V K S; Badyal, S K; Barlag, C; Bathe, S; Batyunya, B; Bernier, T; Bhalla, K B; Bhatia, V S; Blume, C; Bock, R; Bohne, E M; Böröcz, Z K; Bucher, D; Buijs, A; Büsching, H; Carlén, L; Chalyshev, V; Chattopadhyay, S; Cherbachev, R; Chujo, T; Claussen, A; Das, A C; Decowski, M P; Delagrange, H; Dzhordzhadze, V; Dönni, P; Dubovik, I; Dutt, S; Dutta-Majumdar, M R; El-Chenawi, K F; Eliseev, S; Enosawa, K; Foka, P Y; Fokin, S L; Ganti, M S; Garpman, S; Gavrishchuk, O P; Geurts, F J M; Ghosh, T K; Glasow, R; Gupta, S K; Guskov, B; Gustafsson, Hans Åke; Gutbrod, H H; Higuchi, R; Hrivnacova, I; Ippolitov, M S; Kalechofsky, H; Kamermans, R; Kampert, K H; Karadzhev, K; Karpio, K; Kato, S; Kees, S; Klein-Bösing, C; Knoche, S; Kolb, B W; Kosarev, I G; Kucheryaev, I; Krümpel, T; Kugler, A; Kulinich, P A; Kurata, M; Kurita, K; Kuzmin, N A; Langbein, I; Lee, Y Y; Löhner, H; Luquin, Lionel; Mahapatra, D P; Man'ko, V I; Martin, M; Martínez, G; Maksimov, A; Mgebrishvili, G; Miake, Y; Mir, M F; Mishra, G C; Miyamoto, Y; Mohanty, B; Morrison, D; Mukhopadhyay, D S; Naef, H; Nandi, B K; Nayak, S K; Nayak, T K; Neumaier, S; Nyanin, A; Nikitin, V A; Nikolaev, S; Nilsson, P O; Nishimura, S; Nomokonov, V P; Nystrand, J; Obenshain, F E; Oskarsson, A; Otterlund, I; Pachr, M; Pavlyuk, S; Peitzmann, Thomas; Petracek, V; Pinganaud, W; Plasil, F; Von Poblotzki, U; Purschke, M L; Rak, J; Raniwala, R; Raniwala, S; Ramamurthy, V S; Rao, N K; Retière, F; Reygers, K; Roland, G; Rosselet, L; Rufanov, I A; Roy, C; Rubio, J M; Sako, H; Sambyal, S S; Santo, R; Sato, S; Schlagheck, H; Schmidt, H R; Schutz, Y; Shabratova, G; Shah, T H; Sibiryak, Yu; Siemiarczuk, T; Silvermyr, D; Sinha, B C; Slavin, N V; Söderström, K; Solomey, Nickolas; Sood, G; Sørensen, S P; Stankus, P; Stefanek, G; Steinberg, P; Stenlund, E; Stüken, D; Sumbera, M; Svensson, S; Trivedi, M D; Tsvetkov, A A; Tykarski, L; Urbahn, J; Van den Pijll, E C; van Eijndhoven, N; van Nieuwenhuizen, G J; Vinogradov, A; Viyogi, Y P; Vodopyanov, A S; Vörös, S; Wyslouch, B; Yagi, K; Yokota, Y; Young, G R

    2002-01-01

    A measurement of direct photon production in /sup 208/Pb+/sup 208/Pb collisions at 158 A GeV has been carried out in the CERN WA98 experiment. The invariant yield of direct photons was extracted as a function of transverse momentum in the interval 0.51.5 GeV/c. the result constitutes the first observation of direct photons in ultrarelativistic heavy-ion collisions. (19 refs).

  11. Eosin Y as a Direct Hydrogen Atom Transfer Photocatalyst for the Functionalization of C-H Bonds.

    Science.gov (United States)

    Fan, Xuan-Zi; Rong, Jia-Wei; Wu, Hao-Lin; Zhou, Quan; Deng, Hong-Ping; Tan, Jin Da; Xue, Cheng-Wen; Wu, Li-Zhu; Tao, Hai-Rong; Wu, Jie

    2018-05-02

    Eosin Y, a well-known economical alternative to metal catalysts in visible-light-driven single-electron transfer-based organic transformations, can behave as an effective direct hydrogen atom transfer catalyst for C-H activation. Using the alkylation of C-H bonds with electron-deficient alkenes as a model study revealed an extremely broad substrate scope, enabling easy access to a variety of important synthons. This eosin Y-based photocatalytic hydrogen atom transfer strategy is promising for diverse functionalization of a wide range of native C-H bonds in a green and sustainable manner. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Two-Functional Direct Current Sputtered Silver-Containing Titanium Dioxide Thin Films

    Directory of Open Access Journals (Sweden)

    Ditta IB

    2009-01-01

    Full Text Available Abstract The article reports on structure, mechanical, optical, photocatalytic and biocidal properties of Ti–Ag–O films. The Ti–Ag–O films were reactively sputter-deposited from a composed Ti/Ag target at different partial pressures of oxygen on unheated glass substrate held on floating potentialU fl. It was found that addition of ~2 at.% of Ag into TiO2film has no negative influence on UV-induced hydrophilicity of TiO2film. Thick (~1,500 nm TiO2/Ag films containing (200 anatase phase exhibit the best hydrophilicity with water droplet contact angle (WDCA lower than 10° after UV irradiation for 20 min. Thick (~1,500 nm TiO2/Ag films exhibited a better UV-induced hydrophilicity compared to that of thinner (~700 nm TiO2/Ag films. Further it was found that hydrophilic TiO2/Ag films exhibit a strong biocidal effect under both the visible light and the UV irradiation with 100% killing efficiency ofEscherichia coliATCC 10536 after UV irradiation for 20 min. Reported results show that single layer of TiO2with Ag distributed in its whole volume exhibits, after UV irradiation, simultaneously two functions: (1 excellent hydrophilicity with WDCA < 10° and (2 strong power to killE. colieven under visible light due to direct toxicity of Ag.

  13. Non-Neutralizing Antibodies Directed against HIV and Their Functions

    Directory of Open Access Journals (Sweden)

    Luzia M. Mayr

    2017-11-01

    Full Text Available B cells produce a plethora of anti-HIV antibodies (Abs but only few of them exhibit neutralizing activity. This was long considered a profound limitation for the enforcement of humoral immune responses against HIV-1 infection, especially since these neutralizing Abs (nAbs are extremely difficult to induce. However, increasing evidence shows that additional non-neutralizing Abs play a significant role in decreasing the viral load, leading to partial and sometimes even total protection. Mechanisms suspected to participate in protection are numerous. They involve the Fc domain of Abs as well as their Fab part, and consequently the induced Ab isotype will be determinant for their functions, as well as the quantity and quality of the Fc-receptors (FcRs expressed on immune cells. Fc-mediated inhibitory functions, such as Ab-dependent cellular cytotoxicity, antibody-dependent cellular phagocytosis, aggregation, and even immune activation have been proposed. However, as for nAbs, the non-neutralizing activities are limited to a subset of anti-HIV Abs. An improved in-depth characterization of the Abs displaying these functional responses is required for the development of new vaccination strategies, which aim to selectively trigger the B cells able to induce the right functional Ab combinations both at the right place and at the right time. This review summarizes our current knowledge on non-neutralizing functional inhibitory Abs and discusses the potential benefit of inducing them via vaccination. We also provide new insight into the roles of the FcγR-mediated Ab therapeutics in clinical trials for HIV diseases.

  14. The difference between electrical microstimulation and direct electrical stimulation - towards new opportunities for innovative functional brain mapping?

    Science.gov (United States)

    Vincent, Marion; Rossel, Olivier; Hayashibe, Mitsuhiro; Herbet, Guillaume; Duffau, Hugues; Guiraud, David; Bonnetblanc, François

    2016-04-01

    Both electrical microstimulation (EMS) and direct electrical stimulation (DES) of the brain are used to perform functional brain mapping. EMS is applied to animal fundamental neuroscience experiments, whereas DES is performed in the operating theatre on neurosurgery patients. The objective of the present review was to shed new light on electrical stimulation techniques in brain mapping by comparing EMS and DES. There is much controversy as to whether the use of DES during wide-awake surgery is the 'gold standard' for studying the brain function. As part of this debate, it is sometimes wrongly assumed that EMS and DES induce similar effects in the nervous tissues and have comparable behavioural consequences. In fact, the respective stimulation parameters in EMS and DES are clearly different. More surprisingly, there is no solid biophysical rationale for setting the stimulation parameters in EMS and DES; this may be due to historical, methodological and technical constraints that have limited the experimental protocols and prompted the use of empirical methods. In contrast, the gap between EMS and DES highlights the potential for new experimental paradigms in electrical stimulation for functional brain mapping. In view of this gap and recent technical developments in stimulator design, it may now be time to move towards alternative, innovative protocols based on the functional stimulation of peripheral nerves (for which a more solid theoretical grounding exists).

  15. Improvement of Left Ventricular Function by Permanent Direct His-Bundle Pacing in a Case with Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Yukiko Sashida, MD

    2006-01-01

    Full Text Available The patient was a 67-year-old female diagnosed with dilated cardiomyopathy. She had chronic atrial fibrillation (AF with bradycardia and low left ventricular function (left ventricular ejection fraction (LVEF 40%. She was admitted for congestive heart failure. She remained New York Heart Association (NYHA functional class III due to AF bradycardia. Pacemaker implantation was necessary for treatment of heart failure and administration of dose intensive β-blockers. As she had normal His-Purkinje activation, we examined the optimal pacing sites. Hemodynamics of His-bundle pacing and biventricular pacing were compared. Pulmonary capillary wedge pressure (PCWP was significantly lower on Hisbundle pacing than right ventricular (RV apical pacing and biventricular pacing (13mmHg, 19mmHg, and 19mmHg, respectively with an almost equal cardiac index. Based on the examination we implanted a permanent pacemaker for Direct His-bundle pacing (DHBP. After the DHBP implantation, the LVEF immediately improved from 40% to 55%, and BNP level decreased from 422 pg/ml to 42 pg/ml. The number of premature ventricular complex (PVC was decreased, and non sustained ventricular tachycardia (NSVT disappeared. Pacing threshold for His-bundle pacing has remained at the same level. His-bundle pacing has been maintained during 27 months and her long-term DHBP can improve cardiac function and the NYHA functional class.

  16. Memorization in Type-Directed Partial Evaluation

    DEFF Research Database (Denmark)

    Balat, Vincent; Danvy, Olivier

    2002-01-01

    We use a code generator—type-directed partial evaluation— to verify conversions between isomorphic types, or more precisely to verify that a composite function is the identity function at some complicated type. A typed functional language such as ML provides a natural support to express the funct...

  17. Versatile Surface Functionalization of Metal-Organic Frameworks through Direct Metal Coordination with a Phenolic Lipid Enables Diverse Applications

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Wei [Univ. of New Mexico, Albuquerque, NM (United States); Xiang, Guolei [Univ. of Cambridge (United Kingdom); Shang, Jin [Univ. of Hong Kong (China); Guo, Jimin [Univ. of New Mexico, Albuquerque, NM (United States); Motevalli, Benyamin [Monash Univ., Clayton, VIC (Australia); Durfee, Paul [Univ. of New Mexico, Albuquerque, NM (United States); Agola, Jacob Ongudi [Univ. of New Mexico, Albuquerque, NM (United States); Coker, Eric N. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Brinker, C. Jeffrey [Univ. of New Mexico, Albuquerque, NM (United States); Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2018-02-22

    Here, a novel strategy for the versatile functionalization of the external surface of metal-organic frameworks (MOFs) has been developed based on the direct coordination of a phenolic-inspired lipid molecule DPGG (1,2-dipalmitoyl-sn-glycero-3-galloyl) with metal nodes/sites surrounding MOF surface. X-ray diffraction and Argon sorption analysis prove that the modified MOF particles retain their structural integrity and porosity after surface modification. Density functional theory calculations reveal that strong chelation strength between the metal sites and the galloyl head group of DPGG is the basic prerequisite for successful coating. Due to the pH-responsive nature of metal-phenol complexation, the modification process is reversible by simple washing in weak acidic water, showing an excellent regeneration ability for water-stable MOFs. Moreover, the colloidal stability of the modified MOFs in the nonpolar solvent allows them to be further organized into 2 dimensional MOF or MOF/polymer monolayers by evaporation-induced interfacial assembly conducted on an air/water interface. Lastly, the easy fusion of a second functional layer onto DPGG-modified MOF cores, enabled a series of MOF-based functional nanoarchitectures, such as MOFs encapsulated within hybrid supported lipid bilayers (so-called protocells), polyhedral core-shell structures, hybrid lipid-modified-plasmonic vesicles and multicomponent supraparticles with target functionalities, to be generated. for a wide range of applications.

  18. Direct numerical simulation of fractal-generated turbulence

    International Nuclear Information System (INIS)

    Suzuki, H; Hasegawa, Y; Ushijima, T; Nagata, K; Sakai, Y; Hayase, T

    2013-01-01

    We simulate fractal-generated turbulence (Hurst and Vassilicos 2007 Phys. Fluids 19 035103)) by means of a direct numerical simulation and address its fundamental characteristics. We examine whether the fractal-generated turbulence in the upstream region has a nature similar to that of a wake. We propose an equation for predicting peak values of the velocity fluctuation intensity and devise a method for formulating the functional form of the quantity of interest by focusing on the time scale of decaying turbulence, and we examine those forms for the turbulent kinetic energy and rms of pressure fluctuation through this method. By using the method, both of these functional forms are found to be power-law functions in the downstream region, even though these profiles follow exponential functions around these peaks. In addition, decay exponents of these quantities are estimated. The integral length scales of velocity fluctuations for transverse as well as streamwise directions are essentially constant in the downstream direction. Decaying turbulence having both these characteristics conflicts with decaying turbulence described by the theory predicting exponential decay. We discuss a factor causing the difference by focusing on the functional form of the transfer function of homogeneous, isotropic turbulence. (paper)

  19. Inverse and direct transfer functions for the fatigue follow-up of piping systems submitted to stratification

    International Nuclear Information System (INIS)

    Guyette, M.; De Smet, M.

    1995-01-01

    In this paper we outline a methodology to assess the fatigue induced in piping systems submitted to thermal stratification. More specifically, the transformation from the measured outer wall temperature time histories to stress time histories in any point of the line is treated.By means of inverse transfer functions, the fluid temperature distribution is calculated from the outside wall temperatures measured in a limited number of temperature sections. Using direct transfer functions, the local stresses due to stratification may be determined as well as the pipe free curvatures and the pipe free axial strains. Using a finite beam element model of the line, the global response of the line (in terms of displacements or stresses) due to the applied curvatures, axial strains, end point displacements, internal pressure and possible contacts with the pipe environment may be determined.The method is illustrated for the surge lines of the Doel 2 and Doel 4 nuclear power plants. An excellent correlation is found between measured and calculated displacements. Typical stress time histories are shown for a plant cool down. ((orig.))

  20. Wave directional spectrum from array measurements

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, A.A; Sarma, Y; Menon, H.B.

    Using the method of Esteva (1976, 1977), whcih assumes that at the frequency band the waves approach from just a single "mean" wave direction, wave direction has been consistently, accurately and unambiguously evaluated as a function of frequency...

  1. Thermoelastic Theory for the Response of Materials Functionally Graded in Two Directions with Applications to the Free-Edge Problem

    Science.gov (United States)

    Aboudi, Jacob; Pindera, Marek-Jerzy; Arnold, Steven M.

    1995-01-01

    A recently developed micromechanical theory for the thermoelastic response of functionally graded composites with nonuniform fiber spacing in the through-thickness direction is further extended to enable analysis of material architectures characterized by arbitrarily nonuniform fiber spacing in two directions. In contrast to currently employed micromechanical approaches applied to functionally graded materials, which decouple the local and global effects by assuming the existence of a representative volume element at every point within the composite, the new theory explicitly couples the local and global effects. The analytical development is based on volumetric averaging of the various field quantities, together with imposition of boundary and interfacial conditions in an average sense. Results are presented that illustrate the capability of the derived theory to capture local stress gradients at the free edge of a laminated composite plate due to the application of a uniform temperature change. It is further shown that it is possible to reduce the magnitude of these stress concentrations by a proper management of the microstructure of the composite plies near the free edge. Thus by an appropriate tailoring of the microstructure it is possible to reduce or prevent the likelihood of delamination at free edges of standard composite laminates.

  2. On the Retrieval of the Directional Scattering Matrix from Directional Noise

    NARCIS (Netherlands)

    Wapenaar, C.P.A.; Thorbecke, J.W.

    2013-01-01

    The crosscorrelation of ambient acoustic noise observed at two receivers yields the impulse response between these receivers, assuming that the noise field is diffuse. In practical situations the noise field exhibits directionality, which imprints the angle-dependent correlation function. For the

  3. Exchange effects in direct reactions

    International Nuclear Information System (INIS)

    LeMere, M.; Kanellopoulos, E.J.; Suenkel, W.; Tang, Y.C.

    1979-01-01

    The effect of antisymmetrization in direct reactions is examined by studying the properties of the coupling-normalization kernel function occurring in a resonating-group formulation. From this study, one obtains useful information concerning the general behavior of direct-reactiion processes and some justification for the use of three-body models in phenomenological analyses

  4. Changes of Functional and Directed Resting-State Connectivity Are Associated with Neuronal Oscillations, ApoE Genotype and Amyloid Deposition in Mild Cognitive Impairment

    Directory of Open Access Journals (Sweden)

    Lars Michels

    2017-09-01

    Full Text Available The assessment of effects associated with cognitive impairment using electroencephalography (EEG power mapping allows the visualization of frequency-band specific local changes in oscillatory activity. In contrast, measures of coherence and dynamic source synchronization allow for the study of functional and effective connectivity, respectively. Yet, these measures have rarely been assessed in parallel in the context of mild cognitive impairment (MCI and furthermore it has not been examined if they are related to risk factors of Alzheimer’s disease (AD such as amyloid deposition and apolipoprotein ε4 (ApoE allele occurrence. Here, we investigated functional and directed connectivities with Renormalized Partial Directed Coherence (RPDC in 17 healthy controls (HC and 17 participants with MCI. Participants underwent ApoE-genotyping and Pittsburgh compound B positron emission tomography (PiB-PET to assess amyloid deposition. We observed lower spectral source power in MCI in the alpha and beta bands. Coherence was stronger in HC than MCI across different neuronal sources in the delta, theta, alpha, beta and gamma bands. The directed coherence analysis indicated lower information flow between fronto-temporal (including the hippocampus sources and unidirectional connectivity in MCI. In MCI, alpha and beta RPDC showed an inverse correlation to age and gender; global amyloid deposition was inversely correlated to alpha coherence, RPDC and beta and gamma coherence. Furthermore, the ApoE status was negatively correlated to alpha coherence and RPDC, beta RPDC and gamma coherence. A classification analysis of cognitive state revealed the highest accuracy using EEG power, coherence and RPDC as input. For this small but statistically robust (Bayesian power analyses sample, our results suggest that resting EEG related functional and directed connectivities are sensitive to the cognitive state and are linked to ApoE and amyloid burden.

  5. Functional connections between activated and deactivated brain regions mediate emotional interference during externally directed cognition.

    Science.gov (United States)

    Di Plinio, Simone; Ferri, Francesca; Marzetti, Laura; Romani, Gian Luca; Northoff, Georg; Pizzella, Vittorio

    2018-04-24

    Recent evidence shows that task-deactivations are functionally relevant for cognitive performance. Indeed, higher cognitive engagement has been associated with higher suppression of activity in task-deactivated brain regions - usually ascribed to the Default Mode Network (DMN). Moreover, a negative correlation between these regions and areas actively engaged by the task is associated with better performance. DMN regions show positive modulation during autobiographical, social, and emotional tasks. However, it is not clear how processing of emotional stimuli affects the interplay between the DMN and executive brain regions. We studied this interplay in an fMRI experiment using emotional negative stimuli as distractors. Activity modulations induced by the emotional interference of negative stimuli were found in frontal, parietal, and visual areas, and were associated with modulations of functional connectivity between these task-activated areas and DMN regions. A worse performance was predicted both by lower activity in the superior parietal cortex and higher connectivity between visual areas and frontal DMN regions. Connectivity between right inferior frontal gyrus and several DMN regions in the left hemisphere was related to the behavioral performance. This relation was weaker in the negative than in the neutral condition, likely suggesting less functional inhibitions of DMN regions during emotional processing. These results show that both executive and DMN regions are crucial for the emotional interference process and suggest that DMN connections are related to the interplay between externally-directed and internally-focused processes. Among DMN regions, superior frontal gyrus may be a key node in regulating the interference triggered by emotional stimuli. © 2018 Wiley Periodicals, Inc.

  6. Implementation of the zooplankton functional response in plankton models: State of the art, recent challenges and future directions

    Science.gov (United States)

    Morozov, Andrew; Poggiale, Jean-Christophe; Cordoleani, Flora

    2012-09-01

    The conventional way of describing grazing in plankton models is based on a zooplankton functional response framework, according to which the consumption rate is computed as the product of a certain function of food (the functional response) and the density/biomass of herbivorous zooplankton. A large amount of literature on experimental feeding reports the existence of a zooplankton functional response in microcosms and small mesocosms, which goes a long way towards explaining the popularity of this framework both in mean-field (e.g. NPZD models) and spatially resolved models. On the other hand, the complex foraging behaviour of zooplankton (feeding cycles) as well as spatial heterogeneity of food and grazer distributions (plankton patchiness) across time and space scales raise questions as to the existence of a functional response of herbivores in vivo. In the current review, we discuss limitations of the ‘classical’ zooplankton functional response and consider possible ways to amend this framework to cope with the complexity of real planktonic ecosystems. Our general conclusion is that although the functional response of herbivores often does not exist in real ecosystems (especially in the form observed in the laboratory), this framework can be rather useful in modelling - but it does need some amendment which can be made based on various techniques of model reduction. We also show that the shape of the functional response depends on the spatial resolution (‘frame’) of the model. We argue that incorporating foraging behaviour and spatial heterogeneity in plankton models would not necessarily require the use of individual based modelling - an approach which is now becoming dominant in the literature. Finally, we list concrete future directions and challenges and emphasize the importance of a closer collaboration between plankton biologists and modellers in order to make further progress towards better descriptions of zooplankton grazing.

  7. Direct repeat sequences are essential for function of the cis-acting locus of transfer (clt) of Streptomyces phaeochromogenes plasmid pJV1.

    Science.gov (United States)

    Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis

    2003-11-01

    The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.

  8. Comparison of ultraviolet Bi-directional Reflectance Distribution Function (BRDF) measurements of diffusers used in the calibration of the Total Ozone Mapping Spectrometer (TOMS)

    NARCIS (Netherlands)

    Butler, J.J.; Park, H.; Barnes, P.Y.; Early, E.A.; Eijk-Olij, C. van; Zoutman, A.E.; Buller-Leeuwen, S. van; Groote Schaarsberg, J.

    2002-01-01

    The measurement and long-term monitoring of global total ozone by ultraviolet albedo measuring satellite instruments require accurate and precise determination of the Bi-directional Reflectance Distribution Function (BRDF) of laboratory-based diffusers used in the pre-launch calibration of those

  9. Occlusal force is correlated with cognitive function directly as well as indirectly via food intake in community-dwelling older Japanese: From the SONIC study.

    Science.gov (United States)

    Ikebe, Kazunori; Gondo, Yasuyuki; Kamide, Kei; Masui, Yukie; Ishizaki, Taturo; Arai, Yasumichi; Inagaki, Hiroki; Nakagawa, Takeshi; Kabayama, Mai; Ryuno, Hirochika; Okubo, Hitomi; Takeshita, Hajime; Inomata, Chisato; Kurushima, Yuko; Mihara, Yusuke; Hatta, Kohdai; Fukutake, Motoyoshi; Enoki, Kaori; Ogawa, Taiji; Matsuda, Ken-Ichi; Sugimoto, Ken; Oguro, Ryosuke; Takami, Yoichi; Itoh, Norihisa; Takeya, Yasushi; Yamamoto, Koichi; Rakugi, Hiromi; Murakami, Shinya; Kitamura, Masahiro; Maeda, Yoshinobu

    2018-01-01

    Growing evidence suggests that oral health may be an important factor associated with cognitive function in aged populations. However, many previous studies on this topic used insensitive oral indicators or did not include certain essential covariates. Thus, we examined the association between occlusal force and cognitive function in a large sample of older adults, controlling for dietary intake, vascular risk factors, inflammatory biomarkers, depression, and genetic factors. In this cross-sectional study of older community-dwelling Japanese adults, we examined data collected from 994 persons aged 70 years and 968 persons aged 80 years. Cognitive function was measured using the Japanese version of the Montreal Cognitive Assessment (MoCA-J). Oral status and function were evaluated according to the number of remaining teeth, periodontal pocket depth, and maximal occlusal force. Associations between MoCA-J scores and occlusal force were investigated via bivariate and multivariate analyses. Education level, financial status, depression score, and intake of green and yellow vegetables, as well as number of teeth and occlusal force, were significantly correlated with MoCA-J scores in both age groups. Among individuals aged 80 years, CRP and periodontal status were weakly but significantly associated with MoCA-J score. After controlling for all significant variables via bivariate analyses, the correlation between maximal occlusal force and cognitive function persisted. A path analysis confirmed the hypothesis that cognitive function is associated with occlusal force directly as well as indirectly via food intake. After controlling for possible factors, maximal occlusal force was positively associated with cognitive function directly as well as indirectly through dietary intake.

  10. Nonlocal electron transport: direct and Greens function solution and comparison of our model with the SNB model

    Science.gov (United States)

    Colombant, Denis; Manheimer, Wallace; Schmitt, Andrew J.

    2013-10-01

    At least two models, ours and SNB (Schurtz-Nicolai-Busquet), and two methods of solution, direct numerical solution (DS) and Greens function (GF) are being used in multi-dimensional radiation hydrodynamics codes. We present results of a laser target implosion using both methods of solution. Although our model and SNB differ in some physical content, direct comparisons have been non-existent up to now. However a paper by Marocchino et al. has recently presented the results of two nanosecond-time-scale test problems, showing that the preheat calculated by the two models are different by about three orders of magnitude. We have rerun these problems and we find much less difference between the two than they do. One can show analytically that the results should be quite similar and are about an order of magnitude less than the maximum, and two orders of magnitude more than the minimum preheating in. We have been able to trace the somewhat different results back to the different physical assumptions made in each model. Work supported by DoE-NNSA and ONR.

  11. Simulating real world functioning in schizophrenia using a naturalistic city environment and single-trial, goal-directed navigation

    Directory of Open Access Journals (Sweden)

    John A Zawadzki

    2013-11-01

    Full Text Available Objective: To develop a virtual reality platform that would serve as a functionally meaningful measure of cognition in schizophrenia that would complement standard batteries of cognitive tests during clinical trials for cognitive treatments in schizophrenia, be amenable to human neuroimaging research, yet lend itself to neurobiological comparison with rodent analogues.Method: Thirty-three patients with schizophrenia and 33 healthy controls matched for age, sex, video gaming experience and education completed eight rapid, single-trial virtual navigation tasks within a naturalistic virtual city. Four trials tested their ability to find different targets seen during the passive viewing of a closed path that led them around different city blocks. Four subsequent trials tested their ability to return to four different starting points after viewing a path that took them several blocks away from the starting position. Results: Individuals with schizophrenia had difficulties in way-finding, measured as distance travelled to find targets previously encountered within the virtual city. They were also more likely not to notice the target during passive viewing, less likely to find novel shortcuts to targets and more likely to become lost and fail completely in finding the target. Total travel distances across all eight trials strongly correlated (negatively with neurocognitive measures and, for 49 participants who completed the Quality of Life Scale, psychosocial functioning. Conclusion: Single-trial, goal-directed navigation in a naturalistic virtual environment is a functionally meaningful measure of cognitive functioning in schizophrenia.

  12. Statistical mechanics of directed models of polymers in the square lattice

    International Nuclear Information System (INIS)

    Rensburg, E J Janse van

    2003-01-01

    Directed square lattice models of polymers and vesicles have received considerable attention in the recent mathematical and physical sciences literature. These are idealized geometric directed lattice models introduced to study phase behaviour in polymers, and include Dyck paths, partially directed paths, directed trees and directed vesicles models. Directed models are closely related to models studied in the combinatorics literature (and are often exactly solvable). They are also simplified versions of a number of statistical mechanics models, including the self-avoiding walk, lattice animals and lattice vesicles. The exchange of approaches and ideas between statistical mechanics and combinatorics have considerably advanced the description and understanding of directed lattice models, and this will be explored in this review. The combinatorial nature of directed lattice path models makes a study using generating function approaches most natural. In contrast, the statistical mechanics approach would introduce partition functions and free energies, and then investigate these using the general framework of critical phenomena. Generating function and statistical mechanics approaches are closely related. For example, questions regarding the limiting free energy may be approached by considering the radius of convergence of a generating function, and the scaling properties of thermodynamic quantities are related to the asymptotic properties of the generating function. In this review the methods for obtaining generating functions and determining free energies in directed lattice path models of linear polymers is presented. These methods include decomposition methods leading to functional recursions, as well as the Temperley method (that is implemented by creating a combinatorial object, one slice at a time). A constant term formulation of the generating function will also be reviewed. The thermodynamic features and critical behaviour in models of directed paths may be

  13. The Direct Impact of Team Cohesiveness and Athletes' Perception of Coaching Leadership Functions on Team Success in NCAA Division I Women's Basketball

    Science.gov (United States)

    Palmer, Mary E.

    2013-01-01

    This study investigated the direct impact of team cohesiveness and student-athletes' perceptions of coaching behavior/leadership functions on the success of NCAA Division I Women's basketball, based on the teams' win/loss records. The research collection was quantitative in nature. Statistical design and analysis provided justification for the use…

  14. Memoization in Type-Directed Partial Evaluation

    DEFF Research Database (Denmark)

    Balat, Vincent; Danvy, Olivier

    2002-01-01

    the functions and type-directed partial evaluation provides a convenient setting to obtain the normal form of their composition. However, off-the-shelf type-directed partial evaluation turns out to yield gigantic normal forms. We identify that this gigantism is due to redundancies, and that these redundancies...

  15. Opportunities and challenges for direct C–H functionalization of piperazines

    Directory of Open Access Journals (Sweden)

    Zhishi Ye

    2016-04-01

    Full Text Available Piperazine ranks within the top three most utilized N-heterocyclic moieties in FDA-approved small-molecule pharmaceuticals. Herein we summarize the current synthetic methods available to perform C–H functionalization on piperazines in order to lend structural diversity to this privileged drug scaffold. Multiple approaches such as those involving α-lithiation trapping, transition-metal-catalyzed α-C–H functionalizations, and photoredox catalysis are discussed. We also highlight the difficulties experienced when successful methods for α-C–H functionalization of acyclic amines and saturated mono-nitrogen heterocyclic compounds (such as piperidines and pyrrolidines were applied to piperazine substrates.

  16. Directed self-avoiding walks in random media

    International Nuclear Information System (INIS)

    Santra, S. B.; Seitz, W. A.; Klein, D. J.

    2001-01-01

    Two types of directed self-avoiding walks (SAW's), namely, three-choice directed SAW and outwardly directed SAW, have been studied on infinite percolation clusters on the square lattice in two dimensions. The walks on the percolation clusters are generated via a Monte Carlo technique. The longitudinal extension R N and the transverse fluctuation W N have been measured as a function of the number of steps N. Slight swelling is observed in the longitudinal direction on the random lattices. A crossover from shrinking to swelling of the transverse fluctuations is found at a certain length N c of the walks. The exponents related to the transverse fluctuations are seen to be unchanged in the random media even as the percolation threshold is reached. The scaling function form of the extensions are verified

  17. Separating Direct and Indirect Turbofan Engine Combustion Noise While Estimating Post-Combustion (Post-Flame) Residence Time Using the Correlation Function

    Science.gov (United States)

    Miles, Jeffrey Hilton

    2011-01-01

    A previous investigation on the presence of direct and indirect combustion noise for a full-scale turbofan engine using a far-field microphone at 130 is extended by also examining signals obtained at two additional downstream directions using far-field microphones at 110 deg and 160 deg. A generalized cross-correlation function technique is used to study the change in propagation time to the far field of the combined direct and indirect combustion noise signal as a sequence of low-pass filters are applied. The filtering procedure used produces no phase distortion. As the low-pass filter frequency is decreased, the travel time increases because the relative amount of direct combustion noise is reduced. The indirect combustion noise signal travels more slowly because in the combustor entropy fluctuations move with the flow velocity, which is slow compared to the local speed of sound. The indirect combustion noise signal travels at acoustic velocities after reaching the turbine and being converted into an acoustic signal. The direct combustion noise is always propagating at acoustic velocities. The results show that the estimated indirect combustion noise time delay values (post-combustion residence times) measured at each angle are fairly consistent with one another for a relevant range of operating conditions and demonstrate source separation of a mixture of direct and indirect combustion noise. The results may lead to a better idea about the acoustics in the combustor and may help develop and validate improved reduced-order physics-based methods for predicting turbofan engine core noise.

  18. Realistic PIC modelling of laser-plasma interaction: a direct implicit method with adjustable damping and high order weight functions

    International Nuclear Information System (INIS)

    Drouin, M.

    2009-11-01

    This research thesis proposes a new formulation of the relativistic implicit direct method, based on the weak formulation of the wave equation which is solved by means of a Newton algorithm. The first part of this thesis deals with the properties of the explicit particle-in-cell (PIC) methods: properties and limitations of an explicit PIC code, linear analysis of a numerical plasma, numerical heating phenomenon, interest of a higher order interpolation function, and presentation of two applications in high density relativistic laser-plasma interaction. The second and main part of this report deals with adapting the direct implicit method to laser-plasma interaction: presentation of the state of the art, formulating of the direct implicit method, resolution of the wave equation. The third part concerns various numerical and physical validations of the ELIXIRS code: case of laser wave propagation in vacuum, demonstration of the adjustable damping which is a characteristic of the proposed algorithm, influence of space-time discretization on energy conservation, expansion of a thermal plasma in vacuum, two cases of plasma-beam unsteadiness in relativistic regime, and then a case of the overcritical laser-plasma interaction

  19. The development of a semi-structured home interview (CHIF) to directly assess function in cognitively impaired elderly people in two cultures

    Science.gov (United States)

    Hendrie, H. C.; Lane, K. A.; Ogunniyi, A.; Baiyewu, O.; Gureje, O.; Evans, R.; Smith-Gamble, V.; Pettaway, M.; Unverzagt, F. W.; Gao, S.; Hall, K. S.

    2010-01-01

    Background Assessing function is a crucial element in the diagnosis of dementia. This information is usually obtained from key informants. However, reliable informants are not always available. Methods A 10-item semi-structured home interview (the CHIF, or Clinician Home-based Interview to assess Function) to assess function primarily by measuring instrumental activities of daily living directly was developed and tested for inter-rater reliability and validity as part of the Indianapolis–Ibadan dementia project. The primary validity measurements were correlations between scores on the CHIF and independently gathered scores on the Blessed Dementia Scale (from informants) and the Mini-mental State Examination (MMSE). Sensitivities and specificities of scores on the CHIF and receiver operator characteristic (ROC) curves were constructed with dementia as the dependent variable. Results Inter-rater reliability for the CHIF was high (Pearson’s correlation coefficient 0.99 in Indianapolis and 0.87 in Ibadan). Internal consistency, in both samples, was good (Cronbach’s α 0.95 in Indianapolis and 0.83 in Ibadan). Scores on the CHIF correlated well with the Blessed Dementia scores at both sites (−0.71, p < 0.0001 for Indianapolis and −0.56, p < 0.0001 for Ibadan) and with the MMSE (0.75, p < 0.0001 for Indianapolis and 0.44, p < 0.0001 for Ibadan). For all items at both sites, the subjects without dementia performed significantly better than those with dementia. The area under the ROC curve for dementia diagnosis was 0.965 for Indianapolis and 0.925 for Ibadan. Conclusion The CHIF is a useful instrument to assess function directly in elderly participants in international studies, particularly in the absence of reliable informants. PMID:16640794

  20. Experimental analysis of bidirectional reflectance distribution function cross section conversion term in direction cosine space.

    Science.gov (United States)

    Butler, Samuel D; Nauyoks, Stephen E; Marciniak, Michael A

    2015-06-01

    Of the many classes of bidirectional reflectance distribution function (BRDF) models, two popular classes of models are the microfacet model and the linear systems diffraction model. The microfacet model has the benefit of speed and simplicity, as it uses geometric optics approximations, while linear systems theory uses a diffraction approach to compute the BRDF, at the expense of greater computational complexity. In this Letter, nongrazing BRDF measurements of rough and polished surface-reflecting materials at multiple incident angles are scaled by the microfacet cross section conversion term, but in the linear systems direction cosine space, resulting in great alignment of BRDF data at various incident angles in this space. This results in a predictive BRDF model for surface-reflecting materials at nongrazing angles, while avoiding some of the computational complexities in the linear systems diffraction model.

  1. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-07-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  2. Toward three-dimensional microelectronic systems: directed self-assembly of silicon microcubes via DNA surface functionalization.

    Science.gov (United States)

    Lämmerhardt, Nico; Merzsch, Stephan; Ledig, Johannes; Bora, Achyut; Waag, Andreas; Tornow, Marc; Mischnick, Petra

    2013-07-02

    The huge and intelligent processing power of three-dimensional (3D) biological "processors" like the human brain with clock speeds of only 0.1 kHz is an extremely fascinating property, which is based on a massively parallel interconnect strategy. Artificial silicon microprocessors are 7 orders of magnitude faster. Nevertheless, they do not show any indication of intelligent processing power, mostly due to their very limited interconnectivity. Massively parallel interconnectivity can only be realized in three dimensions. Three-dimensional artificial processors would therefore be at the root of fabricating artificially intelligent systems. A first step in this direction would be the self-assembly of silicon based building blocks into 3D structures. We report on the self-assembly of such building blocks by molecular recognition, and on the electrical characterization of the formed assemblies. First, planar silicon substrates were functionalized with self-assembling monolayers of 3-aminopropyltrimethoxysilane for coupling of oligonucleotides (single stranded DNA) with glutaric aldehyde. The oligonucleotide immobilization was confirmed and quantified by hybridization with fluorescence-labeled complementary oligonucleotides. After the individual processing steps, the samples were analyzed by contact angle measurements, ellipsometry, atomic force microscopy, and fluorescence microscopy. Patterned DNA-functionalized layers were fabricated by microcontact printing (μCP) and photolithography. Silicon microcubes of 3 μm edge length as model objects for first 3D self-assembly experiments were fabricated out of silicon-on-insulator (SOI) wafers by a combination of reactive ion etching (RIE) and selective wet etching. The microcubes were then surface-functionalized using the same protocol as on planar substrates, and their self-assembly was demonstrated both on patterned silicon surfaces (88% correctly placed cubes), and to cube aggregates by complementary DNA

  3. Directional patterns of cross frequency phase and amplitude coupling within the resting state mimic patterns of fMRI functional connectivity

    Science.gov (United States)

    Weaver, Kurt E.; Wander, Jeremiah D.; Ko, Andrew L.; Casimo, Kaitlyn; Grabowski, Thomas J.; Ojemann, Jeffrey G.; Darvas, Felix

    2016-01-01

    Functional imaging investigations into the brain's resting state interactions have yielded a wealth of insight into the intrinsic and dynamic neural architecture supporting cognition and behavior. Electrophysiological studies however have highlighted the fact that synchrony across large-scale cortical systems is composed of spontaneous interactions occurring at timescales beyond the traditional resolution of fMRI, a feature that limits the capacity of fMRI to draw inference on the true directional relationship between network nodes. To approach the question of directionality in resting state signals, we recorded resting state functional MRI (rsfMRI) and electrocorticography (ECoG) from four human subjects undergoing invasive epilepsy monitoring. Using a seed-point based approach, we employed phase-amplitude coupling (PAC) and biPhase Locking Values (bPLV), two measures of cross-frequency coupling (CFC) to explore both outgoing and incoming connections between the seed and all non-seed, site electrodes. We observed robust PAC between a wide range of low-frequency phase and high frequency amplitude estimates. However, significant bPLV, a CFC measure of phase-phase synchrony, was only observed at specific narrow low and high frequency bandwidths. Furthermore, the spatial patterns of outgoing PAC connectivity were most closely associated with the rsfMRI connectivity maps. Our results support the hypothesis that PAC is relatively ubiquitous phenomenon serving as a mechanism for coordinating high-frequency amplitudes across distant neuronal assemblies even in absence of overt task structure. Additionally, we demonstrate that the spatial distribution of a seed-point rsfMRI sensorimotor network is strikingly similar to specific patterns of directional PAC. Specifically, the high frequency activities of distal patches of cortex owning membership in a rsfMRI sensorimotor network were most likely to be entrained to the phase of a low frequency rhythm engendered from the

  4. BNL Direct Wind Superconducting Magnets

    Energy Technology Data Exchange (ETDEWEB)

    Parker, B.; Anerella, M.; Escallier, J.; Ghosh, A.; Jain, A.; Marone, A.; Muratore, A.; Wanderer, P.

    2011-09-12

    BNL developed Direct Wind magnet technology is used to create a variety of complex multi-functional multi-layer superconducting coil structures without the need for creating custom production tooling and fixturing for each new project. Our Direct Wind process naturally integrates prestress into the coil structure so external coil collars and yokes are not needed; the final coil package transverse size can then be very compact. Direct Wind magnets are produced with very good field quality via corrections applied during the course of coil winding. The HERA-II and BEPC-II Interaction Region (IR) magnet, J-PARC corrector and Alpha antihydrogen magnetic trap magnets and our BTeV corrector magnet design are discussed here along with a full length ILC IR prototype magnet presently in production and the coils that were wound for an ATF2 upgrade at KEK. A new IR septum magnet design concept for a 6.2 T combined-function IR magnet for eRHIC, a future RHIC upgrade, is introduced here.

  5. Assessing eco-efficiency: A metafrontier directional distance function approach using life cycle analysis

    International Nuclear Information System (INIS)

    Beltrán-Esteve, Mercedes; Reig-Martínez, Ernest; Estruch-Guitart, Vicent

    2017-01-01

    Sustainability analysis requires a joint assessment of environmental, social and economic aspects of production processes. Here we propose the use of Life Cycle Analysis (LCA), a metafrontier (MF) directional distance function (DDF) approach, and Data Envelopment Analysis (DEA), to assess technological and managerial differences in eco-efficiency between production systems. We use LCA to compute six environmental and health impacts associated with the production processes of nearly 200 Spanish citrus farms belonging to organic and conventional farming systems. DEA is then employed to obtain joint economic-environmental farm's scores that we refer to as eco-efficiency. DDF allows us to determine farms' global eco-efficiency scores, as well as eco-efficiency scores with respect to specific environmental impacts. Furthermore, the use of an MF helps us to disentangle technological and managerial eco-inefficiencies by comparing the eco-efficiency of both farming systems with regards to a common benchmark. Our core results suggest that the shift from conventional to organic farming technology would allow a potential reduction in environmental impacts of 80% without resulting in any decline in economic performance. In contrast, as regards farmers' managerial capacities, both systems display quite similar mean scores.

  6. Assessing eco-efficiency: A metafrontier directional distance function approach using life cycle analysis

    Energy Technology Data Exchange (ETDEWEB)

    Beltrán-Esteve, Mercedes, E-mail: mercedes.beltran@uv.es [Department of Applied Economics II, University of Valencia (Spain); Reig-Martínez, Ernest [Department of Applied Economics II, University of Valencia, Ivie (Spain); Estruch-Guitart, Vicent [Department of Economy and Social Sciences, Polytechnic University of Valencia (Spain)

    2017-03-15

    Sustainability analysis requires a joint assessment of environmental, social and economic aspects of production processes. Here we propose the use of Life Cycle Analysis (LCA), a metafrontier (MF) directional distance function (DDF) approach, and Data Envelopment Analysis (DEA), to assess technological and managerial differences in eco-efficiency between production systems. We use LCA to compute six environmental and health impacts associated with the production processes of nearly 200 Spanish citrus farms belonging to organic and conventional farming systems. DEA is then employed to obtain joint economic-environmental farm's scores that we refer to as eco-efficiency. DDF allows us to determine farms' global eco-efficiency scores, as well as eco-efficiency scores with respect to specific environmental impacts. Furthermore, the use of an MF helps us to disentangle technological and managerial eco-inefficiencies by comparing the eco-efficiency of both farming systems with regards to a common benchmark. Our core results suggest that the shift from conventional to organic farming technology would allow a potential reduction in environmental impacts of 80% without resulting in any decline in economic performance. In contrast, as regards farmers' managerial capacities, both systems display quite similar mean scores.

  7. Direct electrochemical sensing of glucose using glucose oxidase immobilized on functionalized carbon nanotubes via a novel metal chelate-based affinity method

    International Nuclear Information System (INIS)

    Tu, X.; Zhao, Y.; Luo, S.; Luo, X.; Feng, L.

    2012-01-01

    We report on a novel amperometric glassy carbon biosensing electrode for glucose. It is based on the immobilization of a highly sensitive glucose oxidase (GOx) by affinity interaction on carbon nanotubes (CNTs) functionalized with iminodiacetic acid and metal chelates. The new technique for immobilization is exploiting the affinity of Co(II) ions to the histidine and cysteine moieties on the surface of GOx. The direct electrochemistry of immobilized GOx revealed that the functionalized CNTs greatly improve the direct electron transfer between GOx and the surface of the electrode to give a pair of well-defined and almost reversible redox peaks and undergoes fast heterogeneous electron transfer with a rate constant (k s) of 0. 59 s -1 . The GOx immobilized in this way fully retained its activity for the oxidation of glucose. The resulting biosensor is capable of detecting glucose at levels as low as 0.01 mM, and has excellent operational stability (with no decrease in the activity of enzyme over a 10 days period). The method of immobilizing GOx is easy and also provides a model technique for potential use with other redox enzymes and proteins. (author)

  8. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection.

    Science.gov (United States)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; da Cruz, Nilson Cristino; de Moraes, Marli Leite; Riul, Antonio; Ferreira, Marystela

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4μmol·L(-1) and sensitivity of 2.47μA·cm(-2)·mmol(-1)·L for glucose with the (GPDDA/GPSS)1/(GPDDA/GOx)2 architecture, whose thickness was 19.80±0.28nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Spatial Statistics and Spatio-Temporal Data Covariance Functions and Directional Properties

    CERN Document Server

    Sherman, Michael

    2010-01-01

    In the spatial or space-time context, specifying the correct covariance function is important to obtain efficient predictions and to understand the underlying physical process of interest. There have been several books in recent years in the general area of spatial statistics. This book focuses on covariance and variogram functions, their role in prediction, and the proper choice of these functions in data applications. Presenting recent methods from 2004-2007 alongside more established methodology of assessing the usual assumptions on such functions such as isotropy, separability and symmetry

  10. Learning to trade via direct reinforcement.

    Science.gov (United States)

    Moody, J; Saffell, M

    2001-01-01

    We present methods for optimizing portfolios, asset allocations, and trading systems based on direct reinforcement (DR). In this approach, investment decision-making is viewed as a stochastic control problem, and strategies are discovered directly. We present an adaptive algorithm called recurrent reinforcement learning (RRL) for discovering investment policies. The need to build forecasting models is eliminated, and better trading performance is obtained. The direct reinforcement approach differs from dynamic programming and reinforcement algorithms such as TD-learning and Q-learning, which attempt to estimate a value function for the control problem. We find that the RRL direct reinforcement framework enables a simpler problem representation, avoids Bellman's curse of dimensionality and offers compelling advantages in efficiency. We demonstrate how direct reinforcement can be used to optimize risk-adjusted investment returns (including the differential Sharpe ratio), while accounting for the effects of transaction costs. In extensive simulation work using real financial data, we find that our approach based on RRL produces better trading strategies than systems utilizing Q-learning (a value function method). Real-world applications include an intra-daily currency trader and a monthly asset allocation system for the S&P 500 Stock Index and T-Bills.

  11. Vector Directional Distance Rational Hybrid Filters for Color Image Restoration

    Directory of Open Access Journals (Sweden)

    L. Khriji

    2005-12-01

    Full Text Available A new class of nonlinear filters, called vector-directional distance rational hybrid filters (VDDRHF for multispectral image processing, is introduced and applied to color image-filtering problems. These filters are based on rational functions (RF. The VDDRHF filter is a two-stage filter, which exploits the features of the vector directional distance filter (VDDF, the center weighted vector directional distance filter (CWVDDF and those of the rational operator. The filter output is a result of vector rational function (VRF operating on the output of three sub-functions. Two vector directional distance (VDDF filters and one center weighted vector directional distance filter (CWVDDF are proposed to be used in the first stage due to their desirable properties, such as, noise attenuation, chromaticity retention, and edges and details preservation. Experimental results show that the new VDDRHF outperforms a number of widely known nonlinear filters for multi-spectral image processing such as the vector median filter (VMF, the generalized vector directional filters (GVDF and distance directional filters (DDF with respect to all criteria used.

  12. Direct Cardiac Reprogramming: Advances in Cardiac Regeneration

    Directory of Open Access Journals (Sweden)

    Olivia Chen

    2015-01-01

    Full Text Available Heart disease is one of the lead causes of death worldwide. Many forms of heart disease, including myocardial infarction and pressure-loading cardiomyopathies, result in irreversible cardiomyocyte death. Activated fibroblasts respond to cardiac injury by forming scar tissue, but ultimately this response fails to restore cardiac function. Unfortunately, the human heart has little regenerative ability and long-term outcomes following acute coronary events often include chronic and end-stage heart failure. Building upon years of research aimed at restoring functional cardiomyocytes, recent advances have been made in the direct reprogramming of fibroblasts toward a cardiomyocyte cell fate both in vitro and in vivo. Several experiments show functional improvements in mouse models of myocardial infarction following in situ generation of cardiomyocyte-like cells from endogenous fibroblasts. Though many of these studies are in an early stage, this nascent technology holds promise for future applications in regenerative medicine. In this review, we discuss the history, progress, methods, challenges, and future directions of direct cardiac reprogramming.

  13. Anatomic and functional outcomes of pharmacomechanical and catheter-directed thrombolysis of iliofemoral deep venous thrombosis.

    Science.gov (United States)

    Hager, Eric; Yuo, Theodore; Avgerinos, Efthymios; Naddaf, Abdullah; Jeyabalan, Geetha; Marone, Luke; Chaer, Rabih

    2014-07-01

    Pharmacomechanical thrombolysis (PMT) and catheter-directed thrombolysis (CDT) are commonly used for the treatment of iliofemoral deep venous thrombosis (DVT). The purpose of this study was to examine the short- and long-term venous patency and venous valvular function as well as clinical outcomes of patients treated for iliofemoral DVT by PMT and CDT. A retrospective review of all patients with symptomatic DVT treated between 2006 and 2011 with PMT or CDT was performed. All patients were treated by local tissue plasminogen activator delivered with PMT or CDT. Patients were divided into two groups on the basis of initial treatment modality: patients treated by PMT alone (group 1), and those who underwent PMT and CDT or CDT alone (group 2). Group comorbidities, initial presenting symptoms, and Clinical, Etiologic, Anatomic, and Pathologic (CEAP) classification scores were compared. Postprocedural duplex ultrasound was used to assess valve function and treated vein patency rates. At all visits, Villalta and CEAP scores were recorded and compared. Group demographic and procedural results were analyzed by Fisher exact test for dichotomous variables and Kruskal-Wallis equality-of-populations rank test for the ordinal and continuous data. Kaplan-Meier survival estimates were used to assess preserved valve function as well as primary and secondary patency rates. There were 79 patients with 102 limbs treated for extensive iliofemoral DVT (median age, 51.5 years; range, 16.6-83.8 years). There were 18 patients in group 1 and 61 patients in group 2 (PMT + CDT [n = 54] or CDT alone [n = 7]). There were no differences in demographics or comorbidities between groups aside from malignant disease, which was more common in group 1 (35.3% vs 11.5%; P = .03). A total of 102 limbs were analyzed, 24 in group 1 and 78 in group 2. Patients in group 1 had a shorter symptom duration compared with group 2 (7 days vs 16 days; P = .011). The median number of procedures in group 1

  14. Functional mapping of the fission yeast DNA polymerase δ B-subunit Cdc1 by site-directed and random pentapeptide insertion mutagenesis

    Directory of Open Access Journals (Sweden)

    Gray Fiona C

    2009-08-01

    Full Text Available Abstract Background DNA polymerase δ plays an essential role in chromosomal DNA replication in eukaryotic cells, being responsible for synthesising the bulk of the lagging strand. In fission yeast, Pol δ is a heterotetrameric enzyme comprising four evolutionarily well-conserved proteins: the catalytic subunit Pol3 and three smaller subunits Cdc1, Cdc27 and Cdm1. Pol3 binds directly to the B-subunit, Cdc1, which in turn binds the C-subunit, Cdc27. Human Pol δ comprises the same four subunits, and the crystal structure was recently reported of a complex of human p50 and the N-terminal domain of p66, the human orthologues of Cdc1 and Cdc27, respectively. Results To gain insights into the structure and function of Cdc1, random and directed mutagenesis techniques were used to create a collection of thirty alleles encoding mutant Cdc1 proteins. Each allele was tested for function in fission yeast and for binding of the altered protein to Pol3 and Cdc27 using the two-hybrid system. Additionally, the locations of the amino acid changes in each protein were mapped onto the three-dimensional structure of human p50. The results obtained from these studies identify amino acid residues and regions within the Cdc1 protein that are essential for interaction with Pol3 and Cdc27 and for in vivo function. Mutations specifically defective in Pol3-Cdc1 interactions allow the identification of a possible Pol3 binding surface on Cdc1. Conclusion In the absence of a three-dimensional structure of the entire Pol δ complex, the results of this study highlight regions in Cdc1 that are vital for protein function in vivo and provide valuable clues to possible protein-protein interaction surfaces on the Cdc1 protein that will be important targets for further study.

  15. Direct quantification of negatively charged functional groups on membrane surfaces

    KAUST Repository

    Tiraferri, Alberto

    2012-02-01

    Surface charge plays an important role in membrane-based separations of particulates, macromolecules, and dissolved ionic species. In this study, we present two experimental methods to determine the concentration of negatively charged functional groups at the surface of dense polymeric membranes. Both techniques consist of associating the membrane surface moieties with chemical probes, followed by quantification of the bound probes. Uranyl acetate and toluidine blue O dye, which interact with the membrane functional groups via complexation and electrostatic interaction, respectively, were used as probes. The amount of associated probes was quantified using liquid scintillation counting for uranium atoms and visible light spectroscopy for the toluidine blue dye. The techniques were validated using self-assembled monolayers of alkanethiols with known amounts of charged moieties. The surface density of negatively charged functional groups of hand-cast thin-film composite polyamide membranes, as well as commercial cellulose triacetate and polyamide membranes, was quantified under various conditions. Using both techniques, we measured a negatively charged functional group density of 20-30nm -2 for the hand-cast thin-film composite membranes. The ionization behavior of the membrane functional groups, determined from measurements with toluidine blue at varying pH, was consistent with published data for thin-film composite polyamide membranes. Similarly, the measured charge densities on commercial membranes were in general agreement with previous investigations. The relative simplicity of the two methods makes them a useful tool for quantifying the surface charge concentration of a variety of surfaces, including separation membranes. © 2011 Elsevier B.V.

  16. A Direct Method of Hamiltonian Structure

    International Nuclear Information System (INIS)

    Li Qi; Chen Dengyuan; Su Shuhua

    2011-01-01

    A direct method of constructing the Hamiltonian structure of the soliton hierarchy with self-consistent sources is proposed through computing the functional derivative under some constraints. The Hamiltonian functional is related with the conservation densities of the corresponding hierarchy. Three examples and their two reductions are given. (general)

  17. Directional sensitivity of MuSTAnG muon telescope

    Directory of Open Access Journals (Sweden)

    Ganeva Marina

    2013-04-01

    Full Text Available We investigate directional sensitivity of MuSTAnG muon telescope by deriving the distribution of secondary muons, which create the counting rate of telescope, by asymptotic directions of primary protons. This distribution, defined as “directivity function”, allows us to clarify protons appearing from which direction essentially contribute to counting rate of detector. Directivity function has different behavior for the muons falling on the telescope at different zenith and polar angles. Vertical, West, and East fluxes exhibit strong maximums near the asymptotic longitude about 61°, whereas North and South fluxes have larger spread distributions. About 65% of muons, which create the Vertical counting rate of MuSTAnG, are produced by the primary protons, coming in the interval of asymptotic longitudes about (50°, 80°. Using directivity function will allow one to more correctly determine the location of interplanetary disturbances. Analogous analysis, made for other muon detectors, will clarify their directional sensitivities, improving by this the forecasting capability of network of ground-based muon detectors.

  18. Direct Functionalization of an Acid-Terminated Nanodiamond with Azide: Enabling Access to 4-Substituted-1,2,3-Triazole-Functionalized Particles.

    Science.gov (United States)

    Kennedy, Zachary C; Barrett, Christopher A; Warner, Marvin G

    2017-03-21

    Azides on the periphery of nanodiamond materials (ND) are of great utility because they have been shown to undergo Cu-catalyzed and Cu-free cycloaddition reactions with structurally diverse alkynes, affording particles tailored for applications in biology and materials science. However, current methods employed to access ND featuring azide groups typically require either harsh pretreatment procedures or multiple synthesis steps and use surface linking groups that may be susceptible to undesirable cleavage. Here we demonstrate an alternative single-step approach to producing linker-free, azide-functionalized ND. Our method was applied to low-cost, detonation-derived ND powders where surface carbonyl groups undergo silver-mediated decarboxylation and radical substitution with azide. ND with directly grafted azide groups were then treated with a variety of aliphatic, aromatic, and fluorescent alkynes to afford 1-(ND)-4-substituted-1,2,3-triazole materials under standard copper-catalyzed cycloaddition conditions. Surface modification steps were verified by characteristic infrared absorptions and elemental analyses. High loadings of triazole surface groups (up to 0.85 mmol g -1 ) were obtained as determined from thermogravimetric analysis. The azidation procedure disclosed is envisioned to become a valuable initial transformation in numerous future applications of ND.

  19. Substrate-Directed Catalytic Selective Chemical Reactions.

    Science.gov (United States)

    Sawano, Takahiro; Yamamoto, Hisashi

    2018-05-04

    The development of highly efficient reactions at only the desired position is one of the most important subjects in organic chemistry. Most of the reactions in current organic chemistry are reagent- or catalyst-controlled reactions, and the regio- and stereoselectivity of the reactions are determined by the inherent nature of the reagent or catalyst. In sharp contrast, substrate-directed reaction determines the selectivity of the reactions by the functional group on the substrate and can strictly distinguish sterically and electronically similar multiple reaction sites in the substrate. In this Perspective, three topics of substrate-directed reaction are mainly reviewed: (1) directing group-assisted epoxidation of alkenes, (2) ring-opening reactions of epoxides by various nucleophiles, and (3) catalytic peptide synthesis. Our newly developed synthetic methods with new ligands including hydroxamic acid derived ligands realized not only highly efficient reactions but also pinpointed reactions at the expected position, demonstrating the substrate-directed reaction as a powerful method to achieve the desired regio- and stereoselective functionalization of molecules from different viewpoints of reagent- or catalyst-controlled reactions.

  20. Methods of conditioning direct methanol fuel cells

    Science.gov (United States)

    Rice, Cynthia; Ren, Xiaoming; Gottesfeld, Shimshon

    2005-11-08

    Methods for conditioning the membrane electrode assembly of a direct methanol fuel cell ("DMFC") are disclosed. In a first method, an electrical current of polarity opposite to that used in a functioning direct methanol fuel cell is passed through the anode surface of the membrane electrode assembly. In a second method, methanol is supplied to an anode surface of the membrane electrode assembly, allowed to cross over the polymer electrolyte membrane of the membrane electrode assembly to a cathode surface of the membrane electrode assembly, and an electrical current of polarity opposite to that in a functioning direct methanol fuel cell is drawn through the membrane electrode assembly, wherein methanol is oxidized at the cathode surface of the membrane electrode assembly while the catalyst on the anode surface is reduced. Surface oxides on the direct methanol fuel cell anode catalyst of the membrane electrode assembly are thereby reduced.

  1. Functional displays

    International Nuclear Information System (INIS)

    Angelis De, F.; Haentjens, J.

    1995-01-01

    The Functional Displays are directly derived from the Man-Machine Design key document: Function-Based Task Analysis. The presentation defines and describes the goals-means structure of the plant function along with applicable control volumes and parameters of interest. The purpose of the subject is to show, through an example of a preliminary design, what the main parts of a function are. (3 figs.)

  2. Direct interaction of TFIIB and the IE protein of equine herpesvirus 1 is required for maximal trans-activation function

    International Nuclear Information System (INIS)

    Albrecht, Randy A.; Jang, Hyung K.; Kim, Seong K.; O'Callaghan, Dennis J.

    2003-01-01

    Recently, we reported that the immediate-early (IE) protein of equine herpesvirus 1 (EHV-1) associates with transcription factor TFIIB [J. Virol. 75 (2001), 10219]. In the current study, the IE protein purified as a glutathione-S-transferase (GST) fusion protein was shown to interact directly with purified TFIIB in GST-pulldown assays. A panel of TFIIB mutants employed in protein-binding assays revealed that residues 125 to 174 within the first direct repeat of TFIIB mediate its interaction with the IE protein. This interaction is physiologically relevant as transient transfection assays demonstrated that (1) exogenous native TFIIB did not perturb IE protein function, and (2) ectopic expression of a TFIIB mutant that lacked the IE protein interactive domain significantly diminished the ability of the IE protein to trans-activate EHV-1 promoters. These results suggest that an interaction of the IE protein with TFIIB is an important aspect of the regulatory role of the IE protein in the trans-activation of EHV-1 promoters

  3. TU-G-BRA-02: Can We Extract Lung Function Directly From 4D-CT Without Deformable Image Registration?

    Energy Technology Data Exchange (ETDEWEB)

    Kipritidis, J; Woodruff, H; Counter, W; Keall, P [University of Sydney, Sydney, NSW (Australia); Hofman, M; Siva, S; Callahan, J; Le Roux, P [Peter MacCallum Cancer Centre, Melbourne, VIC (Australia); Hardcastle, N [Royal North Shore Hospital, Sydney, NSW (Australia)

    2015-06-15

    Purpose: Dynamic CT ventilation imaging (CT-VI) visualizes air volume changes in the lung by evaluating breathing-induced lung motion using deformable image registration (DIR). Dynamic CT-VI could enable functionally adaptive lung cancer radiation therapy, but its sensitivity to DIR parameters poses challenges for validation. We hypothesize that a direct metric using CT parameters derived from Hounsfield units (HU) alone can provide similar ventilation images without DIR. We compare the accuracy of Direct and Dynamic CT-VIs versus positron emission tomography (PET) images of inhaled {sup 68}Ga-labelled nanoparticles (‘Galligas’). Methods: 25 patients with lung cancer underwent Galligas 4D-PET/CT scans prior to radiation therapy. For each patient we produced three CT- VIs. (i) Our novel method, Direct CT-VI, models blood-gas exchange as the product of air and tissue density at each lung voxel based on time-averaged 4D-CT HU values. Dynamic CT-VIs were produced by evaluating: (ii) regional HU changes, and (iii) regional volume changes between the exhale and inhale 4D-CT phase images using a validated B-spline DIR method. We assessed the accuracy of each CT-VI by computing the voxel-wise Spearman correlation with free-breathing Galligas PET, and also performed a visual analysis. Results: Surprisingly, Direct CT-VIs exhibited better global correlation with Galligas PET than either of the dynamic CT-VIs. The (mean ± SD) correlations were (0.55 ± 0.16), (0.41 ± 0.22) and (0.29 ± 0.27) for Direct, Dynamic HU-based and Dynamic volume-based CT-VIs respectively. Visual comparison of Direct CT-VI to PET demonstrated similarity for emphysema defects and ventral-to-dorsal gradients, but inability to identify decreased ventilation distal to tumor-obstruction. Conclusion: Our data supports the hypothesis that Direct CT-VIs are as accurate as Dynamic CT-VIs in terms of global correlation with Galligas PET. Visual analysis, however, demonstrated that different CT

  4. TU-G-BRA-02: Can We Extract Lung Function Directly From 4D-CT Without Deformable Image Registration?

    International Nuclear Information System (INIS)

    Kipritidis, J; Woodruff, H; Counter, W; Keall, P; Hofman, M; Siva, S; Callahan, J; Le Roux, P; Hardcastle, N

    2015-01-01

    Purpose: Dynamic CT ventilation imaging (CT-VI) visualizes air volume changes in the lung by evaluating breathing-induced lung motion using deformable image registration (DIR). Dynamic CT-VI could enable functionally adaptive lung cancer radiation therapy, but its sensitivity to DIR parameters poses challenges for validation. We hypothesize that a direct metric using CT parameters derived from Hounsfield units (HU) alone can provide similar ventilation images without DIR. We compare the accuracy of Direct and Dynamic CT-VIs versus positron emission tomography (PET) images of inhaled "6"8Ga-labelled nanoparticles (‘Galligas’). Methods: 25 patients with lung cancer underwent Galligas 4D-PET/CT scans prior to radiation therapy. For each patient we produced three CT- VIs. (i) Our novel method, Direct CT-VI, models blood-gas exchange as the product of air and tissue density at each lung voxel based on time-averaged 4D-CT HU values. Dynamic CT-VIs were produced by evaluating: (ii) regional HU changes, and (iii) regional volume changes between the exhale and inhale 4D-CT phase images using a validated B-spline DIR method. We assessed the accuracy of each CT-VI by computing the voxel-wise Spearman correlation with free-breathing Galligas PET, and also performed a visual analysis. Results: Surprisingly, Direct CT-VIs exhibited better global correlation with Galligas PET than either of the dynamic CT-VIs. The (mean ± SD) correlations were (0.55 ± 0.16), (0.41 ± 0.22) and (0.29 ± 0.27) for Direct, Dynamic HU-based and Dynamic volume-based CT-VIs respectively. Visual comparison of Direct CT-VI to PET demonstrated similarity for emphysema defects and ventral-to-dorsal gradients, but inability to identify decreased ventilation distal to tumor-obstruction. Conclusion: Our data supports the hypothesis that Direct CT-VIs are as accurate as Dynamic CT-VIs in terms of global correlation with Galligas PET. Visual analysis, however, demonstrated that different CT-VI algorithms

  5. Direct marketing a automobilový trh

    OpenAIRE

    Humaj, Matúš

    2011-01-01

    Bachelor's thesis focuses on direct marketing in close links with car market in Czech republic. Theoretical part points to direct marketing like event of marketing communication, it mentions about advantages and disadvantages, functions, tools and about adjustmen. In practical part I try to find the weak site of the market by the help of market's analysis and questionnaire and I propose the concept of direct marketing utilization.

  6. Echocardiographic assessment with right ventricular function improvement following ultrasound-accelerated catheter-directed thrombolytic therapy in submassive pulmonary embolism.

    Science.gov (United States)

    Doheny, Charles; Gonzalez, Lorena; Duchman, Stanley M; Varon, Joseph; Bechara, Carlos F; Cheung, Mathew; Lin, Peter H

    2018-06-01

    Introduction The objective of this study was to evaluate the efficacy of ultrasound-accelerated catheter-directed thrombolytic therapy in patients with submassive pulmonary embolism. Methods Clinical records of 46 patients with submassive pulmonary embolism who underwent ultrasound-accelerated catheter-directed pulmonary thrombolysis using tissue plasminogen activator, from 2007 to 2017, were analyzed. All patients experienced clinical symptoms with computed tomography evidence of pulmonary thrombus burden. Right ventricular dysfunction was present in all patients by echocardiographic finding of right ventricle-to-left ventricle ratio > 0.9. Treatment outcome, procedural complications, right ventricular pressures, and thrombus clearance were evaluated. Follow-up evaluation included echocardiographic assessment of right ventricle-to-left ventricle ratio at one month, six months, and one year. Results Technical success was achieved in all patients ( n = 46, 100%). Our patients received an average of 18.4 ± 4.7 mg of tissue plasminogen activator using ultrasound-accelerated thrombolytic catheter with an average infusion time of 16.5± 5.4 h. Clinical success was achieved in all patients (100%). Significant reduction of mean pulmonary artery pressure occurred following the treatment, which decreased from 36 ± 8 to 21 ± 5 mmHg ( p right ventricular dysfunction based on echocardiographic assessment. The right ventricle-to-left ventricle ratio decreased from 1.32 ± 0.18 to 0.91 ± 0.13 at the time of hospital discharge ( p right ventricular function remained improved at 6 months and 12 months of follow-up, as right ventricle-to-left ventricle ratio were 0.92 ± 0.14 ( p right ventricular function in patients with submassive pulmonary embolism.

  7. ERF/ERFC, Calculation of Error Function, Complementary Error Function, Probability Integrals

    International Nuclear Information System (INIS)

    Vogel, J.E.

    1983-01-01

    1 - Description of problem or function: ERF and ERFC are used to compute values of the error function and complementary error function for any real number. They may be used to compute other related functions such as the normal probability integrals. 4. Method of solution: The error function and complementary error function are approximated by rational functions. Three such rational approximations are used depending on whether - x .GE.4.0. In the first region the error function is computed directly and the complementary error function is computed via the identity erfc(x)=1.0-erf(x). In the other two regions the complementary error function is computed directly and the error function is computed from the identity erf(x)=1.0-erfc(x). The error function and complementary error function are real-valued functions of any real argument. The range of the error function is (-1,1). The range of the complementary error function is (0,2). 5. Restrictions on the complexity of the problem: The user is cautioned against using ERF to compute the complementary error function by using the identity erfc(x)=1.0-erf(x). This subtraction may cause partial or total loss of significance for certain values of x

  8. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    International Nuclear Information System (INIS)

    Kowalewski, Markus; Mukamel, Shaul

    2015-01-01

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings

  9. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    Energy Technology Data Exchange (ETDEWEB)

    Kowalewski, Markus, E-mail: mkowalew@uci.edu; Mukamel, Shaul, E-mail: smukamel@uci.edu [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States)

    2015-07-28

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings.

  10. Direction of information flow in large-scale resting-state networks is frequency-dependent

    NARCIS (Netherlands)

    Hillebrand, Arjan; Tewarie, Prejaas; Van Dellen, Edwin; Yu, Meichen; Carbo, Ellen W S; Douw, Linda; Gouw, Alida A.; Van Straaten, Elisabeth C W; Stam, Cornelis J.

    2016-01-01

    Normal brain function requires interactions between spatially separated, and functionally specialized, macroscopic regions, yet the directionality of these interactions in large-scale functional networks is unknown. Magnetoencephalography was used to determine the directionality of these

  11. Mutual Connectivity Analysis (MCA) Using Generalized Radial Basis Function Neural Networks for Nonlinear Functional Connectivity Network Recovery in Resting-State Functional MRI.

    Science.gov (United States)

    DSouza, Adora M; Abidin, Anas Zainul; Nagarajan, Mahesh B; Wismüller, Axel

    2016-03-29

    We investigate the applicability of a computational framework, called mutual connectivity analysis (MCA), for directed functional connectivity analysis in both synthetic and resting-state functional MRI data. This framework comprises of first evaluating non-linear cross-predictability between every pair of time series prior to recovering the underlying network structure using community detection algorithms. We obtain the non-linear cross-prediction score between time series using Generalized Radial Basis Functions (GRBF) neural networks. These cross-prediction scores characterize the underlying functionally connected networks within the resting brain, which can be extracted using non-metric clustering approaches, such as the Louvain method. We first test our approach on synthetic models with known directional influence and network structure. Our method is able to capture the directional relationships between time series (with an area under the ROC curve = 0.92 ± 0.037) as well as the underlying network structure (Rand index = 0.87 ± 0.063) with high accuracy. Furthermore, we test this method for network recovery on resting-state fMRI data, where results are compared to the motor cortex network recovered from a motor stimulation sequence, resulting in a strong agreement between the two (Dice coefficient = 0.45). We conclude that our MCA approach is effective in analyzing non-linear directed functional connectivity and in revealing underlying functional network structure in complex systems.

  12. Enhancement of Cortical Excitability and Lower Limb Motor Function in Patients With Stroke by Transcranial Direct Current Stimulation.

    Science.gov (United States)

    Chang, Min Cheol; Kim, Dae Yul; Park, Dae Hwan

    2015-01-01

    Motor dysfunction in the lower limbs is a common sequela in stroke patients. We used transcranial magnetic stimulation (TMS) to determine if applying transcranial direct current stimulation (tDCS) to the primary motor cortex helps enhance cortical excitability. Furthermore, we evaluate if combination anodal tDCS and conventional physical therapy improves motor function in the lower limbs. Twenty-four patients with early-stage stroke were randomly assigned to 2 groups: 1) the tDCS group, in which patients received 10 sessions of anodal tDCS and conventional physical therapy; and 2) the sham group, in which patients received 10 sessions of sham stimulation and conventional physical therapy. One day before and after intervention, the motor-evoked potential (MEP) of the affected tibialis anterior muscle was evaluated and motor function was assessed using the lower limb subscale of the Fugl-Meyer Assessment (FMA-LE), lower limb Motricity Index (MI-LE), Functional Ambulatory Category (FAC), Berg Balance Scale (BBS), and gait analysis. The MEPs in the tDCS group became shorter in latency and higher in amplitude after intervention in comparison with the sham group. Improvements in FMA-LE and MI-LE were greater in the tDCS group, but no significant differences in FAC or BBS scores were found. Also, the changes observed on the gait analyses did not significantly differ between the tDCS and sham groups. Combination anodal tDCS and conservative physical therapy appears to be a beneficial therapeutic modality for improving motor function in the lower limbs in patients with subacute stroke. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Functionally graded material of 304L stainless steel and inconel 625 fabricated by directed energy deposition: Characterization and thermodynamic modeling

    International Nuclear Information System (INIS)

    Carroll, Beth E.; Otis, Richard A.; Borgonia, John Paul; Suh, Jong-ook; Dillon, R. Peter; Shapiro, Andrew A.; Hofmann, Douglas C.; Liu, Zi-Kui; Beese, Allison M.

    2016-01-01

    Many engineering applications, particularly in extreme environments, require components with properties that vary with location in the part. Functionally graded materials (FGMs), which possess gradients in properties such as hardness or density, are a potential solution to address these requirements. The laser-based additive manufacturing process of directed energy deposition (DED) can be used to fabricate metallic parts with a gradient in composition by adjusting the volume fraction of metallic powders delivered to the melt pool as a function of position. As this is a fusion process, secondary phases may develop in the gradient zone during solidification that can result in undesirable properties in the part. This work describes experimental and thermodynamic studies of a component built from 304L stainless steel incrementally graded to Inconel 625. The microstructure, chemistry, phase composition, and microhardness as a function of position were characterized by microscopy, energy dispersive spectroscopy, X-ray diffraction, and microindentation. Particles of secondary phases were found in small amounts within cracks in the gradient zone. These were ascertained to consist of transition metal carbides by experimental results and thermodynamic calculations. The study provides a combined experimental and thermodynamic computational modeling approach toward the fabrication and evaluation of a functionally graded material made by DED additive manufacturing.

  14. Direct sampling methods for inverse elastic scattering problems

    Science.gov (United States)

    Ji, Xia; Liu, Xiaodong; Xi, Yingxia

    2018-03-01

    We consider the inverse elastic scattering of incident plane compressional and shear waves from the knowledge of the far field patterns. Specifically, three direct sampling methods for location and shape reconstruction are proposed using the different component of the far field patterns. Only inner products are involved in the computation, thus the novel sampling methods are very simple and fast to be implemented. With the help of the factorization of the far field operator, we give a lower bound of the proposed indicator functionals for sampling points inside the scatterers. While for the sampling points outside the scatterers, we show that the indicator functionals decay like the Bessel functions as the sampling point goes away from the boundary of the scatterers. We also show that the proposed indicator functionals continuously dependent on the far field patterns, which further implies that the novel sampling methods are extremely stable with respect to data error. For the case when the observation directions are restricted into the limited aperture, we firstly introduce some data retrieval techniques to obtain those data that can not be measured directly and then use the proposed direct sampling methods for location and shape reconstructions. Finally, some numerical simulations in two dimensions are conducted with noisy data, and the results further verify the effectiveness and robustness of the proposed sampling methods, even for multiple multiscale cases and limited-aperture problems.

  15. Phospholipids as an alternative to direct covalent coupling: surface functionalization of nanoporous alumina for protein recognition and purification.

    Science.gov (United States)

    Lazzara, Thomas D; Behn, Daniela; Kliesch, Torben-Tobias; Janshoff, Andreas; Steinem, Claudia

    2012-01-15

    Anodic aluminum oxide (AAO) substrates with aligned, cylindrical, non-intersecting pores with diameters of 75 nm and depths of 3.5 or 10 μm were functionalized with lipid monolayers harboring different receptor lipids. AAO was first functionalized with dodecyl-trichlorosilane, followed by fusion of small unilamellar vesicles (SUVs) forming a lipid monolayer. The SUVs' lipid composition was transferred onto the AAO surface, allowing us to control the surface receptor density. Owing to the optical transparency of the AAO, the overall vesicle spreading process and subsequent protein binding to the receptor-doped lipid monolayers could be investigated in situ by optical waveguide spectroscopy (OWS). SUV spreading occurred at the pore-rim interface, followed by lateral diffusion of lipids within the pore-interior surface until homogeneous coverage was achieved with a lipid monolayer. The functionality of the system was demonstrated through streptavidin binding onto a biotin-DOPE containing POPC membrane, showing maximum protein coverage at 10 mol% of biotin-DOPE. The system enabled us to monitor in real-time the selective extraction of two histidine-tagged proteins, PIGEA14 (14 kDa) and ezrin (70 kDa), directly from cell lysate solutions using a DOGS-NTA(Ni)/DOPC (1:9) membrane. The purification process including protein binding and elution was monitored by OWS and confirmed by SDS-PAGE. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. A validation of a ray-tracing tool used to generate bi-directional scattering distribution functions for complex fenestration systems

    DEFF Research Database (Denmark)

    McNeil, A.; Jonsson, C.J.; Appelfeld, David

    2013-01-01

    , or daylighting systems. However, such tools require users to provide bi-directional scattering distribution function (BSDF) data that describe the solar-optical performance of the CFS. A free, open-source Radiance tool genBSDF enables users to generate BSDF data for arbitrary CFS. Prior to genBSDF, BSDF data.......We explain the basis and use of the genBSDF tool and validate the tool by comparing results for four different cases to BSDF data produced via alternate methods. This validation demonstrates that BSDFs created with genBSDF are comparable to BSDFs generated analytically using TracePro and by measurement...

  17. Effect of Transcranial Direct Current Stimulation on Severely Affected Arm-Hand Motor Function in Patients After an Acute Ischemic Stroke: A Pilot Randomized Control Trial.

    Science.gov (United States)

    Rabadi, Meheroz H; Aston, Christopher E

    2017-10-01

    The aim of this article was to determine whether cathodal transcranial direct current stimulation (c-tDCS) to unaffected primary motor cortex (PMC) plus conventional occupational therapy (OT) improves functional motor recovery of the affected arm hand in patients after an acute ischemic stroke compared with sham transcranial direct current stimulation plus conventional OT. In this prospective, randomized, double-blinded, sham-controlled trial of 16 severe, acute ischemic stroke patients with severe arm-hand weakness were randomly assigned to either experimental (c-tDCS plus OT; n = 8) or control (sham transcranial direct current stimulation plus OT; n = 8) groups. All patients received a standard 3-hr in-patient rehabilitation therapy, plus an additional ten 30-min sessions of tDCS. During each session, 1 mA of cathodal stimulation to the unaffected PMC is performed followed by the patient's scheduled OT. The primary outcome measure was change in Action Research Arm Test (ARAT) total and subscores on discharge. Application of c-tDCS to unaffected PMC resulted in a clinically relevant 10-point improvement in the affected arm-hand function based on ARAT total score compared with a 2-point improvement in the control group. Application of 30-min of c-tDCS to the unaffected PMC showed a 10-point improvement in the ARAT score. This corresponds to a large effect size in improvement of affected arm-hand function in patients with severe, acute ischemic stroke. Although not statistically significant, this suggests that larger studies, enrolling at least 25 patients in each group, and with a longer follow-up are warranted.

  18. Direct Functionalization of an Acid-Terminated Nanodiamond with Azide: Enabling Access to 4-Substituted-1,2,3-Triazole-Functionalized Particles

    International Nuclear Information System (INIS)

    Kennedy, Zachary C.; Barrett, Christopher A.; Warner, Marvin G.

    2017-01-01

    Azides on the periphery of nanodiamond materials (ND) are of great utility because they have been shown to undergo Cu-catalyzed and Cu-free cycloaddition reactions with structurally diverse alkynes, affording particles tailored for applications in biology and materials science. However, current methods employed to access ND featuring azide groups typically require either harsh pretreatment procedures or multiple synthesis steps and use surface linking groups that may be susceptible to undesirable cleavage. Here in this paper we demonstrate an alternative single-step approach to producing linker-free, azide-functionalized ND. Our method was applied to low-cost, detonation-derived ND powders where surface carbonyl groups undergo silver-mediated decarboxylation and radical substitution with azide. ND with directly grafted azide groups were then treated with a variety of aliphatic, aromatic, and fluorescent alkynes to afford 1-(ND)-4-substituted-1,2,3-triazole materials under standard copper-catalyzed cycloaddition conditions. Surface modification steps were verified by characteristic infrared absorptions and elemental analyses. High loadings of triazole surface groups (up to 0.85 mmol g –1 ) were obtained as determined from thermogravimetric analysis. The azidation procedure disclosed is envisioned to become a valuable initial transformation in numerous future applications of ND.

  19. The dynamic adjoint as a Green’s function

    International Nuclear Information System (INIS)

    Pázsit, I.; Dykin, V.

    2015-01-01

    Highlight: • The relationship between the direct Green’s function and the dynamic adjoint function is discussed in two-group theory. • It is shown that the elements of the direct Greens’ function matrix are identical to those of the transpose of the adjoint Green’s function matrix, with an interchange of arguments. • It is also remarked how the dynamic adjoint function of van Dam can be given in terms of the direct Green’s function matrix. - Abstract: The concept of the dynamic adjoint was introduced by Hugo van Dam for calculating the in-core neutron noise in boiling water reactors in the mid-70’s. This successful approach found numerous applications for calculating the neutron noise in both PWRs and BWRs since then. Although the advantages and disadvantages of using the direct (forward) or the adjoint (backward) approach for the calculation of the neutron noise were analysed in a number of publications, the direct relationship between the forward Green’s function and the dynamic adjoint has not been discussed. On the other hand, in particle transport theory the relationship between the direct and adjoint Green’s function has been discussed in detail, in which Mike Williams has had many seminal contributions. In this note we analyse the relationship between the direct Green’s function and the dynamic adjoint in the spirit of Mike’s work in neutron transport and radiation damage theory. The paper is closed with some personal remarks and reminiscences.

  20. Direct stimulation of angiotensin II type 2 receptor enhances spatial memory

    DEFF Research Database (Denmark)

    Jing, Fei; Mogi, Masaki; Sakata, Akiko

    2012-01-01

    We examined the possibility that direct stimulation of the angiotensin II type 2 (AT(2)) receptor by a newly generated direct AT(2) receptor agonist, Compound 21 (C21), enhances cognitive function. Treatment with C21 intraperitoneal injection for 2 weeks significantly enhanced cognitive function...

  1. Possibilistic Belief Functions Generated by Direct Products of Single Possibilistic Measures

    Czech Academy of Sciences Publication Activity Database

    Kramosil, Ivan

    1999-01-01

    Roč. 9, č. 6 (1999), s. 517-525 ISSN 1210-0552 R&D Projects: GA AV ČR IAA1030803 Institutional research plan: AV0Z1030915 Keywords : belief functions * belief revision * Dempster combination rule * possibilistic measures * possibilistic belief functions Subject RIV: BA - General Mathematics

  2. Distribution of transverse distances in directed animals

    CERN Document Server

    Sumedha

    2003-01-01

    We relate phi(x, s), the average number of sites at a transverse distance x in the directed animals with s sites in d transverse dimensions, to the two-point correlation function of a lattice gas with nearest neighbour exclusion in d dimensions. For large s, phi(x, s) has the scaling form s/R sup d sub s f(|x|/R sub s), where R sub s is the root-mean square radius of gyration of animals of s sites. We determine the exact scaling function for d = 1 to be f(r) = sq root pi/2 sq root 3 erfc(r/sq root 3). We also show that phi(x = 0, s) can be determined in terms of the animal number generating function of the directed animals.

  3. Deposition of low sheet resistance indium tin oxide directly onto functional small molecules

    KAUST Repository

    Franklin, Joseph B.; Fleet, Luke R.; Burgess, Claire H.; McLachlan, Martyn A.

    2014-01-01

    © 2014 Elsevier B.V. All rights reserved. We outline a methodology for depositing tin-doped indium oxide (ITO) directly onto semiconducting organic small molecule films for use as a transparent conducting oxide top-electrode. ITO films were grown using pulsed laser deposition onto copper(II)phthalocyanine (CuPc):buckminsterfullerene (C60) coated substrates. The ITO was deposited at a substrate temperature of 150 °C over a wide range of background oxygen pressures (Pd) (0.67-10 Pa). Deposition at 0.67 ≤ Pd ≤ 4.7 Pa led to delamination of the organic films owing to damage induced by the high energy ablated particles, at intermediate 4.7 ≤ Pd < 6.7 Pa pressures macroscopic cracking is observed in the ITO. Increasing Pd further, ≥ 6.7 Pa, supports the deposition of continuous, polycrystalline and highly transparent ITO films without damage to the CuPc:C60. The free carrier concentration of ITO is strongly influenced by Pd; hence growth at > 6.7 Pa induces a significant decrease in conductivity; with a minimum sheet resistance (Rs) of 145 /□ achieved for 300 nm thick ITO films. To reduce the Rs a multi-pressure deposition was implemented, resulting in the formation of polycrystalline, highly transparent ITO with an Rs of - 20/□ whilst maintaining the inherent functionality and integrity of the small molecule substrate.

  4. Deposition of low sheet resistance indium tin oxide directly onto functional small molecules

    KAUST Repository

    Franklin, Joseph B.

    2014-11-01

    © 2014 Elsevier B.V. All rights reserved. We outline a methodology for depositing tin-doped indium oxide (ITO) directly onto semiconducting organic small molecule films for use as a transparent conducting oxide top-electrode. ITO films were grown using pulsed laser deposition onto copper(II)phthalocyanine (CuPc):buckminsterfullerene (C60) coated substrates. The ITO was deposited at a substrate temperature of 150 °C over a wide range of background oxygen pressures (Pd) (0.67-10 Pa). Deposition at 0.67 ≤ Pd ≤ 4.7 Pa led to delamination of the organic films owing to damage induced by the high energy ablated particles, at intermediate 4.7 ≤ Pd < 6.7 Pa pressures macroscopic cracking is observed in the ITO. Increasing Pd further, ≥ 6.7 Pa, supports the deposition of continuous, polycrystalline and highly transparent ITO films without damage to the CuPc:C60. The free carrier concentration of ITO is strongly influenced by Pd; hence growth at > 6.7 Pa induces a significant decrease in conductivity; with a minimum sheet resistance (Rs) of 145 /□ achieved for 300 nm thick ITO films. To reduce the Rs a multi-pressure deposition was implemented, resulting in the formation of polycrystalline, highly transparent ITO with an Rs of - 20/□ whilst maintaining the inherent functionality and integrity of the small molecule substrate.

  5. [Nostalgia and the functions of autobiographical memory].

    Science.gov (United States)

    Wolf, T

    2014-11-01

    Current research on autobiographical memory distinguishes between a self function, a directive function, and a social function of autobiographical memory. From a lifespan perspective, the use of autobiographical memory for these functions is expected to decrease with age. The present study extended these functions by the function of nostalgia: Often triggered by negative emotions, remembering personal and positive experiences might, among others, enhance positive effects. This emotion-regulating function is expected to become more important in old age. In the present study 273 adults (aged between 19 and 90 years) completed the Thinking About Life Experiences Questionnaire (TALE) as well as 11 newly developed items to assess the nostalgia function. Exploratory and confirmatory factor analyses supported a four-factor model reflecting the presumed self, directive, social, and nostalgia functions of autobiographical memory. The results showed a decrease in the use of autobiographical memory for self, directive and social functions with increasing age, whereas the nostalgia function followed a U-shaped pattern.

  6. Direct observation of syringeal muscle function in songbirds and a parrot

    DEFF Research Database (Denmark)

    Larsen, Ole Næsbye; Goller, Franz

    2002-01-01

    on the syrinx. Contraction of m. tracheobronchialis ventralis enlarges the syringeal lumen and thus increases airflow by abducting the LL but does not affect the ML. The largest syringeal muscle, m. syringealis ventralis, plays a minor role, if any, in direct aperture control and thus in gating airflow...... the LTMs further into the tracheal lumen but does not close the syringeal aperture fully. The intrinsic deep muscle, m. syringealis profundus, abducts the LTMs through cranio-laterad movement of a paired, protruding half-ring. The weakly developed extrinsic m. sternotrachealis seems to increase tension......The role of syringeal muscles in controlling the aperture of the avian vocal organ, the syrinx, was evaluated directly for the first time by observing and filming through an endoscope while electrically stimulating different muscle groups of anaesthetised birds. In songbirds (brown thrashers...

  7. Direct 4D reconstruction of parametric images incorporating anato-functional joint entropy.

    Science.gov (United States)

    Tang, Jing; Kuwabara, Hiroto; Wong, Dean F; Rahmim, Arman

    2010-08-07

    We developed an anatomy-guided 4D closed-form algorithm to directly reconstruct parametric images from projection data for (nearly) irreversible tracers. Conventional methods consist of individually reconstructing 2D/3D PET data, followed by graphical analysis on the sequence of reconstructed image frames. The proposed direct reconstruction approach maintains the simplicity and accuracy of the expectation-maximization (EM) algorithm by extending the system matrix to include the relation between the parametric images and the measured data. A closed-form solution was achieved using a different hidden complete-data formulation within the EM framework. Furthermore, the proposed method was extended to maximum a posterior reconstruction via incorporation of MR image information, taking the joint entropy between MR and parametric PET features as the prior. Using realistic simulated noisy [(11)C]-naltrindole PET and MR brain images/data, the quantitative performance of the proposed methods was investigated. Significant improvements in terms of noise versus bias performance were demonstrated when performing direct parametric reconstruction, and additionally upon extending the algorithm to its Bayesian counterpart using the MR-PET joint entropy measure.

  8. Quantitative determination of acidic groups in functionalized graphene by direct titration

    Czech Academy of Sciences Publication Activity Database

    Ederer, J.; Janoš, P.; Ecorchard, Petra; Štengl, Václav; Bělčická, Zuzana; Šťastný, Martin; Pop-Georgievski, Ognen; Dohnal, V.

    2016-01-01

    Roč. 103, JUN (2016), s. 44-53 ISSN 1381-5148 R&D Projects: GA ČR(CZ) GA14-05146S Institutional support: RVO:61388980 ; RVO:61389013 Keywords : Acid-base titration * Carboxylic functional groups * Graphene oxide * Phenolic functional groups * Proton-binding model Subject RIV: CA - Inorganic Chemistry ; CD - Macromolecular Chemistry (UMCH-V) Impact factor: 3.151, year: 2016

  9. Impact of transcranial direct current stimulation (tDCS) on neuronal functions

    NARCIS (Netherlands)

    Das, S. (Suman); P.J. Holland (Peter); M.A. Frens (Maarten); O. Donchin (Opher)

    2016-01-01

    textabstractTranscranial direct current stimulation (tDCS), a non-invasive brain stimulation technique, modulates neuronal excitability by the application of a small electrical current. The low cost and ease of the technique has driven interest in potential clinical applications. However, outcomes

  10. Pair Correlation Function Integrals

    DEFF Research Database (Denmark)

    Wedberg, Nils Hejle Rasmus Ingemar; O'Connell, John P.; Peters, Günther H.J.

    2011-01-01

    We describe a method for extending radial distribution functions obtained from molecular simulations of pure and mixed molecular fluids to arbitrary distances. The method allows total correlation function integrals to be reliably calculated from simulations of relatively small systems. The long......-distance behavior of radial distribution functions is determined by requiring that the corresponding direct correlation functions follow certain approximations at long distances. We have briefly described the method and tested its performance in previous communications [R. Wedberg, J. P. O’Connell, G. H. Peters......, and J. Abildskov, Mol. Simul. 36, 1243 (2010); Fluid Phase Equilib. 302, 32 (2011)], but describe here its theoretical basis more thoroughly and derive long-distance approximations for the direct correlation functions. We describe the numerical implementation of the method in detail, and report...

  11. Influence of Functionality on Direct Arylation of Model Systems as a Route Toward Fluorinated Copolymers via Direct Arylation Polymerization (DArP)

    DEFF Research Database (Denmark)

    Livi, Francesco; Gobalasingham, Nemal S.; Bundgaard, Eva

    2015-01-01

    A screening of direct arylation conditions on amodel small molecule system is carried out to develop suitableconditions for the direct arylation polymerization (DArP) of fluorinatedcopolymers, which are incompatible with conditionspreviously utilized successfully for nonfluorinated systems. Themo......,4-phenylene)dithiophene. Polymers arefree of β-defects and significant homocoupling. This work furtherunderscores the attractive simplicity, relevance, and easeof DArP while reconfirming its broad compatibility withincreasingly popular fluorinated copolymers....

  12. Relativistic direct interaction and hadron models

    International Nuclear Information System (INIS)

    Biswas, T.

    1984-01-01

    Direct interaction theories at a nonrelativistic level have been used successfully in several areas earlier (e.g. nuclear physics). But for hadron spectroscopy relativistic effects are important and hence the need for a relativistic direct interaction theory arises. It is the goal of this thesis to suggest such a theory which has the simplicity and the flexibility required for phenomenological model building. In general the introduction of relativity in a direct interaction theory is shown to be non-trivial. A first attempt leads to only an approximate form for allowed interactions. Even this is far too complex for phenomenological applicability. To simplify the model an extra spacelike particle called the vertex is introduced in any set of physical (timelike) particles. The vertex model is successfully used to fit and to predict experimental data on hadron spectra, γ and psi states fit very well with an interaction function inspired by QCD. Light mesons also fit reasonably well. Better forms of hyperfine interaction functions would be needed to improve the fitting of light mesons. The unexpectedly low pi meson mass is partially explained. Baryon ground states are fitted with unprecedented accuracy with very few adjustable parameters. For baryon excited states it is shown that better QCD motivated interaction functions are needed for a fit. Predictions for bb states in e + e - experiments are made to assist current experiments

  13. Functional characterization of Dihydroflavonol-4-reductase in anthocyanin biosynthesis of purple sweet potato underlies the direct evidence of anthocyanins function against abiotic stresses.

    Science.gov (United States)

    Wang, Hongxia; Fan, Weijuan; Li, Hong; Yang, Jun; Huang, Jirong; Zhang, Peng

    2013-01-01

    Dihydroflavonol-4-reductase (DFR) is a key enzyme in the catalysis of the stereospecific reduction of dihydroflavonols to leucoanthocyanidins in anthocyanin biosynthesis. In the purple sweet potato (Ipomoea batatas Lam.) cv. Ayamurasaki, expression of the IbDFR gene was strongly associated with anthocyanin accumulation in leaves, stems and roots. Overexpression of the IbDFR in Arabidopsis tt3 mutants fully complemented the pigmentation phenotype of the seed coat, cotyledon and hypocotyl. Downregulation of IbDFR expression in transgenic sweet potato (DFRi) using an RNAi approach dramatically reduced anthocyanin accumulation in young leaves, stems and storage roots. In contrast, the increase of flavonols quercetin-3-O-hexose-hexoside and quercetin-3-O-glucoside in the leaves and roots of DFRi plants is significant. Therefore, the metabolic pathway channeled greater flavonol influx in the DFRi plants when their anthocyanin and proanthocyanidin accumulation were decreased. These plants also displayed reduced antioxidant capacity compared to the wild type. After 24 h of cold treatment and 2 h recovery, the wild-type plants were almost fully restored to the initial phenotype compared to the slower recovery of DFRi plants, in which the levels of electrolyte leakage and hydrogen peroxide accumulation were dramatically increased. These results provide direct evidence of anthocyanins function in the protection against oxidative stress in the sweet potato. The molecular characterization of the IbDFR gene in the sweet potato not only confirms its important roles in flavonoid metabolism but also supports the protective function of anthocyanins of enhanced scavenging of reactive oxygen radicals in plants under stressful conditions.

  14. Functional characterization of Dihydroflavonol-4-reductase in anthocyanin biosynthesis of purple sweet potato underlies the direct evidence of anthocyanins function against abiotic stresses.

    Directory of Open Access Journals (Sweden)

    Hongxia Wang

    Full Text Available Dihydroflavonol-4-reductase (DFR is a key enzyme in the catalysis of the stereospecific reduction of dihydroflavonols to leucoanthocyanidins in anthocyanin biosynthesis. In the purple sweet potato (Ipomoea batatas Lam. cv. Ayamurasaki, expression of the IbDFR gene was strongly associated with anthocyanin accumulation in leaves, stems and roots. Overexpression of the IbDFR in Arabidopsis tt3 mutants fully complemented the pigmentation phenotype of the seed coat, cotyledon and hypocotyl. Downregulation of IbDFR expression in transgenic sweet potato (DFRi using an RNAi approach dramatically reduced anthocyanin accumulation in young leaves, stems and storage roots. In contrast, the increase of flavonols quercetin-3-O-hexose-hexoside and quercetin-3-O-glucoside in the leaves and roots of DFRi plants is significant. Therefore, the metabolic pathway channeled greater flavonol influx in the DFRi plants when their anthocyanin and proanthocyanidin accumulation were decreased. These plants also displayed reduced antioxidant capacity compared to the wild type. After 24 h of cold treatment and 2 h recovery, the wild-type plants were almost fully restored to the initial phenotype compared to the slower recovery of DFRi plants, in which the levels of electrolyte leakage and hydrogen peroxide accumulation were dramatically increased. These results provide direct evidence of anthocyanins function in the protection against oxidative stress in the sweet potato. The molecular characterization of the IbDFR gene in the sweet potato not only confirms its important roles in flavonoid metabolism but also supports the protective function of anthocyanins of enhanced scavenging of reactive oxygen radicals in plants under stressful conditions.

  15. Wigner functions for a class of semi-direct product groups

    International Nuclear Information System (INIS)

    Krasowska, Anna E; Ali, S Twareque

    2003-01-01

    Following a general method proposed earlier, we construct here Wigner functions defined on coadjoint orbits of a class of semidirect product groups. The groups in question are such that their unitary duals consist purely of representations from the discrete series and each unitary irreducible representation is associated with a coadjoint orbit. The set of all coadjoint orbits (hence UIRs) is finite and their union is dense in the dual of the Lie algebra. The simple structure of the groups and the orbits enables us to compute the various quantities appearing in the definition of the Wigner function explicitly. A large number of examples, with potential use in image analysis, is worked out

  16. Direct atomic imaging and density functional theory study of the Au24Pd1 cluster catalyst.

    Science.gov (United States)

    Bruma, A; Negreiros, F R; Xie, S; Tsukuda, T; Johnston, R L; Fortunelli, A; Li, Z Y

    2013-10-21

    In this study we report a direct, atomic-resolution imaging of calcined Au24Pd1 clusters supported on multiwall carbon nanotubes by employing aberration-corrected scanning transmission electron microscopy. Using gold atoms as mass standards, we confirm the cluster size to be 25 ± 2, in agreement with the Au24Pd1(SR)18 precursor used in the synthesis. Concurrently, a Density-Functional/Basin-Hopping computational algorithm is employed to locate the low-energy configurations of free Au24Pd1 cluster. Cage structures surrounding a single core atom are found to be favored, with a slight preference for Pd to occupy the core site. The cluster shows a tendency toward elongated arrangements, consistent with experimental data. The degree of electron transfer from the Pd dopant to Au is quantified through a Löwdin charge analysis, suggesting that Pd may act as an electron promoter to the surrounding Au atoms when they are involved in catalytic reactions.

  17. Executive functions, parental punishment, and aggression: Direct and moderated relations.

    Science.gov (United States)

    Fatima, Shameem; Sharif, Imran

    2017-12-01

    The main focus of the current study was to assess whether executive functions (EFs) moderate the effect of parental punishment on adolescent aggression. The sample were 370 participants (53% girls, 47% boys) enrolled at secondary and higher secondary levels and ranged in age between 13-19 years (M = 15.5, SD = 1.3). Participants were assessed on a self-report measure of aggression and two punishment measures, in addition to a demographic sheet. Then, they were individually assessed on four tests taken from the Delis-Kaplan Executive Functions System (D-KEFS) namely Trial Making Test (TMT), Design Fluency Test (DFT), Color Word Interference Test (CWIT), and Card Sorting Test (CST) to assess cognitive flexibility, nonverbal fluency, inhibition, and problem-solving ability, respectively. Correlation coefficients indicated that all four executive functioning measures and the two punishment measures were significantly correlated with aggression. Moderation analysis indicated that all EFs moderated the relationship between physical punishment and aggression, and only inhibition and problem-solving ability, but not cognitive flexibility and nonverbal fluency, moderated the relations between symbolic punishment and aggression. The findings support the hypothesis that EFs are protective personal factors that promote healthy adolescent adjustment in the presence of challenging environmental factors.

  18. Directed flow of baryons in heavy-ion collisions

    International Nuclear Information System (INIS)

    Ivanov, Yu.B.; Nikonov, E.G.; Toneev, V.D.; Noerenberg, W.; Shanenko, A.A.

    2000-11-01

    The collective motion of nucleons from high-energy heavy-ion collisions is analyzed within a relativistic two-fluid model for different equations of state (EoS). As function of beam energy the theoretical slope parameter F y of the differential directed flow is in good agreement with experimental data, when calculated for the QCD-consistent EoS described by the statistical mixed-phase model. Within this model, which takes the deconfinement phase transition into account, the excitation function of the directed flow left angle P x right angle turns out to be a smooth function in the whole range from SIS till SPS energies. This function is close to that for pure hadronic EoS and exhibits no minimum predicted earlier for a two-phase bag-model EoS. Attention is also called to a possible formation of nucleon antiflow (F y or∼100 A.GeV. (orig.)

  19. Transcranial cerebellar direct current stimulation and transcutaneous spinal cord direct current stimulation as innovative tools for neuroscientists

    Science.gov (United States)

    Priori, Alberto; Ciocca, Matteo; Parazzini, Marta; Vergari, Maurizio; Ferrucci, Roberta

    2014-01-01

    Two neuromodulatory techniques based on applying direct current (DC) non-invasively through the skin, transcranial cerebellar direct current stimulation (tDCS) and transcutaneous spinal DCS, can induce prolonged functional changes consistent with a direct influence on the human cerebellum and spinal cord. In this article we review the major experimental works on cerebellar tDCS and on spinal tDCS, and their preliminary clinical applications. Cerebellar tDCS modulates cerebellar motor cortical inhibition, gait adaptation, motor behaviour, and cognition (learning, language, memory, attention). Spinal tDCS influences the ascending and descending spinal pathways, and spinal reflex excitability. In the anaesthetised mouse, DC stimulation applied under the skin along the entire spinal cord may affect GABAergic and glutamatergic systems. Preliminary clinical studies in patients with cerebellar disorders, and in animals and patients with spinal cord injuries, have reported beneficial effects. Overall the available data show that cerebellar tDCS and spinal tDCS are two novel approaches for inducing prolonged functional changes and neuroplasticity in the human cerebellum and spinal cord, and both are new tools for experimental and clinical neuroscientists. PMID:24907311

  20. Constraint-Induced Movement Therapy Combined with Transcranial Direct Current Stimulation over Premotor Cortex Improves Motor Function in Severe Stroke: A Pilot Randomized Controlled Trial

    Directory of Open Access Journals (Sweden)

    Suellen M. Andrade

    2017-01-01

    Full Text Available Objective. We compared the effects of transcranial direct current stimulation at different cortical sites (premotor and motor primary cortex combined with constraint-induced movement therapy for treatment of stroke patients. Design. Sixty patients were randomly distributed into 3 groups: Group A, anodal stimulation on premotor cortex and constraint-induced movement therapy; Group B, anodal stimulation on primary motor cortex and constraint-induced movement therapy; Group C, sham stimulation and constraint-induced movement therapy. Evaluations involved analysis of functional independence, motor recovery, spasticity, gross motor function, and muscle strength. Results. A significant improvement in primary outcome (functional independence after treatment in the premotor group followed by primary motor group and sham group was observed. The same pattern of improvement was highlighted among all secondary outcome measures regarding the superior performance of the premotor group over primary motor and sham groups. Conclusions. Premotor cortex can contribute to motor function in patients with severe functional disabilities in early stages of stroke. This study was registered in ClinicalTrials.gov database (NCT 02628561.

  1. Optimization of the quantitative direct solid total-reflection X-ray fluorescence analysis of glass microspheres functionalized with Zr organometallic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Ruiz, Ramon, E-mail: ramon.fernandez@uam.e [Servicio Interdepartamental de Investigacion, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, E-28049, Madrid (Spain); Andres, Roman; Jesus, Ernesto de [Departamento de Quimica Inorganica, Universidad de Alcala, Campus Universitario, 28871, Alcala de Henares, Madrid (Spain); Terreros, Pilar [Instituto de Catalisis y Petroleo-Quimica, CSIC, Cantoblanco, 28049, Madrid (Spain)

    2010-06-15

    Quantitative determination of Zr in the system constituted by quartz microspheres functionalized with two kinds of organometallic compounds has been studied due to the importance of the correct quantization of the Zr from a catalytic point of view. Two parallel approximations were done, i.e. acid leaching and direct solid quantization. To validate the acid leaching TXRF measures, ICP-MS analysis were carried out. The results obtained by means of the optimization of the quantitative direct solid procedure show that, with a previous particle size distribution modification, TXRF obtain the same analytical results as ICP-MS and TXRF by acid leaching way but without previous chemical acid manipulation. This fact implies an important improvement for the analysis time, reagents costs and analysis facility and it proves again the versatility of TXRF to solve analytical problems in an easy, quick and accurate way. Additionally and for the direct solid TXRF measurements, a deeper study was done to evaluate the intrinsic analytical parameters of the Zr TXRF analysis of this material. So, the influence of the particle size distributions (modified by means of a high power ultrasound probe) with respect to uncertainty and detection limits for Zr were developed. The main analytical conclusion was the strong correlation between the average particle sizes and the TXRF analytical parameters of Zr measurements, i.e. concentration, accuracy, uncertainty and detection limits.

  2. Multi-frequency direct sampling method in inverse scattering problem

    Science.gov (United States)

    Kang, Sangwoo; Lambert, Marc; Park, Won-Kwang

    2017-10-01

    We consider the direct sampling method (DSM) for the two-dimensional inverse scattering problem. Although DSM is fast, stable, and effective, some phenomena remain unexplained by the existing results. We show that the imaging function of the direct sampling method can be expressed by a Bessel function of order zero. We also clarify the previously unexplained imaging phenomena and suggest multi-frequency DSM to overcome traditional DSM. Our method is evaluated in simulation studies using both single and multiple frequencies.

  3. Directivity of basic linear arrays

    DEFF Research Database (Denmark)

    Bach, Henning

    1970-01-01

    For a linear uniform array ofnelements, an expression is derived for the directivity as a function of the spacing and the phase constants. The cases of isotropic elements, collinear short dipoles, and parallel short dipoles are included. The formula obtained is discussed in some detail and contour...

  4. Comparison of ultraviolet Bi-directional Reflectance Distribution Function (BRDF) measurements of diffusers used in the calibration of the Total Ozone Mapping Spectrometer (TOMS)

    OpenAIRE

    Butler, J.J.; Park, H.; Barnes, P.Y.; Early, E.A.; Eijk-Olij, C. van; Zoutman, A.E.; Buller-Leeuwen, S. van; Groote Schaarsberg, J.

    2002-01-01

    The measurement and long-term monitoring of global total ozone by ultraviolet albedo measuring satellite instruments require accurate and precise determination of the Bi-directional Reflectance Distribution Function (BRDF) of laboratory-based diffusers used in the pre-launch calibration of those instruments. To assess the ability of laboratories to provide accurate Ultra Violet (UV) diffuse BRDF measurements, a BRDF measurement comparison was initiated by the NASA Total Ozone Mapping Spectrom...

  5. Convergence of Algorithms for Reconstructing Convex Bodies and Directional Measures

    DEFF Research Database (Denmark)

    Gardner, Richard; Kiderlen, Markus; Milanfar, Peyman

    2006-01-01

    We investigate algorithms for reconstructing a convex body K in Rn from noisy measurements of its support function or its brightness function in k directions u1, . . . , uk. The key idea of these algorithms is to construct a convex polytope Pk whose support function (or brightness function) best...

  6. Functional Object Analysis

    DEFF Research Database (Denmark)

    Raket, Lars Lau

    We propose a direction it the field of statistics which we will call functional object analysis. This subfields considers the analysis of functional objects defined on continuous domains. In this setting we will focus on model-based statistics, with a particularly emphasis on mixed......-effect formulations, where the observed functional signal is assumed to consist of both fixed and random functional effects. This thesis takes the initial steps toward the development of likelihood-based methodology for functional objects. We first consider analysis of functional data defined on high...

  7. Does functional MRI detect activation in white matter? A review of emerging evidence, issues, and future directions

    Science.gov (United States)

    Gawryluk, Jodie R.; Mazerolle, Erin L.; D'Arcy, Ryan C. N.

    2014-01-01

    Functional magnetic resonance imaging (fMRI) is a non-invasive technique that allows for visualization of activated brain regions. Until recently, fMRI studies have focused on gray matter. There are two main reasons white matter fMRI remains controversial: (1) the blood oxygen level dependent (BOLD) fMRI signal depends on cerebral blood flow and volume, which are lower in white matter than gray matter and (2) fMRI signal has been associated with post-synaptic potentials (mainly localized in gray matter) as opposed to action potentials (the primary type of neural activity in white matter). Despite these observations, there is no direct evidence against measuring fMRI activation in white matter and reports of fMRI activation in white matter continue to increase. The questions underlying white matter fMRI activation are important. White matter fMRI activation has the potential to greatly expand the breadth of brain connectivity research, as well as improve the assessment and diagnosis of white matter and connectivity disorders. The current review provides an overview of the motivation to investigate white matter fMRI activation, as well as the published evidence of this phenomenon. We speculate on possible neurophysiologic bases of white matter fMRI signals, and discuss potential explanations for why reports of white matter fMRI activation are relatively scarce. We end with a discussion of future basic and clinical research directions in the study of white matter fMRI. PMID:25152709

  8. Personality dispositions and the function of autobiographical memory

    DEFF Research Database (Denmark)

    Rasmussen, Anne Scharling

    It has been proposed that autobiographical memory contains three broad functions: The directive function, the self-function and the social function. The purpose of the present study is to examine if this tripartite model reflect on both singular memories and personality traits.......It has been proposed that autobiographical memory contains three broad functions: The directive function, the self-function and the social function. The purpose of the present study is to examine if this tripartite model reflect on both singular memories and personality traits....

  9. Selective functionalization of carbon nanotubes

    Science.gov (United States)

    Strano, Michael S. (Inventor); Usrey, Monica (Inventor); Barone, Paul (Inventor); Dyke, Christopher A. (Inventor); Tour, James M. (Inventor); Kittrell, W. Carter (Inventor); Hauge, Robert H. (Inventor); Smalley, Richard E. (Inventor)

    2009-01-01

    The present invention is directed toward methods of selectively functionalizing carbon nanotubes of a specific type or range of types, based on their electronic properties, using diazonium chemistry. The present invention is also directed toward methods of separating carbon nanotubes into populations of specific types or range(s) of types via selective functionalization and electrophoresis, and also to the novel compositions generated by such separations.

  10. Preparing direct care nurses to function as research coordinators in a heart failure study.

    Science.gov (United States)

    Trocky, Nina M

    2017-09-19

    Nurses interviewed heart failure patients admitted to two rural hospitals, to learn what was important to them concerning their disease. Data from this study would inform a subsequent heart failure intervention study. The researchers gained a better appreciation of the role of direct care nurses in research coordination, recruitment and data collection. To describe lessons learned during this research about using direct care nurses as research coordinators. The direct care nurses were highly motivated and engaged in the research, identifying barriers and solutions to enrolling heart failure patients in the hospital. The researchers developed customised educational materials and data management documents to address the nurses' learning needs, ensuring compliance with protocol and the safety of participants. Nurse researchers can establish an effective partnership with direct care nurses when conducting research studies. To accommodate learning needs and workplace demands, securing protected time for nurses to complete training, budgeting for administrative support and monitoring recruitment data weekly, as opposed to monthly, may be considered. Direct care nurses can inform the design and conduct of research conducted in a hospital. ©2012 RCN Publishing Company Ltd. All rights reserved. Not to be copied, transmitted or recorded in any way, in whole or part, without prior permission of the publishers.

  11. The tensor distribution function.

    Science.gov (United States)

    Leow, A D; Zhu, S; Zhan, L; McMahon, K; de Zubicaray, G I; Meredith, M; Wright, M J; Toga, A W; Thompson, P M

    2009-01-01

    Diffusion weighted magnetic resonance imaging is a powerful tool that can be employed to study white matter microstructure by examining the 3D displacement profile of water molecules in brain tissue. By applying diffusion-sensitized gradients along a minimum of six directions, second-order tensors (represented by three-by-three positive definite matrices) can be computed to model dominant diffusion processes. However, conventional DTI is not sufficient to resolve more complicated white matter configurations, e.g., crossing fiber tracts. Recently, a number of high-angular resolution schemes with more than six gradient directions have been employed to address this issue. In this article, we introduce the tensor distribution function (TDF), a probability function defined on the space of symmetric positive definite matrices. Using the calculus of variations, we solve the TDF that optimally describes the observed data. Here, fiber crossing is modeled as an ensemble of Gaussian diffusion processes with weights specified by the TDF. Once this optimal TDF is determined, the orientation distribution function (ODF) can easily be computed by analytic integration of the resulting displacement probability function. Moreover, a tensor orientation distribution function (TOD) may also be derived from the TDF, allowing for the estimation of principal fiber directions and their corresponding eigenvalues.

  12. Moving in the Right Direction: Evolution of Protein Structural Vibrations with Functional State and Mutation

    Science.gov (United States)

    Niessen, Katherine; Xu, Mengyang; Snell, Edward; Markelz, Andrea

    Long-range intramolecular vibrations may enable efficient access to functionally important conformations. We examine how these motions change with inhibitor binding and mutation using terahertz anisotropic absorption and molecular modeling. The measured anisotropic absorption dramatically changes with 3NAG inhibitor binding for wild type (WT) free chicken egg white lysozyme (CEWL). We examine the evolution of internal motions with binding using normal mode analysis to calculate an ensemble averaged vibrational density of states (VDOS) and isotropic and anisotropic absorptions for both WT and a two residue (R14 and H15) deletion mutant which has a 1.4 higher activity rate. While the VDOS and isotropic response are largely unchanged with inhibitor binding, the anisotropic response changes dramatically with binding. However, for the mutant the calculated unbound anisotropic absorption more closely resembles its bound spectrum, and it has increased calculated mean squared fluctuations in regions overlapping those in its bound state. These results indicate that the mutant's enhanced activity may be due to a shift in the direction of vibrations toward those of the bound state, increasing the sampling rate of the bound conformation.

  13. Regulation and functions of the lms homeobox gene during development of embryonic lateral transverse muscles and direct flight muscles in Drosophila.

    Directory of Open Access Journals (Sweden)

    Dominik Müller

    Full Text Available BACKGROUND: Patterning and differentiation of developing musculatures require elaborate networks of transcriptional regulation. In Drosophila, significant progress has been made into identifying the regulators of muscle development and defining their interactive networks. One major family of transcription factors involved in these processes consists of homeodomain proteins. In flies, several members of this family serve as muscle identity genes to specify the fates of individual muscles, or groups thereof, during embryonic and/or adult muscle development. Herein, we report on the expression and function of a new Drosophila homeobox gene during both embryonic and adult muscle development. METHODOLOGY/PRINCIPAL FINDINGS: The newly described homeobox gene, termed lateral muscles scarcer (lms, which has yet uncharacterized orthologs in other invertebrates and primitive chordates but not in vertebrates, is expressed exclusively in subsets of developing muscle tissues. In embryos, lms is expressed specifically in the four lateral transverse (LT muscles and their founder cells in each hemisegment, whereas in larval wing imaginal discs, it is expressed in myoblasts that develop into direct flight muscles (DFMs, which are important for proper wing positioning. We have analyzed the regulatory inputs of various other muscle identity genes with overlapping or complementary expression patterns towards the cell type specific regulation of lms expression. Further we demonstrate that lms null mutants exhibit reduced numbers of embryonic LT muscles, and null mutant adults feature held-out-wing phenotypes. We provide a detailed description of the pattern and morphology of the direct flight muscles in the wild type and lms mutant flies by using the recently-developed ultramicroscopy and show that, in the mutants, all DFMs are present and present normal morphologies. CONCLUSIONS/SIGNIFICANCE: We have identified the homeobox gene lms as a new muscle identity gene

  14. The direct, not V1-mediated, functional influence between the thalamus and middle temporal complex in the human brain is modulated by the speed of visual motion.

    Science.gov (United States)

    Gaglianese, A; Costagli, M; Ueno, K; Ricciardi, E; Bernardi, G; Pietrini, P; Cheng, K

    2015-01-22

    The main visual pathway that conveys motion information to the middle temporal complex (hMT+) originates from the primary visual cortex (V1), which, in turn, receives spatial and temporal features of the perceived stimuli from the lateral geniculate nucleus (LGN). In addition, visual motion information reaches hMT+ directly from the thalamus, bypassing the V1, through a direct pathway. We aimed at elucidating whether this direct route between LGN and hMT+ represents a 'fast lane' reserved to high-speed motion, as proposed previously, or it is merely involved in processing motion information irrespective of speeds. We evaluated functional magnetic resonance imaging (fMRI) responses elicited by moving visual stimuli and applied connectivity analyses to investigate the effect of motion speed on the causal influence between LGN and hMT+, independent of V1, using the Conditional Granger Causality (CGC) in the presence of slow and fast visual stimuli. Our results showed that at least part of the visual motion information from LGN reaches hMT+, bypassing V1, in response to both slow and fast motion speeds of the perceived stimuli. We also investigated whether motion speeds have different effects on the connections between LGN and functional subdivisions within hMT+: direct connections between LGN and MT-proper carry mainly slow motion information, while connections between LGN and MST carry mainly fast motion information. The existence of a parallel pathway that connects the LGN directly to hMT+ in response to both slow and fast speeds may explain why MT and MST can still respond in the presence of V1 lesions. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  15. Onsite-effects of dual-hemisphere versus conventional single-hemisphere transcranial direct current stimulation

    OpenAIRE

    Kwon, Yong Hyun; Jang, Sung Ho

    2012-01-01

    We performed functional MRI examinations in six right-handed healthy subjects. During functional MRI scanning, transcranial direct current stimulation was delivered with the anode over the right primary sensorimotor cortex and the cathode over the left primary sensorimotor cortex using dual-hemispheric transcranial direct current stimulation. This was compared to a cathode over the left supraorbital area using conventional single-hemispheric transcranial direct current stimulation. Voxel coun...

  16. Histological Evidence of the Osseointegration of Fractured Direct Metal Laser Sintering Implants Retrieved after 5 Years of Function

    Directory of Open Access Journals (Sweden)

    Francesco Mangano

    2017-01-01

    Full Text Available Background. Direct metal laser sintering (DMLS is an additive manufacturing technique that allows the fabrication of dental implants layer by layer through the laser fusion of titanium microparticles. The surface of DMLS implants is characterized by a high open porosity with interconnected pores of different sizes; therefore, it has the potential to enhance and accelerate bone healing. To date, however, there are no histologic/histomorphometric studies in the literature evaluating the interface between bone and DMLS implants in the long-term. Purpose. To evaluate the interface between bone and DMLS implants retrieved after 5 years of functional loading. Methods. Two fractured DMLS implants were retrieved from the human jaws, using a 5 mm trephine bur. Both the implants were clinically stable and functioned regularly before fracture. The specimens were processed for histologic/histomorphometric evaluation; the bone-to-implant contact (BIC% was calculated. Results. Compact, mature lamellar bone was found over most of the DMLS implants in close contact with the implant surface; the histomorphometric evaluation showed a mean BIC% of 66.1% (±4.5%. Conclusions. The present histologic/histomorphometric study showed that DMLS implants were well integrated in bone, after 5 years of loading, with the peri-implant bone undergoing continuous remodeling at the interface.

  17. Histological Evidence of the Osseointegration of Fractured Direct Metal Laser Sintering Implants Retrieved after 5 Years of Function

    Science.gov (United States)

    Piattelli, Adriano

    2017-01-01

    Background Direct metal laser sintering (DMLS) is an additive manufacturing technique that allows the fabrication of dental implants layer by layer through the laser fusion of titanium microparticles. The surface of DMLS implants is characterized by a high open porosity with interconnected pores of different sizes; therefore, it has the potential to enhance and accelerate bone healing. To date, however, there are no histologic/histomorphometric studies in the literature evaluating the interface between bone and DMLS implants in the long-term. Purpose To evaluate the interface between bone and DMLS implants retrieved after 5 years of functional loading. Methods Two fractured DMLS implants were retrieved from the human jaws, using a 5 mm trephine bur. Both the implants were clinically stable and functioned regularly before fracture. The specimens were processed for histologic/histomorphometric evaluation; the bone-to-implant contact (BIC%) was calculated. Results Compact, mature lamellar bone was found over most of the DMLS implants in close contact with the implant surface; the histomorphometric evaluation showed a mean BIC% of 66.1% (±4.5%). Conclusions The present histologic/histomorphometric study showed that DMLS implants were well integrated in bone, after 5 years of loading, with the peri-implant bone undergoing continuous remodeling at the interface. PMID:28929117

  18. Histological Evidence of the Osseointegration of Fractured Direct Metal Laser Sintering Implants Retrieved after 5 Years of Function.

    Science.gov (United States)

    Mangano, Francesco; Mangano, Carlo; Piattelli, Adriano; Iezzi, Giovanna

    2017-01-01

    Direct metal laser sintering (DMLS) is an additive manufacturing technique that allows the fabrication of dental implants layer by layer through the laser fusion of titanium microparticles. The surface of DMLS implants is characterized by a high open porosity with interconnected pores of different sizes; therefore, it has the potential to enhance and accelerate bone healing. To date, however, there are no histologic/histomorphometric studies in the literature evaluating the interface between bone and DMLS implants in the long-term. To evaluate the interface between bone and DMLS implants retrieved after 5 years of functional loading. Two fractured DMLS implants were retrieved from the human jaws, using a 5 mm trephine bur. Both the implants were clinically stable and functioned regularly before fracture. The specimens were processed for histologic/histomorphometric evaluation; the bone-to-implant contact (BIC%) was calculated. Compact, mature lamellar bone was found over most of the DMLS implants in close contact with the implant surface; the histomorphometric evaluation showed a mean BIC% of 66.1% (±4.5%). The present histologic/histomorphometric study showed that DMLS implants were well integrated in bone, after 5 years of loading, with the peri-implant bone undergoing continuous remodeling at the interface.

  19. Direct interventions for improving the performance of individuals with Alzheimer's disease.

    Science.gov (United States)

    Mahendra, N

    2001-11-01

    Direct interventions are being used increasingly to maintain and improve the communicative and cognitive functioning of patients with Alzheimer's dementia. Speech-language pathologists can play an integral role in maximizing the functioning of dementia patients by selecting appropriate direct interventions that capitalize on spared neuropsychological abilities to compensate for impaired abilities. Successful direct interventions use techniques that facilitate learning and retention of information and skills. In this article, direct intervention techniques-repeated exposure via spaced retrieval training and quizzes; errorless learning; multisensory stimulation using music, toys, pets, and memory wallets; and other approaches to cognitive-linguistic stimulation such as the use of personal computers; the Montessori method; and activity programming-are reviewed. The rationale for use of these direct interventions and available efficacy data with Alzheimer's patients also are presented.

  20. Directional connectivity in hydrology and ecology

    Science.gov (United States)

    Larsen, Laurel G.; Choi, Jungyill; Nungesser, Martha K.; Harvey, Judson W.

    2012-01-01

    Quantifying hydrologic and ecological connectivity has contributed to understanding transport and dispersal processes and assessing ecosystem degradation or restoration potential. However, there has been little synthesis across disciplines. The growing field of ecohydrology and recent recognition that loss of hydrologic connectivity is leading to a global decline in biodiversity underscore the need for a unified connectivity concept. One outstanding need is a way to quantify directional connectivity that is consistent, robust to variations in sampling, and transferable across scales or environmental settings. Understanding connectivity in a particular direction (e.g., streamwise, along or across gradient, between sources and sinks, along cardinal directions) provides critical information for predicting contaminant transport, planning conservation corridor design, and understanding how landscapes or hydroscapes respond to directional forces like wind or water flow. Here we synthesize progress on quantifying connectivity and develop a new strategy for evaluating directional connectivity that benefits from use of graph theory in ecology and percolation theory in hydrology. The directional connectivity index (DCI) is a graph-theory based, multiscale metric that is generalizable to a range of different structural and functional connectivity applications. It exhibits minimal sensitivity to image rotation or resolution within a given range and responds intuitively to progressive, unidirectional change. Further, it is linearly related to the integral connectivity scale length—a metric common in hydrology that correlates well with actual fluxes—but is less computationally challenging and more readily comparable across different landscapes. Connectivity-orientation curves (i.e., directional connectivity computed over a range of headings) provide a quantitative, information-dense representation of environmental structure that can be used for comparison or detection of

  1. Directional connectivity in hydrology and ecology.

    Science.gov (United States)

    Larsen, Laurel G; Choi, Jungyill; Nungesser, Martha K; Harvey, Judson W

    2012-12-01

    Quantifying hydrologic and ecological connectivity has contributed to understanding transport and dispersal processes and assessing ecosystem degradation or restoration potential. However, there has been little synthesis across disciplines. The growing field of ecohydrology and recent recognition that loss of hydrologic connectivity is leading to a global decline in biodiversity underscore the need for a unified connectivity concept. One outstanding need is a way to quantify directional connectivity that is consistent, robust to variations in sampling, and transferable across scales or environmental settings. Understanding connectivity in a particular direction (e.g., streamwise, along or across gradient, between sources and sinks, along cardinal directions) provides critical information for predicting contaminant transport, planning conservation corridor design, and understanding how landscapes or hydroscapes respond to directional forces like wind or water flow. Here we synthesize progress on quantifying connectivity and develop a new strategy for evaluating directional connectivity that benefits from use of graph theory in ecology and percolation theory in hydrology. The directional connectivity index (DCI) is a graph-theory based, multiscale metric that is generalizable to a range of different structural and functional connectivity applications. It exhibits minimal sensitivity to image rotation or resolution within a given range and responds intuitively to progressive, unidirectional change. Further, it is linearly related to the integral connectivity scale length--a metric common in hydrology that correlates well with actual fluxes--but is less computationally challenging and more readily comparable across different landscapes. Connectivity-orientation curves (i.e., directional connectivity computed over a range of headings) provide a quantitative, information-dense representation of environmental structure that can be used for comparison or detection of

  2. Multi-Functional Fibre-Optic Microwave Links

    DEFF Research Database (Denmark)

    Gliese, Ulrik Bo

    1998-01-01

    The multi-functionality of microwave links based on remote heterodyne detection of signals from a dual-frequency laser transmitter is discussed and experimentally demonstrated in this paper. Typically, direct detection in conjunction with optical intensity modulation is used to implement fibre......-optic microwave links. The resulting links are inherently transparent and mainly used for signal transmission. As opposed to direct detection links, remote heterodyne detection links can directly perform functionalities such as modulation, frequency conversion, and transparent signal recovery in addition...

  3. Structure and direct decay of Giant Monopole Resonances

    International Nuclear Information System (INIS)

    Avez, B.; Simenel, C.

    2013-01-01

    We study structure and direct decay of the Giant Monopole Resonance (GMR) at the Random Phase Approximation (RPA) level using the time-dependent energy density functional method in the linear response regime in a few doubly magic nuclei. A proper treatment of the continuum, through the use of large coordinate space, allows for a separation between the nucleus and its emitted nucleons. The microscopic structure of the GMR is investigated with the decomposition of the strength function into individual single-particle quantum numbers. A similar microscopic decomposition of the spectra of emitted nucleons by direct decay of the GMR is performed. In this harmonic picture of giant resonance, shifting every contribution by the initial single-particle energy allows to reconstruct the GMR strength function. The RPA residual interaction couples bound 1-particle 1-hole states to unbound ones, allowing for the total decay of the GMR. In this article, we then intend to get an understanding of the direct decay mechanism from coherent one-particle-one-hole superpositions, while neglecting more complex configurations. Time-dependent beyond mean-field approaches should be used, in the future, to extend this method. (orig.)

  4. Vocatives and Other Direct Address Forms: A Contrastive Study

    OpenAIRE

    Lilli Parrott

    2010-01-01

    In this paper I analyze Russian direct address forms, both the distinct truncated vocative and nominative-case direct address forms. I contrast the formal and functional restrictions on the truncated vocative with vocatives in other languages (e.g. Czech and Polish), and I compare the interpolation of Russian direct address forms in an utterance to the situation in English. While similarities are found both in the form and the usage of Russian direct address forms with those in other language...

  5. Direct α-C-H bond functionalization of unprotected cyclic amines

    Science.gov (United States)

    Chen, Weijie; Ma, Longle; Paul, Anirudra; Seidel, Daniel

    2018-02-01

    Cyclic amines are ubiquitous core structures of bioactive natural products and pharmaceutical drugs. Although the site-selective abstraction of C-H bonds is an attractive strategy for preparing valuable functionalized amines from their readily available parent heterocycles, this approach has largely been limited to substrates that require protection of the amine nitrogen atom. In addition, most methods rely on transition metals and are incompatible with the presence of amine N-H bonds. Here we introduce a protecting-group-free approach for the α-functionalization of cyclic secondary amines. An operationally simple one-pot procedure generates products via a process that involves intermolecular hydride transfer to generate an imine intermediate that is subsequently captured by a nucleophile, such as an alkyl or aryl lithium compound. Reactions are regioselective and stereospecific and enable the rapid preparation of bioactive amines, as exemplified by the facile synthesis of anabasine and (-)-solenopsin A.

  6. Direct observation of quark-hadron duality in the free neutron F2 structure function

    Energy Technology Data Exchange (ETDEWEB)

    Niculescu, I. [James Madison Univ., Harrisonburg, VA (United States); Niculescu, G. [James Madison Univ., Harrisonburg, VA (United States); Melnitchouk, W. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Arrington, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Christy, M. E. [Hampton Univ., Hampton, VA (United States); Ent, R. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Griffioen, K. A. [College of William and Mary, Williamsburg, VA (United States); Kalantarians, N. [Hampton Univ., Hampton, VA (United States); Keppel, C. E. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); Kuhn, S. [Old Dominion Univ., Norfolk, VA (United States); Tkachenko, S. [Univ. of Virginia, Charlottesville, VA (United States); Zhang, J. [Univ. of Virginia, Charlottesville, VA (United States)

    2015-05-21

    Using data from the recent BONuS experiment at Jefferson Lab, which utilized a novel spectator tagging technique to extract the inclusive electron-free neutron scattering cross section, we obtain the first direct observation of quark-hadron duality in the neutron F2 structure function. In addition, the data are used to reconstruct the lowest few (N = 2, 4 and 6) moments of F2 in the three prominent nucleon resonance regions, as well as the moments integrated over the entire resonance region. Comparison with moments computed from global parametrizations of parton distribution functions suggest that quark--hadron duality holds locally for the neutron in the second and third resonance regions down to Q2 ≈ 1 GeV2, with violations possibly up to 20% observed in the first resonance region.

  7. Marginal Abatement Cost of CO2 in China Based on Directional Distance Function: An Industry Perspective

    Directory of Open Access Journals (Sweden)

    Bowen Xiao

    2017-01-01

    Full Text Available Industrial sectors account for around 70% of the total energy-related CO2 emissions in China. It is of great importance to measure the potential for CO2 emissions reduction and calculate the carbon price in industrial sectors covered in the Emissions Trading Scheme and carbon tax. This paper employs the directional distance function to calculate the marginal abatement costs of CO2 emissions during 2005–2011 and makes a comparative analysis between our study and the relevant literature. Our empirical results show that the marginal abatement costs vary greatly from industry to industry: high marginal abatement costs occur in industries with low carbon intensity, and vice versa. In the application of the marginal abatement cost, the abatement distribution scheme with minimum cost is established under different abatement targets. The conclusions of abatement distribution scheme indicate that those heavy industries with low MACs and high carbon intensity should take more responsibility for emissions reduction and vice versa. Finally, the policy implications for marginal abatement cost are provided.

  8. Structure-function insights into direct lipid transfer between membranes by Mmm1-Mdm12 of ERMES.

    Science.gov (United States)

    Kawano, Shin; Tamura, Yasushi; Kojima, Rieko; Bala, Siqin; Asai, Eri; Michel, Agnès H; Kornmann, Benoît; Riezman, Isabelle; Riezman, Howard; Sakae, Yoshitake; Okamoto, Yuko; Endo, Toshiya

    2018-03-05

    The endoplasmic reticulum (ER)-mitochondrial encounter structure (ERMES) physically links the membranes of the ER and mitochondria in yeast. Although the ER and mitochondria cooperate to synthesize glycerophospholipids, whether ERMES directly facilitates the lipid exchange between the two organelles remains controversial. Here, we compared the x-ray structures of an ERMES subunit Mdm12 from Kluyveromyces lactis with that of Mdm12 from Saccharomyces cerevisiae and found that both Mdm12 proteins possess a hydrophobic pocket for phospholipid binding. However in vitro lipid transfer assays showed that Mdm12 alone or an Mmm1 (another ERMES subunit) fusion protein exhibited only a weak lipid transfer activity between liposomes. In contrast, Mdm12 in a complex with Mmm1 mediated efficient lipid transfer between liposomes. Mutations in Mmm1 or Mdm12 impaired the lipid transfer activities of the Mdm12-Mmm1 complex and furthermore caused defective phosphatidylserine transport from the ER to mitochondrial membranes via ERMES in vitro. Therefore, the Mmm1-Mdm12 complex functions as a minimal unit that mediates lipid transfer between membranes. © 2018 Kawano et al.

  9. and chebyshev functions

    Directory of Open Access Journals (Sweden)

    Mohsen Razzaghi

    2000-01-01

    Full Text Available A direct method for finding the solution of variational problems using a hybrid function is discussed. The hybrid functions which consist of block-pulse functions plus Chebyshev polynomials are introduced. An operational matrix of integration and the integration of the cross product of two hybrid function vectors are presented and are utilized to reduce a variational problem to the solution of an algebraic equation. Illustrative examples are included to demonstrate the validity and applicability of the technique.

  10. Status and future of the direct sales market

    International Nuclear Information System (INIS)

    DuMaresq, P.R.

    1996-01-01

    Three topics of interest concerning the direct purchase of natural gas, were discussed. The three topics were: (1) the Ontario market, past, present and future, along with an analysis of market segmentation, (2) Ontario local distribution companies (LDC) separation, or separating the merchant role from the distribution role, and (3) the status of direct purchase in Alberta. Changes in the natural gas market since deregulation in 1985, were also reviewed. It was noted that today, only a handful of agents, brokers and marketers of natural gas are vying for the market; customers are looking to purchase gas at a price lower than the LDC buy/sell price; and there is pressure for the LDCs to separate the merchant functions from the distribution functions in most of the provinces in Canada. The direct and long term impact of these developments will be to enhance competition among distributors

  11. [Direct osteosynthesis of instable Gehweiler Type III atlas fractures. Presentation of a dorsoventral osteosynthesis of instable atlas fractures while maintaining function].

    Science.gov (United States)

    Böhm, H; Kayser, R; El Saghir, H; Heyde, C-E

    2006-09-01

    This retrospective study evaluates eight patients with unstable fractures of the atlas vertebra, treated operatively in the Central Clinic Bad Berka between January 1995 and December 2001. In all cases, we were confronted with unstable and dislocated type III fractures according to Gehweiler, caused by an injured transverse ligament. Mean age was 34 years (range 20-49) in two women and six men. We introduce a new technique of direct reconstruction of the atlas vertebra. This technique leads to a stable ring construct that allows compression osteosynthesis of the fracture. Spinal fusion can be avoided, as can postoperative immobilization, since sufficient stability for functional postoperative treatment is achievable. The follow-up control 38 months (range 6-75) after surgery showed solid bony fusion in all cases, in one case after revision surgery. All patients showed good functional results, there was no need for analgesics and all patients could be reintegrated into their former occupation.

  12. Exploring candidate biological functions by Boolean Function Networks for Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Maria Simak

    Full Text Available The great amount of gene expression data has brought a big challenge for the discovery of Gene Regulatory Network (GRN. For network reconstruction and the investigation of regulatory relations, it is desirable to ensure directness of links between genes on a map, infer their directionality and explore candidate biological functions from high-throughput transcriptomic data. To address these problems, we introduce a Boolean Function Network (BFN model based on techniques of hidden Markov model (HMM, likelihood ratio test and Boolean logic functions. BFN consists of two consecutive tests to establish links between pairs of genes and check their directness. We evaluate the performance of BFN through the application to S. cerevisiae time course data. BFN produces regulatory relations which show consistency with succession of cell cycle phases. Furthermore, it also improves sensitivity and specificity when compared with alternative methods of genetic network reverse engineering. Moreover, we demonstrate that BFN can provide proper resolution for GO enrichment of gene sets. Finally, the Boolean functions discovered by BFN can provide useful insights for the identification of control mechanisms of regulatory processes, which is the special advantage of the proposed approach. In combination with low computational complexity, BFN can serve as an efficient screening tool to reconstruct genes relations on the whole genome level. In addition, the BFN approach is also feasible to a wide range of time course datasets.

  13. A Direct Search Algorithm for Global Optimization

    Directory of Open Access Journals (Sweden)

    Enrique Baeyens

    2016-06-01

    Full Text Available A direct search algorithm is proposed for minimizing an arbitrary real valued function. The algorithm uses a new function transformation and three simplex-based operations. The function transformation provides global exploration features, while the simplex-based operations guarantees the termination of the algorithm and provides global convergence to a stationary point if the cost function is differentiable and its gradient is Lipschitz continuous. The algorithm’s performance has been extensively tested using benchmark functions and compared to some well-known global optimization algorithms. The results of the computational study show that the algorithm combines both simplicity and efficiency and is competitive with the heuristics-based strategies presently used for global optimization.

  14. Onsite-effects of dual-hemisphere versus conventional single-hemisphere transcranial direct current stimulation

    Science.gov (United States)

    Kwon, Yong Hyun; Jang, Sung Ho

    2012-01-01

    We performed functional MRI examinations in six right-handed healthy subjects. During functional MRI scanning, transcranial direct current stimulation was delivered with the anode over the right primary sensorimotor cortex and the cathode over the left primary sensorimotor cortex using dual-hemispheric transcranial direct current stimulation. This was compared to a cathode over the left supraorbital area using conventional single-hemispheric transcranial direct current stimulation. Voxel counts and blood oxygenation level-dependent signal intensities in the right primary sensorimotor cortex regions were estimated and compared between the two transcranial direct current stimulation conditions. Our results showed that dual-hemispheric transcranial direct current stimulation induced greater cortical activities than single-hemispheric transcranial direct current stimulation. These findings suggest that dual-hemispheric transcranial direct current stimulation may provide more effective cortical stimulation than single-hemispheric transcranial direct current stimulation. PMID:25624815

  15. Comparison of NGA-West2 directivity models

    Science.gov (United States)

    Spudich, Paul A.; Rowshandel, Badie; Shahi, Shrey; Baker, Jack W.; Chiou, Brian S-J

    2014-01-01

    Five directivity models have been developed based on data from the NGA-West2 database and based on numerical simulations of large strike-slip and reverse-slip earthquakes. All models avoid the use of normalized rupture dimension, enabling them to scale up to the largest earthquakes in a physically reasonable way. Four of the five models are explicitly “narrow-band” (in which the effect of directivity is maximum at a specific period that is a function of earthquake magnitude). Several strategies for determining the zero-level for directivity have been developed. We show comparisons of maps of the directivity amplification. This comparison suggests that the predicted geographic distributions of directivity amplification are dominated by effects of the models' assumptions, and more than one model should be used for ruptures dipping less than about 65 degrees.

  16. Permanent magnetic field, direct electric field, and infrared to reduce blood glucose level and hepatic function in mus musculus with diabetic mellitus

    Science.gov (United States)

    Suhariningsih; Basuki Notobroto, Hari; Winarni, Dwi; Achmad Hussein, Saikhu; Anggono Prijo, Tri

    2017-05-01

    Blood contains several electrolytes with positive (cation) and negative (anion) ion load. Both electrolytes deliver impulse synergistically adjusting body needs. Those electrolytes give specific effect to external disturbance such as electric, magnetic, even infrared field. A study has been conducted to reduce blood glucose level and liver function, in type 2 Diabetes Mellitus patients, using Biophysics concept which uses combination therapy of permanent magnetic field, electric field, and infrared. This study used 48 healthy mice (mus musculus), male, age 3-4 weeks, with approximately 25-30 g in weight. Mice was fed with lard as high fat diet orally, before Streptozotocin (STZ) induction become diabetic mice. Therapy was conducted by putting mice in a chamber that emits the combination of permanent magnetic field, electric field, and infrared, every day for 1 hour for 28 days. There were 4 combinations of therapy/treatment, namely: (1) permanent magnetic field, direct electric field, and infrared; (2) permanent magnetic field, direct electric field, without infrared; (3) permanent magnetic field, alternating electric field, and infrared; and (4) permanent magnetic field, alternating electric field, without infrared. The results of therapy show that every combination is able to reduce blood glucose level, AST, and ALT. However, the best result is by using combination of permanent magnetic field, direct electric field, and infrared.

  17. Robust, directed assembly of fluorescent nanodiamonds.

    Science.gov (United States)

    Kianinia, Mehran; Shimoni, Olga; Bendavid, Avi; Schell, Andreas W; Randolph, Steven J; Toth, Milos; Aharonovich, Igor; Lobo, Charlene J

    2016-10-27

    Arrays of fluorescent nanoparticles are highly sought after for applications in sensing, nanophotonics and quantum communications. Here we present a simple and robust method of assembling fluorescent nanodiamonds into macroscopic arrays. Remarkably, the yield of this directed assembly process is greater than 90% and the assembled patterns withstand ultra-sonication for more than three hours. The assembly process is based on covalent bonding of carboxyl to amine functional carbon seeds and is applicable to any material, and to non-planar surfaces. Our results pave the way to directed assembly of sensors and nanophotonics devices.

  18. Direct and indirect spino-cerebellar pathways: shared ideas but different functions in motor control

    Directory of Open Access Journals (Sweden)

    Juan eJiang

    2015-07-01

    Full Text Available The impressive precision of mammalian limb movements relies on internal feedback pathways that convey information about ongoing motor output to cerebellar circuits. The spino-cerebellar tracts (SCT in the cervical, thoracic and lumbar spinal cord have long been considered canonical neural substrates for the conveyance of internal feedback signals. Here we consider the distinct features of an indirect spino-cerebellar route, via the brainstem lateral reticular nucleus (LRN, and the implications of this pre-cerebellar ‘detour’ for the execution and evolution of limb motor control. Both direct and indirect spino-cerebellar pathways signal spinal interneuronal activity to the cerebellum during movements, but evidence suggests that direct SCT neurons are mainly modulated by rhythmic activity, whereas the LRN also receives information from systems active during postural adjustment, reaching and grasping. Thus, while direct and indirect spino-cerebellar circuits can both be regarded as internal copy pathways, it seems likely that the direct system is principally dedicated to rhythmic motor acts like locomotion, while the indirect system also provides a means of pre-cerebellar integration relevant to the execution and coordination of de

  19. Directed forgetting: Comparing pictures and words.

    Science.gov (United States)

    Quinlan, Chelsea K; Taylor, Tracy L; Fawcett, Jonathan M

    2010-03-01

    The authors investigated directed forgetting as a function of the stimulus type (picture, word) presented at study and test. In an item-method directed forgetting task, study items were presented 1 at a time, each followed with equal probability by an instruction to remember or forget. Participants exhibited greater yes-no recognition of remember than forget items for each of the 4 study-test conditions (picture-picture, picture-word, word-word, word-picture). However, this difference was significantly smaller when pictures were studied than when words were studied. This finding demonstrates that the magnitude of the directed forgetting effect can be reduced by high item memorability, such as when the picture superiority effect is operating. This suggests caution in using pictures at study when the goal of an experiment is to examine potential group differences in the magnitude of the directed forgetting effect. 2010 APA, all rights reserved.

  20. Polymer Directed Protein Assemblies

    Directory of Open Access Journals (Sweden)

    Patrick van Rijn

    2013-05-01

    Full Text Available Protein aggregation and protein self-assembly is an important occurrence in natural systems, and is in some form or other dictated by biopolymers. Very obvious influences of biopolymers on protein assemblies are, e.g., virus particles. Viruses are a multi-protein assembly of which the morphology is dictated by poly-nucleotides namely RNA or DNA. This “biopolymer” directs the proteins and imposes limitations on the structure like the length or diameter of the particle. Not only do these bionanoparticles use polymer-directed self-assembly, also processes like amyloid formation are in a way a result of directed protein assembly by partial unfolded/misfolded biopolymers namely, polypeptides. The combination of proteins and synthetic polymers, inspired by the natural processes, are therefore regarded as a highly promising area of research. Directed protein assembly is versatile with respect to the possible interactions which brings together the protein and polymer, e.g., electrostatic, v.d. Waals forces or covalent conjugation, and possible combinations are numerous due to the large amounts of different polymers and proteins available. The protein-polymer interacting behavior and overall morphology is envisioned to aid in clarifying protein-protein interactions and are thought to entail some interesting new functions and properties which will ultimately lead to novel bio-hybrid materials.

  1. Allosteric conformational barcodes direct signaling in the cell.

    Science.gov (United States)

    Nussinov, Ruth; Ma, Buyong; Tsai, Chung-Jung; Csermely, Peter

    2013-09-03

    The cellular network is highly interconnected. Pathways merge and diverge. They proceed through shared proteins and may change directions. How are cellular pathways controlled and their directions decided, coded, and read? These questions become particularly acute when we consider that a small number of pathways, such as signaling pathways that regulate cell fates, cell proliferation, and cell death in development, are extensively exploited. This review focuses on these signaling questions from the structural standpoint and discusses the literature in this light. All co-occurring allosteric events (including posttranslational modifications, pathogen binding, and gain-of-function mutations) collectively tag the protein functional site with a unique barcode. The barcode shape is read by an interacting molecule, which transmits the signal. A conformational barcode provides an intracellular address label, which selectively favors binding to one partner and quenches binding to others, and, in this way, determines the pathway direction, and, eventually, the cell's response and fate. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. A Trajectory Generation Approach for Payload Directed Flight

    Science.gov (United States)

    Ippolito, Corey A.; Yeh, Yoo-Hsiu

    2009-01-01

    Presently, flight systems designed to perform payload-centric maneuvers require preconstructed procedures and special hand-tuned guidance modes. To enable intelligent maneuvering via strong coupling between the goals of payload-directed flight and the autopilot functions, there exists a need to rethink traditional autopilot design and function. Research into payload directed flight examines sensor and payload-centric autopilot modes, architectures, and algorithms that provide layers of intelligent guidance, navigation and control for flight vehicles to achieve mission goals related to the payload sensors, taking into account various constraints such as the performance limitations of the aircraft, target tracking and estimation, obstacle avoidance, and constraint satisfaction. Payload directed flight requires a methodology for accurate trajectory planning that lets the system anticipate expected return from a suite of onboard sensors. This paper presents an extension to the existing techniques used in the literature to quickly and accurately plan flight trajectories that predict and optimize the expected return of onboard payload sensors.

  3. Multivariate Functional Data Visualization and Outlier Detection

    KAUST Repository

    Dai, Wenlin

    2017-03-19

    This article proposes a new graphical tool, the magnitude-shape (MS) plot, for visualizing both the magnitude and shape outlyingness of multivariate functional data. The proposed tool builds on the recent notion of functional directional outlyingness, which measures the centrality of functional data by simultaneously considering the level and the direction of their deviation from the central region. The MS-plot intuitively presents not only levels but also directions of magnitude outlyingness on the horizontal axis or plane, and demonstrates shape outlyingness on the vertical axis. A dividing curve or surface is provided to separate non-outlying data from the outliers. Both the simulated data and the practical examples confirm that the MS-plot is superior to existing tools for visualizing centrality and detecting outliers for functional data.

  4. Multivariate Functional Data Visualization and Outlier Detection

    KAUST Repository

    Dai, Wenlin; Genton, Marc G.

    2017-01-01

    This article proposes a new graphical tool, the magnitude-shape (MS) plot, for visualizing both the magnitude and shape outlyingness of multivariate functional data. The proposed tool builds on the recent notion of functional directional outlyingness, which measures the centrality of functional data by simultaneously considering the level and the direction of their deviation from the central region. The MS-plot intuitively presents not only levels but also directions of magnitude outlyingness on the horizontal axis or plane, and demonstrates shape outlyingness on the vertical axis. A dividing curve or surface is provided to separate non-outlying data from the outliers. Both the simulated data and the practical examples confirm that the MS-plot is superior to existing tools for visualizing centrality and detecting outliers for functional data.

  5. Search Directions for Direct H2O2 Synthesis Catalysts Starting from Au-12 Nanoclusters

    DEFF Research Database (Denmark)

    Grabow, Lars; Larsen, Britt Hvolbæk; Falsig, Hanne

    2012-01-01

    that the rate of H2O2 and H2O formation can be determined from a single descriptor, namely, the binding energy of oxygen (E-O). Our model predicts the search direction starting from an Au-12 nanocluster for an optimal catalyst in terms of activity and selectivity for direct H2O2 synthesis. Taking also stability......We present density functional theory calculations on the direct synthesis of H2O2 from H-2 and O-2 over an Au-12 corner model of a gold nanoparticle. We first show a simple route for the direct formation of H2O2 over a gold nanocatalyst, by studying the energetics of 20 possible elementary...... reactions involved in the oxidation of H-2 by O-2. The unwanted side reaction to H2O is also considered. Next we evaluate the degree of catalyst control and address the factors controlling the activity and the selectivity. By combining well-known energy scaling relations with microkinetic modeling, we show...

  6. Exploitation of geoinformatics at modelling of functional effects of forest functions

    International Nuclear Information System (INIS)

    Sitko, R.

    2005-01-01

    From point of view of space modelling geoinformatics has wide application in group of ecologic function of forest because they directly depend on natural conditions of site. A causa de cy modelling application was realised on the territory of TANAP (Tatras National Park), West Tatras, in the part Liptovske Kopy. The size of this territory is about 4,900 hectares and forests there subserve the first of all significant ecological functions, what are soil protection from erosion, water management, and anti-avalanche function. Of environmental functions they have recreational role of the forest and function of nature protection. Anti-avalanche and anti-erosion function of forest is evaluated in this presentation

  7. Note on asymptotic series expansions for the derivative of the Hurwitz zeta function and related functions

    International Nuclear Information System (INIS)

    Rudaz, S.

    1990-01-01

    Asymptotic series for the Hurwitz zeta function, its derivative, and related functions (including the Riemann zeta function of odd integer argument) are derived as an illustration of a simple, direct method of broad applicability, inspired by the calculus of finite differences

  8. Technical principles of direct bipolar electrostimulation for cortical and subcortical mapping in awake craniotomy.

    Science.gov (United States)

    Pallud, J; Mandonnet, E; Corns, R; Dezamis, E; Parraga, E; Zanello, M; Spena, G

    2017-06-01

    Intraoperative application of electrical current to the brain is a standard technique during brain surgery for inferring the function of the underlying brain. The purpose of intraoperative functional mapping is to reliably identify cortical areas and subcortical pathways involved in eloquent functions, especially motor, sensory, language and cognitive functions. The aim of this article is to review the rationale and the electrophysiological principles of the use of direct bipolar electrostimulation for cortical and subcortical mapping under awake conditions. Direct electrical stimulation is a window into the whole functional network that sustains a particular function. It is an accurate (spatial resolution of about 5mm) and a reproducible technique particularly adapted to clinical practice for brain resection in eloquent areas. If the procedure is rigorously applied, the sensitivity of direct electrical stimulation for the detection of cortical and subcortical eloquent areas is nearly 100%. The main disadvantage of this technique is its suboptimal specificity. Another limitation is the identification of eloquent areas during surgery, which, however, could have been functionally compensated postoperatively if removed surgically. Direct electrical stimulation is an easy, accurate, reliable and safe invasive technique for the intraoperative detection of both cortical and subcortical functional brain connectivity for clinical purpose. In our opinion, it is the optimal technique for minimizing the risk of neurological sequelae when resecting in eloquent brain areas. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Direct laser metal deposition of WC/Co/Cr powder by means of the functionally graded materials strategy

    Science.gov (United States)

    Angelastro, A.; Campanelli, S. L.

    2017-12-01

    One of the many applications of direct laser metal deposition (DLMD) is the realization of multilayer thick coatings having particular mechanical characteristics, such as high hardness. The objective of this work was to obtain a thick, very hard and wear resistant coating, containing a high percentage of tungsten carbide (WC), on an AISI 304 stainless steel substrate. In order to achieve this result, a tungsten carbide-cobalt-chrome (WC/Co/Cr) powder was processed by the DLMD method. WC/Co/Cr is a composite widely used as a wear-resistant material for cutting tools, molds, coatings and other severe applications. Because of its high hardness, poor ductility and low thermal expansion coefficient, depositing this material directly on the stainless steel substrate is very difficult. In order to overcome this problem, the strategy of functionally graded materials (FGM) was used. Colmonoy 227-F nickel alloy was chosen for this purpose in order to generate a mixture with the WC/Co/Cr powder. Four different materials were deposited, layer by layer, by mixing Colmonoy 227-F with an increasing amount of WC/Co/Cr powders, until obtaining a thick surface coating with a maximum amount of WC of 77.4 wt%. For each powder mixture, a mathematical model was applied to calculate optimal values of translation speed and overlap percentages. A metallographic examination was performed in order to detect macro- and micro-structures of the different materials. Finally, Vickers micro-hardness was measured at various locations along the transverse section to appreciate the gradual increase of the FGM hardness, starting from the substrate and culminating at the top surface of the last deposited material.

  10. Direct coupling of electromembrane extraction to mass spectrometry - Advancing the probe functionality toward measurements of zwitterionic drug metabolites.

    Science.gov (United States)

    Rye, Torstein Kige; Fuchs, David; Pedersen-Bjergaard, Stig; Petersen, Nickolaj Jacob

    2017-08-29

    A triple-flow electromembrane extraction (EME) probe was developed and coupled directly to electrospray-ionization mass spectrometry (ESI-MS). Metabolic reaction mixtures (pH 7.4) containing drug substances and related metabolites were continuously drawn (20 μL/min) into the EME probe in one flow channel, and mixed inside the probe with 7.5 μL min -1 of 1 M formic acid as make-up flow from a second flow channel. Following this acidification, the drug substances and their related metabolites were continuously extracted by EME at 400 V, across a supported liquid membrane (SLM) comprising 2-nitrophenyl octyl ether (and for some experiments containing 30% triphenyl phosphate (TPP)), and into 20 μL min -1 of formic acid as acceptor phase, which was introduced through a third flow channel. The acceptor phase was pumped directly to the MS system, and the ion intensity of extracted analytes was followed continuously as function of time. The triple-flow EME probe was used for co-extraction of positively charged parent drugs and their zwitterionic drug metabolites (hydroxyzine and its carboxylic acid metabolite cetirizine; and vortioxetine and its carboxylic acid metabolite Lu AA34443). While the zwitterionic metabolites could not be extracted at pH 7.4, it was shown that by acidifying the sample solution the zwitterionic metabolites could be extracted effectively. Various extraction parameters like make-up flow, extraction voltage and SLM composition were optimized for simultaneous extraction of parent drugs and metabolites. It was found that TPP added to the SLM improved extraction efficiencies of certain drug metabolites. Finally the optimized and characterized triple-flow EME probe was used for online studying the in-vitro metabolism of hydroxyzine and vortioxetine by rat liver microsomes. Due to the automated pre-extraction acidification of the rat liver microsomal solutions, it was possible to continuously monitor formation of the zwitterionic drug

  11. Directional preference and functional outcomes among subjects classified at high psychosocial risk using STarT.

    Science.gov (United States)

    Werneke, Mark W; Edmond, Susan; Young, Michelle; Grigsby, David; McClenahan, Brian; McGill, Troy

    2018-03-14

    Physiotherapy has an important role in managing patients with non-specific low back pain who experience elevated psychosocial distress or risk for chronic disability. In terms of evidence-based physiotherapy practice, cognitive-behavioural approaches for patients at high psychosocial risk are the recommended management to improve patient treatment outcomes. Evidence also suggests that directional preference (DP) is an important treatment effect modifier for prescribing specific exercises for patients to improve outcomes. Little is known about the influence of treatment techniques based on DP on outcomes for patients classified as high psychosocial risk using the Subgroups for Targeted Treatment (STarT) Back Screening Tool. This study aimed to examine the association between functional status (FS) at rehabilitation discharge for patients experiencing low back pain classified at high STarT psychosocial risk and whose symptoms showed a DP versus No-DP. High STarT risk patients (n = 138) completed intake surveys, that is, the lumbar FS of Focus On Therapeutic Outcomes, Inc., and STarT, and were evaluated for DP by physiotherapists credentialed in McKenzie methods. The FS measure of Focus On Therapeutic Outcomes, Inc., was repeated at discharge. DP and No-DP prevalence rates were calculated. Associations between first-visit DP and No-DP and change in FS were assessed using univariate and multivariate regression models controlling for 11 risk-adjusted variables. One hundred nine patients classified as high STarT risk had complete intake and discharge FS and DP data. Prevalence rate for DP was 65.1%. A significant and clinically important difference (7.98 FS points; p = .03) in change in function at discharge between DP and No-DP was observed after controlling for all confounding variables in the final model. Findings suggest that interventions matched to DP are effective for managing high psychological risk patients and may provide physiotherapists with an

  12. A Functional HAZOP Methodology

    DEFF Research Database (Denmark)

    Liin, Netta; Lind, Morten; Jensen, Niels

    2010-01-01

    A HAZOP methodology is presented where a functional plant model assists in a goal oriented decomposition of the plant purpose into the means of achieving the purpose. This approach leads to nodes with simple functions from which the selection of process and deviation variables follow directly...

  13. European community direct taxation: the recent integration trends

    OpenAIRE

    Kalvytė, Vesta

    2011-01-01

    While Member States retain direct tax sovereignity and determine the tax, its base, rate, taxable subjects discretionary, fundamental differencies occur, resulting in market fragmentation and big obstacles for effective functioning of Community internal market. These differencies and the gap between harmonization in direct taxes and other spheres stipulate the need of harmonization and pressure for the Member States. However, the sole harmonization base requires the Council to act unanimously...

  14. The Quality of Self, Social, and Directive Memories: Are There Adult Age Group Differences?

    Science.gov (United States)

    Alea, Nicole; Arneaud, Mary Jane; Ali, Sideeka

    2013-01-01

    The quality of functional autobiographical memories was examined in young, middle-aged, and older adult Trinidadians ("N" = 245). Participants wrote about an event that served a self, social, and directive function, and reported on the memory's quality (e.g., significance, vividness, valence, etc.). Across age groups, directive memories…

  15. cl-Supercontinuous Functions

    Directory of Open Access Journals (Sweden)

    D. Singh

    2007-10-01

    Full Text Available Basic properties of cl-supercontinuity, a strong variant of continuity, due to Reilly and Vamanamurthy [Indian J. Pure Appl. Math., 14 (1983, 767–772], who call such maps clopen continuous, are studied. Sufficient conditions on domain or range for a continuous function to be cl-supercontinuous are observed. Direct and inverse transfer of certain topological properties under cl-supercontinuous functions are studied and existence or nonexistence of certain cl-supercontinuous function with specified domain or range is outlined.

  16. Permanent magnetic field, direct electric field, and infrared to reduce blood glucose level and hepatic function in mus musculus with diabetic mellitus

    International Nuclear Information System (INIS)

    Suhariningsih; Prijo, Tri Anggono; Notobroto, Hari Basuki; Winarni, Dwi; Hussein, Saikhu Achmad

    2017-01-01

    Blood contains several electrolytes with positive (cation) and negative (anion) ion load. Both electrolytes deliver impulse synergistically adjusting body needs. Those electrolytes give specific effect to external disturbance such as electric, magnetic, even infrared field. A study has been conducted to reduce blood glucose level and liver function, in type 2 Diabetes Mellitus patients, using Biophysics concept which uses combination therapy of permanent magnetic field, electric field, and infrared. This study used 48 healthy mice ( mus musculus ), male, age 3-4 weeks, with approximately 25-30 g in weight. Mice was fed with lard as high fat diet orally, before Streptozotocin (STZ) induction become diabetic mice. Therapy was conducted by putting mice in a chamber that emits the combination of permanent magnetic field, electric field, and infrared, every day for 1 hour for 28 days. There were 4 combinations of therapy/treatment, namely: (1) permanent magnetic field, direct electric field, and infrared; (2) permanent magnetic field, direct electric field, without infrared; (3) permanent magnetic field, alternating electric field, and infrared; and (4) permanent magnetic field, alternating electric field, without infrared. The results of therapy show that every combination is able to reduce blood glucose level, AST, and ALT. However, the best result is by using combination of permanent magnetic field, direct electric field, and infrared. (paper)

  17. Functional microorganisms for functional food quality.

    Science.gov (United States)

    Gobbetti, M; Cagno, R Di; De Angelis, M

    2010-09-01

    Functional microorganisms and health benefits represent a binomial with great potential for fermented functional foods. The health benefits of fermented functional foods are expressed either directly through the interactions of ingested live microorganisms with the host (probiotic effect) or indirectly as the result of the ingestion of microbial metabolites synthesized during fermentation (biogenic effect). Since the importance of high viability for probiotic effect, two major options are currently pursued for improving it--to enhance bacterial stress response and to use alternative products for incorporating probiotics (e.g., ice cream, cheeses, cereals, fruit juices, vegetables, and soy beans). Further, it seems that quorum sensing signal molecules released by probiotics may interact with human epithelial cells from intestine thus modulating several physiological functions. Under optimal processing conditions, functional microorganisms contribute to food functionality through their enzyme portfolio and the release of metabolites. Overproduction of free amino acids and vitamins are two classical examples. Besides, bioactive compounds (e.g., peptides, γ-amino butyric acid, and conjugated linoleic acid) may be released during food processing above the physiological threshold and they may exert various in vivo health benefits. Functional microorganisms are even more used in novel strategies for decreasing phenomenon of food intolerance (e.g., gluten intolerance) and allergy. By a critical approach, this review will aim at showing the potential of functional microorganisms for the quality of functional foods.

  18. Dark matter directional detection in non-relativistic effective theories

    International Nuclear Information System (INIS)

    Catena, Riccardo

    2015-01-01

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF 4 , CS 2 and 3 He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments

  19. Multi-directional random wave interaction with an array of cylinders

    DEFF Research Database (Denmark)

    Ji, Xinran; Liu, Shuxue; Bingham, Harry B.

    2015-01-01

    Based on the linear theory of wave interaction with an array of circular bottom-mounted vertical cylinders, systematic calculations are made to investigate the effects of the wave directionality on wave loads in short-crested seas. The multi-directional waves are specified using a discrete form...... of the Mitsuyasu-type spreading function. The time series of multi-directional wave loads, including both the wave run-up and wave force, can be simulated. The effect of wave directionality on the wave run-up and wave loading on the cylinders is investigated. For multi-directional waves, as the distribution...

  20. Direct navigation on 3D rotational x-ray data acquired with a mobile propeller C-arm: accuracy and application in functional endoscopic sinus surgery

    International Nuclear Information System (INIS)

    Kraats, Everine B van de; Carelsen, Bart; Fokkens, Wytske J; Boon, Sjirk N; Noordhoek, Niels; Niessen, Wiro J; Walsum, Theo van

    2005-01-01

    Recently, three-dimensional (3D) rotational x-ray imaging has been combined with navigation technology, enabling direct 3D navigation for minimally invasive image guided interventions. In this study, phantom experiments are used to determine the accuracy of such a navigation set-up for a mobile C-arm with propeller motion. After calibration of the C-arm system, the accuracy is evaluated by pinpointing divots on a special-purpose phantom with known geometry. This evaluation is performed both with and without C-arm motion in between calibration and registration for navigation. The variation caused by each of the individual transformations in the calibration and registration process is also studied. The feasibility of direct navigation on 3D rotational x-ray images for functional endoscopic sinus surgery has been evaluated in a cadaver navigation experiment. Navigation accuracy was approximately 1.0 mm, which is sufficient for functional endoscopic sinus surgery. C-arm motion in between calibration and registration slightly degraded the registration accuracy by approximately 0.3 mm. Standard deviations of each of the transformations were in the range 0.15-0.31 mm. In the cadaver experiment, the navigation images were considered in good correspondence with the endoscopic images by an experienced ENT surgeon. Availability of 3D localization information provided by the navigation system was considered valuable by the ENT surgeon

  1. A Sequential Quadratically Constrained Quadratic Programming Method of Feasible Directions

    International Nuclear Information System (INIS)

    Jian Jinbao; Hu Qingjie; Tang Chunming; Zheng Haiyan

    2007-01-01

    In this paper, a sequential quadratically constrained quadratic programming method of feasible directions is proposed for the optimization problems with nonlinear inequality constraints. At each iteration of the proposed algorithm, a feasible direction of descent is obtained by solving only one subproblem which consist of a convex quadratic objective function and simple quadratic inequality constraints without the second derivatives of the functions of the discussed problems, and such a subproblem can be formulated as a second-order cone programming which can be solved by interior point methods. To overcome the Maratos effect, an efficient higher-order correction direction is obtained by only one explicit computation formula. The algorithm is proved to be globally convergent and superlinearly convergent under some mild conditions without the strict complementarity. Finally, some preliminary numerical results are reported

  2. Study of direct photons produced in hadronic interactions

    International Nuclear Information System (INIS)

    Karyotakis, Y.

    1985-05-01

    This thesis studies direct photons produced by π + , π - and proton beams of 200 GeV/c, momentum interacting with a carbon target. QCD predicts that direct photons are produced either by the quark-antiquark annihilation qantiq → gγ, or by gluon scattering gq → qγ. The experiment was performed at CERN and used the NA3 spectrometer. Photons are converted within 10% conversion length, and resulting e + e - are detected by the trigger system which requires a minimum transverse momentum of 2.5 GeV/c. Electrons tracks are detected by the spectrometer, while energy and position of photons are measured by an electromagnetic calorimeter and a shower chamber. Direct photon's signal is obtained only statistically, after correcting the ''single photons'' candidats for the π 0 and eta 0 contribution. This correction is obtained only from a sophisticated Monte Carlo, in which electromagnetic shower simulation is difficult. We have observed a significant direct photon signal and we measured the cross section. The γ/π 0 ratio at psub(t) = 4.5 GeV/c is about 10% and seems to grow as a function of transverse momentum. Systematic errors, which are important, limit the precision on the gluon's structure function measurement [fr

  3. International Workshop on Electronic Density Functional Theory : Recent Progress and New Directions

    CERN Document Server

    Vignale, Giovanni; Das, Mukunda

    1998-01-01

    This book is an outcome of the International Workshop on Electronic Density Functional Theory, held at Griffith University in Brisbane, Australia, in July 1996. Density functional theory, standing as it does at the boundary between the disciplines of physics, chemistry, and materials science, is a great mixer. Invited experts from North America, Europe, and Australia mingled with students from several disciplines, rapidly taking up the informal style for which Australia is famous. A list of participants is given at the end of the book. Density functional theory (DFT) is a subtle approach to the very difficult problem of predicting the behavior of many interacting particles. A major application is the study of many-electron systems. This was the workshop theme, embracing inter alia computational chemistry and condensed matter physics. DFT circumvents the more conceptually straightforward (but more computationally intensive) approach in which one solves the many-body Schrodinger equation. It relies instead on r...

  4. Directional spread parameter at intermediate water depth

    Digital Repository Service at National Institute of Oceanography (India)

    SanilKumar, V.; Deo, M.C.; Anand, N.M.; AshokKumar, K.

    ’ involves only the significant wave height, zero crossing wave period and water depth, the spreading function based on ‘s 3 ’ can be used for practical appli- cation. In the model based on ‘s 3 ’ the mean wave direction is an input and this has...-linearity parameter can be recommended for practical use as it provides an averaged distribution. Acknowledgements The authors would like to thank the Department of Science and Technology, New Delhi, for funding the project titled “Directional wave modelling...

  5. The evolution of trade-offs under directional and correlational selection.

    Science.gov (United States)

    Roff, Derek A; Fairbairn, Daphne J

    2012-08-01

    Using quantitative genetic theory, we develop predictions for the evolution of trade-offs in response to directional and correlational selection. We predict that directional selection favoring an increase in one trait in a trade-off will result in change in the intercept but not the slope of the trade-off function, with the mean value of the selected trait increasing and that of the correlated trait decreasing. Natural selection will generally favor an increase in some combination of trait values, which can be represented as directional selection on an index value. Such selection induces both directional and correlational selection on the component traits. Theory predicts that selection on an index value will also change the intercept but not the slope of the trade-off function but because of correlational selection, the direction of change in component traits may be in the same or opposite directions. We test these predictions using artificial selection on the well-established trade-off between fecundity and flight capability in the cricket, Gryllus firmus and compare the empirical results with a priori predictions made using genetic parameters from a separate half-sibling experiment. Our results support the predictions and illustrate the complexity of trade-off evolution when component traits are subject to both directional and correlational selection. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  6. Basic Functional Analysis Puzzles of Spectral Flow

    DEFF Research Database (Denmark)

    Booss-Bavnbek, Bernhelm

    2011-01-01

    We explain an array of basic functional analysis puzzles on the way to general spectral flow formulae and indicate a direction of future topological research for dealing with these puzzles.......We explain an array of basic functional analysis puzzles on the way to general spectral flow formulae and indicate a direction of future topological research for dealing with these puzzles....

  7. Functional Programming With Relations

    OpenAIRE

    Hutton, Graham

    1991-01-01

    While programming in a relational framework has much to offer over the functional style in terms of expressiveness, computing with relations is less efficient, and more semantically troublesome. In this paper we propose a novel blend of the functional and relational styles. We identify a class of "causal relations", which inherit some of the bi-directionality properties of relations, but retain the efficiency and semantic foundations of the functional style.

  8. Functions of Autobiographical Memory in Younger and Older Adults

    Directory of Open Access Journals (Sweden)

    Andrea Vranić

    2018-02-01

    Full Text Available Functional approach to autobiographical memory (AM posits its three broad functions: directive, self, and social. Although these functions are probably universal, life stage and gender variations are expected. This research builds on previous studies investigating the validity of Thinking About Life Experiences Questionnaire (TALE; Bluck and Alea, 2011. A sample of 365 adults (56% female, mean age 43.3 years, divided in 2 age cohorts (young: 18–45 years, old: 46–90 years, used TALE, to rate their tendency of using AM for three different purposes, and measures of self-concept clarity, attachment in close relationships and time perspective. Confirmatory factor analysis of TALE confirmed the tripartite model of AM functions and further analysis showed partial factorial equivalence across age and gender groups. Young tend to use AM more for directing future behavior and social-bonding, while no age differences were found in the use of AM to serve self-function. As for gender variations, women tend to use AM more for directing their behavior, while no other gender differences in the use of AM were found. TALE showed good internal consistency and convergent validity of the three subscales. The theory-driven hypotheses that individuals with low self-concept clarity would use AM more often to serve a self-function, those with higher levels of attachment anxiety would use AM more often to serve a social function, and those past-oriented would use memory more often for directive purpose, were all confirmed. Also confirmed was the notion of Past Negative Orientation to be more related to the directive use of AM than Past Positive Time Orientation. Limitations and future directions are discussed.

  9. Functions of Autobiographical Memory in Younger and Older Adults.

    Science.gov (United States)

    Vranić, Andrea; Jelić, Margareta; Tonković, Mirjana

    2018-01-01

    Functional approach to autobiographical memory (AM) posits its three broad functions: directive, self, and social. Although these functions are probably universal, life stage and gender variations are expected. This research builds on previous studies investigating the validity of Thinking About Life Experiences Questionnaire (TALE; Bluck and Alea, 2011). A sample of 365 adults (56% female, mean age 43.3 years), divided in 2 age cohorts (young: 18-45 years, old: 46-90 years), used TALE, to rate their tendency of using AM for three different purposes, and measures of self-concept clarity, attachment in close relationships and time perspective. Confirmatory factor analysis of TALE confirmed the tripartite model of AM functions and further analysis showed partial factorial equivalence across age and gender groups. Young tend to use AM more for directing future behavior and social-bonding, while no age differences were found in the use of AM to serve self-function. As for gender variations, women tend to use AM more for directing their behavior, while no other gender differences in the use of AM were found. TALE showed good internal consistency and convergent validity of the three subscales. The theory-driven hypotheses that individuals with low self-concept clarity would use AM more often to serve a self-function, those with higher levels of attachment anxiety would use AM more often to serve a social function, and those past-oriented would use memory more often for directive purpose, were all confirmed. Also confirmed was the notion of Past Negative Orientation to be more related to the directive use of AM than Past Positive Time Orientation. Limitations and future directions are discussed.

  10. Current direction-dependent modulation of human hand motor function by intermittent theta burst stimulation (iTBS).

    Science.gov (United States)

    Shirota, Yuichiro; Dhaka, Suman; Paulus, Walter; Sommer, Martin

    2017-05-22

    Transcranial magnetic stimulation (TMS) with different current directions can activate different sets of neurons. Current direction can also affect the results of repetitive TMS. To test the influence of uni-directional intermittent theta burst stimulation (iTBS) using different current directions, namely posteroanterior (PA) and anteroposterior (AP), on motor behaviour. In a cross-over design, PA- and AP-iTBS was applied over the left primary motor cortex in 19 healthy, right-handed volunteers. Performance of a finger-tapping task was recorded before and 0, 10, 20, and 30min after the iTBS. The task was conducted with the right and left hands separately at each time point. As a control, AP-iTBS with reduced intensity was applied to 14 participants in a separate session (AP weak condition). The finger-tapping count with the left hand was decreased after PA-iTBS. Neither AP- nor AP weak -iTBS altered the performance. Current direction had a significant impact on the after-effects of iTBS. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Fabrication of multi-functional silicon surface by direct laser writing

    Science.gov (United States)

    Verma, Ashwani Kumar; Soni, R. K.

    2018-05-01

    We present a simple, quick and one-step methodology based on nano-second laser direct writing for the fabrication of micro-nanostructures on silicon surface. The fabricated surfaces suppress the optical reflection by multiple reflection due to light trapping effect to a much lower value than polished silicon surface. These textured surfaces offer high enhancement ability after gold nanoparticle deposition and then explored for Surface Enhanced Raman Scattering (SERS) for specific molecular detection. The effect of laser scanning line interval on optical reflection and SERS signal enhancement ability was also investigated. Our results indicate that low optical reflection substrates exhibit uniform SERS enhancement with enhancement factor of the order of 106. Furthermore, this methodology provide an alternative approach for cost-effective large area fabrication with good control over feature size.

  12. Direct and inverse problems of infrared tomography

    DEFF Research Database (Denmark)

    Sizikov, Valery S.; Evseev, Vadim; Fateev, Alexander

    2016-01-01

    The problems of infrared tomography-direct (the modeling of measured functions) and inverse (the reconstruction of gaseous medium parameters)-are considered with a laboratory burner flame as an example of an application. The two measurement modes are used: active (ON) with an external IR source...

  13. Gut-directed hypnotherapy in children with irritable bowel syndrome or functional abdominal pain (syndrome): A randomized controlled trial on self exercises at home using CD versus individual therapy by qualified therapists

    NARCIS (Netherlands)

    J.M.T.M. Rutten (Juliette); A.M. Vlieger (Arine M.); C. Frankenhuis (Carla); E.K. George (Elvira K.); M. Groeneweg (Michael); O.F. Norbruis (Obbe); W.E. Tjon A ten; H. Van Wering (Herbert); M.G.W. Dijkgraaf (Marcel); M.P. Merkus; M.A. Benninga (Marc)

    2014-01-01

    textabstractBackground: Irritable bowel syndrome (IBS) and functional abdominal pain (syndrome) (FAP(S)) are common pediatric disorders, characterized by chronic or recurrent abdominal pain. Treatment is challenging, especially in children with persisting symptoms. Gut-directed hypnotherapy (HT)

  14. Radiation protection office at the general direction of health

    International Nuclear Information System (INIS)

    Piechowski, J.

    1996-01-01

    The radiation protection office at the general direction of health has the following functions: organisation and relations with decentralized services, legal aspects, relations with the direction of nuclear installation safety, nuclear medicine with licensing, radioactive wastes in relation with ANDRA, environment, trusteeship of OPRI in matter of measurements, dosimetry and epidemiology in relation with the Minister of work and training in radiation protection. (N.C.)

  15. Direct image reconstruction with limited angle projection data for computerized tomography

    International Nuclear Information System (INIS)

    Inouye, T.

    1980-01-01

    Discussions are made on the minimum angle range for projection data necessary to reconstruct the complete CT image. As is easily shown from the image reconstruction theorem, the lack of projection angle provides no data for the Fourier transformed function of the object on the corresponding angular directions, where the projections are missing. In a normal situation, the Fourier transformed function of an object image holds an analytic characteristic with respect to two-dimensional orthogonal parameters. This characteristic enables uniquely prolonging the function outside the obtained region employing a sort of analytic continuation with respect to both parameters. In the method reported here, an object pattern, which is confined within a finite range, is shifted to a specified region to have complete orthogonal function expansions without changing the projection angle directions. These orthogonal functions are analytically extended to the missing projection angle range and the whole function is determined. This method does not include any estimation process, whose effectiveness is often seriously jeopardized by the presence of a slight fluctuation component. Computer simulations were carried out to demonstrate the effectiveness of the method

  16. Relations between the functions of autobiographical memory and psychological wellbeing.

    Science.gov (United States)

    Waters, Theodore E A

    2014-01-01

    Researchers have proposed that autobiographical memory serves three basic functions in everyday life: self-definition, social connection, and directing behaviour (e.g., Bluck, Alea, Habermas, & Rubin, 2005). However, no research has examined relations between the functions of autobiographical memory and healthy functioning (i.e., psychological wellbeing). The present research examined the relations between the self, social, and directive functions of autobiographical memory and three factors of psychological wellbeing in single and recurring autobiographical memories. A total of 103 undergraduate students were recruited and provided ratings of each function for four autobiographical memories (two single, two recurring events). Results found that individuals who use their autobiographical memories to serve self, social, and directive functions reported higher levels of Purpose and Communion and Positive Relationships, and that these relations differ slightly by event type.

  17. Functionalized ormosil scaffolds processed by direct laser polymerization for application in tissue engineering

    DEFF Research Database (Denmark)

    Matei, A.; Schou, Jørgen; Canulescu, Stela

    2013-01-01

    Synthesized N,N′-(methacryloyloxyethyl triehtoxy silyl propyl carbamoyl-oxyhexyl)-urea hybrid methacrylate was polymerized by direct laser polymerization using femtosecond laser pulses with the aim of using it for subsequent applications in tissue engineering. The as-obtained scaffolds were...

  18. Structure-function relationships during segregated and integrated network states of human brain functional connectivity.

    Science.gov (United States)

    Fukushima, Makoto; Betzel, Richard F; He, Ye; van den Heuvel, Martijn P; Zuo, Xi-Nian; Sporns, Olaf

    2018-04-01

    Structural white matter connections are thought to facilitate integration of neural information across functionally segregated systems. Recent studies have demonstrated that changes in the balance between segregation and integration in brain networks can be tracked by time-resolved functional connectivity derived from resting-state functional magnetic resonance imaging (rs-fMRI) data and that fluctuations between segregated and integrated network states are related to human behavior. However, how these network states relate to structural connectivity is largely unknown. To obtain a better understanding of structural substrates for these network states, we investigated how the relationship between structural connectivity, derived from diffusion tractography, and functional connectivity, as measured by rs-fMRI, changes with fluctuations between segregated and integrated states in the human brain. We found that the similarity of edge weights between structural and functional connectivity was greater in the integrated state, especially at edges connecting the default mode and the dorsal attention networks. We also demonstrated that the similarity of network partitions, evaluated between structural and functional connectivity, increased and the density of direct structural connections within modules in functional networks was elevated during the integrated state. These results suggest that, when functional connectivity exhibited an integrated network topology, structural connectivity and functional connectivity were more closely linked to each other and direct structural connections mediated a larger proportion of neural communication within functional modules. Our findings point out the possibility of significant contributions of structural connections to integrative neural processes underlying human behavior.

  19. Gut-directed hypnotherapy in children with irritable bowel syndrome or functional abdominal pain (syndrome): a randomized controlled trial on self exercises at home using CD versus individual therapy by qualified therapists

    NARCIS (Netherlands)

    Rutten, Juliette M. T. M.; Vlieger, Arine M.; Frankenhuis, Carla; George, Elvira K.; Groeneweg, Michael; Norbruis, Obbe F.; Tjon A ten, Walther; van Wering, Herbert; Dijkgraaf, Marcel G. W.; Merkus, Maruschka P.; Benninga, Marc A.

    2014-01-01

    Irritable bowel syndrome (IBS) and functional abdominal pain (syndrome) (FAP(S)) are common pediatric disorders, characterized by chronic or recurrent abdominal pain. Treatment is challenging, especially in children with persisting symptoms. Gut-directed hypnotherapy (HT) performed by a therapist

  20. The risk function approach to profit maximizing estimation in direct mailing

    NARCIS (Netherlands)

    Muus, Lars; Scheer, Hiek van der; Wansbeek, Tom

    1999-01-01

    When the parameters of the model describing consumers' reaction to a mailing are known, addresses for a future mailing can be selected in a profit-maximizing way. Usually, these parameters are unknown and are to be estimated. Standard estimation are based on a quadratic loss function. In the present

  1. Directed Evolution of Proteins through In Vitro Protein Synthesis in Liposomes

    Directory of Open Access Journals (Sweden)

    Takehiro Nishikawa

    2012-01-01

    Full Text Available Directed evolution of proteins is a technique used to modify protein functions through “Darwinian selection.” In vitro compartmentalization (IVC is an in vitro gene screening system for directed evolution of proteins. IVC establishes the link between genetic information (genotype and the protein translated from the information (phenotype, which is essential for all directed evolution methods, by encapsulating both in a nonliving microcompartment. Herein, we introduce a new liposome-based IVC system consisting of a liposome, the protein synthesis using recombinant elements (PURE system and a fluorescence-activated cell sorter (FACS used as a microcompartment, in vitro protein synthesis system, and high-throughput screen, respectively. Liposome-based IVC is characterized by in vitro protein synthesis from a single copy of a gene in a cell-sized unilamellar liposome and quantitative functional evaluation of the synthesized proteins. Examples of liposome-based IVC for screening proteins such as GFP and β-glucuronidase are described. We discuss the future directions for this method and its applications.

  2. Transcranial direct current stimulation (tDCS) for improving function and activities of daily living in patients after stroke.

    Science.gov (United States)

    Elsner, Bernhard; Kugler, Joachim; Pohl, Marcus; Mehrholz, Jan

    2013-11-15

    Stroke is one of the leading causes of disability worldwide. Functional impairment resulting in poor performance in activities of daily living (ADLs) among stroke survivors is common. Current rehabilitation approaches have limited effectiveness in improving ADL performance and function after stroke, but a possible adjunct to stroke rehabilitation might be non-invasive brain stimulation by transcranial direct current stimulation (tDCS) to modulate cortical excitability and hence to improve ADL performance and function. To assess the effects of tDCS on generic activities of daily living (ADLs) and motor function in people with stroke. We searched the Cochrane Stroke Group Trials Register (March 2013), the Cochrane Central Register of Controlled Trials (CENTRAL) (The Cochrane Library, May 2013), MEDLINE (1948 to May 2013), EMBASE (1980 to May 2013), CINAHL (1982 to May 2013), AMED (1985 to May 2013), Science Citation Index (1899 to May 2013) and four additional databases. In an effort to identify further published, unpublished and ongoing trials, we searched trials registers and reference lists, handsearched conference proceedings and contacted authors and equipment manufacturers. We included only randomised controlled trials (RCTs) and randomised controlled cross-over trials (from which we analysed only the first period as a parallel-group design) that compared tDCS versus control in adults with stroke for improving ADL performance and function. Two review authors independently assessed trial quality (JM and MP) and extracted data (BE and JM). If necessary, we contacted study authors to ask for additional information. We collected information on dropouts and adverse events from the trial reports. We included 15 studies involving a total of 455 participants. Analysis of six studies involving 326 participants regarding our primary outcome, ADL, showed no evidence of an effect in favour of tDCS at the end of the intervention phase (mean difference (MD) 5.31 Barthel

  3. Numerical Investigation on the Directionality of Nonlinear Indicial Responses

    International Nuclear Information System (INIS)

    Yee, Kwan Jung; Hong, Sang Won; Lee, Dong Ho

    2007-01-01

    An unsteady Euler solver is modified to investigate the directionality of nonlinear indicial response to a step change in the angle of attack. An impulsive change in the angle of attack is incorporated by using the field velocity approach, which is known to decouple the step change in the angle of attack from a pitch rate. Numerical results are thoroughly compared against analytical results for two-dimensional indicial responses. The same method is applied to investigate the directionality of nonlinear indicial responses. It is found that directionality is mainly due to the asymmetry of initial shock locations. Since the directionality of the pitching moment responses is significant in the critical Mach number region, it is also shown that consideration of the directionality is crucial for accurate modeling of the nonlinear indicial functions

  4. Novel Hypoxia-Directed Cancer Therapeutics

    Science.gov (United States)

    2017-07-01

    using small-molecules. The findings also show for the first time, that the mechanism of action for inhibiting these proteins is through disruption...sought to identify small-molecules that bind and act directly through the HIF proteins to block their functions. Over the first year of funding, we...molecules that bind to and inhibit HIF proteins . We will use purified HIF proteins and a chemical library of 32,000 small molecules that have drug -like

  5. OUTWARD BRAZILIAN FOREIGN DIRECT INVESTMENT: IMPULSES AND RESPONSES

    Directory of Open Access Journals (Sweden)

    Ronald de Oliveira Concer

    2010-12-01

    Full Text Available This paper models the outward foreign direct investment from Brazil series using time a series econometrics model, namely the Vector Auto Regressive (VAR model. We have drawn impulse response functions for the key relevant factors that may explain the outward foreign direct investment flows. We start with a review of the literature on the Dunning location approach to international business. We worked with a data set of quarterly observations from Q1-1995 to Q1-2010. We carried also out Granger causality tests as for determining whether international business travelling should be included as an explanatory variable in our model. Results stressed that although the strong exchange rate in Brazil is often blamed for forcing companies to invest abroad, the evidence found in the aggregate data suggests that there is not a significant relationship between the level of foreign exchange rate and the outward Brazilian foreign direct investment. Differently from previous studies, this paper uses impulse response functions to present dynamic results, thus avoiding the typical binary results “affect” or “don’t affect”, and in so doing we provide a more detailed insight into this important location factor.

  6. OUTWARD BRAZILIAN FOREIGN DIRECT INVESTMENT: IMPULSES AND RESPONSES

    Directory of Open Access Journals (Sweden)

    Ronald de Oliveira Concer

    2010-01-01

    Full Text Available This paper models the outward foreign direct investment from Brazil series using time a series econometrics model, namely the Vector Auto Regressive (VAR model. We have drawn impulse response functions for the key relevant factors that may explain the outward foreign direct investment flows. We start with a review of the literature on the Dunning location approach to international business. We worked with a data set of quarterly observations from Q1-1995 to Q1-2010. We carried also out Granger causality tests as for determining whether international business travelling should be included as an explanatory variable in our model. Results stressed that although the strong exchange rate in Brazil is often blamed for forcing companies to invest abroad, the evidence found in the aggregate data suggests that there is not a significant relationship between the level of foreign exchange rate and the outward Brazilian foreign direct investment. Differently from previous studies, this paper uses impulse response functions to present dynamic results, thus avoiding the typical binary results “affect” or “don’t affect”, and in so doing we provide a more detailed insight into this important location factor.

  7. Functionally graded materials

    CERN Document Server

    Mahamood, Rasheedat Modupe

    2017-01-01

    This book presents the concept of functionally graded materials as well as their use and different fabrication processes. The authors describe the use of additive manufacturing technology for the production of very complex parts directly from the three dimension computer aided design of the part by adding material layer after layer. A case study is also presented in the book on the experimental analysis of functionally graded material using laser metal deposition process.

  8. Directed C-H Bond Oxidation of (+)-Pleuromutilin.

    Science.gov (United States)

    Ma, Xiaoshen; Kucera, Roman; Goethe, Olivia F; Murphy, Stephen K; Herzon, Seth B

    2018-05-01

    Antibiotics derived from the diterpene fungal metabolite (+)-pleuromutilin (1) are useful agents for the treatment Gram-positive infections in humans and farm animals. Pleuromutilins elicit slow rates of resistance development and minimal cross-resistance with existing antibiotics. Despite efforts aimed at producing new derivatives by semisynthesis, modification of the tricyclic core is underexplored, in part due to a limited number of functional group handles. Herein, we report methods to selectively functionalize the methyl groups of (+)-pleuromutilin (1) by hydroxyl-directed iridium-catalyzed C-H silylation, followed by Tamao-Fleming oxidation. These reactions provided access to C16, C17, and C18 monooxidized products, as well as C15/C16 and C17/C18 dioxidized products. Four new functionalized derivatives were prepared from the protected C17 oxidation product. C6 carboxylic acid, aldehyde, and normethyl derivatives were prepared from the C16 oxidation product. Many of these sequences were executed on gram scales. The efficiency and practicality of these routes provides an easy method to rapidly interrogate structure-activity relationships that were previously beyond reach. This study will inform the design of fully synthetic approaches to novel pleuromutilins and underscores the power of the hydroxyl-directed iridium-catalyzed C-H silylation reaction.

  9. Ordered self-assembled monolayers terminated with different chemical functional groups direct neural stem cell linage behaviours

    International Nuclear Information System (INIS)

    Yao, Shenglian; Liu, Xi; He, Jin; Wang, Xiumei; Wang, Ying; Cui, Fu-Zhai

    2016-01-01

    Neural stem cells (NSCs) have been a promising candidate for stem cell-based nerve tissue regeneration. Therefore, the design of idea biomaterials that deliver precise regulatory signals to control stem cell fate is currently a crucial issue that depends on a profound understanding of the interactions between NSCs with the surrounding micro-environment. In this work, self-assembled monolayers of alkanethiols on gold with different chemical groups, including hydroxyl (−OH), amino (−NH 2 ), carboxyl (−COOH) and methyl (−CH 3 ), were used as a simple model to study the effects of surface chemistry on NSC fate decisions. Contact angle measurement and x-ray photoelectron spectroscopy (XPS) examination implied that all types of alkanethiols self-assembled on gold into a close-packed phase structure with similar molecular densities. In this study, we evaluated NSC adhesion, migration and differentiation in response to different chemical functional groups cultured under serum-free conditions. Our studies showed that NSCs exhibited certain phenotypes with extreme sensitivity to surface chemical groups. Compared with other functional groups, the SAMs with hydroxyl end-groups provided the best micro-environment in promoting NSC migration and maintaining an undifferentiated or neuronal differentiation state.  −NH 2 surfaces directed neural stem cells into astrocytic lineages, while NSCs on  −COOH and  −CH 3 surfaces had a similar potency to differentiate into three nerve lineages. To further investigate the possible signaling pathway, the gene expression of integrin β1 and β4 were examined. The results indicated that a high expression of β1 integrin would probably have a tight correlation with the expression of nestin, which implied the stemness of NSCs, while β4 integrin seemed to correspond to the differentiated NSCs. The results presented here give useful information for the future design of biomaterials to regulate the preservation

  10. Particle Engineering of Excipients for Direct Compression: Understanding the Role of Material Properties.

    Science.gov (United States)

    Mangal, Sharad; Meiser, Felix; Morton, David; Larson, Ian

    2015-01-01

    Tablets represent the preferred and most commonly dispensed pharmaceutical dosage form for administering active pharmaceutical ingredients (APIs). Minimizing the cost of goods and improving manufacturing output efficiency has motivated companies to use direct compression as a preferred method of tablet manufacturing. Excipients dictate the success of direct compression, notably by optimizing powder formulation compactability and flow, thus there has been a surge in creating excipients specifically designed to meet these needs for direct compression. Greater scientific understanding of tablet manufacturing coupled with effective application of the principles of material science and particle engineering has resulted in a number of improved direct compression excipients. Despite this, significant practical disadvantages of direct compression remain relative to granulation, and this is partly due to the limitations of direct compression excipients. For instance, in formulating high-dose APIs, a much higher level of excipient is required relative to wet or dry granulation and so tablets are much bigger. Creating excipients to enable direct compression of high-dose APIs requires the knowledge of the relationship between fundamental material properties and excipient functionalities. In this paper, we review the current understanding of the relationship between fundamental material properties and excipient functionality for direct compression.

  11. Group B streptococcal beta-hemolysin/cytolysin directly impairs cardiomyocyte viability and function.

    Directory of Open Access Journals (Sweden)

    Mary E Hensler

    Full Text Available BACKGROUND: Group B Streptococcus (GBS is a leading cause of neonatal sepsis where myocardial dysfunction is an important contributor to poor outcome. Here we study the effects of the GBS pore-forming beta-hemolysin/cytolysin (Bh/c exotoxin on cardiomyocyte viability, contractility, and calcium transients. METHODOLOGY/PRINCIPAL FINDINGS: HL-1 cardiomyocytes exposed to intact wild-type (WT or isogenic Deltabeta h/c mutant GBS, or to cell-free extracts from either strain, were assessed for viability by trypan blue exclusion and for apoptosis by TUNEL staining. Functionality of exposed cardiomyocytes was analyzed by visual quantitation of the rate and extent of contractility. Mitochondrial membrane polarization was measured in TMRE-loaded cells exposed to GBS beta h/c. Effects of GBS beta h/c on calcium transients were studied in fura-2AM-loaded primary rat ventricular cardiomyocytes. Exposure of HL-1 cardiomyocytes to either WT GBS or beta h/c extracts significantly reduced both rate and extent of contractility and later induced necrotic and apoptotic cell death. No effects on cardiomyocyte viability or function were observed after treatment with Deltabeta h/c mutant bacteria or extracts. The beta h/c toxin was associated with complete and rapid loss of detectable calcium transients in primary neonatal rat ventricular cardiomyocytes and induced a loss of mitochondrial membrane polarization. These effects on viability and function were abrogated by the beta h/c inhibitor, dipalmitoyl phosphatidylcholine (DPPC. CONCLUSIONS/SIGNIFICANCE: Our data show a rapid loss of cardiomyocyte viability and function induced by GBS beta h/c, and these deleterious effects are inhibited by DPPC, a normal constituent of human pulmonary surfactant.. These findings have clinical implications for the cardiac dysfunction observed in neonatal GBS infections.

  12. Taming astrophysical bias in direct dark matter searches

    NARCIS (Netherlands)

    Pato, M.; Strigari, L.E.; Trotta, R.; Bertone, G.

    2013-01-01

    We explore systematic biases in the identification of dark matter in future direct detection experiments and compare the reconstructed dark matter properties when assuming a self-consistent dark matter distribution function and the standard Maxwellian velocity distribution. We find that the

  13. Direct and inverse scattering for viscoelastic media

    International Nuclear Information System (INIS)

    Ammicht, E.; Corones, J.P.; Krueger, R.J.

    1987-01-01

    A time domain approach to direct and inverse scattering problems for one-dimensional viscoelastic media is presented. Such media can be characterized as having a constitutive relation between stress and strain which involves the past history of the strain through a memory function, the relaxation modulus. In the approach in this article, the relaxation modulus of a material is shown to be related to the reflection properties of the material. This relation provides a constructive algorithm for direct and inverse scattering problems. A numerical implementation of this algorithm is tested on several problems involving realistic relaxation moduli

  14. An Outlyingness Matrix for Multivariate Functional Data Classification

    KAUST Repository

    Dai, Wenlin

    2017-08-25

    The classification of multivariate functional data is an important task in scientific research. Unlike point-wise data, functional data are usually classified by their shapes rather than by their scales. We define an outlyingness matrix by extending directional outlyingness, an effective measure of the shape variation of curves that combines the direction of outlyingness with conventional statistical depth. We propose two classifiers based on directional outlyingness and the outlyingness matrix, respectively. Our classifiers provide better performance compared with existing depth-based classifiers when applied on both univariate and multivariate functional data from simulation studies. We also test our methods on two data problems: speech recognition and gesture classification, and obtain results that are consistent with the findings from the simulated data.

  15. Estimates of rates and errors for measurements of direct-γ and direct-γ + jet production by polarized protons at RHIC

    International Nuclear Information System (INIS)

    Beddo, M.E.; Spinka, H.; Underwood, D.G.

    1992-01-01

    Studies of inclusive direct-γ production by pp interactions at RHIC energies were performed. Rates and the associated uncertainties on spin-spin observables for this process were computed for the planned PHENIX and STAR detectors at energies between √s = 50 and 500 GeV. Also, rates were computed for direct-γ + jet production for the STAR detector. The goal was to study the gluon spin distribution functions with such measurements. Recommendations concerning the electromagnetic calorimeter design and the need for an endcap calorimeter for STAR are made

  16. Direct photons in heavy-ion collisions

    Energy Technology Data Exchange (ETDEWEB)

    Baeuchle, Bjoern

    2010-12-13

    Direct photon emission from heavy-ion collisions has been calculated and compared to available experimental data. Three different models have been combined to extract direct photons from different environments in a heavy-ion collision: Thermal photons from partonic and hadronic matter have been extracted from relativistic, non-viscous 3+1-dimensional hydrodynamic calculations. Thermal and non-thermal photons from hadronic interactions have been calculated from relativistic transport theory. The impact of different physics assumptions about the thermalized matter has been studied. The models used for the determination of photons from both hydrodynamic and transport calculations have been elucidated and their numerical properties tested. The origin of direct photons, itemised by emission stage, emission time, channel and baryon number density, has been investigated for various systems, as have the transverse momentum spectra and elliptic flow patterns of direct photons. Taking into account the full (vacuum) spectral function of the rho-meson decreases the direct photon emission by approximately 10% at low photon transverse momentum. In all systems that have been considered -- heavy-ion collisions at E{sub lab}=35 AGeV and 158 AGeV, (s{sub NN}){sup 1/2}=62.4 GeV, 130 GeV and 200 GeV -- thermal emission from a system with partonic degrees of freedom is greatly enhanced over that from hadronic systems, while the difference between the direct photon yields from a viscous and a non-viscous hadronic system (transport vs. hydrodynamics) is found to be very small. Predictions for direct photon emission in central U+U-collisions at 35 AGeV have been made. (orig.)

  17. Direct photons in heavy-ion collisions

    International Nuclear Information System (INIS)

    Baeuchle, Bjoern

    2010-01-01

    Direct photon emission from heavy-ion collisions has been calculated and compared to available experimental data. Three different models have been combined to extract direct photons from different environments in a heavy-ion collision: Thermal photons from partonic and hadronic matter have been extracted from relativistic, non-viscous 3+1-dimensional hydrodynamic calculations. Thermal and non-thermal photons from hadronic interactions have been calculated from relativistic transport theory. The impact of different physics assumptions about the thermalized matter has been studied. The models used for the determination of photons from both hydrodynamic and transport calculations have been elucidated and their numerical properties tested. The origin of direct photons, itemised by emission stage, emission time, channel and baryon number density, has been investigated for various systems, as have the transverse momentum spectra and elliptic flow patterns of direct photons. Taking into account the full (vacuum) spectral function of the rho-meson decreases the direct photon emission by approximately 10% at low photon transverse momentum. In all systems that have been considered -- heavy-ion collisions at E lab =35 AGeV and 158 AGeV, (s NN ) 1/2 =62.4 GeV, 130 GeV and 200 GeV -- thermal emission from a system with partonic degrees of freedom is greatly enhanced over that from hadronic systems, while the difference between the direct photon yields from a viscous and a non-viscous hadronic system (transport vs. hydrodynamics) is found to be very small. Predictions for direct photon emission in central U+U-collisions at 35 AGeV have been made. (orig.)

  18. Floodplain Condition and Water Framework Directive River Classification in England: Evidence of a Disconnect.

    Science.gov (United States)

    Bentley, S.

    2017-12-01

    The European Union Water Framework Directive came into force in October 2000 committing European Union member states to achieve Good Ecological Status for all water bodies. By 2015 29% of rivers across England had achieved this level suggesting that these watercourse units are now functioning well. This study utilises recently published land cover data for England clipped to the floodplain boundary as defined by the 100 year return period discharge to examine the state of valley bottom vegetation and function for these Good Status rivers. Agricultural use of floodplain areas is high with cereal and horticulture covering an average of 24% and pasture accounting for some 37% of the area. Maximum values increase to 77% and 92% respectively. In all cases wetland accounts for less than 2% of the floodplain and rough grassland averages 7%. Such significant and widespread alteration to floodplain vegetation character suggests that the ecological functioning of this component of the fluvial system has been severely negatively impacted calling into question the Water Framework Directive status level. This is a fault of the Water Framework Directive process which only explicitly evaluates the hydromorphological component of the fluvial system for high status rivers preferring to infer functioning from biological indicators that are focused on in-channel assessments. The fundamental omission of floodplain condition in the Water Framework Directive process will result in only partial achievement of the original goals of the Directive with the majority of Europe's floodplains remaining in a highly degraded, non-functional state.

  19. Proposals for Iterated Hash Functions

    DEFF Research Database (Denmark)

    Knudsen, Lars Ramkilde; Thomsen, Søren Steffen

    2008-01-01

    The past few years have seen an increase in the number of attacks on cryptographic hash functions. These include attacks directed at specific hash functions, and generic attacks on the typical method of constructing hash functions. In this paper we discuss possible methods for protecting against...... some generic attacks. We also give a concrete proposal for a new hash function construction, given a secure compression function which, unlike in typical existing constructions, is not required to be resistant to all types of collisions. Finally, we show how members of the SHA-family can be turned...

  20. Proposals for iterated hash functions

    DEFF Research Database (Denmark)

    Knudsen, Lars Ramkilde; Thomsen, Søren Steffen

    2006-01-01

    The past few years have seen an increase in the number of attacks on cryptographic hash functions. These include attacks directed at specific hash functions, and generic attacks on the typical method of constructing hash functions. In this paper we discuss possible methods for protecting against...... some generic attacks. We also give a concrete proposal for a new hash function construction, given a secure compression function which, unlike in typical existing constructions, is not required to be resistant to all types of collisions. Finally, we show how members of the SHA-family can be turned...

  1. Excited-state density functional theory

    International Nuclear Information System (INIS)

    Harbola, Manoj K; Hemanadhan, M; Shamim, Md; Samal, P

    2012-01-01

    Starting with a brief introduction to excited-state density functional theory, we present our method of constructing modified local density approximated (MLDA) energy functionals for the excited states. We show that these functionals give accurate results for kinetic energy and exchange energy compared to the ground state LDA functionals. Further, with the inclusion of GGA correction, highly accurate total energies for excited states are obtained. We conclude with a brief discussion on the further direction of research that include the construction of correlation energy functional and exchange potential for excited states.

  2. Synthesis of Directional Sources Using Wave Field Synthesis, Possibilities, and Limitations

    Directory of Open Access Journals (Sweden)

    Corteel E

    2007-01-01

    Full Text Available The synthesis of directional sources using wave field synthesis is described. The proposed formulation relies on an ensemble of elementary directivity functions based on a subset of spherical harmonics. These can be combined to create and manipulate directivity characteristics of the synthesized virtual sources. The WFS formulation introduces artifacts in the synthesized sound field for both ideal and real loudspeakers. These artifacts can be partly compensated for using dedicated equalization techniques. A multichannel equalization technique is shown to provide accurate results thus enabling for the manipulation of directional sources with limited reconstruction artifacts. Applications of directional sources to the control of the direct sound field and the interaction with the listening room are discussed.

  3. NKG2D performs two functions in invariant NKT cells: direct TCR-independent activation of NK-like cytolysis and co-stimulation of activation by CD1d.

    Science.gov (United States)

    Kuylenstierna, Carlotta; Björkström, Niklas K; Andersson, Sofia K; Sahlström, Peter; Bosnjak, Lidija; Paquin-Proulx, Dominic; Malmberg, Karl-Johan; Ljunggren, Hans-Gustaf; Moll, Markus; Sandberg, Johan K

    2011-07-01

    Invariant NKT cells are important in the activation and regulation of immune responses. They can also function as CD1d-restricted killer cells. However, the role of activating innate NK-cell receptors expressed on NKT cells in triggering cytolytic function is poorly characterized. Here, we initially confirmed that the cellular stress-ligand receptor NKG2D is expressed on CD4- NKT cells, whereas most CD4+ NKT cells lack this receptor. Interestingly, NKG2D+ NKT cells frequently expressed perforin, and both NKG2D and perforin localized at the site of contact with NKG2D ligand-expressing target cells. CD4- NKT cells degranulated in response to NKG2D engagement in a redirected activation assay independent of stimulation via their invariant TCR. NKT cells killed P815 cells coated with anti-NKG2D mAb and CD1d-negative K562 tumor target cells in an NKG2D-dependent manner. Furthermore, NKG2D engagement co-stimulated TCR-mediated NKT-cell activation in response to endogenous CD1d-presented ligands or suboptimal levels of anti-CD3 triggering. These data indicate that the CD4- subset of human NKT cells can mediate direct lysis of target cells via NKG2D engagement independent of CD1d, and that NKG2D also functions as a co-stimulatory receptor in these cells. NKG2D thus plays both a direct and a co-stimulatory role in the activation of NKT cells. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Boundary element analysis of the directional sensitivity of the concentric EMG electrode

    DEFF Research Database (Denmark)

    Henneberg, Kaj-åge; R., Plonsey

    1993-01-01

    on the intrinsic features linked to the geometry of the electrode. The results show that the cannula perturbs the potential distribution significantly. The core and the cannula electrodes measure potentials of the same order of magnitude in all of the pick-up range, except adjacent to the central wire, where...... as the mutual electrical influence between the electrode surfaces. A three-dimensional sensitivity function is defined from which information about the preferential direction of sensitivity, blind spots, phase changes, rate of attenuation, and range of pick-up radius can be derived. The study focuses...... the latter dominates the sensitivity function. The preferential directions of sensitivity are determined by.the amount of geometric offset between the individual sensitivity functions of the core and the cannula. The sensitivity function also reveals a complicated pattern of phase changes in the pick...

  5. A map of directional genetic interactions in a metazoan cell.

    Science.gov (United States)

    Fischer, Bernd; Sandmann, Thomas; Horn, Thomas; Billmann, Maximilian; Chaudhary, Varun; Huber, Wolfgang; Boutros, Michael

    2015-03-06

    Gene-gene interactions shape complex phenotypes and modify the effects of mutations during development and disease. The effects of statistical gene-gene interactions on phenotypes have been used to assign genes to functional modules. However, directional, epistatic interactions, which reflect regulatory relationships between genes, have been challenging to map at large-scale. Here, we used combinatorial RNA interference and automated single-cell phenotyping to generate a large genetic interaction map for 21 phenotypic features of Drosophila cells. We devised a method that combines genetic interactions on multiple phenotypes to reveal directional relationships. This network reconstructed the sequence of protein activities in mitosis. Moreover, it revealed that the Ras pathway interacts with the SWI/SNF chromatin-remodelling complex, an interaction that we show is conserved in human cancer cells. Our study presents a powerful approach for reconstructing directional regulatory networks and provides a resource for the interpretation of functional consequences of genetic alterations.

  6. Transcription Factor Networks Directing the Development, Function, and Evolution of Innate Lymphoid Effectors

    Science.gov (United States)

    Kang, Joonsoo; Malhotra, Nidhi

    2015-01-01

    Mammalian lymphoid immunity is mediated by fast and slow responders to pathogens. Fast innate lymphocytes are active within hours after infections in mucosal tissues. Slow adaptive lymphocytes are conventional T and B cells with clonal antigen receptors that function days after pathogen exposure. A transcription factor (TF) regulatory network guiding early T cell development is at the core of effector function diversification in all innate lymphocytes, and the kinetics of immune responses is set by developmental programming. Operational units within the innate lymphoid system are not classified by the types of pathogen-sensing machineries but rather by discrete effector functions programmed by regulatory TF networks. Based on the evolutionary history of TFs of the regulatory networks, fast effectors likely arose earlier in the evolution of animals to fortify body barriers, and in mammals they often develop in fetal ontogeny prior to the establishment of fully competent adaptive immunity. PMID:25650177

  7. When Is a Program Like a Function?

    Science.gov (United States)

    Klotz, Frederic S.

    1986-01-01

    Functional programming, in which the connection to mathematics is simple and direct, is described. A language such as Logo illustrates the relationship between functional programming and mathematics in more detail. (MNS)

  8. Gut-directed hypnotherapy for functional abdominal pain or irritable bowel syndrome in children: a systematic review.

    Science.gov (United States)

    Rutten, Juliette M T M; Reitsma, Johannes B; Vlieger, Arine M; Benninga, Marc A

    2013-04-01

    Gut directed hypnotherapy (HT) is shown to be effective in adult functional abdominal pain (FAP) and irritable bowel syndrome (IBS) patients. We performed a systematic review to assess efficacy of HT in paediatric FAP/IBS patients. We searched Medline, Embase, PsychINFO, Cumulative Index to Nursing and Allied Health Literature databases and Cochrane Central Register of Controlled Trials for randomised controlled trials (RCT) in children with FAP or IBS, investigating efficacy of HT on the following outcomes: abdominal pain scores, quality of life, costs and school absenteeism. Three RCT comparing HT to a control treatment were included with sample sizes ranging from 22 to 52 children. We refrained from statistical pooling because of low number of studies and many differences in design and outcomes. Two studies examined HT performed by a therapist, one examined HT through self-exercises on audio CD. All trials showed statistically significantly greater improvement in abdominal pain scores among children receiving HT. One trial reported beneficial effects sustained after 1 year of follow-up. One trial reported statistically significant improvement in quality of life in the HT group. Two trials reported significant reductions in school absenteeism after HT. Therapeutic effects of HT seem superior to standard medical care in children with FAP or IBS. It remains difficult to quantify exact benefits. The need for more high quality research is evident.

  9. Directed information measures in neuroscience

    CERN Document Server

    Vicente, Raul; Lizier, Joseph

    2014-01-01

    Analysis of information transfer has found rapid adoption in neuroscience, where a highly dynamic transfer of information continuously runs on top of the brain's slowly-changing anatomical connectivity. Measuring such transfer is crucial to understanding how flexible information routing and processing give rise to higher cognitive function. Directed Information Measures in Neuroscience reviews recent developments of concepts and tools for measuring information transfer, their application to neurophysiological recordings and analysis of interactions. Written by the most active researchers in the field the book discusses the state of the art, future prospects and challenges on the way to an efficient assessment of neuronal information transfer. Highlights include the theoretical quantification and practical estimation of information transfer, description of transfer locally in space and time, multivariate directed measures, information decomposition among a set of stimulus/responses variables, and the relation ...

  10. Experimental investigation of a directionally enhanced DHX concept for high temperature Direct Reactor Auxiliary Cooling Systems

    International Nuclear Information System (INIS)

    Hughes, Joel T.; Blandford, Edward D.

    2016-01-01

    Highlights: • A novel directional heat exchanger design has been developed. • Hydrodynamic tests have been performed on the proposed design. • Heat transfer performance is inferred by hydrodynamic results. • Results are discussed and future work is suggested. - Abstract: The use of Direct Reactor Auxiliary Cooling Systems (DRACSs) as a safety-related decay heat removal system for advanced reactors has developed historically through the Sodium Fast Reactor (SFR) community. Beginning with the EBR-II, DRACSs have been utilized in a large number of past and current SFR designs. More recently, the DRACS has been adopted for Fluoride Salt-Cooled High-Temperature Reactors (FHRs) for similar decay heat removal functions. In this paper we introduce a novel directionally enhanced DRACS Heat Exchanger (DHX) concept. We present design options for optimizing such a heat exchanger so that shell-side heat transfer is enhanced in one primary coolant flow direction and degraded in the opposite coolant flow direction. A reduced-scale experiment investigating the hydrodynamics of a directionally enhanced DHX was built and the data collected is presented. The concept of thermal diodicity is expanded to heat exchanger technologies and used as performance criteria for evaluating design options. A heat exchanger that can perform as such would be advantageous for use in advanced reactor concepts where primary coolant flow reversal is expected during Loss-of-Forced-Circulation (LOFC) accidents where the ability to circulate coolant is compromised. The design could also find potential use in certain advanced Sodium Fast Reactor (SFR) designs utilizing fluidic diode concepts.

  11. Experimental investigation of a directionally enhanced DHX concept for high temperature Direct Reactor Auxiliary Cooling Systems

    Energy Technology Data Exchange (ETDEWEB)

    Hughes, Joel T.; Blandford, Edward D., E-mail: edb@unm.edu

    2016-07-15

    Highlights: • A novel directional heat exchanger design has been developed. • Hydrodynamic tests have been performed on the proposed design. • Heat transfer performance is inferred by hydrodynamic results. • Results are discussed and future work is suggested. - Abstract: The use of Direct Reactor Auxiliary Cooling Systems (DRACSs) as a safety-related decay heat removal system for advanced reactors has developed historically through the Sodium Fast Reactor (SFR) community. Beginning with the EBR-II, DRACSs have been utilized in a large number of past and current SFR designs. More recently, the DRACS has been adopted for Fluoride Salt-Cooled High-Temperature Reactors (FHRs) for similar decay heat removal functions. In this paper we introduce a novel directionally enhanced DRACS Heat Exchanger (DHX) concept. We present design options for optimizing such a heat exchanger so that shell-side heat transfer is enhanced in one primary coolant flow direction and degraded in the opposite coolant flow direction. A reduced-scale experiment investigating the hydrodynamics of a directionally enhanced DHX was built and the data collected is presented. The concept of thermal diodicity is expanded to heat exchanger technologies and used as performance criteria for evaluating design options. A heat exchanger that can perform as such would be advantageous for use in advanced reactor concepts where primary coolant flow reversal is expected during Loss-of-Forced-Circulation (LOFC) accidents where the ability to circulate coolant is compromised. The design could also find potential use in certain advanced Sodium Fast Reactor (SFR) designs utilizing fluidic diode concepts.

  12. Functional Analysis and Treatment of Human-Directed Undesirable Behavior Exhibited by a Captive Chimpanzee

    Science.gov (United States)

    Martin, Allison L.; Bloomsmith, Mollie A.; Kelley, Michael E.; Marr, M. Jackson; Maple, Terry L.

    2011-01-01

    A functional analysis identified the reinforcer maintaining feces throwing and spitting exhibited by a captive adult chimpanzee ("Pan troglodytes"). The implementation of a function-based treatment combining extinction with differential reinforcement of an alternate behavior decreased levels of inappropriate behavior. These findings further…

  13. Breakdown of interdependent directed networks.

    Science.gov (United States)

    Liu, Xueming; Stanley, H Eugene; Gao, Jianxi

    2016-02-02

    Increasing evidence shows that real-world systems interact with one another via dependency connectivities. Failing connectivities are the mechanism behind the breakdown of interacting complex systems, e.g., blackouts caused by the interdependence of power grids and communication networks. Previous research analyzing the robustness of interdependent networks has been limited to undirected networks. However, most real-world networks are directed, their in-degrees and out-degrees may be correlated, and they are often coupled to one another as interdependent directed networks. To understand the breakdown and robustness of interdependent directed networks, we develop a theoretical framework based on generating functions and percolation theory. We find that for interdependent Erdős-Rényi networks the directionality within each network increases their vulnerability and exhibits hybrid phase transitions. We also find that the percolation behavior of interdependent directed scale-free networks with and without degree correlations is so complex that two criteria are needed to quantify and compare their robustness: the percolation threshold and the integrated size of the giant component during an entire attack process. Interestingly, we find that the in-degree and out-degree correlations in each network layer increase the robustness of interdependent degree heterogeneous networks that most real networks are, but decrease the robustness of interdependent networks with homogeneous degree distribution and with strong coupling strengths. Moreover, by applying our theoretical analysis to real interdependent international trade networks, we find that the robustness of these real-world systems increases with the in-degree and out-degree correlations, confirming our theoretical analysis.

  14. State of the Art in Transfer Functions for Direct Volume Rendering

    KAUST Repository

    Ljung, Patric; Krü ger, Jens; Groller, Eduard; Hadwiger, Markus; Hansen, Charles D.; Ynnerman, Anders

    2016-01-01

    A central topic in scientific visualization is the transfer function (TF) for volume rendering. The TF serves a fundamental role in translating scalar and multivariate data into color and opacity to express and reveal the relevant features present in the data studied. Beyond this core functionality, TFs also serve as a tool for encoding and utilizing domain knowledge and as an expression for visual design of material appearances. TFs also enable interactive volumetric exploration of complex data. The purpose of this state-of-the-art report (STAR) is to provide an overview of research into the various aspects of TFs, which lead to interpretation of the underlying data through the use of meaningful visual representations. The STAR classifies TF research into the following aspects: dimensionality, derived attributes, aggregated attributes, rendering aspects, automation, and user interfaces. The STAR concludes with some interesting research challenges that form the basis of an agenda for the development of next generation TF tools and methodologies. © 2016 The Author(s) Computer Graphics Forum © 2016 The Eurographics Association and John Wiley & Sons Ltd. Published by John Wiley & Sons Ltd.

  15. State of the Art in Transfer Functions for Direct Volume Rendering

    KAUST Repository

    Ljung, Patric

    2016-07-04

    A central topic in scientific visualization is the transfer function (TF) for volume rendering. The TF serves a fundamental role in translating scalar and multivariate data into color and opacity to express and reveal the relevant features present in the data studied. Beyond this core functionality, TFs also serve as a tool for encoding and utilizing domain knowledge and as an expression for visual design of material appearances. TFs also enable interactive volumetric exploration of complex data. The purpose of this state-of-the-art report (STAR) is to provide an overview of research into the various aspects of TFs, which lead to interpretation of the underlying data through the use of meaningful visual representations. The STAR classifies TF research into the following aspects: dimensionality, derived attributes, aggregated attributes, rendering aspects, automation, and user interfaces. The STAR concludes with some interesting research challenges that form the basis of an agenda for the development of next generation TF tools and methodologies. © 2016 The Author(s) Computer Graphics Forum © 2016 The Eurographics Association and John Wiley & Sons Ltd. Published by John Wiley & Sons Ltd.

  16. Boosters and barriers for direct cardiac reprogramming.

    Science.gov (United States)

    Talkhabi, Mahmood; Zonooz, Elmira Rezaei; Baharvand, Hossein

    2017-06-01

    Heart disease is currently the most significant cause of morbidity and mortality worldwide, which accounts for approximately 33% of all deaths. Recently, a promising and alchemy-like strategy has been developed called direct cardiac reprogramming, which directly converts somatic cells such as fibroblasts to cardiac lineage cells such as cardiomyocytes (CMs), termed induced CMs or iCMs. The first in vitro cardiac reprogramming study, mediated by cardiac transcription factors (TFs)-Gata4, Tbx5 and Mef2C-, was not enough efficient to produce an adequate number of fully reprogrammed, functional iCMs. As a result, numerous combinations of cardiac TFs exist for direct cardiac reprogramming of mouse and human fibroblasts. However, the efficiency of direct cardiac reprogramming remains low. Recently, a number of cellular and molecular mechanisms have been identified to increase the efficiency of direct cardiac reprogramming and the quality of iCMs. For example, microgrooved substrate, cardiogenic growth factors [VEGF, FGF, BMP4 and Activin A], and an appropriate stoichiometry of TFs boost the direct cardiac reprogramming. On the other hand, serum, TGFβ signaling, activators of epithelial to mesenchymal transition, and some epigenetic factors (Bmi1 and Ezh2) are barriers for direct cardiac reprogramming. Manipulating these mechanisms by the application of boosters and removing barriers can increase the efficiency of direct cardiac reprogramming and possibly make iCMs reliable for cell-based therapy or other potential applications. In this review, we summarize the latest trends in cardiac TF- or miRNA-based direct cardiac reprogramming and comprehensively discuses all molecular and cellular boosters and barriers affecting direct cardiac reprogramming. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Directed Evolution of Membrane Transport Using Synthetic Selections

    DEFF Research Database (Denmark)

    Bali, Anne Pihl; Genee, Hans J.; Sommer, Morten O. A.

    2018-01-01

    systems that enable selective growth of E. coli cells only if they functionally express an importer that is specific to the biosensor ligand. Using this system in a directed evolution framework, we successfully engineer the specificity of nicotinamide riboside transporters, PnuC, to accept thiamine...

  18. Connotation and category of functional-molecular imaging

    International Nuclear Information System (INIS)

    Li Tianran; Tian Jiahe

    2007-01-01

    Function and molecular lmaging represent medical imaging' s direction. The review article introduce function and molecular's concept and category and its characteristic. Comparing with traditionary classics radiology, function and molecular imaging have many features, such as micro-mount and specificity and quantitative. There are many technology about function and molecular imaging. Function and molecular imaging is important ingredient of modern medical and play a considerable role. (authors)

  19. Sophisticating a naive Liapunov function

    International Nuclear Information System (INIS)

    Smith, D.; Lewins, J.D.

    1985-01-01

    The art of the direct method of Liapunov to determine system stability is to construct a suitable Liapunov or V function where V is to be positive definite (PD), to shrink to a center, which may be conveniently chosen as the origin, and where V is the negative definite (ND). One aid to the art is to solve an approximation to the system equations in order to provide a candidate V function. It can happen, however, that the V function is not strictly ND but vanishes at a finite number of isolated points. Naively, one anticipates that stability has been demonstrated since the trajectory of the system at such points is only momentarily tangential and immediately enters a region of inward directed trajectories. To demonstrate stability rigorously requires the construction of a sophisticated Liapunov function from what can be called the naive original choice. In this paper, the authors demonstrate the method of perturbing the naive function in the context of the well-known second-order oscillator and then apply the method to a more complicated problem based on a prompt jump model for a nuclear fission reactor

  20. Statistical mechanics of directed models of polymers in the square lattice

    CERN Document Server

    Rensburg, J V

    2003-01-01

    Directed square lattice models of polymers and vesicles have received considerable attention in the recent mathematical and physical sciences literature. These are idealized geometric directed lattice models introduced to study phase behaviour in polymers, and include Dyck paths, partially directed paths, directed trees and directed vesicles models. Directed models are closely related to models studied in the combinatorics literature (and are often exactly solvable). They are also simplified versions of a number of statistical mechanics models, including the self-avoiding walk, lattice animals and lattice vesicles. The exchange of approaches and ideas between statistical mechanics and combinatorics have considerably advanced the description and understanding of directed lattice models, and this will be explored in this review. The combinatorial nature of directed lattice path models makes a study using generating function approaches most natural. In contrast, the statistical mechanics approach would introduce...

  1. LXA4 actions direct fibroblast function and wound closure

    International Nuclear Information System (INIS)

    Herrera, Bruno S.; Kantarci, Alpdogan; Zarrough, Ahmed; Hasturk, Hatice; Leung, Kai P.; Van Dyke, Thomas E.

    2015-01-01

    Timely resolution of inflammation is crucial for normal wound healing. Resolution of inflammation is an active biological process regulated by specialized lipid mediators including the lipoxins and resolvins. Failure of resolution activity has a major negative impact on wound healing in chronic inflammatory diseases that is manifest as excess fibrosis and scarring. Lipoxins, including Lipoxin A 4 (LXA 4 ), have known anti-fibrotic and anti-scarring properties. The goal of this study was to elucidate the impact of LXA 4 on fibroblast function. Mouse fibroblasts (3T3 Mus musculus Swiss) were cultured for 72 h in the presence of TGF-β1, to induce fibroblast activation. The impact of exogenous TGF-β1 (1 ng/mL) on LXA 4 receptor expression (ALX/FPR2) was determined by flow cytometry. Fibroblast proliferation was measured by bromodeoxyuridine (BrdU) labeling and migration in a “scratch” assay wound model. Expression of α-smooth muscle actin (α-SMA), and collagen types I and III were measured by Western blot. We observed that TGF-β1 up-regulates LXA 4 receptor expression, enhances fibroblast proliferation, migration and scratch wound closure. α-SMA levels and Collagen type I and III deposition were also enhanced. LXA 4 slowed fibroblast migration and scratch wound closure at early time points (24 h), but wound closure was equal to TGF-β1 alone at 48 and 72 h. LXA 4 tended to slow fibroblast proliferation at both concentrations, but had no impact on α-SMA or collagen production by TGF-β1 stimulated fibroblasts. The generalizability of the actions of resolution molecules was examined in experiments repeated with resolvin D2 (RvD2) as the agonist. The activity of RvD2 mimicked the actions of LXA 4 in all assays, through an as yet unidentified receptor. The results suggest that mediators of resolution of inflammation enhance wound healing and limit fibrosis in part by modulating fibroblast function. - Highlights: • TGF-β1 up-regulates LXA 4 receptor (ALX

  2. AmbiGaze : direct control of ambient devices by gaze

    OpenAIRE

    Velloso, Eduardo; Wirth, Markus; Weichel, Christian; Abreu Esteves, Augusto Emanuel; Gellersen, Hans-Werner Georg

    2016-01-01

    Eye tracking offers many opportunities for direct device control in smart environments, but issues such as the need for calibration and the Midas touch problem make it impractical. In this paper, we propose AmbiGaze, a smart environment that employs the animation of targets to provide users with direct control of devices by gaze only through smooth pursuit tracking. We propose a design space of means of exposing functionality through movement and illustrate the concept through four prototypes...

  3. Multiple scattering processes: inverse and direct

    International Nuclear Information System (INIS)

    Kagiwada, H.H.; Kalaba, R.; Ueno, S.

    1975-01-01

    The purpose of the work is to formulate inverse problems in radiative transfer, to introduce the functions b and h as parameters of internal intensity in homogeneous slabs, and to derive initial value problems to replace the more traditional boundary value problems and integral equations of multiple scattering with high computational efficiency. The discussion covers multiple scattering processes in a one-dimensional medium; isotropic scattering in homogeneous slabs illuminated by parallel rays of radiation; the theory of functions b and h in homogeneous slabs illuminated by isotropic sources of radiation either at the top or at the bottom; inverse and direct problems of multiple scattering in slabs including internal sources; multiple scattering in inhomogeneous media, with particular reference to inverse problems for estimation of layers and total thickness of inhomogeneous slabs and to multiple scattering problems with Lambert's law and specular reflectors underlying slabs; and anisotropic scattering with reduction of the number of relevant arguments through axially symmetric fields and expansion in Legendre functions. Gaussian quadrature data for a seven point formula, a FORTRAN program for computing the functions b and h, and tables of these functions supplement the text

  4. Direct His bundle pacing post AVN ablation.

    Science.gov (United States)

    Lakshmanadoss, Umashankar; Aggarwal, Ashim; Huang, David T; Daubert, James P; Shah, Abrar

    2009-08-01

    Atrioventricular nodal (AVN) ablation with concomitant pacemaker implantation is one of the strategies that reduce symptoms in patients with atrial fibrillation (AF). However, the long-term adverse effects of right ventricular (RV) apical pacing have led to the search for alternating sites of pacing. Biventricular pacing produces a significant improvement in functional capacity over RV pacing in patients undergoing AVN ablation. Another alternative site for pacing is direct His bundle to reduce the adverse outcome of RV pacing. Here, we present a case of direct His bundle pacing using steerable lead delivery system in a patient with symptomatic paroxysmal AF with concurrent AVN ablation.

  5. Transfer function combinations

    KAUST Repository

    Zhou, Liang; Schott, Mathias; Hansen, Charles

    2012-01-01

    Direct volume rendering has been an active area of research for over two decades. Transfer function design remains a difficult task since current methods, such as traditional 1D and 2D transfer functions, are not always effective for all data sets. Various 1D or 2D transfer function spaces have been proposed to improve classification exploiting different aspects, such as using the gradient magnitude for boundary location and statistical, occlusion, or size metrics. In this paper, we present a novel transfer function method which can provide more specificity for data classification by combining different transfer function spaces. In this work, a 2D transfer function can be combined with 1D transfer functions which improve the classification. Specifically, we use the traditional 2D scalar/gradient magnitude, 2D statistical, and 2D occlusion spectrum transfer functions and combine these with occlusion and/or size-based transfer functions to provide better specificity. We demonstrate the usefulness of the new method by comparing to the following previous techniques: 2D gradient magnitude, 2D occlusion spectrum, 2D statistical transfer functions and 2D size based transfer functions. © 2012 Elsevier Ltd.

  6. Transfer function combinations

    KAUST Repository

    Zhou, Liang

    2012-10-01

    Direct volume rendering has been an active area of research for over two decades. Transfer function design remains a difficult task since current methods, such as traditional 1D and 2D transfer functions, are not always effective for all data sets. Various 1D or 2D transfer function spaces have been proposed to improve classification exploiting different aspects, such as using the gradient magnitude for boundary location and statistical, occlusion, or size metrics. In this paper, we present a novel transfer function method which can provide more specificity for data classification by combining different transfer function spaces. In this work, a 2D transfer function can be combined with 1D transfer functions which improve the classification. Specifically, we use the traditional 2D scalar/gradient magnitude, 2D statistical, and 2D occlusion spectrum transfer functions and combine these with occlusion and/or size-based transfer functions to provide better specificity. We demonstrate the usefulness of the new method by comparing to the following previous techniques: 2D gradient magnitude, 2D occlusion spectrum, 2D statistical transfer functions and 2D size based transfer functions. © 2012 Elsevier Ltd.

  7. Prefronto–cerebellar transcranial direct current stimulation improves visuospatial memory, executive functions, and neurological soft signs in patients with euthymic bipolar disorder

    Directory of Open Access Journals (Sweden)

    Minichino A

    2015-08-01

    Full Text Available Amedeo Minichino, Francesco Saverio Bersani, Laura Bernabei, Francesco Spagnoli, Lucilla Vergnani, Alessandra Corrado, Ines Taddei, Massimo Biondi, Roberto Delle Chiaie Department of Neurology and Psychiatry, Sapienza University of Rome, Rome, Italy Objective: The aim of the study was to improve neuropsychological functioning of euthymic patients with bipolar disorder (BD using transcranial direct current stimulation (tDCS applied to cerebellar and prefrontal cortices.Methods: Twenty-five BD outpatients underwent prefrontal (anodal and cerebellar (cathodal tDCS for 3 consecutive weeks. All participants were assessed through the Rey Complex Figure Test delay and copy and the Neurological Examination Scale at baseline and after therapy with tDCS.Results: After tDCS treatment, patients showed significant improvements in visuospatial memory tasks. Patients with worse baseline cognitive performances also showed a significant improvement in executive functioning tasks. Neurological Examination Scale total score and motor coordination subscale significantly improved.Conclusion: Prefrontal-excitatory and cerebellar-inhibitory stimulations in euthymic BD patients may lead to better neurocognitive performances. This improvement could result from the modulation of prefronto–thalamic–cerebellar circuit activity pattern, which can be disrupted in BD. Keywords: cerebellum, dorsolateral prefrontal cortex, neuropsychology, cognition 

  8. Drawbacks of the use of indirect estimates of renal function to evaluate the effect of risk factors on renal function

    NARCIS (Netherlands)

    Verhave, JC; Gansevoort, RT; Hillege, HL; De Zeeuw, D; Curhan, GC; De Jong, PE

    Many epidemiologic studies presently aim to evaluate the effect of risk factors on renal function. As direct measurement of renal function is cumbersome to perform, epidentiologic studies generally use an indirect estimate of renal function. The consequences of using different methods of renal

  9. Distribution functions of sections and projections of convex bodies

    OpenAIRE

    Kim, Jaegil; Yaskin, Vladyslav; Zvavitch, Artem

    2015-01-01

    Typically, when we are given the section (or projection) function of a convex body, it means that in each direction we know the size of the central section (or projection) perpendicular to this direction. Suppose now that we can only get the information about the sizes of sections (or projections), and not about the corresponding directions. In this paper we study to what extent the distribution function of the areas of central sections (or projections) of a convex body can be used to derive ...

  10. The direct manipulation shell

    International Nuclear Information System (INIS)

    Allen, M.E.; Christiansen, M.

    1992-01-01

    Accelerator controls systems provide parameter display pages which allow the operator to monitor and manipulate selected control points in the system. Display pages are generally implemented as either hand-crafted, purpose-built programs; or by using a specialized display page layout tool. These two methods of display page development exhibit the classic trade-off between functionality vs. ease of implementation. In the Direct Manipulation Shell we approach the process of developing a display page in a manifestly object-oriented manner. This is done by providing a general framework for interactively instantiating and manipulating display objects. (author)

  11. Nuclear correlations and structure functions

    International Nuclear Information System (INIS)

    Hu Guoju; Irvine, J.M.

    1989-01-01

    It is argued that the search for a mass number dependence of the nuclear structure function per nucleon is profitably directed to the region of Bjorken scaling variable x > 1. We show that in the convolution model of the nuclear structure function the nuclear momentum distribution and energy spectrum generated by cluster expansion techniques, here realised in the correlated basis function method, invoking tensor correlations and short-range density-dependent repulsions adequately describes the structure function for 12 C in the region x > 1. The results of structure functions for a number of light-, medium- and heavy-mass nuclei are presented. (author)

  12. Decentralized adaptive control of interconnected nonlinear systems with unknown control directions.

    Science.gov (United States)

    Huang, Jiangshuai; Wang, Qing-Guo

    2018-03-01

    In this paper, we propose a decentralized adaptive control scheme for a class of interconnected strict-feedback nonlinear systems without a priori knowledge of subsystems' control directions. To address this problem, a novel Nussbaum-type function is proposed and a key theorem is drawn which involves quantifying the interconnections of multiple Nussbaum-type functions of the subsystems with different control directions in a single inequality. Global stability of the closed-loop system and asymptotic stabilization of subsystems' output are proved and a simulation example is given to illustrate the effectiveness of the proposed control scheme. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  13. Patterns of postural deformity in non-ambulant people with cerebral palsy: what is the relationship between the direction of scoliosis, direction of pelvic obliquity, direction of windswept hip deformity and side of hip dislocation?

    Science.gov (United States)

    Porter, David; Michael, Shona; Kirkwood, Craig

    2007-12-01

    To investigate: (a) associations between the direction of scoliosis, direction of pelvic obliquity, direction of windswept deformity and side of hip subluxation/ dislocation in non-ambulant people with cerebral palsy; and (b) the lateral distribution of these postural asymmetries. Cross-sectional observational study. Posture management services in three centres in the UK. Non-ambulant people at level five on the gross motor function classification system for cerebral palsy. Direction of pelvic obliquity and lateral spinal curvature determined from physical examination, direction of windswept hip deformity derived from range of hip abduction/adduction, and presence/side of unilateral hip subluxation defined by hip migration percentage. A total of 747 participants were included in the study, aged 6-80 years (median 18 years 10 months). Associations between the direction of scoliosis and direction of pelvic obliquity, and between the direction of windswept hip deformity and side hip subluxation/dislocation were confirmed. A significant association was also seen between the direction of scoliosis and the direction of the windswept hip deformity (P<0.001) such that the convexity of the lateral spinal curve was more likely to be opposite to the direction of windsweeping. Furthermore, significantly more windswept deformities to the right (P=0.007), hips subluxed on the left (P=0.002) and lateral lumbar/lower thoracic spinal curves convex to the left (P=0.03) were observed. The individual asymmetrical postural deformities are not unrelated in terms of direction and not equally distributed to the left/right. A pattern of postural deformity was observed.

  14. Role of intracranial cavities in avian directional hearing

    DEFF Research Database (Denmark)

    Larsen, Ole Næsbye; Christensen-Dalsgaard, Jakob; Jensen, Kenneth Kragh

    2016-01-01

    Whereas it is clear from anatomical studies that all birds have complex interaural canals connecting their middle ears, the effect of interaural coupling on directional hearing has been disputed. A reason for conflicting results in earlier studies may have been that the function of the tympanic e...

  15. 48 CFR 702.170-17 - Automated Directives System.

    Science.gov (United States)

    2010-10-01

    .... “Automated Directives System” (“ADS”) sets forth the Agency's policies and essential procedures, as well as supplementary informational references. It contains six functional series, interim policy updates, valid USAID handbook chapters, a resource library, and a glossary. References to “ADS” throughout this chapter 7 are...

  16. Human projected area factors for detailed direct and diffuse solar radiation analysis

    DEFF Research Database (Denmark)

    Kubaha, K.; Fiala, D.; Toftum, Jørn

    2004-01-01

    Projected area factors for individual segments of the standing and sedentary human body were modelled for both direct and diffuse solar radiation using detailed 3D geometry and radiation models. The local projected area factors with respect to direct short-wave radiation are a function of the solar...

  17. Direct methods of solution for problems in mechanics from invariance principles

    International Nuclear Information System (INIS)

    Rajan, M.

    1986-01-01

    Direct solutions to problems in mechanics are developed from variational statements derived from the principle of invariance of the action integral under a one-parameter family of infinitesimal transformations. Exact, direct solution procedures for linear systems are developed by a careful choice of the arbitrary functions used to generate the infinitesimal transformations. It is demonstrated that the well-known methods for the solution of differential equations can be directly adapted to the required variational statements. Examples in particle and continuum mechanics are presented

  18. Directional dominance on stature and cognition in diverse human populations

    DEFF Research Database (Denmark)

    Joshi, Peter K; Esko, Tonu; Mattsson, Hannele

    2015-01-01

    is predicted for traits under directional evolutionary selection, this study provides evidence that increased stature and cognitive function have been positively selected in human evolution, whereas many important risk factors for late-onset complex diseases may not have been....... confounding, directly contributes to phenotypic variance. Contrary to earlier reports in substantially smaller samples, no evidence was seen of an influence of genome-wide homozygosity on blood pressure and low density lipoprotein cholesterol, or ten other cardio-metabolic traits. Since directional dominance...

  19. Information processing architecture of functionally defined clusters in the macaque cortex.

    Science.gov (United States)

    Shen, Kelly; Bezgin, Gleb; Hutchison, R Matthew; Gati, Joseph S; Menon, Ravi S; Everling, Stefan; McIntosh, Anthony R

    2012-11-28

    Computational and empirical neuroimaging studies have suggested that the anatomical connections between brain regions primarily constrain their functional interactions. Given that the large-scale organization of functional networks is determined by the temporal relationships between brain regions, the structural limitations may extend to the global characteristics of functional networks. Here, we explored the extent to which the functional network community structure is determined by the underlying anatomical architecture. We directly compared macaque (Macaca fascicularis) functional connectivity (FC) assessed using spontaneous blood oxygen level-dependent functional magnetic resonance imaging (BOLD-fMRI) to directed anatomical connectivity derived from macaque axonal tract tracing studies. Consistent with previous reports, FC increased with increasing strength of anatomical connection, and FC was also present between regions that had no direct anatomical connection. We observed moderate similarity between the FC of each region and its anatomical connectivity. Notably, anatomical connectivity patterns, as described by structural motifs, were different within and across functional modules: partitioning of the functional network was supported by dense bidirectional anatomical connections within clusters and unidirectional connections between clusters. Together, our data directly demonstrate that the FC patterns observed in resting-state BOLD-fMRI are dictated by the underlying neuroanatomical architecture. Importantly, we show how this architecture contributes to the global organizational principles of both functional specialization and integration.

  20. Direct Desktop Printed-Circuits-on-Paper Flexible Electronics

    Science.gov (United States)

    Zheng, Yi; He, Zhizhu; Gao, Yunxia; Liu, Jing

    2013-01-01

    There currently lacks of a way to directly write out electronics, just like printing pictures on paper by an office printer. Here we show a desktop printing of flexible circuits on paper via developing liquid metal ink and related working mechanisms. Through modifying adhesion of the ink, overcoming its high surface tension by dispensing machine and designing a brush like porous pinhead for printing alloy and identifying matched substrate materials among different papers, the slightly oxidized alloy ink was demonstrated to be flexibly printed on coated paper, which could compose various functional electronics and the concept of Printed-Circuits-on-Paper was thus presented. Further, RTV silicone rubber was adopted as isolating inks and packaging material to guarantee the functional stability of the circuit, which suggests an approach for printing 3D hybrid electro-mechanical device. The present work paved the way for a low cost and easygoing method in directly printing paper electronics.

  1. Use of direct marketing in nonprofit organizations

    Directory of Open Access Journals (Sweden)

    Popović Ana

    2010-01-01

    Full Text Available Non profit organizations represent very heterogenus group of organizations which can be determined by the fact that they are being used as forums for creation and distribution of new ideas. Their aim is to raise public awareness on the purpose they promote and get the reply for their initiatives for gaining support in form of monetary sources for charities, vote for political candidate or achieving a communicational goal. Non governmental organizations, as the dominant form of non profit organizations, are being founded with mission to raise public awareness on some issue or provide help to certain marginalized group. The direct marketing instruments and techniques are considered to be very useful for achieving mission formulated that way. They are, by their nature, precisely targeted and objective-oriented and require direct reply. Apart from that, direct marketing activities are cost-efficient, costs that they generate can be shown in financial reports, and results of undertaken initiatives are directly measurable. All the mentioned lead to conclusion that direct marketing is, for additional reasons, even more appropriate for NPOs having in mind that they usually have limited available resources. In the relevant literature two main roles of direct marketing in non profit organizations are mentioned - managing relations with representatives of stakeholder groups and fundraising. In this paper, therefore, after the facts referring functioning of NPOs, direct marketing strategies used for mentioned purposes will be presented consequently.

  2. Dark matter direct detection with non-Maxwellian velocity structure

    International Nuclear Information System (INIS)

    Kuhlen, Michael; Weiner, Neal; Diemand, Jürg; Moore, Ben; Potter, Doug; Stadel, Joachim; Madau, Piero; Zemp, Marcel

    2010-01-01

    The velocity distribution function of dark matter particles is expected to show significant departures from a Maxwell-Boltzmann distribution. This can have profound effects on the predicted dark matter - nucleon scattering rates in direct detection experiments, especially for dark matter models in which the scattering is sensitive to the high velocity tail of the distribution, such as inelastic dark matter (iDM) or light (few GeV) dark matter (LDM), and for experiments that require high energy recoil events, such as many directionally sensitive experiments. Here we determine the velocity distribution functions from two of the highest resolution numerical simulations of Galactic dark matter structure (Via Lactea II and GHALO), and study the effects for these scenarios. For directional detection, we find that the observed departures from Maxwell-Boltzmann increase the contrast of the signal and change the typical direction of incoming DM particles. For iDM, the expected signals at direct detection experiments are changed dramatically: the annual modulation can be enhanced by more than a factor two, and the relative rates of DAMA compared to CDMS can change by an order of magnitude, while those compared to CRESST can change by a factor of two. The spectrum of the signal can also change dramatically, with many features arising due to substructure. For LDM the spectral effects are smaller, but changes do arise that improve the compatibility with existing experiments. We find that the phase of the modulation can depend upon energy, which would help discriminate against background should it be found

  3. Random matrix theory for analyzing the brain functional network in attention deficit hyperactivity disorder

    Science.gov (United States)

    Wang, Rong; Wang, Li; Yang, Yong; Li, Jiajia; Wu, Ying; Lin, Pan

    2016-11-01

    Attention deficit hyperactivity disorder (ADHD) is the most common childhood neuropsychiatric disorder and affects approximately 6 -7 % of children worldwide. Here, we investigate the statistical properties of undirected and directed brain functional networks in ADHD patients based on random matrix theory (RMT), in which the undirected functional connectivity is constructed based on correlation coefficient and the directed functional connectivity is measured based on cross-correlation coefficient and mutual information. We first analyze the functional connectivity and the eigenvalues of the brain functional network. We find that ADHD patients have increased undirected functional connectivity, reflecting a higher degree of linear dependence between regions, and increased directed functional connectivity, indicating stronger causality and more transmission of information among brain regions. More importantly, we explore the randomness of the undirected and directed functional networks using RMT. We find that for ADHD patients, the undirected functional network is more orderly than that for normal subjects, which indicates an abnormal increase in undirected functional connectivity. In addition, we find that the directed functional networks are more random, which reveals greater disorder in causality and more chaotic information flow among brain regions in ADHD patients. Our results not only further confirm the efficacy of RMT in characterizing the intrinsic properties of brain functional networks but also provide insights into the possibilities RMT offers for improving clinical diagnoses and treatment evaluations for ADHD patients.

  4. Optimizing Generic Functions

    NARCIS (Netherlands)

    Alimarine, A.; Smetsers, J.E.W.

    2004-01-01

    Generic functions are defined by induction on the structural representation of types. As a consequence, by defining just a single generic operation, one acquires this operation over any particular type. An instance on a specific type is generated by interpretation of the type's structure. A direct

  5. Direct or indirect - that is the question!

    DEFF Research Database (Denmark)

    Pallesen, Ulla

    2016-01-01

    Time has passed since the prevention of caries was performed by extending cavity preparations wide in the tooth and below the gingiva. In the same period adhesive techniques have improved and nowadays made it possible to extend the indications for direct composite resin restorations, also when...... rather destroyed teeth need to be restored. Although much can be solved by direct fillings and thereby make treatments less invasive for the tooth and less expensive for the patient, there still will be teeth, where the prognosis is improved, if an indirect restoration in terms of an inlay, onlay...... or crown is made. Factors as remaining tooth structure, endodontic treatment, number of teeth, caries risk, para-functional habits, material properties, economy etc. will all have an influence, when the dentist guides the patient to choose the best solution. What is best for the tooth – direct or indirect...

  6. Direct Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Austern, N. [University of Pittsburgh, Pittsburgh, PA (United States)

    1963-01-15

    In order to give a unified presentation of one point of view, these lectures are devoted only to a detailed development of the standard theories of direct reactions, starting from basic principles. Discussion is given of the present status of the theories, of the techniques used for practical calculation, and of possible future developments. The direct interaction (DI) aspects of a reaction are those which involve only a few of the many degrees of freedom of a nucleus. In fact the minimum number of degrees of freedom which must be involved in a reaction are those required to describe the initial and final channels, and DI studies typically consider these degrees of freedom and no others. Because of this simplicity DI theories may be worked out in painstaking detail. DI processes concern only part of the wave function for a problem. The other part involves complicated excitations of many degrees of freedom, and gives the compound nucleus (CN) effects. While it is extremely interesting to learn how to separate DI and CN effects in an orderly manner, if they are both present in a reaction, no suitable method has yet been found. Instead, current work stresses the kinds of reactions and the kinds of final states in which DI effects dominate and in which CN effects may almost be forgotten. The DI cross-sections which are studied are often extremely large, comparable to elastic scattering cross-sections. (author)

  7. Digital circuit in CλaSH: functional specifications and type-directed synthesis

    NARCIS (Netherlands)

    Baaij, C.P.R.

    2015-01-01

    Over the last three decades, the number of transistors used in microchips has increased by three orders of magnitude, from millions to billions. The productivity of the designers, however, lags behind. Managing to implement complex algorithms, while keeping non-functional properties within desired

  8. Functional integration processes underlying the instruction-based learning of novel goal-directed behaviors.

    Science.gov (United States)

    Ruge, Hannes; Wolfensteller, Uta

    2013-03-01

    How does the human brain translate symbolic instructions into overt behavior? Previous studies suggested that this process relies on a rapid control transition from the lateral prefrontal cortex (LPFC) to the anterior striatum (aSTR) and premotor cortex (PMC). The present fMRI study investigated whether the transfer from symbolic to pragmatic stimulus-response (S-R) rules relies on changes in the functional coupling among these and other areas and to which extent action goal representations might get integrated within this symbolic-pragmatic transfer. Goal integration processes were examined by manipulating the contingency between actions and differential outcomes (i.e. action goals). We observed a rapid strengthening of the functional coupling between the LPFC and the basal ganglia (aSTR and putamen) and orbitofrontal cortex (OFC) as well as between the LPFC and the anterior dorsal PMC (pre-PMd), the anterior inferior parietal lobule (aIPL), and the posterior superior parietal lobule (pSPL). Importantly, only some of these functional integration processes were sensitive to the outcome contingency manipulation, including LPFC couplings with aSTR, OFC, aIPL, and pre-PMd. This suggests that the symbolic-pragmatic rule transfer is governed by principles of both, instrumental learning (increasingly tighter coupling between LPFC and aSTR/OFC) and ideomotor learning (increasingly tighter coupling between LPFC and aIPL/pre-PMd). By contrast, increased functional coupling between LPFC and putamen was insensitive to outcome contingency possibly indicating an early stage of habit formation under instructed learning conditions. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Directed polymers versus directed percolation

    Science.gov (United States)

    Halpin-Healy, Timothy

    1998-10-01

    Universality plays a central role within the rubric of modern statistical mechanics, wherein an insightful continuum formulation rises above irrelevant microscopic details, capturing essential scaling behaviors. Nevertheless, occasions do arise where the lattice or another discrete aspect can constitute a formidable legacy. Directed polymers in random media, along with its close sibling, directed percolation, provide an intriguing case in point. Indeed, the deep blood relation between these two models may have sabotaged past efforts to fully characterize the Kardar-Parisi-Zhang universality class, to which the directed polymer belongs.

  10. Adrenergic Blockade Bi-directionally and Asymmetrically Alters Functional Brain-Heart Communication and Prolongs Electrical Activities of the Brain and Heart during Asphyxic Cardiac Arrest

    Science.gov (United States)

    Tian, Fangyun; Liu, Tiecheng; Xu, Gang; Li, Duan; Ghazi, Talha; Shick, Trevor; Sajjad, Azeem; Wang, Michael M.; Farrehi, Peter; Borjigin, Jimo

    2018-01-01

    Sudden cardiac arrest is a leading cause of death in the United States. The neurophysiological mechanism underlying sudden death is not well understood. Previously we have shown that the brain is highly stimulated in dying animals and that asphyxia-induced death could be delayed by blocking the intact brain-heart neuronal connection. These studies suggest that the autonomic nervous system plays an important role in mediating sudden cardiac arrest. In this study, we tested the effectiveness of phentolamine and atenolol, individually or combined, in prolonging functionality of the vital organs in CO2-mediated asphyxic cardiac arrest model. Rats received either saline, phentolamine, atenolol, or phentolamine plus atenolol, 30 min before the onset of asphyxia. Electrocardiogram (ECG) and electroencephalogram (EEG) signals were simultaneously collected from each rat during the entire process and investigated for cardiac and brain functions using a battery of analytic tools. We found that adrenergic blockade significantly suppressed the initial decline of cardiac output, prolonged electrical activities of both brain and heart, asymmetrically altered functional connectivity within the brain, and altered, bi-directionally and asymmetrically, functional, and effective connectivity between the brain and heart. The protective effects of adrenergic blockers paralleled the suppression of brain and heart connectivity, especially in the right hemisphere associated with central regulation of sympathetic function. Collectively, our results demonstrate that blockade of brain-heart connection via alpha- and beta-adrenergic blockers significantly prolonged the detectable activities of both the heart and the brain in asphyxic rat. The beneficial effects of combined alpha and beta blockers may help extend the survival of cardiac arrest patients. PMID:29487541

  11. Adrenergic Blockade Bi-directionally and Asymmetrically Alters Functional Brain-Heart Communication and Prolongs Electrical Activities of the Brain and Heart during Asphyxic Cardiac Arrest

    Directory of Open Access Journals (Sweden)

    Fangyun Tian

    2018-02-01

    Full Text Available Sudden cardiac arrest is a leading cause of death in the United States. The neurophysiological mechanism underlying sudden death is not well understood. Previously we have shown that the brain is highly stimulated in dying animals and that asphyxia-induced death could be delayed by blocking the intact brain-heart neuronal connection. These studies suggest that the autonomic nervous system plays an important role in mediating sudden cardiac arrest. In this study, we tested the effectiveness of phentolamine and atenolol, individually or combined, in prolonging functionality of the vital organs in CO2-mediated asphyxic cardiac arrest model. Rats received either saline, phentolamine, atenolol, or phentolamine plus atenolol, 30 min before the onset of asphyxia. Electrocardiogram (ECG and electroencephalogram (EEG signals were simultaneously collected from each rat during the entire process and investigated for cardiac and brain functions using a battery of analytic tools. We found that adrenergic blockade significantly suppressed the initial decline of cardiac output, prolonged electrical activities of both brain and heart, asymmetrically altered functional connectivity within the brain, and altered, bi-directionally and asymmetrically, functional, and effective connectivity between the brain and heart. The protective effects of adrenergic blockers paralleled the suppression of brain and heart connectivity, especially in the right hemisphere associated with central regulation of sympathetic function. Collectively, our results demonstrate that blockade of brain-heart connection via alpha- and beta-adrenergic blockers significantly prolonged the detectable activities of both the heart and the brain in asphyxic rat. The beneficial effects of combined alpha and beta blockers may help extend the survival of cardiac arrest patients.

  12. Dynamic selection of ship responses for estimation of on-site directional wave spectra

    DEFF Research Database (Denmark)

    Andersen, Ingrid Marie Vincent; Storhaug, Gaute

    2012-01-01

    -estimate of the wave spectrum is suggested. The selection method needs to be robust for what reason a parameterised uni-directional, two-parameter wave spectrum is treated. The parameters included are the zero up-crossing period, the significant wave height and the main wave direction relative to the ship’s heading...... with the best overall agreement are selected for the actual estimation of the directional wave spectrum. The transfer functions for the ship responses can be determined using different computational methods such as striptheory, 3D panel codes, closed form expressions or model tests. The uncertainty associated......Knowledge of the wave environment in which a ship is operating is crucial for most on-board decision support systems. Previous research has shown that the directional wave spectrum can be estimated by the use of measured global ship responses and a set of transfer functions determined...

  13. Subsystem density functional theory with meta-generalized gradient approximation exchange-correlation functionals.

    Science.gov (United States)

    Śmiga, Szymon; Fabiano, Eduardo; Laricchia, Savio; Constantin, Lucian A; Della Sala, Fabio

    2015-04-21

    We analyze the methodology and the performance of subsystem density functional theory (DFT) with meta-generalized gradient approximation (meta-GGA) exchange-correlation functionals for non-bonded molecular systems. Meta-GGA functionals depend on the Kohn-Sham kinetic energy density (KED), which is not known as an explicit functional of the density. Therefore, they cannot be directly applied in subsystem DFT calculations. We propose a Laplacian-level approximation to the KED which overcomes this limitation and provides a simple and accurate way to apply meta-GGA exchange-correlation functionals in subsystem DFT calculations. The so obtained density and energy errors, with respect to the corresponding supermolecular calculations, are comparable with conventional approaches, depending almost exclusively on the approximations in the non-additive kinetic embedding term. An embedding energy error decomposition explains the accuracy of our method.

  14. Interaction between asthma and lung function growth in early life

    DEFF Research Database (Denmark)

    Bisgaard, Hans; Jensen, Signe Marie; Bønnelykke, Klaus

    2012-01-01

    The causal direction between asthma and lung function deficit is unknown, but important for the focus of preventive measures and research into the origins of asthma.......The causal direction between asthma and lung function deficit is unknown, but important for the focus of preventive measures and research into the origins of asthma....

  15. Transport Coefficients from Large Deviation Functions

    OpenAIRE

    Gao, Chloe Ya; Limmer, David T.

    2017-01-01

    We describe a method for computing transport coefficients from the direct evaluation of large deviation functions. This method is general, relying on only equilibrium fluctuations, and is statistically efficient, employing trajectory based importance sampling. Equilibrium fluctuations of molecular currents are characterized by their large deviation functions, which are scaled cumulant generating functions analogous to the free energies. A diffusion Monte Carlo algorithm is used to evaluate th...

  16. Functionalization of magnetic nanoparticles with 3-aminopropyl silane

    International Nuclear Information System (INIS)

    Campelj, Stanislav; Makovec, Darko; Drofenik, Miha

    2009-01-01

    Superparamagnetic maghemite nanoparticles were functionalized with 3-aminopropyl triethoxy silane (APS). The influence of the different experimental parameters (temperature, pH, and reactant concentration) on the efficiency of the APS bonding directly to the maghemite nanoparticles or after their coating with a thin layer of silica was systematically studied. The functionalization was followed with measurements of the ζ-potential and direct measurements of the surface APS concentration on the nanoparticles. The surface concentration of the APS was much higher in the case when the APS was bonded to the silica-coated nanoparticles compared to bonding directly to the surfaces of the iron-oxide nanoparticles.

  17. Direct estimation of functionals of density operators by local operations and classical communication

    International Nuclear Information System (INIS)

    Alves, Carolina Moura; Horodecki, Pawel; Oi, Daniel K. L.; Kwek, L. C.; Ekert, Artur K.

    2003-01-01

    We present a method of direct estimation of important properties of a shared bipartite quantum state, within the ''distant laboratories'' paradigm, using only local operations and classical communication. We apply this procedure to spectrum estimation of shared states, and locally implementable structural physical approximations to incompletely positive maps. This procedure can also be applied to the estimation of channel capacity and measures of entanglement

  18. Directing-Group-mediated C-H-Alkynylations.

    Science.gov (United States)

    Caspers, Lucien D; Nachtsheim, Boris J

    2018-05-18

    C-C triple bonds are amongst the most versatile functional groups in synthetic chemistry. Complementary to the Sonogashira coupling the direct metal-catalyzed alkynylation of C-H bonds has emerged as a highly promising approach in recent years. To guarantee a high regioselectivity suitable directing groups (DGs) are necessary to guide the transition metal (TM) into the right place. In this Focus Review we present the current developments in DG-mediated C(sp 2 )-H and C(sp 3 )-H modifications with terminal alkynes under oxidative conditions and with electrophilic alkynylation reagents. We will discuss further modifications of the alkyne, in particular subsequent cyclizations to carbo- and heterocycles and modifications of the DG in the presence of the alkyne. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A stock market forecasting model combining two-directional two-dimensional principal component analysis and radial basis function neural network.

    Science.gov (United States)

    Guo, Zhiqiang; Wang, Huaiqing; Yang, Jie; Miller, David J

    2015-01-01

    In this paper, we propose and implement a hybrid model combining two-directional two-dimensional principal component analysis ((2D)2PCA) and a Radial Basis Function Neural Network (RBFNN) to forecast stock market behavior. First, 36 stock market technical variables are selected as the input features, and a sliding window is used to obtain the input data of the model. Next, (2D)2PCA is utilized to reduce the dimension of the data and extract its intrinsic features. Finally, an RBFNN accepts the data processed by (2D)2PCA to forecast the next day's stock price or movement. The proposed model is used on the Shanghai stock market index, and the experiments show that the model achieves a good level of fitness. The proposed model is then compared with one that uses the traditional dimension reduction method principal component analysis (PCA) and independent component analysis (ICA). The empirical results show that the proposed model outperforms the PCA-based model, as well as alternative models based on ICA and on the multilayer perceptron.

  20. Wearable functional Near Infrared Spectroscopy (fNIRS and transcranial Direct Current Stimulation (tDCS: Expanding Vistas for Neurocognitive Augmentation

    Directory of Open Access Journals (Sweden)

    Ryan eMcKendrick

    2015-03-01

    Full Text Available Contemporary studies with transcranial direct current stimulation (tDCS provide a growing base of evidence for enhancing cognition through the non-invasive delivery of weak electric currents to the brain. The main effect of tDCS is to modulate cortical excitability depending on the polarity of the applied current. However, the underlying mechanism of neuromodulation is not well understood. A new generation of functional near infrared spectroscopy (fNIRS systems is described that are miniaturized, portable, and include wearable sensors. These developments provide an opportunity to couple fNIRS with tDCS, consistent with a neuroergonomics approach for joint neuroimaging and neurostimulation investigations of cognition in complex tasks and in naturalistic conditions. The effects of tDCS on complex task performance and the use of fNIRS for monitoring cognitive workload during task performance are described. Also explained is how fNIRS + tDCS can be used simultaneously for assessing spatial working memory. Mobile optical brain imaging is a promising neuroimaging tool that has the potential to complement tDCS for realistic applications in natural settings.

  1. Directional bending wave propagation in periodically perforated plates

    DEFF Research Database (Denmark)

    Andreassen, Erik; Manktelow, Kevin; Ruzzene, Massimo

    2015-01-01

    We report on the investigation of wave propagation in a periodically perforated plate. A unit cell with double-C perforations is selected as a test article suitable to investigate two-dimensional dispersion characteristics, group velocities, and internal resonances. A numerical model, formulated...... using Mindlin plate elements, is developed to predict relevant wave characteristics such as dispersion, and group velocity variation as a function of frequency and direction of propagation. Experimental tests are conducted through a scanning laser vibrometer, which provides full wave field information...... for the design of phononic waveguides with directional and internal resonant characteristics....

  2. Highly effective and CO-tolerant PtRu electrocatalysts supported on poly(ethyleneimine) functionalized carbon nanotubes for direct methanol fuel cells

    International Nuclear Information System (INIS)

    Cheng, Yi; Jiang, San Ping

    2013-01-01

    A highly efficient and CO tolerant PtRu electrocatalysts supported on amino-rich, cationic poly(ethyleneimine) polyelectrolyte functionalized multi-walled carbon nanotubes (PtRu/PEI-MWCNTs) has been developed. The catalysts were characterized by thermogravimetric analysis, Raman spectroscopy, cyclic voltammograms, CO stripping, chronoamperometry, transmission electron microscopy (TEM) and X-ray diffraction (XRD). The PtRu particles with average size ∼2.5 nm are well dispersed on PEI-MWCNTs. The peak current for the methanol oxidation reaction on 40% PtRu/PEI-MWCNTs is 636mAmg Pt −1 , 5.7 times higher than 112mA mg Pt −1 measured on the 40% PtRu supported on acid treated MWCNTs (PtRu/AO-MWCNTs) under identical conditions. PtRu/PEI-MWCNTs catalysts exhibit a superior electrocatalytic activity and stability for the methanol oxidation reaction due to its high tolerance toward CO poisoning as compared with PtRu/AO-MWCNTs for direct methanol fuel cells

  3. Pancreatic Exocrine Function Testing

    OpenAIRE

    Berk, J. Edward

    1982-01-01

    It is important to understand which pancreatic function tests are available and how to interpret them when evaluating patients with malabsorption. Available direct tests are the secretin stimulation test, the Lundh test meal, and measurement of serum or fecal enzymes. Indirect tests assess pancreatic exocrine function by measuring the effect of pancreatic secretion on various nutrients. These include triglycerides labeled with carbon 14, cobalamin labeled with cobalt 57 and cobalt 58, and par...

  4. Interventions for treating functional dysphonia in adults.

    Science.gov (United States)

    Ruotsalainen, J H; Sellman, J; Lehto, L; Jauhiainen, M; Verbeek, J H

    2007-07-18

    Poor voice quality due to functional dysphonia can lead to a reduced quality of life. In occupations where voice use is substantial it can lead to a loss of employment. To evaluate the effectiveness of interventions to treat functional dysphonia in adults. We searched MEDLINE (PubMed, 1950 to 2006), EMBASE (1974 to 2006), CENTRAL (The Cochrane Library, Issue 2 2006), CINAHL (1983 to 2006), PsychINFO (1967 to 2006), Science Citation Index (1986 to 2006) and the Occupational Health databases OSH-ROM (to 2006). The date of the last search was 5(th) April 2006. Randomised controlled trials (RCTs) of interventions evaluating the effectiveness of treatments targeted at adults with functional dysphonia. For work-directed interventions interrupted time series and prospective cohort studies were also eligible. Two authors independently extracted data and assessed trial quality. Meta-analysis was performed where appropriate. We identified six randomised controlled trials including a total of 163 participants in intervention groups and 141 controls. One trial was high quality. Interventions were grouped into 1) Direct voice therapy 2) Indirect voice therapy 3) Combination of direct and indirect voice therapy and 4) Other treatments: pharmacological treatment and vocal hygiene instructions given by phoniatrist. No studies were found evaluating direct voice therapy on its own. One study did not show indirect voice therapy on its own to be effective when compared to no intervention. There is evidence from three studies for the effectiveness of a combination of direct and indirect voice therapy on self-reported vocal functioning (SMD -1.07; 95% CI -1.94 to -0.19), on observer-rated vocal functioning (WMD -13.00; 95% CI -17.92 to -8.08) and on instrumental assessment of vocal functioning (WMD -1.20; 95% CI -2.37 to -0.03) when compared to no intervention. The results of one study also show that the remedial effect remains significant for at least 14 weeks on self-reported vocal

  5. Methods for selective functionalization and separation of carbon nanotubes

    Science.gov (United States)

    Strano, Michael S. (Inventor); Usrey, Monica (Inventor); Barone, Paul (Inventor); Dyke, Christopher A. (Inventor); Tour, James M. (Inventor); Kittrell, W. Carter (Inventor); Hauge, Robert H (Inventor); Smalley, Richard E. (Inventor); Marek, legal representative, Irene Marie (Inventor)

    2011-01-01

    The present invention is directed toward methods of selectively functionalizing carbon nanotubes of a specific type or range of types, based on their electronic properties, using diazonium chemistry. The present invention is also directed toward methods of separating carbon nanotubes into populations of specific types or range(s) of types via selective functionalization and electrophoresis, and also to the novel compositions generated by such separations.

  6. Satellite orbits perturbed by direct solar radiation pressure: general expansion of the disturbing function

    International Nuclear Information System (INIS)

    Hughes, S.

    1977-01-01

    An expression is derived for the solar radiation pressure disturbing function on an Earth satellite orbit which takes into account the variation of the solar radiation flux with distance from the Sun's centre and the absorption of radiation by the satellite. This expression is then expanded in terms of the Keplerian elements of the satellite and solar orbits using Kaula's method (Astr. J.; 67:300 (1962)). The Kaula inclination functions are replaced by an equivalent set of modified Allan (Proc. R. Soc. A.; 288:60 (1965)) inclination functions. The resulting expression reduces to the form commonly used in solar radiation pressure perturbation studies (e.g. Aksnes, Cel. Mech.; 13:89 (1976)), when certain terms are neglected. If, as happens quite often in practice, a satellite's orbit is in near-resonance with certain of these neglected terms, these near-resonant terms can cause changes in the satellite's orbital elements comparable to those produced by the largest term in Aksnes's expression. A new expression for the solar radiation pressure disturbing function expansion is suggested for use in future studies of satellite orbits perturbed by solar radiation pressure. (author)

  7. A Review on Adducin from Functional to Pathological Mechanisms: Future Direction in Cancer

    Directory of Open Access Journals (Sweden)

    Karrie Mei-Yee Kiang

    2018-01-01

    Full Text Available Adducin (ADD is a family of membrane skeleton proteins including ADD1, ADD2, and ADD3 that are encoded by distinct genes on different chromosomes. Adducin is primarily responsible for the assembly of spectrin-actin network that provides physical support to the plasma membrane and mediates signal transduction in various cellular physiological processes upon regulation by protein kinase C-dependent and calcium/calmodulin-dependent pathways. Abnormal phosphorylation, genetic variations, and alternative splicing of adducin may contribute to alterations in cellular functions involved in pathogenic processes. These alterations are associated with a wide range of diseases including cancer. This paper begins with a discussion on how adducin partakes in the structural formation of membrane skeleton, its regulation, and related functional characteristics, followed by a review on the pathogenesis of hypertension, biliary atresia, and cancer with respect to increased disease susceptibility mediated by adducin polymorphism and/or dysregulation. Given the functional diversity of adducin in different cellular compartments, we aim to provide a knowledge base whereby its pathophysiological roles can be better understood. More importantly, we aim to provide novel insights that may be of significance in turning the adducin model to clinical application.

  8. A Simple K-Map Based Variable Selection Scheme in the Direct ...

    African Journals Online (AJOL)

    A multiplexer with (n-l) data select inputs can realise directly a function of n variables. In this paper, a simple k-map based variable selection scheme is proposed such that an n variable logic function can be synthesised using a multiplexer with (n-q) data input variables and q data select variables. The procedure is based on ...

  9. Photoacoustic microbeam-oscillator with tunable resonance direction and amplitude

    Science.gov (United States)

    Wu, Qingjun; Li, Fanghao; Wang, Bo; Yi, Futing; Jiang, J. Z.; Zhang, Dongxian

    2018-01-01

    We successfully design one photoacoustic microbeam-oscillator actuated by nanosecond laser, which exhibits tunable resonance direction and amplitude. The mechanism of laser induced oscillation is systematically analyzed. Both simulation and experimental results reveal that the laser induced acoustic wave propagates in a multi-reflected mode, resulting in resonance in the oscillator. This newly-fabricated micrometer-sized beam-oscillator has an excellent actuation function, i.e., by tuning the laser frequency, the direction and amplitude of actuation can be efficiently altered, which will have potential industrial applications.

  10. Directive Speech Act of Imamu in Katoba Discourse of Muna Ethnic

    Science.gov (United States)

    Ardianto, Ardianto; Hadirman, Hardiman

    2018-05-01

    One of the traditions of Muna ethnic is katoba ritual. Katoba ritual is one tradition that values local knowledge maintained its existence for generations until today. Katoba ritual is a ritual to be Islamic person, repentance, and the formation of a child's character (male/female) who will enter adulthood (6-11 years) using directive speech. In katoba ritual, a child who is in-katoba introduced to the teaching of the Islamic religion, customs, manners to parents and his brother and behaviour towards others which is expected to be implemented in daily life. This study aims to describe and explain the directive speech acts of the imamu in the katoba discourse of Muna ethnic. This research uses a qualitative approach. Data are collected from a natural setting, namely katoba speech discourses. The data consist of two types, namely: (a) speech data, and (b) field note data. Data are analyzed using an interactive model with four stages: (1) data collection, (2) data reduction, (3) data display, and (4) conclusion and verification. The result shows, firstly, the form of directive speech acts includes declarative and imperative form; secondly, the function of directive speech acts includes functions of teaching, explaining, suggesting, and expecting; and thirdly, the strategy of directive speech acts includes both direct and indirect strategy. The results of this study could be implied in the development of character learning materials at schools. It also can be one of the contents of local content (mulok) at school.

  11. Directing functional chemistries on micropatterned conducting polymers for all-polymer cell analysis microsystems

    DEFF Research Database (Denmark)

    Lind, Johan Ulrik; Daugaard, Anders Egede; Andresen, Thomas Lars

    Micrometer scale electrical circuits of PEDOT (poly(3,4-dioxythiophene)) were created by locally oxidizing PEDOT thin films with an agarose stamp containing the oxidizing agent NaOCl. The oxidized PEDOT was removed completely by applying detergents. The process was sufficiently mild that chemical...... groups on the underlying substrate, such as azides or alkynes, were preserved for subsequent specific functionalization. Moreover entire PMOXA (poly(2-methyl-2-oxazoline)) films preventing cell binding could be hidden below the PEDOT and be re-exposed upon stamping, allowing for cell capturing...... microelectrodes on a cell non-adhesive background. Chemically functionalized PEDOT types permitted the introduction of multiple additional types of micropatterned chemistry....

  12. Directed assembly of functional light harvesting antenna complexes onto chemically patterned surfaces

    International Nuclear Information System (INIS)

    Escalante, Maryana; Maury, Pascale; Bruinink, Christiaan M; Werf, Kees van der; Olsen, John D; Timney, John A; Huskens, Jurriaan; Hunter, C Neil; Subramaniam, Vinod; Otto, Cees

    2008-01-01

    We report the directed assembly of the photosynthetic membrane proteins LH1 and LH2 isolated from the purple bacterium Rhodobacter sphaeroides onto chemically patterned substrates. Nanoimprint lithography was used to pattern discrete regions of amino- and fluoro-terminated or poly(ethylene glycol) self-assembled monolayers onto a glass substrate. Densely packed layers of assembled protein complexes were observed with atomic force microscopy. The protein complexes attached selectively to the amino-terminated regions by electrostatic interactions. Spectral images generated with a hybrid scanning probe and fluorescence microscope confirmed that the patterned proteins retained their native optical signatures

  13. Directed assembly of functional light harvesting antenna complexes onto chemically patterned surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Escalante, Maryana [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Maury, Pascale [Molecular Nanofabrication Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Bruinink, Christiaan M [Molecular Nanofabrication Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Werf, Kees van der [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Olsen, John D [Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN (United Kingdom); Timney, John A [Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN (United Kingdom); Huskens, Jurriaan [Molecular Nanofabrication Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Hunter, C Neil [Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN (United Kingdom); Subramaniam, Vinod [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands); Otto, Cees [Biophysical Engineering Group, MESA and Institute for Nanotechnology, University of Twente, PO Box 217, 7500 AE Enschede (Netherlands)

    2008-01-16

    We report the directed assembly of the photosynthetic membrane proteins LH1 and LH2 isolated from the purple bacterium Rhodobacter sphaeroides onto chemically patterned substrates. Nanoimprint lithography was used to pattern discrete regions of amino- and fluoro-terminated or poly(ethylene glycol) self-assembled monolayers onto a glass substrate. Densely packed layers of assembled protein complexes were observed with atomic force microscopy. The protein complexes attached selectively to the amino-terminated regions by electrostatic interactions. Spectral images generated with a hybrid scanning probe and fluorescence microscope confirmed that the patterned proteins retained their native optical signatures.

  14. Energy efficiency in the European Union: What can be learned from the joint application of directional distance functions and slacks-based measures?

    International Nuclear Information System (INIS)

    Gómez-Calvet, Roberto; Conesa, David; Gómez-Calvet, Ana Rosa; Tortosa-Ausina, Emili

    2014-01-01

    Highlights: • We analyze the efficiency of electricity and derived heat generation in the European Union (EU). • We consider both desirable and undesirable outputs. • In our specifications both directional distance functions and slacks-based measure models are used. • Results show remarkable efficiency differences among EU countries. • This would call for further intensification of harmonization environmental policies in the EU. - Abstract: Over the last few years concerns have increased about the energy mix in many countries. These concerns have been of greater magnitude for countries with a common energy regulation such as European Union (EU) member states. An important aspect to take into account when choosing a given energy mix is the efficiency involved in its generation. In this context, the present study analyzes the efficiency with which electricity and derived heat was produced in 25 EU member states over the last decade. This analysis considers not only the inputs and outputs involved but, more importantly, which undesirable by-products were generated during the production process, a relevant issue for EU climate policy. To this end, two nonparametric frontier models are applied: first, a Directional Distance Function (DDF), based on Briec’s (1997) [16] proposal and, second, a modified version of Tone’s (2001) [51] Slacks-Based Measure (SBM) model, both of which are especially appropriate in this particular context due to their treatment of undesirable outputs. Results are partly innovative since, with few exceptions, applications on this issue are relatively scarce. From a policy implications’ point of view, our achievements are also interesting because they reveal remarkable efficiency differences among EU countries: those countries from the latest EU enlargements account for the lowest efficiencies, with large opportunities for improvement in CO 2 abatement and primary energy saving. Results also show stable efficiencies along the

  15. The in utero programming effect of increased maternal androgens and a direct fetal intervention on liver and metabolic function in adult sheep.

    Directory of Open Access Journals (Sweden)

    Kirsten Hogg

    Full Text Available Epigenetic changes in response to external stimuli are fast emerging as common underlying causes for the pre-disposition to adult disease. Prenatal androgenization is one such model that results in reproductive and metabolic features that are present in conditions such as polycystic ovary syndrome (PCOS. We examined the effect of prenatal androgens on liver function and metabolism of adult sheep. As non-alcoholic fatty liver disease is increased in PCOS we hypothesized that this, and other important liver pathways including metabolic function, insulin-like growth factor (IGF and steroid receptivity, would be affected. Pregnant ewes received vehicle control (C; n = 5 or testosterone propionate (TP; n = 9 twice weekly (100 mg; i.m from d62-102 (gestation 147 days. In a novel treatment paradigm, a second cohort received a direct C (n = 4 or TP (20 mg; n = 7 fetal injection at d62 and d82. In adults, maternal TP exposure resulted in increased insulin secretion to glucose load (P<0.05 and the histological presence of fatty liver (P<0.05 independent of central obesity. Additionally, hepatic androgen receptor (AR; P<0.05, glucocorticoid receptor (GR; P<0.05, UDP- glucose ceramide glucosyltransferase (UGCG; P<0.05 and IGF1 (P<0.01 expression were upregulated. The direct fetal intervention (C and TP led to early fatty liver changes in all animals without differential changes in insulin secretion. Furthermore, hepatic phosphoenolpyruvate carboxykinase (PEPCK was up-regulated in the fetal controls (P<0.05 and this was opposed by fetal TP (P<0.05. Hepatic estrogen receptor (ERα; P<0.05 and mitogen activated protein kinase kinase 4 (MAP2K4; P<0.05 were increased following fetal TP exposure. Adult liver metabolism and signaling can be altered by early exposure to sex steroids implicating epigenetic regulation of metabolic disturbances that are common in PCOS.

  16. Ulysses directives in The Netherlands: opinions of psychiatrists and clients.

    Science.gov (United States)

    Varekamp, I

    2004-12-01

    In this article we present a study on the opinions of Dutch psychiatrists and clients on Ulysses directives. In-depth interviews were conducted with 18 clients and 17 psychiatrists. Most respondents were proponents of Ulysses directives. The most frequently mentioned objective of these directives was to secure timely admission to hospital, although a large minority was mainly interested in giving patients influence on treatment decisions. Psychiatrists differed on how much autonomy they preferred with regard to decisions about the moment of admission and kind of treatment. Clients also differed in this respect. Pressure from others to execute a Ulysses directive, and premature admission to the hospital were mentioned as risks of Ulysses directives. Crisis cards were seen as an alternative by many psychiatrists and some clients. Recommendations are made for a good functioning of Ulysses directives, and the appropriateness of crisis cards as an alternative for a number of patients is discussed.

  17. Directional Darwinian Selection in proteins.

    Science.gov (United States)

    McClellan, David A

    2013-01-01

    Molecular evolution is a very active field of research, with several complementary approaches, including dN/dS, HON90, MM01, and others. Each has documented strengths and weaknesses, and no one approach provides a clear picture of how natural selection works at the molecular level. The purpose of this work is to present a simple new method that uses quantitative amino acid properties to identify and characterize directional selection in proteins. Inferred amino acid replacements are viewed through the prism of a single physicochemical property to determine the amount and direction of change caused by each replacement. This allows the calculation of the probability that the mean change in the single property associated with the amino acid replacements is equal to zero (H0: μ = 0; i.e., no net change) using a simple two-tailed t-test. Example data from calanoid and cyclopoid copepod cytochrome oxidase subunit I sequence pairs are presented to demonstrate how directional selection may be linked to major shifts in adaptive zones, and that convergent evolution at the whole organism level may be the result of convergent protein adaptations. Rather than replace previous methods, this new method further complements existing methods to provide a holistic glimpse of how natural selection shapes protein structure and function over evolutionary time.

  18. Motif-role-fingerprints: the building-blocks of motifs, clustering-coefficients and transitivities in directed networks.

    Directory of Open Access Journals (Sweden)

    Mark D McDonnell

    Full Text Available Complex networks are frequently characterized by metrics for which particular subgraphs are counted. One statistic from this category, which we refer to as motif-role fingerprints, differs from global subgraph counts in that the number of subgraphs in which each node participates is counted. As with global subgraph counts, it can be important to distinguish between motif-role fingerprints that are 'structural' (induced subgraphs and 'functional' (partial subgraphs. Here we show mathematically that a vector of all functional motif-role fingerprints can readily be obtained from an arbitrary directed adjacency matrix, and then converted to structural motif-role fingerprints by multiplying that vector by a specific invertible conversion matrix. This result demonstrates that a unique structural motif-role fingerprint exists for any given functional motif-role fingerprint. We demonstrate a similar result for the cases of functional and structural motif-fingerprints without node roles, and global subgraph counts that form the basis of standard motif analysis. We also explicitly highlight that motif-role fingerprints are elemental to several popular metrics for quantifying the subgraph structure of directed complex networks, including motif distributions, directed clustering coefficient, and transitivity. The relationships between each of these metrics and motif-role fingerprints also suggest new subtypes of directed clustering coefficients and transitivities. Our results have potential utility in analyzing directed synaptic networks constructed from neuronal connectome data, such as in terms of centrality. Other potential applications include anomaly detection in networks, identification of similar networks and identification of similar nodes within networks. Matlab code for calculating all stated metrics following calculation of functional motif-role fingerprints is provided as S1 Matlab File.

  19. Digit ratio predicts sense of direction in women.

    Directory of Open Access Journals (Sweden)

    Xiaoqian J Chai

    Full Text Available The relative length of the second-to-fourth digits (2D:4D has been linked with prenatal androgen in humans. The 2D:4D is sexually dimorphic, with lower values in males than females, and appears to correlate with diverse measures of behavior. However, the relationship between digit ratio and cognition, and spatial cognition in particular, has produced mixed results. In the present study, we hypothesized that spatial tasks separating cue conditions that either favored female or male strategies would examine this structure-function correlation with greater precision. Previous work suggests that males are better in the use of directional cues than females. In the present study, participants learned a target location in a virtual landscape environment, in conditions that contained either all directional (i.e., distant or compass bearing cues, or all positional (i.e., local, small objects cues. After a short delay, participants navigated back to the target location from a novel starting location. Males had higher accuracy in initial search direction than females in environments with all directional cues. Lower digit ratio was correlated with higher accuracy of initial search direction in females in environments with all directional cues. Mental rotation scores did not correlate with digit ratio in either males or females. These results demonstrate for the first time that a sex difference in the use of directional cues, i.e., the sense of direction, is associated with more male-like digit ratio.

  20. Digit ratio predicts sense of direction in women.

    Science.gov (United States)

    Chai, Xiaoqian J; Jacobs, Lucia F

    2012-01-01

    The relative length of the second-to-fourth digits (2D:4D) has been linked with prenatal androgen in humans. The 2D:4D is sexually dimorphic, with lower values in males than females, and appears to correlate with diverse measures of behavior. However, the relationship between digit ratio and cognition, and spatial cognition in particular, has produced mixed results. In the present study, we hypothesized that spatial tasks separating cue conditions that either favored female or male strategies would examine this structure-function correlation with greater precision. Previous work suggests that males are better in the use of directional cues than females. In the present study, participants learned a target location in a virtual landscape environment, in conditions that contained either all directional (i.e., distant or compass bearing) cues, or all positional (i.e., local, small objects) cues. After a short delay, participants navigated back to the target location from a novel starting location. Males had higher accuracy in initial search direction than females in environments with all directional cues. Lower digit ratio was correlated with higher accuracy of initial search direction in females in environments with all directional cues. Mental rotation scores did not correlate with digit ratio in either males or females. These results demonstrate for the first time that a sex difference in the use of directional cues, i.e., the sense of direction, is associated with more male-like digit ratio.

  1. Echolocating bats emit a highly directional sonar sound beam in the field

    DEFF Research Database (Denmark)

    Surlykke, Annemarie; Boel Pedersen, Simon; Jakobsen, Lasse

    2009-01-01

    Bats use echolocation or biosonar to navigate and find prey at night. They emit short ultrasonic calls and listen for reflected echoes. The beam width of the calls is central to the function of the sonar, but directionality of echolocation calls has never been measured from bats flying in the wild....... We used a microphone array to record sounds and determine horizontal directionality for echolocation calls of the trawling Daubenton's bat, Myotis daubentonii, flying over a pond in its natural habitat. Myotis daubentonii emitted highly directional calls in the field. Directionality increased...... and directionality can be explained by the simple piston model. The model also suggests that the increase in the emitted intensity in the field is caused by the increased directionality, focusing sound energy in the forward direction. The bat may increase directionality by opening the mouth wider to emit a louder...

  2. Directional dependence of binaural loudness

    DEFF Research Database (Denmark)

    Ellermeier, Wolfgang; Sivonen, Ville Pekka

    2006-01-01

    on binaural loudness summation, on the other hand, focuses on a highly artificial paradigm according to which unnatural combinations of sound pressure levels(such as monotic-diotic comparisons) are presented to listeners via headphones. In order to reconcile these two approaches, we recently started a series...... incidence angle, in order to relate the changes in actual at-ear exposure to the observed changes in loudness as a function of sound incidence. Combining the listening-test data with the physical measurements, an attempt was made to model the binaural summation underlying the directional loudness matches....

  3. Phase reversal of biomechanical functions and muscle activity in backward pedaling.

    Science.gov (United States)

    Ting, L H; Kautz, S A; Brown, D A; Zajac, F E

    1999-02-01

    Computer simulations of pedaling have shown that a wide range of pedaling tasks can be performed if each limb has the capability of executing six biomechanical functions, which are arranged into three pairs of alternating antagonistic functions. An Ext/Flex pair accelerates the limb into extension or flexion, a Plant/Dorsi pair accelerates the foot into plantarflexion or dorsiflexion, and an Ant/Post pair accelerates the foot anteriorly or posteriorly relative to the pelvis. Because each biomechanical function (i.e., Ext, Flex, Plant, Dorsi, Ant, or Post) contributes to crank propulsion during a specific region in the cycle, phasing of a muscle is hypothesized to be a consequence of its ability to contribute to one or more of the biomechanical functions. Analysis of electromyogram (EMG) patterns has shown that this biomechanical framework assists in the interpretation of muscle activity in healthy and hemiparetic subjects during forward pedaling. Simulations show that backward pedaling can be produced with a phase shift of 180 degrees in the Ant/Post pair. No phase shifts in the Ext/Flex and Plant/Dorsi pairs are then necessary. To further test whether this simple yet biomechanically viable strategy may be used by the nervous system, EMGs from 7 muscles in 16 subjects were measured during backward as well as forward pedaling. As predicted, phasing in vastus medialis (VM), tibialis anterior (TA), medial gastrocnemius (MG), and soleus (SL) were unaffected by pedaling direction, with VM and SL contributing to Ext, MG to Plant, and TA to Dorsi. In contrast, phasing in biceps femoris (BF) and semimembranosus (SM) were affected by pedaling direction, as predicted, compatible with their contribution to the directionally sensitive Post function. Phasing of rectus femoris (RF) was also affected by pedaling direction; however, its ability to contribute to the directionally sensitive Ant function may only be expressed in forward pedaling. RF also contributed significantly to

  4. Molecular calculations with B functions

    International Nuclear Information System (INIS)

    Steinborn, E.O.; Homeier, H.H.H.; Ema, I.; Lopez, R.; Ramirez, G.

    2000-01-01

    A program for molecular calculations with B functions is reported and its performance is analyzed. All the one- and two-center integrals and the three-center nuclear attraction integrals are computed by direct procedures, using previously developed algorithms. The three- and four-center electron repulsion integrals are computed by means of Gaussian expansions of the B functions. A new procedure for obtaining these expansions is also reported. Some results on full molecular calculations are included to show the capabilities of the program and the quality of the B functions to represent the electronic functions in molecules

  5. Performance of direct ethanol fuel cells as function of using of compressed air; Desempenho de celulas a combustivel com alimentacao direta de etanol em funcao do uso de ar comprimido

    Energy Technology Data Exchange (ETDEWEB)

    Belchor, P.M. [UFRGS - Universidade Federal do Rio Grande do Sul, Porto Alegre, RS (Brazil); Berns, B.A.; Ferreira, R.C.; Goldbach, A.; Carpenter, D. [FURB - Fundacao Universidade Regional de Blumenau, Blumenau, SC (Brazil)

    2010-07-01

    This paper compared the performance of a direct ethanol fuel cell (CCADE) cathode feeding with air replacing the pure oxygen. The results have shown that the small decreasing of the yield of the cell under both practical and experimental situations, by the use of air replacing pure oxygen, it completely acceptable as function of great diminishing of operational costs. (author)

  6. Direct hospital marketing: an idea whose time has come.

    Science.gov (United States)

    Dodson, D C; Dotson, M J; Cussimanio, L

    1990-01-01

    Health care marketing has arrived swiftly and with significant impact upon the hospital scene. From the early days of rejection and suspicion of only a few years ago, it has now taken its place with other hospital management functions. Still, however, hospitals have not yet reached the degree of expertise that exists in other sectors. One of the reasons why hospitals have not fully emerged to the level of marketing expertise as many of their traditional business counterparts is that many of the areas of both the science and art of marketing have not been fully developed. One such area is direct mail marketing. Presented here is an overview of the advantages and functions of hospital direct mail marketing. A variety of examples are given with a more thorough case example being provided by Lee's Summit Community Hospital in Lee's Summit, Missouri. The successful direct mail marketing campaign there should be both an inspiration and a model for success for other hospitals. Space limitations prevent the authors from some of the more exacting details of mail marketing and, of course, successful campaigns do not happen by magic. They take careful planning, strategy, and execution. They also require a coordinated organizational and human effort to be successful. But direct mail marketing does offer a potentially new arena of marketing for most hospitals. The expertise, skill, knowledge, and technology are in place. All that is really needed is the commitment on the part of the hospital leadership.

  7. Directional borehole antenna - Theory

    International Nuclear Information System (INIS)

    Falk, L.

    1992-02-01

    A directional antenna has been developed for the borehole radar constructed during phase 2 of the Stripa project. The new antenna can determine the azimuth of a strong reflector with an accuracy of about 3 degrees as confirmed during experiments in Stripa, although the ratio of borehole diameter to wavelength is small, about 0.03. The antenna synthesizes the effect of a loop antenna rotating in the borehole from four signals measured in turn by a stationary antenna. These signals are also used to calculate an electric dipole signal and a check sum which is used to examine the function of the system. The theory of directional antennas is reviewed and used to design an antenna consisting of four parallel wires. The radiation pattern of this antenna is calculated using transmission line theory with due regard to polarization, which is of fundamental importance for the analysis of directional data. In particular the multipole expansion of the field is calculated to describe the antenna radiation pattern. Various sources of error, e.g. the effect of the borehole, are discussed and the methods of calibrating the antenna are reviewed. The ambiguity inherent in a loop antenna can be removed by taking the phase of the signal into account. Typical reflectors in rock, e.g. fracture zones an tunnels, may be modelled as simple geometrical structures. The corresponding analysis is described and exemplified on measurements from Stripa. Radar data is nowadays usually analyzed directly on the computer screen using the program RADINTER developed within the Stripa project. An algorithm for automatic estimation of the parameters of a reflector have been tested with some success. The relation between measured radar data and external coordinates as determined by rotational indicators is finally expressed in terms of Euler angles. (au)

  8. The law of distribution of light beam direction fluctuations in telescopes. [normal density functions

    Science.gov (United States)

    Divinskiy, M. L.; Kolchinskiy, I. G.

    1974-01-01

    The distribution of deviations from mean star trail directions was studied on the basis of 105 star trails. It was found that about 93% of the trails yield a distribution in agreement with the normal law. About 4% of the star trails agree with the Charlier distribution.

  9. From verbal prefixes to direction/result markers in Romance

    Directory of Open Access Journals (Sweden)

    Patrizia Cordin

    2011-12-01

    Full Text Available In this paper I analyze verb-locative constructions in Romance. Even though not allowed in standard Romance languages, which have maintained and codified the classical Latin prefix system, these constructions are widely attested in non standard varieties, that are scarcely (or not at all regularized. In this paper I deal in particular with a northern Italian variety, Trentino, where locatives, combining with some classes of verbs (unaccusative verbs and transitive activity verbs can express not only concrete direction and metaphorical direction, but also aspect (the result of an activity or the progress of a process; in other words, they can express an abstract, more grammaticalized feature of direction. In fact, Trentino verb-locative constructions can express a specific phase of the development of an event, often the result (end-point of an activity, or the start-point, or the progress, or the intensity of the activity itself. I argue that in Trentino (and in other similar dialectal varieties locatives can function as grammatical markers both for arguments (in combination with motion verbs and for aspect (in combination with verbs involving the feature of an abstract path. In a more general context, I note that locatives in combination of verbs function as goal/result markers in those varieties that tend to spell out markers of functional elements, frequently generating a repetition (doubling of the same feature. Finally, I compare Romance and Germanic constructions, noting that diachronic, grammatical and typological differences (with particular reference to Talmy's distinction between verb-framed languages and satellite languages confirm the independence of Romance verb-locative constructions.

  10. Mitochondrial bioenergetics during the initiation of mercuric chloride-induced renal injury. I. Direct effects of in vitro mercuric chloride on renal cortical mitochondrial function

    Energy Technology Data Exchange (ETDEWEB)

    Weinberg, J.M. (Veterans Administration Medical Center, Ann Arbor, MI); Harding, P.G.; Humes, H.D.

    1982-01-01

    Increasing data suggest that mitochondrial dysfunction may be an important early component of nephrotoxin-induced changes in renal cell function and viability. This study was designed to obtain more detailed information about the effects on several basic bioenergetic parameters of the direct interaction of Hg/sup 2 +/ with renal cortical mitochondria in vitro as a necessary prelude to studies of mitochondrial functional changes after treatment with mercuric chloride in vivo. Beginning at a threshhold level of 2 nmol of Hg/sup 2 +//mg of mitochondrial protein Hg/sup 2 +/ induced marked stimulation of State 4 respiration, mild inhibition of State 3 respiration, and 2,4-dinitrophenol uncoupled respiration, a striking increase in atractyloside-insensitive ADP uptake and stimulation of both basal- and Mg/sup 2 +/-activated oligomycin-sensitive mitochondrial ATPase activity. These effects of Hg/sup 2 +/ could be prevented and reversed by the sulfhydryl reagent dithioerythritol and by albumin but were not affected by Mg/sup 2 +/. Detailed studies on the addition of HgCl/sub 2/ to the preparation at different stages of the mitochondrial isolation procedure demonstrated that the presence of other proteins decreased mitochondrial Hg/sup 2 +/ binding, that the Hg/sup 2 +/ was not readily washed off the mitochondria by nonprotein-containing solutions, and that prolonged exposure of mitochondria to Hg/sup 2 +/ during the isolation procedure did not markedly alter its functional effects on their reversibility as assessed on the final mitochondrial preparation. These data provide an important basis for critically assessing the changes in function of mitochondria isolated after in vivo treatment with mercuric chloride.

  11. Simple functional-differential equations for the bound-state wave-function components

    International Nuclear Information System (INIS)

    Kamuntavicius, G.P.

    1986-01-01

    The author presents a new method of a direct derivation of differential equations for the wave-function components of identical-particles systems. The method generates in a simple manner all the possible variants of these equations. In some cases they are the differential equations of Faddeev or Yakubovskii. It is shown that the case of the bound states allows to formulate very simple equations for the components which are equivalent to the Schroedinger equation for the complete wave function. The components with a minimal antisymmetry are defined and the corresponding equations are derived. (Auth.)

  12. Efficient visibility encoding for dynamic illumination in direct volume rendering.

    Science.gov (United States)

    Kronander, Joel; Jönsson, Daniel; Löw, Joakim; Ljung, Patric; Ynnerman, Anders; Unger, Jonas

    2012-03-01

    We present an algorithm that enables real-time dynamic shading in direct volume rendering using general lighting, including directional lights, point lights, and environment maps. Real-time performance is achieved by encoding local and global volumetric visibility using spherical harmonic (SH) basis functions stored in an efficient multiresolution grid over the extent of the volume. Our method enables high-frequency shadows in the spatial domain, but is limited to a low-frequency approximation of visibility and illumination in the angular domain. In a first pass, level of detail (LOD) selection in the grid is based on the current transfer function setting. This enables rapid online computation and SH projection of the local spherical distribution of visibility information. Using a piecewise integration of the SH coefficients over the local regions, the global visibility within the volume is then computed. By representing the light sources using their SH projections, the integral over lighting, visibility, and isotropic phase functions can be efficiently computed during rendering. The utility of our method is demonstrated in several examples showing the generality and interactive performance of the approach.

  13. Chitin and Chitosan as Direct Compression Excipients in Pharmaceutical Applications

    Science.gov (United States)

    Badwan, Adnan A.; Rashid, Iyad; Al Omari, Mahmoud M.H.; Darras, Fouad H.

    2015-01-01

    Despite the numerous uses of chitin and chitosan as new functional materials of high potential in various fields, they are still behind several directly compressible excipients already dominating pharmaceutical applications. There are, however, new attempts to exploit chitin and chitosan in co-processing techniques that provide a product with potential to act as a direct compression (DC) excipient. This review outlines the compression properties of chitin and chitosan in the context of DC pharmaceutical applications. PMID:25810109

  14. Chitin and Chitosan as Direct Compression Excipients in Pharmaceutical Applications

    Directory of Open Access Journals (Sweden)

    Adnan A. Badwan

    2015-03-01

    Full Text Available Despite the numerous uses of chitin and chitosan as new functional materials of high potential in various fields, they are still behind several directly compressible excipients already dominating pharmaceutical applications. There are, however, new attempts to exploit chitin and chitosan in co-processing techniques that provide a product with potential to act as a direct compression (DC excipient. This review outlines the compression properties of chitin and chitosan in the context of DC pharmaceutical applications.

  15. Nanoscale Engineering in VO2 Nanowires via Direct Electron Writing Process.

    Science.gov (United States)

    Zhang, Zhenhua; Guo, Hua; Ding, Wenqiang; Zhang, Bin; Lu, Yue; Ke, Xiaoxing; Liu, Weiwei; Chen, Furong; Sui, Manling

    2017-02-08

    Controlling phase transition in functional materials at nanoscale is not only of broad scientific interest but also important for practical applications in the fields of renewable energy, information storage, transducer, sensor, and so forth. As a model functional material, vanadium dioxide (VO 2 ) has its metal-insulator transition (MIT) usually at a sharp temperature around 68 °C. Here, we report a focused electron beam can directly lower down the transition temperature of a nanoarea to room temperature without prepatterning the VO 2 . This novel process is called radiolysis-assisted MIT (R-MIT). The electron beam irradiation fabricates a unique gradual MIT zone to several times of the beam size in which the temperature-dependent phase transition is achieved in an extended temperature range. The gradual transformation zone offers to precisely control the ratio of metal/insulator phases. This direct electron writing technique can open up an opportunity to precisely engineer nanodomains of diversified electronic properties in functional material-based devices.

  16. Using the electron localization function to correct for confinement physics in semi-local density functional theory

    International Nuclear Information System (INIS)

    Hao, Feng; Mattsson, Ann E.; Armiento, Rickard

    2014-01-01

    We have previously proposed that further improved functionals for density functional theory can be constructed based on the Armiento-Mattsson subsystem functional scheme if, in addition to the uniform electron gas and surface models used in the Armiento-Mattsson 2005 functional, a model for the strongly confined electron gas is also added. However, of central importance for this scheme is an index that identifies regions in space where the correction provided by the confined electron gas should be applied. The electron localization function (ELF) is a well-known indicator of strongly localized electrons. We use a model of a confined electron gas based on the harmonic oscillator to show that regions with high ELF directly coincide with regions where common exchange energy functionals have large errors. This suggests that the harmonic oscillator model together with an index based on the ELF provides the crucial ingredients for future improved semi-local functionals. For a practical illustration of how the proposed scheme is intended to work for a physical system we discuss monoclinic cupric oxide, CuO. A thorough discussion of this system leads us to promote the cell geometry of CuO as a useful benchmark for future semi-local functionals. Very high ELF values are found in a shell around the O ions, and take its maximum value along the Cu–O directions. An estimate of the exchange functional error from the effect of electron confinement in these regions suggests a magnitude and sign that could account for the error in cell geometry

  17. Prediction of sound transmission loss through multilayered panels by using Gaussian distribution of directional incident energy

    Science.gov (United States)

    Kang; Ih; Kim; Kim

    2000-03-01

    In this study, a new prediction method is suggested for sound transmission loss (STL) of multilayered panels of infinite extent. Conventional methods such as random or field incidence approach often given significant discrepancies in predicting STL of multilayered panels when compared with the experiments. In this paper, appropriate directional distributions of incident energy to predict the STL of multilayered panels are proposed. In order to find a weighting function to represent the directional distribution of incident energy on the wall in a reverberation chamber, numerical simulations by using a ray-tracing technique are carried out. Simulation results reveal that the directional distribution can be approximately expressed by the Gaussian distribution function in terms of the angle of incidence. The Gaussian function is applied to predict the STL of various multilayered panel configurations as well as single panels. The compared results between the measurement and the prediction show good agreements, which validate the proposed Gaussian function approach.

  18. Climatology of Wind Direction Fluctuations at Risø

    DEFF Research Database (Denmark)

    Kristensen, Leif; Panofsky, H. A.

    1976-01-01

    Standard deviations of wind direction fluctuations at 76 m at Risø for the first half year of 1975 have been analyzed as functions of wind speed and temperature lapse rate, either measured near the surface or near the level of the azimuth variations. Between 31 and 37% of the variance of the stan...

  19. Calibration method for direct conversion receiver front-ends

    Directory of Open Access Journals (Sweden)

    R. Müller

    2008-05-01

    Full Text Available Technology induced process tolerances in analog circuits cause device characteristics different from specification. For direct conversion receiver front-ends a system level calibration method is presented. The malfunctions of the devices are compensated by tuning dominant circuit parameters. Thereto optimization techniques are applied which use measurement values and special evaluation functions.

  20. On-chip spin-controlled orbital angular momentum directional coupling

    Science.gov (United States)

    Xie, Zhenwei; Lei, Ting; Si, Guangyuan; Du, Luping; Lin, Jiao; Min, Changjun; Yuan, Xiaocong

    2018-01-01

    Optical vortex beams have many potential applications in the particle trapping, quantum encoding, optical orbital angular momentum (OAM) communications and interconnects. However, the on-chip compact OAM detection is still a big challenge. Based on a holographic configuration and a spin-dependent structure design, we propose and demonstrate an on-chip spin-controlled OAM-mode directional coupler, which can couple the OAM signal to different directions due to its topological charge. While the directional coupling function can be switched on/off by altering the spin of incident beam. Both simulation and experimental measurements verify the validity of the proposed approach. This work would benefit the on-chip OAM devices for optical communications and high dimensional quantum coding/decoding in the future.

  1. Assessing work disability for social security benefits: international models for the direct assessment of work capacity.

    Science.gov (United States)

    Geiger, Ben Baumberg; Garthwaite, Kayleigh; Warren, Jon; Bambra, Clare

    2017-08-25

    It has been argued that social security disability assessments should directly assess claimants' work capacity, rather than relying on proxies such as on functioning. However, there is little academic discussion of how such assessments could be conducted. The article presents an account of different models of direct disability assessments based on case studies of the Netherlands, Germany, Denmark, Norway, the United States of America, Canada, Australia, and New Zealand, utilising over 150 documents and 40 expert interviews. Three models of direct work disability assessments can be observed: (i) structured assessment, which measures the functional demands of jobs across the national economy and compares these to claimants' functional capacities; (ii) demonstrated assessment, which looks at claimants' actual experiences in the labour market and infers a lack of work capacity from the failure of a concerned rehabilitation attempt; and (iii) expert assessment, based on the judgement of skilled professionals. Direct disability assessment within social security is not just theoretically desirable, but can be implemented in practice. We have shown that there are three distinct ways that this can be done, each with different strengths and weaknesses. Further research is needed to clarify the costs, validity/legitimacy, and consequences of these different models. Implications for rehabilitation It has recently been argued that social security disability assessments should directly assess work capacity rather than simply assessing functioning - but we have no understanding about how this can be done in practice. Based on case studies of nine countries, we show that direct disability assessment can be implemented, and argue that there are three different ways of doing it. These are "demonstrated assessment" (using claimants' experiences in the labour market), "structured assessment" (matching functional requirements to workplace demands), and "expert assessment" (the

  2. Multiple Types of Memory and Everyday Functional Assessment in Older Adults

    Science.gov (United States)

    Beaver, Jenna

    2017-01-01

    Abstract Objective Current proxy measures for assessing everyday functioning (e.g., questionnaires, performance-based measures, and direct observation) show discrepancies in their rating of functional status. The present study investigated the relationship between multiple proxy measures of functional status and content memory (i.e., memory for information), temporal order memory, and prospective memory in an older adult sample. Method A total of 197 community-dwelling older adults who did (n = 45) or did not meet (n = 152) criteria for mild cognitive impairment (MCI), completed six different assessments of functional status (two questionnaires, two performance-based tasks, and two direct observation tasks) as well as experimental measures of content memory, prospective memory, and temporal order memory. Results After controlling for demographics and content memory, the temporal order and prospective memory measures explained a significant amount of variance in all proxy functional status measures. When all variables were entered into the regression analyses, content memory and prospective memory were found to be significant predictors of all measures of functional status, whereas temporal order memory was a significant predictor for the questionnaire and direct observation measures, but not performance-based measures. Conclusion The results suggest that direct observation and questionnaire measures may be able to capture components of everyday functioning that require context and temporal sequencing abilities, such as multi-tasking, that are not as well captured in many current laboratory performance-based measures of functional status. Future research should aim to inform the development and use of maximally effective and valid proxy measures of functional ability. PMID:28334170

  3. Diffusion properties of active particles with directional reversal

    International Nuclear Information System (INIS)

    Großmann, R; Bär, M; Peruani, F

    2016-01-01

    The diffusion properties of self-propelled particles which move at constant speed and, in addition, reverse their direction of motion repeatedly are investigated. The internal dynamics of particles triggering these reversal processes is modeled by a stochastic clock. The velocity correlation function as well as the mean squared displacement is investigated and, furthermore, a general expression for the diffusion coefficient for self-propelled particles with directional reversal is derived. Our analysis reveals the existence of an optimal, finite rotational noise amplitude which maximizes the diffusion coefficient. We comment on the relevance of these results with regard to biological systems and suggest further experiments in this context. (paper)

  4. Nonrespiratory lung function

    Energy Technology Data Exchange (ETDEWEB)

    Isawa, Toyoharu [Tohoku University Research Institute for Chest Disease and Cancer, Sendai (Japan)

    1994-07-01

    The function of the lungs is primarily the function as a gas exchanger: the venous blood returning to the lungs is arterialized with oxygen in the lungs and the arterialized blood is sent back again to the peripheral tissues of the whole body to be utilized for metabolic oxygenation. Besides the gas exchanging function which we call ''respiratory lung function'' the lungs have functions that have little to do with gas exchange itself. We categorically call the latter function of the lungs as ''nonrespiratory lung function''. The lungs consist of the conductive airways, the gas exchanging units like the alveoli, and the interstitial space that surrounds the former two compartments. The interstitial space contains the blood and lymphatic capillaries, collagen and elastic fibers and cement substances. The conductive airways and the gas exchanging units are directly exposed to the atmosphere that contains various toxic and nontoxic gases, fume and biological or nonbiological particles. Because the conductive airways are equipped with defense mechanisms like mucociliary clearance or coughs to get rid of these toxic gases, particles or locally produced biological debris, we are usually free from being succumbed to ill effects of inhaled materials. By use of nuclear medicine techniques, we can now evaluate mucociliary clearance function, and other nonrespiratory lung functions as well in vivo.

  5. Nonrespiratory lung function

    International Nuclear Information System (INIS)

    Isawa, Toyoharu

    1994-01-01

    The function of the lungs is primarily the function as a gas exchanger: the venous blood returning to the lungs is arterialized with oxygen in the lungs and the arterialized blood is sent back again to the peripheral tissues of the whole body to be utilized for metabolic oxygenation. Besides the gas exchanging function which we call ''respiratory lung function'' the lungs have functions that have little to do with gas exchange itself. We categorically call the latter function of the lungs as ''nonrespiratory lung function''. The lungs consist of the conductive airways, the gas exchanging units like the alveoli, and the interstitial space that surrounds the former two compartments. The interstitial space contains the blood and lymphatic capillaries, collagen and elastic fibers and cement substances. The conductive airways and the gas exchanging units are directly exposed to the atmosphere that contains various toxic and nontoxic gases, fume and biological or nonbiological particles. Because the conductive airways are equipped with defense mechanisms like mucociliary clearance or coughs to get rid of these toxic gases, particles or locally produced biological debris, we are usually free from being succumbed to ill effects of inhaled materials. By use of nuclear medicine techniques, we can now evaluate mucociliary clearance function, and other nonrespiratory lung functions as well in vivo

  6. Structural and functional networks in complex systems with delay.

    Science.gov (United States)

    Eguíluz, Víctor M; Pérez, Toni; Borge-Holthoefer, Javier; Arenas, Alex

    2011-05-01

    Functional networks of complex systems are obtained from the analysis of the temporal activity of their components, and are often used to infer their unknown underlying connectivity. We obtain the equations relating topology and function in a system of diffusively delay-coupled elements in complex networks. We solve exactly the resulting equations in motifs (directed structures of three nodes) and in directed networks. The mean-field solution for directed uncorrelated networks shows that the clusterization of the activity is dominated by the in-degree of the nodes, and that the locking frequency decreases with increasing average degree. We find that the exponent of a power law degree distribution of the structural topology γ is related to the exponent of the associated functional network as α=(2-γ)(-1) for γ<2. © 2011 American Physical Society

  7. Controllable assembly of silver nanoparticles induced by femtosecond laser direct writing

    International Nuclear Information System (INIS)

    Wang, Huan; Liu, Sen; Zhang, Yong-Lai; Wang, Jian-Nan; Wang, Lei; Xia, Hong; Chen, Qi-Dai; Sun, Hong-Bo; Ding, Hong

    2015-01-01

    We report controllable assembly of silver nanoparticles (Ag NPs) for patterning of silver microstructures. The assembly is induced by femtosecond laser direct writing (FsLDW). A tightly focused femtosecond laser beam is capable of trapping and driving Ag NPs to form desired micropatterns with a high resolution of ∼190 nm. Taking advantage of the ‘direct writing’ feature, three microelectrodes have been integrated with a microfluidic chip; two silver-based microdevices including a microheater and a catalytic reactor have been fabricated inside a microfluidic channel for chip functionalization. The FsLDW-induced programmable assembly of Ag NPs may open up a new way to the designable patterning of silver microstructures toward flexible fabrication and integration of functional devices. (focus issue paper)

  8. Use of functional near-infrared spectroscopy to monitor cortical plasticity induced by transcranial direct current stimulation

    Science.gov (United States)

    Khan, Bilal; Hervey, Nathan; Stowe, Ann; Hodics, Timea; Alexandrakis, George

    2013-03-01

    Electrical stimulation of the human cortex in conjunction with physical rehabilitation has been a valuable approach in facilitating the plasticity of the injured brain. One such method is transcranial direct current stimulation (tDCS) which is a non-invasive method to elicit neural stimulation by delivering current through electrodes placed on the scalp. In order to better understand the effects tDCS has on cortical plasticity, neuroimaging techniques have been used pre and post tDCS stimulation. Recently, neuroimaging methods have discovered changes in resting state cortical hemodynamics after the application of tDCS on human subjects. However, analysis of the cortical hemodynamic activity for a physical task during and post tDCS stimulation has not been studied to our knowledge. A viable and sensitive neuroimaging method to map changes in cortical hemodynamics during activation is functional near-infrared spectroscopy (fNIRS). In this study, the cortical activity during an event-related, left wrist curl task was mapped with fNIRS before, during, and after tDCS stimulation on eight healthy adults. Along with the fNIRS optodes, two electrodes were placed over the sensorimotor hand areas of both brain hemispheres to apply tDCS. Changes were found in both resting state cortical connectivity and cortical activation patterns that occurred during and after tDCS. Additionally, changes to surface electromyography (sEMG) measurements of the wrist flexor and extensor of both arms during the wrist curl movement, acquired concurrently with fNIRS, were analyzed and related to the transient cortical plastic changes induced by tDCS.

  9. Direct computation of harmonic moments for tomographic reconstruction

    International Nuclear Information System (INIS)

    Nara, Takaaki; Ito, Nobutaka; Takamatsu, Tomonori; Sakurai, Tetsuya

    2007-01-01

    A novel algorithm to compute harmonic moments of a density function from its projections is presented for tomographic reconstruction. For projection p(r, θ), we define harmonic moments of projection by ∫ π 0 ∫ ∞ -∞ p(r,θ)(re iθ ) n drd θ and show that it coincides with the harmonic moments of the density function except a constant. Furthermore, we show that the harmonic moment of projection of order n can be exactly computed by using n+ 1 projection directions, which leads to an efficient algorithm to reconstruct the vertices of a polygon from projections.

  10. Engineering the functional fitness of transglycosidases and ...

    African Journals Online (AJOL)

    The artificial implementation of the Darwinian theory of evolution to create new variants of functional proteins, a process referred to as directed evolution, has acquired many applications in biochemical engineering. Directed evolution is a handy tool in the nascent science of glycobiology, where it is used in the conversion of ...

  11. Focalised stimulation using high definition transcranial direct current stimulation (HD-tDCS) to investigate declarative verbal learning and memory functioning.

    Science.gov (United States)

    Nikolin, Stevan; Loo, Colleen K; Bai, Siwei; Dokos, Socrates; Martin, Donel M

    2015-08-15

    Declarative verbal learning and memory are known to be lateralised to the dominant hemisphere and to be subserved by a network of structures, including those located in frontal and temporal regions. These structures support critical components of verbal memory, including working memory, encoding, and retrieval. Their relative functional importance in facilitating declarative verbal learning and memory, however, remains unclear. To investigate the different functional roles of these structures in subserving declarative verbal learning and memory performance by applying a more focal form of transcranial direct current stimulation, "High Definition tDCS" (HD-tDCS). Additionally, we sought to examine HD-tDCS effects and electrical field intensity distributions using computer modelling. HD-tDCS was administered to the left dorsolateral prefrontal cortex (LDLPFC), planum temporale (PT), and left medial temporal lobe (LMTL) to stimulate the hippocampus, during learning on a declarative verbal memory task. Sixteen healthy participants completed a single blind, intra-individual cross-over, sham-controlled study which used a Latin Square experimental design. Cognitive effects on working memory and sustained attention were additionally examined. HD-tDCS to the LDLPFC significantly improved the rate of verbal learning (p=0.03, η(2)=0.29) and speed of responding during working memory performance (p=0.02, η(2)=0.35), but not accuracy (p=0.12, η(2)=0.16). No effect of tDCS on verbal learning, retention, or retrieval was found for stimulation targeted to the LMTL or the PT. Secondary analyses revealed that LMTL stimulation resulted in increased recency (p=0.02, η(2)=0.31) and reduced mid-list learning effects (p=0.01, η(2)=0.39), suggesting an inhibitory effect on learning. HD-tDCS to the LDLPFC facilitates the rate of verbal learning and improved efficiency of working memory may underlie performance effects. This focal method of administrating tDCS has potential for probing

  12. Direct Cellular Lysis/Protein Extraction Protocol for Soil Metaproteomics

    Energy Technology Data Exchange (ETDEWEB)

    Chourey, Karuna [ORNL; Jansson, Janet [Lawrence Berkeley National Laboratory (LBNL); Verberkmoes, Nathan C [ORNL; Shah, Manesh B [ORNL; Chavarria, Krystle L. [Lawrence Berkeley National Laboratory (LBNL); Tom, Lauren M [Lawrence Berkeley National Laboratory (LBNL); Brodie, Eoin L. [Lawrence Berkeley National Laboratory (LBNL); Hettich, Robert {Bob} L [ORNL

    2010-01-01

    We present a novel direct protocol for deep proteome characterization of microorganisms in soil. The method employs thermally assisted detergent-based cellular lysis (SDS) of soil samples, followed by TCA precipitation for proteome extraction/cleanup prior to liquid chromatography-mass spectrometric characterization. This approach was developed and optimized using different soils inoculated with genome-sequenced bacteria (Gram-negative Pseudomonas putida or Gram-positive Arthrobacter chlorophenolicus). Direct soil protein extraction was compared to protein extraction from cells isolated from the soil matrix prior to lysis (indirect method). Each approach resulted in identification of greater than 500 unique proteins, with a wide range in molecular mass and functional categories. To our knowledge, this SDS-TCA approach enables the deepest proteome characterizations of microbes in soil to date, without significant biases in protein size, localization, or functional category compared to pure cultures. This protocol should provide a powerful tool for ecological studies of soil microbial communities.

  13. Sliding spool design for reducing the actuation forces in direct operated proportional directional valves: Experimental validation

    International Nuclear Information System (INIS)

    Amirante, Riccardo; Distaso, Elia; Tamburrano, Paolo

    2016-01-01

    Highlights: • An innovative procedure to design a commercial proportional directional valve is shown. • Experimental tests are performed to demonstrate the flow force reduction. • The design is improved by means of a previously made optimization procedure. • Great reduction in the flow forces without reducing the flow rate is demonstrated. - Abstract: This paper presents the experimental validation of a new methodology for the design of the spool surfaces of four way three position direct operated proportional directional valves. The proposed methodology is based on the re-design of both the compensation profile (the central conical surface of the spool) and the lateral surfaces of the spool, in order to reduce the flow forces acting on the spool and hence the actuation forces. The aim of this work is to extend the application range of these valves to higher values of pressure and flow rate, thus avoiding the employment of more expensive two stage configurations in the case of high-pressure conditions and/or flow rate. The paper first presents a theoretical approach and a general strategy for the sliding spool design to be applied to any four way three position direct operated proportional directional valve. Then, the proposed approach is experimentally validated on a commercially available valve using a hydraulic circuit capable of measuring the flow rate as well as the actuation force over the entire spool stroke. The experimental results, performed using both the electronic driver provided by the manufacturer and a manual actuation system, show that the novel spool surface requires remarkably lower actuation forces compared to the commercial configuration, while maintaining the same flow rate trend as a function of the spool position.

  14. Direct vs. indirect pathway of hepatic glycogen synthesis as a function of glucose infusion rate

    International Nuclear Information System (INIS)

    Bagby, G.J.; Lang, C.H.; Johnson, J.L.; Blakesly, H.L.; Spitzer, J.J.

    1986-01-01

    This study was initiated to determine the influence of the rate of exogenous glucose administration on liver glycogen synthesis by the direct (glucose uptake and incorporation into glycogen) vs the indirect pathway (glucose degradation to 3-carbon intermediates, e.g., lactate, prior to incorporation into glycogen). Catheterized rats were fasted 2 days prior to receiving a 3 hr infusion of glucose at rates of 0 to 230 μmol/min/kg containing tracer [6- 3 H]- and [U- 14 C]-glucose. Plasma glucose (r = 0.80), insulin (r = 0.90) and lactate (r = 0.84) were correlated with glucose infusion rate. The rate of liver glycogen deposition (0.46 +/- 0.03 μmol/min/g) did not differ between a glucose infusion rate of 20 and 230 μmol/min/kg. At the lowest and highest glucose infusion rates hepatic glycogenesis accounted for 87 +/- 6 and 9 +/- 1% of the total glucose load, respectively. The percent contribution of the direct pathways to glycogen deposition ([ 3 H] specific activity in hepatic glycogen/[ 3 H] specific activity in plasma glucose) increased from 16 +/- 3 to 83 +/- 5% from lowest to highest glucose infusion rates (prevailing plasma glucose concentrations: 9 +/- 1 and 21 +/- 2 mM, respectively). The results indicate that the relative contribution of the direct and indirect pathways of glucogen synthesis are dependent upon the glucose load or plasma glucose concentration

  15. On Gap Functions for Quasi-Variational Inequalities

    Directory of Open Access Journals (Sweden)

    Kouichi Taji

    2008-01-01

    Full Text Available For variational inequalities, various merit functions, such as the gap function, the regularized gap function, the D-gap function and so on, have been proposed. These functions lead to equivalent optimization formulations and are used to optimization-based methods for solving variational inequalities. In this paper, we extend the regularized gap function and the D-gap functions for a quasi-variational inequality, which is a generalization of the variational inequality and is used to formulate generalized equilibrium problems. These extensions are shown to formulate equivalent optimization problems for quasi-variational inequalities and are shown to be continuous and directionally differentiable.

  16. Analysis of primary cilia in directional cell migration in fibroblasts

    DEFF Research Database (Denmark)

    Christensen, Søren Tvorup; Veland, Iben; Schwab, Albrecht

    2013-01-01

    summarize selected methods in analyzing ciliary function in directional cell migration, including immunofluorescence microscopy, scratch assay, and chemotaxis assay by micropipette addition of PDGFRα ligands to cultures of fibroblasts. These methods should be useful not only in studying cell migration....... In particular, platelet-derived growth factor receptor alpha (PDGFRα) is compartmentalized to the primary cilium to activate signaling pathways that regulate reorganization of the cytoskeleton required for lamellipodium formation and directional migration in the presence of a specific ligand gradient. We...

  17. Functional genomics by mass spectrometry

    DEFF Research Database (Denmark)

    Andersen, Jens S.; Mann, M

    2000-01-01

    Systematic analysis of the function of genes can take place at the oligonucleotide or protein level. The latter has the advantage of being closest to function, since it is proteins that perform most of the reactions necessary for the cell. For most protein based ('proteomic') approaches to gene f...... numbers of intact proteins by mass spectrometry directly. Examples from this laboratory illustrate biological problem solving by modern mass spectrometric techniques. These include the analysis of the structure and function of the nucleolus and the analysis of signaling complexes....

  18. A centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria.

    Science.gov (United States)

    Choi, Goro; Jung, Jae Hwan; Park, Byung Hyun; Oh, Seung Jun; Seo, Ji Hyun; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok

    2016-06-21

    In this study, we developed a centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria contaminated milk samples. The microdevice was designed to contain identical triplicate functional units and each unit has four reaction chambers, thereby making it possible to perform twelve direct-RPA reactions simultaneously. The integrated microdevice consisted of two layers: RPA reagents were injected in the top layer, while spiked milk samples with food poisoning bacteria were loaded into sample reservoirs in the bottom layer. For multiplex bacterial detection, the target gene-specific primers and probes were dried in each reaction chamber. The introduced samples and reagents could be equally aliquoted and dispensed into each reaction chamber by centrifugal force, and then the multiplex direct-RPA reaction was executed. The target genes of bacteria spiked in milk could be amplified at 39 °C without a DNA extraction step by using the direct-RPA cocktails, which were a combination of a direct PCR buffer and RPA enzymes. As the target gene amplification proceeded, the increased fluorescence signals coming from the reaction chambers were recorded in real-time at an interval of 2 min. The entire process, including the sample distribution, the direct-RPA reaction, and the real-time analysis, was accomplished with a custom-made portable genetic analyzer and a miniaturized optical detector. Monoplex, duplex, and triplex food poisoning bacteria (Salmonella enterica, Escherichia coli O157:H7, and Vibrio parahaemolyticus) detection was successfully performed with a detection sensitivity of 4 cells per 3.2 μL of milk samples within 30 min. By implementing the direct-PRA on the miniaturized centrifugal microsystem, the on-site food poisoning bacteria analysis would be feasible with high speed, sensitivity, and multiplicity.

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. Teaching Paraprofessionals to Implement Function-Based Interventions

    Science.gov (United States)

    Walker, Virginia L.; Snell, Martha E.

    2017-01-01

    The purpose of this study was to evaluate the effects of workshops and coaching on paraprofessional implementation of function-based interventions. The results of indirect and direct functional behavior assessment guided the development of intervention strategies for three students with autism and intellectual disability. Following intervention,…