WorldWideScience

Sample records for direct wimp detection

  1. Working Group Report: WIMP Dark Matter Direct Detection

    International Nuclear Information System (INIS)

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-01-01

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  2. Working Group Report: WIMP Dark Matter Direct Detection

    Energy Technology Data Exchange (ETDEWEB)

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-10-30

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  3. Understanding WIMP-baryon interactions with direct detection: a roadmap

    International Nuclear Information System (INIS)

    Gluscevic, Vera; Peter, Annika H.G.

    2014-01-01

    We study prospects of dark-matter direct-detection searches for probing non-relativistic effective theory for WIMP-baryon scattering. We simulate a large set of noisy recoil-energy spectra for different scattering scenarios (beyond the standard momentum-independent contact interaction), for Generation 2 and futuristic experiments. We analyze these simulations and quantify the probability of successfully identifying the operator governing the scattering, if a WIMP signal is observed. We find that the success rate depends on a combination of factors: the WIMP mass, the mediator mass, the type of interaction, and the experimental energy window. For example, for a 20 GeV WIMP, Generation 2 is only likely to identify the right operator if the interaction is Coulomb-like, and is unlikely to do so in any other case. For a WIMP with a mass of 200 GeV or higher, success is almost guaranteed. We also find that, regardless of the scattering model and the WIMP parameters, a single Generation 2 experiment is unlikely to successfully discern the momentum dependence of the underlying operator on its own, but prospects improve drastically when experiments with different target materials and energy windows are analyzed jointly. Furthermore, we examine the quality of parameter estimation and degeneracies in the multi-dimensional parameter space of the effective theory. We find in particular that the resulting WIMP mass estimates can be severely biased if data are analyzed assuming the standard (momentum-independent) operator while the actual operator has momentum-dependence. Finally, we evaluate the ultimate reach of direct detection, finding that the prospects for successful operator selection prior to reaching the irreducible backgrounds are excellent, if the signal is just below the current limits, but slim if Generation 2 does not report WIMP detection

  4. Readout technologies for directional WIMP Dark Matter detection

    International Nuclear Information System (INIS)

    Battat, J.B.R.; Irastorza, I.G.; Aleksandrov, A.; Asada, T.; Baracchini, E.; Billard, J.; Bosson, G.; Bourrion, O.; Bouvier, J.; Buonaura, A.; Burdge, K.; Cebrián, S.

    2016-01-01

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  5. Model-independent determination of the WIMP mass from direct dark matter detection data

    International Nuclear Information System (INIS)

    Drees, Manuel; Shan, Chung-Lin

    2008-01-01

    Weakly interacting massive particles (WIMPs) are one of the leading candidates for dark matter. We develop a model-independent method for determining the mass m χ of the WIMP by using data (i.e. measured recoil energies) of direct detection experiments. Our method is independent of the as yet unknown WIMP density near the Earth, of the form of the WIMP velocity distribution, as well as of the WIMP–nucleus cross section. However, it requires positive signals from at least two detectors with different target nuclei. In a background-free environment, m χ ∼50 GeV could in principle be determined with an error of ∼35% with only 2 × 50 events; in practice, upper and lower limits on the recoil energy of signal events, imposed to reduce backgrounds, can increase the error. The method also loses precision if m χ significantly exceeds the mass of the heaviest target nucleus used

  6. The Diurnal Variation of the Wimp Detection Event Rates in Directional Experiments

    CERN Document Server

    Vergados, J D

    2009-01-01

    The recent WMAP data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Modern particle theories naturally provide viable cold dark matter candidates with masses in the GeV-TeV region. Supersymmetry provides the lightest supersymmetric particle (LSP), theories in extra dimensions supply the lightest Kaluza-Klein particle (LKP) etc. The nature of dark matter can only be unraveled only by its direct detection in the laboratory. All such candidates will be called WIMPs (Weakly Interacting Massive Particles). In any case the direct dark matter search, which amounts to detecting the recoiling nucleus, following its collision with WIMP, is central to particle physics and cosmology. In this work we briefly review the theoretical elements relevant to the direct dark matter detection experiments, paying particular attention to directional experiments. i.e experiments in which, not only the energy but the direction of the recoiling nucleus is ob...

  7. Halo-independent analysis of direct detection data for light WIMPs

    International Nuclear Information System (INIS)

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng; Gondolo, Paolo

    2013-01-01

    We present a halo-independent analysis of direct detection data on ''light WIMPs'', i.e. weakly interacting massive particles with mass close to or below 10 GeV/c 2 . We include new results from silicon CDMS detectors (bounds and excess events), the latest CoGeNT acceptances, and recent measurements of low sodium quenching factors in NaI crystals. We focus on light WIMPs with spin-independent isospin-conserving and isospin-violating interactions with nucleons. For these dark matter candidates we find that a low quenching factor would make the DAMA modulation incompatible with a reasonable escape velocity for the dark matter halo, and that the tension among experimental data tightens in both the isospin-conserving and isospin-violating scenarios. We also find that a new although milder tension appears between the CoGeNT and DAMA annual modulations on one side and the silicon excess events on the other, in that it seems difficult to interpret them as the modulated and unmodulated aspects of the same WIMP dark matter signal

  8. A Study of Nuclear Recoils in Liquid Argon Time Projection Chamber for the Direct Detection of WIMP Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Huajie [Princeton Univ., NJ (United States)

    2014-11-01

    Robust results of WIMP direct detection experiments depend on rm understandings of nuclear recoils in the detector media. This thesis documents the most comprehensive study to date on nuclear recoils in liquid argon - a strong candidate for the next generation multi-ton scale WIMP detectors. This study investigates both the energy partition from nuclear recoil energy to secondary modes (scintillation and ionization) and the pulse shape characteristics of scintillation from nuclear recoils.

  9. Direct detection of WIMPs: implications of a self-consistent truncated isothermal model of the Milky Way's dark matter halo

    Science.gov (United States)

    Chaudhury, Soumini; Bhattacharjee, Pijushpani; Cowsik, Ramanath

    2010-09-01

    Direct detection of Weakly Interacting Massive Particle (WIMP) candidates of Dark Matter (DM) is studied within the context of a self-consistent truncated isothermal model of the finite-size dark halo of the Galaxy. The halo model, based on the ``King model'' of the phase space distribution function of collisionless DM particles, takes into account the modifications of the phase-space structure of the halo due to the gravitational influence of the observed visible matter in a self-consistent manner. The parameters of the halo model are determined by a fit to a recently determined circular rotation curve of the Galaxy that extends up to ~ 60 kpc. Unlike in the Standard Halo Model (SHM) customarily used in the analysis of the results of WIMP direct detection experiments, the velocity distribution of the WIMPs in our model is non-Maxwellian with a cut-off at a maximum velocity that is self-consistently determined by the model itself. For our halo model that provides the best fit to the rotation curve data, the 90% C.L. upper limit on the WIMP-nucleon spin-independent cross section from the recent results of the CDMS-II experiment, for example, is ~ 5.3 × 10-8 pb at a WIMP mass of ~ 71 GeV. We also find, using the original 2-bin annual modulation amplitude data on the nuclear recoil event rate seen in the DAMA experiment, that there exists a range of small WIMP masses, typically ~ 2-16 GeV, within which DAMA collaboration's claimed annual modulation signal purportedly due to WIMPs is compatible with the null results of other experiments. These results, based as they are on a self-consistent model of the dark matter halo of the Galaxy, strengthen the possibility of low-mass (lsim10 GeV) WIMPs as a candidate for dark matter as indicated by several earlier studies performed within the context of the SHM. A more rigorous analysis using DAMA bins over smaller intervals should be able to better constrain the ``DAMA regions'' in the WIMP parameter space within the context of

  10. Anisotropic dark matter distribution functions and impact on WIMP direct detection

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Schwetz, Thomas; Catena, Riccardo

    2013-01-01

    Dark matter N-body simulations suggest that the velocity distribution of dark matter is anisotropic. In this work we employ a mass model for the Milky Way whose parameters are determined from a fit to kinematical data. Then we adopt an ansatz for the dark matter phase space distribution which allows to construct self-consistent halo models which feature a degree of anisotropy as a function of the radius such as suggested by the simulations. The resulting velocity distributions are then used for an analysis of current data from dark matter direct detection experiments. We find that velocity distributions which are radially biased at large galactocentric distances (up to the virial radius) lead to an increased high velocity tail of the local dark matter distribution. This affects the interpretation of data from direct detection experiments, especially for dark matter masses around 10 GeV, since in this region the high velocity tail is sampled. We find that the allowed regions in the dark matter mass-cross section plane as indicated by possible hints for a dark matter signal reported by several experiments as well as conflicting exclusion limits from other experiments shift in a similar way when the halo model is varied. Hence, it is not possible to improve the consistency of the data by referring to anisotropic halo models of the type considered in this work

  11. The local dark matter phase-space density and impact on WIMP direct detection

    International Nuclear Information System (INIS)

    Catena, Riccardo; Ullio, Piero

    2012-01-01

    We present a new determination of the local dark matter phase-space density. This result is obtained implementing, in the limit of isotropic velocity distribution and spherical symmetry, Eddington's inversion formula, which links univocally the dark matter distribution function to the density profile, and applying, within a Bayesian framework, a Markov Chain Monte Carlo algorithm to sample mass models for the Milky Way against a broad and variegated sample of dynamical constraints. We consider three possible choices for the dark matter density profile, namely the Einasto, NFW and Burkert profiles, finding that the velocity dispersion, which characterizes the width in the distribution, tends to be larger for the Burkert case, while the escape velocity depends very weakly on the profile, with the mean value we obtain being in very good agreement with estimates from stellar kinematics. The derived dark matter phase-space densities differ significantly — most dramatically in the high velocity tails — from the model usually taken as a reference in dark matter detection studies, a Maxwell-Boltzmann distribution with velocity dispersion fixed in terms of the local circular velocity and with a sharp truncation at a given value of the escape velocity. We discuss the impact of astrophysical uncertainties on dark matter scattering rates and direct detection exclusion limits, considering a few sample cases and showing that the most sensitive ones are those for light dark matter particles and for particles scattering inelastically. As a general trend, regardless of the assumed profile, when adopting a self-consistent phase-space density, we find that rates are larger, and hence exclusion limits stronger, than with the standard Maxwell-Boltzmann approximation. Tools for applying our result on the local dark matter phase-space density to other dark matter candidates or experimental setups are provided

  12. NEWSdm: Nuclear Emulsions for WIMP Search with directional measurement

    Directory of Open Access Journals (Sweden)

    Di Crescenzo A.

    2017-01-01

    Full Text Available Direct Dark Matter searches are nowadays one of the most exciting research topics. Several experimental efforts are concentrated on the development, construction, and operation of detectors looking for the scattering of target nuclei with Weakly Interactive Massive Particles (WIMPs. The measurement of the direction of WIMP-induced nuclear recoils is a challenging strategy to extend dark matter searches beyond the neutrino floor and provide an unambiguous signature of the detection of Galactic dark matter. Current directional experiments are based on the use of gas TPC whose sensitivity is strongly limited by the small achievable detector mass. We present an innovative directional experiment based on the use of a solid target made by newly developed nuclear emulsions and read-out systems reaching a position resolution of the order of 10 nm.

  13. NEWSdm: Nuclear Emulsions for WIMP Search with directional measurement

    Science.gov (United States)

    Di Crescenzo, A.

    2017-12-01

    Direct Dark Matter searches are nowadays one of the most exciting research topics. Several experimental efforts are concentrated on the development, construction, and operation of detectors looking for the scattering of target nuclei with Weakly Interactive Massive Particles (WIMPs). The measurement of the direction of WIMP-induced nuclear recoils is a challenging strategy to extend dark matter searches beyond the neutrino floor and provide an unambiguous signature of the detection of Galactic dark matter. Current directional experiments are based on the use of gas TPC whose sensitivity is strongly limited by the small achievable detector mass. We present an innovative directional experiment based on the use of a solid target made by newly developed nuclear emulsions and read-out systems reaching a position resolution of the order of 10 nm.

  14. Direct detection of dark matter with the EDELWEISS-III experiment: signals induced by charge trapping, data analysis and characterization of cryogenic detector sensitivity to low-mass WIMPs

    International Nuclear Information System (INIS)

    Arnaud, Quentin

    2015-01-01

    The EDELWEISS-III experiment is dedicated to direct dark matter searches aiming at detecting WIMPS. These massive particles should account for more than 80% of the mass of the Universe and be detectable through their elastic scattering on nuclei constituting the absorber of a detector. As the expected WIMP event rate is extremely low ( 20 GeV). Finally, a study dedicated to the optimization of solid cryogenic detectors to low mass WIMP searches is presented. This study is performed on simulated data using a statistical test based on a profiled likelihood ratio that allows for statistical background subtraction and spectral shape discrimination. This study combined with results from Run308, has lead the EDELWEISS experiment to favor low mass WIMP searches ( [fr

  15. WIMP detection and slow ion dynamics in carbon nanotube arrays

    International Nuclear Information System (INIS)

    Cavoto, G.; Cirillo, E.N.M.; Cocina, F.; Ferretti, J.; Polosa, A.D.

    2016-01-01

    Large arrays of aligned carbon nanotubes (CNTs), open at one end, could be used as target material for the directional detection of weakly interacting dark matter particles (WIMPs). As a result of a WIMP elastic scattering on a CNT, a carbon ion might be injected in the body of the array and propagate through multiple collisions within the lattice. The ion may eventually emerge from the surface with open end CNTs, provided that its longitudinal momentum is large enough to compensate energy losses and its transverse momentum approaches the channeling conditions in a single CNT. Therefore, the angle formed between the WIMP wind apparent orientation and the direction of parallel carbon nanotube axes must be properly chosen. We focus on very low ion recoil kinetic energies, related to low mass WIMPs (∼ 11 GeV) where most of the existing experiments have low sensitivity. Relying on some exact results on two-dimensional lattices of circular obstacles, we study the low energy ion motion in the transverse plane with respect to CNT directions. New constraints are obtained on how to devise the CNT arrays to maximize the target channeling efficiency. (orig.)

  16. WIMP detection and slow ion dynamics in carbon nanotube arrays

    Energy Technology Data Exchange (ETDEWEB)

    Cavoto, G. [INFN Sezione di Roma, Rome (Italy); Cirillo, E.N.M. [Sapienza Universita di Roma, Dipartimento SBAI, Rome (Italy); Cocina, F. [Sapienza Universita di Roma, Dipartimento di Fisica, Rome (Italy); Ferretti, J. [Sapienza Universita di Roma, Dipartimento di Fisica (Italy); INFN Sezione di Roma, Rome (Italy); Polosa, A.D. [Sapienza Universita di Roma, Dipartimento di Fisica (Italy); CERN, Theory Division, Geneva (Switzerland); INFN Sezione di Roma, Rome (Italy)

    2016-06-15

    Large arrays of aligned carbon nanotubes (CNTs), open at one end, could be used as target material for the directional detection of weakly interacting dark matter particles (WIMPs). As a result of a WIMP elastic scattering on a CNT, a carbon ion might be injected in the body of the array and propagate through multiple collisions within the lattice. The ion may eventually emerge from the surface with open end CNTs, provided that its longitudinal momentum is large enough to compensate energy losses and its transverse momentum approaches the channeling conditions in a single CNT. Therefore, the angle formed between the WIMP wind apparent orientation and the direction of parallel carbon nanotube axes must be properly chosen. We focus on very low ion recoil kinetic energies, related to low mass WIMPs (∼ 11 GeV) where most of the existing experiments have low sensitivity. Relying on some exact results on two-dimensional lattices of circular obstacles, we study the low energy ion motion in the transverse plane with respect to CNT directions. New constraints are obtained on how to devise the CNT arrays to maximize the target channeling efficiency. (orig.)

  17. WIMP detection and slow ion dynamics in carbon nanotube arrays.

    Science.gov (United States)

    Cavoto, G; Cirillo, E N M; Cocina, F; Ferretti, J; Polosa, A D

    2016-01-01

    Large arrays of aligned carbon nanotubes (CNTs), open at one end, could be used as target material for the directional detection of weakly interacting dark matter particles (WIMPs). As a result of a WIMP elastic scattering on a CNT, a carbon ion might be injected in the body of the array and propagate through multiple collisions within the lattice. The ion may eventually emerge from the surface with open end CNTs, provided that its longitudinal momentum is large enough to compensate energy losses and its transverse momentum approaches the channeling conditions in a single CNT. Therefore, the angle formed between the WIMP wind apparent orientation and the direction of parallel carbon nanotube axes must be properly chosen. We focus on very low ion recoil kinetic energies, related to low mass WIMPs ([Formula: see text] GeV) where most of the existing experiments have low sensitivity. Relying on some exact results on two-dimensional lattices of circular obstacles, we study the low energy ion motion in the transverse plane with respect to CNT directions. New constraints are obtained on how to devise the CNT arrays to maximize the target channeling efficiency.

  18. WIMP detection and slow ion dynamics in carbon nanotube arrays

    CERN Document Server

    Cavoto, G.; Cocina, F.; Ferretti, J.; Polosa, A.D.

    2016-06-24

    Large arrays of aligned carbon nanotubes (CNTs), open at one end, could be used as target material for the directional detection of weakly interacting dark matter particles (WIMPs). As a result of a WIMP elastic scattering on a CNT, a carbon ion might be injected in the body of the array and propagate through multiple collisions within the lattice. The ion may eventually emerge from the surface with open end CNTs, provided that its longitudinal momentum is large enough to compensate energy losses and its transverse momentum approaches the channeling conditions in a single CNT. Therefore, the angle formed between the WIMP wind apparent orientation and the direction of parallel carbon nanotube axes must be properly chosen. We focus on very low ion recoil kinetic energies, related to low mass WIMPs (~ 10 GeV) where most of the existing experiments have low sensitivity. Relying on some exact results on two-dimensional lattices of circular obstacles, we study the low energy ion motion in the transverse plane with ...

  19. Beyond WIMP: From Theory to Detection of Sub-GeV Dark Matter

    CERN Multimedia

    CERN. Geneva

    2014-01-01

    The existence of dark matter has been well established with overwhelming evidence, but its particle identity is still unknown. For more than three decades, significant theoretical and experimental efforts have been directed towards the search for a Weakly Interacting Massive Particle (WIMP), often overlooking other possibilities. The lack of an unambiguous positive WIMP signal, at both indirect- and direct-detection experiments and at the LHC, stresses the need to expand dark matter research into additional theoretical scenarios and, more importantly, to develop new experimental capabilities that go beyond the limitations of WIMP detection. In this talk I will discuss new theoretical ideas and experimental avenues for searching for light, sub-GeV dark matter. Some emphasis will be given to direct detection experiments, where several new strategies to directly detect dark matter particles with MeV to GeV mass, far below standard direct detection capabilities, are developed.

  20. Optimization of the energy resolution and of the radioactive background rejection for ionization-heat detectors equipped with thermometric thin films for the direct WIMPs detection

    International Nuclear Information System (INIS)

    Dolgorouky, Y.W.

    2008-09-01

    The EDELWEISS experiment aims at the direct detection of WIMPs as possible candidates for dark matter. It uses heat-and-ionization detectors that can discriminate these particles from the radioactive background. To date, this method is limited by events with incomplete charge collection that occur just beneath the detectors electrodes. In order to identify and reject these undesirable events, we have developed detectors equipped with thin films used both as thermometers - and hence sensitive to the transient athermal regime - and as electrodes for the charge collection. This thesis focuses on the optimization of such thin films regarding surface events rejection and on the modelling of the physical processes enabling this identification. The optimization must both maximize the fiducial volume and conserve an energy resolution such that the recoil energy threshold is of the order of 30 keV. Our work explores four generations of detectors each of which corresponds to successive evolutions in their conception. In all cases, the electrode-thermometer is an amorphous Anderson insulator NbSi thin film polarized by two interleaved comb-shaped niobium electrodes. In spite of constant progress in the successive detectors performances, the latest generation does not display the performances required for the EDELWEISS II experiment. Our work has shown the difficulty of the transient thermal signal modelling due to the complex contribution of the charge collection. This works has lead to new ideas regarding the detectors configuration, so that the athermal regime can be optimized to enhance both the rejection capability and the resolution. (author)

  1. Optimization of the energy resolution and of the radioactive background rejection for ionization-heat detectors equipped with thermometric thin films for the direct WIMPs detection; Optimisation du pouvoir de resolution et du rejet du fond radioactif de detecteurs ionisation-chaleur equipes de couches minces thermometriques pour la detection directe de WIMPS

    Energy Technology Data Exchange (ETDEWEB)

    Dolgorouky, Y.W.

    2008-09-15

    The EDELWEISS experiment aims at the direct detection of WIMPs as possible candidates for dark matter. It uses heat-and-ionization detectors that can discriminate these particles from the radioactive background. To date, this method is limited by events with incomplete charge collection that occur just beneath the detectors electrodes. In order to identify and reject these undesirable events, we have developed detectors equipped with thin films used both as thermometers - and hence sensitive to the transient athermal regime - and as electrodes for the charge collection. This thesis focuses on the optimization of such thin films regarding surface events rejection and on the modelling of the physical processes enabling this identification. The optimization must both maximize the fiducial volume and conserve an energy resolution such that the recoil energy threshold is of the order of 30 keV. Our work explores four generations of detectors each of which corresponds to successive evolutions in their conception. In all cases, the electrode-thermometer is an amorphous Anderson insulator NbSi thin film polarized by two interleaved comb-shaped niobium electrodes. In spite of constant progress in the successive detectors performances, the latest generation does not display the performances required for the EDELWEISS II experiment. Our work has shown the difficulty of the transient thermal signal modelling due to the complex contribution of the charge collection. This works has lead to new ideas regarding the detectors configuration, so that the athermal regime can be optimized to enhance both the rejection capability and the resolution. (author)

  2. The WIMP Forest: Indirect Detection of a Chiral Square

    Energy Technology Data Exchange (ETDEWEB)

    Bertone, Gianfranco; Jackson, C.B.; Shaughnessy, Gabe; Tait, Tim M.P.; Vallinotto, Alberto

    2009-04-01

    The spectrum of photons arising from WIMP annihilation carries a detailed imprint of the structure of the dark sector. In particular, loop-level annihilations into a photon and another boson can in principle lead to a series of lines (a WIMP forest) at energies up to the WIMP mass. A specific model which illustrates this feature nicely is a theory of two universal extra dimensions compactified on a chiral square. Aside from the continuum emission, which is a generic prediction of most dark matter candidates, we find a 'forest' of prominent annihilation lines that, after convolution with the angular resolution of current experiments, leads to a distinctive (2-bump plus continuum) spectrum, which may be visible in the near future with the Fermi Gamma-Ray Space Telescope (formerly known as GLAST).

  3. 6th Patras workshop on axions, WIMPs and WISPs (PATRAS 2010). Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Baudis, Laura; Schumann, Marc (eds.)

    2010-11-15

    The following topics were dealt with: Axions, WIMPs, WISPs, and neutrinos in the universe, laboratory experimental searching for WISPs, astrophysical experimental searching for WISPs, direct and indirect detection of WIMPs, new ideas and developments, visions, large laboratories. (HSI)

  4. 6th Patras workshop on axions, WIMPs and WISPs (PATRAS 2010). Proceedings

    International Nuclear Information System (INIS)

    Baudis, Laura; Schumann, Marc

    2010-11-01

    The following topics were dealt with: Axions, WIMPs, WISPs, and neutrinos in the universe, laboratory experimental searching for WISPs, astrophysical experimental searching for WISPs, direct and indirect detection of WIMPs, new ideas and developments, visions, large laboratories. (HSI)

  5. Accurate calculations of the WIMP halo around the Sun and prospects for its gamma-ray detection

    International Nuclear Information System (INIS)

    Sivertsson, Sofia; Edsjoe, Joakim

    2010-01-01

    Galactic weakly interacting massive particles (WIMPs) may scatter off solar nuclei to orbits gravitationally bound to the Sun. Once bound, the WIMPs continue to lose energy by repeated scatters in the Sun, eventually leading to complete entrapment in the solar interior. While the density of the bound population is highest at the center of the Sun, the only observable signature of WIMP annihilations inside the Sun is neutrinos. It has been previously suggested that although the density of WIMPs just outside the Sun is lower than deep inside, gamma rays from WIMP annihilation just outside the surface of the Sun, in the so-called WIMP halo around the Sun, may be more easily detected. We here revisit this problem using detailed Monte Carlo simulations and detailed composition and structure information about the Sun to estimate the size of the gamma-ray flux. Compared to earlier simpler estimates, we find that the gamma-ray flux from WIMP annihilations in the solar WIMP halo would be negligible; no current or planned detectors would be able to detect this flux.

  6. Results and status of the Edelweiss Wimp search experiment; Experience Edelweiss de recherche directe de Wimps: resultats et perspectives

    Energy Technology Data Exchange (ETDEWEB)

    Benoit, A.; Berge, L.; Blumer, J.; Broniatowski, A.; Censier, B.; Chabert, L.; Chambon, B.; Chapellier, M.; Chardin, G.; Charvin, P.; Jesus, M. de; Drain, D.; Di Stefano, P.; Dumoulin, L.; Eitel, K.; Fesquet, M.; Firucci, S.; Gascon, J.; Gerbier, G.; Gerlic, E.; Goldbach, C.; Goyot, M.; Gros, M.; Habermahl, F.; Horn, M.; Hadjout, J.P.; Herve, S.; Juillard, A.; Kikuchi, C.; Lesquen, A. de; Luca, M.; Mallet, J.; Marnieros, S.; Martineau, O.; Mosca, L.; Navick, X.F.; Nollez, G.; Pari, P.; Riccio, C.; Sanglard, V.; Stern, M.; Vagneron, L.; Villard, V

    2005-07-01

    In the Edelweiss experiment, nuclear recoils induced by elastic collisions with WIMPs (weakly interacting massive particle) from the galactic halo are identified in low-temperature Ge detectors where the ratio of the heat and ionization signals provide an event-by-event discrimination of nuclear recoils from the dominant background coming from {gamma}-rays interactions. The Edelweiss experiment is located in the Modane underground facility in order to cut the muon flux drastically. We present here the results obtained during the first part of the experiment named Edelweiss-I that ended in the beginning of 2004. Since october 2002, 3 optimized 320 grams detectors have been simultaneously operated at a regulated temperature of 0.017 K and about 50 kg*day were added to the previous published data. These data are still under analysis but preliminary results concerning the upper limit at 90% CL (confidence level) confirm the limit already published in 2002. The first run of Edelweiss-II is due to begin during summer 2005, we are expecting to gain 2 orders of magnitude in terms of detector sensitivity and reach 0.002 events/day*kg. (A.C.)

  7. The Fraternal WIMP Miracle

    CERN Document Server

    Craig, Nathaniel

    2015-01-01

    We identify and analyze thermal dark matter candidates in the fraternal twin Higgs model and its generalizations. The relic abundance of fraternal twin dark matter is set by twin weak interactions, with a scale tightly tied to the weak scale of the Standard Model by naturalness considerations. As such, the dark matter candidates benefit from a "fraternal WIMP miracle," reproducing the observed dark matter abundance for dark matter masses between 50 and 150 GeV. However, the couplings dominantly responsible for dark matter annihilation do not lead to interactions with the visible sector. The direct detection rate is instead set via fermionic Higgs portal interactions, which are likewise constrained by naturalness considerations but parametrically weaker than those leading to dark matter annihilation. The predicted direct detection cross section is close to current LUX bounds and presents an opportunity for the next generation of direct detection experiments.

  8. Complementarity of WIMP Sensitivity with direct SUSY, Monojet and Dark Matter Searches in the MSSM

    CERN Document Server

    Arbey, Alexandre; Mahmoudi, Farvah

    2014-01-01

    This letter presents new results on the combined sensitivity of the LHC and underground dark matter search experiments to the lightest neutralino as WIMP candidate in the minimal Supersymmetric extension of the Standard Model. We show that monojet searches significantly extend the sensitivity to the neutralino mass in scenarios where scalar quarks are nearly degenerate in mass with it. The inclusion of the latest bound by the LUX experiment on the neutralino-nucleon spin-independent scattering cross section expands this sensitivity further, highlighting the remarkable complementarity of jets/$\\ell$s+MET and monojet at LHC and dark matter searches in probing models of new physics with a dark matter candidate. The qualitative results of our study remain valid after accounting for theoretical uncertainties.

  9. Dark matter spin determination with directional direct detection experiments

    Science.gov (United States)

    Catena, Riccardo; Conrad, Jan; Döring, Christian; Ferella, Alfredo Davide; Krauss, Martin B.

    2018-01-01

    If dark matter has spin 0, only two WIMP-nucleon interaction operators can arise as leading operators from the nonrelativistic reduction of renormalizable single-mediator models for dark matter-quark interactions. Based on this crucial observation, we show that about 100 signal events at next generation directional detection experiments can be enough to enable a 2 σ rejection of the spin 0 dark matter hypothesis in favor of alternative hypotheses where the dark matter particle has spin 1 /2 or 1. In this context, directional sensitivity is crucial since anisotropy patterns in the sphere of nuclear recoil directions depend on the spin of the dark matter particle. For comparison, about 100 signal events are expected in a CF4 detector operating at a pressure of 30 torr with an exposure of approximately 26,000 cubic-meter-detector days for WIMPs of 100 GeV mass and a WIMP-fluorine scattering cross section of 0.25 pb. Comparable exposures require an array of cubic meter time projection chamber detectors.

  10. Bolometer's development for the detection of dark matter; Instrumentation autour de bolometres pour la recherche de matiere sombre WIMPs

    Energy Technology Data Exchange (ETDEWEB)

    Yvon, D

    2000-06-01

    The author reviews his contributions to the use of bolometers (cryogenic detectors) for the detection of wimps (weakly interactive massive particles). Wimps are detected through their elastic scattering on the nuclei of the detector, a heat signal, luminescence or ionization can be simultaneously detected (at least 2 signals are necessary to discard photon interactions). Bolometers operate at low temperatures (< 50 mK) so they allow very low detection threshold and resolution (< keV) with a full energy conversion for recoiling nuclei. In Saclay the technology of bolometers based on simultaneous detection of heat and ionisation has been developed and improvements have been studied (NbSi thin films bolometers). The first results obtained in the framework of the Edelweiss collaboration are presented. Other developments based on infra-red bolometry (Planck surveyor and Archeops projects) are briefly described. In an appendix the operating principle of a bolometer is presented. (A.C.)

  11. First low WIMP mass results in EDELWEISS III experiment

    Energy Technology Data Exchange (ETDEWEB)

    Scorza, Silvia [Karlsruher Institut fuer Technologie, Institut fuer Experimentelle Kernphysik, Postfach 3640, Karlsruhe (Germany); Collaboration: EDELWEISS-Collaboration

    2016-07-01

    The EDELWEISS-III collaboration is operating an experiment for the direct detection of Weakly Interacting Massive Particle (WIMPs) dark matter in the low radioactivity environment of the Modane Underground Laboratory. It consists of twenty-four advanced high purity germanium detectors operating at 18 mK in a dilution refrigerator in order to identify rare nuclear recoils induced by elastic scattering of WIMPs from our Galactic halo. The current EDELWEISS-III program, including improvements of the background, data-acquisition and the configuration is detailed. Sources of background along with the rejection techniques are discussed. Detector performances and a first low WIMP mass analysis of data acquired in a long-term campaign are presented as well.

  12. Revisiting the direct detection of dark matter in simplified models

    OpenAIRE

    Li, Tong

    2018-01-01

    In this work we numerically re-examine the loop-induced WIMP-nucleon scattering cross section for the simplified dark matter models and the constraint set by the latest direct detection experiment. We consider a fermion, scalar or vector dark matter component from five simplified models with leptophobic spin-0 mediators coupled only to Standard Model quarks and dark matter particles. The tree-level WIMP-nucleon cross sections in these models are all momentum-suppressed. We calculate the non-s...

  13. Higgs dark matter in UEDs: A good WIMP with bad detection prospects

    International Nuclear Information System (INIS)

    Melbéus, Henrik; Merle, Alexander; Ohlsson, Tommy

    2012-01-01

    We study the first Kaluza-Klein excitation of the Higgs boson in universal extra dimensions as a dark matter candidate. The first-level Higgs boson could be the lightest Kaluza-Klein particle, which is stable due to the conservation of Kaluza-Klein parity, in non-minimal models where boundary localized terms modify the mass spectrum. We calculate the relic abundance and find that it agrees with the observed dark matter density if the mass of the first-level Higgs boson is slightly above 2 TeV, not considering coannihilations and assuming no relative mass splitting among the first-level Kaluza-Klein modes. In the case of coannihilations and a non-zero mass splitting, the mass of the first-level Higgs boson can range from 1 TeV to 4 TeV. We study also the prospects for detection of this dark matter candidate in direct as well as indirect detection experiments. Although the first-level Higgs boson is a typical weakly interacting massive particle, an observation in any of the conventional experiments is very challenging.

  14. Direct detection with dark mediators

    Energy Technology Data Exchange (ETDEWEB)

    Curtin, David; Surujon, Ze' ev [C. N. Yang Institute for Theoretical Physics, Stony Brook University, Stony Brook, NY 11794 (United States); Tsai, Yuhsin [Physics Department, University of California Davis, Davis, CA 95616 (United States)

    2014-11-10

    We introduce dark mediator Dark Matter (dmDM) where the dark and visible sectors are connected by at least one light mediator ϕ carrying the same dark charge that stabilizes DM. ϕ is coupled to the Standard Model via an operator q{sup ¯}qϕϕ{sup ⁎}/Λ, and to dark matter via a Yukawa coupling y{sub χ}χ{sup c¯}χϕ. Direct detection is realized as the 2→3 process χN→χ{sup ¯}Nϕ at tree-level for m{sub ϕ}≲10 keV and small Yukawa coupling, or alternatively as a loop-induced 2→2 process χN→χN. We explore the direct-detection consequences of this scenario and find that a heavy O(100 GeV) dmDM candidate fakes different O(10 GeV) standard WIMPs in different experiments. Large portions of the dmDM parameter space are detectable above the irreducible neutrino background and not yet excluded by any bounds. Interestingly, for the m{sub ϕ} range leading to novel direct detection phenomenology, dmDM is also a form of Self-Interacting Dark Matter (SIDM), which resolves inconsistencies between dwarf galaxy observations and numerical simulations.

  15. Directional Sensitivity in Light-Mass Dark Matter Searches with Single-Electron-Resolution Ionization Detectors

    Science.gov (United States)

    Kadribasic, Fedja; Mirabolfathi, Nader; Nordlund, Kai; Sand, Andrea E.; Holmström, Eero; Djurabekova, Flyura

    2018-03-01

    We propose a method using solid state detectors with directional sensitivity to dark matter interactions to detect low-mass weakly interacting massive particles (WIMPs) originating from galactic sources. In spite of a large body of literature for high-mass WIMP detectors with directional sensitivity, no available technique exists to cover WIMPs in the mass range semiconductor detectors allow for directional sensitivity once properly calibrated. We examine the commonly used semiconductor material response to these low-mass WIMP interactions.

  16. Markov chain Monte Carlo analysis to constrain dark matter properties with directional detection

    International Nuclear Information System (INIS)

    Billard, J.; Mayet, F.; Santos, D.

    2011-01-01

    Directional detection is a promising dark matter search strategy. Indeed, weakly interacting massive particle (WIMP)-induced recoils would present a direction dependence toward the Cygnus constellation, while background-induced recoils exhibit an isotropic distribution in the Galactic rest frame. Taking advantage of these characteristic features, and even in the presence of a sizeable background, it has recently been shown that data from forthcoming directional detectors could lead either to a competitive exclusion or to a conclusive discovery, depending on the value of the WIMP-nucleon cross section. However, it is possible to further exploit these upcoming data by using the strong dependence of the WIMP signal with: the WIMP mass and the local WIMP velocity distribution. Using a Markov chain Monte Carlo analysis of recoil events, we show for the first time the possibility to constrain the unknown WIMP parameters, both from particle physics (mass and cross section) and Galactic halo (velocity dispersion along the three axis), leading to an identification of non-baryonic dark matter.

  17. The waning of the WIMP? A review of models, searches, and constraints

    Science.gov (United States)

    Arcadi, Giorgio; Dutra, Maíra; Ghosh, Pradipta; Lindner, Manfred; Mambrini, Yann; Pierre, Mathias; Profumo, Stefano; Queiroz, Farinaldo S.

    2018-03-01

    Weakly Interacting Massive Particles (WIMPs) are among the best-motivated dark matter candidates. No conclusive signal, despite an extensive search program that combines, often in a complementary way, direct, indirect, and collider probes, has been detected so far. This situation might change in near future due to the advent of one/multi-TON Direct Detection experiments. We thus, find it timely to provide a review of the WIMP paradigm with focus on a few models which can be probed at best by these facilities. Collider and Indirect Detection, nevertheless, will not be neglected when they represent a complementary probe.

  18. Theoretical interpretation of experimental data from direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Chung-Lin, Shan

    2007-10-15

    I derive expressions that allow to reconstruct the normalized one-dimensional velocity distribution function of halo WIMPs and to determine its moments from the recoil energy spectrum as well as from experimental data directly. The reconstruction of the velocity distribution function is further extended to take into account the annual modulation of the event rate. All these expressions are independent of the as yet unknown WIMP density near the Earth as well as of the WIMP-nucleus cross section. The only information about the nature of halo WIMPs which one needs is the WIMP mass. I also present a method for the determination of the WIMP mass by combining two (or more) experiments with different detector materials. This method is not only independent of the model of Galactic halo but also of that of WIMPs. (orig.)

  19. Theoretical interpretation of experimental data from direct dark matter detection

    International Nuclear Information System (INIS)

    Shan Chung-Lin

    2007-10-01

    I derive expressions that allow to reconstruct the normalized one-dimensional velocity distribution function of halo WIMPs and to determine its moments from the recoil energy spectrum as well as from experimental data directly. The reconstruction of the velocity distribution function is further extended to take into account the annual modulation of the event rate. All these expressions are independent of the as yet unknown WIMP density near the Earth as well as of the WIMP-nucleus cross section. The only information about the nature of halo WIMPs which one needs is the WIMP mass. I also present a method for the determination of the WIMP mass by combining two (or more) experiments with different detector materials. This method is not only independent of the model of Galactic halo but also of that of WIMPs. (orig.)

  20. TREX-DM: a low-background Micromegas-based TPC for low-mass WIMP detection

    Energy Technology Data Exchange (ETDEWEB)

    Iguaz, F.J.; Garza, J.G.; Castel, J.F.; Cebrian, S.; Dafni, T.; Garcia, J.A.; Irastorza, I.G.; Lagraba, A.; Luzon, G.; Peiro, A. [Universidad de Zaragoza, Grupo de Fisica Nuclear y Astroparticulas, Zaragoza (Spain); Aznar, F. [Universidad de Zaragoza, Grupo de Fisica Nuclear y Astroparticulas, Zaragoza (Spain); Universidad de Zaragoza, Centro Universitario de la Defensa, Zaragoza (Spain)

    2016-10-15

    If Dark Matter is made of Weakly Interacting Massive Particles (WIMPs) with masses below ∝20 GeV, the corresponding nuclear recoils in mainstream WIMP experiments are of energies too close, or below, the experimental threshold. Gas Time Projection Chambers (TPCs) can be operated with a variety of target elements, offer good tracking capabilities and, on account of the amplification in gas, very low thresholds are achievable. Recent advances in electronics and in novel radiopure TPC readouts, especially micro-mesh gas structure (Micromegas), are improving the scalability and low-background prospects of gaseous TPCs. Here we present TREX-DM, a prototype to test the concept of a Micromegas-based TPC to search for low-mass WIMPs. The detector is designed to host an active mass of ∝0.300 kg of Ar at 10 bar, or alternatively ∝0.160 kg of Ne at 10 bar, with an energy threshold below 0.4 keVee, and is fully built with radiopure materials. We will describe the detector in detail, the results from the commissioning phase on surface, as well as a preliminary background model. The anticipated sensitivity of this technique may go beyond current experimental limits for WIMPs of masses of 2-8 GeV. (orig.)

  1. Projected WIMP Sensitivity of the LUX-ZEPLIN (LZ) Dark Matter Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Akerib, D.S.; et al.

    2018-02-16

    LUX-ZEPLIN (LZ) is a next generation dark matter direct detection experiment that will operate 4850 feet underground at the Sanford Underground Research Facility (SURF) in Lead, South Dakota, USA. Using a two-phase xenon detector with an active mass of 7 tonnes, LZ will search primarily for low-energy interactions with Weakly Interacting Massive Particles (WIMPs), which are hypothesized to make up the dark matter in our galactic halo. In this paper, the projected WIMP sensitivity of LZ is presented based on the latest background estimates and simulations of the detector. For a 1000 live day run using a 5.6 tonne fiducial mass, LZ is projected to exclude at 90% confidence level spin-independent WIMP-nucleon cross sections above $1.6 \\times 10^{-48}$ cm$^{2}$ for a 40 $\\mathrm{GeV}/c^{2}$ mass WIMP. Additionally, a $5\\sigma$ discovery potential is projected reaching cross sections below the existing and projected exclusion limits of similar experiments that are currently operating. For spin-dependent WIMP-neutron(-proton) scattering, a sensitivity of $2.7 \\times 10^{-43}$ cm$^{2}$ ($8.1 \\times 10^{-42}$ cm$^{2}$) for a 40 $\\mathrm{GeV}/c^{2}$ mass WIMP is expected. With construction well underway, LZ is on track for underground installation at SURF in 2019 and will start collecting data in 2020.

  2. The capability to detect wimps with a high energy neutrino telescope

    International Nuclear Information System (INIS)

    Blondeau, F.

    1998-05-01

    We studied the potential of the proposed ANTARES undersea neutrino telescope to detect muons coming from from neutralinos annihilating at the center of the Earth. First results show that the full 1 km 3 -scale detector can indicate, after a few years of operation, if there are indeed neutralinos trapped at the core of celestial bodies, as expected are the major form of dark matter in our galaxy. (author)

  3. Phenomenological introduction to direct dark matter detection

    International Nuclear Information System (INIS)

    Gondolo, P.

    1996-01-01

    The dark matter of our galactic halo may be constituted by elementary particles that interact weakly with with ordinary matter (WIMPs). In spite of the very low counting rates expected for these dark matter particle to scatter off nuclei in a laboratory detector, such direct WIMP searches are possible and are experimentally carried out at present. An introduction to the theoretical ingredients entering the counting rates predictions, together with a short discussion of the major theoretical uncertainties, is here presented. (author)

  4. Detection of WIMPs in the Edelweiss experiment. Study of the radioactive background noise and measurements with bolometers; Recherche des wimp's du halo galactique dans l'experience edelweiss: etude du bas bruit radioactif et mesures a l'aide de bolometres a double detection ionisation/chaleur

    Energy Technology Data Exchange (ETDEWEB)

    Miramonti, L. [CEA/Saclay, Dept. d' Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l' Instrumentation Associee (DAPNIA), 91 - Gif-sur-Yvette (France)]|[Paris-11 Univ., 91 - Orsay (France)

    1999-11-01

    This thesis is dedicated to the detection of black matter in the form of WIMPs (weakly interacting massive particle). The characteristics of the interaction of WIMPs with matter are recalled. The very low number of expected events (<1 event/day.Kg) implies a radioactive background noise as weak as possible, furthermore the exponential decrease of the interacting rate with increasing energy calls for detectors with very low thresholds. Bolometers present advantages in WIMPs detection: i) very good resolution and very low thresholds, ii) very broad range of materials that can be used as absorber, the only requirements are: a crystal structure, to be a diamagnetic isolator and to have a convenient Debye temperature, iii) the possibility of detecting ionizing or non-ionizing particles, iv) the possibility of identifying the incident particle by measuring both temperature and another parameter such as ionization or scintillation, and v) the possibility of localizing the interaction inside the absorber by detecting ballistic phonons. The problematic of radioactive background noise is presented and the answers to the different sources (cosmic radiation,natural and artificial radioactivity) generating the background noise are examined. The materials used in the building of the detector and cryostat must be carefully chosen, they should be as little radioactive as possible. The test benches used to select materials for the Edelweiss experiment are described. The first measurements concerning the detectors Ge-4 and Ge-7 are presented. (A.C.)

  5. Wimps and stellar structure

    International Nuclear Information System (INIS)

    Bouquet, A.; Salati, P.

    1988-01-01

    We present the results of an analytic approximation to compute the effects of WIMPs on stellar structures in a self-consistent way. We examine in particular the case of the Sun and of horizontal branch stars

  6. Joint Rome Workshop "Challenges in the Dark Sector: Alternatives to the WIMP paradigm”

    CERN Document Server

    2015-01-01

    Identifying what Dark Matter (DM) is, as well as its nature and properties, remains a major challenge for both theoretical and experimental astroparticle physics communities. In the past decades, WIMP DM has been the most hunted candidate, with the result that nowadays WIMPS are cornered by large amounts of experimental data from Direct Detection, Indirect Detection, and Collider Experiments. If no WIMP signal is detected in the next few years, the possibility that this very appealing theoretical idea is not what Nature has chosen will become even more compelling and will boost theoretical studies and experimental searches for non-WIMP alternatives for DM. The aim of this 3-day meeting is to convene experts on alternatives to the WIMP paradigm to stimulate informal discussions on different possibilities (dark photons, axion-like particles, Majorons, self-interacting dark sectors, just to mention a few). We plan to have only three or four talks each day, and plenty of time to discuss implications of these DM s...

  7. Looking for the WIMP next door

    Science.gov (United States)

    Evans, Jared A.; Gori, Stefania; Shelton, Jessie

    2018-02-01

    We comprehensively study experimental constraints and prospects for a class of minimal hidden sector dark matter (DM) models, highlighting how the cosmological history of these models informs the experimental signals. We study simple `secluded' models, where the DM freezes out into unstable dark mediator states, and consider the minimal cosmic history of this dark sector, where coupling of the dark mediator to the SM was sufficient to keep the two sectors in thermal equilibrium at early times. In the well-motivated case where the dark mediators couple to the Standard Model (SM) via renormalizable interactions, the requirement of thermal equilibrium provides a minimal, UV-insensitive, and predictive cosmology for hidden sector dark matter. We call DM that freezes out of a dark radiation bath in thermal equilibrium with the SM a WIMP next door, and demonstrate that the parameter space for such WIMPs next door is sharply defined, bounded, and in large part potentially accessible. This parameter space, and the corresponding signals, depend on the leading interaction between the SM and the dark mediator; we establish it for both Higgs and vector portal interactions. In particular, there is a cosmological lower bound on the portal coupling strength necessary to thermalize the two sectors in the early universe. We determine this thermalization floor as a function of equilibration temperature for the first time. We demonstrate that direct detection experiments are currently probing this cosmological lower bound in some regions of parameter space, while indirect detection signals and terrestrial searches for the mediator cut further into the viable parameter space. We present regions of interest for both direct detection and dark mediator searches, including motivated parameter space for the direct detection of sub-GeV DM.

  8. Proceedings of the 4th Patras workshop on axions, WIMPs and WISPs

    Energy Technology Data Exchange (ETDEWEB)

    Lindner, Axel; Redondo, Javier; Ringwald, Andreas [eds.

    2008-08-15

    The following topics were dealt with: Physical foundations for WIMPs, axions, and WISPS, signals from astrophysical sources, direct searches for dark matter WIMPs, new theoretical developments, new experimental approaches. (HSI)

  9. Proceedings of the 4th Patras workshop on axions, WIMPs and WISPs

    International Nuclear Information System (INIS)

    Lindner, Axel; Redondo, Javier; Ringwald, Andreas

    2008-08-01

    The following topics were dealt with: Physical foundations for WIMPs, axions, and WISPS, signals from astrophysical sources, direct searches for dark matter WIMPs, new theoretical developments, new experimental approaches. (HSI)

  10. Direct detection of non-baryonic dark matter

    International Nuclear Information System (INIS)

    Nollez, G.

    2003-01-01

    Baryonic matter, which constitutes stars and galaxies, amounts to a few percents of the mass of the universe in agreement with the theory of the big-bang nucleosynthesis. Most of the matter in the universe (approximately 85%) is then non-baryonic and dark. One of the most favoured hypothesis is that this non-baryonic dark matter is constituted by a new type, still undiscovered, of elementary weakly interacting massive particles (wimps). These hypothetical particles would appear as thermal relics from the big-bang era during which they were created. A rich spectrum of new elementary particles is predicted by supersymmetry, the lightest of which is the neutralino. If the dark matter halo of our Milky-way is made of neutralinos, their detection in terrestrial detectors should be possible. Neutralinos are coupled to matter through the electroweak interaction, this implies that the detection rate is extraordinary low. About 10 experiments in the world are dedicated to the search after wimps. A first group of experiments (HDMS, IGEX, DAMA and Zeplin) use 'classical' detectors of nuclear physics, germanium semiconductor diodes or NaI scintillators. A second group (CDMS, Edelweiss) gathers cryogenic phonon ionisation experiments and a third group (CRESST, Rosebud) is based on cryogenic phonon-light experiments. Till now no wimps has been clearly detected, the direct detection story is obviously not concluded, most of the future experiments aim to reach a sensitivity of 10 -44 cm 2 . (A.C.)

  11. Power corrections to the universal heavy WIMP-nucleon cross section

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Chien-Yi; Hill, Richard J.; Solon, Mikhail P.; Wijangco, Alexander M.

    2018-06-01

    WIMP-nucleon scattering is analyzed at order $1/M$ in Heavy WIMP Effective Theory. The $1/M$ power corrections, where $M\\gg m_W$ is the WIMP mass, distinguish between different underlying UV models with the same universal limit and their impact on direct detection rates can be enhanced relative to naive expectations due to generic amplitude-level cancellations at leading order. The necessary one- and two-loop matching calculations onto the low-energy effective theory for WIMP interactions with Standard Model quarks and gluons are performed for the case of an electroweak SU(2) triplet WIMP, considering both the cases of elementary fermions and composite scalars. The low-velocity WIMP-nucleon scattering cross section is evaluated and compared with current experimental limits and projected future sensitivities. Our results provide the most robust prediction for electroweak triplet Majorana fermion dark matter direct detection rates; for this case, a cancellation between two sources of power corrections yields a small total $1/M$ correction, and a total cross section close to the universal limit for $M \\gtrsim {\\rm few} \\times 100\\,{\\rm GeV}$. For the SU(2) composite scalar, the $1/M$ corrections introduce dependence on underlying strong dynamics. Using a leading chiral logarithm evaluation, the total $1/M$ correction has a larger magnitude and uncertainty than in the fermionic case, with a sign that further suppresses the total cross section. These examples provide definite targets for future direct detection experiments and motivate large scale detectors capable of probing to the neutrino floor in the TeV mass regime.

  12. Power corrections to the universal heavy WIMP-nucleon cross section

    Science.gov (United States)

    Chen, Chien-Yi; Hill, Richard J.; Solon, Mikhail P.; Wijangco, Alexander M.

    2018-06-01

    WIMP-nucleon scattering is analyzed at order 1 / M in Heavy WIMP Effective Theory. The 1 / M power corrections, where M ≫mW is the WIMP mass, distinguish between different underlying UV models with the same universal limit and their impact on direct detection rates can be enhanced relative to naive expectations due to generic amplitude-level cancellations at leading order. The necessary one- and two-loop matching calculations onto the low-energy effective theory for WIMP interactions with Standard Model quarks and gluons are performed for the case of an electroweak SU(2) triplet WIMP, considering both the cases of elementary fermions and composite scalars. The low-velocity WIMP-nucleon scattering cross section is evaluated and compared with current experimental limits and projected future sensitivities. Our results provide the most robust prediction for electroweak triplet Majorana fermion dark matter direct detection rates; for this case, a cancellation between two sources of power corrections yields a small total 1 / M correction, and a total cross section close to the universal limit for M ≳ few × 100GeV. For the SU(2) composite scalar, the 1 / M corrections introduce dependence on underlying strong dynamics. Using a leading chiral logarithm evaluation, the total 1 / M correction has a larger magnitude and uncertainty than in the fermionic case, with a sign that further suppresses the total cross section. These examples provide definite targets for future direct detection experiments and motivate large scale detectors capable of probing to the neutrino floor in the TeV mass regime.

  13. Evading direct dark matter detection in Higgs portal models

    Energy Technology Data Exchange (ETDEWEB)

    Arcadi, Giorgio [Max Planck Institut für Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); Gross, Christian, E-mail: christian.gross@helsinki.fi [Department of Physics and Helsinki Institute of Physics, Gustaf Hällströmin katu 2, FI-00014 Helsinki (Finland); Lebedev, Oleg [Department of Physics and Helsinki Institute of Physics, Gustaf Hällströmin katu 2, FI-00014 Helsinki (Finland); Pokorski, Stefan [Institute of Theoretical Physics, University of Warsaw, Pasteura 5, PL-02-093 Warsaw (Poland); Toma, Takashi [Physik-Department T30d, Technische Universität München, James-Franck-Straße, D-85748 Garching (Germany)

    2017-06-10

    Many models of Higgs portal Dark Matter (DM) find themselves under pressure from increasingly tight direct detection constraints. In the framework of gauge field DM, we study how such bounds can be relaxed while retaining the thermal WIMP paradigm. When the hidden sector gauge symmetry is broken via the Higgs mechanism, the hidden sector generally contains unstable states which are lighter than dark matter. These states provide DM with an efficient annihilation channel. As a result, the DM relic abundance and the direct detection limits are controlled by different parameters, and the two can easily be reconciled. This simple setup realizes the idea of “secluded” dark matter naturally.

  14. To catch a WIMP

    International Nuclear Information System (INIS)

    Goldsmith, Donald.

    1995-01-01

    In the rush to account for the missing ''dark matter'' in the universe, many teams of cosmologists are setting up experiments to prove the existence of a hypothetical form of matter called weakly interacting massive particles, or WIMPS. The innovative research ideas developed by these teams are described and compared briefly. (UK)

  15. 5th Patras workshop on axions, WIMPs and WISPs (PATRAS 2009). Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Jaeckel, Joerg; Lindner, Axel; Redondo, Javier [eds.

    2010-06-15

    The following topics were dealt with: Direct searches for dark matter, indirect searches for WIMPS, photon generation and laser polarization experiments, direct axion signals, theoretic WISP developments. (HSI)

  16. 5th Patras workshop on axions, WIMPs and WISPs (PATRAS 2009). Proceedings

    International Nuclear Information System (INIS)

    Jaeckel, Joerg; Lindner, Axel; Redondo, Javier

    2010-06-01

    The following topics were dealt with: Direct searches for dark matter, indirect searches for WIMPS, photon generation and laser polarization experiments, direct axion signals, theoretic WISP developments. (HSI)

  17. The WIMP Paradigm: Current Status

    International Nuclear Information System (INIS)

    Feng, Jonathan

    2011-01-01

    The WIMP paradigm is the glue that joins together much of the high energy and cosmic frontiers. It postulates that most of the matter in the Universe is made of weakly-interacting massive particles, with implications for a broad range of experiments and observations. I will review the WIMP paradigm's underlying motivations, its current status in view of rapid experimental progress on several fronts, and recent theoretical variations on the WIMP paradigm theme.

  18. Exclusion limits on the WIMP nucleon elastic scattering cross-section from the Cryogenic Dark Matter Search

    Energy Technology Data Exchange (ETDEWEB)

    Golwala, Sunil Ramanlal [UC, Berkeley

    2000-01-01

    Extensive evidence indicates that a large fraction of the matter in the universe is nonluminous, nonbaryonic, and “cold” — nonrelativistic at the time matter began to dominate the energy density of the universe. Weakly Interacting Massive Particles (WIMPs) are an excellent candidate for nonbaryonic, cold dark matter. Minimal supersymmetry provides a natural WIMP candidate in the form of the lightest superpartner, with a typical mass Mδ ~ 100 GeV c-2 . WIMPs are expected to have collapsed into a roughly isothermal, spherical halo within which the visible portion of our galaxy resides. They would scatter off nuclei via the weak interaction, potentially allowingtheir direct detection. The Cryogenic Dark Matter Search (CDMS) employs Ge and Si detectors to search for WIMPs via their elastic-scatteringinteractions with nuclei while discriminatingagainst interactions of background particles. The former yield nuclear recoils while the latter produce electron recoils. The ionization yield (the ratio of ionization production to recoil energy in a semiconductor) of a particle interaction differs greatly for nuclear and electron recoils. CDMS detectors measure phonon and electron-hole-pair production to determine recoil energy and ionization yield for each event and thereby discriminate nuclear recoils from electron recoils. This dissertation reports new limits on the spin-independent WIMP-nucleon elastic-scattering cross section that exclude unexplored parameter space above 10 GeV c-2 WIMP mass and, at > 75% CL, the entire 3σ allowed region for the WIMP signal reported by the DAMA experiment. The experimental apparatus, detector performance, and data analysis are fully described.

  19. A Search for WIMP Dark Matter Using the First Five-Tower Run of the Cryogenic Dark Matter Search

    Energy Technology Data Exchange (ETDEWEB)

    Filippini, Jeffrey Peter [UC, Berkeley

    2008-01-01

    In recent decades astronomers and physicists have accumulated a vast array of evidence that the bulk of the universe's matter is in some non-baryonic form that remains undetected by electromagnetic means. This \\dark matter" resides in diuse halos surrounding galaxies and other cosmic structures. Particle theorists have proposed a wide array of candidates for its nature. One particularly promising class of candidates are Weakly Interacting Massive Particles (WIMPs): quanta with masses of order 100 GeV/c2 and interactions characteristic of the weak nuclear force. The Cryogenic Dark Matter Search (CDMS) experiment seeks to directly detect the rare elastic interactions of galactic WIMPs with terrestrial nuclei. To this end, CDMS operates an array of crystalline Ge and Si particle detectors in Soudan Underground Laboratory in northern Minnesota. These crystals are operated at millikelvin temperatures and instrumented to measure the ionization and athermal phonons generated by each particle interaction. This combination provides a powerful two-fold discrimination against the interactions of particles generated by radioactive decay and cosmogenic showers. This dissertation describes the commissioning, analysis, and results of the rst WIMP-search data runs of the CDMS experiment with its full complement of 5 \\Towers" of detectors. These data represent a substantial increase in target mass and exposure over previous CDMS results. The results of this work place the most stringent limits yet set upon the WIMP-nucleon spin-independent cross section for WIMP masses above 44 GeV/c2 , as well as setting competitive limits on spin-dependent WIMP-nucleon interactions. This work also outlines the larger context of this and other probes of the WIMP theory of dark matter, as well as some current development eorts toward a larger cryogenic experiment.

  20. Planck-scale effects on WIMP dark matter

    Directory of Open Access Journals (Sweden)

    Sofiane M Boucenna

    2014-01-01

    Full Text Available There exists a widely known conjecture that gravitational effects violate global symmetries. We study the effect of global-symmetry violating higher-dimension operators induced by Planck-scale physics on the properties of WIMP dark matter. Using an effective description, we show that the lifetime of the WIMP dark matter candidate can satisfy cosmological bounds under reasonable assumptions regarding the strength of the dimension-five operators. On the other hand, the indirect WIMP dark matter detection signal is significantly enhanced due to new decay channels.

  1. Peaked signals from dark matter velocity structures in direct detection experiments

    Science.gov (United States)

    Lang, Rafael F.; Weiner, Neal

    2010-06-01

    In direct dark matter detection experiments, conventional elastic scattering of WIMPs results in exponentially falling recoil spectra. In contrast, theories of WIMPs with excited states can lead to nuclear recoil spectra that peak at finite recoil energies ER. The peaks of such signals are typically fairly broad, with ΔER/Epeak ~ 1. We show that in the presence of dark matter structures with low velocity dispersion, such as streams or clumps, peaks from up-scattering can become extremely narrow with FWHM of a few keV only. This differs dramatically from the conventionally expected WIMP spectrum and would, once detected, open the possibility to measure the dark matter velocity structure with high accuracy. As an intriguing example, we confront the observed cluster of 3 events near 42 keV from the CRESST commissioning run with this scenario. Inelastic dark matter particles with a wide range of parameters are capable of producing such a narrow peak. We calculate the possible signals at other experiments, and find that such particles could also give rise to the signal at DAMA, although not from the same stream. Over some range of parameters, a signal would be visible at xenon experiments. We show that such dark matter peaks are a very clear signal and can be easily disentangled from potential backgrounds, both terrestrial or due to WIMP down-scattering, by an enhanced annual modulation in both the amplitude of the signal and its spectral shape.

  2. Peaked signals from dark matter velocity structures in direct detection experiments

    International Nuclear Information System (INIS)

    Lang, Rafael F.; Weiner, Neal

    2010-01-01

    In direct dark matter detection experiments, conventional elastic scattering of WIMPs results in exponentially falling recoil spectra. In contrast, theories of WIMPs with excited states can lead to nuclear recoil spectra that peak at finite recoil energies E R . The peaks of such signals are typically fairly broad, with ΔE R /E peak ∼ 1. We show that in the presence of dark matter structures with low velocity dispersion, such as streams or clumps, peaks from up-scattering can become extremely narrow with FWHM of a few keV only. This differs dramatically from the conventionally expected WIMP spectrum and would, once detected, open the possibility to measure the dark matter velocity structure with high accuracy. As an intriguing example, we confront the observed cluster of 3 events near 42 keV from the CRESST commissioning run with this scenario. Inelastic dark matter particles with a wide range of parameters are capable of producing such a narrow peak. We calculate the possible signals at other experiments, and find that such particles could also give rise to the signal at DAMA, although not from the same stream. Over some range of parameters, a signal would be visible at xenon experiments. We show that such dark matter peaks are a very clear signal and can be easily disentangled from potential backgrounds, both terrestrial or due to WIMP down-scattering, by an enhanced annual modulation in both the amplitude of the signal and its spectral shape

  3. Large-scale nuclear structure calculations for spin-dependent WIMP scattering with chiral effective field theory currents

    OpenAIRE

    Klos, P.; Menéndez, J.; Gazit, D.; Schwenk, A.

    2013-01-01

    We perform state-of-the-art large-scale shell-model calculations of the structure factors for elastic spin-dependent WIMP scattering off 129,131Xe, 127I, 73Ge, 19F, 23Na, 27Al, and 29Si. This comprehensive survey covers the non-zero-spin nuclei relevant to direct dark matter detection. We include a pedagogical presentation of the formalism necessary to describe elastic and inelastic WIMP-nucleus scattering. The valence spaces and nuclear interactions employed have been previously used in nucl...

  4. Direct Dark Matter Detection through the use of a Xenon Based TPC Detector

    Science.gov (United States)

    Daniel, Jonathan; Akerib, Daniel; LZ group at SLAC

    2018-01-01

    The vast majority of matter in the universe is unaccounted for. Only 15% of the universe's mass density is visible matter, while the other 85% is Dark Matter (DM). The Weakly Interacting Massive Particle (WIMP) is currently the frontrunner of the DM candidates. The Large Underground Xenon (LUX) and next generation LUX-ZEPLIN (LZ) experiments are designed to directly detect WIMPs. Both experiments are xenon-based Time Projection Chambers (TPC) used to observe possible WIMP interactions. These interactions produce photons and electrons with the photons being collected in a set of two photomultiplier tube (PMT) arrays and the electrons drifted upwards in the detector by a strong electric field to create a secondary production of photons in gaseous xenon. These two populations of photons are classified as S1 and S2 signals, respectively. Using these signals we reconstruct the energy and position of the interaction and in doing so we can eliminate background events that would otherwise “light up” the detector. My participation in the experiment, while at SLAC, was the creation of the grids that produce the large electric field, along with additional lab activities aimed at testing the grids. While at Stan State, I work on background modeling in order to distinguish a possible WIMP signal from ambient backgrounds.

  5. WIMP dark matter candidates and searches—current status and future prospects

    Science.gov (United States)

    Roszkowski, Leszek; Sessolo, Enrico Maria; Trojanowski, Sebastian

    2018-06-01

    We review several current aspects of dark matter theory and experiment. We overview the present experimental status, which includes current bounds and recent claims and hints of a possible signal in a wide range of experiments: direct detection in underground laboratories, gamma-ray, cosmic ray, x-ray, neutrino telescopes, and the LHC. We briefly review several possible particle candidates for a weakly interactive massive particle (WIMP) and dark matter that have recently been considered in the literature. We pay particular attention to the lightest neutralino of supersymmetry as it remains the best motivated candidate for dark matter and also shows excellent detection prospects. Finally we briefly review some alternative scenarios that can considerably alter properties and prospects for the detection of dark matter obtained within the standard thermal WIMP paradigm.

  6. WIMP dark matter candidates and searches-current status and future prospects.

    Science.gov (United States)

    Roszkowski, Leszek; Sessolo, Enrico Maria; Trojanowski, Sebastian

    2018-06-01

    We review several current aspects of dark matter theory and experiment. We overview the present experimental status, which includes current bounds and recent claims and hints of a possible signal in a wide range of experiments: direct detection in underground laboratories, gamma-ray, cosmic ray, x-ray, neutrino telescopes, and the LHC. We briefly review several possible particle candidates for a weakly interactive massive particle (WIMP) and dark matter that have recently been considered in the literature. We pay particular attention to the lightest neutralino of supersymmetry as it remains the best motivated candidate for dark matter and also shows excellent detection prospects. Finally we briefly review some alternative scenarios that can considerably alter properties and prospects for the detection of dark matter obtained within the standard thermal WIMP paradigm.

  7. Direct and Indirect Dark Matter Detection in Gauge Theories

    Energy Technology Data Exchange (ETDEWEB)

    Queiroz, Farinaldo [Federal Univ. of Paraba (Brazil)

    2013-01-01

    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.

  8. Supersymmetry with Radiatively-Driven Naturalness: Implications for WIMP and Axion Searches

    Directory of Open Access Journals (Sweden)

    Kyu Jung Bae

    2015-05-01

    Full Text Available By insisting on naturalness in both the electroweak and quantum chromodynamics (QCD sectors of the minimal supersymmetric standard model (MSSM, the portrait for dark matter production is seriously modified from the usual weakly interacting massive particle (WIMP miracle picture. In supersymmetry (SUSY models with radiatively-driven naturalness (radiative natural SUSY or radiative natural SUSY (RNS which include a Dine–Fischler–Srednicki–Zhitnitsky (DFSZ-like solution to the strong charge-conjugation-parity (CP and SUSY \\(\\mu\\ problems, dark matter is expected to be an admixture of both axions and higgsino-like WIMPs. The WIMP/axion abundance calculation requires simultaneous solution of a set of coupled Boltzmann equations which describe quasi-stable axinos and saxions. In most of parameter space, axions make up the dominant contribution of dark matter although regions of WIMP dominance also occur. We show the allowed range of Peccei-Quinn (PQ scale \\(f_a\\ and compare to the values expected to be probed by the axion dark matter search experiment (ADMX axion detector in the near future. We also show WIMP detection rates, which are suppressed from usual expectations, because now WIMPs comprise only a fraction of the total dark matter. Nonetheless, ton-scale noble liquid detectors should be able to probe the entirety of RNS parameter space. Indirect WIMP detection rates are less propitious since they are reduced by the square of the depleted WIMP abundance.

  9. Course 6. dark matter: direct detection

    International Nuclear Information System (INIS)

    Chardin, G.

    2000-01-01

    Determining the precise nature of dark matter is one of the main open questions of contemporary physics. The search for non-baryonic dark matter is strongly motivated by present data and 3 particle candidates: wimps (weakly interactive massive particles), axions and massive neutrinos are actively searched by several experiments (GENIUS, HDMS, CDMS, EDELWEISS, LLNL, CARRACK, SOLAX, DAMA,...). In this course the author reviews and summarizes the experimental situation and analyzes the main detection strategies developed to identify the dark matter candidates. (A.C.)

  10. WIMP search and a Cherenkov detector prototype for ILC polarimetry

    Energy Technology Data Exchange (ETDEWEB)

    Bartels, Christoph

    2011-10-15

    The planned International Linear Collider (ILC) will be an essential experiment to precisely determine the properties and structure of physics at the TeV scale. An important feature of the ILC is the possibility to use polarized electrons and positrons. In part 1 of this thesis, a model independent search for Weakly Interacting Massive Particles (WIMPs) at ILC is presented. The signal channel under study is direct WIMP pair production with associated Initial State Radiation (ISR), e{sup +}e{sup -} {yields} {chi}{chi}{gamma}, where the WIMPs leave the detector without any further interaction, and only the emitted photon is detected. From the energy spectrum of the detected photons the coupling structure, cross sections, masses and the quantum number of the dominant partial wave in the production process can be inferred. The analysis includes the dominant SM, as well as machine-induced backgrounds, and is performed using a full simulation of the ILD detector concept. For an integrated luminosity of L=500 fb{sup -1}, the signal cross sections can be measured to a precision of 3%, dominated by systematic uncertainties on the polarization measurement of the initial electrons and positrons. Masses can be measured to a precision of up to 2% by a comparison of the data photon spectrum to parametrized template spectra. In part 2 of this thesis, a Cherenkov detector prototype for Compton polarimetry at ILC is presented. For the polarization measurement a systematic uncertainty of {delta} P/P = 0.25% or better is envisioned. To achieve this goal, the Cherenkov detector has to be precisely aligned with the fan of Compton scattered electrons and its signal response needs to be highly linear. For the detector prototype data driven alignment strategies have been developed by comparing data recorded at the Elsa accelerator in Bonn, Germany, with detailed Geant4 simulations. With the use of multi-anode photomultipliers, data driven alignment strategies promise to provide the

  11. WIMP search and a Cherenkov detector prototype for ILC polarimetry

    International Nuclear Information System (INIS)

    Bartels, Christoph

    2011-10-01

    The planned International Linear Collider (ILC) will be an essential experiment to precisely determine the properties and structure of physics at the TeV scale. An important feature of the ILC is the possibility to use polarized electrons and positrons. In part 1 of this thesis, a model independent search for Weakly Interacting Massive Particles (WIMPs) at ILC is presented. The signal channel under study is direct WIMP pair production with associated Initial State Radiation (ISR), e + e - → χχγ, where the WIMPs leave the detector without any further interaction, and only the emitted photon is detected. From the energy spectrum of the detected photons the coupling structure, cross sections, masses and the quantum number of the dominant partial wave in the production process can be inferred. The analysis includes the dominant SM, as well as machine-induced backgrounds, and is performed using a full simulation of the ILD detector concept. For an integrated luminosity of L=500 fb -1 , the signal cross sections can be measured to a precision of 3%, dominated by systematic uncertainties on the polarization measurement of the initial electrons and positrons. Masses can be measured to a precision of up to 2% by a comparison of the data photon spectrum to parametrized template spectra. In part 2 of this thesis, a Cherenkov detector prototype for Compton polarimetry at ILC is presented. For the polarization measurement a systematic uncertainty of δ P/P = 0.25% or better is envisioned. To achieve this goal, the Cherenkov detector has to be precisely aligned with the fan of Compton scattered electrons and its signal response needs to be highly linear. For the detector prototype data driven alignment strategies have been developed by comparing data recorded at the Elsa accelerator in Bonn, Germany, with detailed Geant4 simulations. With the use of multi-anode photomultipliers, data driven alignment strategies promise to provide the required precision. At ILC, these

  12. Can tonne-scale direct detection experiments discover nuclear dark matter?

    Energy Technology Data Exchange (ETDEWEB)

    Butcher, Alistair; Kirk, Russell; Monroe, Jocelyn; West, Stephen M., E-mail: Alistair.Butcher.2010@live.rhul.ac.uk, E-mail: Russell.Kirk.2008@live.rhul.ac.uk, E-mail: Jocelyn.Monroe@rhul.ac.uk, E-mail: Stephen.West@rhul.ac.uk [Department of Physics, Royal Holloway University of London, Egham, Surrey, TW20 0EX (United Kingdom)

    2017-10-01

    Models of nuclear dark matter propose that the dark sector contains large composite states consisting of dark nucleons in analogy to Standard Model nuclei. We examine the direct detection phenomenology of a particular class of nuclear dark matter model at the current generation of tonne-scale liquid noble experiments, in particular DEAP-3600 and XENON1T. In our chosen nuclear dark matter scenario distinctive features arise in the recoil energy spectra due to the non-point-like nature of the composite dark matter state. We calculate the number of events required to distinguish these spectra from those of a standard point-like WIMP state with a decaying exponential recoil spectrum. In the most favourable regions of nuclear dark matter parameter space, we find that a few tens of events are needed to distinguish nuclear dark matter from WIMPs at the 3 σ level in a single experiment. Given the total exposure time of DEAP-3600 and XENON1T we find that at best a 2 σ distinction is possible by these experiments individually, while 3 σ sensitivity is reached for a range of parameters by the combination of the two experiments. We show that future upgrades of these experiments have potential to distinguish a large range of nuclear dark matter models from that of a WIMP at greater than 3 σ .

  13. Can tonne-scale direct detection experiments discover nuclear dark matter?

    International Nuclear Information System (INIS)

    Butcher, Alistair; Kirk, Russell; Monroe, Jocelyn; West, Stephen M.

    2017-01-01

    Models of nuclear dark matter propose that the dark sector contains large composite states consisting of dark nucleons in analogy to Standard Model nuclei. We examine the direct detection phenomenology of a particular class of nuclear dark matter model at the current generation of tonne-scale liquid noble experiments, in particular DEAP-3600 and XENON1T. In our chosen nuclear dark matter scenario distinctive features arise in the recoil energy spectra due to the non-point-like nature of the composite dark matter state. We calculate the number of events required to distinguish these spectra from those of a standard point-like WIMP state with a decaying exponential recoil spectrum. In the most favourable regions of nuclear dark matter parameter space, we find that a few tens of events are needed to distinguish nuclear dark matter from WIMPs at the 3 σ level in a single experiment. Given the total exposure time of DEAP-3600 and XENON1T we find that at best a 2 σ distinction is possible by these experiments individually, while 3 σ sensitivity is reached for a range of parameters by the combination of the two experiments. We show that future upgrades of these experiments have potential to distinguish a large range of nuclear dark matter models from that of a WIMP at greater than 3 σ .

  14. ZEPLIN-II limits on WIMP-nucelon interactions

    International Nuclear Information System (INIS)

    Alner, G. J.; Bungau, C.; Camanzi, B.; Durkin, T.; Edwards, B.; Lewin, J. D.; Luescher, R.; Preece, R. M.; Smith, N. J. T.; Smith, P. F.; Sumner, T. J.; Thorne, C.; Araujo, H. M.; Bewick, A.; Davidge, D.; Dawson, J.; Howard, A. S.; Jones, W. G.; Joshi, M.; Lebedenko, V. N.

    2009-01-01

    ZEPLIN II is a two-phase xenon detector designed to detect dark matter in the form of Weakly Interacting Massive Particles (WIMPs). Following the first 31-day underground run in Boulby Mine, UK, the collaboration published dark matter limits in January 2007; the first such limits using two-phase xenon technology. We outline the key detector design, performance and results here.

  15. Identifying WIMP dark matter from particle and astroparticle data

    Science.gov (United States)

    Bertone, Gianfranco; Bozorgnia, Nassim; Kim, Jong Soo; Liem, Sebastian; McCabe, Christopher; Otten, Sydney; Ruiz de Austri, Roberto

    2018-03-01

    One of the most promising strategies to identify the nature of dark matter consists in the search for new particles at accelerators and with so-called direct detection experiments. Working within the framework of simplified models, and making use of machine learning tools to speed up statistical inference, we address the question of what we can learn about dark matter from a detection at the LHC and a forthcoming direct detection experiment. We show that with a combination of accelerator and direct detection data, it is possible to identify newly discovered particles as dark matter, by reconstructing their relic density assuming they are weakly interacting massive particles (WIMPs) thermally produced in the early Universe, and demonstrating that it is consistent with the measured dark matter abundance. An inconsistency between these two quantities would instead point either towards additional physics in the dark sector, or towards a non-standard cosmology, with a thermal history substantially different from that of the standard cosmological model.

  16. Constraints on light WIMP candidates from the isotropic diffuse gamma-ray emission

    International Nuclear Information System (INIS)

    Arina, Chiara; Tytgat, Michel H.G.

    2011-01-01

    Motivated by the measurements reported by direct detection experiments, most notably DAMA, CDMS-II, CoGeNT and Xenon10/100, we study further the constraints that might be set on some light dark matter candidates, M DM ∼ few GeV, using the Fermi-LAT data on the isotropic gamma-ray diffuse emission. In particular, we consider a Dirac fermion singlet interacting through a new Z' gauge boson, and a scalar singlet S interacting through the Higgs portal. Both candidates are WIMP (Weakly Interacting Massive Particles), i.e. they have an annihilation cross-section in the pbarn range. Also they may both have a spin-independent elastic cross section on nucleons in the range required by direct detection experiments. Although being generic WIMP candidates, because they have different interactions with Standard Model particles, their phenomenology regarding the isotropic diffuse gamma-ray emission is quite distinct. In the case of the scalar singlet, the one-to-one correspondence between its annihilation cross-section and its spin-independent elastic scattering cross-section permits to express the constraints from the Fermi-LAT data in the direct detection exclusion plot, σ n 0 −M DM . Depending on the astrophysics, we argue that it is possible to exclude the singlet scalar dark matter candidate at 95% confidence level. The constraints on the Dirac singlet interacting through a Z' are comparatively weaker

  17. Constraints on low-mass WIMPs from the EDELWEISS-III dark matter search

    Energy Technology Data Exchange (ETDEWEB)

    Armengaud, E.; De Boissière, T. [CEA Saclay, DSM/IRFU, Gif-sur-Yvette Cedex, 91191 France (France); Arnaud, Q.; Augier, C.; Benoît, A.; Billard, J.; Cazes, A.; Charlieux, F. [Institut de Physique Nucléaire de Lyon-UCBL, IN2P3-CNRS, 4 rue Enrico Fermi, Villeurbanne Cedex, 69622 France (France); Benoît, A.; Bres, G.; Camus, P. [Institut Néel, CNRS/UJF, 25 rue des Martyrs, BP 166, Grenoble, 38042 France (France); Bergé, L.; Broniatowski, A.; Chapellier, M.; Dumoulin, L. [CSNSM, Université Paris-Sud, CNRS/IN2P3, Université Paris-Saclay, Orsay, 91405 France (France); Bergmann, T. [Karlsruher Institut für Technologie, Institut für Prozessdatenverarbeitung und Elektronik, Postfach 3640, Karlsruhe, 76021 Germany (Germany); Blümer, J. [Karlsruher Institut für Technologie, Institut für Experimentelle Kernphysik, Gaedestr. 1, Karlsruhe, 76128 Germany (Germany); Brudanin, V.; Filosofov, D. [JINR, Laboratory of Nuclear Problems, Joliot-Curie 6, Dubna, Moscow Region, 141980 Russian Federation (Russian Federation); Eitel, K., E-mail: eric.armengaud@cea.fr [Karlsruher Institut für Technologie, Institut für Kernphysik, Postfach 3640, Karlsruhe, 76021 Germany (Germany); and others

    2016-05-01

    We present the results of a search for elastic scattering from galactic dark matter in the form of Weakly Interacting Massive Particles (WIMPs) in the 4–30 GeV/ c {sup 2} mass range. We make use of a 582 kg-day fiducial exposure from an array of 800 g Germanium bolometers equipped with a set of interleaved electrodes with full surface coverage. We searched specifically for ∼ 2.5–20 keV nuclear recoils inside the detector fiducial volume. As an illustration the number of observed events in the search for 5 (resp. 20) GeV/ c {sup 2} WIMPs are 9 (resp. 4), compared to an expected background of 6.1 (resp. 1.4). A 90% CL limit of 4.3 × 10{sup −40} cm{sup 2} (resp. 9.4 × 10{sup −44} cm{sup 2}) is set on the spin-independent WIMP-nucleon scattering cross-section for 5 (resp. 20) GeV/ c {sup 2} WIMPs. This result represents a 41-fold improvement with respect to the previous EDELWEISS-II low-mass WIMP search for 7 GeV/ c {sup 2} WIMPs. The derived constraint is in tension with hints of WIMP signals from some recent experiments, thus confirming results obtained with different detection techniques.

  18. From direct detection to relic abundance: the case of proton-philic spin-dependent inelastic Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Scopel, Stefano; Yu, Hyeonhye, E-mail: scopel@sogang.ac.kr, E-mail: skyh2yu@gmail.com [Department of Physics, Sogang University, Seoul (Korea, Republic of)

    2017-04-01

    We discuss strategies to make inferences on the thermal relic abundance of a Weakly Interacting Massive Particle (WIMP) when the same effective dimension-six operator that explains an experimental excess in direct detection is assumed to drive decoupling at freeze-out, and apply them to the explicit scenario of WIMP inelastic up-scattering with spin-dependent couplings to protons (proton-philic Spin-dependent Inelastic Dark Matter, pSIDM), a phenomenological set-up containing two Dark Matter (DM) particles χ{sub 1} and χ{sub 2} with masses m {sub χ}= m {sub χ{sub 1}} and m {sub χ{sub 2}}= m {sub χ}+δ that we have shown in a previous paper to explain the DAMA effect in compliance with the constraints from other detectors. We also update experimental constraints on pSIDM, extend the analysis to the most general spin-dependent momentum-dependent interactions allowed by non-relativistic Effective Field Theory (EFT), and consider for the WIMP velocity distribution in our Galaxy f ( v ) both a halo-independent approach and a standard Maxwellian. Under these conditions we find that the DAMA effect can be explained in terms of the particle χ{sub 1} in compliance with all the other constraints for all the analyzed EFT couplings and also for a Maxwellian f ( v ). As far as the relic abundance is concerned, we show that the problem of calculating it by using direct detection data to fix the model parameters is affected by a strong sensitivity on f ( v ) and by the degeneracy between the WIMP local density ρ{sub χ} and the WIMP-nucleon scattering cross section, since ρ{sub χ} must be rescaled with respect to the observed DM density in the neighborhood of the Sun when the calculated relic density Ω is smaller than the observed one Ω{sub 0}. As a consequence, a DM direct detection experiment is not directly sensitive to the physical cut-off scale of the EFT, but on some dimensional combination that does not depend on the actual value of Ω. However, such degeneracy

  19. Constraints on WIMP masses and interactions

    International Nuclear Information System (INIS)

    Enqvist, K.

    1991-01-01

    It is shown that cosmology, experiments and unitarity considerations limit the mass and coupling g' of a generic, heavy WIMP from the above as well as from the below. There are absolute lower limits of 4x10 -5 g and 6x10 -5 g for the couplings of Diracn and Majorana WIMPs, respectively. In U(1)' models cosmology implies an upper limit of about 1 TeV on the Z' and on the WIMP masses, but only in the absence of Z-Z' mixing. (orig.)

  20. Neutrino astronomy and search for WIMPs with MACRO

    CERN Document Server

    Bernardini, P

    2000-01-01

    Upward-going muons, induced primarily by atmospheric neutrinos, are used to search for neutrinos of astrophysical origin. No evidence has been found looking at the event direction and flux limits are obtained on candidate sources. A space-time correlation between gamma ray bursts and upward-going muons has been also investigated. Furthermore the search for a neutrino signal from the Earth and the Sun induced by weakly interacting massive particles (WIMP) has been updated. The number of events from the Sun and from the Earth is compatible with the background from atmospheric neutrinos. Therefore flux limits for different search cones have been estimated. Here we concentrate on neutralinos as WIMP candidates and limits depending on the neutralino mass are given and compared with the prediction of supersymmetric models. (11 refs).

  1. Identification of Dark Matter particles with LHC and direct detection data

    CERN Document Server

    Bertone, Gianfranco; Fornasa, Mattia; de Austri, Roberto Ruiz; Trotta, Roberto

    2010-01-01

    Dark matter (DM) is currently searched for with a variety of detection strategies. Accelerator searches are particularly promising, but even if Weakly Interacting Massive Particles (WIMPs) are found at the Large Hadron Collider (LHC), it will be difficult to prove that they constitute the bulk of the DM in the Universe. We show that a significantly better reconstruction of the DM properties can be obtained with a combined analysis of LHC and direct detection (DD) data, by making a simple Ansatz on the WIMP local density, i.e. by assuming that the local density scales with the cosmological relic abundance. We demonstrate this method in an explicit example in the context of a 24-parameter supersymmetric model, with a neutralino LSP in the stau co-annihilation region. Our results show that future ton-scale DD experiments will allow to break degeneracies in the SUSY parameter space and achieve a significantly better reconstruction of the neutralino composition and its relic density than with LHC data alone.

  2. Direct detection of light anapole and magnetic dipole DM

    International Nuclear Information System (INIS)

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng; Gondolo, Paolo

    2014-01-01

    We present comparisons of direct detection data for ''light WIMPs'' with an anapole moment interaction (ADM) and a magnetic dipole moment interaction (MDM), both assuming the Standard Halo Model (SHM) for the dark halo of our galaxy and in a halo-independent manner. In the SHM analysis we find that a combination of the 90% CL LUX and CDMSlite limits or the new 90% CL SuperCDMS limit by itself exclude the parameter space regions allowed by DAMA, CoGeNT and CDMS-II-Si data for both ADM and MDM. In our halo-independent analysis the new LUX bound excludes the same potential signal regions as the previous XENON100 bound. Much of the remaining signal regions is now excluded by SuperCDMS, while the CDMSlite limit is much above them. The situation is of strong tension between the positive and negative search results both for ADM and MDM. We also clarify the confusion in the literature about the ADM scattering cross section

  3. The effective field theory of dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Fitzpatrick, A. Liam; Haxton, Wick; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2013-02-01

    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  4. Asymmetric WIMP Dark Matter in the presence of DM/anti-DM oscillations

    International Nuclear Information System (INIS)

    Zaharijas, G.

    2014-01-01

    The general class of 'Asymmetric Dark Matter (DM)' scenarios assumes the existence of a primordial particle/anti-particle asymmetry in the dark matter sector related to the asymmetry in the baryonic one, as a way to achieve the observed similarity between the baryonic and dark matter energy densities today. Focusing on this framework we study the effect of oscillations between dark matter and its anti-particle on the re-equilibration of the initial asymmetry. We calculate the evolution of the dark matter relic abundance and show how oscillations re-open the parameter space of asymmetric dark matter models, in particular in the direction of allowing large (WIMP-scale) DM masses. We found in particular that a typical WIMP with a mass at the EW scale (about 1 TeV) having a primordial asymmetry of the same order as the baryon asymmetry, naturally gets the correct relic abundance if the δm mass term is in the ∼ meV range. This turns out to be a natural value for fermionic DM arising from the higher dimensional operator H 2 DM 2 /Λ where H is the Higgs field and Λ ∼ M Pl . Finally, we constrain the parameter space in this framework by applying up-to-date bounds from indirect detection signals on annihilating DM

  5. Consequences of DM/antiDM Oscillations for Asymmetric WIMP Dark Matter

    CERN Document Server

    Cirelli, Marco; Servant, Geraldine; Zaharijas, Gabrijela

    2012-01-01

    Assuming the existence of a primordial asymmetry in the dark sector, a scenario usually dubbed Asymmetric Dark Matter (aDM), we study the effect of oscillations between dark matter and its antiparticle on the re-equilibration of the initial asymmetry before freeze-out, which enable efficient annihilations to recouple. We calculate the evolution of the DM relic abundance and show how oscillations re-open the parameter space of aDM models, in particular in the direction of allowing large (WIMP-scale) DM masses. A typical wimp with a mass at the EW scale (\\sim 100 GeV - 1 TeV) presenting a primordial asymmetry of the same order as the baryon asymmetry naturally gets the correct relic abundance if the DM-number-violating Delta(DM) = 2 mass term is in the \\sim meV range. The re-establishment of annihilations implies that constraints from the accumulation of aDM in astrophysical bodies are evaded. On the other hand, the ordinary bounds from BBN, CMB and indirect detection signals on annihilating DM have to be consi...

  6. Towards understanding thermal history of the Universe through direct and indirect detection of dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Roszkowski, Leszek; Trojanowski, Sebastian [National Centre for Nuclear Research, Hoża 69, 00-681 Warsaw (Poland); Turzyński, Krzysztof, E-mail: leszek.roszkowski@ncbj.gov.pl, E-mail: sebastian.trojanowski@uci.edu, E-mail: Krzysztof-Jan.Turzynski@fuw.edu.pl [Institute of Theoretical Physics, Faculty of Physics, University of Warsaw, ul. Pasteura 5, 02-093 Warsaw (Poland)

    2017-10-01

    We examine the question to what extent prospective detection of dark matter by direct and indirect- detection experiments could shed light on what fraction of dark matter was generated thermally via the freeze-out process in the early Universe. By simulating putative signals that could be seen in the near future and using them to reconstruct WIMP dark matter properties, we show that, in a model- independent approach this could only be achieved in a thin sliver of the parameter space. However, with additional theoretical input the hypothesis about the thermal freeze-out as the dominant mechanism for generating dark matter can potentially be verified. We illustrate this with two examples: an effective field theory of dark matter with a vector messenger and a higgsino or wino dark matter within the MSSM.

  7. Discovery potential for directional dark matter detection with nuclear emulsions

    Science.gov (United States)

    Guler, A. M.; NEWSdm Collaboration

    2017-06-01

    Direct Dark Matter searches are nowadays one of the most exciting research topics. Several Experimental efforts are concentrated on the development, construction, and operation of detectors looking for the scattering of target nuclei with Weakly Interactive Massive Particles (WIMPs). In this field a new frontier can be opened by directional detectors able to reconstruct the direction of the WIMP-recoiled nucleus thus allowing to extend dark matter searches beyond the neutrino floor. Exploiting directionality would also give a proof of the galactic origin of dark matter making it possible to have a clear and unambiguous signal to background separation. The angular distribution of WIPM-scattered nuclei is indeed expected to be peaked in the direction of the motion of the Solar System in the Galaxy, i.e. toward the Cygnus constellation, while the background distribution is expected to be isotropic. Current directional experiments are based on the use of gas TPC whose sensitivity is limited by the small achievable detector mass. In this paper we show the potentiality in terms of exclusion limit of a directional experiment based on the use of a solid target made by newly developed nuclear emulsions and read-out systems reaching sub-micrometric resolution.

  8. Plasma dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Clarke, J.D.; Foot, R., E-mail: j.clarke5@pgrad.unimelb.edu.au, E-mail: rfoot@unimelb.edu.au [ARC Centre of Excellence for Particle Physics at the Terascale, School of Physics, University of Melbourne, Victoria 3010 Australia (Australia)

    2016-01-01

    Dark matter in spiral galaxies like the Milky Way may take the form of a dark plasma. Hidden sector dark matter charged under an unbroken U(1)' gauge interaction provides a simple and well defined particle physics model realising this possibility. The assumed U(1)' neutrality of the Universe then implies (at least) two oppositely charged dark matter components with self-interactions mediated via a massless 'dark photon' (the U(1)' gauge boson). In addition to nuclear recoils such dark matter can give rise to keV electron recoils in direct detection experiments. In this context, the detailed physical properties of the dark matter plasma interacting with the Earth is required. This is a complex system, which is here modelled as a fluid governed by the magnetohydrodynamic equations. These equations are numerically solved for some illustrative examples, and implications for direct detection experiments discussed. In particular, the analysis presented here leaves open the intriguing possibility that the DAMA annual modulation signal is due primarily to electron recoils (or even a combination of electron recoils and nuclear recoils). The importance of diurnal modulation (in addition to annual modulation) as a means of probing this kind of dark matter is also emphasised.

  9. Direct Fast-Neutron Detection

    International Nuclear Information System (INIS)

    DC Stromswold; AJ Peurrung; RR Hansen; PL Reeder

    2000-01-01

    Direct fast-neutron detection is the detection of fast neutrons before they are moderated to thermal energy. We have investigated two approaches for using proton-recoil in plastic scintillators to detect fast neutrons and distinguish them from gamma-ray interactions. Both approaches use the difference in travel speed between neutrons and gamma rays as the basis for separating the types of events. In the first method, we examined the pulses generated during scattering in a plastic scintillator to see if they provide a means for distinguishing fast-neutron events from gamma-ray events. The slower speed of neutrons compared to gamma rays results in the production of broader pulses when neutrons scatter several times within a plastic scintillator. In contrast, gamma-ray interactions should produce narrow pulses, even if multiple scattering takes place, because the time between successive scattering is small. Experiments using a fast scintillator confirmed the presence of broader pulses from neutrons than from gamma rays. However, the difference in pulse widths between neutrons and gamma rays using the best commercially available scintillators was not sufficiently large to provide a practical means for distinguishing fast neutrons and gamma rays on a pulse-by-pulse basis. A faster scintillator is needed, and that scintillator might become available in the literature. Results of the pulse-width studies were presented in a previous report (peurrung et al. 1998), and they are only summarized here

  10. Boffins go underground searching for Wimps

    CERN Multimedia

    2003-01-01

    In a bid to identify the prime suspect for Dark Matter known as Weakly Interacting Massive Particles, or Wimps, British scientists have installed detectors 1100m down a salt mine at Boulby on the North Yorkshire moors (1/2 page).

  11. Less-simplified models of dark matter for direct detection and the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, Arghya [Regional Centre for Accelerator-based Particle Physics, Harish-Chandra Research Institute,Allahabad - 211019 (India); Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J. [National Centre for Nuclear Research,Hoża 69, 00-681 Warsaw (Poland)

    2016-04-29

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators’ mass. We derive the strongest limits for combinations of vector + scalar, vector + “squark”, and “squark” + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  12. Less-simplified models of dark matter for direct detection and the LHC

    International Nuclear Information System (INIS)

    Choudhury, Arghya; Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J.

    2016-01-01

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators’ mass. We derive the strongest limits for combinations of vector + scalar, vector + “squark”, and “squark” + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  13. Less-simplified models of dark matter for direct detection and the LHC

    Science.gov (United States)

    Choudhury, Arghya; Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J.

    2016-04-01

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳ 10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators' mass. We derive the strongest limits for combinations of vector + scalar, vector + "squark", and "squark" + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  14. A precision search for WIMPs with charged cosmic rays

    Science.gov (United States)

    Reinert, Annika; Winkler, Martin Wolfgang

    2018-01-01

    AMS-02 has reached the sensitivity to probe canonical thermal WIMPs by their annihilation into antiprotons. Due to the high precision of the data, uncertainties in the astrophysical background have become the most limiting factor for indirect dark matter detection. In this work we systematically quantify and—where possible—reduce uncertainties in the antiproton background. We constrain the propagation of charged cosmic rays through the combination of antiproton, B/C and positron data. Cross section uncertainties are determined from a wide collection of accelerator data and are—for the first time ever—fully taken into account. This allows us to robustly constrain even subdominant dark matter signals through their spectral properties. For a standard NFW dark matter profile we are able to exclude thermal WIMPs with masses up to 570 GeV which annihilate into bottom quarks. While we confirm a reported excess compatible with dark matter of mass around 80 GeV, its local (global) significance only reaches 2.2 σ (1.1 σ) in our analysis.

  15. 7th Patras workshop on axions, WIMPs and WISPs (PATRAS 2011). Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Zioutas, Konstantin; Schumann, Marc (eds.)

    2011-12-15

    The year 2011 was an exciting period to work on the ''dark side'' of the Universe. Several experimental claims of the direct detection of WIMP dark matter were challenged by the restrictive limits of several others. Dedicated experiments searching for axions, another well motivated dark matter candidate, and for axion-like particles continued to improve their limits and got an additional boost by puzzling astrophysical observations and new developments in theory. The LHC collected an unexpectedly large amount of data and started to produce results at an amazing speed. And finally, this year's Nobel price of physics was awarded to the observation of the accelerating expansion of the Universe, an effect which might be related to dark energy, whose nature remain among the biggest mysteries in physics. These exciting topics and many more important aspects of particle- and astroparticle physics were discussed between experimentalists and theorists at the 7th Patras Workshop on Axions, WIMPs, and WISPs. The workshop took place from June 27 - July 1, 2011, in the Royal Myconian and Myconian Imperial Resorts Hotels on the Greek island of Mykonos. As in the previous years, it was a very fruitful and lively meeting in an inspiring and open atmosphere, which allowed for many open and constructive discussions also on controversial topics. The scientific exchange, the beautiful scenery of the island, the venue itself, the food, an excursion to the ancient ruins of Delos, and finally an amazing conference dinner made this meeting really unique. The ''spirit'' of the workshop and its atmosphere cannot be brought to paper, but many of its scientific highlights are collected in these proceedings. We are looking forward to the 8th Patras Workshop, which will be held in Chicago (USA) July 18-22, 2012. It will be organized jointly by our US colleagues Andrei Afanasev (JLAB), Oliver Baker (Yale), and William Wester (FNAL).

  16. 7th Patras workshop on axions, WIMPs and WISPs (PATRAS 2011). Proceedings

    International Nuclear Information System (INIS)

    Zioutas, Konstantin; Schumann, Marc

    2011-12-01

    The year 2011 was an exciting period to work on the ''dark side'' of the Universe. Several experimental claims of the direct detection of WIMP dark matter were challenged by the restrictive limits of several others. Dedicated experiments searching for axions, another well motivated dark matter candidate, and for axion-like particles continued to improve their limits and got an additional boost by puzzling astrophysical observations and new developments in theory. The LHC collected an unexpectedly large amount of data and started to produce results at an amazing speed. And finally, this year's Nobel price of physics was awarded to the observation of the accelerating expansion of the Universe, an effect which might be related to dark energy, whose nature remain among the biggest mysteries in physics. These exciting topics and many more important aspects of particle- and astroparticle physics were discussed between experimentalists and theorists at the 7th Patras Workshop on Axions, WIMPs, and WISPs. The workshop took place from June 27 - July 1, 2011, in the Royal Myconian and Myconian Imperial Resorts Hotels on the Greek island of Mykonos. As in the previous years, it was a very fruitful and lively meeting in an inspiring and open atmosphere, which allowed for many open and constructive discussions also on controversial topics. The scientific exchange, the beautiful scenery of the island, the venue itself, the food, an excursion to the ancient ruins of Delos, and finally an amazing conference dinner made this meeting really unique. The ''spirit'' of the workshop and its atmosphere cannot be brought to paper, but many of its scientific highlights are collected in these proceedings. We are looking forward to the 8th Patras Workshop, which will be held in Chicago (USA) July 18-22, 2012. It will be organized jointly by our US colleagues Andrei Afanasev (JLAB), Oliver Baker (Yale), and William Wester (FNAL).

  17. Calculated WIMP signals at the ANDES laboratory: comparison with northern and southern located dark matter detectors

    Science.gov (United States)

    Civitarese, O.; Fushimi, K. J.; Mosquera, M. E.

    2016-12-01

    Weakly interacting massive particles (WIMPs) are possible components of the Universe’s dark matter (DM). The detection of WIMPs is signaled by the recoil of the atomic nuclei which form a detector. CoGeNT at the Soudan Underground Laboratory (SUL) and DAMA at the Laboratori Nazionali del Gran Sasso (LNGS) have reported data on annual modulation of signals attributed to WIMPs. Both experiments are located in laboratories in the Northern Hemisphere. DM detectors are planned to operate (or already operate) in laboratories in the Southern Hemisphere, including SABRE at Stawell Underground Physics Laboratory (SUPL) in Australia, and DM-ICE in Antarctica. In this work we have analyzed the dependence of diurnal and annual modulation of signals, pertaining to the detection of WIMP, on the coordinates of the laboratory, for experiments which may be performed in the planned new Agua Negra Deep Experimental Site (ANDES) underground facility, to be built in San Juan, Argentina. We made predictions for NaI and Ge-type detectors placed in ANDES, to compare with DAMA, CoGeNT, SABRE and DM-ICE arrays, and found that the diurnal modulation of the signals, at the ANDES site, is amplified at its maximum value, both for NaI (Ge)-type detectors, while the annual modulation remains unaffected by the change in coordinates from north to south.

  18. Calculated WIMP signals at the ANDES laboratory: comparison with northern and southern located dark matter detectors

    International Nuclear Information System (INIS)

    Civitarese, O; Mosquera, M E; Fushimi, K J

    2016-01-01

    Weakly interacting massive particles (WIMPs) are possible components of the Universe’s dark matter (DM). The detection of WIMPs is signaled by the recoil of the atomic nuclei which form a detector. CoGeNT at the Soudan Underground Laboratory (SUL) and DAMA at the Laboratori Nazionali del Gran Sasso (LNGS) have reported data on annual modulation of signals attributed to WIMPs. Both experiments are located in laboratories in the Northern Hemisphere. DM detectors are planned to operate (or already operate) in laboratories in the Southern Hemisphere, including SABRE at Stawell Underground Physics Laboratory (SUPL) in Australia, and DM-ICE in Antarctica. In this work we have analyzed the dependence of diurnal and annual modulation of signals, pertaining to the detection of WIMP, on the coordinates of the laboratory, for experiments which may be performed in the planned new Agua Negra Deep Experimental Site (ANDES) underground facility, to be built in San Juan, Argentina. We made predictions for NaI and Ge-type detectors placed in ANDES, to compare with DAMA, CoGeNT, SABRE and DM-ICE arrays, and found that the diurnal modulation of the signals, at the ANDES site, is amplified at its maximum value, both for NaI (Ge)-type detectors, while the annual modulation remains unaffected by the change in coordinates from north to south. (paper)

  19. Object Detection: Current and Future Directions

    Directory of Open Access Journals (Sweden)

    Rodrigo eVerschae

    2015-11-01

    Full Text Available Object detection is a key ability required by most computer and robot vision systems. The latest research on this area has been making great progress in many directions. In the current manuscript we give an overview of past research on object detection, outline the current main research directions, and discuss open problems and possible future directions.

  20. Detector Simulation and WIMP Search Analysis for the Cryogenic Dark Matter Search Experiment

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, Kevin [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States)

    2013-06-01

    Astrophysical and cosmological measurements on the scales of galaxies, galaxy clusters, and the universe indicate that 85% of the matter in the universe is composed of dark matter, made up of non-baryonic particles that interact with cross-sections on the weak scale or lower. Hypothetical Weakly Interacting Massive Particles, or WIMPs, represent a potential solution to the dark matter problem, and naturally arise in certain Standard Model extensions. The Cryogenic Dark Matter Search (CDMS) collaboration aims to detect the scattering of WIMP particles from nuclei in terrestrial detectors. Germanium and silicon particle detectors are deployed in the Soudan Underground Laboratory in Minnesota. These detectors are instrumented with phonon and ionization sensors, which allows for discrimination against electromagnetic backgrounds, which strike the detector at rates orders of magnitude higher than the expected WIMP signal. This dissertation presents the development of numerical models of the physics of the CDMS detectors, implemented in a computational package collectively known as the CDMS Detector Monte Carlo (DMC). After substantial validation of the models against data, the DMC is used to investigate potential backgrounds to the next iteration of the CDMS experiment, known as SuperCDMS. Finally, an investigation of using the DMC in a reverse Monte Carlo analysis of WIMP search data is presented.

  1. First 5 tower WIMP-search results from the Cryogenic Dark Matter Search with improved understanding of neutron backgrounds and benchmarking

    Energy Technology Data Exchange (ETDEWEB)

    Hennings-Yeomans, Raul [Case Western Reserve Univ., Cleveland, OH (United States)

    2009-02-01

    Non-baryonic dark matter makes one quarter of the energy density of the Universe and is concentrated in the halos of galaxies, including the Milky Way. The Weakly Interacting Massive Particle (WIMP) is a dark matter candidate with a scattering cross section with an atomic nucleus of the order of the weak interaction and a mass comparable to that of an atomic nucleus. The Cryogenic Dark Matter Search (CDMS-II) experiment, using Ge and Si cryogenic particle detectors at the Soudan Underground Laboratory, aims to directly detect nuclear recoils from WIMP interactions. This thesis presents the first 5 tower WIMP-search results from CDMS-II, an estimate of the cosmogenic neutron backgrounds expected at the Soudan Underground Laboratory, and a proposal for a new measurement of high-energy neutrons underground to benchmark the Monte Carlo simulations. Based on the non-observation of WIMPs and using standard assumptions about the galactic halo [68], the 90% C.L. upper limit of the spin-independent WIMPnucleon cross section for the first 5 tower run is 6.6 × 10-44cm2 for a 60 GeV/c2 WIMP mass. A combined limit using all the data taken at Soudan results in an upper limit of 4.6×10-44cm2 at 90% C.L.for a 60 GeV/c2 WIMP mass. This new limit corresponds to a factor of ~3 improvement over any previous CDMS-II limit and a factor of ~2 above 60 GeV/c 2 better than any other WIMP search to date. This thesis presents an estimation, based on Monte Carlo simulations, of the nuclear recoils produced by cosmic-ray muons and their secondaries (at the Soudan site) for a 5 tower Ge and Si configuration as well as for a 7 supertower array. The results of the Monte Carlo are that CDMS-II should expect 0.06 ± 0.02+0.18 -0.02 /kgyear unvetoed single nuclear recoils in Ge for the 5 tower configuration, and 0.05 ± 0.01+0.15 -0.02 /kg-year for the 7 supertower configuration. The systematic error is based on the available

  2. Direct dark matter detection with the DarkSide-50 experiment

    Energy Technology Data Exchange (ETDEWEB)

    Pagani, Luca [Univ. of Genoa (Italy)

    2017-01-01

    The existence of dark matter is known because of its gravitational effects, and although its nature remains undisclosed, there is a growing indication that the galactic halo could be permeated by weakly interacting massive particles (WIMPs) with mass of the order of $100$\\,GeV/c$^2$ and coupling with ordinary matter at or below the weak scale. In this context, DarkSide-50 aims to direct observe WIMP-nucleon collisions in a liquid argon dual phase time-projection chamber located deep underground at Gran Sasso National Laboratory, in Italy. In this work a re-analysis of the data that led to the best limit on WIMP-nucleon cross section with an argon target is done. As starting point of the new approach, the energy reconstruction of events is considered: a new energy variable is developed where anti-correlation between ionization and scintillation produced by an interaction is taken into account. As first result, a better energy resolution is achieved. In this new energy framewor k, access is granted to micro-physics parameters fundamental to argon scintillation such as the recombination and quenching as a function of the energy. The improved knowledge of recombination and quenching allows to develop a new model for distinguish between events possibly due to WIMPs and backgrounds. In light of the new model, the final result of this work is a more stringent limit on spin independent WIMP-nucleon cross section with an argon target. This work was supervised by Marco Pallavicini and was completed in collaboration with members of the DarkSide collaboration.

  3. Science plumbs new depths in hunt for Wimps

    CERN Multimedia

    Benfield, C

    2003-01-01

    Lord Sainsbury has officially opened a laboratory in the salt mine at Boulby near Whitby. The lab is searching for WIMPs and was recently awarded 3.1 millions pounds by PPARC to upgrade the facility (1 page).

  4. WIMP-nucleus scattering in chiral effective theory

    Science.gov (United States)

    Cirigliano, Vincenzo; Graesser, Michael L.; Ovanesyan, Grigory

    2012-10-01

    We discuss long-distance QCD corrections to the WIMP-nucleon(s) interactions in the framework of chiral effective theory. For scalar-mediated WIMP-quark interactions, we calculate all the next-to-leading-order corrections to the WIMP-nucleus elastic cross-section, including two-nucleon amplitudes and recoil-energy dependent shifts to the single-nucleon scalar form factors. As a consequence, the scalar-mediated WIMP-nucleus cross-section cannot be parameterized in terms of just two quantities, namely the neutron and proton scalar form factors at zero momentum transfer, but additional parameters appear, depending on the short-distance WIMP-quark interaction. Moreover, multiplicative factorization of the cross-section into particle, nuclear and astro-particle parts is violated. In practice, while the new effects are of the natural size expected by chiral power counting, they become very important in those regions of parameter space where the leading order WIMP-nucleus amplitude is suppressed, including the so-called "isospin-violating dark matter" regime. In these regions of parameter space we find order-of-magnitude corrections to the total scattering rates and qualitative changes to the shape of recoil spectra.

  5. Displaying results of direct detection dark matter experiments free of astrophysical uncertainties

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Ludwig [Max Planck Institut fuer Kernphysik, Heidelberg (Germany); Collaboration: Collaboration XENON 100

    2015-07-01

    A number of experiments try to measure WIMP interactions by using different detector technologies and target elements. Hence, energy thresholds and sensitivities to light or heavy WIMP masses differ. However, due to large systematic uncertainties in the parameters defining the dark matter halo, a comparison of detectors is demanding. By mapping experimental results from the traditional cross section vs. dark matter mass parameter-space into a dark matter halo independent phase space, direct comparisons between experiments can be made. This is possible due to the monotonicity of the velocity integral which enables to combine all astrophysical assumptions into one parameter common to all experiments. In this talk the motivation as well as the mapping method are explained based on the XENON100 data.

  6. The impact of baryons on the direct detection of dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Kelso, Chris [Department of Physics, University of North Florida, Jacksonville, FL 32224 (United States); Savage, Christopher; Freese, Katherine [Nordita, KTH Royal Institute of Technology and Stockholm University, SE-106 91 Stockholm (Sweden); Valluri, Monica [Department of Astronomy, University of Michigan, Ann Arbor, MI 48109 (United States); Stinson, Gregory S. [Max-Planck-Institut für Astronomie, Königstuhl 17, D-69117, Heidelberg (Germany); Bailin, Jeremy, E-mail: ckelso@unf.edu, E-mail: chris@savage.name, E-mail: mvalluri@umich.edu, E-mail: ktfreese@umich.edu, E-mail: stinson@mpia.de, E-mail: jbailin@ua.edu [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL 35487 (United States)

    2016-08-01

    The spatial and velocity distributions of dark matter particles in the Milky Way Halo affect the signals expected to be observed in searches for dark matter. Results from direct detection experiments are often analyzed assuming a simple isothermal distribution of dark matter, the Standard Halo Model (SHM). Yet there has been skepticism regarding the validity of this simple model due to the complicated gravitational collapse and merger history of actual galaxies. In this paper we compare the SHM to the results of cosmological hydrodynamical simulations of galaxy formation to investigate whether or not the SHM is a good representation of the true WIMP distribution in the analysis of direct detection data. We examine two Milky Way-like galaxies from the MaGICC cosmological simulations (a) with dark matter only and (b) with baryonic physics included. The inclusion of baryons drives the shape of the DM halo to become more spherical and makes the velocity distribution of dark matter particles less anisotropic especially at large heliocentric velocities, thereby making the SHM a better fit. We also note that we do not find a significant disk-like rotating dark matter component in either of the two galaxy halos with baryons that we examine, suggesting that dark disks are not a generic prediction of cosmological hydrodynamical simulations. We conclude that in the Solar neighborhood, the SHM is in fact a good approximation to the true dark matter distribution in these cosmological simulations (with baryons) which are reasonable representations of the Milky Way, and hence can also be used for the purpose of dark matter direct detection calculations.

  7. Rejuvenating direct modulation and direct detection for modern optical communications

    Science.gov (United States)

    Che, Di; Li, An; Chen, Xi; Hu, Qian; Shieh, William

    2018-02-01

    High-speed transoceanic optical fiber transmission using direct modulation (DM) and direct detection (DD) was one of the most stirring breakthroughs for telecommunication in 1990s, which drove the internet as a global phenomenon. However, the later evolution of optical coherent communications in 2000s gradually took over the long-haul applications, due to its superior optical spectral efficiency. Nowadays, DM-DD systems are dominant mainly in cost- and power-sensitive short-reach applications, because of its natural characteristics-the simplicity. This paper reviews the recent advances of DM-DD transceivers from both hardware and signal processing perspectives. It introduces a variety of modified DM and/or DD systems for 3 application scenarios: very-short-reach interconnect with little fiber channel impact; single or a few spans of fiber transmission up to several hundred km; and distance beyond the 2nd scenario. Besides the DM-DD and multi-dimension DM-DD with polarization diversity, this paper focuses on how to rejuvenate traditional DM and DD technologies in order to bridge the transmission application gap between DM-DD and coherent transceivers, using technologies such as dispersion compensation, signal field recovery from the intensity-only DD receiver, and complex direct modulation with coherent detection. More than 30 years since the birth, DM and DD still hold indispensable roles in modern optical communications.

  8. Wind measurement via direct detection lidar

    Science.gov (United States)

    Afek, I.; Sela, N.; Narkiss, N.; Shamai, G.; Tsadka, S.

    2013-10-01

    Wind sensing Lidar is considered a promising technology for high quality wind measurements required for various applications such as hub height wind resource assessment, power curve measurements and advanced, real time, forward looking turbine control. Until recently, the only available Lidar technology was based on coherent Doppler shift detection, whose market acceptance has been slow primarily due to its exuberant price. Direct detection Lidar technology provides an alternative to remote sensing of wind by incorporating high precision measurement, a robust design and an affordable price tag.

  9. Optimizing EDELWEISS detectors for low-mass WIMP searches

    Science.gov (United States)

    Arnaud, Q.; Armengaud, E.; Augier, C.; Benoît, A.; Bergé, L.; Billard, J.; Broniatowski, A.; Camus, P.; Cazes, A.; Chapellier, M.; Charlieux, F.; de Jésus, M.; Dumoulin, L.; Eitel, K.; Foerster, N.; Gascon, J.; Giuliani, A.; Gros, M.; Hehn, L.; Jin, Y.; Juillard, A.; Kleifges, M.; Kozlov, V.; Kraus, H.; Kudryavtsev, V. A.; Le-Sueur, H.; Maisonobe, R.; Marnieros, S.; Navick, X.-F.; Nones, C.; Olivieri, E.; Pari, P.; Paul, B.; Poda, D.; Queguiner, E.; Rozov, S.; Sanglard, V.; Scorza, S.; Siebenborn, B.; Vagneron, L.; Weber, M.; Yakushev, E.; EDELWEISS Collaboration

    2018-01-01

    The physics potential of EDELWEISS detectors for the search of low-mass weakly interacting massive particles (WIMPs) is studied. Using a data-driven background model, projected exclusion limits are computed using frequentist and multivariate analysis approaches, namely, profile likelihood and boosted decision tree. Both current and achievable experimental performances are considered. The optimal strategy for detector optimization depends critically on whether the emphasis is put on WIMP masses below or above ˜5 GeV /c2 . The projected sensitivity for the next phase of the EDELWEISS-III experiment at the Modane Underground Laboratory (LSM) for low-mass WIMP search is presented. By 2018 an upper limit on the spin-independent WIMP-nucleon cross section of σSI=7 ×10-42 cm2 is expected for a WIMP mass in the range 2 - 5 GeV /c2 . The requirements for a future hundred-kilogram-scale experiment designed to reach the bounds imposed by the coherent scattering of solar neutrinos are also described. By improving the ionization resolution down to 50 eVe e , we show that such an experiment installed in an even lower background environment (e.g., at SNOLAB) together with an exposure of 1 000 kg .yr , should allow us to observe about 80 B 8 neutrino events after discrimination.

  10. Discriminating dark matter candidates using direct detection

    International Nuclear Information System (INIS)

    Belanger, G.; Nezri, E.; Pukhov, A.

    2009-01-01

    We examine the predictions for both the spin-dependent and spin-independent direct detection rates in a variety of new particle physics models with dark matter candidates. We show that a determination of both spin-independent and spin-dependent amplitudes on protons and neutrons can in principle discriminate different candidates of dark matter up to a few ambiguities. We emphasize the importance of making measurements with different spin-dependent sensitive detector materials and the need for significant improvement of the detector sensitivities. Scenarios where exchange of new colored particles contributes significantly to the elastic scattering cross sections are often the most difficult to identify, the LHC should give an indication whether such scenarios are relevant for direct detection.

  11. Directly detecting isospin-violating dark matter

    Science.gov (United States)

    Kelso, Chris; Kumar, Jason; Marfatia, Danny; Sandick, Pearl

    2018-03-01

    We consider the prospects for multiple dark matter direct detection experiments to determine if the interactions of a dark matter candidate are isospin-violating. We focus on theoretically well-motivated examples of isospin-violating dark matter (IVDM), including models in which dark matter interactions with nuclei are mediated by a dark photon, a Z , or a squark. We determine that the best prospects for distinguishing IVDM from the isospin-invariant scenario arise in the cases of dark photon-or Z -mediated interactions, and that the ideal experimental scenario would consist of large exposure xenon- and neon-based detectors. If such models just evade current direct detection limits, then one could distinguish such models from the standard isospin-invariant case with two detectors with of order 100 ton-year exposure.

  12. Directly detecting isospin-violating dark matter

    OpenAIRE

    Kelso, Chris; Kumar, Jason; Marfatia, Danny; Sandick, Pearl

    2018-01-01

    We consider the prospects for multiple dark matter direct detection experiments to determine if the interactions of a dark matter candidate are isospin-violating. We focus on theoretically well-motivated examples of isospin-violating dark matter (IVDM), including models in which dark matter interactions with nuclei are mediated by a dark photon, a Z, or a squark. We determine that the best prospects for distinguishing IVDM from the isospin-invariant scenario arise in the cases of dark photon–...

  13. No WIMP mini-spikes in dwarf spheroidal galaxies

    NARCIS (Netherlands)

    Wanders, M.; Bertone, G.; Volonteri, M.; Weniger, C.

    2015-01-01

    The formation of black holes inevitably affects the distribution of dark and baryonic matter in their vicinity, leading to an enhancement of the dark matter density, called spike, and if dark matter is made of WIMPs, to a strong enhancement of the dark matter annihilation rate. Spikes at the center

  14. Dark Matter: Looking for WIMPs in the Galactic Halo

    International Nuclear Information System (INIS)

    Akerib, Daniel S.

    2006-01-01

    Overwhelming observational evidence indicates that most of the matter in the Universe consists of non-baryonic dark matter. One possibility is that the dark matter is Weakly-Interacting Massive Particles (WIMPs) that were produced in the early Universe. These relics could comprise the Milky Way's dark halo and provide evidence for new particle physics, such as Supersymmetry. After reviewing some of the evidence for dark matter and the WIMP hypothesis, I will describe the strategy for searching for WIMPs, along with a survey of the current status and outlook. In particular, dark matter searches have begun to explore the region of parameter space where SUSY particles could provide dark matter candidates. I will also mention some of the recent theoretical work on dark matter candidates which is being done in anticipation of the turn-on of the LHC and as part of the active R and D on the ILC. Finally, a vigorous detector development program promises significant advances in WIMP sensitivity in the coming years

  15. Direct detection of Leishmania from clinical samples.

    Science.gov (United States)

    Waitumbi, John N; Bast, Joshua; Nyakoe, Nancy; Magiri, Charles; Quintana, Miguel; Takhampunya, Ratree; Schuster, Anthony L; Van de Wyngaerde, Marshall T; McAvin, James C; Coleman, Russell E

    2017-01-01

    The ability to rapidly and accurately diagnose leishmaniasis is a military priority. Testing was conducted to evaluate diagnostic sensitivity and specificity of field-expedient Leishmania genus and visceral Leishmania specific dual-fluorogenic, hydrolysis probe (TaqMan), polymerase chain reaction assays previously established for use in vector surveillance. Blood samples of patients with confirmed visceral leishmaniasis and controls without the disease from Baringo District, Kenya, were tested. Leishmania genus assay sensitivity was 100% (14/14) and specificity was 84% (16/19). Visceral Leishmania assay sensitivity was 93% (13/14) and specificity 80% (4/5). Cutaneous leishmaniasis (CL) skin scrapes of patients from Honduras were also evaluated. Leishmania genus assay sensitivity was 100% (10/10). Visceral Leishmania assay specificity was 100% (10/10) from cutaneous leishmaniasis samples; no fluorescence above background was reported. These results show promise in a rapid, sensitive, and specific method for Leishmania direct detection from clinical samples.

  16. Coaxial direct-detection lidar-system

    DEFF Research Database (Denmark)

    2014-01-01

    The invention relates to a coaxial direct-detection LIDAR system for measuring velocity, temperature and/or particulate density. The system comprises a laser source for emitting a laser light beam having a lasing center frequency along an emission path. The system further comprises an optical....... Finally, the system comprises a detector system arranged to receive the return signal from the optical delivery system, the detector system comprising a narrowband optical filter and a detector, the narrowband optical filter having a filter center frequency of a pass-band, wherein the center lasing...... frequency and/or the center filter frequency may be scanned. The invention further relates to an aircraft airspeed measurement device, and a wind turbine airspeed measurement device comprising the LIDAR system....

  17. Direct fast neutron detection: A status report

    International Nuclear Information System (INIS)

    Peurrung, A.J.; Hansen, R.R.; Craig, R.A.; Hensley, W.K.; Hubbard, C.W.; Keller, P.E.; Reeder, P.L.; Sunberg, D.S.

    1997-12-01

    This report describes the status of efforts to develop direct fast-neutron detection via proton recoil within plastic scintillator. Since recording proton recoil events is of little practical use without a means to discriminate effectively against gamma-ray interactions, the present effort is concentrated on demonstrating a method that distinguishes between pulse types. The proposed method exploits the different pulse shapes that are to be expected primarily on the basis of the slower speed of the recoiling fission neutrons. Should this effort ultimately prove successful, the resulting novel technology will have the potential to significantly lower cost and increase capability for a number of critical neutron-detection applications. Considerable progress has been made toward a clear and compelling demonstration of this new technique. An exhaustive theoretical and numerical investigation of the method has been completed. The authors have been able to better understand the laboratory results and estimate the performance that could ultimately be achieved using the proposed technique. They have assessed the performance of a number of different algorithms for discriminating between neutron and gamma ray events. The results of this assessment will be critical when the construction of low-cost, field-portable neutron detectors becomes necessary. Finally, a laboratory effort to realize effective discrimination is well underway and has resulted in partial success

  18. EXTRAGALACTIC DARK MATTER AND DIRECT DETECTION EXPERIMENTS

    International Nuclear Information System (INIS)

    Baushev, A. N.

    2013-01-01

    Recent astronomical data strongly suggest that a significant part of the dark matter content of the Local Group and Virgo Supercluster is not incorporated into the galaxy halos and forms diffuse components of these galaxy clusters. A portion of the particles from these components may penetrate the Milky Way and make an extragalactic contribution to the total dark matter containment of our Galaxy. We find that the particles of the diffuse component of the Local Group are apt to contribute ∼12% to the total dark matter density near Earth. The particles of the extragalactic dark matter stand out because of their high speed (∼600 km s –1 ), i.e., they are much faster than the galactic dark matter. In addition, their speed distribution is very narrow (∼20 km s –1 ). The particles have an isotropic velocity distribution (perhaps, in contrast to the galactic dark matter). The extragalactic dark matter should provide a significant contribution to the direct detection signal. If the detector is sensitive only to the fast particles (v > 450 km s –1 ), then the signal may even dominate. The density of other possible types of the extragalactic dark matter (for instance, of the diffuse component of the Virgo Supercluster) should be relatively small and comparable with the average dark matter density of the universe. However, these particles can generate anomaly high-energy collisions in direct dark matter detectors.

  19. Excluding the light dark matter window of a 331 model using LHC and direct dark matter detection data

    Energy Technology Data Exchange (ETDEWEB)

    Cogollo, D. [Departamento de Física, Universidade Federal de Campina Grande, Caixa Postal 10071, 58109-970, Campina Grande, PB (Brazil); Gonzalez-Morales, Alma X.; Queiroz, Farinaldo S. [Department of Physics and Santa Cruz Institute for Particle Physics, University of California, Santa Cruz, CA 95064 (United States); Teles, P. Rebello, E-mail: diegocogollo@df.ufcg.edu.br, E-mail: alxogonz@ucsc.edu, E-mail: fdasilva@ucsc.edu, E-mail: patricia.rebello.teles@cern.ch [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rio de Janeiro, RJ (Brazil)

    2014-11-01

    We sift the impact of the recent Higgs precise measurements, and recent dark matter direct detection results, on the dark sector of an electroweak extension of the Standard Model that has a complex scalar as dark matter. We find that in this model the Higgs decays with a large branching ratio into dark matter particles, and charged scalars when these are kinematically available, for any coupling strength differently from the so called Higgs portal. Moreover, we compute the abundance and spin-independent WIMP-nucleon scattering cross section, which are driven by the Higgs and Z{sup '} boson processes. We decisively exclude the 1–500 GeV dark matter window and find the most stringent lower bound in the literature on the scale of symmetry breaking of the model namely 10 TeV, after applying the LUX-2013 limit. Interestingly, the projected XENON1T constraint will be able to rule out the entire 1 GeV–1000 GeV dark matter mass range. Lastly, for completeness, we compute the charged scalar production cross section at the LHC and comment on the possibility of detection at current and future LHC runnings.

  20. Excluding the light dark matter window of a 331 model using LHC and direct dark matter detection data

    International Nuclear Information System (INIS)

    Cogollo, D.; Gonzalez-Morales, Alma X.; Queiroz, Farinaldo S.; Teles, P. Rebello

    2014-01-01

    We sift the impact of the recent Higgs precise measurements, and recent dark matter direct detection results, on the dark sector of an electroweak extension of the Standard Model that has a complex scalar as dark matter. We find that in this model the Higgs decays with a large branching ratio into dark matter particles, and charged scalars when these are kinematically available, for any coupling strength differently from the so called Higgs portal. Moreover, we compute the abundance and spin-independent WIMP-nucleon scattering cross section, which are driven by the Higgs and Z ' boson processes. We decisively exclude the 1–500 GeV dark matter window and find the most stringent lower bound in the literature on the scale of symmetry breaking of the model namely 10 TeV, after applying the LUX-2013 limit. Interestingly, the projected XENON1T constraint will be able to rule out the entire 1 GeV–1000 GeV dark matter mass range. Lastly, for completeness, we compute the charged scalar production cross section at the LHC and comment on the possibility of detection at current and future LHC runnings

  1. Direct progeny detection techniques and random epidemiology

    International Nuclear Information System (INIS)

    Mayya, Y.S.; Mishra, Rosaline; Sapra, B.K.

    2015-01-01

    Over the past 40 years, there has been considerable progress in the measurements methods and their application to the estimates of risks due to radon among general populations. The previous decade saw major development in this regard. It was the direct estimate of indoor radon risk from epidemiological studies in Europe and North America. These were important findings that demonstrated the presence of lung cancer risks at residential radon levels supplementing the generally used risks estimates at high exposures obtained from uranium miner's data. The residential radon epidemiological studies largely used radon concentration as a measure of exposure. The exposure to decay products, which are primarily the dose givers, are assumed to be proportional to the measured gas concentrations. Also, the presence of thoron was neglected in these studies. Although several corrections have appeared to these assessments, the question of variability of actual decay product exposures has largely remained unaddressed. In order to circumvent this limitation, passive techniques were developed to estimate the decay product concentrations directly using deposition monitors. These are based on detecting the alpha particles from decay products deposited on an absorber mounted LR-115 detectors. Known as Direct radon, and Thoron Progeny sensors (DRPS/DTPS), these have been further refined to separate fine fraction from the coarse fraction by wire-mesh capping techniques. Large number environmental calibration exercises and field data generation has been carried out on the progeny concentrations in Indian and some European environments. The development of progeny sensors offers a new tool for future epidemiology. Since in the Indian context, there exist no radon related epidemiological estimates of risk, it is time one conducts large scale studies to seek possible correlations between DRPS/DTPS data and lung cancer risks. While epidemiological studies in High background radiation areas

  2. Direct Detection of Soil-Bound Prions

    Science.gov (United States)

    Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro

    2007-01-01

    Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

  3. Direct detection of soil-bound prions.

    Directory of Open Access Journals (Sweden)

    Sacha Genovesi

    Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.

  4. Cosmological radio emission induced by WIMP Dark Matter

    International Nuclear Information System (INIS)

    Fornengo, N.; Regis, M.; Lineros, R.; Taoso, M.

    2012-01-01

    We present a detailed analysis of the radio synchrotron emission induced by WIMP dark matter annihilations and decays in extragalactic halos. We compute intensity, angular correlation, and source counts and discuss the impact on the expected signals of dark matter clustering, as well as of other astrophysical uncertainties as magnetic fields and spatial diffusion. Bounds on dark matter microscopic properties are then derived, and, depending on the specific set of assumptions, they are competitive with constraints from other indirect dark matter searches. At GHz frequencies, dark matter sources can become a significant fraction of the total number of sources with brightness below the microJansky level. We show that, at this level of fluxes (which are within the reach of the next-generation radio surveys), properties of the faint edge of differential source counts, as well as angular correlation data, can become an important probe for WIMPs

  5. Cosmological radio emission induced by WIMP Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Fornengo, N.; Regis, M. [Dipartimento di Fisica Teorica, Università di Torino, via P. Giuria 1, I-10125 Torino (Italy); Lineros, R.; Taoso, M., E-mail: fornengo@to.infn.it, E-mail: rlineros@ific.uv.es, E-mail: regis@to.infn.it, E-mail: mtaoso@phas.ubc.ca [IFIC, CSIC-Universidad de Valencia, Ed. Institutos, Apdo. Correos 22085, E-46071 Valencia (Spain)

    2012-03-01

    We present a detailed analysis of the radio synchrotron emission induced by WIMP dark matter annihilations and decays in extragalactic halos. We compute intensity, angular correlation, and source counts and discuss the impact on the expected signals of dark matter clustering, as well as of other astrophysical uncertainties as magnetic fields and spatial diffusion. Bounds on dark matter microscopic properties are then derived, and, depending on the specific set of assumptions, they are competitive with constraints from other indirect dark matter searches. At GHz frequencies, dark matter sources can become a significant fraction of the total number of sources with brightness below the microJansky level. We show that, at this level of fluxes (which are within the reach of the next-generation radio surveys), properties of the faint edge of differential source counts, as well as angular correlation data, can become an important probe for WIMPs.

  6. Dark matter and its detection

    International Nuclear Information System (INIS)

    Bi Xiaojun; Qin Bo

    2011-01-01

    We first explain the concept of dark matter,then review the history of its discovery and the evidence of its existence. We describe our understanding of the nature of dark matter particles, the popular dark matter models,and why the weakly interacting massive particles (called WIMPs) are the most attractive candidates for dark matter. Then we introduce the three methods of dark matter detection: colliders, direct detection and indirect detection. Finally, we review the recent development of dark matter detection, including the new results from DAMA, CoGent, PAMELA, ATIC and Fermi. (authors)

  7. Study of new germanium bolometers with interleaved concentric electrodes for non-baryonic cold dark matter direct detection in the Edelweiss-II experiment

    International Nuclear Information System (INIS)

    Domange, J.

    2011-09-01

    EDELWEISS is a direct non-baryonic cold dark matter detection experiment in the form of weakly interacting massive particles (also known as WIMPs), which currently constitute the most popular candidates to account for the missing mass in the Universe. To this purpose, EDELWEISS uses germanium bolometers at cryogenic temperature (20 mK approximately) in the Underground Laboratory of Modane (LSM) at the French-Italian border. Since 2008, a new type of detector is operated, equipped with concentric electrodes to optimize the rejection of surface events (coplanar-grid detectors). This thesis work is divided into several research orientations. First, we carried out measurements concerning charge collection in the crystals. The velocity laws of the carriers (electrons and holes) have been determined in germanium at 20 mK in the orientation, and a complete study of charge sharing has been done, including an evaluation of the transport anisotropy and of the straggling of the carriers. These results lead to a better understanding of the inner properties of the EDELWEISS detectors. Then, studies relating to the improvement of the performances were carried out. In particular, we have optimized the space-charge cancellation procedure in the crystals and improved the passive rejection of surface events (β). The fiducial volume of the detectors has been evaluated using two X-ray lines from cosmically activated radionuclides: 68 Ge and 65 Zn. Finally, an exhaustive study of the low energy spectra has been carried out, which makes it possible to develop a systematic analysis method for the search of low-mass WIMPs in EDELWEISS. (author)

  8. Direct and indirect detection of supersymmetric dark matter; Detection directe et indirecte de matiere sombre supersymetrique

    Energy Technology Data Exchange (ETDEWEB)

    Mayet, F

    2001-09-01

    A substantial body of astrophysical evidence supports the existence of non-baryonic dark matter in the universe. One of the leading dark matter candidates is the neutralino predicted by the supersymmetric extensions of the standard model of particle physics. Different detectors have been designed for the detection, either indirect or direct, of the neutralino. Related to indirect detection, the present work has been performed in the context of the AMS experiment. A precursor version of the spectrometer was flown on the space shuttle Discovery in June 1998. The detector included an Aerogel Threshold Cherenkov counter (ATC) to identify antiprotons, whose spectrum may be used to infer a neutralino signal. The analysis of the ATC data is presented including an evaluation of the flight performance and a description of the optimization of the antiproton selection. An antiproton analysis is also reported. A phenomenological study allows us to investigate the discovery potential of this indirect method. This thesis also includes the development of a new detector (MACHe3) designed for direct neutralino search using a superfluid {sup 3}He bolometer operated at ultra low temperatures. The data analysis of the prototype cell is presented. A Monte Carlo simulation has been developed, in order to optimize the detector design for direct neutralino search. These results are compared with theoretical predictions of supersymmetric models, thus highlighting the discovery potential of this detector and its complementarity with existing devices. (author)

  9. DarkSide-20k: A 20 tonne two-phase LAr TPC for direct dark matter detection at LNGS

    Science.gov (United States)

    Aalseth, C. E.; Acerbi, F.; Agnes, P.; Albuquerque, I. F. M.; Alexander, T.; Alici, A.; Alton, A. K.; Antonioli, P.; Arcelli, S.; Ardito, R.; Arnquist, I. J.; Asner, D. M.; Ave, M.; Back, H. O.; Barrado Olmedo, A. I.; Batignani, G.; Bertoldo, E.; Bettarini, S.; Bisogni, M. G.; Bocci, V.; Bondar, A.; Bonfini, G.; Bonivento, W.; Bossa, M.; Bottino, B.; Boulay, M.; Bunker, R.; Bussino, S.; Buzulutskov, A.; Cadeddu, M.; Cadoni, M.; Caminata, A.; Canci, N.; Candela, A.; Cantini, C.; Caravati, M.; Cariello, M.; Carlini, M.; Carpinelli, M.; Castellani, A.; Catalanotti, S.; Cataudella, V.; Cavalcante, P.; Cavuoti, S.; Cereseto, R.; Chepurnov, A.; Cicalò, C.; Cifarelli, L.; Citterio, M.; Cocco, A. G.; Colocci, M.; Corgiolu, S.; Covone, G.; Crivelli, P.; D'Antone, I.; D'Incecco, M.; D'Urso, D.; Da Rocha Rolo, M. D.; Daniel, M.; Davini, S.; de Candia, A.; De Cecco, S.; De Deo, M.; De Filippis, G.; De Guido, G.; De Rosa, G.; Dellacasa, G.; Della Valle, M.; Demontis, P.; Derbin, A.; Devoto, A.; Di Eusanio, F.; Di Pietro, G.; Dionisi, C.; Dolgov, A.; Dormia, I.; Dussoni, S.; Empl, A.; Fernandez Diaz, M.; Ferri, A.; Filip, C.; Fiorillo, G.; Fomenko, K.; Franco, D.; Froudakis, G. E.; Gabriele, F.; Gabrieli, A.; Galbiati, C.; Garcia Abia, P.; Gendotti, A.; Ghisi, A.; Giagu, S.; Giampa, P.; Gibertoni, G.; Giganti, C.; Giorgi, M. A.; Giovanetti, G. K.; Gligan, M. L.; Gola, A.; Gorchakov, O.; Goretti, A. M.; Granato, F.; Grassi, M.; Grate, J. W.; Grigoriev, G. Y.; Gromov, M.; Guan, M.; Guerra, M. B. B.; Guerzoni, M.; Gulino, M.; Haaland, R. K.; Hallin, A.; Harrop, B.; Hoppe, E. W.; Horikawa, S.; Hosseini, B.; Hughes, D.; Humble, P.; Hungerford, E. V.; Ianni, An.; Jillings, C.; Johnson, T. N.; Keeter, K.; Kendziora, C. L.; Kim, S.; Koh, G.; Korablev, D.; Korga, G.; Kubankin, A.; Kuss, M.; Kuźniak, M.; La Commara, M.; Lehnert, B.; Li, X.; Lissia, M.; Lodi, G. U.; Loer, B.; Longo, G.; Loverre, P.; Lussana, R.; Luzzi, L.; Ma, Y.; Machado, A. A.; Machulin, I. N.; Mandarano, A.; Mapelli, L.; Marcante, M.; Margotti, A.; Mari, S. M.; Mariani, M.; Maricic, J.; Martoff, C. J.; Mascia, M.; Mayer, M.; McDonald, A. B.; Messina, A.; Meyers, P. D.; Milincic, R.; Moggi, A.; Moioli, S.; Monroe, J.; Monte, A.; Morrocchi, M.; Mount, B. J.; Mu, W.; Muratova, V. N.; Murphy, S.; Musico, P.; Nania, R.; Navrer Agasson, A.; Nikulin, I.; Nosov, V.; Nozdrina, A. O.; Nurakhov, N. N.; Oleinik, A.; Oleynikov, V.; Orsini, M.; Ortica, F.; Pagani, L.; Pallavicini, M.; Palmas, S.; Pandola, L.; Pantic, E.; Paoloni, E.; Paternoster, G.; Pavletcov, V.; Pazzona, F.; Peeters, S.; Pelczar, K.; Pellegrini, L. A.; Pelliccia, N.; Perotti, F.; Perruzza, R.; Pesudo, V.; Piemonte, C.; Pilo, F.; Pocar, A.; Pollmann, T.; Portaluppi, D.; Pugachev, D. A.; Qian, H.; Radics, B.; Raffaelli, F.; Ragusa, F.; Razeti, M.; Razeto, A.; Regazzoni, V.; Regenfus, C.; Reinhold, B.; Renshaw, A. L.; Rescigno, M.; Retière, F.; Riffard, Q.; Rivetti, A.; Rizzardini, S.; Romani, A.; Romero, L.; Rossi, B.; Rossi, N.; Rubbia, A.; Sablone, D.; Salatino, P.; Samoylov, O.; Sánchez García, E.; Sands, W.; Sanfilippo, S.; Sant, M.; Santorelli, R.; Savarese, C.; Scapparone, E.; Schlitzer, B.; Scioli, G.; Segreto, E.; Seifert, A.; Semenov, D. A.; Shchagin, A.; Shekhtman, L.; Shemyakina, E.; Sheshukov, A.; Simeone, M.; Singh, P. N.; Skensved, P.; Skorokhvatov, M. D.; Smirnov, O.; Sobrero, G.; Sokolov, A.; Sotnikov, A.; Speziale, F.; Stainforth, R.; Stanford, C.; Suffritti, G. B.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Tonazzo, A.; Tosi, A.; Trinchese, P.; Unzhakov, E. V.; Vacca, A.; Vázquez-Jáuregui, E.; Verducci, M.; Viant, T.; Villa, F.; Vishneva, A.; Vogelaar, B.; Wada, M.; Wahl, J.; Walding, J.; Wang, H.; Wang, Y.; Watson, A. W.; Westerdale, S.; Williams, R.; Wojcik, M. M.; Wu, S.; Xiang, X.; Xiao, X.; Yang, C.; Ye, Z.; Yllera de Llano, A.; Zappa, F.; Zappalà, G.; Zhu, C.; Zichichi, A.; Zullo, M.; Zullo, A.; Zuzel, G.

    2018-03-01

    Building on the successful experience in operating the DarkSide-50 detector, the DarkSide Collaboration is going to construct DarkSide-20k, a direct WIMP search detector using a two-phase Liquid Argon Time Projection Chamber (LAr TPC) with an active (fiducial) mass of 23 t (20 t). This paper describes a preliminary design for the experiment, in which the DarkSide-20k LAr TPC is deployed within a shield/veto with a spherical Liquid Scintillator Veto (LSV) inside a cylindrical Water Cherenkov Veto (WCV). This preliminary design provides a baseline for the experiment to achieve its physics goals, while further development work will lead to the final optimization of the detector parameters and an eventual technical design. Operation of DarkSide-50 demonstrated a major reduction in the dominant 39Ar background when using argon extracted from an underground source, before applying pulse shape analysis. Data from DarkSide-50, in combination with MC simulation and analytical modeling, shows that a rejection factor for discrimination between electron and nuclear recoils of >3 × 109 is achievable. This, along with the use of the veto system and utilizing silicon photomultipliers in the LAr TPC, are the keys to unlocking the path to large LAr TPC detector masses, while maintaining an experiment in which less than < 0.1 events (other than ν-induced nuclear recoils) is expected to occur within the WIMP search region during the planned exposure. DarkSide-20k will have ultra-low backgrounds than can be measured in situ, giving sensitivity to WIMP-nucleon cross sections of 1.2 × 10^{-47} cm2 (1.1 × 10^{-46} cm2) for WIMPs of 1 TeV/c 2 (10 TeV/c 2) mass, to be achieved during a 5 yr run producing an exposure of 100 t yr free from any instrumental background.

  10. WIMP Dark Matter interpretation of Higgs results

    CERN Document Server

    Wang, Renjie; The ATLAS collaboration

    2017-01-01

    The results from searching for dark matter either directly from invisible decay of Higgs bosons or in association with a Higgs boson at the LHC are presented. No significant excess is found beyond the Standard Model prediction, and upper limits are set on the production cross section times branching fraction using data collected in proton-proton collisions at center-of-mass energies of 13 TeV by the ATLAS and CMS detectors. An interpreted upper limit is presented on the allowed dark matter-nucleon scattering cross section.

  11. Final results of the EDELWEISS-II WIMP search using a 4-kg array of cryogenic germanium detectors with interleaved electrodes

    International Nuclear Information System (INIS)

    Armengaud, E.; Augier, C.; Benoit, A.; Berge, L.; Bluemer, J.; Broniatowski, A.; Brudanin, V.; Censier, B.; Chardin, G.; Chapellier, M.; Charlieux, F.; Coulter, P.; Cox, G.A.; Defay, X.; De Jesus, M.; Dolgorouki, Y.; Domange, J.; Dumoulin, L.

    2011-01-01

    The EDELWEISS-II Collaboration has completed a direct search for WIMP dark matter with an array of ten 400-g cryogenic germanium detectors in operation at the Laboratoire Souterrain de Modane. The combined use of thermal phonon sensors and charge collection electrodes with an interleaved geometry enables the efficient rejection of γ-induced radioactivity as well as near-surface interactions. A total effective exposure of 384 kg d has been achieved, mostly coming from fourteen months of continuous operation. Five nuclear recoil candidates are observed above 20 keV, while the estimated background is 3.0 events. The result is interpreted in terms of limits on the cross-section of spin-independent interactions of WIMPs and nucleons. A cross-section of 4.4x10 -8 pb is excluded at 90%CL for a WIMP mass of 85 GeV. New constraints are also set on models where the WIMP-nucleon scattering is inelastic.

  12. Inverted dipole feature in directional detection of exothermic dark matter

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Gelmini, Graciela B.; Gondolo, Paolo

    2017-01-01

    Directional dark matter detection attempts to measure the direction of motion of nuclei recoiling after having interacted with dark matter particles in the halo of our Galaxy. Due to Earth's motion with respect to the Galaxy, the dark matter flux is concentrated around a preferential direction. An anisotropy in the recoil direction rate is expected as an unmistakable signature of dark matter. The average nuclear recoil direction is expected to coincide with the average direction of dark matter particles arriving to Earth. Here we point out that for a particular type of dark matter, inelastic exothermic dark matter, the mean recoil direction as well as a secondary feature, a ring of maximum recoil rate around the mean recoil direction, could instead be opposite to the average dark matter arrival direction. Thus, the detection of an average nuclear recoil direction opposite to the usually expected direction would constitute a spectacular experimental confirmation of this type of dark matter.

  13. Indirect detection of radiation sources through direct detection of radiolysis products

    Science.gov (United States)

    Farmer, Joseph C [Tracy, CA; Fischer, Larry E [Los Gatos, CA; Felter, Thomas E [Livermore, CA

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  14. An intermediate framework between WIMP, FIMP, and EWIP dark matter

    International Nuclear Information System (INIS)

    Yaguna, Carlos E.

    2012-01-01

    WIMP (Weakly Interacting Massive Particle), FIMP (Feebly interacting Massive Particle) and EWIP (Extremely Weakly Interacting Particle) dark matter are different theoretical frameworks that have been postulated to explain the dark matter. In this paper we examine an intermediate scenario that combines features from these three frameworks. It consists of a weakly interacting particle — à la WIMP — that does not reach thermal equilibrium in the early Universe — à la FIMP — and whose relic density is determined by the reheating temperature of the Universe — à la EWIP. As an example, an explicit realization of this framework, based on the singlet scalar model of dark matter, is analyzed in detail. In particular, the relic density is studied as a function of the parameters of the model, and the new viable region within this intermediate scenario is determined. Finally, it is shown that this alternative framework of dark matter allows for arbitrarily heavy dark matter particles and that it suggests a connection between dark matter and inflation

  15. Current status of direct dark matter detection experiments

    Science.gov (United States)

    Liu, Jianglai; Chen, Xun; Ji, Xiangdong

    2017-03-01

    Much like ordinary matter, dark matter might consist of elementary particles, and weakly interacting massive particles are one of the prime suspects. During the past decade, the sensitivity of experiments trying to directly detect them has improved by three to four orders of magnitude, but solid evidence for their existence is yet to come. We overview the recent progress in direct dark matter detection experiments and discuss future directions.

  16. Thermalization time scales for WIMP capture by the Sun in effective theories

    Energy Technology Data Exchange (ETDEWEB)

    Widmark, A., E-mail: axel.widmark@fysik.su.se [The Oskar Klein Centre for Cosmoparticle Physics, AlbaNova, SE-106 91 Stockholm (Sweden)

    2017-05-01

    I study the process of dark matter capture by the Sun, under the assumption of a Weakly Interacting Massive Particle (WIMP), in the framework of non-relativistic effective field theory. Hypothetically, WIMPs from the galactic halo can scatter against atomic nuclei in the solar interior, settle to thermal equilibrium with the solar core and annihilate to produce an observable flux of neutrinos. In particular, I examine the thermalization process using Monte-Carlo integration of WIMP trajectories. I consider WIMPs in a mass range of 10–1000 GeV and WIMP-nucleon interaction operators with different dependence on spin and transferred momentum. I find that the density profiles of captured WIMPs are in accordance with a thermal profile described by the Sun's gravitational potential and core temperature. Depending on the operator that governs the interaction, the majority of the thermalization time is spent in either the solar interior or exterior. If normalizing the WIMP-nuclei interaction strength to a specific capture rate, I find that the thermalization time differs at most by 3 orders of magnitude between operators. In most cases of interest, the thermalization time is many orders of magnitude shorter than the age of the solar system.

  17. Generalized spin-dependent WIMP-nucleus interactions and the DAMA modulation effect

    Energy Technology Data Exchange (ETDEWEB)

    Scopel, Stefano; Yoon, Kook-Hyun; Yoon, Jong-Hyun, E-mail: scopel@sogang.ac.kr, E-mail: koreasds@naver.com, E-mail: pledge200@gmail.com [Department of Physics, Sogang University, Seoul (Korea, Republic of)

    2015-07-01

    Guided by non-relativistic Effective Field Theory (EFT) we classify the most general spin-dependent interactions between a fermionic Weakly Interacting Massive Particle (WIMP) and nuclei, and within this class of models we discuss the viability of an interpretation of the DAMA modulation result in terms of a signal from WIMP elastic scatterings using a halo-independent approach. We find that, although several relativistic EFT's can lead to a spin-dependent cross section, in some cases with an explicit, non-negligible dependence on the WIMP incoming velocity, three main scenarios can be singled out in the non-relativistic limit which approximately encompass them all, and that only differ by their dependence on the transferred momentum. For two of them compatibility between DAMA and other constraints is possible for a WIMP mass below 30 GeV, but only for a WIMP velocity distribution in the halo of our Galaxy which departs from a Maxwellian. This is achieved by combining a suppression of the WIMP effective coupling to neutrons (to evade constraints from xenon and germanium detectors) to an explicit quadratic or quartic dependence of the cross section on the transferred momentum (that leads to a relative enhancement of the expected rate off sodium in DAMA compared to that off fluorine in droplet detectors and bubble chambers). For larger WIMP masses the same scenarios are excluded by scatterings off iodine in COUPP.

  18. Simultaneous Generation of WIMP Miracle-like Densities of Baryons and Dark Matter

    International Nuclear Information System (INIS)

    McDonald, John

    2012-01-01

    The observed density of dark matter is of the magnitude expected for a thermal relic weakly-interacting massive particle (WIMP). In addition, the observed baryon density is within an order of magnitude of the dark matter density. This suggests that the baryon density is physically related to a typical thermal relic WIMP dark matter density. We present a model which simultaneously generates thermal relic WIMP-like densities for both baryons and dark matter by modifying a large initial baryon asymmetry. Production of unstable scalars carrying baryon number at the LHC would be a clear signature of the model.

  19. Gravitationally induced particle production and its impact on the WIMP abundance

    Directory of Open Access Journals (Sweden)

    I. Baranov

    2015-12-01

    Full Text Available A large set of independent astronomical observations have provided a strong evidence for nonbaryonic dark matter in the Universe. One of the most investigated candidates is an unknown long-lived Weakly Interacting Massive Particle (WIMP which was in thermal equilibrium with the primeval plasma. Here we investigate the WIMP abundance based on the relativistic kinetic treatment for gravitationally induced particle production recently proposed in the literature (Lima and Baranov, 2014 [16]. The new evolution equation is deduced and solved both numerically and through a semi-analytical approach. The predictions of the WIMP observables are discussed and compared with the ones obtained in the standard approach.

  20. Beyond WIMPs: the Quark (Anti Nugget Dark Matter

    Directory of Open Access Journals (Sweden)

    Zhitnitsky Ariel

    2017-01-01

    Full Text Available We review a testable dark matter (DM model outside of the standard WIMP paradigm. The model is unique in a sense that the observed ratio Ωdark ≃ Ωvisible for visible and dark matter densities finds its natural explanation as a result of their common QCD origin when both types of matter (DM and visible are formed during the QCD phase transition and both are proportional to single dimensional parameter of the system, Λqcd. We argue that the charge separation effect also inevitably occurs during the same QCD phase transition in the presence of the CP odd axion field a(x. It leads to preferential formation of one species of nuggets on the scales of the visible Universe where the axion field a(x is coherent. A natural outcome of this preferential evolution is that only one type of the visible baryons (not anti- baryons remain in the system after the nuggets complete their formation. Unlike conventional WIMP dark matter candidates, the nuggets and anti-nuggets are strongly interacting but macroscopically large objects. The rare events of annihilation of the anti-nuggets with visible matter lead to a number of observable effects. We argue that the relative intensities for a number of measured excesses of emission from the centre of galaxy (covering more than 11 orders of magnitude are determined by standard and well established physics. At the same time the absolute intensity of emission is determined by a single new fundamental parameter of the theory, the axion mass, 10−6eV ≲ ma ≲ 10−3eV. Finally, we comment on implications of these studies for the axion search experiments, including microwave cavity and the Orpheus experiments.

  1. Direct 13C NMR Detection in HPLC Hyphenation Mode

    DEFF Research Database (Denmark)

    Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils

    2012-01-01

    Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments...... application of HPLC-SPE-NMR analysis using direct-detected (13)C NMR spectra. HPLC column loading, accumulative SPE trappings, and the effect of different elution solvents were evaluated and optimized. A column loading of approximately 600 mug of a prefractionated triterpenoid mixture, six trappings...

  2. Direct detection of the optical field beyond single polarization mode.

    Science.gov (United States)

    Che, Di; Sun, Chuanbowen; Shieh, William

    2018-02-05

    Direct detection is traditionally regarded as a detection method that recovers only the optical intensity. Compared with coherent detection, it owns a natural advantage-the simplicity-but lacks a crucial capability of field recovery that enables not only the multi-dimensional modulation, but also the digital compensation of the fiber impairments linear with the optical field. Full-field detection is crucial to increase the capacity-distance product of optical transmission systems. A variety of methods have been investigated to directly detect the optical field of the single polarization mode, which normally sends a carrier traveling with the signal for self-coherent detection. The crux, however, is that any optical transmission medium supports at least two propagating modes (e.g. single mode fiber supports two polarization modes), and until now there is no direct detection that can recover the complete set of optical fields beyond one polarization, due to the well-known carrier fading issue after mode demultiplexing induced by the random mode coupling. To avoid the fading, direct detection receivers should recover the signal in an intensity space isomorphic to the optical field without loss of any degrees of freedom, and a bridge should be built between the field and its isomorphic space for the multi-mode field recovery. Based on this thinking, we propose, for the first time, the direct detection of dual polarization modes by a novel receiver concept, the Stokes-space field receiver (SSFR) and its extension, the generalized SSFR for multiple spatial modes. The idea is verified by a dual-polarization field recovery of a polarization-multiplexed complex signal over an 80-km single mode fiber transmission. SSFR can be applied to a much wider range of fields beyond optical communications such as coherent sensing and imaging, where simple field recovery without an extra local laser is desired for enhanced system performance.

  3. Limits on Spin-Dependent WIMP-Nucleon Cross Section Obtained from the Complete LUX Exposure

    Science.gov (United States)

    Akerib, D. S.; Alsum, S.; Araújo, H. M.; Bai, X.; Bailey, A. J.; Balajthy, J.; Beltrame, P.; Bernard, E. P.; Bernstein, A.; Biesiadzinski, T. P.; Boulton, E. M.; Brás, P.; Byram, D.; Cahn, S. B.; Carmona-Benitez, M. C.; Chan, C.; Chiller, A. A.; Chiller, C.; Currie, A.; Cutter, J. E.; Davison, T. J. R.; Dobi, A.; Dobson, J. E. Y.; Druszkiewicz, E.; Edwards, B. N.; Faham, C. H.; Fallon, S. R.; Fiorucci, S.; Gaitskell, R. J.; Gehman, V. M.; Ghag, C.; Gilchriese, M. G. D.; Hall, C. R.; Hanhardt, M.; Haselschwardt, S. J.; Hertel, S. A.; Hogan, D. P.; Horn, M.; Huang, D. Q.; Ignarra, C. M.; Jacobsen, R. G.; Ji, W.; Kamdin, K.; Kazkaz, K.; Khaitan, D.; Knoche, R.; Larsen, N. A.; Lee, C.; Lenardo, B. G.; Lesko, K. T.; Lindote, A.; Lopes, M. I.; Manalaysay, A.; Mannino, R. L.; Marzioni, M. F.; McKinsey, D. N.; Mei, D.-M.; Mock, J.; Moongweluwan, M.; Morad, J. A.; Murphy, A. St. J.; Nehrkorn, C.; Nelson, H. N.; Neves, F.; O'Sullivan, K.; Oliver-Mallory, K. C.; Palladino, K. J.; Pease, E. K.; Reichhart, L.; Rhyne, C.; Shaw, S.; Shutt, T. A.; Silva, C.; Solmaz, M.; Solovov, V. N.; Sorensen, P.; Stephenson, S.; Sumner, T. J.; Szydagis, M.; Taylor, D. J.; Taylor, W. C.; Tennyson, B. P.; Terman, P. A.; Tiedt, D. R.; To, W. H.; Tripathi, M.; Tvrznikova, L.; Uvarov, S.; Velan, V.; Verbus, J. R.; Webb, R. C.; White, J. T.; Whitis, T. J.; Witherell, M. S.; Wolfs, F. L. H.; Xu, J.; Yazdani, K.; Young, S. K.; Zhang, C.; LUX Collaboration

    2017-06-01

    We present experimental constraints on the spin-dependent WIMP-nucleon elastic cross sections from the total 129.5 kg yr exposure acquired by the Large Underground Xenon experiment (LUX), operating at the Sanford Underground Research Facility in Lead, South Dakota (USA). A profile likelihood ratio analysis allows 90% C.L. upper limits to be set on the WIMP-neutron (WIMP-proton) cross section of σn=1.6 ×10-41 cm2 (σp=5 ×10-40 cm2 ) at 35 GeV c-2 , almost a sixfold improvement over the previous LUX spin-dependent results. The spin-dependent WIMP-neutron limit is the most sensitive constraint to date.

  4. Assembly of gamma radiation detection with directivity properties

    International Nuclear Information System (INIS)

    Stoica, M.; Talpalariu, C.

    2016-01-01

    An assembly of gamma radiation detection with directivity properties and small size enables the development of portable equipment or robots specialized in finding and signaling radioactively contaminated areas in case of nuclear incidents or decommissioning of nuclear installations. Directivity characteristic of the assembly of gamma radiation detection is very important when aiming to build an equipment for searching radioactively contaminated areas. In order to obtain a suitable directivity characteristics in terms of detection of gamma rays, it was necessary to construct a lead collimator with a cylindrical shape. The detector, preamplifier and amplifier pulse were placed inside the collimator and pulse discriminator circuit and power source were placed beside the collimator, all being disposed within the housing cylindrical experimental. A PIN photodiode type was used as a detector of gamma radiation. (authors)

  5. Can the Existence of Dark Energy be Directly Detected?

    Energy Technology Data Exchange (ETDEWEB)

    Perl, Martin L.; /SLAC /KIPAC, Menlo Park

    2011-11-23

    The majority of astronomers and physicists accept the reality of dark energy and also believe that it can only be studied indirectly through observation of the motions of stars and galaxies. In this paper I open the experimental question of whether it is possible to directly detect dark energy through the presence of dark energy density. Two thirds of this paper outlines the major aspects of dark energy density as now comprehended by the astronomical and physics community. The final third summarizes various proposals for direct detection of dark energy density or its possible effects. At this time I do not have a fruitful answer to the question: Can the Existence of Dark Energy Be Directly Detected?

  6. Optimized velocity distributions for direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Ibarra, Alejandro; Rappelt, Andreas, E-mail: ibarra@tum.de, E-mail: andreas.rappelt@tum.de [Physik-Department T30d, Technische Universität München, James-Franck-Straße, 85748 Garching (Germany)

    2017-08-01

    We present a method to calculate, without making assumptions about the local dark matter velocity distribution, the maximal and minimal number of signal events in a direct detection experiment given a set of constraints from other direct detection experiments and/or neutrino telescopes. The method also allows to determine the velocity distribution that optimizes the signal rates. We illustrate our method with three concrete applications: i) to derive a halo-independent upper limit on the cross section from a set of null results, ii) to confront in a halo-independent way a detection claim to a set of null results and iii) to assess, in a halo-independent manner, the prospects for detection in a future experiment given a set of current null results.

  7. Direct detection of antihydrogen atoms using a BGO crystal

    Energy Technology Data Exchange (ETDEWEB)

    Nagata, Y. [Department of Applied Physics, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei-shi, 184-8588 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Kuroda, N., E-mail: kuroda@phys.c.u-tokyo.ac.jp [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Ohtsuka, M. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Leali, M.; Lodi-Rizzini, E.; Mascagna, V. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Tajima, M.; Torii, H.A. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Zurlo, N. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Matsuda, Y. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Venturelli, L. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Yamazaki, Y. [Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan)

    2016-12-21

    The ASACUSA collaboration has developed a detector consisting of a large size BGO crystal to detect an atomic antihydrogen beam, and performed the direct detection of antihydrogen atoms. Energy spectra from antihydrogen annihilation on the BGO crystal are discussed in comparison to simulation results from the GEANT4 toolkit. Background mainly originating from cosmic rays were strongly suppressed by analyzing the energy deposited in the BGO and requiring a multiplicity of charged pions. Thus antihydrogen events were identified.

  8. Direct detection of neutralino dark matter in the NMSSM

    International Nuclear Information System (INIS)

    Cerdeno, David G

    2006-01-01

    The direct detection of neutralino dark matter is analysed in the Next-to-Minimal Supersymmetric Standard Model (NMSSM). Sizable values for the neutralino detection cross section, within the reach of dark matter detectors, are attainable, due to the exchange of very light Higgses, which have a significant singlet composition. The lightest neutralino exhibits a large singlino-Higgsino composition, and a mass in the range 50 ∼ χ -0 1 ∼< 100 GeV

  9. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    Science.gov (United States)

    2015-01-01

    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  10. Light Magnetic Dark Matter in Direct Detection Searches

    DEFF Research Database (Denmark)

    Del Nobile, Eugenio; Kouvaris, Christoforos; Panci, Paolo

    2012-01-01

    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out...

  11. Direct detection of the inflationary gravitational-wave background

    International Nuclear Information System (INIS)

    Smith, Tristan L.; Kamionkowski, Marc; Cooray, Asantha

    2006-01-01

    Inflation generically predicts a stochastic background of gravitational waves over a broad range of frequencies, from those accessible with cosmic microwave background (CMB) measurements, to those accessible directly with gravitational-wave detectors, like NASA's Big-Bang Observer (BBO) or Japan's Deci-Hertz Interferometer Gravitational-wave Observer (DECIGO), both currently under study. Here we investigate the detectability of the inflationary gravitational-wave background at BBO/DECIGO frequencies. To do so, we survey a range of slow-roll inflationary models consistent with constraints from the CMB and large-scale structure (LSS). We go beyond the usual assumption of power-law power spectra, which may break down given the 16 orders of magnitude in frequency between the CMB and direct detection, and solve instead the inflationary dynamics for four classes of inflaton potentials. Direct detection is possible in a variety of inflationary models, although probably not in any in which the gravitational-wave signal does not appear in the CMB polarization. However, direct detection by BBO/DECIGO can help discriminate between inflationary models that have the same slow-roll parameters at CMB/LSS scales

  12. Development and deployment of the Collimated Directional Radiation Detection System

    Science.gov (United States)

    Guckes, Amber L.; Barzilov, Alexander

    2017-09-01

    The Collimated Directional Radiation Detection System (CDRDS) is capable of imaging radioactive sources in two dimensions (as a directional detector). The detection medium of the CDRDS is a single Cs2LiYCl6:Ce3+ scintillator cell enriched in 7Li (CLYC-7). The CLYC-7 is surrounded by a heterogeneous high-density polyethylene (HDPE) and lead (Pb) collimator. These materials make-up a coded aperture inlaid in the collimator. The collimator is rotated 360° by a stepper motor which enables time-encoded imaging of a radioactive source. The CDRDS is capable of spectroscopy and pulse shape discrimination (PSD) of photons and fast neutrons. The measurements of a radioactive source are carried out in discrete time steps that correlate to the angular rotation of the collimator. The measurement results are processed using a maximum likelihood expectation (MLEM) algorithm to create an image of the measured radiation. This collimator design allows for the directional detection of photons and fast neutrons simultaneously by utilizing only one CLYC-7 scintillator. Directional detection of thermal neutrons can also be performed by utilizing another suitable scintillator. Moreover, the CDRDS is portable, robust, and user friendly. This unit is capable of utilizing wireless data transfer for possible radiation mapping and network-centric applications. The CDRDS was tested by performing laboratory measurements with various gamma-ray and neutron sources.

  13. Sol-gel matrices for direct colorimetric detection of analytes

    Science.gov (United States)

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2000-01-01

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  14. Analysis of the theoretical bias in dark matter direct detection

    International Nuclear Information System (INIS)

    Catena, Riccardo

    2014-01-01

    Fitting the model ''A'' to dark matter direct detection data, when the model that underlies the data is ''B'', introduces a theoretical bias in the fit. We perform a quantitative study of the theoretical bias in dark matter direct detection, with a focus on assumptions regarding the dark matter interactions, and velocity distribution. We address this problem within the effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. We analyze 24 benchmark points in the parameter space of the theory, using frequentist and Bayesian statistical methods. First, we simulate the data of future direct detection experiments assuming a momentum/velocity dependent dark matter-nucleon interaction, and an anisotropic dark matter velocity distribution. Then, we fit a constant scattering cross section, and an isotropic Maxwell-Boltzmann velocity distribution to the simulated data, thereby introducing a bias in the analysis. The best fit values of the dark matter particle mass differ from their benchmark values up to 2 standard deviations. The best fit values of the dark matter-nucleon coupling constant differ from their benchmark values up to several standard deviations. We conclude that common assumptions in dark matter direct detection are a source of potentially significant bias

  15. Direct detection of dark matter bound to the Earth

    DEFF Research Database (Denmark)

    Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    We study the properties and direct detection prospects of an as of yet neglected population of dark matter (DM) particles moving in orbits gravitationally bound to the Earth. This DM population is expected to form via scattering by nuclei in the Earth's interior. We compute fluxes and nuclear...

  16. arXiv Uncertainties in WIMP Dark Matter Scattering Revisited

    CERN Document Server

    Ellis, John; Olive, Keith A.

    We revisit the uncertainties in the calculation of spin-independent scattering matrix elements for the scattering of WIMP dark matter particles on nuclear matter. In addition to discussing the uncertainties due to limitations in our knowledge of the nucleonic matrix elements of the light quark scalar densities , we also discuss the importances of heavy quark scalar densities , and comment on uncertainties in quark mass ratios. We analyze estimates of the light-quark densities made over the past decade using lattice calculations and/or phenomenological inputs. We find an uncertainty in the combination that is larger than has been assumed in some phenomenological analyses, and a range of that is smaller but compatible with earlier estimates. We also analyze the importance of the {\\cal O}(\\alpha_s^3) calculations of the heavy-quark matrix elements that are now available, which provide an important refinement of the calculation of the spin-independent scattering cross section. We use for illustration a benchmar...

  17. Results and status of the Edelweiss Wimp search experiment

    International Nuclear Information System (INIS)

    Benoit, A.; Berge, L.; Blumer, J.; Broniatowski, A.; Censier, B.; Chabert, L.; Chambon, B.; Chapellier, M.; Chardin, G.; Charvin, P.; Jesus, M. de; Drain, D.; Di Stefano, P.; Dumoulin, L.; Eitel, K.; Fesquet, M.; Firucci, S.; Gascon, J.; Gerbier, G.; Gerlic, E.; Goldbach, C.; Goyot, M.; Gros, M.; Habermahl, F.; Horn, M.; Hadjout, J.P.; Herve, S.; Juillard, A.; Kikuchi, C.; Lesquen, A. de; Luca, M.; Mallet, J.; Marnieros, S.; Martineau, O.; Mosca, L.; Navick, X.F.; Nollez, G.; Pari, P.; Riccio, C.; Sanglard, V.; Stern, M.; Vagneron, L.; Villard, V.

    2005-01-01

    In the Edelweiss experiment, nuclear recoils induced by elastic collisions with WIMPs (weakly interacting massive particle) from the galactic halo are identified in low-temperature Ge detectors where the ratio of the heat and ionization signals provide an event-by-event discrimination of nuclear recoils from the dominant background coming from γ-rays interactions. The Edelweiss experiment is located in the Modane underground facility in order to cut the muon flux drastically. We present here the results obtained during the first part of the experiment named Edelweiss-I that ended in the beginning of 2004. Since october 2002, 3 optimized 320 grams detectors have been simultaneously operated at a regulated temperature of 0.017 K and about 50 kg*day were added to the previous published data. These data are still under analysis but preliminary results concerning the upper limit at 90% CL (confidence level) confirm the limit already published in 2002. The first run of Edelweiss-II is due to begin during summer 2005, we are expecting to gain 2 orders of magnitude in terms of detector sensitivity and reach 0.002 events/day*kg. (A.C.)

  18. Dark matter directional detection in non-relativistic effective theories

    International Nuclear Information System (INIS)

    Catena, Riccardo

    2015-01-01

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF 4 , CS 2 and 3 He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments

  19. Directional detection of dark matter with two-dimensional targets

    Science.gov (United States)

    Hochberg, Yonit; Kahn, Yonatan; Lisanti, Mariangela; Tully, Christopher G.; Zurek, Kathryn M.

    2017-09-01

    We propose two-dimensional materials as targets for direct detection of dark matter. Using graphene as an example, we focus on the case where dark matter scattering deposits sufficient energy on a valence-band electron to eject it from the target. We show that the sensitivity of graphene to dark matter of MeV to GeV mass can be comparable, for similar exposure and background levels, to that of semiconductor targets such as silicon and germanium. Moreover, a two-dimensional target is an excellent directional detector, as the ejected electron retains information about the angular dependence of the incident dark matter particle. This proposal can be implemented by the PTOLEMY experiment, presenting for the first time an opportunity for directional detection of sub-GeV dark matter.

  20. Intrinsic neutron background of nuclear emulsions for directional Dark Matter searches

    Science.gov (United States)

    Alexandrov, A.; Asada, T.; Buonaura, A.; Consiglio, L.; D'Ambrosio, N.; De Lellis, G.; Di Crescenzo, A.; Di Marco, N.; Di Vacri, M. L.; Furuya, S.; Galati, G.; Gentile, V.; Katsuragawa, T.; Laubenstein, M.; Lauria, A.; Loverre, P. F.; Machii, S.; Monacelli, P.; Montesi, M. C.; Naka, T.; Pupilli, F.; Rosa, G.; Sato, O.; Strolin, P.; Tioukov, V.; Umemoto, A.; Yoshimoto, M.

    2016-07-01

    Recent developments of the nuclear emulsion technology led to the production of films with nanometric silver halide grains suitable to track low energy nuclear recoils with submicrometric length. This improvement opens the way to a directional Dark Matter detection, thus providing an innovative and complementary approach to the on-going WIMP searches. An important background source for these searches is represented by neutron-induced nuclear recoils that can mimic the WIMP signal. In this paper we provide an estimation of the contribution to this background from the intrinsic radioactive contamination of nuclear emulsions. We also report the neutron-induced background as a function of the read-out threshold, by using a GEANT4 simulation of the nuclear emulsion, showing that it amounts to about 0.06 per year per kilogram, fully compatible with the design of a 10 kg × year exposure.

  1. The phenomenology of superWIMP dark matter scenariow with long-lived sleptons

    Energy Technology Data Exchange (ETDEWEB)

    Heisig, Jan

    2013-08-15

    We study the phenomenology of a supersymmetric scenario where the next-to-lightest superparticle (NLSP) is the charged slepton and is long-lived due to a lightest superparticle (LSP) which is a super weakly interacting massive particle (superWIMP), like the gravitino. This has far-reaching consequences for the cosmological history of the universe on the one hand and for the signatures at colliders on the other hand. We do not assume any high-scale model for the mediation of SUSY breaking to the MSSM but work along the lines of simplified models and the phenomenological MSSM (pMSSM). In a first part, we investigate the LHC sensitivity and its dependence on the superparticle spectrum with an emphasis on strong production and decay. We formulate appropriate simplified models that allow to conservatively approximate the signal efficiencies of arbitrary spectra from a small number of decisive parameters. We found that the application of simplified models is especially suitable in the considered scenario. Devising cuts that yield a large detection efficiency in the whole parameter space, we determine the discovery and exclusion potential of the LHC. We found that the prominent signature of long-lived sleptons allows to extract more robust constraints on the parameter space than for the widely studied case of a neutralino LSP scenario. In addition, we study the implications of the recent LHC results on the cosmological validity of a superWIMP Dark Matter scenario with a long-lived stau NLSP. Therefore, we work in a pMSSM framework and perform a Monte Carlo scan over the pMSSM parameter space highlighting the implications of a Higgs around 125 GeV and the nullsearches for heavy stable charged particles at the 7 and 8TeV LHC. Further, we consider bounds from MSSM Higgs searches, from flavor and precision observables as well as from the theoretical requirement of vacuum stability. In particular we work out the impact on the allowed range for the stau yield after freeze

  2. The phenomenology of superWIMP dark matter scenariow with long-lived sleptons

    International Nuclear Information System (INIS)

    Heisig, Jan

    2013-08-01

    We study the phenomenology of a supersymmetric scenario where the next-to-lightest superparticle (NLSP) is the charged slepton and is long-lived due to a lightest superparticle (LSP) which is a super weakly interacting massive particle (superWIMP), like the gravitino. This has far-reaching consequences for the cosmological history of the universe on the one hand and for the signatures at colliders on the other hand. We do not assume any high-scale model for the mediation of SUSY breaking to the MSSM but work along the lines of simplified models and the phenomenological MSSM (pMSSM). In a first part, we investigate the LHC sensitivity and its dependence on the superparticle spectrum with an emphasis on strong production and decay. We formulate appropriate simplified models that allow to conservatively approximate the signal efficiencies of arbitrary spectra from a small number of decisive parameters. We found that the application of simplified models is especially suitable in the considered scenario. Devising cuts that yield a large detection efficiency in the whole parameter space, we determine the discovery and exclusion potential of the LHC. We found that the prominent signature of long-lived sleptons allows to extract more robust constraints on the parameter space than for the widely studied case of a neutralino LSP scenario. In addition, we study the implications of the recent LHC results on the cosmological validity of a superWIMP Dark Matter scenario with a long-lived stau NLSP. Therefore, we work in a pMSSM framework and perform a Monte Carlo scan over the pMSSM parameter space highlighting the implications of a Higgs around 125 GeV and the nullsearches for heavy stable charged particles at the 7 and 8TeV LHC. Further, we consider bounds from MSSM Higgs searches, from flavor and precision observables as well as from the theoretical requirement of vacuum stability. In particular we work out the impact on the allowed range for the stau yield after freeze

  3. Indirect detection of dark matter

    International Nuclear Information System (INIS)

    Pieri, L.

    2008-01-01

    In the Cold Dark Matter scenario, the Dark Matter particle candidate may be a Weakly Interacting Massive Particle (Wimp). Annihilation of two Wimps in local or cosmological structures would result in the production of a number of standard model particles such as photons, leptons and baryons which could be observed with the presently available or future experiments such as the Pamela or Glast satellites or the Cherenkov Telescopes. In this work we review the status-of-the-art of the theoretical and phenomenological studies about the possibility of indirect detection of signals coming from Wimp annihilation.

  4. Dark Matter Detection: Current Status

    International Nuclear Information System (INIS)

    Akerib, Daniel S.

    2011-01-01

    Overwhelming observational evidence indicates that most of the matter in the Universe consists of non-baryonic dark matter. One possibility is that the dark matter is Weakly-Interacting Massive Particles (WIMPs) that were produced in the early Universe. These relics could comprise the Milky Way's dark halo and provide evidence for new particle physics, such as Supersymmetry. This talk focuses on the status of current efforts to detect dark matter by testing the hypothesis that WIMPs exist in the galactic halo. WIMP searches have begun to explore the region of parameter space where SUSY particles could provide dark matter candidates.

  5. Direct versus indirect detection of supersymmetric dark matter

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    This document gathers the slides that were presented during the workshop 'direct versus indirect detection of supersymmetric dark matter'(about 30 contributions). This workshop intended to bring together people from the particle theory community, astrophysicists and cosmologists, as well as experimentalists involved in the detection of dark matter. The aim is to generate a discussion about current and future strategies for detection of SUSY dark matter (with focus, but not exclusively, on neutralinos). Complementarities between accelerator, direct and indirect searches as well as a comparison between the uncertainties in direct and indirect searches of dark matter, are supposed to be discussed. Among the issues which will be addressed are: -) the crucial questions related to the structure of galaxies (local dark matter density, clumping, anomalous velocity distributions, etc.) ; -) the possibilities offered by the present and future experimental facilities for direct and indirect (photon, neutrino) searches; -) the potential for the discovery of SUSY at LHC and beyond; and -) the parameterization of the SUSY breaking models beyond the minimal versions.

  6. Direct versus indirect detection of supersymmetric dark matter

    International Nuclear Information System (INIS)

    2003-01-01

    This document gathers the slides that were presented during the workshop 'direct versus indirect detection of supersymmetric dark matter'(about 30 contributions). This workshop intended to bring together people from the particle theory community, astrophysicists and cosmologists, as well as experimentalists involved in the detection of dark matter. The aim is to generate a discussion about current and future strategies for detection of SUSY dark matter (with focus, but not exclusively, on neutralinos). Complementarities between accelerator, direct and indirect searches as well as a comparison between the uncertainties in direct and indirect searches of dark matter, are supposed to be discussed. Among the issues which will be addressed are: -) the crucial questions related to the structure of galaxies (local dark matter density, clumping, anomalous velocity distributions, etc.) ; -) the possibilities offered by the present and future experimental facilities for direct and indirect (photon, neutrino) searches; -) the potential for the discovery of SUSY at LHC and beyond; and -) the parameterization of the SUSY breaking models beyond the minimal versions

  7. The XENON project for dark matter direct detection at LNGS

    Science.gov (United States)

    Molinario, Andrea

    2017-12-01

    The XENON project at INFN Laboratori Nazionali del Gran Sasso, Italy, aims at dark matter direct detection with liquid xenon dual-phase time projection chambers. Latest results of XENON100 detector exclude various models of leptophilic dark matter. A search for low mass weakly interacting massive particles was also performed, lowering the energy threshold for detection to 0.7 keV for nuclear recoils. The multi-ton XENON1T detector is fully installed and operating. It is expected to reach a sensitivity a factor 100 better than XENON100 with a 2 ton·year exposure.

  8. Neutron stars at the dark matter direct detection frontier

    Science.gov (United States)

    Raj, Nirmal; Tanedo, Philip; Yu, Hai-Bo

    2018-02-01

    Neutron stars capture dark matter efficiently. The kinetic energy transferred during capture heats old neutron stars in the local galactic halo to temperatures detectable by upcoming infrared telescopes. We derive the sensitivity of this probe in the framework of effective operators. For dark matter heavier than a GeV, we find that neutron star heating can set limits on the effective operator cutoff that are orders of magnitude stronger than possible from terrestrial direct detection experiments in the case of spin-dependent and velocity-suppressed scattering.

  9. Exploring light mediators with low-threshold direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kahlhoefer, Felix [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); RWTH Aachen Univ. (Germany). Inst. for Theoretical Particle Physics and Cosmology; Kulkarni, Suchita [Oesterreichische Akademie der Wissenschaften, Vienna (Austria). Inst. fuer Hochenergiephysik; Wild, Sebastian [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2017-11-15

    We explore the potential of future cryogenic direct detection experiments to determine the properties of the mediator that communicates the interactions between dark matter and nuclei. Due to their low thresholds and large exposures, experiments like CRESST-III, SuperCDMS SNOLAB and EDELWEISS-III will have excellent capability to reconstruct mediator masses in the MeV range for a large class of models. Combining the information from several experiments further improves the parameter reconstruction, even when taking into account additional nuisance parameters related to background uncertainties and the dark matter velocity distribution. These observations may offer the intriguing possibility of studying dark matter self-interactions with direct detection experiments.

  10. Hunting electroweakinos at future hadron colliders and direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Cortona, Giovanni Grilli di [SISSA - International School for Advanced Studies,Via Bonomea 265, I-34136 Trieste (Italy); INFN - Sezione di Trieste,via Valerio 2, I-34127 Trieste (Italy)

    2015-05-07

    We analyse the mass reach for electroweakinos at future hadron colliders and their interplay with direct detection experiments. Motivated by the LHC data, we focus on split supersymmetry models with different electroweakino spectra. We find for example that a 100 TeV collider may explore Winos up to ∼7 TeV in low scale gauge mediation models or thermal Wino dark matter around 3 TeV in models of anomaly mediation with long-lived Winos. We show moreover how collider searches and direct detection experiments have the potential to cover large part of the parameter space even in scenarios where the lightest neutralino does not contribute to the whole dark matter relic density.

  11. Exploring light mediators with low-threshold direct detection experiments

    International Nuclear Information System (INIS)

    Kahlhoefer, Felix

    2017-11-01

    We explore the potential of future cryogenic direct detection experiments to determine the properties of the mediator that communicates the interactions between dark matter and nuclei. Due to their low thresholds and large exposures, experiments like CRESST-III, SuperCDMS SNOLAB and EDELWEISS-III will have excellent capability to reconstruct mediator masses in the MeV range for a large class of models. Combining the information from several experiments further improves the parameter reconstruction, even when taking into account additional nuisance parameters related to background uncertainties and the dark matter velocity distribution. These observations may offer the intriguing possibility of studying dark matter self-interactions with direct detection experiments.

  12. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  13. Halo-independent determination of the unmodulated WIMP signal in DAMA: the isotropic case

    Energy Technology Data Exchange (ETDEWEB)

    Gondolo, Paolo [Department of Physics, University of Utah, 115 South 1400 East #201, Salt Lake City, Utah 84112-0830 (United States); Scopel, Stefano, E-mail: paolo.gondolo@utah.edu, E-mail: scopel@sogang.ac.kr [Department of Physics, Sogang University, Seoul 121-742 (Korea, Republic of)

    2017-09-01

    We present a halo-independent determination of the unmodulated signal corresponding to the DAMA modulation if interpreted as due to dark matter weakly interacting massive particles (WIMPs). First we show how a modulated signal gives information on the WIMP velocity distribution function in the Galactic rest frame from which the unmodulated signal descends. Then we describe a mathematically-sound profile likelihood analysis in which the likelihood is profiled over a continuum of nuisance parameters (namely, the WIMP velocity distribution). As a first application of the method, which is very general and valid for any class of velocity distributions, we restrict the analysis to velocity distributions that are isotropic in the Galactic frame. In this way we obtain halo-independent maximum-likelihood estimates and confidence intervals for the DAMA unmodulated signal. We find that the estimated unmodulated signal is in line with expectations for a WIMP-induced modulation and is compatible with the DAMA background+signal rate. Specifically, for the isotropic case we find that the modulated amplitude ranges between a few percent and about 25% of the unmodulated amplitude, depending on the WIMP mass.

  14. Inelastic Boosted Dark Matter at direct detection experiments

    OpenAIRE

    Giudice, Gian F.; Kim, Doojin; Park, Jong-Chul; Shin, Seodong

    2018-01-01

    We explore a novel class of multi-particle dark sectors, called Inelastic Boosted Dark Matter (iBDM). These models are constructed by combining properties of particles that scatter off matter by making transitions to heavier states (Inelastic Dark Matter) with properties of particles that are produced with a large Lorentz boost in annihilation processes in the galactic halo (Boosted Dark Matter). This combination leads to new signals that can be observed at ordinary direct detection experimen...

  15. Direct Detection of Oil; Case History From Iran

    International Nuclear Information System (INIS)

    Tabatabaee, S. H.

    2007-01-01

    Iran is one of the main petroleum producers and also one of the countries which experiences contemporary geophysical techniques in Middle East region. Main aim of this study is direct detection of oil hydrocarbons by a special geophysical technique. To accomplish that, FEM, TEM and IP integrated geophysical techniques were successfully applied to measure IP phase shift which might relate to existence of oil traps. Target penetration for this prospecting is about 6 kms

  16. Study and optimization of the ionisation channel in the Edelweiss dark matter direct detection experiment

    International Nuclear Information System (INIS)

    Censier, B.

    2006-02-01

    The EDELWEISS experiment is aiming at the detection of Weakly Interactive Massive Particles (WIMPs), today's most favoured candidates for solving the dark matter issue. Background ionising particles are identified thanks to the simultaneous measurement of heat and ionisation in the detectors. The main limitation to this method is coming from the ionisation measurement, charge collection being less efficient in some part of the detectors known as 'dead' areas. The specificity of the measurement is due to the use of very low temperatures and low collection fields. This thesis is dedicated to the study of carrier trapping. It involves time-resolved charge measurements as well as a simulation code adapted to the specific physical conditions. We first present results concerning charge trapping at the free surfaces of the detectors. Our method allows to build a surface-charge in a controlled manner by irradiation with a strong radioactive source. This charge is then characterised with a weaker source which acts as a probe. In a second part of the work, bulk-trapping characteristics are deduced from charge collection efficiency measurements, and by an original method based on event localisation in the detector. The results show that a large proportion of the doping impurities are ionised, as indicated independently by the study of degradation by space-charge build-up. In this last part, near-electrodes areas are found to contain large densities of charged trapping centres, in connection with dead-layer effects. (author)

  17. Dark matter direct detection with non-Maxwellian velocity structure

    International Nuclear Information System (INIS)

    Kuhlen, Michael; Weiner, Neal; Diemand, Jürg; Moore, Ben; Potter, Doug; Stadel, Joachim; Madau, Piero; Zemp, Marcel

    2010-01-01

    The velocity distribution function of dark matter particles is expected to show significant departures from a Maxwell-Boltzmann distribution. This can have profound effects on the predicted dark matter - nucleon scattering rates in direct detection experiments, especially for dark matter models in which the scattering is sensitive to the high velocity tail of the distribution, such as inelastic dark matter (iDM) or light (few GeV) dark matter (LDM), and for experiments that require high energy recoil events, such as many directionally sensitive experiments. Here we determine the velocity distribution functions from two of the highest resolution numerical simulations of Galactic dark matter structure (Via Lactea II and GHALO), and study the effects for these scenarios. For directional detection, we find that the observed departures from Maxwell-Boltzmann increase the contrast of the signal and change the typical direction of incoming DM particles. For iDM, the expected signals at direct detection experiments are changed dramatically: the annual modulation can be enhanced by more than a factor two, and the relative rates of DAMA compared to CDMS can change by an order of magnitude, while those compared to CRESST can change by a factor of two. The spectrum of the signal can also change dramatically, with many features arising due to substructure. For LDM the spectral effects are smaller, but changes do arise that improve the compatibility with existing experiments. We find that the phase of the modulation can depend upon energy, which would help discriminate against background should it be found

  18. Directional genomic hybridization for chromosomal inversion discovery and detection.

    Science.gov (United States)

    Ray, F Andrew; Zimmerman, Erin; Robinson, Bruce; Cornforth, Michael N; Bedford, Joel S; Goodwin, Edwin H; Bailey, Susan M

    2013-04-01

    Chromosomal rearrangements are a source of structural variation within the genome that figure prominently in human disease, where the importance of translocations and deletions is well recognized. In principle, inversions-reversals in the orientation of DNA sequences within a chromosome-should have similar detrimental potential. However, the study of inversions has been hampered by traditional approaches used for their detection, which are not particularly robust. Even with significant advances in whole genome approaches, changes in the absolute orientation of DNA remain difficult to detect routinely. Consequently, our understanding of inversions is still surprisingly limited, as is our appreciation for their frequency and involvement in human disease. Here, we introduce the directional genomic hybridization methodology of chromatid painting-a whole new way of looking at structural features of the genome-that can be employed with high resolution on a cell-by-cell basis, and demonstrate its basic capabilities for genome-wide discovery and targeted detection of inversions. Bioinformatics enabled development of sequence- and strand-specific directional probe sets, which when coupled with single-stranded hybridization, greatly improved the resolution and ease of inversion detection. We highlight examples of the far-ranging applicability of this cytogenomics-based approach, which include confirmation of the alignment of the human genome database and evidence that individuals themselves share similar sequence directionality, as well as use in comparative and evolutionary studies for any species whose genome has been sequenced. In addition to applications related to basic mechanistic studies, the information obtainable with strand-specific hybridization strategies may ultimately enable novel gene discovery, thereby benefitting the diagnosis and treatment of a variety of human disease states and disorders including cancer, autism, and idiopathic infertility.

  19. Prospects for SIMPLE 2000: a large-mass, low-background superheated droplet detector for WIMP searches

    International Nuclear Information System (INIS)

    Collar, J.I.; Girard, T.A.; Miley, H.S.; Waysand, G.

    2000-01-01

    The Superheated Instrument for Massive Particle searches (SIMPLE 2000) will consist of an array of 8-16 large active mass (approx. 15 g) superheated droplet detectors (SDDs) to be installed in the new underground laboratory of Rustrel-Pays d'Apt. Several factors make the use of SDDs an attractive approach for the detection of weakly interacting massive particles (WIMPs), namely their intrinsic insensitivity to minimally ionizing particles, high fluorine content, low cost and operation at near ambient pressure and temperature. We comment here on the fabrication, calibration and already-competitive first limits from prototype SDDs for SIMPLE, as well as on the expected immediate increase in sensitivity of the programme, which aims at an exposure of > 25 kg day during 2000. The ability of modest-mass fluorine-rich detectors to investigate regions of neutralino parameter space beyond the reach of the most ambitious cryogenic projects is pointed out. (author)

  20. Prospects for SIMPLE 2000: a large-mass, low-background superheated droplet detector for WIMP searches

    International Nuclear Information System (INIS)

    Collar, J I; Puibasset, J; Girard, T A; Limagne, D; Miley, H S; Waysand, G

    2000-01-01

    The Superheated Instrument for Massive Particle searches (SIMPLE 2000) will consist of an array of 8-16 large active mass (≅15 g) superheated droplet detectors (SDDs) to be installed in the new underground laboratory of Rustrel-Pays d'Apt. Several factors make the use of SDDs an attractive approach for the detection of weakly interacting massive particles (WIMPs), namely their intrinsic insensitivity to minimally ionizing particles, high fluorine content, low cost and operation at near ambient pressure and temperature. We comment here on the fabrication, calibration and already-competitive first limits from prototype SDDs for SIMPLE, as well as on the expected immediate increase in sensitivity of the programme, which aims at an exposure of > 25 kg day during 2000. The ability of modest-mass fluorine-rich detectors to investigate regions of neutralino parameter space beyond the reach of the most ambitious cryogenic projects is pointed out

  1. Direct and indirect detection of dissipative dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Fan, JiJi; Katz, Andrey; Shelton, Jessie, E-mail: jijifan1982@gmail.com, E-mail: katz.andrey@gmail.com, E-mail: jshelton137@gmail.com [Department of Physics, Harvard University, Cambridge, MA 02138 (United States)

    2014-06-01

    We study the constraints from direct detection and solar capture on dark matter scenarios with a subdominant dissipative component. This dissipative dark matter component in general has both a symmetric and asymmetric relic abundance. Dissipative dynamics allow this subdominant dark matter component to cool, resulting in its partial or total collapse into a smaller volume inside the halo (e.g., a dark disk) as well as a reduced thermal velocity dispersion compared to that of normal cold dark matter. We first show that these features considerably relax the limits from direct detection experiments on the couplings between standard model (SM) particles and dissipative dark matter. On the other hand, indirect detection of the annihilation of the symmetric dissipative dark matter component inside the Sun sets stringent and robust constraints on the properties of the dissipative dark matter. In particular, IceCube observations force dissipative dark matter particles with mass above 50 GeV to either have a small coupling to the SM or a low local density in the solar system, or to have a nearly asymmetric relic abundance. Possible helioseismology signals associated with purely asymmetric dissipative dark matter are discussed, with no present constraints.

  2. Direct and indirect detection of dissipative dark matter

    International Nuclear Information System (INIS)

    Fan, JiJi; Katz, Andrey; Shelton, Jessie

    2014-01-01

    We study the constraints from direct detection and solar capture on dark matter scenarios with a subdominant dissipative component. This dissipative dark matter component in general has both a symmetric and asymmetric relic abundance. Dissipative dynamics allow this subdominant dark matter component to cool, resulting in its partial or total collapse into a smaller volume inside the halo (e.g., a dark disk) as well as a reduced thermal velocity dispersion compared to that of normal cold dark matter. We first show that these features considerably relax the limits from direct detection experiments on the couplings between standard model (SM) particles and dissipative dark matter. On the other hand, indirect detection of the annihilation of the symmetric dissipative dark matter component inside the Sun sets stringent and robust constraints on the properties of the dissipative dark matter. In particular, IceCube observations force dissipative dark matter particles with mass above 50 GeV to either have a small coupling to the SM or a low local density in the solar system, or to have a nearly asymmetric relic abundance. Possible helioseismology signals associated with purely asymmetric dissipative dark matter are discussed, with no present constraints

  3. Halo-Independent Direct Detection Analyses Without Mass Assumptions

    CERN Document Server

    Anderson, Adam J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the $m_\\chi-\\sigma_n$ plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the $v_{min}-\\tilde{g}$ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from $v_{min}$ to nuclear recoil momentum ($p_R$), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call $\\tilde{h}(p_R)$. The entire family of conventional halo-independent $\\tilde{g}(v_{min})$ plots for all DM masses are directly found from the single $\\tilde{h}(p_R)$ plot through a simple re...

  4. Collider, direct and indirect detection of supersymmetric dark matter

    International Nuclear Information System (INIS)

    Baer, Howard; Park, Eun-Kyung; Tata, Xerxes

    2009-01-01

    We present an overview of supersymmetry (SUSY) searches, both at collider experiments and via searches for dark matter (DM). We focus on three DM possibilities in the SUSY context: the thermally produced neutralino, a mixture of axion and axino, and the gravitino, and compare and contrast signals that may be expected at colliders, in direct detection (DD) experiments searching of DM relics left over from the Big Bang, and indirect detection (ID) experiments designed to detect the products of DM annihilations within the solar interior or galactic halo. Detection of DM particles using multiple strategies provides complementary information that may shed light on the new physics associated with the DM sector. In contrast to the minimal supergravity (mSUGRA) model where the measured cold DM relic density restricts us to special regions mostly on the edge of the m 0 -m 1/2 plane, the entire parameter plane becomes allowed if the universality assumption is relaxed in models with just one additional parameter. Then, thermally produced neutralinos with a well-tempered mix of wino, bino and higgsino components, or with a mass adjusted so that their annihilation in the early Universe is Higgs-resonance-enhanced, can be the DM. Well-tempered neutralinos typically yield heightened rates for DD and ID experiments compared with generic predictions from mSUGRA. If instead DM consists of axinos (possibly together with axions) or gravitinos, then there exists the possibility of detection of quasi-stable next-to-lightest SUSY particles at colliding beam experiments, with especially striking consequences if the next-lightest-supersymmetric-particle (NLSP) is charged, but no DD or ID detection. The exception for mixed axion/axino DM is that DD of axions may be possible.

  5. Congratulations on the direct detection of gravitational waves

    CERN Multimedia

    2016-01-01

    This week saw the announcement of an extraordinary physics result: the first direct detection of gravitational waves by the LIGO Scientific Collaboration, which includes the GEO team, and the Virgo Collaboration, using the twin Laser Interferometer Gravitational-wave Observatory (LIGO) detectors located in Livingston, Louisiana, and Hanford, Washington, USA.   Albert Einstein predicted gravitational waves in a paper published 100 years ago in 1916. They are a natural consequence of the theory of general relativity, which describes the workings of gravity and was published a few months earlier. Until now, they have remained elusive. Gravitational waves are tiny ripples in space-time produced by violent gravitational phenomena. Because the fractional change in the space-time geometry can be at the level of 10-21 or smaller, extremely sophisticated, high-sensitivity instruments are needed to detect them. Recently, the Advanced LIGO detector increased its sensitivity by alm...

  6. Prospects for the direct detection of the cosmic neutrino background

    International Nuclear Information System (INIS)

    Ringwald, Andreas

    2009-01-01

    The existence of a cosmic neutrino background - the analogue of the cosmic microwave background - is a fundamental prediction of standard big bang cosmology. Up to now, the observational evidence for its existence is rather indirect and rests entirely on cosmological observations of, e.g., the light elemental abundances, the anisotropies in the cosmic microwave background, and the large scale distribution of matter. Here, we review more direct, weak interaction based detection techniques for the cosmic neutrino background in the present epoch and in our local neighbourhood. We show that, with current technology, all proposals are still off by some orders of magnitude in sensitivity to lead to a guaranteed detection of the relic neutrinos. The most promising laboratory search, based on neutrino capture on beta decaying nuclei, may be done in future experiments designed to measure the neutrino mass through decay kinematics.

  7. Optical filtering in directly modulated/detected OOFDM systems.

    Science.gov (United States)

    Sánchez, C; Ortega, B; Wei, J L; Capmany, J

    2013-12-16

    This work presents a theoretical investigation on the performance of directly modulated/detected (DM/DD) optical orthogonal frequency division multiplexed (OOFDM) systems subject to optical filtering. The impact of both linear and nonlinear distortion effects are taken into account to calculate the effective signal-to-noise ratio of each subcarrier. These results are then employed to optimize the design parameters of two simple optical filtering structures: a Mach Zehnder interferometer and a uniform fiber Bragg grating, leading to a significant optical power budget improvement given by 3.3 and 3dB, respectively. These can be further increased to 5.5 and 4.2dB respectively when balanced detection configurations are employed. We find as well that this improvement is highly dependent on the clipping ratio.

  8. Prospects for the direct detection of the cosmic neutrino background

    International Nuclear Information System (INIS)

    Ringwald, Andreas

    2009-01-01

    The existence of a cosmic neutrino background - the analogue of the cosmic microwave background - is a fundamental prediction of standard big bang cosmology. Up to now, the observational evidence for its existence is rather indirect and rests entirely on cosmological observations of, e.g., the light elemental abundances, the anisotropies in the cosmic microwave background, and the large scale distribution of matter. Here, we review more direct, weak interaction based detection techniques for the cosmic neutrino background in the present epoch and in our local neighbourhood. We show that, with current technology, all proposals are still off by some orders of magnitude in sensitivity to lead to a guaranteed detection of the relic neutrinos. The most promising laboratory search, based on neutrino capture on beta decaying nuclei, may be done in future experiments designed to measure the neutrino mass through decay kinematics. (orig.)

  9. Theoretical antineutrino detection, direction and ranging at long distances

    Energy Technology Data Exchange (ETDEWEB)

    Jocher, Glenn R., E-mail: gjocher@integrity-apps.com [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Bondy, Daniel A., E-mail: dbondy@integrity-apps.com [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Dobbs, Brian M., E-mail: Brian.M.Dobbs.ctr@nga.mil [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Dye, Stephen T., E-mail: sdye@phys.hawaii.edu [College of Natural Sciences, Hawaii Pacific University, Kaneohe, HI 96744 (United States); Department of Physics and Astronomy, University of Hawaii, Honolulu, HI, 96822 (United States); Georges, James A., E-mail: James.A.Georges.ctr@nga.mil [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Learned, John G., E-mail: jgl@phys.hawaii.edu [Department of Physics and Astronomy, University of Hawaii, Honolulu, HI, 96822 (United States); Mulliss, Christopher L., E-mail: Christopher.L.Mulliss.ctr@nga.mil [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Usman, Shawn, E-mail: Shawn.Usman@nga.mil [InnoVision Basic and Applied Research Office, Sensor Geopositioning Center, National Geospatial-Intelligence Agency, 7500 GEOINT Dr., Springfield, VA, 22150 (United States)

    2013-06-20

    In this paper we introduce the concept of what we call “NUDAR” (NeUtrino Direction and Ranging), making the point that measurements of the observed energy and direction vectors can be employed to passively deduce the exact three-dimensional location and thermal power of geophysical and anthropogenic neutrino sources from even a single detector. Earlier studies have presented the challenges of long-range detection, dominated by the unavoidable inverse-square falloff in neutrinos, which force the use of kiloton scale detectors beyond a few kilometers. Earlier work has also presented the case for multiple detectors, and has reviewed the background challenges. We present the most precise background estimates to date, all handled in full three dimensions, as functions of depth and geographical location. For the present calculations, we consider a hypothetical 138 kiloton detector which can be transported to an ocean site and deployed to an operational depth. We present a Bayesian estimation framework to incorporate any a priori knowledge of the reactor that we are trying to detect, as well as the estimated uncertainty in the background and the oscillation parameters. Most importantly, we fully employ the knowledge of the reactor spectrum and the distance-dependent effects of neutrino oscillations on such spectra. The latter, in particular, makes possible determination of range from one location, given adequate signal statistics. Further, we explore the rich potential of improving detection with even modest improvements in individual neutrino direction determination. We conclude that a 300 MW{sub th} reactor can indeed be geolocated, and its operating power estimated with one or two detectors in the hundred kiloton class at ranges out to a few hundred kilometers. We note that such detectors would have natural and non-interfering utility for scientific studies of geo-neutrinos, neutrino oscillations, and astrophysical neutrinos. This motivates the development of cost

  10. On the direct detection of {sup 229m}Th

    Energy Technology Data Exchange (ETDEWEB)

    Wense, Lars von der

    2017-02-03

    The measurement of time has always been an important tool in science and society. Today's most precise time and frequency measurements are performed with optical atomic clocks. However, these clocks could potentially be outperformed by a ''nuclear clock'', which employs a nuclear transition instead of an atomic shell transition for time measurement. Among the 176 000 known nuclear excited states, there is only one nuclear state that would allow for the development of a nuclear clock using currently available technology. This is the isomeric first excited state of {sup 229}Th, denoted as {sup 229m}Th. Despite 40 years of past research, no direct decay detection of this nuclear state has so far been achieved. In this thesis, measurements are described that have led to the first direct detection of the ground-state decay of {sup 229m}Th. Two decay channels (radiative decay and internal conversion) are experimentally investigated. Only the investigation of the internal conversion decay channel has led to the successful observation of the first excited isomeric nuclear state of {sup 229}Th. Based on this direct detection, a new nuclear laser excitation scheme for {sup 229m}Th is proposed. This excitation scheme circumvents the general assumed requirement of a better knowledge of the isomeric energy value, thereby paving the way for nuclear laser spectroscopy of {sup 229m}Th. Many of the presented results have so far been unpublished. This includes results of the investigation of a potential radiative decay channel of {sup 229m}Th, a negative result in the search for an isomeric decay during extraction of {sup 229}Th{sup 1+}, investigation of the isomeric decay in thorium molecules and on an MgF{sub 2}-coated surface, as well as a first report of the isomeric half-life for neutral {sup 229}Th.

  11. Edge-detect interpolation for direct digital periapical images

    International Nuclear Information System (INIS)

    Song, Nam Kyu; Koh, Kwang Joon

    1998-01-01

    The purpose of this study was to aid in the use of the digital images by edge-detect interpolation for direct digital periapical images using edge-deted interpolation. This study was performed by image processing of 20 digital periapical images; pixel replication, linear non-interpolation, linear interpolation, and edge-sensitive interpolation. The obtained results were as follows ; 1. Pixel replication showed blocking artifact and serious image distortion. 2. Linear interpolation showed smoothing effect on the edge. 3. Edge-sensitive interpolation overcame the smoothing effect on the edge and showed better image.

  12. Detailed noise statistics for an optically preamplified direct detection receiver

    DEFF Research Database (Denmark)

    Danielsen, Søren Lykke; Mikkelsen, Benny; Durhuus, Terji

    1995-01-01

    We describe the exact statistics of an optically preamplified direct detection receiver by means of the moment generating function. The theory allows an arbitrary shaped electrical filter in the receiver circuit. The moment generating function (MGF) allows for a precise calculation of the error...... rate by using the inverse Fast Fourier transform (FFT). The exact results are compared with the usual Gaussian approximation (GA), the saddlepoint approximation (SAP) and the modified Chernoff bound (MCB). This comparison shows that the noise is not Gaussian distributed for all values of the optical...... and calculate the sensitivity degradation due to inter symbol interference (ISI)...

  13. Simultaneous mass detection for direct inlet mass spectrometry

    International Nuclear Information System (INIS)

    Gordon, R.L.

    1979-05-01

    The evolution of analytical techniques for application in trace analysis has led to interest in practical methods for real-time monitoring. Direct inlet mass spectrometry (DIMS) has been the subject of considerable activity in recent years. A DIMS instrument is described which consists of an inlet system designed to permit particles entrained in the inlet air stream to strike a hot, oxidized rhenium filament which serves as a surface ionization source. A mass analyzer and detection system then permits identification of the elemental composition of particulates which strike the filament

  14. Unstable gravitino dark matter prospects for indirect and direct detection

    International Nuclear Information System (INIS)

    Grefe, Michael

    2011-11-01

    We confront the signals expected from unstable gravitino dark matter with observations of indirect dark matter detection experiments in all possible cosmic-ray channels. For this purpose we calculate in detail the gravitino decay widths in theories with bilinear violation of R parity, particularly focusing on decay channels with three particles in the final state. Based on these calculations we predict the fluxes of gamma rays, charged cosmic rays and neutrinos expected from decays of gravitino dark matter. Although the predicted spectra could in principal explain the anomalies observed in the cosmic ray positron and electron fluxes as measured by PAMELA and Fermi LAT, we find that this possibility is ruled out by strong constraints from gamma-ray and antiproton observations. Therefore, we employ current data of indirect detection experiments to place strong constraints on the gravitino lifetime and the strength of R-parity violation. In addition, we discuss the prospects of forthcoming searches for a gravitino signal in the spectrum of cosmic-ray antideuterons, finding that they are in particular sensitive to rather low gravitino masses. Finally, we discuss in detail the prospects for detecting a neutrino signal from gravitino dark matter decays, finding that the sensitivity of neutrino telescopes like IceCube is competitive to observations in other cosmic ray channels, especially for rather heavy gravitinos. Moreover, we discuss the prospects for a direct detection of gravitino dark matter via R-parity violating inelastic scatterings off nucleons. We find that, although the scattering cross section is considerably enhanced compared to the case of elastic gravitino scattering, the expected signal is many orders of magnitude too small in order to hope for a detection in underground detectors. (orig.)

  15. Unstable gravitino dark matter prospects for indirect and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Grefe, Michael

    2011-11-15

    We confront the signals expected from unstable gravitino dark matter with observations of indirect dark matter detection experiments in all possible cosmic-ray channels. For this purpose we calculate in detail the gravitino decay widths in theories with bilinear violation of R parity, particularly focusing on decay channels with three particles in the final state. Based on these calculations we predict the fluxes of gamma rays, charged cosmic rays and neutrinos expected from decays of gravitino dark matter. Although the predicted spectra could in principal explain the anomalies observed in the cosmic ray positron and electron fluxes as measured by PAMELA and Fermi LAT, we find that this possibility is ruled out by strong constraints from gamma-ray and antiproton observations. Therefore, we employ current data of indirect detection experiments to place strong constraints on the gravitino lifetime and the strength of R-parity violation. In addition, we discuss the prospects of forthcoming searches for a gravitino signal in the spectrum of cosmic-ray antideuterons, finding that they are in particular sensitive to rather low gravitino masses. Finally, we discuss in detail the prospects for detecting a neutrino signal from gravitino dark matter decays, finding that the sensitivity of neutrino telescopes like IceCube is competitive to observations in other cosmic ray channels, especially for rather heavy gravitinos. Moreover, we discuss the prospects for a direct detection of gravitino dark matter via R-parity violating inelastic scatterings off nucleons. We find that, although the scattering cross section is considerably enhanced compared to the case of elastic gravitino scattering, the expected signal is many orders of magnitude too small in order to hope for a detection in underground detectors. (orig.)

  16. Analyzing direct dark matter detection data with unrejected background events by the AMIDAS website

    International Nuclear Information System (INIS)

    Shan, Chung-Lin

    2012-01-01

    In this talk I have presented the data analysis results of extracting properties of halo WIMPs: the mass and the (ratios between the) spin-independent and spin-dependent couplings/cross sections on nucleons by the AMIDAS website by taking into account possible unrejected background events in the analyzed data sets. Although non-standard astronomical setup has been used to generate pseudodata sets for our analyses, it has been found that, without prior information/assumption about the local density and velocity distribution of halo Dark Matter, these WIMP properties have been reconstructed with ∼ 2% to ∼< 30% deviations from the input values.

  17. Dark matter and exotic neutrino interactions in direct detection searches

    Energy Technology Data Exchange (ETDEWEB)

    Bertuzzo, Enrico [Departamento de Física Matemática, Instituto de Física, Universidade de São Paulo,R. do Matão 1371, CEP. 05508-090, São Paulo (Brazil); Deppisch, Frank F. [Department of Physics and Astronomy, University College London,London WC1E 6BT (United Kingdom); Kulkarni, Suchita [Institut für Hochenergiephysik, Österreichische Akademie der Wissenschaften,Nikolsdorfer Gasse 18, 1050 Wien (Austria); Gonzalez, Yuber F. Perez; Funchal, Renata Zukanovich [Departamento de Física Matemática, Instituto de Física, Universidade de São Paulo,R. do Matão 1371, CEP. 05508-090, São Paulo (Brazil)

    2017-04-12

    We investigate the effect of new physics interacting with both Dark Matter (DM) and neutrinos at DM direct detection experiments. Working within a simplified model formalism, we consider vector and scalar mediators to determine the scattering of DM as well as the modified scattering of solar neutrinos off nuclei. Using existing data from LUX as well as the expected sensitivity of LUX-ZEPLIN and DARWIN, we set limits on the couplings of the mediators to quarks, neutrinos and DM. Given the current limits, we also assess the true DM discovery potential of direct detection experiments under the presence of exotic neutrino interactions. In the case of a vector mediator, we show that the DM discovery reach of future experiments is affected for DM masses m{sub χ}≲10 GeV or DM scattering cross sections σ{sub χ}≲10{sup −47} cm{sup 2}. On the other hand, a scalar mediator will not affect the discovery reach appreciably.

  18. First results from the NEWS-G direct dark matter search experiment at the LSM

    Science.gov (United States)

    Arnaud, Q.; Asner, D.; Bard, J.-P.; Brossard, A.; Cai, B.; Chapellier, M.; Clark, M.; Corcoran, E. C.; Dandl, T.; Dastgheibi-Fard, A.; Dering, K.; Di Stefano, P.; Durnford, D.; Gerbier, G.; Giomataris, I.; Gorel, P.; Gros, M.; Guillaudin, O.; Hoppe, E. W.; Kamaha, A.; Katsioulas, I.; Kelly, D. G.; Martin, R. D.; McDonald, J.; Muraz, J.-F.; Mols, J.-P.; Navick, X.-F.; Papaevangelou, T.; Piquemal, F.; Roth, S.; Santos, D.; Savvidis, I.; Ulrich, A.; Vazquez de Sola Fernandez, F.; Zampaolo, M.

    2018-01-01

    New Experiments With Spheres-Gas (NEWS-G) is a direct dark matter detection experiment using Spherical Proportional Counters (SPCs) with light noble gases to search for low-mass Weakly Interacting Massive Particles (WIMPs). We report the results from the first physics run taken at the Laboratoire Souterrain de Modane (LSM) with SEDINE, a 60 cm diameter prototype SPC operated with a mixture of Ne + CH4 (0.7%) at 3.1 bars for a total exposure of 9.6 kg · days. New constraints are set on the spin-independent WIMP-nucleon scattering cross-section in the sub-GeV/c2 mass region. We exclude cross-sections above 4.4 ×10-37cm2 at 90% confidence level (C.L.) for a 0.5 GeV/c2 WIMP. The competitive results obtained with SEDINE are promising for the next phase of the NEWS-G experiment: a 140 cm diameter SPC to be installed at SNOLAB by summer 2018.

  19. Direct and dynamic detection of HIV-1 in living cells.

    Directory of Open Access Journals (Sweden)

    Jonas Helma

    Full Text Available In basic and applied HIV research, reliable detection of viral components is crucial to monitor progression of infection. While it is routine to detect structural viral proteins in vitro for diagnostic purposes, it previously remained impossible to directly and dynamically visualize HIV in living cells without genetic modification of the virus. Here, we describe a novel fluorescent biosensor to dynamically trace HIV-1 morphogenesis in living cells. We generated a camelid single domain antibody that specifically binds the HIV-1 capsid protein (CA at subnanomolar affinity and fused it to fluorescent proteins. The resulting fluorescent chromobody specifically recognizes the CA-harbouring HIV-1 Gag precursor protein in living cells and is applicable in various advanced light microscopy systems. Confocal live cell microscopy and super-resolution microscopy allowed detection and dynamic tracing of individual virion assemblies at the plasma membrane. The analysis of subcellular binding kinetics showed cytoplasmic antigen recognition and incorporation into virion assembly sites. Finally, we demonstrate the use of this new reporter in automated image analysis, providing a robust tool for cell-based HIV research.

  20. Development of a novel gamma probe for detecting radiation direction

    Science.gov (United States)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  1. Development of a novel gamma probe for detecting radiation direction

    International Nuclear Information System (INIS)

    Pani, R.; Pellegrini, R.; Cinti, M.N.; Longo, M.; Donnarumma, R.; Borrazzo, C.; D'Alessio, A.; Pergola, A.; Ridolfi, S.; Vincentis, G. De

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security

  2. Halo-independent direct detection analyses without mass assumptions

    International Nuclear Information System (INIS)

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-01-01

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m χ −σ n plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v min −g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v min to nuclear recoil momentum (p R ), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-til-tilde(p R ). The entire family of conventional halo-independent g-tilde(v min ) plots for all DM masses are directly found from the single h-tilde(p R ) plot through a simple rescaling of axes. By considering results in h-tilde(p R ) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde(v min ) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity

  3. Impacts of WIMP dark matter upon stellar evolution: main-sequence stars

    CERN Document Server

    Scott, Pat; Edsjo, Joakim

    2008-01-01

    The presence of large amounts of WIMP dark matter in stellar cores has been shown to have significant effects upon models of stellar evolution. We present a series of detailed grids of WIMP-influenced stellar models for main sequence stars, computed using the DarkStars code. We describe the changes in stellar structure and main sequence evolution which occur for masses ranging from 0.3 to 2.0 solar masses and metallicities from Z = 0.0003-0.02, as a function of the rate of energy injection by WIMPs. We then go on to show what rates of energy injection can be obtained using realistic orbital parameters for stars near supermassive black holes, including detailed considerations of dark matter halo velocity and density profiles. Capture and annihilation rates are strongly boosted when stars follow elliptical rather than circular orbits, causing WIMP annihilation to provide up to 100 times the energy of hydrogen fusion in stars at the Galactic centre.

  4. Simultaneous generation of WIMP miracle-like densities of baryons and dark matter

    International Nuclear Information System (INIS)

    McDonald, John

    2011-01-01

    The observed density of dark matter is of the magnitude expected for a thermal relic weakly-interacting massive particle (WIMP). In addition, the observed baryon density is within an order of magnitude of the dark matter density. This suggests that the baryon density is physically related to a typical thermal relic WIMP dark matter density. We present a model which simultaneously generates thermal relic WIMP-like densities for both baryons and dark matter by modifying a large initial baryon asymmetry. Dark matter is due to O(100) GeV gauge singlet scalars produced in the annihilation of the O(TeV) colored scalars which are responsible for the final thermal WIMP-like baryon asymmetry. The requirement of no baryon washout implies that there are two gauge singlet scalars. The low-temperature transfer of the asymmetry to conventional baryons can be understood if the long-lived O(TeV) colored scalars have large hypercharge, |Y|>4/3. Production of such scalars at the LHC would be a clear signature of the model.

  5. Ultra-cold WIMPs relics of non-standard pre-BBN cosmologies

    CERN Document Server

    Gelmini, Graciela B

    2008-01-01

    We point out that in scenarios in which the Universe evolves in a non-standard manner during and after the kinetic decoupling of weakly interacting massive particles (WIMPs), these relics can be much colder than in standard cosmological scenarios (i.e. can be ultra-cold), possibly leading to the formation of smaller first objects in hierarchical structure formation scenarios.

  6. Direct detection of glucuronide metabolites of lidocaine in sheep urine.

    Science.gov (United States)

    Doran, Gregory S; Smith, Alistair K; Rothwell, Jim T; Edwards, Scott H

    2018-02-15

    The anaesthetic lidocaine is metabolised quickly to produce a series of metabolites, including several hydroxylated metabolites, which are further metabolised by addition of a glucuronic acid moiety. Analysis of these glucuronide metabolites in urine is performed indirectly by cleaving the glucuronic acid group using β-glucuronidase. However, direct analysis of intact glucuronide conjugates is a more straightforward approach as it negates the need for long hydrolysis incubations, and minimises the oxidation of sensitive hydrolysis products, while also distinguishing between the two forms of hydroxylated metabolites. A method was developed to identify three intact glucuronides of lidocaine in sheep urine using LC-MS/MS, which was further confirmed by the synthesis of glucuronide derivatives of 3OH-MEGX and 4OH-LIDO. Direct analysis of urine allowed the detection of the glucuronide metabolites of hydroxylidocaine (OH-LIDO), hydroxyl-monoethylglycinexylidide (OH-MEGX), and hydroxy-2,6-xylidine (OH-XYL). Analysis of urine before and after β-glucuronidase digestion showed that the efficiency of hydrolysis of these glucuronide metabolites may be underestimated in some studies. Analysis of urine in the current study from three different sheep with similar glucuronide metabolite concentrations resulted in different hydrolysis efficiencies, which may have been a result of different levels of substrate binding by matrix components, preventing enzyme cleavage. The use of direct analysis of intact glucuronides has the benefit of being less influenced by these matrix effects, while also allowing analysis of unstable metabolites like 4OH-XYL, which rapidly oxidises after hydrolysis. Additionally, direct analysis is less expensive and less time consuming, while providing more information about the status of hydroxylated metabolites in urine. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  7. Ultrafast electron microscopy integrated with a direct electron detection camera

    Directory of Open Access Journals (Sweden)

    Young Min Lee

    2017-07-01

    Full Text Available In the past decade, we have witnessed the rapid growth of the field of ultrafast electron microscopy (UEM, which provides intuitive means to watch atomic and molecular motions of matter. Yet, because of the limited current of the pulsed electron beam resulting from space-charge effects, observations have been mainly made to periodic motions of the crystalline structure of hundreds of nanometers or higher by stroboscopic imaging at high repetition rates. Here, we develop an advanced UEM with robust capabilities for circumventing the present limitations by integrating a direct electron detection camera for the first time which allows for imaging at low repetition rates. This approach is expected to promote UEM to a more powerful platform to visualize molecular and collective motions and dissect fundamental physical, chemical, and materials phenomena in space and time.

  8. Ultrafast electron microscopy integrated with a direct electron detection camera.

    Science.gov (United States)

    Lee, Young Min; Kim, Young Jae; Kim, Ye-Jin; Kwon, Oh-Hoon

    2017-07-01

    In the past decade, we have witnessed the rapid growth of the field of ultrafast electron microscopy (UEM), which provides intuitive means to watch atomic and molecular motions of matter. Yet, because of the limited current of the pulsed electron beam resulting from space-charge effects, observations have been mainly made to periodic motions of the crystalline structure of hundreds of nanometers or higher by stroboscopic imaging at high repetition rates. Here, we develop an advanced UEM with robust capabilities for circumventing the present limitations by integrating a direct electron detection camera for the first time which allows for imaging at low repetition rates. This approach is expected to promote UEM to a more powerful platform to visualize molecular and collective motions and dissect fundamental physical, chemical, and materials phenomena in space and time.

  9. From quarks to nucleons in dark matter direct detection

    Science.gov (United States)

    Bishara, Fady; Brod, Joachim; Grinstein, Benjamin; Zupan, Jure

    2017-11-01

    We provide expressions for the nonperturbative matching of the effective field theory describing dark matter interactions with quarks and gluons to the effective theory of nonrelativistic dark matter interacting with nonrelativistic nucleons. We give expressions of leading and subleading order in chiral counting. In general, a single partonic operator matches onto several nonrelativistic operators already at leading order in chiral counting. Keeping only one operator at the time in the nonrelativistic effective theory thus does not properly describe the scattering in direct detection. The matching of the axial-axial partonic level operator, as well as the matching of the operators coupling DM to the QCD anomaly term, include naively momentum suppressed terms. However, these are still of leading chiral order due to pion poles and can be numerically important.

  10. Inelastic Boosted Dark Matter at direct detection experiments

    Science.gov (United States)

    Giudice, Gian F.; Kim, Doojin; Park, Jong-Chul; Shin, Seodong

    2018-05-01

    We explore a novel class of multi-particle dark sectors, called Inelastic Boosted Dark Matter (iBDM). These models are constructed by combining properties of particles that scatter off matter by making transitions to heavier states (Inelastic Dark Matter) with properties of particles that are produced with a large Lorentz boost in annihilation processes in the galactic halo (Boosted Dark Matter). This combination leads to new signals that can be observed at ordinary direct detection experiments, but require unconventional searches for energetic recoil electrons in coincidence with displaced multi-track events. Related experimental strategies can also be used to probe MeV-range boosted dark matter via their interactions with electrons inside the target material.

  11. Improved EDELWEISS-III sensitivity for low-mass WIMPs using a profile likelihood approach

    Energy Technology Data Exchange (ETDEWEB)

    Hehn, L. [Karlsruher Institut fuer Technologie, Institut fuer Kernphysik, Karlsruhe (Germany); Armengaud, E.; Boissiere, T. de; Gros, M.; Navick, X.F.; Nones, C.; Paul, B. [CEA Saclay, DSM/IRFU, Gif-sur-Yvette Cedex (France); Arnaud, Q. [Univ Lyon, Universite Claude Bernard Lyon 1, CNRS/IN2P3, Institut de Physique Nucleaire de Lyon, Lyon (France); Queen' s University, Kingston (Canada); Augier, C.; Billard, J.; Cazes, A.; Charlieux, F.; Jesus, M. de; Gascon, J.; Juillard, A.; Queguiner, E.; Sanglard, V.; Vagneron, L. [Univ Lyon, Universite Claude Bernard Lyon 1, CNRS/IN2P3, Institut de Physique Nucleaire de Lyon, Lyon (France); Benoit, A.; Camus, P. [Institut Neel, CNRS/UJF, Grenoble (France); Berge, L.; Chapellier, M.; Dumoulin, L.; Giuliani, A.; Le-Sueur, H.; Marnieros, S.; Olivieri, E.; Poda, D. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Bluemer, J. [Karlsruher Institut fuer Technologie, Institut fuer Kernphysik, Karlsruhe (Germany); Karlsruher Institut fuer Technologie, Institut fuer Experimentelle Kernphysik, Karlsruhe (Germany); Broniatowski, A. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Karlsruher Institut fuer Technologie, Institut fuer Experimentelle Kernphysik, Karlsruhe (Germany); Eitel, K.; Kozlov, V.; Siebenborn, B. [Karlsruher Institut fuer Technologie, Institut fuer Kernphysik, Karlsruhe (Germany); Foerster, N.; Heuermann, G.; Scorza, S. [Karlsruher Institut fuer Technologie, Institut fuer Experimentelle Kernphysik, Karlsruhe (Germany); Jin, Y. [Laboratoire de Photonique et de Nanostructures, CNRS, Route de Nozay, Marcoussis (France); Kefelian, C. [Univ Lyon, Universite Claude Bernard Lyon 1, CNRS/IN2P3, Institut de Physique Nucleaire de Lyon, Lyon (France); Karlsruher Institut fuer Technologie, Institut fuer Experimentelle Kernphysik, Karlsruhe (Germany); Kleifges, M.; Tcherniakhovski, D.; Weber, M. [Karlsruher Institut fuer Technologie, Institut fuer Prozessdatenverarbeitung und Elektronik, Karlsruhe (Germany); Kraus, H. [University of Oxford, Department of Physics, Oxford (United Kingdom); Kudryavtsev, V.A. [University of Sheffield, Department of Physics and Astronomy, Sheffield (United Kingdom); Pari, P. [CEA Saclay, DSM/IRAMIS, Gif-sur-Yvette (France); Piro, M.C. [CSNSM, Univ. Paris-Sud, CNRS/IN2P3, Universite Paris-Saclay, Orsay (France); Rensselaer Polytechnic Institute, Troy, NY (United States); Rozov, S.; Yakushev, E. [JINR, Laboratory of Nuclear Problems, Dubna, Moscow Region (Russian Federation); Schmidt, B. [Karlsruher Institut fuer Technologie, Institut fuer Kernphysik, Karlsruhe (Germany); Lawrence Berkeley National Laboratory, Berkeley, CA (United States)

    2016-10-15

    We report on a dark matter search for a Weakly Interacting Massive Particle (WIMP) in the mass range m{sub χ} element of [4, 30] GeV/c{sup 2} with the EDELWEISS-III experiment. A 2D profile likelihood analysis is performed on data from eight selected detectors with the lowest energy thresholds leading to a combined fiducial exposure of 496 kg-days. External backgrounds from γ- and β-radiation, recoils from {sup 206}Pb and neutrons as well as detector intrinsic backgrounds were modelled from data outside the region of interest and constrained in the analysis. The basic data selection and most of the background models are the same as those used in a previously published analysis based on boosted decision trees (BDT) [1]. For the likelihood approach applied in the analysis presented here, a larger signal efficiency and a subtraction of the expected background lead to a higher sensitivity, especially for the lowest WIMP masses probed. No statistically significant signal was found and upper limits on the spin-independent WIMP-nucleon scattering cross section can be set with a hypothesis test based on the profile likelihood test statistics. The 90 % C.L. exclusion limit set for WIMPs with m{sub χ} = 4 GeV/c{sup 2} is 1.6 x 10{sup -39} cm{sup 2}, which is an improvement of a factor of seven with respect to the BDT-based analysis. For WIMP masses above 15 GeV/c{sup 2} the exclusion limits found with both analyses are in good agreement. (orig.)

  12. Exclusion limits on the WIMP-nucleon cross section from the Cryogenic Dark Matter Search

    International Nuclear Information System (INIS)

    Abrams, D.; Baudis, L.; Brink, P.L.; Cabrera, B.; Castle, J.P.; Chang, C.L.; Clarke, R.M.; Saab, T.; Akerib, D.S.; Bolozdynya, A.; Driscoll, D.; Kamat, S.; Perera, T.A.; Schnee, R.W.; Wang, G.; Armel-Funkhouser, M.S.; Golwala, S.R.; Hellmig, J.; Mandic, V.; Meunier, P.

    2002-01-01

    The Cryogenic Dark Matter Search (CDMS) employs low-temperature Ge and Si detectors to search for weakly interacting massive particles (WIMPs) via their elastic-scattering interactions with nuclei while discriminating against interactions of background particles. For recoil energies above 10 keV, events due to background photons are rejected with >99.9% efficiency, and surface events are rejected with >95% efficiency. The estimate of the background due to neutrons is based primarily on the observation of multiple-scatter events that should all be neutrons. Data selection is determined primarily by examining calibration data and vetoed events. Resulting efficiencies should be accurate to ∼10%. Results of CDMS data from 1998 and 1999 with a relaxed fiducial-volume cut (resulting in 15.8 kg days exposure on Ge) are consistent with an earlier analysis with a more restrictive fiducial-volume cut. Twenty-three WIMP candidate events are observed, but these events are consistent with a background from neutrons in all ways tested. Resulting limits on the spin-independent WIMP-nucleon elastic-scattering cross section exclude unexplored parameter space for WIMPs with masses between 10-70 GeV/c 2 . These limits border, but do not exclude, parameter space allowed by supersymmetry models and accelerator constraints. Results are compatible with some regions reported as allowed at 3σ by the annual-modulation measurement of the DAMA Collaboration. However, under the assumptions of standard WIMP interactions and a standard halo, the results are incompatible with the DAMA most likely value at >99.9% confidence level (C.L.), and are incompatible with the model-independent annual-modulation signal of DAMA at 99.99% C.L. in the asymptotic limit

  13. Neutrinos from WIMP annihilations obtained using a full three-flavor Monte Carlo approach

    International Nuclear Information System (INIS)

    Blennow, Mattias; Ohlsson, Tommy; Edsjö, Joakim

    2008-01-01

    Weakly interacting massive particles (WIMPs) are one of the main candidates for making up the dark matter in the Universe. If these particles make up the dark matter, then they can be captured by the Sun or the Earth, sink to the respective cores, annihilate, and produce neutrinos. Thus, these neutrinos can be a striking dark matter signature at neutrino telescopes looking towards the Sun and/or the Earth. Here, we improve previous analyses on computing the neutrino yields from WIMP annihilations in several respects. We include neutrino oscillations in a full three-flavor framework as well as all effects from neutrino interactions on the way through the Sun (absorption, energy loss, and regeneration from tau decays). In addition, we study the effects of non-zero values of the mixing angle θ 13 as well as the normal and inverted neutrino mass hierarchies. Our study is performed in an event-based setting which makes these results very useful both for theoretical analyses and for building a neutrino telescope Monte Carlo code. All our results for the neutrino yields, as well as our Monte Carlo code, are publicly available. We find that the yield of muon-type neutrinos from WIMP annihilations in the Sun is enhanced or suppressed, depending on the dominant WIMP annihilation channel. This effect is due to an effective flavor mixing caused by neutrino oscillations. For WIMP annihilations inside the Earth, the distance from source to detector is too small to allow for any significant amount of oscillations at the neutrino energies relevant for neutrino telescopes

  14. ASSESSING ASTROPHYSICAL UNCERTAINTIES IN DIRECT DETECTION WITH GALAXY SIMULATIONS

    International Nuclear Information System (INIS)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M.; Governato, Fabio

    2016-01-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  15. ASSESSING ASTROPHYSICAL UNCERTAINTIES IN DIRECT DETECTION WITH GALAXY SIMULATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M. [Department of Physics and Astronomy, Rutgers University, Piscataway, NJ 08854 (United States); Governato, Fabio [Astronomy Department, University of Washington, Box 351580, Seattle, WA 98195-1580 (United States)

    2016-11-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  16. Calculating exclusion limits for weakly interacting massive particle direct detection experiments without background subtraction

    International Nuclear Information System (INIS)

    Green, Anne M.

    2002-01-01

    Competitive limits on the weakly interacting massive particle (WIMP) spin-independent scattering cross section are currently being produced by 76 Ge detectors originally designed to search for neutrinoless double beta decay, such as the Heidelberg-Moscow and IGEX experiments. In the absence of background subtraction, limits on the WIMP interaction cross section are set by calculating the upper confidence limit on the theoretical event rate, given the observed event rate. The standard analysis technique involves calculating the 90% upper confidence limit on the number of events in each bin, and excluding any set of parameters (WIMP mass and cross section) which produces a theoretical event rate for any bin which exceeds the 90% upper confidence limit on the event rate for that bin. We show that, if there is more than one energy bin, this produces exclusion limits that are actually at a lower degree of confidence than 90%, and are hence erroneously tight. We formulate criteria which produce true 90% confidence exclusion limits in these circumstances, including calculating the individual bin confidence limit for which the overall probability that no bins exceed this confidence limit is 90% and calculating the 90% minimum confidence limit on the number of bins which exceed their individual bin 90% confidence limits. We then compare the limits on the WIMP cross section produced by these criteria with those found using the standard technique, using data from the Heidelberg-Moscow and IGEX experiments

  17. Direct Detection of Polarized, Scattered Light from Exoplanets

    Science.gov (United States)

    Laughlin, Gregory

    We propose to radically advance the state of exoplanet characterization, which lags dramatically behind exoplanet discovery. We propose to directly detect scattered light from the atmospheres of close-in, highly eccentric, and extended/non-spherical exoplanets and thereby determine the following: orbital inclination (and therefore masses free of the M sin i mass ambiguity), geometric albedo, presence or lack of hazes and cloud layers, and scattering particle size and composition. Such measurements are crucial to the understanding of exoplanet atmospheres, because observations with NASA s Hubble, Spitzer, and Kepler space telescopes present the following questions: 1) Do exoplanets have highly reflective haze layers? 2) How does the upper atmospheric composition differ between exoplanets with and without thermal inversions? 3) What are the optical manifestations of the extreme heating of highly eccentric exoplanets? 4) Are the atmospheres of certain exoplanets truly escaping their Roche lobes? Using the POLISH2 polarimeter developed by the Postdoctoral Associate (Wiktorowicz) for the Lick 3-m telescope, we propose to monitor the linear polarization state of exoplanet host stars at the part per million level. POLISH2 consistently delivers nearly photon shot noise limited measurements with this precision. In addition, the simultaneous full-Stokes measurements of POLISH2 and the equatorial mount of the Lick 3-m telescope ensure that systematic effects are mitigated to the part per million level. Indeed, we find the accuracy of the POLISH2 polarimeter to be 0.1 parts per million. This instrument and telescope represent the highest precision polarimeter in the world for exoplanet research. We present potential detection of polarized, scattered light from the HD 189733b, Tau Boo b, and WASP-12b exoplanets. We propose to observe hot Jupiters on circular orbits, highly eccentric exoplanets, exoplanets with extended or non-spherical scattering surfaces, and 55 Cnc e, the

  18. WIMP dark matter and supersymmetry searches with neutrino telescopes

    International Nuclear Information System (INIS)

    Fornengo, N.

    2011-01-01

    The particle physics interpretation of the missing-mass, or dark-matter, a problem of cosmological and astrophysical nature, is going to be placed under strong scrutiny in the next years. From the particle physics side, accelerator physics will deeply test theoretical ideas about new physics beyond the Standard Model, where a particle physics candidate to dark matter is often naturally obtained. From the astrophysical side, many probes are already providing a great deal of independent information on signals which can be produced by the galactic or extra-galactic dark matter. The current and new-generation experimental efforts are therefore going to place under deep scrutiny the theoretical explanations of the relevant signals. The ultimate hope is in fact to be able to disentangle a dark matter signal from the various sources of backgrounds. Neutrino telescopes are one of the prominent tools for looking at dark matter and search for a signal, the neutrino flux from Earth and Sun. In this neutrino dark matter searches share properties with both direct dark matter searches and cosmic-ray indirect dark matter searches, and therefore complement these different detection techniques.

  19. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    Science.gov (United States)

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  20. NEW COMPLETENESS METHODS FOR ESTIMATING EXOPLANET DISCOVERIES BY DIRECT DETECTION

    International Nuclear Information System (INIS)

    Brown, Robert A.; Soummer, Remi

    2010-01-01

    We report on new methods for evaluating realistic observing programs that search stars for planets by direct imaging, where observations are selected from an optimized star list and stars can be observed multiple times. We show how these methods bring critical insight into the design of the mission and its instruments. These methods provide an estimate of the outcome of the observing program: the probability distribution of discoveries (detection and/or characterization) and an estimate of the occurrence rate of planets (η). We show that these parameters can be accurately estimated from a single mission simulation, without the need for a complete Monte Carlo mission simulation, and we prove the accuracy of this new approach. Our methods provide tools to define a mission for a particular science goal; for example, a mission can be defined by the expected number of discoveries and its confidence level. We detail how an optimized star list can be built and how successive observations can be selected. Our approach also provides other critical mission attributes, such as the number of stars expected to be searched and the probability of zero discoveries. Because these attributes depend strongly on the mission scale (telescope diameter, observing capabilities and constraints, mission lifetime, etc.), our methods are directly applicable to the design of such future missions and provide guidance to the mission and instrument design based on scientific performance. We illustrate our new methods with practical calculations and exploratory design reference missions for the James Webb Space Telescope (JWST) operating with a distant starshade to reduce scattered and diffracted starlight on the focal plane. We estimate that five habitable Earth-mass planets would be discovered and characterized with spectroscopy, with a probability of zero discoveries of 0.004, assuming a small fraction of JWST observing time (7%), η = 0.3, and 70 observing visits, limited by starshade fuel.

  1. Contribution to the scintillation detection optimization in double phase detectors for direct detection of dark matter

    Science.gov (United States)

    Balan, Catalin

    Na ultima decada, foram feitos grandes progressos no desenvolvimento dos detetores de detecao direta das particulas que constituem a materia negra. Com estrategias do aumento gradual do volume do alvo e, simultaneamente, de reducao dos niveis de fundo, a experiencia XENON obteve resultados muito bons e perspetivas promissoras para a detecao de materia negra. Tarefas relativas a analise de dados experimentais adquiridos com o detetor de dupla fase em uso, assim como as simulacoes do campo eletrico, desenvolvimento, montagem e testes para o proximo detetor XENON1T, assim como a participacao regular na manutencao geral e monitorizacao do prototipo atual XENON100 no LNGS, constituiram o plano de trabalhos para as atividades de investigacao do presente doutoramento e a minha contribuicao para a otimizacao da detecao de cintilacao nos detetores da experiencia XENON. A necessidade de alcancar niveis elevados de sensibilidade, requer inovacao em todos os aspetos fisicos do detetor, assim como a reducao de todas as fontes de radioatividade que contribuem para o fundo. O modo mais indicado de operacao para os detetores com enchimento a Xe no estado liquido e gasoso envolve a medicao da cintilacao primaria e da secundaria provenientes da interacao das particulas no Xe liquido. A razao entre estes dois sinais permite diferenciar claramente a maior parte dos eventos correspondentes as fundo dos eventos correspondentes a WIMPs. Deste modo, a leitura dos sinais correspondentes a cintilacao e de extrema importancia. A amplitude do sinal de cintilacao antes dos fotossensores e maximizada atraves da otimizacao de varios parametros, tais como a geometria do alvo do detetor, a transparencia das grelhas dos eletrodos, a uniformidade do ganho em cintilacao secundaria e a utilizacao de material reflectivo para cobrir as superficies que nao sao fotossensiveis.

  2. First direct detection of solar pp neutrinos by Borexino

    Energy Technology Data Exchange (ETDEWEB)

    Maneschg, Werner [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Collaboration: Werner Maneschg on behalf of the Borexino collaboration

    2015-07-01

    According to the Standard Solar Model (SSM) the radiative energy of our Sun is produced by a series of nuclear reactions that convert hydrogen into helium. In 99% of cases these processes are supposed to start with a fusion of two protons and the emission of a positron and a low-energy neutrino. These so-called pp neutrinos vastly outnumber those emitted in other sub-reactions, but only the large volume organic liquid scintillator detector Borexino has recently succeeded to perform a spectroscopic and direct measurement of them. The present talk reviews the procedure adopted by the Borexino collaboration to detect pp neutrinos. The key requirements, i.e. unprecedented radiopurity levels at low energies and a precise spectral description of the main background arising from 14C decays, and their fulfillment are discussed. The measured pp neutrino flux is then compared with the predictions of the SSM including neutrino oscillation mechanisms, and with the solar luminosity constraint deduced from photospheric observations.

  3. Direct detection of exothermic dark matter with light mediator

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Chao-Qiang [Chongqing University of Posts & Telecommunications,Chongqing, 400065 (China); Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Huang, Da; Lee, Chun-Hao [Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Wang, Qing [Department of Physics, Tsinghua University,Beijing, 100084 (China); Collaborative Innovation Center of Quantum Matter,Beijing, 100084 (China)

    2016-08-05

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  4. CMOS-based avalanche photodiodes for direct particle detection

    International Nuclear Information System (INIS)

    Stapels, Christopher J.; Squillante, Michael R.; Lawrence, William G.; Augustine, Frank L.; Christian, James F.

    2007-01-01

    Active Pixel Sensors (APSs) in complementary metal-oxide-semiconductor (CMOS) technology are augmenting Charge-Coupled Devices (CCDs) as imaging devices and cameras in some demanding optical imaging applications. Radiation Monitoring Devices are investigating the APS concept for nuclear detection applications and has successfully migrated avalanche photodiode (APD) pixel fabrication to a CMOS environment, creating pixel detectors that can be operated with internal gain as proportional detectors. Amplification of the signal within the diode allows identification of events previously hidden within the readout noise of the electronics. Such devices can be used to read out a scintillation crystal, as in SPECT or PET, and as direct-conversion particle detectors. The charge produced by an ionizing particle in the epitaxial layer is collected by an electric field within the diode in each pixel. The monolithic integration of the readout circuitry with the pixel sensors represents an improved design compared to the current hybrid-detector technology that requires wire or bump bonding. In this work, we investigate designs for CMOS APD detector elements and compare these to typical values for large area devices. We characterize the achievable detector gain and the gain uniformity over the active area. The excess noise in two different pixel structures is compared. The CMOS APD performance is demonstrated by measuring the energy spectra of X-rays from 55 Fe

  5. Direct single-molecule dynamic detection of chemical reactions.

    Science.gov (United States)

    Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng

    2018-02-01

    Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.

  6. GENIUS and the Genius TF: A New Observatory for WIMP Dark Matter and Neutrinoless Double Beta Decay

    OpenAIRE

    Klapdor-Kleingrothaus, H. V.; Majorovits, B.

    2001-01-01

    The GENIUS proposal is described and some of it's physics potential is outlined. Also in the light of the contradictive results from the DAMA and CDMS experiments the Genius TF, a new experimental setup is proposed. The Genius TF could probe the DAMA evidence region using the WIMP nucleus recoil signal and WIMP annual modulation signature simultaneously. Besides that it can prove the long term feasibility of the detector technique to be implemented into the GENIUS setup and will in this sense...

  7. Directional response of identifier Micro Detective ORTEC, N-type with 15% of detection efficiency

    International Nuclear Information System (INIS)

    Arbach, Mayara Nascimento; Karam, Rudnei M.; Cardoso, Domingos D.O.; Sant'anna, Viviane C.; Vellozo, Sergio de O.; Gomes, Renato G.; Amorim, Aneuri S. de; Oliveira, Luciano S.R.

    2016-01-01

    It was characterized the directional response of identifier Micro Detective ORTEC, N-type with 15% of detection efficiency by using sources of Cesium ("1"3"7Cs) with activity of 37,4 kBq and Cobalt ("6"0Co) with an activity of 41 kBq, manufactured on 04/17/2007. The work took place in distances (0,5m, 1,0m, 1,5m e 2,0m) and for the angles (0°, 45°, 60° e 90°), and the measure found in angle 0° of said evaluation was adopted as reference value; this same procedure was adopted for other distances evaluated in this work. The results achieved are provided in charts 1, 2 and 3. (author)

  8. Optical intensity modulation direct detection versus heterodyne detection: A high-SNR capacity comparison

    KAUST Repository

    Chaaban, Anas

    2016-09-15

    An optical wireless communications system which employs either intensity-modulation and direct-detection (IM-DD) or heterodyne detection (HD) is considered. IM-DD has lower complexity and cost than HD, but on the other hand, has lower capacity. It is therefore interesting to investigate the capacity gap between the two systems. The main focus of this paper is to investigate this gap at high SNR. Bounds on this gap are established for two cases: between IM-DD and HD, and between IM-DD and an HD-PAM which is an HD system employing pulse-amplitude modulation (PAM). While the gap between IM-DD and HD increases as the signal-to-noise ratio (SNR) increases, the gap between IM-DD and an HD-PAM is upper bounded by a constant at high SNR. © 2015 IEEE.

  9. Optical intensity modulation direct detection versus heterodyne detection: A high-SNR capacity comparison

    KAUST Repository

    Chaaban, Anas; Alouini, Mohamed-Slim

    2016-01-01

    An optical wireless communications system which employs either intensity-modulation and direct-detection (IM-DD) or heterodyne detection (HD) is considered. IM-DD has lower complexity and cost than HD, but on the other hand, has lower capacity. It is therefore interesting to investigate the capacity gap between the two systems. The main focus of this paper is to investigate this gap at high SNR. Bounds on this gap are established for two cases: between IM-DD and HD, and between IM-DD and an HD-PAM which is an HD system employing pulse-amplitude modulation (PAM). While the gap between IM-DD and HD increases as the signal-to-noise ratio (SNR) increases, the gap between IM-DD and an HD-PAM is upper bounded by a constant at high SNR. © 2015 IEEE.

  10. WIMP-nucleon cross-section results from the second science run of ZEPLIN-III

    Energy Technology Data Exchange (ETDEWEB)

    Akimov, D.Yu. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Araujo, H.M., E-mail: h.araujo@imperial.ac.uk [High Energy Physics Group, Blackett Laboratory, Imperial College London (United Kingdom); Barnes, E.J. [School of Physics and Astronomy, SUPA University of Edinburgh (United Kingdom); Belov, V.A. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Bewick, A. [High Energy Physics Group, Blackett Laboratory, Imperial College London (United Kingdom); Burenkov, A.A. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Chepel, V. [LIP-Coimbra and Department of Physics of the University of Coimbra (Portugal); Currie, A. [High Energy Physics Group, Blackett Laboratory, Imperial College London (United Kingdom); DeViveiros, L. [LIP-Coimbra and Department of Physics of the University of Coimbra (Portugal); Edwards, B. [Particle Physics Department, STFC Rutherford Appleton Laboratory, Chilton (United Kingdom); Ghag, C.; Hollingsworth, A. [School of Physics and Astronomy, SUPA University of Edinburgh (United Kingdom); Horn, M.; Jones, W.G. [High Energy Physics Group, Blackett Laboratory, Imperial College London (United Kingdom); Kalmus, G.E. [Particle Physics Department, STFC Rutherford Appleton Laboratory, Chilton (United Kingdom); Kobyakin, A.S.; Kovalenko, A.G. [Institute for Theoretical and Experimental Physics, Moscow (Russian Federation); Lebedenko, V.N. [High Energy Physics Group, Blackett Laboratory, Imperial College London (United Kingdom); Lindote, A. [LIP-Coimbra and Department of Physics of the University of Coimbra (Portugal); Particle Physics Department, STFC Rutherford Appleton Laboratory, Chilton (United Kingdom); Lopes, M.I. [LIP-Coimbra and Department of Physics of the University of Coimbra (Portugal); and others

    2012-03-13

    We report experimental upper limits on WIMP-nucleon elastic scattering cross sections from the second science run of ZEPLIN-III at the Boulby Underground Laboratory. A raw fiducial exposure of 1344 kg Dot-Operator days was accrued over 319 days of continuous operation between June 2010 and May 2011. A total of eight events was observed in the signal acceptance region in the nuclear recoil energy range 7-29 keV, which is compatible with background expectations. This allows the exclusion of the scalar cross-section above 4.8 Multiplication-Sign 10{sup -8} pb near 50 GeV/c{sup 2} WIMP mass with 90% confidence. Combined with data from the first run, this result improves to 3.9 Multiplication-Sign 10{sup -8} pb. The corresponding WIMP-neutron spin-dependent cross-section limit is 8.0 Multiplication-Sign 10{sup -3} pb. The ZEPLIN programme reaches thus its conclusion at Boulby, having deployed and exploited successfully three liquid xenon experiments of increasing reach.

  11. WIMP-nucleon cross-section results from the second science run of ZEPLIN-III

    International Nuclear Information System (INIS)

    Akimov, D.Yu.; Araújo, H.M.; Barnes, E.J.; Belov, V.A.; Bewick, A.; Burenkov, A.A.; Chepel, V.; Currie, A.; DeViveiros, L.; Edwards, B.; Ghag, C.; Hollingsworth, A.; Horn, M.; Jones, W.G.; Kalmus, G.E.; Kobyakin, A.S.; Kovalenko, A.G.; Lebedenko, V.N.; Lindote, A.; Lopes, M.I.

    2012-01-01

    We report experimental upper limits on WIMP-nucleon elastic scattering cross sections from the second science run of ZEPLIN-III at the Boulby Underground Laboratory. A raw fiducial exposure of 1344 kg⋅days was accrued over 319 days of continuous operation between June 2010 and May 2011. A total of eight events was observed in the signal acceptance region in the nuclear recoil energy range 7-29 keV, which is compatible with background expectations. This allows the exclusion of the scalar cross-section above 4.8×10 -8 pb near 50 GeV/c 2 WIMP mass with 90% confidence. Combined with data from the first run, this result improves to 3.9×10 -8 pb. The corresponding WIMP-neutron spin-dependent cross-section limit is 8.0×10 -3 pb. The ZEPLIN programme reaches thus its conclusion at Boulby, having deployed and exploited successfully three liquid xenon experiments of increasing reach.

  12. Neutrinos from WIMP annihilations in the Sun including neutrino oscillations

    International Nuclear Information System (INIS)

    Blennow, Mattias; Edsjö, Joakim; Ohlsson, Tommy

    2011-01-01

    The prospects to detect neutrinos from the Sun arising from dark matter annihilations in the core of the Sun are reviewed. Emphasis is placed on new work investigating the effects of neutrino oscillations on the expected neutrino fluxes.

  13. Neutrinos from WIMP annihilations in the Sun including neutrino oscillations

    International Nuclear Information System (INIS)

    Blennow, Mattias; Edsjoe, Joakim; Ohlsson, Tommy

    2006-01-01

    The prospects for detecting neutrinos from the Sun arising from dark matter annihilations in the core of the Sun are reviewed. Emphasis is placed on new work investigating the effects of neutrino oscillations on the expected neutrino fluxes

  14. Stereo multiplexing for direct detected optical communication systems

    NARCIS (Netherlands)

    Gaete, O.; Coelho, L.D.; Spinnler, B.; Al Fiad, M.S.A.S.; Jansen, S.L.; Hanik, N.

    2009-01-01

    We propose a novel technique that allows simultaneous detection of two modulated optical sub-carriers. A proof-of-principle experiment is described and subsequently the performance at high data rates (111Gb/s) is assessed by simulations.

  15. Signal modulation in cold-dark-matter detection

    International Nuclear Information System (INIS)

    Freese, K.; Frieman, J.; Gould, A.

    1988-01-01

    If weakly interacting massive particles (WIMP's) are the dark matter in the galactic halo, they may be detected in low-background ionization detectors now operating or with low-temperature devices under development. In detecting WIMP's of low mass or WIMP's with spin-dependent nuclear interactions (e.g., photinos), a principal technical difficulty appears to be achieving very low thresholds (approx. < keV) in large (∼ kg) detectors with low background noise. We present an analytic treatment of WIMP detection and show that the seasonal modulation of the signal can be used to detect WIMP's even at low-signal-to-background levels and thus without the necessity of going to very-low-energy thresholds. As a result, the prospects for detecting a variety of cold-dark-matter candidates may be closer at hand than previously thought. We discuss in detail the detector characteristics required for a number of WIMP candidates, and carefully work out expected event rates for several present and proposed detectors

  16. Prospects for SIMPLE 2000 A large-mass, low-background Superheated Droplet Detector for WIMP searches

    CERN Document Server

    Collar, J I; Girard, T A; Limagne, D; Miley, H S; Waysand, G

    2000-01-01

    SIMPLE 2000 ({\\underline S}uperheated {\\underline I}nstrument for {\\underline M}assive {\\underline P}artic{\\underline {LE}} searches) will consist of an array of eight to sixteen large active mass ($\\sim15$ g) Superheated Droplet Detectors(SDDs) to be installed in the new underground laboratory of Rustrel-Pays d'Apt. Several factors make of SDDs an attractive approach for the detection of Weakly Interacting Massive Particles (WIMPs), namely their intrinsic insensitivity to minimum ionizing particles, high fluorine content, low cost and operation near ambient pressure and temperature. We comment here on the fabrication, calibration and already-competitive first limits from SIMPLE prototype SDDs, as well as on the expected immediate increase in sensitivity of the program, which aims at an exposure of $>$25 kg-day during the year 2000. The ability of modest-mass fluorine-rich detectors to explore regions of neutralino parameter space beyond the reach of the most ambitious cryogenic projects is pointed out.

  17. Study and optimization of the ionisation channel in the Edelweiss dark matter direct detection experiment; Etude et optimisation de la voie ionisation dans l'experience Edelweiss de detection directe de la matiere noire

    Energy Technology Data Exchange (ETDEWEB)

    Censier, B

    2006-02-15

    The EDELWEISS experiment is aiming at the detection of Weakly Interactive Massive Particles (WIMPs), today's most favoured candidates for solving the dark matter issue. Background ionising particles are identified thanks to the simultaneous measurement of heat and ionisation in the detectors. The main limitation to this method is coming from the ionisation measurement, charge collection being less efficient in some part of the detectors known as 'dead' areas. The specificity of the measurement is due to the use of very low temperatures and low collection fields. This thesis is dedicated to the study of carrier trapping. It involves time-resolved charge measurements as well as a simulation code adapted to the specific physical conditions. We first present results concerning charge trapping at the free surfaces of the detectors. Our method allows to build a surface-charge in a controlled manner by irradiation with a strong radioactive source. This charge is then characterised with a weaker source which acts as a probe. In a second part of the work, bulk-trapping characteristics are deduced from charge collection efficiency measurements, and by an original method based on event localisation in the detector. The results show that a large proportion of the doping impurities are ionised, as indicated independently by the study of degradation by space-charge build-up. In this last part, near-electrodes areas are found to contain large densities of charged trapping centres, in connection with dead-layer effects. (author)

  18. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology.

    Science.gov (United States)

    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik

    2015-11-01

    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1-0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology. © The Author

  19. Detection without deflection? A hypothesis for direct sensing of ...

    Indian Academy of Sciences (India)

    PRAKASH

    level, the pressure component of a sound signal is more readily detected ... gives rise to a slowly propagating travelling wave, a wave of displacement on the ..... partial pressure of gas dissolved in sea water stays constant at about the level ...... of Corti (Midwinter Meeting, Florida, Association for Research in Otolaryngology).

  20. Chasing a consistent picture for dark matter direct detection searches

    NARCIS (Netherlands)

    Arina, C.

    2012-01-01

    In this paper we assess the present status of dark matter direct searches by means of Bayesian statistics. We consider three particle physics models for spin-independent dark matter interaction with nuclei: elastic, inelastic and isospin violating scattering. We briefly present the state of the art

  1. Galactic synchrotron emission from WIMPs at radio frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Fornengo, Nicolao; Regis, Marco [Dipartimento di Fisica Teorica, Università di Torino, Istituto Nazionale di Fisica Nucleare, via P. Giuria 1, I-10125 Torino (Italy); Lineros, Roberto A.; Taoso, Marco, E-mail: fornengo@to.infn.it, E-mail: rlineros@ific.uv.es, E-mail: regis@to.infn.it, E-mail: taoso@ific.uv.es [IFIC, CSIC-Universidad de Valencia, Ed. Institutos, Apdo. Correos 22085, E-46071 Valencia (Spain)

    2012-01-01

    Dark matter annihilations in the Galactic halo inject relativistic electrons and positrons which in turn generate a synchrotron radiation when interacting with the galactic magnetic field. We calculate the synchrotron flux for various dark matter annihilation channels, masses, and astrophysical assumptions in the low-frequency range and compare our results with radio surveys from 22 MHz to 1420 MHz. We find that current observations are able to constrain particle dark matter with ''thermal'' annihilation cross-sections, i.e. (σv) = 3 × 10{sup −26} cm{sup 3} s{sup −1}, and masses M{sub DM}∼<10 GeV. We discuss the dependence of these bounds on the astrophysical assumptions, namely galactic dark matter distribution, cosmic rays propagation parameters, and structure of the galactic magnetic field. Prospects for detection in future radio surveys are outlined.

  2. Galactic synchrotron emission from WIMPs at radio frequencies

    International Nuclear Information System (INIS)

    Fornengo, Nicolao; Regis, Marco; Lineros, Roberto A.; Taoso, Marco

    2012-01-01

    Dark matter annihilations in the Galactic halo inject relativistic electrons and positrons which in turn generate a synchrotron radiation when interacting with the galactic magnetic field. We calculate the synchrotron flux for various dark matter annihilation channels, masses, and astrophysical assumptions in the low-frequency range and compare our results with radio surveys from 22 MHz to 1420 MHz. We find that current observations are able to constrain particle dark matter with ''thermal'' annihilation cross-sections, i.e. (σv) = 3 × 10 −26 cm 3 s −1 , and masses M DM ∼<10 GeV. We discuss the dependence of these bounds on the astrophysical assumptions, namely galactic dark matter distribution, cosmic rays propagation parameters, and structure of the galactic magnetic field. Prospects for detection in future radio surveys are outlined

  3. DarkSide-20k: A 20 Tonne Two-Phase LAr TPC for Direct Dark Matter Detection at LNGS

    Energy Technology Data Exchange (ETDEWEB)

    Aalseth, C.E.; et al.

    2017-07-25

    Building on the successful experience in operating the DarkSide-50 detector, the DarkSide Collaboration is going to construct DarkSide-20k, a direct WIMP search detector using a two-phase Liquid Argon Time Projection Chamber (LArTPC) with an active (fiducial) mass of 23 t (20 t). The DarkSide-20k LArTPC will be deployed within a shield/veto with a spherical Liquid Scintillator Veto (LSV) inside a cylindrical Water Cherenkov Veto (WCV). Operation of DarkSide-50 demonstrated a major reduction in the dominant $^{39}$Ar background when using argon extracted from an underground source, before applying pulse shape analysis. Data from DarkSide-50, in combination with MC simulation and analytical modeling, shows that a rejection factor for discrimination between electron and nuclear recoils of $\\gt3\\times10^9$ is achievable. This, along with the use of the veto system, is the key to unlocking the path to large LArTPC detector masses, while maintaining an "instrumental background-free" experiment, an experiment in which less than 0.1 events (other than $\

  4. Teleconnection Paths via Climate Network Direct Link Detection.

    Science.gov (United States)

    Zhou, Dong; Gozolchiani, Avi; Ashkenazy, Yosef; Havlin, Shlomo

    2015-12-31

    Teleconnections describe remote connections (typically thousands of kilometers) of the climate system. These are of great importance in climate dynamics as they reflect the transportation of energy and climate change on global scales (like the El Niño phenomenon). Yet, the path of influence propagation between such remote regions, and weighting associated with different paths, are only partially known. Here we propose a systematic climate network approach to find and quantify the optimal paths between remotely distant interacting locations. Specifically, we separate the correlations between two grid points into direct and indirect components, where the optimal path is found based on a minimal total cost function of the direct links. We demonstrate our method using near surface air temperature reanalysis data, on identifying cross-latitude teleconnections and their corresponding optimal paths. The proposed method may be used to quantify and improve our understanding regarding the emergence of climate patterns on global scales.

  5. The detection of transient directional couplings based on phase synchronization

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, T; Fell, J; Lehnertz, K, E-mail: twagner@uni-bonn.d [Department of Epileptology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany)

    2010-05-15

    We extend recent approaches based on the concept of phase synchronization to enable the time-resolved investigation of directional relationships between coupled dynamical systems from short and transient noisy time series. For our approach, we consider an observed ensemble of a sufficiently large number of time series as multiple realizations of a process. We derive an index that quantifies the direction of transient interactions and assess its statistical significance using surrogate techniques. Analysing time series from noisy and chaotic systems, we demonstrate numerically the applicability and limitations of our approach. Our findings from an exemplary application to event-related brain activities underline the importance of our method for improving knowledge about the mechanisms underlying memory formation in humans.

  6. The detection of transient directional couplings based on phase synchronization

    International Nuclear Information System (INIS)

    Wagner, T; Fell, J; Lehnertz, K

    2010-01-01

    We extend recent approaches based on the concept of phase synchronization to enable the time-resolved investigation of directional relationships between coupled dynamical systems from short and transient noisy time series. For our approach, we consider an observed ensemble of a sufficiently large number of time series as multiple realizations of a process. We derive an index that quantifies the direction of transient interactions and assess its statistical significance using surrogate techniques. Analysing time series from noisy and chaotic systems, we demonstrate numerically the applicability and limitations of our approach. Our findings from an exemplary application to event-related brain activities underline the importance of our method for improving knowledge about the mechanisms underlying memory formation in humans.

  7. Direct detection of a microlens in the Milky Way.

    Science.gov (United States)

    Alcock, C; Allsman, R A; Alves, D R; Axelrod, T S; Becker, A C; Bennett, D P; Cook, K H; Drake, A J; Freeman, K C; Geha, M; Griest, K; Keller, S C; Lehner, M J; Marshall, S L; Minniti, D; Nelson, C A; Peterson, B A; Popowski, P; Pratt, M R; Quinn, P J; Stubbs, C W; Sutherland, W; Tomaney, A B; Vandehei, T; Welch, D

    2001-12-06

    The nature of dark matter remains mysterious, with luminous material accounting for at most approximately 25 per cent of the baryons in the Universe. We accordingly undertook a survey looking for the microlensing of stars in the Large Magellanic Cloud (LMC) to determine the fraction of Galactic dark matter contained in massive compact halo objects (MACHOs). The presence of the dark matter would be revealed by gravitational lensing of the light from an LMC star as the foreground dark matter moves across the line of sight. The duration of the lensing event is the key observable parameter, but gives non-unique solutions when attempting to estimate the mass, distance and transverse velocity of the lens. The survey results to date indicate that between 8 and 50 per cent of the baryonic mass of the Galactic halo is in the form of MACHOs (ref. 3), but removing the degeneracy by identifying a lensing object would tighten the constraints on the mass in MACHOs. Here we report a direct image of a microlens, revealing it to be a nearby low-mass star in the disk of the Milky Way. This is consistent with the expected frequency of nearby stars acting as lenses, and demonstrates a direct determination of a lens mass from a microlensing event. Complete solutions such as this for halo microlensing events will probe directly the nature of the MACHOs.

  8. Search for WIMP dark matter produced in association with a Z boson with the ATLAS detector

    CERN Document Server

    Basalaev, Artem; The ATLAS collaboration

    2016-01-01

    The search for weakly interacting dark matter particle (WIMP) candidates produced in association with a Z boson is presented. Events with large missing transverse momentum and consistent with the decay of a Z boson into oppositely charged electron or muon pairs were selected in analysis. Background estimates and corresponding systematic uncertainties are shown. The limits on the mass scale of the contact interaction as a function of the dark matter particle mass and the limits on the coupling and scalar particle mediator mass for 8 TeV proton-proton collisions data are presented. Prospects for analysis using 13 TeV proton-proton collisions data are discussed.

  9. Further results on the WIMP annual modulation signature by DAMA/NaI

    International Nuclear Information System (INIS)

    Bernabei, R.; Belli, P.; Cappella, F.

    2005-01-01

    The ≅ 100 kg highly radiopure NaI(Tl) set-up of the DAMA project (DAMA/NaI) has investigated the model- independent WIMP annual modulation signature over seven annual cycles for a total exposure of 107731 kg x day, obtaining a model-independent evidence for the presence of a dark matter particle component in the galactic halo at 6.3 σ C.L.. Some of the many possible corollary model-dependent quests for the candidate particle have been investigated with the total exposure as well

  10. CPN/Tools: A Post-WIMP Interface for Editing and Simulating Coloured Petri Nets

    DEFF Research Database (Denmark)

    Andersen, Peter; Beaudouin-Lafon, Michel; Mackay, Wendy E.

    2001-01-01

    traditional ideas about user interfaces, getting rid of pull-down menus, scrollbars, and even selection, while providing the same or greater functionality. It also uses the new and much faster CPN simulator and features incremental syntax checking of the nets. CPN/Tools requires an OpenGL graphics accelerator......CPN/Tools is a major redesign of the popular Design/CPN tool from the University of Aarhus CPN group. The new interface is based on advanced, post-WIMP interaction techniques, including bi-manual interaction, toolglasses and marking menus and a new metaphor for managing the workspace. It challenges...

  11. The use of twin-screen-based WIMPS in spacecraft control

    Science.gov (United States)

    Klim, R. D.

    1990-10-01

    The ergonomic problems of designing a sophisticated Windows Icons Mouse Pop-up (WIMP) based twin screen workstation are outlined. These same problems will be encountered by future spacecraft controllers. The design of a modern, advanced workstation for use on a distributed multicontrol center in a multisatellite control system is outlined. The system uses access control mechanisms to ensure that only authorized personnel can undertake certain operations on the workstation. Rules governing the use of windowing features, screen attributes, icons, keyboard and mouse in spacecraft control are discussed.

  12. Development of low-background CsI(Tl) crystals for WIMP search

    International Nuclear Information System (INIS)

    Lee, H.S.; Bhang, H.; Hahn, I.S.; Hwang, M.J.; Kim, H.J.; Kim, S.C.; Kim, S.K.; Kim, S.Y.; Kim, T.Y.; Kim, Y.D.; Kwak, J.W.; Kwon, Y.J.; Lee, J.; Lee, J.I.; Lee, M.J.; Li, J.; Myung, S.S.; Park, H.; Zhu, J.J.

    2007-01-01

    Search for weakly interacting massive particles (WIMPs) is being carried out at the underground laboratory, Yangyang, Korea. Characteristics and internal background of CsI(Tl) crystal have been investigated. In our extensive R and D, we reduced internal background in the CsI(Tl) crystal. With the latest, we have achieved 5.50+/-0.10cpd (counts/keV/kg/day) at 10-15keV low-energy region. Further reduction of internal background is foreseen with the CsI powder lately produced

  13. Detection of nucleic acid sequences by invader-directed cleavage

    Science.gov (United States)

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  14. Fast and direct detection of neuronal activation with diffusion MRI

    International Nuclear Information System (INIS)

    Le Bihan, D.; Urayama, S.; Aso, T.; Hanakawa, T.; Fukuyama, H.

    2006-01-01

    Over the last 30 years functional neuroimaging has emerged as a revolutionary path to study the brain and the mind. This has been possible because of significant advances mainly in two imaging modalities, namely Positron Emission Tomograph y (PET) and Magnetic Resonance Imaging (MRI). Amazingly, although those two modalities are based on radically different physical approaches (detection of 1 3 radioactivity for the first one and nuclear magnetization for the second), both allo w brain activation images to be obtained through measurements involving water molecules. So far, PET and MRI functional imaging have relied on the same principle that neuronal activation and blood flow are coupled through metabolism: Blood flow increases locally in activated brain regions. In the case of PET one uses H 2 O radioactive water which is produced by using a cyclotron and injected to the subject vasculature. In activated brain regions the increase in blood flow leads to a local increase in the tissue radioactive water content detected and localized by the PE T camera. With MRI the hydrogen nuclei of brain endogenous water molecules are magnetized by a strong external magnetic field. In activated regions the increase in blood flow results in an increase of blood oxygenation which induces a slight perturbation of the magnetization relaxation properties of the water molecules around blood vessels detected by the MRI scanner (so called 'BOLD' effect). I n both approaches water is, thus, merely an indirect means to look at changes in cerebral blood flow which accompany brain activation, and although PET and BOLD f MRI have been extremely successful for the functional neuroimaging community, present well known limitations. While the coupling between neuronal activation, metabolism and blood flow has been verified in most instances including BOLD f MRI, the degree and the mechanism of coupling remains largely debated (Magistratt, Pellerin, Mangia) and may fail in some pathological

  15. Direct detection of a single photon by humans

    Science.gov (United States)

    Tinsley, Jonathan N.; Molodtsov, Maxim I.; Prevedel, Robert; Wartmann, David; Espigulé-Pons, Jofre; Lauwers, Mattias; Vaziri, Alipasha

    2016-01-01

    Despite investigations for over 70 years, the absolute limits of human vision have remained unclear. Rod cells respond to individual photons, yet whether a single-photon incident on the eye can be perceived by a human subject has remained a fundamental open question. Here we report that humans can detect a single-photon incident on the cornea with a probability significantly above chance. This was achieved by implementing a combination of a psychophysics procedure with a quantum light source that can generate single-photon states of light. We further discover that the probability of reporting a single photon is modulated by the presence of an earlier photon, suggesting a priming process that temporarily enhances the effective gain of the visual system on the timescale of seconds. PMID:27434854

  16. Direct detection of radicals in intact soybean nodules

    DEFF Research Database (Denmark)

    Mathieu, C; Moreau, S; Frendo, P

    1998-01-01

    Electron paramagnetic resonance spectroscopy has been employed to examine the nature of the metal ions and radicals present in intact root nodules of soybean plants grown in the absence of nitrate. The spectra obtained from nodules of different ages using this non-invasive technique show dramatic...... differences, suggesting that there are both qualitative and quantitative changes in the metal ion and radical species present. A major component of the spectra obtained from young nodules is assigned to a complex (Lb-NO) of nitric oxide (NO.) with the heme protein leghemoglobin (Lb). This Lb-NO species, which...... has not been previously detected in intact root nodules of plants grown in the absence of nitrate, is thought to be formed by reaction of nitric oxide with iron(II) leghemoglobin. The nitric oxide may be generated from arginine via a nitric oxide synthase-like activity present in the nodules...

  17. A detecting device with compensated directional dependence of response

    International Nuclear Information System (INIS)

    Viererbl, L.

    1988-01-01

    A scintillation detector making up for the directional dependence of response was devised. The jacket of the scintillator consists of a hollow body whose internal diameter is sufficient for the scintillator to be inserted, and of a ring whose height is lower than one-half of the largest dimension of the scintillator. The ring is accommodated at that side of the scintillator face which is more distant from the cathode of the photomultiplier. More than 90% of the material of the ring is constituted by atoms with atomic number higher than 23, whereas more than 90% of the material of the hollow body is constituted by atoms with atomic number lower than 14. (P.A.). 2 figs

  18. Coherent radio-frequency detection for narrowband direct comb spectroscopy.

    Science.gov (United States)

    Anstie, James D; Perrella, Christopher; Light, Philip S; Luiten, Andre N

    2016-02-22

    We demonstrate a scheme for coherent narrowband direct optical frequency comb spectroscopy. An extended cavity diode laser is injection locked to a single mode of an optical frequency comb, frequency shifted, and used as a local oscillator to optically down-mix the interrogating comb on a fast photodetector. The high spectral coherence of the injection lock generates a microwave frequency comb at the output of the photodiode with very narrow features, enabling spectral information to be further down-mixed to RF frequencies, allowing optical transmittance and phase to be obtained using electronics commonly found in the lab. We demonstrate two methods for achieving this step: a serial mode-by-mode approach and a parallel dual-comb approach, with the Cs D1 transition at 894 nm as a test case.

  19. Fast and direct detection of neuronal activation with diffusion MRI

    Energy Technology Data Exchange (ETDEWEB)

    Le Bihan, D. [Service Hospitalier Frederic Joliot (CEA/DSV/DRM), Lab. Anatomical and Functional Neuroimaging, 91 - Orsay (France); Urayama, S.; Aso, T.; Hanakawa, T.; Fukuyama, H. [Kyoto Univ. Graduate School of Medicine, Human Brain Research Center, Kyoto (Japan)

    2006-07-01

    Over the last 30 years functional neuroimaging has emerged as a revolutionary path to study the brain and the mind. This has been possible because of significant advances mainly in two imaging modalities, namely Positron Emission Tomograph y (PET) and Magnetic Resonance Imaging (MRI). Amazingly, although those two modalities are based on radically different physical approaches (detection of 1 3 radioactivity for the first one and nuclear magnetization for the second), both allo w brain activation images to be obtained through measurements involving water molecules. So far, PET and MRI functional imaging have relied on the same principle that neuronal activation and blood flow are coupled through metabolism: Blood flow increases locally in activated brain regions. In the case of PET one uses H{sub 2}O radioactive water which is produced by using a cyclotron and injected to the subject vasculature. In activated brain regions the increase in blood flow leads to a local increase in the tissue radioactive water content detected and localized by the PE T camera. With MRI the hydrogen nuclei of brain endogenous water molecules are magnetized by a strong external magnetic field. In activated regions the increase in blood flow results in an increase of blood oxygenation which induces a slight perturbation of the magnetization relaxation properties of the water molecules around blood vessels detected by the MRI scanner (so called 'BOLD' effect). I n both approaches water is, thus, merely an indirect means to look at changes in cerebral blood flow which accompany brain activation, and although PET and BOLD f MRI have been extremely successful for the functional neuroimaging community, present well known limitations. While the coupling between neuronal activation, metabolism and blood flow has been verified in most instances including BOLD f MRI, the degree and the mechanism of coupling remains largely debated (Magistratt, Pellerin, Mangia) and may fail in some

  20. Directionality and signal amplification in cryogenic dark matter detection

    International Nuclear Information System (INIS)

    More, T.

    1996-05-01

    A mounting body of evidence suggests that most of the mass in our universe is not contained in stars, but rather exists in some non- luminous form. The evidence comes independently from astronomical observation, cosmological theory, and particle physics. All of this missing mass is collectively referred to as dark matter. In this thesis we discuss two ways to improve the performance of dark matter detectors based on the measurement of ballistic phonons. First, we address the issue of signal identification through solitons. Secondly, we discuss a method for lowering the detection threshold and improving the energy sensitivity: amplifying phonons through the evaporation of helium atoms from a superfluid film coating the target and the adsorption of the evaporated atoms onto a helium-free substrate. A phonon amplifier would also be of use in many other applications in which a few phonons are to be measured at low temperatures. Factors contributing to the low amplifier gains achieved thus far are described and proposals for avoiding them are analyzed and discussed. 101 refs., 30 figs., 2 tabs

  1. WIMP search in the mono-photon channel at the international linear collider

    Energy Technology Data Exchange (ETDEWEB)

    Habermehl, Moritz [Deutsches Elektronen-Synchrotron (DESY), Notkestrasse 85, 22607 Hamburg (Germany); Universitaet Hamburg, Institut fuer Experimentalphysik, Luruper Chaussee 149, 22761 Hamburg (Germany); List, Jenny [Deutsches Elektronen-Synchrotron (DESY), Notkestrasse 85, 22607 Hamburg (Germany)

    2016-07-01

    The International Linear Collider (ILC) is a planned electron-positron collider with √(s) tunable from 250 to 500 GeV, with a possible upgrade to 1 TeV. Besides precision measurements of the Higgs boson its physics goals comprise searches for physics beyond the Standard Model, e.g. searches for Dark Matter. This collider search assumes the production of WIMPs in pairs. They are not visible in the detector but the energy carried away can be observed via an additional (''tag'') particle. Photon emission from the initial state leads to the almost model independent signature: e{sup +}e{sup -} → χχγ. As this analysis tests couplings between WIMPs and leptons it is complementary to analogues searches at the LHC. A precise study is facilitated by the clean environment of lepton colliders with small systematics of electroweak backgrounds. While the conceptual feasibility and the sensitivity reach of the ILC have been shown in the past, this talk focusses on the consequences for the detector design. The requirements for the central detector as well as for the instrumentation of the forward region are discussed in the context of the ILD detector concept.

  2. Halo-independent direct detection of momentum-dependent dark matter

    DEFF Research Database (Denmark)

    Cherry, J. F.; Frandsen, M. T.; Shoemaker, I. M.

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given...... a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can...

  3. Detailed Characterization of Nuclear Recoil Pulse Shape Discrimination in the Darkside-50 Direct Dark Matter Experiment

    Science.gov (United States)

    Ludert, Erin Edkins

    While evidence of non-baryonic dark matter has been accumulating for decades, its exact nature continues to remain a mystery. Weakly Interacting Massive Particles (WIMPs) are a well motivated candidate which appear in certain extensions of the Standard Model, independently of dark matter theory. If such particles exist, they should occasionally interact with particles of normal matter, producing a signal which may be detected. The DarkSide-50 direct dark matter experiment aims to detect the energy of recoiling argon atoms due to the elastic scattering of postulated WIMPs. In order to make such a discovery, a clear understanding of both the background and signal region is essential. This understanding requires a careful study of the detector's response to radioactive sources, which in turn requires such sources may be safely introduced into or near the detector volume and reliably removed. The CALibration Insertaion System (CALIS) was designed and built for this purpose in a joint effort between Fermi National Laboratory and the University of Hawaii. This work describes the design and testing of CALIS, its installation and commissioning at the Laboratori Nazionali del Gran Sasso (LNGS) and the multiple calibration campaigns which have successfully employed it. As nuclear recoils produced by WIMPs are indistinguishable from those produced by neutrons, radiogenic neutrons are both the most dangerous class of background and a vital calibration source for the study of the potential WIMP signal. Prior to the calibration of DarkSide-50 with radioactive neutron sources, the acceptance region was determined by the extrapolation of nuclear recoil data from a separate, dedicated experiment, ScENE, which measured the distribution of the pulse shape discrimination parameter, f 90, for nuclear recoils of known energies. This work demonstrates the validity of the extrapolation of ScENE values to DarkSide-50, by direct comparison of the f90 distribution of nuclear recoils from Sc

  4. A Bio-Inspired Model-Based Approach for Context-Aware Post-WIMP Tele-Rehabilitation

    Directory of Open Access Journals (Sweden)

    Víctor López-Jaquero

    2016-10-01

    Full Text Available Tele-rehabilitation is one of the main domains where Information and Communication Technologies (ICT have been proven useful to move healthcare from care centers to patients’ home. Moreover, patients, especially those carrying out a physical therapy, cannot use a traditional Window, Icon, Menu, Pointer (WIMP system, but they need to interact in a natural way, that is, there is a need to move from WIMP systems to Post-WIMP ones. Moreover, tele-rehabilitation systems should be developed following the context-aware approach, so that they are able to adapt to the patients’ context to provide them with usable and effective therapies. In this work a model-based approach is presented to assist stakeholders in the development of context-aware Post-WIMP tele-rehabilitation systems. It entails three different models: (i a task model for designing the rehabilitation tasks; (ii a context model to facilitate the adaptation of these tasks to the context; and (iii a bio-inspired presentation model to specify thoroughly how such tasks should be performed by the patients. Our proposal overcomes one of the limitations of the model-based approach for the development of context-aware systems supporting the specification of non-functional requirements. Finally, a case study is used to illustrate how this proposal can be put into practice to design a real world rehabilitation task.

  5. Detectability of weakly interacting massive particles in the Sagittarius dwarf tidal stream

    International Nuclear Information System (INIS)

    Freese, Katherine; Gondolo, Paolo; Newberg, Heidi Jo

    2005-01-01

    Tidal streams of the Sagittarius dwarf spheroidal galaxy (Sgr) may be showering dark matter onto the solar system and contributing ∼(0.3-23)% of the local density of our galactic halo. If the Sagittarius galaxy contains dark matter in the form of weakly interacting massive particles (WIMPs), the extra contribution from the stream gives rise to a steplike feature in the energy recoil spectrum in direct dark matter detection. For our best estimate of stream velocity (300 km/s) and direction (the plane containing the Sgr dwarf and its debris), the count rate is maximum on June 28 and minimum on December 27 (for most recoil energies), and the location of the step oscillates yearly with a phase opposite to that of the count rate. In the CDMS experiment, for 60 GeV WIMPs, the location of the step oscillates between 35 and 42 keV, and for the most favorable stream density, the stream should be detectable at the 11σ level in four years of data with 10 keV energy bins. Planned large detectors like XENON, CryoArray, and the directional detector DRIFT may also be able to identify the Sgr stream

  6. Minimizing Detection Probability Routing in Ad Hoc Networks Using Directional Antennas

    Directory of Open Access Journals (Sweden)

    Towsley Don

    2009-01-01

    Full Text Available In a hostile environment, it is important for a transmitter to make its wireless transmission invisible to adversaries because an adversary can detect the transmitter if the received power at its antennas is strong enough. This paper defines a detection probability model to compute the level of a transmitter being detected by a detection system at arbitrary location around the transmitter. Our study proves that the probability of detecting a directional antenna is much lower than that of detecting an omnidirectional antenna if both the directional and omnidirectional antennas provide the same Effective Isotropic Radiated Power (EIRP in the direction of the receiver. We propose a Minimizing Detection Probability (MinDP routing algorithm to find a secure routing path in ad hoc networks where nodes employ directional antennas to transmit data to decrease the probability of being detected by adversaries. Our study shows that the MinDP routing algorithm can reduce the total detection probability of deliveries from the source to the destination by over 74%.

  7. Evaluation of two methods for direct detection of Fusarium spp. in water.

    Science.gov (United States)

    Graça, Mariana G; van der Heijden, Inneke M; Perdigão, Lauro; Taira, Cleison; Costa, Silvia F; Levin, Anna S

    2016-04-01

    Fusarium is a waterborne fungus that causes severe infections especially in patients with prolonged neutropenia. Traditionally, the detection of Fusarium in water is done by culturing which is difficult and time consuming. A faster method is necessary to prevent exposure of susceptible patients to contaminated water. The objective of this study was to develop a molecular technique for direct detection of Fusarium in water. A direct DNA extraction method from water was developed and coupled to a genus-specific PCR, to detect 3 species of Fusarium (verticillioides, oxysporum and solani). The detection limits were 10 cells/L and 1 cell/L for the molecular and culture methods, respectively. To our knowledge, this is the first method developed to detect Fusarium directly from water. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Near-IR Direct Detection of Water Vapor in Tau Bootis b

    Science.gov (United States)

    2014-02-24

    unknown orbital inclination. Treating the τ Boo system as a high flux ratio double-lined spectroscopic binary permits the direct measurement of the...the atmosphere of a non-transiting hot Jupiter, τ Boo b. Key words: planets and satellites: atmospheres – techniques: spectroscopic 1. INTRODUCTION...sensitivity required for these detections. Despite the agreement between the two groups, the direct detection of exoplanets, especially τ Boo b, has

  9. Direct Detection Phenomenology in Models Where the Products of Dark Matter Annihilation Interact with Nuclei

    DEFF Research Database (Denmark)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2015-01-01

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection...... to nuclei, the limit from annihilation to relativistic particles in the Sun can be stronger than that of conventional non-relativistic direct detection by more than three orders of magnitude for masses in a 2-7 GeV window.......We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection...... experiments is controlled by relativistic kinematics. This results in a distinctive recoil spectrum, a non-standard and or even absent annual modulation, and the ability to probe DM masses as low as a $\\sim$10 MeV. We use current LUX data to show that experimental sensitivity to thermal relic annihilation...

  10. Search for WIMP dark matter produced in association with a Z boson with the ATLAS detector

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00399337; The ATLAS collaboration

    2016-01-01

    The search for weakly interacting dark matter particle (WIMP) candidates produced in association with a Z boson with the ATLAS detector at the LHC is presented. Events with large missing transverse momentum and consistent with the decay of a Z boson into oppositely charged electron or muon pairs were selected in analysis. Background estimates and corresponding systematic uncertainties are shown. The limits on the mass scale of the contact interaction as a function of the dark matter particle mass and the limits on the coupling and scalar particle mediator mass for 8 TeV proton-proton collisions data are presented. Prospects for analysis using 13 TeV proton-proton collisions data are discussed.

  11. Characterising dark matter searches at colliders and direct detection experiments: Vector mediators

    International Nuclear Information System (INIS)

    Buchmueller, Oliver; Dolan, Matthew J.; Malik, Sarah A.; McCabe, Christopher

    2015-01-01

    We introduce a Minimal Simplified Dark Matter (MSDM) framework to quantitatively characterise dark matter (DM) searches at the LHC. We study two MSDM models where the DM is a Dirac fermion which interacts with a vector and axial-vector mediator. The models are characterised by four parameters: m DM , M med, g DM and g q , the DM and mediator masses, and the mediator couplings to DM and quarks respectively. The MSDM models accurately capture the full event kinematics, and the dependence on all masses and couplings can be systematically studied. The interpretation of mono-jet searches in this framework can be used to establish an equal-footing comparison with direct detection experiments. For theories with a vector mediator, LHC mono-jet searches possess better sensitivity than direct detection searches for light DM masses (≲5 GeV). For axial-vector mediators, LHC and direct detection searches generally probe orthogonal directions in the parameter space. We explore the projected limits of these searches from the ultimate reach of the LHC and multi-ton xenon direct detection experiments, and find that the complementarity of the searches remains. In conclusion, we provide a comparison of limits in the MSDM and effective field theory (EFT) frameworks to highlight the deficiencies of the EFT framework, particularly when exploring the complementarity of mono-jet and direct detection searches

  12. Deciphering inflation with gravitational waves: Cosmic microwave background polarization vs direct detection with laser interferometers

    International Nuclear Information System (INIS)

    Smith, Tristan L.; Peiris, Hiranya V.; Cooray, Asantha

    2006-01-01

    A detection of the primordial gravitational wave background is considered to be the 'smoking-gun' evidence for inflation. While superhorizon waves are probed with cosmic microwave background (CMB) polarization, the relic background will be studied with laser interferometers. The long lever arm spanned by the two techniques improves constraints on the inflationary potential and validation of consistency relations expected under inflation. If gravitational waves with a tensor-to-scalar amplitude ratio greater than 0.01 are detected by the CMB, then a direct-detection experiment with a sensitivity consistent with current concept studies should be pursued vigorously. If no primordial tensors are detected by the CMB, a direct-detection experiment to understand the simplest form of inflation must have a sensitivity improved by two to 3 orders of magnitude over current plans

  13. A comparison of directed search target detection versus in-scene target detection in Worldview-2 datasets

    Science.gov (United States)

    Grossman, S.

    2015-05-01

    Since the events of September 11, 2001, the intelligence focus has moved from large order-of-battle targets to small targets of opportunity. Additionally, the business community has discovered the use of remotely sensed data to anticipate demand and derive data on their competition. This requires the finer spectral and spatial fidelity now available to recognize those targets. This work hypothesizes that directed searches using calibrated data perform at least as well as inscene manually intensive target detection searches. It uses calibrated Worldview-2 multispectral images with NEF generated signatures and standard detection algorithms to compare bespoke directed search capabilities against ENVI™ in-scene search capabilities. Multiple execution runs are performed at increasing thresholds to generate detection rates. These rates are plotted and statistically analyzed. While individual head-to-head comparison results vary, 88% of the directed searches performed at least as well as in-scene searches with 50% clearly outperforming in-scene methods. The results strongly support the premise that directed searches perform at least as well as comparable in-scene searches.

  14. Detailed Characterization of Nuclear Recoil Pulse Shape Discrimination in the DarkSide-50 Direct Dark Matter Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Edkins, Erin Elisabeth [Univ. of Hawaii, Honolulu, HI (United States)

    2017-05-01

    While evidence of non-baryonic dark matter has been accumulating for decades, its exact nature continues to remain a mystery. Weakly Interacting Massive Particles (WIMPs) are a well motivated candidate which appear in certain extensions of the Standard Model, independently of dark matter theory. If such particles exist, they should occasionally interact with particles of normal matter, producing a signal which may be detected. The DarkSide-50 direct dark matter experiment aims to detect the energy of recoiling argon atoms due to the elastic scattering of postulated WIMPs. In order to make such a discovery, a clear understanding of both the background and signal region is essential. This understanding requires a careful study of the detector's response to radioactive sources, which in turn requires such sources may be safely introduced into or near the detector volume and reliably removed. The CALibration Insertaion System (CALIS) was designed and built for this purpose in a j oint effort between Fermi National Laboratory and the University of Hawaii. This work describes the design and testing of CALIS, its installation and commissioning at the Laboratori Nazionali del Gran Sasso (LNGS) and the multiple calibration campaigns which have successfully employed it. As nuclear recoils produced by WIMPs are indistinguishable from those produced by neutrons, radiogenic neutrons are both the most dangerous class of background and a vital calibration source for the study of the potential WIMP signal. Prior to the calibration of DarkSide-50 with radioactive neutron sources, the acceptance region was determined by the extrapolation of nuclear recoil data from a separate, dedicated experiment, ScENE, which measured the distribution of the pulse shape discrimination parameter, $f_{90}$, for nuclear recoils of known energies. This work demonstrates the validity of the extrapolation of ScENE values to DarkSide-50, by direct comparison of the $f_{90}$ distributio n of nuclear

  15. Loop-induced dark matter direct detection signals from gamma-ray lines

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Haisch, Ulrich; Kahlhoefer, Felix

    2012-01-01

    Improved limits as well as tentative claims for dark matter annihilation into gamma-ray lines have been presented recently. We study the direct detection cross section induced from dark matter annihilation into two photons in a model-independent fashion, assuming no additional couplings between...... dark matter and nuclei. We find a striking non-standard recoil spectrum due to different destructively interfering contributions to the dark matter nucleus scattering cross section. While in the case of s-wave annihilation the current sensitivity of direct detection experiments is insufficient...... to compete with indirect detection searches, for p-wave annihilation the constraints from direct searches are comparable. This will allow to test dark matter scenarios with p-wave annihilation that predict a large di-photon annihilation cross section in the next generation of experiments....

  16. Effectiveness of direct and indirect radionuclide cystography in detecting vesicoureteral reflux

    International Nuclear Information System (INIS)

    Conway, J.J.; Kruglik, G.D.

    1976-01-01

    A modified of the direct radionuclide cystography technique to include filling, voiding, and postvoiding phases of the examination permitted a simulated comparison between direct and indirect radionuclide cystography. One hundred thirty-seven examples of reflux were documented with this technique. Of these, 96 instances of reflux (70 percent) were recorded during two or more phases and thus would have been detected by either technique. Twenty-nine examples (21 percent) were only detected during filling and thus would have been missed by the indirect radionuclide technique and by some roentgenographic techniques. Only 12 examples (9 percent) were detected during the voiding phase only. The modified direct method of radionuclide cystography, which continuously monitors the urinary tracts during filling, voiding, and postvoiding, is offered as the best current technique for assessing visicoureteral reflus

  17. Halo-independent direct detection of momentum-dependent dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Cherry, John F. [Theoretical Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Frandsen, Mads T.; Shoemaker, Ian M., E-mail: jcherry@lanl.gov, E-mail: frandsen@cp3-origins.net, E-mail: shoemaker@cp3-origins.net [CP3-Origins and the Danish Institute for Advanced Study, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark)

    2014-10-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be ∼< 10 MeV for DM in the 20-1000 GeV range in a halo-independent manner.

  18. Halo-independent direct detection of momentum-dependent dark matter

    International Nuclear Information System (INIS)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be ∼< 10 MeV for DM in the 20-1000 GeV range in a halo-independent manner

  19. Exploring the Cosmic Frontier, Task A - Direct Detection of Dark Matter, Task B - Experimental Particle Astrophysics

    International Nuclear Information System (INIS)

    Matthews, John A.J.; Gold, Michael S.

    2016-01-01

    This report summarizes the work of Task A and B for the period 2013-2016. For Task A the work is for direct detection of dark matter with the single-phase liquid argon experiment Mini-CLEAN. For Task B the work is for the search for new physics in the analysis of fluorescence events with the Auger experiment and for the search for the indirect detection of dark matter with the HAWC experiment.

  20. Exploring the Cosmic Frontier, Task A - Direct Detection of Dark Matter, Task B - Experimental Particle Astrophysics

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, John A.J. [Univ. of New Mexico, Albuquerque, NM (United States); Gold, Michael S. [Univ. of New Mexico, Albuquerque, NM (United States)

    2016-08-11

    This report summarizes the work of Task A and B for the period 2013-2016. For Task A the work is for direct detection of dark matter with the single-phase liquid argon experiment Mini-CLEAN. For Task B the work is for the search for new physics in the analysis of fluorescence events with the Auger experiment and for the search for the indirect detection of dark matter with the HAWC experiment.

  1. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    International Nuclear Information System (INIS)

    Garny, Mathias; Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan

    2012-01-01

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years

  2. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Garny, Mathias [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan [Technische Univ. Muenchen, Garching (Germany). Physik-Department

    2012-07-15

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  3. Indirect detection of dark matter with γ rays.

    Science.gov (United States)

    Funk, Stefan

    2015-10-06

    The details of what constitutes the majority of the mass that makes up dark matter in the Universe remains one of the prime puzzles of cosmology and particle physics today-80 y after the first observational indications. Today, it is widely accepted that dark matter exists and that it is very likely composed of elementary particles, which are weakly interacting and massive [weakly interacting massive particles (WIMPs)]. As important as dark matter is in our understanding of cosmology, the detection of these particles has thus far been elusive. Their primary properties such as mass and interaction cross sections are still unknown. Indirect detection searches for the products of WIMP annihilation or decay. This is generally done through observations of γ-ray photons or cosmic rays. Instruments such as the Fermi large-area telescope, high-energy stereoscopic system, major atmospheric gamma-ray imaging Cherenkov, and very energetic radiation imaging telescope array, combined with the future Cherenkov telescope array, will provide important complementarity to other search techniques. Given the expected sensitivities of all search techniques, we are at a stage where the WIMP scenario is facing stringent tests, and it can be expected that WIMPs will be either be detected or the scenario will be so severely constrained that it will have to be rethought. In this sense, we are on the threshold of discovery. In this article, I will give a general overview of the current status and future expectations for indirect searches of dark matter (WIMP) particles.

  4. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Science.gov (United States)

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Gene doping detection: evaluation of approach for direct detection of gene transfer using erythropoietin as a model system.

    Science.gov (United States)

    Baoutina, A; Coldham, T; Bains, G S; Emslie, K R

    2010-08-01

    As clinical gene therapy has progressed toward realizing its potential, concern over misuse of the technology to enhance performance in athletes is growing. Although 'gene doping' is banned by the World Anti-Doping Agency, its detection remains a major challenge. In this study, we developed a methodology for direct detection of the transferred genetic material and evaluated its feasibility for gene doping detection in blood samples from athletes. Using erythropoietin (EPO) as a model gene and a simple in vitro system, we developed real-time PCR assays that target sequences within the transgene complementary DNA corresponding to exon/exon junctions. As these junctions are absent in the endogenous gene due to their interruption by introns, the approach allows detection of trace amounts of a transgene in a large background of the endogenous gene. Two developed assays and one commercial gene expression assay for EPO were validated. On the basis of ability of these assays to selectively amplify transgenic DNA and analysis of literature on testing of gene transfer in preclinical and clinical gene therapy, it is concluded that the developed approach would potentially be suitable to detect gene doping through gene transfer by analysis of small volumes of blood using regular out-of-competition testing.

  6. A performance comparison of direct- and indirect-detection flat-panel imagers

    International Nuclear Information System (INIS)

    Partridge, M.; Hesse, B.-M.; Mueller, L.

    2002-01-01

    A comparison of the performance of a direct- and an indirect-detection amorphous silicon flat-panel X-ray imager is presented for a 6 MV beam. Experimental measurements of the noise characteristics, image lag, spectral response, spatial resolution and quantum efficiency are described, compared and discussed. The two systems are comprised of 512x512 pixel, 400 μm pitch, arrays of a-Si:H p-i-n photodiodes and thin-film transistors. In the direct-detection system, X-rays interact to produce electron/hole pairs directly in the silicon photodiodes. For the indirect-detection system, a phosphor screen converts energy from the incident X-rays into visible light, which is then detected by the photodiodes. Both systems are shown to be quantum noise limited, with the total electronic noise in the detector 10-15 times smaller than the Poisson noise level in detected signal. The measured lag for both systems is 1.0±0.1% or less in the first frame with subsequent signals decaying exponentially with frame read-out, with a half-life of between 3.3 and 3.8 frames. Both systems are demonstrated to have a pronounced sensitivity to low-energy multiply scattered photons, although this is shown to be effectively filtered out using a 2 mm copper build-up plate. The direct-detection system, with the 2 mm Cu build-up, shows greater sensitivity to scattered radiation than the indirect system. The spatial resolutions of both systems were effectively equal with an f 50 of 0.25 mm -1 when pixels are binned 2x2, although a slight contribution from optical scattering in the phosphor screen is seen for the indirect-detection system. The quantum efficiency of the direct-detection system is a factor of 0.45 lower than that of the indirect-detection system. The application of these detectors to megavoltage CT is discussed, with the conclusion that the indirect-detection system is to be preferred

  7. Direct biosensor immunoassays for the detection of nonmilk proteins in milk powder

    NARCIS (Netherlands)

    Haasnoot, W.; Olieman, K.; Cazemier, G.; Verheijen, R.

    2001-01-01

    The low prices of some nonmilk proteins make them attractive as potential adulterants in dairy products. An optical biosensor (BIACORE 3000) was used to develop a direct and combined biosensor immunoassay (BIA) for the simultaneous detection of soy, pea, and soluble wheat proteins in milk powders.

  8. 16-level differential phase shift keying (D16PSK) in direct detection optical communication systems

    DEFF Research Database (Denmark)

    Sambaraju, R.; Tokle, Torger; Jensen, J.B.

    2006-01-01

    Optical 16-level differential phase shift keying (D16PSK) carrying four bits for every symbol is proposed for direct detection optical communication systems. Transmitter and receiver schematics are presented, and the receiver sensitivity is discussed. We numerically investigate the impact...

  9. Interplay and Characterization of Dark Matter Searches at Colliders and in Direct Detection Experiments

    CERN Document Server

    Malik, Sarah A.; Araujo, Henrique; Belyaev, A.; Bœhm, Céline; Brooke, Jim; Buchmueller, Oliver; Davies, Gavin; De Roeck, Albert; de Vries, Kees; Dolan, Matthew J.; Ellis, John; Fairbairn, Malcolm; Flaecher, Henning; Gouskos, Loukas; Khoze, Valentin V.; Landsberg, Greg; Newbold, Dave; Papucci, Michele; Sumner, Timothy; Thomas, Marc; Worm, Steven

    2015-01-01

    In this White Paper we present and discuss a concrete proposal for the consistent interpretation of Dark Matter searches at colliders and in direct detection experiments. Based on a specific implementation of simplified models of vector and axial-vector mediator exchanges, this proposal demonstrates how the two search strategies can be compared on an equal footing.

  10. Signatures of Earth-scattering in the direct detection of Dark Matter

    DEFF Research Database (Denmark)

    Kavanagh, Bradley J.; Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation...

  11. Direct detection of dark matter in models with a light Z'

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Sarkar, Subir

    2011-01-01

    We discuss the direct detection signatures of dark matter interacting with nuclei via a Z' mediator, focussing on the case where both the dark matter and the $Z'$ have mass of a few GeV. Isospin violation (i.e. different couplings to protons and neutrons) arises naturally in this scenario...

  12. A performance comparison of direct- and indirect-detection flat-panel imagers

    CERN Document Server

    Partridge, M; Müller, L

    2002-01-01

    A comparison of the performance of a direct- and an indirect-detection amorphous silicon flat-panel X-ray imager is presented for a 6 MV beam. Experimental measurements of the noise characteristics, image lag, spectral response, spatial resolution and quantum efficiency are described, compared and discussed. The two systems are comprised of 512x512 pixel, 400 mu m pitch, arrays of a-Si:H p-i-n photodiodes and thin-film transistors. In the direct-detection system, X-rays interact to produce electron/hole pairs directly in the silicon photodiodes. For the indirect-detection system, a phosphor screen converts energy from the incident X-rays into visible light, which is then detected by the photodiodes. Both systems are shown to be quantum noise limited, with the total electronic noise in the detector 10-15 times smaller than the Poisson noise level in detected signal. The measured lag for both systems is 1.0+-0.1% or less in the first frame with subsequent signals decaying exponentially with frame read-out, with...

  13. Direct 13C-detected NMR experiments for mapping and characterization of hydrogen bonds in RNA

    International Nuclear Information System (INIS)

    Fürtig, Boris; Schnieders, Robbin; Richter, Christian; Zetzsche, Heidi; Keyhani, Sara; Helmling, Christina; Kovacs, Helena; Schwalbe, Harald

    2016-01-01

    In RNA secondary structure determination, it is essential to determine whether a nucleotide is base-paired and not. Base-pairing of nucleotides is mediated by hydrogen bonds. The NMR characterization of hydrogen bonds relies on experiments correlating the NMR resonances of exchangeable protons and can be best performed for structured parts of the RNA, where labile hydrogen atoms are protected from solvent exchange. Functionally important regions in RNA, however, frequently reveal increased dynamic disorder which often leads to NMR signals of exchangeable protons that are broadened beyond 1 H detection. Here, we develop 13 C direct detected experiments to observe all nucleotides in RNA irrespective of whether they are involved in hydrogen bonds or not. Exploiting the self-decoupling of scalar couplings due to the exchange process, the hydrogen bonding behavior of the hydrogen bond donor of each individual nucleotide can be determined. Furthermore, the adaption of HNN-COSY experiments for 13 C direct detection allows correlations of donor–acceptor pairs and the localization of hydrogen-bond acceptor nucleotides. The proposed 13 C direct detected experiments therefore provide information about molecular sites not amenable by conventional proton-detected methods. Such information makes the RNA secondary structure determination by NMR more accurate and helps to validate secondary structure predictions based on bioinformatics.

  14. Anti-impulse-noise Edge Detection via Anisotropic Morphological Directional Derivatives.

    Science.gov (United States)

    Shui, Peng-Lang; Wang, Fu-Ping

    2017-07-13

    Traditional differential-based edge detection suffers from abrupt degradation in performance when images are corrupted by impulse noises. The morphological operators such as the median filters and weighted median filters possess the intrinsic ability to counteract impulse noise. In this paper, by combining the biwindow configuration with weighted median filters, anisotropic morphological directional derivatives (AMDD) robust to impulse noise are proposed to measure the local grayscale variation around a pixel. For ideal step edges, the AMDD spatial response and directional representation are derived. The characteristics and edge resolution of two kinds of typical biwindows are analyzed thoroughly. In terms of the AMDD spatial response and directional representation of ideal step edges, the spatial matched filter is used to extract the edge strength map (ESM) from the AMDDs of an image. The spatial and directional matched filters are used to extract the edge direction map (EDM). Embedding the extracted ESM and EDM into the standard route of the differential-based edge detection, an anti-impulse-noise AMDD-based edge detector is constructed. It is compared with the existing state-of-the-art detectors on a recognized image dataset for edge detection evaluation. The results show that it attains competitive performance in noise-free and Gaussian noise cases and the best performance in impulse noise cases.

  15. Detection of directional eye movements based on the electrooculogram signals through an artificial neural network

    International Nuclear Information System (INIS)

    Erkaymaz, Hande; Ozer, Mahmut; Orak, İlhami Muharrem

    2015-01-01

    The electrooculogram signals are very important at extracting information about detection of directional eye movements. Therefore, in this study, we propose a new intelligent detection model involving an artificial neural network for the eye movements based on the electrooculogram signals. In addition to conventional eye movements, our model also involves the detection of tic and blinking of an eye. We extract only two features from the electrooculogram signals, and use them as inputs for a feed-forwarded artificial neural network. We develop a new approach to compute these two features, which we call it as a movement range. The results suggest that the proposed model have a potential to become a new tool to determine the directional eye movements accurately

  16. Direct detection of OTA by impedimetric aptasensor based on modified polypyrrole-dendrimers

    Energy Technology Data Exchange (ETDEWEB)

    Mejri-Omrani, Nawel [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Miodek, Anna; Zribi, Becem [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); Marrakchi, Mouna [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Université de Tunis El Manar, Higher Institute of Applied Biological Sciences (ISSBAT), 1006 Tunis (Tunisia); Hamdi, Moktar [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Marty, Jean-Louis [BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Korri-Youssoufi, Hafsa, E-mail: hafsa.korri-youssoufi@u-psud.fr [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France)

    2016-05-12

    Ochratoxin A (OTA) is a carcinogenic mycotoxin that contaminates food such as cereals, wine and beer; therefore it represents a risk for human health. Consequently, the allowed concentration of OTA in food is regulated by governmental organizations and its detection is of major agronomical interest. In the current study we report the development of an electrochemical aptasensor able to directly detect trace OTA without any amplification procedure. This aptasensor was constructed by coating the surface of a gold electrode with a film layer of modified polypyrrole (PPy), which was thereafter covalently bound to polyamidoamine dendrimers of the fourth generation (PAMAM G4). Finally, DNA aptamers that specifically binds OTA were covalently bound to the PAMAM G4 providing the aptasensor, which was characterized by using both Atomic Force Microscopy (AFM) and Surface Plasmon Resonance (SPR) techniques. The study of OTA detection by the constructed electrochemical aptasensor was performed using Electrochemical Impedance Spectroscopy (EIS) and revealed that the presence of OTA led to the modification of the electrical properties of the PPy layer. These modifications could be assigned to conformational changes in the folding of the aptamers upon specific binding of OTA. The aptasensor had a dynamic range of up to 5 μg L{sup −1} of OTA and a detection limit of 2 ng L{sup −1} of OTA, which is below the OTA concentration allowed in food by the European regulations. The efficient detection of OTA by this electrochemical aptasensor provides an unforeseen platform that could be used for the detection of various small molecules through specific aptamer association. - Highlights: • Development of innovative platform for direct and ultra-sensitive toxins detection. • Aptasensor based on modified conductive polypyrrole layer. • We demonstrate the conformation change of aptamer upon toxin binding. • We highlight that detection was obtained by modification of charge of

  17. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    Energy Technology Data Exchange (ETDEWEB)

    Caballero, David, E-mail: caballero@unistra.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Martinez, Elena [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Bausells, Joan [Centre Nacional de Microelectronica (CNM-IMB), CSIC, Campus UAB, 08193 Bellaterra (Spain); Errachid, Abdelhamid, E-mail: abdelhamid.errachid-el-salhi@univ-lyon1.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Universite Claude Bernard - Lyon 1, LSA - UMR 5180, 43 Bd du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Samitier, Josep [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. Black-Right-Pointing-Pointer Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. Black-Right-Pointing-Pointer Silicon nitride offers multiple advantages compared to other common materials. Black-Right-Pointing-Pointer The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si{sub 3}N{sub 4}) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si{sub 3}N{sub 4}-based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO{sub 2}/Si{sub 3}N{sub 4} structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10{sup -13}-10{sup -7} M were detected, showing a sensitivity of 0.128 {Omega} {mu}M{sup -1} and a limit of detection of 10{sup -14} M. The specificity of the sensor was also addressed by studying the

  18. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    International Nuclear Information System (INIS)

    Caballero, David; Martinez, Elena; Bausells, Joan; Errachid, Abdelhamid; Samitier, Josep

    2012-01-01

    Highlights: ► An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. ► Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. ► Silicon nitride offers multiple advantages compared to other common materials. ► The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si 3 N 4 ) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si 3 N 4 -based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO 2 /Si 3 N 4 structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10 −13 –10 −7 M were detected, showing a sensitivity of 0.128 Ω μM −1 and a limit of detection of 10 −14 M. The specificity of the sensor was also addressed by studying the interferences with a similar protein, bovine serum albumin. The results obtained show that the antibodies were efficiently immobilized and the proteins

  19. Performance of a direct detection camera for off-axis electron holography

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Shery L.Y., E-mail: shery.chang@asu.edu [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); LeRoy Eyring Center for Solid State Science, Arizona State University, Tempe, AZ 85287 (United States); Dwyer, Christian [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Department of Physics, Arizona State University, Tempe, AZ 85287 (United States); Barthel, Juri; Boothroyd, Chris B.; Dunin-Borkowski, Rafal E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany)

    2016-02-15

    The performance of a direct detection camera (DDC) is evaluated in the context of off-axis electron holographic experiments in a transmission electron microscope. Its performance is also compared directly with that of a conventional charge-coupled device (CCD) camera. The DDC evaluated here can be operated either by the detection of individual electron events (counting mode) or by the effective integration of many such events during a given exposure time (linear mode). It is demonstrated that the improved modulation transfer functions and detective quantum efficiencies of both modes of the DDC give rise to significant benefits over the conventional CCD cameras, specifically, a significant improvement in the visibility of the holographic fringes and a reduction of the statistical error in the phase of the reconstructed electron wave function. The DDC's linear mode, which can handle higher dose rates, allows optimisation of the dose rate to achieve the best phase resolution for a wide variety of experimental conditions. For suitable conditions, the counting mode can potentially utilise a significantly lower dose to achieve a phase resolution that is comparable to that achieved using the linear mode. The use of multiple holograms and correlation techniques to increase the total dose in counting mode is also demonstrated. - Highlights: • Performance of a direct detection camera for off-axis electron holography has been evaluated. • Better holographic fringe visibility and phase resolution are achieved using DDC. • Both counting and linear modes offered by DDC are advantageous for different dose regimes.

  20. Performance of a direct detection camera for off-axis electron holography

    International Nuclear Information System (INIS)

    Chang, Shery L.Y.; Dwyer, Christian; Barthel, Juri; Boothroyd, Chris B.; Dunin-Borkowski, Rafal E.

    2016-01-01

    The performance of a direct detection camera (DDC) is evaluated in the context of off-axis electron holographic experiments in a transmission electron microscope. Its performance is also compared directly with that of a conventional charge-coupled device (CCD) camera. The DDC evaluated here can be operated either by the detection of individual electron events (counting mode) or by the effective integration of many such events during a given exposure time (linear mode). It is demonstrated that the improved modulation transfer functions and detective quantum efficiencies of both modes of the DDC give rise to significant benefits over the conventional CCD cameras, specifically, a significant improvement in the visibility of the holographic fringes and a reduction of the statistical error in the phase of the reconstructed electron wave function. The DDC's linear mode, which can handle higher dose rates, allows optimisation of the dose rate to achieve the best phase resolution for a wide variety of experimental conditions. For suitable conditions, the counting mode can potentially utilise a significantly lower dose to achieve a phase resolution that is comparable to that achieved using the linear mode. The use of multiple holograms and correlation techniques to increase the total dose in counting mode is also demonstrated. - Highlights: • Performance of a direct detection camera for off-axis electron holography has been evaluated. • Better holographic fringe visibility and phase resolution are achieved using DDC. • Both counting and linear modes offered by DDC are advantageous for different dose regimes.

  1. A comparison of photographic, replication and direct clinical examination methods for detecting developmental defects of enamel

    Directory of Open Access Journals (Sweden)

    Pakshir Hamid-Reza

    2011-04-01

    Full Text Available Abstract Background Different methods have been used for detecting developmental defects of enamel (DDE. This study aimed to compare photographic and replication methods with the direct clinical examination method for detecting DDE in children's permanent incisors. Methods 110 8-10-year-old schoolchildren were randomly selected from an examined sample of 335 primary Shiraz school children. Modified DDE index was used in all three methods. Direct examinations were conducted by two calibrated examiners using flat oral mirrors and tongue blades. Photographs were taken using a digital SLR camera (Nikon D-80, macro lens, macro flashes, and matt flash filters. Impressions were taken using additional-curing silicon material and casts made in orthodontic stone. Impressions and models were both assessed using dental loupes (magnification=x3.5. Each photograph/impression/cast was assessed by two calibrated examiners. Reliability of methods was assessed using kappa agreement tests. Kappa agreement, McNemar's and two-sample proportion tests were used to compare results obtained by the photographic and replication methods with those obtained by the direct examination method. Results Of the 110 invited children, 90 were photographed and 73 had impressions taken. The photographic method had higher reliability levels than the other two methods, and compared to the direct clinical examination detected significantly more subjects with DDE (P = 0.002, 3.1 times more DDE (P Conclusion The photographic method was much more sensitive than direct clinical examination in detecting DDE and was the best of the three methods for epidemiological studies. The replication method provided less information about DDE compared to photography. Results of this study have implications for both epidemiological and detailed clinical studies on DDE.

  2. Direct electrochemistry of glucose oxidase assembled on graphene and application to glucose detection

    International Nuclear Information System (INIS)

    Wu Ping; Shao Qian; Hu Yaojuan; Jin Juan; Yin Yajing; Zhang Hui; Cai Chenxin

    2010-01-01

    The direct electrochemistry of glucose oxidase (GOx) integrated with graphene was investigated. The voltammetric results indicated that GOx assembled on graphene retained its native structure and bioactivity, exhibited a surface-confined process, and underwent effective direct electron transfer (DET) reaction with an apparent rate constant (k s ) of 2.68 s -1 . This work also developed a novel approach for glucose detection based on the electrocatalytic reduction of oxygen at the GOx-graphene/GC electrode. The assembled GOx could electrocatalyze the reduction of dissolved oxygen. Upon the addition of glucose, the reduction current decreased, which could be used for glucose detection with a high sensitivity (ca. 110 ± 3 μA mM -1 cm -2 ), a wide linear range (0.1-10 mM), and a low detection limit (10 ± 2 μM). The developed approach can efficiently exclude the interference of commonly coexisting electroactive species due to the use of a low detection potential (-470 mV, versus SCE). Therefore, this study has not only successfully achieved DET reaction of GOx assembled on graphene, but also established a novel approach for glucose detection and provided a general route for fabricating graphene-based biosensing platform via assembling enzymes/proteins on graphene surface.

  3. Image covariance and lesion detectability in direct fan-beam x-ray computed tomography.

    Science.gov (United States)

    Wunderlich, Adam; Noo, Frédéric

    2008-05-21

    We consider noise in computed tomography images that are reconstructed using the classical direct fan-beam filtered backprojection algorithm, from both full- and short-scan data. A new, accurate method for computing image covariance is presented. The utility of the new covariance method is demonstrated by its application to the implementation of a channelized Hotelling observer for a lesion detection task. Results from the new covariance method and its application to the channelized Hotelling observer are compared with results from Monte Carlo simulations. In addition, the impact of a bowtie filter and x-ray tube current modulation on reconstruction noise and lesion detectability are explored for full-scan reconstruction.

  4. Direct detection of light dark matter and solar neutrinos via color center production in crystals

    OpenAIRE

    Budnik, Ranny; Cheshnovsky, Ori; Slone, Oren; Volansky, Tomer

    2018-01-01

    We propose a new low-threshold direct-detection concept for dark matter and for coherent nuclear scattering of solar neutrinos, based on the dissociation of atoms and subsequent creation of color center type defects within a lattice. The novelty in our approach lies in its ability to detect single defects in a macroscopic bulk of material. This class of experiments features ultra-low energy thresholds which allows for the probing of dark matter as light as O(10) MeV through nuclear scattering...

  5. Image covariance and lesion detectability in direct fan-beam x-ray computed tomography

    International Nuclear Information System (INIS)

    Wunderlich, Adam; Noo, Frederic

    2008-01-01

    We consider noise in computed tomography images that are reconstructed using the classical direct fan-beam filtered backprojection algorithm, from both full- and short-scan data. A new, accurate method for computing image covariance is presented. The utility of the new covariance method is demonstrated by its application to the implementation of a channelized Hotelling observer for a lesion detection task. Results from the new covariance method and its application to the channelized Hotelling observer are compared with results from Monte Carlo simulations. In addition, the impact of a bowtie filter and x-ray tube current modulation on reconstruction noise and lesion detectability are explored for full-scan reconstruction

  6. Direct SUSY dark matter detection-theoretical rates due to the spin

    International Nuclear Information System (INIS)

    Vergados, J D

    2004-01-01

    The recent WMAP data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Thus direct dark matter detection, consisting of detecting the recoiling nucleus, is central to particle physics and cosmology. Supersymmetry provides a natural dark matter candidate, the lightest supersymmetric particle (LSP). The relevant cross sections arise out of two mechanisms: (i) the coherent mode, due to the scalar interaction and (ii) the spin contribution arising from the axial current. In this paper we will focus on the spin contribution, which is expected to dominate for light targets. For both modes it is possible to obtain detectable rates, but in most models the expected rates are much lower than the present experimental goals. So one should exploit two characteristic signatures of the reaction, namely the modulation effect and in directional experiments the correlation of the event rates with the sun's motion. In standard non-directional experiments the modulation is small, less than 2 per cent. In the case of the directional event rates we would like to suggest that the experiments exploit two features of the process, which are essentially independent of the SUSY model employed, namely: (1) the forward-backward asymmetry, with respect to the sun's direction of motion, is very large and (2) the modulation is much larger, especially if the observation is made in a plane perpendicular to the sun's velocity. In this case the difference between maximum and minimum can be larger than 40 per cent and the phase of the earth at the maximum is direction dependent

  7. Precision measurements, dark matter direct detection and LHC Higgs searches in a constrained NMSSM

    International Nuclear Information System (INIS)

    Bélanger, G.; Hugonie, C.; Pukhov, A.

    2009-01-01

    We reexamine the constrained version of the Next-to-Minimal Supersymmetric Standard Model with semi universal parameters at the GUT scale (CNMSSM). We include constraints from collider searches for Higgs and susy particles, upper bound on the relic density of dark matter, measurements of the muon anomalous magnetic moment and of B-physics observables as well as direct searches for dark matter. We then study the prospects for direct detection of dark matter in large scale detectors and comment on the prospects for discovery of heavy Higgs states at the LHC

  8. Search for non-baryonic dark matter with cryogenic detectors based on ionisation and heat detection. Analysis of experimental data from the Edelweiss-I experiment

    International Nuclear Information System (INIS)

    Sanglard, V.

    2005-11-01

    The method of direct detection of WIMPs (weakly interactive massive particles) that are present in the halo of our galaxy rests on the detection of their interaction with a target nucleus. The Edelweiss experiment uses this technique with 3 cryogenic detectors operating on 2 modes ionization and heat. Each detector is made of a 320 g germanium crystal with 2 faces equipped with electrodes. In order to improve the collection of charges, an amorphous layer of Ge or Si is laid between the crystal surface and the electrodes. The validation of the detector system has been made with Co 57 and Cs 137 gamma sources and a Cf 252 neutron source. We present a comparison with simulation results and experimental data for the validation of the response to nuclear recoils. The whole experimental data collected by Edelweiss-I from 2000 till 2003 has been analysed. 40 events have been selected, 6 among them with an energy over 30 keV. Limits for the interaction cross-section between a WIMP and a nucleon have been deduced from the experimental data. The Yellin method has enabled us to determine a limit without knowing the background noise. The best sensitivity appears to be 1.5*10 -6 pb for a WIMP's mass of 80 GeV/c 2 and a confidence level of 90 per cent. In terms of events, the limit for an energy range of 30 - 100 keV is 0.12 events per kg and per day. (A.C.)

  9. Direct detection of saponins in crude extracts of soapnuts by FTIR.

    Science.gov (United States)

    Almutairi, Meshari Saad; Ali, Muhammad

    2015-01-01

    Direct detection of saponins in soapnuts (Sapindus mukorossi) using Fourier transform infrared (FTIR) spectroscopy is investigated in this project. Potassium bromide powder was mixed with extracted powder of soapnuts and compressed to a thin pellet for examination process. The outcome of the FTIR spectra of saponin demonstrated characteristic triterpenoid saponin absorptions of OH, C = O, C-H, and C = C, while the glycoside linkages to the sapogenins were indicated by the absorptions of C-O. The significance of this study is that saponin absorption peaks are directly detectable in crude aqueous and 95% ethanol extracts of soapnuts powder using FTIR spectroscopy, thereby eliminating the need of further expensive and exhaustive purification steps. The extracts of soapnuts were screened for saponins along with controls by phytochemical tests, and advanced spectroscopic techniques such as ultra fast liquid chromatography and ultra performance liquid chromatography quadrupole-time of flight-mass spectrometry were also implemented to validate the saponins.

  10. Analyzing of singlet fermionic dark matter via the updated direct detection data

    Energy Technology Data Exchange (ETDEWEB)

    Ettefaghi, M.M.; Moazzemi, R. [University of Qom, Department of Physics, Qom (Iran, Islamic Republic of)

    2017-05-15

    We revisit the parameter space of singlet fermionic cold dark matter model in order to determine the role of the mixing angle between the standard model Higgs and a new singlet one. Furthermore, we restudy the direct detection constraints with the updated and new experimental data. As an important conclusion, this model is completely excluded by recent XENON100, PandaX II and LUX data. (orig.)

  11. Simplified dark matter models with charged mediators: prospects for direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Sandick, Pearl; Sinha, Kuver; Teng, Fei [Department of Physics and Astronomy, University of Utah,Salt Lake City, UT 84112 (United States)

    2016-10-05

    We consider direct detection prospects for a class of simplified models of fermionic dark matter (DM) coupled to left and right-handed Standard Model fermions via two charged scalar mediators with arbitrary mixing angle α. DM interactions with the nucleus are mediated by higher electromagnetic moments, which, for Majorana DM, is the anapole moment. After giving a full analytic calculation of the anapole moment, including its α dependence, and matching with limits in the literature, we compute the DM-nucleon scattering cross-section and show the LUX and future LZ constraints on the parameter space of these models. We then compare these results with constraints coming from Fermi-LAT continuum and line searches. Results in the supersymmetric limit of these simplified models are provided in all cases. We find that future direct detection experiments will be able to probe most of the parameter space of these models for O(100−200) GeV DM and lightest mediator mass ≲O(5%) larger than the DM mass. The direct detection prospects dwindle for larger DM mass and larger mass gap between the DM and the lightest mediator mass, although appreciable regions are still probed for O(200) GeV DM and lightest mediator mass ≲O(20%) larger than the DM mass. The direct detection bounds are also attenuated near certain “blind spots' in the parameter space, where the anapole moment is severely suppressed due to cancellation of different terms. We carefully study these blind spots and the associated Fermi-LAT signals in these regions.

  12. Horizontal Directional Drilling-Length Detection Technology While Drilling Based on Bi-Electro-Magnetic Sensing

    Directory of Open Access Journals (Sweden)

    Yudan Wang

    2017-04-01

    Full Text Available The drilling length is an important parameter in the process of horizontal directional drilling (HDD exploration and recovery, but there has been a lack of accurate, automatically obtained statistics regarding this parameter. Herein, a technique for real-time HDD length detection and a management system based on the electromagnetic detection method with a microprocessor and two magnetoresistive sensors employing the software LabVIEW are proposed. The basic principle is to detect the change in the magnetic-field strength near a current coil while the drill stem and drill-stem joint successively pass through the current coil forward or backward. The detection system consists of a hardware subsystem and a software subsystem. The hardware subsystem employs a single-chip microprocessor as the main controller. A current coil is installed in front of the clamping unit, and two magneto resistive sensors are installed on the sides of the coil symmetrically and perpendicular to the direction of movement of the drill pipe. Their responses are used to judge whether the drill-stem joint is passing through the clamping unit; then, the order of their responses is used to judge the movement direction. The software subsystem is composed of a visual software running on the host computer and a software running in the slave microprocessor. The host-computer software processes, displays, and saves the drilling-length data, whereas the slave microprocessor software operates the hardware system. A combined test demonstrated the feasibility of the entire drilling-length detection system.

  13. Direct and indirect fluorescent detection of tetracyclines using dually emitting carbon dots

    International Nuclear Information System (INIS)

    Qu, Fei; Sun, Zhe; Liu, Dongya; Zhao, Xianen; You, Jinmao

    2016-01-01

    The authors describe dual-emission carbon nanodots containing blue emitters (BE; peak emission at 385 nm under 315 nm excitation) and yellow emitters (YE; peak emission at 530 nm under 365 nm excitation), and how they can be applied to direct and indirect determination of tetracyclines (TCs). The direct detection scheme is based on the finding that tetracycline (TET), oxytetracycline, chlortetracycline and doxycycline quench the two emissions of the carbon dots. While direct determination is rapid and convenient, it cannot differentiate between TCs. The indirect detection scheme, in contrast, is based on the finding that Al (III) ions enhance the fluorescence of the YE in the carbon dots, and that they cause a blue shift in emission. It is, however, known that TET forms a strong complex with Al (III), and this can inhibit the interaction between Al (III) and the YE, so that the fluorescence of YE is not enhanced and blue-shifted by Al (III) in the presence of TET. This finding is exploited in a fluorescence turn-on/off assay for TET that can distinguish TET from other TCs. The linear range of indirect determination for TET extends from 1 nM to 30 μM, and the limit of detection is 0.52 nM. The indirect method was successfully applied to the determination of TET in spiked milk, fish and pork, and recoveries ranged from 91.7 to 102 %. (author)

  14. You can hide but you have to run: direct detection with vector mediators

    Energy Technology Data Exchange (ETDEWEB)

    D’Eramo, Francesco [Department of Physics, University of California Santa Cruz,1156 High St., Santa Cruz, CA 95064 (United States); Santa Cruz Institute for Particle Physics,1156 High St., Santa Cruz, CA 95064 (United States); Kavanagh, Bradley J. [Laboratoire de Physique Théorique et Hautes Energies, CNRS, UMR 7589,4 Place Jussieu, F-75252, Paris (France); Institut de Physique Théorique, Université Paris Saclay, CNRS, CEA,Orme des Merisiers batiment 774, F-91191 Gif-sur-Yvette Cedex (France); Panci, Paolo [Institut d’Astrophysique de Paris, UMR 7095 CNRS, Université Pierre et Marie Curie,98 bis Boulevard Arago, Paris 75014 (France)

    2016-08-18

    We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running. In some cases the inclusion of these effects changes the bounds by several orders of magnitude, as a consequence of operator mixing which generates new interactions at low energy. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Finally, we provide tools to facilitate the inclusion of these effects in future studies: general approximate expressions for the low energy couplings and a public code runDM to evolve the couplings between arbitrary energy scales.

  15. Limits on the Spin-Dependent WIMP-Nucleon Cross Sections from the First Science Run of the ZEPLIN-III Experiment

    International Nuclear Information System (INIS)

    Lebedenko, V. N.; Bewick, A.; Currie, A.; Davidge, D.; Dawson, J.; Horn, M.; Howard, A. S.; Jones, W. G.; Joshi, M.; Liubarsky, I.; Lyons, K.; Quenby, J. J.; Sumner, T. J.; Thorne, C.; Walker, R. J.; Araujo, H. M.; Edwards, B.; Barnes, E. J.; Ghag, C.; Murphy, A. StJ.

    2009-01-01

    We present new experimental constraints on the WIMP-nucleon spin-dependent elastic cross sections using data from the first science run of ZEPLIN-III, a two-phase xenon experiment searching for galactic dark matter weakly interacting massive particles based at the Boulby mine. Analysis of ∼450 kg·days fiducial exposure allow us to place a 90%-confidence upper limit on the pure WIMP-neutron cross section of σ n =1.9x10 -2 pb at 55 GeV/c 2 WIMP mass. Recent calculations of the nuclear spin structure based on the Bonn charge-dependent nucleon-nucleon potential were used for the odd-neutron isotopes 129 Xe and 131 Xe. These indicate that the sensitivity of xenon targets to the spin-dependent WIMP-proton interaction could be much lower than implied by previous calculations, whereas the WIMP-neutron sensitivity is impaired only by a factor of ∼2.

  16. From superWIMPs to decaying dark matter. Models, bounds and indirect searches

    Energy Technology Data Exchange (ETDEWEB)

    Weniger, Christoph

    2010-06-15

    Despite lots of observational and theoretical efforts, the particle nature of dark matter remains unknown. Beyond the paradigmatic WIMPs (Weakly Interacting Massive Particles), many theoretically well motivated models exist where dark matter interacts much more weakly than electroweak with Standard Model particles. In this case new phenomena occur, like the decay of dark matter or the interference with the standard cosmology of the early Universe. In this thesis we study some of these aspects of superweakly coupled dark matter in general, and in the special case of hidden U(1){sub X} gauginos that kinetically mix with hypercharge. There, we will assume that the gauge group remains unbroken, similar to the Standard Model U(1){sub em}. We study different kinds of cosmological bounds, including bounds from thermal overproduction, from primordial nucleosynthesis and from structure formation. Furthermore, we study the possible cosmic-ray signatures predicted by this scenario, with emphasis on the electron and positron channel in light of the recent observations by PAMELA and Fermi LAT. Moreover we study the cosmic-ray signatures of decaying dark matter independently of concrete particle-physics models. In particular we analyze in how far the rise in the positron fraction above 10 GeV, as observed by PAMELA, can be explained by dark matter decay. Lastly, we concentrate on related predictions for gamma-ray observations with the Fermi LAT, and propose to use the dipole-like anisotropy of the prompt gamma-ray dark matter signal to distinguish exotic dark matter contributions from the extragalactic gamma-ray background. (orig.)

  17. From superWIMPs to decaying dark matter. Models, bounds and indirect searches

    International Nuclear Information System (INIS)

    Weniger, Christoph

    2010-06-01

    Despite lots of observational and theoretical efforts, the particle nature of dark matter remains unknown. Beyond the paradigmatic WIMPs (Weakly Interacting Massive Particles), many theoretically well motivated models exist where dark matter interacts much more weakly than electroweak with Standard Model particles. In this case new phenomena occur, like the decay of dark matter or the interference with the standard cosmology of the early Universe. In this thesis we study some of these aspects of superweakly coupled dark matter in general, and in the special case of hidden U(1) X gauginos that kinetically mix with hypercharge. There, we will assume that the gauge group remains unbroken, similar to the Standard Model U(1) em . We study different kinds of cosmological bounds, including bounds from thermal overproduction, from primordial nucleosynthesis and from structure formation. Furthermore, we study the possible cosmic-ray signatures predicted by this scenario, with emphasis on the electron and positron channel in light of the recent observations by PAMELA and Fermi LAT. Moreover we study the cosmic-ray signatures of decaying dark matter independently of concrete particle-physics models. In particular we analyze in how far the rise in the positron fraction above 10 GeV, as observed by PAMELA, can be explained by dark matter decay. Lastly, we concentrate on related predictions for gamma-ray observations with the Fermi LAT, and propose to use the dipole-like anisotropy of the prompt gamma-ray dark matter signal to distinguish exotic dark matter contributions from the extragalactic gamma-ray background. (orig.)

  18. Detection of Low Molecular Weight Adulterants in Beverages by Direct Analysis in Real Time Mass Spectrometry.

    Science.gov (United States)

    Sisco, Edward; Dake, Jeffrey

    2016-04-14

    Direct Analysis in Real Time Mass Spectrometry (DART-MS) has been used to detect the presence of non-narcotic adulterants in beverages. The non-narcotic adulterants that were examined in this work incorporated a number low molecular weight alcohols, acetone, ammonium hydroxide, and sodium hypochlorite. Analysis of the adulterants was completed by pipetting 1 µL deposits onto glass microcapillaries along with an appropriate dopant species followed by introduction into the DART gas stream. It was found that detection of these compounds in the complex matrices of common beverages (soda, energy drinks, etc.) was simplified through the use of a dopant species to allow for adduct formation with the desired compound(s) of interest. Other parameters that were investigated included DART gas stream temperature, in source collision induced dissociation, ion polarity, and DART needle voltage. Sensitivities of the technique were found to range from 0.001 % volume fraction to 0.1 % volume fraction, comparable to traditional analyses completed using headspace gas chromatography mass spectrometry (HS-GC/MS). Once a method was established using aqueous solutions, , fifteen beverages were spiked with each of the nine adulterants, to simulate real world detection, and in nearly all cases the adulterant could be detected either in pure form, or complexed with the added dopant species. This technique provides a rapid way to directly analyze beverages believed to be contaminated with non-narcotic adulterants at sensitivities similar to or exceeding those of traditional confirmatory analyses.

  19. Direct Electrical Detection of Iodine Gas by a Novel Metal-Organic-Framework-Based Sensor.

    Science.gov (United States)

    Small, Leo J; Nenoff, Tina M

    2017-12-27

    High-fidelity detection of iodine species is of utmost importance to the safety of the population in cases of nuclear accidents or advanced nuclear fuel reprocessing. Herein, we describe the success at using impedance spectroscopy to directly detect the real-time adsorption of I 2 by a metal-organic framework zeolitic imidazolate framework (ZIF)-8-based sensor. Methanolic suspensions of ZIF-8 were dropcast onto platinum interdigitated electrodes, dried, and exposed to gaseous I 2 at 25, 40, or 70 °C. Using an unoptimized sensor geometry, I 2 was readily detected at 25 °C in air within 720 s of exposure. The specific response is attributed to the chemical selectivity of the ZIF-8 toward I 2 . Furthermore, equivalent circuit modeling of the impedance data indicates a >10 5 × decrease in ZIF-8 resistance when 116 wt % I 2 is adsorbed by ZIF-8 at 70 °C in air. This irreversible decrease in resistance is accompanied by an irreversible loss in the long-range crystallinity, as evidenced by X-ray diffraction and infrared spectroscopy. Air, argon, methanol, and water were found to produce minimal changes in ZIF-8 impedance. This report demonstrates how selective I 2 adsorption by ZIF-8 can be leveraged to create a highly selective sensor using >10 5 × changes in impedance response to enable the direct electrical detection of environmentally relevant gaseous toxins.

  20. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    Directory of Open Access Journals (Sweden)

    Jnnifer A. Sánchez

    2014-05-01

    Full Text Available Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%, II: nheA, hblC (2%, III: hblC, cytK (41.2%, IV: hblC (47%. Of 75 cassava starch samples, 44% were contaminated with toxigenic B. cereus and four different toxigenic consortia were determined: I: nheA, hblC, cytK (48.5%, II: nheA, hblC, cytK, cesB (3%, III: hblC, cytK (30.3%, IV: hblC (18.2%. In general, in dietary complement for children only enterotoxigenic consortia were detected while in cassava starch the enterotoxigenic consortia predominated over the emetic. Multiplex PCR was useful to detect toxigenic B. cereus contamination allowing direct and imultaneous detection of all toxin genes in foods. This study is the first in Colombia to evaluate toxigenic B. cereus, providing information of importance for microbiological risk evaluation in dried foods.

  1. Prospects for axion detection in natural SUSY with mixed axion-higgsino dark matter: back to invisible?

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Kyu Jung [Center for Theoretical Physics of the Universe, Institute for Basic Science (IBS), Daejeon 34051 (Korea, Republic of); Baer, Howard; Serce, Hasan, E-mail: kyujungbae@ibs.re.kr, E-mail: baer@nhn.ou.edu, E-mail: serce@ou.edu [Department of Physics and Astronomy, University of Oklahoma, Norman, OK 73019 (United States)

    2017-06-01

    Under the expectation that nature is natural, we extend the Standard Model to include SUSY to stabilize the electroweak sector and PQ symmetry to stabilize the QCD sector. Then natural SUSY arises from a Kim-Nilles solution to the SUSY μ problem which allows for a little hierarchy where μ∼ f {sub a} {sup 2}/ M {sub P} {sub ∼} 100−300 GeV while the SUSY particle mass scale m {sub SUSY}∼ 1−10 TeV >> μ. Dark matter then consists of two particles: a higgsino-like WIMP and a SUSY DFSZ axion. The range of allowed axion mass values m {sub a} depends on the mixed axion-higgsino relic density. The range of m {sub a} is actually restricted in this case by limits on WIMPs from direct and indirect detection experiments. We plot the expected axion detection rate at microwave cavity experiments. The axion-photon-photon coupling is severely diminished by charged higgsino contributions to the anomalous coupling. In this case, the axion may retreat, at least temporarily, back into the regime of near invisibility. From our results, we urge new ideas for techniques which probe both deeper and more broadly into axion coupling versus axion mass parameter space.

  2. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  3. Direct inference of SNP heterozygosity rates and resolution of LOH detection.

    Directory of Open Access Journals (Sweden)

    Xiaohong Li

    2007-11-01

    Full Text Available Single nucleotide polymorphisms (SNPs have been increasingly utilized to investigate somatic genetic abnormalities in premalignancy and cancer. LOH is a common alteration observed during cancer development, and SNP assays have been used to identify LOH at specific chromosomal regions. The design of such studies requires consideration of the resolution for detecting LOH throughout the genome and identification of the number and location of SNPs required to detect genetic alterations in specific genomic regions. Our study evaluated SNP distribution patterns and used probability models, Monte Carlo simulation, and real human subject genotype data to investigate the relationships between the number of SNPs, SNP HET rates, and the sensitivity (resolution for detecting LOH. We report that variances of SNP heterozygosity rate in dbSNP are high for a large proportion of SNPs. Two statistical methods proposed for directly inferring SNP heterozygosity rates require much smaller sample sizes (intermediate sizes and are feasible for practical use in SNP selection or verification. Using HapMap data, we showed that a region of LOH greater than 200 kb can be reliably detected, with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database. Higher densities of SNPs may exist in certain local chromosomal regions that provide some opportunities for reliably detecting LOH of segment sizes smaller than 50 kb. These results suggest that the interpretation of the results from genome-wide scans for LOH using commercial arrays need to consider the relationships among inter-SNP distance, detection probability, and sample size for a specific study. New experimental designs for LOH studies would also benefit from considering the power of detection and sample sizes required to accomplish the proposed aims.

  4. On Moderator Detection in Anchoring Research: Implications of Ignoring Estimate Direction

    Directory of Open Access Journals (Sweden)

    Nathan N. Cheek

    2018-05-01

    Full Text Available Anchoring, whereby judgments assimilate to previously considered standards, is one of the most reliable effects in psychology. In the last decade, researchers have become increasingly interested in identifying moderators of anchoring effects. We argue that a drawback of traditional moderator analyses in the standard anchoring paradigm is that they ignore estimate direction—whether participants’ estimates are higher or lower than the anchor value. We suggest that failing to consider estimate direction can sometimes obscure moderation in anchoring tasks, and discuss three potential analytic solutions that take estimate direction into account. Understanding moderators of anchoring effects is essential for a basic understanding of anchoring and for applied research on reducing the influence of anchoring in real-world judgments. Considering estimate direction reduces the risk of failing to detect moderation.

  5. Direct Detection Electron Energy-Loss Spectroscopy: A Method to Push the Limits of Resolution and Sensitivity.

    Science.gov (United States)

    Hart, James L; Lang, Andrew C; Leff, Asher C; Longo, Paolo; Trevor, Colin; Twesten, Ray D; Taheri, Mitra L

    2017-08-15

    In many cases, electron counting with direct detection sensors offers improved resolution, lower noise, and higher pixel density compared to conventional, indirect detection sensors for electron microscopy applications. Direct detection technology has previously been utilized, with great success, for imaging and diffraction, but potential advantages for spectroscopy remain unexplored. Here we compare the performance of a direct detection sensor operated in counting mode and an indirect detection sensor (scintillator/fiber-optic/CCD) for electron energy-loss spectroscopy. Clear improvements in measured detective quantum efficiency and combined energy resolution/energy field-of-view are offered by counting mode direct detection, showing promise for efficient spectrum imaging, low-dose mapping of beam-sensitive specimens, trace element analysis, and time-resolved spectroscopy. Despite the limited counting rate imposed by the readout electronics, we show that both core-loss and low-loss spectral acquisition are practical. These developments will benefit biologists, chemists, physicists, and materials scientists alike.

  6. Direct detection of cancer biomarkers in blood using a "place n play" modular polydimethylsiloxane pump.

    Science.gov (United States)

    Zhang, Honglian; Li, Gang; Liao, Lingying; Mao, Hongju; Jin, Qinghui; Zhao, Jianlong

    2013-01-01

    Cancer biomarkers have significant potential as reliable tools for the early detection of the disease and for monitoring its recurrence. However, most current methods for biomarker detection have technical difficulties (such as sample preparation and specific detector requirements) which limit their application in point of care diagnostics. We developed an extremely simple, power-free microfluidic system for direct detection of cancer biomarkers in microliter volumes of whole blood. CEA and CYFRA21-1 were chosen as model cancer biomarkers. The system automatically extracted blood plasma from less than 3 μl of whole blood and performed a multiplex sample-to-answer assay (nano-ELISA (enzyme-linked immunosorbent assay) technique) without the use of external power or extra components. By taking advantage of the nano-ELISA technique, this microfluidic system detected CEA at a concentration of 50 pg/ml and CYFRA21-1 at a concentration of 60 pg/ml within 60 min. The combination of PnP polydimethylsiloxane (PDMS) pump and nano-ELISA technique in a single microchip system shows great promise for the detection of cancer biomarkers in a drop of blood.

  7. Direct Detection of Potential Pyrethroids in Yangtze River via an Imprinted Multilayer Phosphorescence Probe.

    Science.gov (United States)

    Chen, Li; Lv, Xiaodong; Dai, Jiangdong; Sun, Lin; Huo, Pengwei; Li, Chunxiang; Yan, Yongsheng

    2018-01-01

    A novel tailored multilayer probe for monitoring potential pyrethroids in the Yangtze River was proposed. The room-temperature phosphorescence method was applied to realize a detection strategy that is superior to the fluorescence method. Efficient Mn-doped ZnS quantum dots with uniform size of 4.6 nm were firstly coated with a mesoporous silica to obtain a suitable intermediate transition layer, then an imprinted layer containing bifenthrin specific recognition sites was anchored. Characterizations verified the multilayer structure convincingly and the detection process relied on the electron transfer-induced fluorescence quenching mechanism. Optional detection time and standard detection curve were obtained within a concentration range from 5.0 to 50 μmol L -1 . The stability was verified to be good after 12 replicates. Feasibility of the probe was proved by monitoring water samples from the Zhenjiang reach of the Yangtze River. The probe offers promise for direct bifenthrin detection in unknown environmental water with an accurate and stable phosphorescence analysis strategy.

  8. Direct and long-term detection of gene doping in conventional blood samples.

    Science.gov (United States)

    Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

    2011-03-01

    The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

  9. An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data.

    Science.gov (United States)

    Wang, Yejun; MacKenzie, Keith D; White, Aaron P

    2015-05-07

    As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for

  10. First direct fluorescence polarization assay for the detection and quantification of spirolides in mussel samples

    Energy Technology Data Exchange (ETDEWEB)

    Otero, Paz; Alfonso, Amparo [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain); Alfonso, Carmen [CIFGA Laboratorio, Plaza de Santo Domingo, 1, 27001 Lugo (Spain); Araoz, Romulo; Molgo, Jordi [CNRS, Institut de Neurobiologie Alfred Fessard - FRC2118, Laboratoire de Neurobiologie et Developpement UPR3294, 1 Avenue de la Terrasse, 91198 Gif sur Yvette Cedex (France); Vieytes, Mercedes R. [Departamento de Fisiologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002 Lugo (Spain); Botana, Luis M., E-mail: luis.botana@usc.es [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain)

    2011-09-09

    Highlights: {yields} A direct assay based in the binding of nAChR to spirolide toxins by FP is described. {yields} A direct relationship between FP and 13-desMeC in the range of 10-500 nM is obtained. {yields} FP is dependent on the 13, 19-didesMeC in a higher concentration range than 13-desMeC. {yields} FP assay is a sensitive method to detect and quantify 13-desMeC in mussel samples. - Abstract: In 2009, we achieve the first inhibition FP assay to detect imine cyclic toxins. In the present paper we propose a new FP assay for direct quantify spirolides. This new method has resulted in significant improvement of sensitivity, rapidity and accessibility. In the method design, nicotinic acetylcholine receptor from Torpedo marmorata membranes labelled with a derivative of fluorescein was used. Spirolides, 13-desmethyl spirolide C (13-desMeC) and 13,19-didesmethyl spirolide C (13,19-didesMeC) were extracted and purified from cultures of the Alexandrium ostenfeldii dinoflagellate. Data showed the decrease of FP when toxin concentration was increased. Thus, a relationship between the FP units and the spirolides amount present in a sample was obtained. This direct assay is a reproducible, simple and very sensitive method with a detection limit about 25 nM for 13-desMeC and 150 nM for 13,19-didesMeC. The procedure was used to measure spirolides in mussel samples using an extraction and clean up protocol suitable for the FP assay. Results obtained show that this method is able to quantify 13-desMeC in the range of 50-350 {mu}g kg{sup -1} meat. Other liposoluble toxins did not interfere with the assay, proving a specific method. Moreover, the matrix do not affect in the range of toxin concentrations that involving risk of spirolides intoxication.

  11. First direct fluorescence polarization assay for the detection and quantification of spirolides in mussel samples

    International Nuclear Information System (INIS)

    Otero, Paz; Alfonso, Amparo; Alfonso, Carmen; Araoz, Romulo; Molgo, Jordi; Vieytes, Mercedes R.; Botana, Luis M.

    2011-01-01

    Highlights: → A direct assay based in the binding of nAChR to spirolide toxins by FP is described. → A direct relationship between FP and 13-desMeC in the range of 10-500 nM is obtained. → FP is dependent on the 13, 19-didesMeC in a higher concentration range than 13-desMeC. → FP assay is a sensitive method to detect and quantify 13-desMeC in mussel samples. - Abstract: In 2009, we achieve the first inhibition FP assay to detect imine cyclic toxins. In the present paper we propose a new FP assay for direct quantify spirolides. This new method has resulted in significant improvement of sensitivity, rapidity and accessibility. In the method design, nicotinic acetylcholine receptor from Torpedo marmorata membranes labelled with a derivative of fluorescein was used. Spirolides, 13-desmethyl spirolide C (13-desMeC) and 13,19-didesmethyl spirolide C (13,19-didesMeC) were extracted and purified from cultures of the Alexandrium ostenfeldii dinoflagellate. Data showed the decrease of FP when toxin concentration was increased. Thus, a relationship between the FP units and the spirolides amount present in a sample was obtained. This direct assay is a reproducible, simple and very sensitive method with a detection limit about 25 nM for 13-desMeC and 150 nM for 13,19-didesMeC. The procedure was used to measure spirolides in mussel samples using an extraction and clean up protocol suitable for the FP assay. Results obtained show that this method is able to quantify 13-desMeC in the range of 50-350 μg kg -1 meat. Other liposoluble toxins did not interfere with the assay, proving a specific method. Moreover, the matrix do not affect in the range of toxin concentrations that involving risk of spirolides intoxication.

  12. Directional support value of Gaussian transformation for infrared small target detection.

    Science.gov (United States)

    Yang, Changcai; Ma, Jiayi; Qi, Shengxiang; Tian, Jinwen; Zheng, Sheng; Tian, Xin

    2015-03-20

    Robust small target detection is one of the key techniques in IR search and tracking systems for self-defense or attacks. In this paper we present a robust solution for small target detection in a single IR image. The key ideas of the proposed method are to use the directional support value of Gaussian transform (DSVoGT) to enhance the targets, and use the multiscale representation provided by DSVoGT to reduce the false alarm rate. The original image is decomposed into sub-bands in different orientations by convolving the image with the directional support value filters, which are deduced from the weighted mapped least-squares-support vector machines (LS-SVMs). Based on the sub-band images, a support value of Gaussian matrix is constructed, and the trace of this matrix is then defined as the target measure. The corresponding multiscale correlations of the target measures are computed for enhancing target signal while suppressing the background clutter. We demonstrate the advantages of the proposed method on real IR images and compare the results against those obtained from standard detection approaches, including the top-hat filter, max-mean filter, max-median filter, min-local-Laplacian of Gaussian (LoG) filter, as well as LS-SVM. The experimental results on various cluttered background images show that the proposed method outperforms other detectors.

  13. Dispersion compensation of fiber optic communication system with direct detection using artificial neural networks (ANNs)

    Science.gov (United States)

    Maghrabi, Mahmoud M. T.; Kumar, Shiva; Bakr, Mohamed H.

    2018-02-01

    This work introduces a powerful digital nonlinear feed-forward equalizer (NFFE), exploiting multilayer artificial neural network (ANN). It mitigates impairments of optical communication systems arising due to the nonlinearity introduced by direct photo-detection. In a direct detection system, the detection process is nonlinear due to the fact that the photo-current is proportional to the absolute square of the electric field intensity. The proposed equalizer provides the most efficient computational cost with high equalization performance. Its performance is comparable to the benchmark compensation performance achieved by maximum-likelihood sequence estimator. The equalizer trains an ANN to act as a nonlinear filter whose impulse response removes the intersymbol interference (ISI) distortions of the optical channel. Owing to the proposed extensive training of the equalizer, it achieves the ultimate performance limit of any feed-forward equalizer (FFE). The performance and efficiency of the equalizer is investigated by applying it to various practical short-reach fiber optic communication system scenarios. These scenarios are extracted from practical metro/media access networks and data center applications. The obtained results show that the ANN-NFFE compensates for the received BER degradation and significantly increases the tolerance to the chromatic dispersion distortion.

  14. Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

    Science.gov (United States)

    Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

    2016-01-25

    We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

  15. Direct tissue blot immunoassay for detection of Xylella fastidiosa in olive trees

    Directory of Open Access Journals (Sweden)

    Khaled DJELOUAH

    2015-01-01

    Full Text Available A direct tissue blot immunoassay (DTBIA technique has been compared with ELISA and PCR for detection of Xylella fastidiosa in olive trees from Apulia (southern Italy. Fresh cross-sections of young twigs and leaf petioles were printed onto nitrocellulose membranes and analyzed in the laboratory. Analyses of a first group of 61 samples gave similar efficiency for the three diagnostic techniques for detection the bacterium (24 positive and 36 negative samples, except for a single sample which was positive only with DTBIA and PCR. Similar results were obtained by separately analyzing suckers and twigs collected from different sectors of tree canopies of a second group of 20 olive trees (ten symptomatic and ten symptomless. In this second test the three diagnostic techniques confirmed the irregular distribution of the bacterium in the tree canopies and erratic detectability of the pathogen in the young suckers. It is therefore necessary to analyse composite samples per tree which should be prepared with twigs collected from different sides of the canopy. The efficiency comparable to ELISA and PCR, combined with the advantages of easier handling, speed and cost, make DTBIA a valid alternative to ELISA in large-scale surveys for occurrence of X. fastidiosa. Moreover, the printing of membranes directly in the field prevents infections spreading to Xylella-free areas, through movement of plant material with pathogen vectors for laboratory testing.

  16. Direct RNA-based detection of CTX-M β-lactamases in human blood samples.

    Science.gov (United States)

    Stein, Claudia; Makarewicz, Oliwia; Pfeifer, Yvonne; Brandt, Christian; Pletz, Mathias W

    2015-05-01

    Bloodstream infections with ESBL-producers are associated with increased mortality, which is due to delayed appropriate treatment resulting in clinical failure. Current routine diagnostics for detection of bloodstream infections consists of blood culture followed by species identification and susceptibility testing. In attempts to improve and accelerate diagnostic procedures, PCR-based methods have been developed. These methods focus on species identification covering only a limited number of ESBL coding genes. Therefore, they fail to cover the steadily further evolving genetic diversity of clinically relevant β-lactamases. We have recently designed a fast and novel RNA targeting method to detect and specify CTX-M alleles from bacterial cultures, based on an amplification-pyrosequencing approach. We further developed this assay towards a diagnostic tool for clinical use and evaluated its sensitivity and specificity when applied directly to human blood samples. An optimized protocol for mRNA isolation allows detection of specific CTX-M groups from as little as 100 CFU/mL blood via reverse transcription, amplification, and pyrosequencing directly from human EDTA blood samples as well as from pre-incubated human blood cultures with a turnaround time for test results of <7 h. Copyright © 2015 Elsevier GmbH. All rights reserved.

  17. Exclusion limits on the WIMP-nucleon cross section from the first run of the Cryogenic Dark Matter Search in the Soudan Underground Laboratory

    International Nuclear Information System (INIS)

    Akerib, D.S.; Bailey, C.N.; Dragowsky, M.R.; Driscoll, D.D.; Hennings-Yeomans, R.; Kamat, S.; Perera, T.A.; Schnee, R.W.; Wang, G.; Armel-Funkhouser, M.S.; Daal, M.; Filippini, J.; Lu, A.; Mandic, V.; Meunier, P.; Mirabolfathi, N.; Issac, M.C. Perillo; Rau, W.; Seitz, D.N.; Serfass, B.

    2005-01-01

    The Cryogenic Dark Matter Search (CDMS-II) employs low-temperature Ge and Si detectors to seek weakly interacting massive particles (WIMPs) via their elastic-scattering interactions with nuclei. Simultaneous measurements of both ionization and phonon energy provide discrimination against interactions of background particles. For recoil energies above 10 keV, events due to background photons are rejected with >99.99% efficiency. Electromagnetic events very near the detector surface can mimic nuclear recoils because of reduced charge collection, but these surface events are rejected with >96% efficiency by using additional information from the phonon pulse shape. Efficient use of active and passive shielding, combined with the 2090 m.w.e. overburden at the experimental site in the Soudan mine, makes the background from neutrons negligible for this first exposure. All cuts are determined in a blind manner from in situ calibrations with external radioactive sources without any prior knowledge of the event distribution in the signal region. Resulting efficiencies are known to ∼10%. A single event with a recoil of 64 keV passes all of the cuts and is consistent with the expected misidentification rate of surface electron recoils. Under the assumptions for a standard dark matter halo, these data exclude previously unexplored parameter space for both spin-independent and spin-dependent WIMP-nucleon elastic scattering. The resulting limit on the spin-independent WIMP-nucleon elastic-scattering cross section has a minimum of 4x10 -43 cm 2 at a WIMP mass of 60 GeVc -2 . The minimum of the limit for the spin-dependent WIMP-neutron elastic-scattering cross section is 2x10 -37 cm 2 at a WIMP mass of 50 GeVc -2

  18. Nanoparticle-based optical biosensors for the direct detection of organophosphate chemical warfare agents and pesticides

    International Nuclear Information System (INIS)

    Simonian, A.L.; Good, T.A.; Wang, S.-S.; Wild, J.R.

    2005-01-01

    Neurotoxic organophosphates (OP) have found widespread use in the environment for insect control. In addition, there is the increasing threat of use of OP based chemical warfare agents in both ground based warfare and terrorist attacks. Together, these trends necessitate the development of simple and specific methods for discriminative detection of ultra low quantities of OP neurotoxins. In our previous investigations a new biosensor for the direct detection of organophosphorus neurotoxins was pioneered. In this system, the enzymatic hydrolysis of OP neurotoxins by organophosphate hydrolase (OPH) generated two protons in each hydrolytic turnover through reactions in which P-X bonds are cleaved. The sensitivity of this biosensor was limited due to the potentiometric method of detection. Recently, it was reported that a change in fluorescence properties of a fluorophore in the vicinity of gold nanoparticles might be used for detection of nanomolar concentrations of DNA oligonucleotides. The detection strategy was based on the fact that an enhancement or quenching of fluorescence intensity is a function of the distances between the gold nanoparticle and fluorophore. While these reports have demonstrated the use of nanoparticle-based sensors for the detection of target DNA, we observed that the specificity of enzyme-substrate interactions could be exploited in similar systems. To test the feasibility of this approach, OPH-gold nanoparticle conjugates were prepared, then incubated with a fluorescent enzyme inhibitor or decoy. The fluorescence intensity of the decoy was sensitive to the proximity of the gold nanoparticle, and thus could be used to indicate that the decoy was bound to the OPH. Then different paraoxon concentrations were introduced to the OPH-nanoparticle-conjugate-decoy mixtures, and normalized ratio of fluorescence intensities were measured. The greatest sensitivity to paraoxon was obtained when decoys and OPH-gold nanoparticle conjugates were present at

  19. Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

    Science.gov (United States)

    Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

    2014-05-08

    Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

  20. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    Directory of Open Access Journals (Sweden)

    Padmavathy

    2012-02-01

    Full Text Available Abstract Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to

  1. New Fpg probe chemistry for direct detection of recombinase polymerase amplification on lateral flow strips.

    Science.gov (United States)

    Powell, Michael L; Bowler, Frank R; Martinez, Aurore J; Greenwood, Catherine J; Armes, Niall; Piepenburg, Olaf

    2018-02-15

    Rapid, cost-effective and sensitive detection of nucleic acids has the ability to improve upon current practices employed for pathogen detection in diagnosis of infectious disease and food testing. Furthermore, if assay complexity can be reduced, nucleic acid amplification tests could be deployed in resource-limited and home use scenarios. In this study, we developed a novel Fpg (Formamidopyrimidine DNA glycosylase) probe chemistry, which allows lateral flow detection of amplification in undiluted recombinase polymerase amplification (RPA) reactions. The prototype nucleic acid lateral flow chemistry was applied to a human genomic target (rs1207445), Campylobacter jejuni 16S rDNA and two genetic markers of the important food pathogen E. coli O157:H7. All four assays have an analytical sensitivity between 10 and 100 copies DNA per amplification. Furthermore, the assay is performed with fewer hands-on steps than using the current RPA Nfo lateral flow method as dilution of amplicon is not required for lateral flow analysis. Due to the simplicity of the workflow, we believe that the lateral flow chemistry for direct detection could be readily adapted to a cost-effective single-use consumable, ideal for use in non-laboratory settings. Copyright © 2017. Published by Elsevier Inc.

  2. Detection of antibodies in human serum using trimellityl-erythrocytes: direct and indirect haemagglutination and haemolysis.

    Science.gov (United States)

    Turner, E S; Pruzansky, J J; Patterson, R; Zeiss, C R; Roberts, M

    1980-02-01

    Utilizing trimellityl-erythrocytes (TM-E), antibodies were detected in sera of seven workers with trimellitic anhydride (TMA) induced airway syndromes by direct haemagglutination, indirect haemagglutination with anti-human IgG, IgA or IgM or by haemolysis. Detectable levels of antibody were obtained with all three methods. The most sensitive technique was indirect haemagglutination using anti-IgG. When added as an inhibitor, TM-human serum albumin produced a 10- to 800-fold reduction in titres. TM-ovalbumin of similar epitope density was less inhibitory and sodium trimellitate the least inhibitory on a molar basis. All of the assays using haptenized human red cells were also capable of detecting anti-TM antibodies in Rhesus monkeys whose airways had been exposed to TMA. These assays are useful for detecting anti-TM antibodies and may also be adapted to demonstrate antibodies induced against other inhaled haptens in sera of environmentally exposed individuals or in animal models of such exposure.

  3. Direct detection of singlet dark matter in classically scale-invariant standard model

    Directory of Open Access Journals (Sweden)

    Kazuhiro Endo

    2015-10-01

    Full Text Available Classical scale invariance is one of the possible solutions to explain the origin of the electroweak scale. The simplest extension is the classically scale-invariant standard model augmented by a multiplet of gauge singlet real scalar. In the previous study it was shown that the properties of the Higgs potential deviate substantially, which can be observed in the International Linear Collider. On the other hand, since the multiplet does not acquire vacuum expectation value, the singlet components are stable and can be dark matter. In this letter we study the detectability of the real singlet scalar bosons in the experiment of the direct detection of dark matter. It is shown that a part of this model has already been excluded and the rest of the parameter space is within the reach of the future experiment.

  4. Detection system qualification for direct measurement of thyroid internal contamination by radioiodine

    International Nuclear Information System (INIS)

    Tiberi, V.; Battisti, P.; Gualdrini, G.

    1999-01-01

    The work deals with a detection system qualification for direct measurements of thyroid internal contamination by radioiodine. The isotopes 131 I and 125 I are the most frequently used in nuclear medicine. Because of their volatility they are very dangerous for thyroid contamination by inhalation. The system has been projected to be easily and fast used and above all transportable where the control is necessary. These characteristic make it able to realise supervision programs of internal contamination by radioiodine. In fact due the very high control frequencies (each 15 days for 131 I), these programs are usually very expensive and demanding when they are executed in external measurement laboratories. The following steps are described: devices presentation, calculation of energy and efficiency parameters, minimum detectable activity, time system reliability, best operative conditions in the measurements. At the end an application example of the system is reported [it

  5. Iodine-125 radioimmunoassay for the direct detection of benzodiazepines in blood and urine

    Energy Technology Data Exchange (ETDEWEB)

    Goddard, C.P.; Stead, A.H.; Mason, P.A.; Law, B.; Moffat, A.C.; McBrien, M.; Cosby, S.

    1986-05-01

    A radioimmunoassay (RIA) for the direct detection of benzodiazepines in blood and urine is described. It is based on a commercially available antiserum and an easily synthesised radio-iodinated derivative of clonazepam that allows the use of relatively simple gamma-counting procedures. The assay can detect low therapeutic levels of all of the benzodiazepines currently available in the UK in 50-..mu..l samples of blood and urine (1-50 ng ml/sup -1/, depending on the drug); no prior sample preparation is required. It is inexpensive, rapid, simple to perform and is broadly specific for the benzodiazepine class of drugs. The assay offers a most suitable means of screening large numbers of samples of forensic interest for the presence of the benzodiazepines.

  6. An iodine-125 radioimmunoassay for the direct detection of benzodiazepines in blood and urine

    International Nuclear Information System (INIS)

    Goddard, C.P.; Stead, A.H.; Mason, P.A.; Law, B.; Moffat, A.C.; McBrien, M.; Cosby, S.

    1986-01-01

    A radioimmunoassay (RIA) for the direct detection of benzodiazepines in blood and urine is described. It is based on a commercially available antiserum and an easily synthesised radio-iodinated derivative of clonazepam that allows the use of relatively simple gamma-counting procedures. The assay can detect low therapeutic levels of all of the benzodiazepines currently available in the UK in 50-μl samples of blood and urine (1-50 ng ml -1 , depending on the drug); no prior sample preparation is required. It is inexpensive, rapid, simple to perform and is broadly specific for the benzodiazepine class of drugs. The assay offers a most suitable means of screening large numbers of samples of forensic interest for the presence of the benzodiazepines. (author)

  7. Direct detection of lower hybrid wave using a reflectometer on Alcator C-Moda)

    Science.gov (United States)

    Shiraiwa, S.; Baek, S.; Dominguez, A.; Marmar, E.; Parker, R.; Kramer, G. J.

    2010-10-01

    The possibility of directly detecting a density perturbation produced by lower hybrid (LH) waves using a reflectometer is presented. We investigate the microwave scattering of reflectometer probe beams by a model density fluctuation produced by short wavelength LH waves in an Alcator C-Mod experimental condition. In the O-mode case, the maximum response of phase measurement is found to occur when the density perturbation is approximately centimeters in front of the antenna, where Bragg scattering condition is satisfied. In the X-mode case, the phase measurement is predicted to be more sensitive to the density fluctuation close to the cut-off layer. A feasibility test was carried out using a 50 GHz O-mode reflectometer on the Alcator C-Mod tokamak, and positive results including the detection of 4.6 GHz pump wave and parametric decay instabilities were obtained.

  8. Rapid detection of NBOME's and other NPS on blotter papers by direct ATR-FTIR spectrometry.

    Science.gov (United States)

    Coelho Neto, José

    2015-07-01

    Blotter paper is among the most common forms of consumption of new psychotropic substances (NPS), formerly referred as designer drugs. In many cases, users are misled to believe they are taking LSD when, in fact, they are taking newer and less known drugs like the NBOMEs or other substituted phenethylamines. We report our findings in quick testing of blotter papers for illicit substances like NBOMEs and other NPS by taking ATR-FTIR spectra directly from blotters seized on the streets, without any sample preparation. Both sides (front and back) of each blotter were tested. Collected data were analyzed by single- and multi-component spectral matching and submitted to chemometric discriminant analysis. Our results showed that, on 66.7% of the cases analyzed, seized blotters contained one or more types of NBOMEs, confirming the growing presence of this novel substances on the market. Matching IR signals were detected on both or just one side of the blotters and showed variable strength. Although no quantitative analysis was made, detection of these substances by the proposed approach serves as indication of variable and possibly higher dosages per blotter when compared to LSD, which showed to be below the detection limit of the applied method. Blotters containing a mescaline-like compound, later confirmed by GC-MS and LC-MS to be MAL (methallylescaline), a substance very similar to mescaline, were detected among the samples tested. Validity of direct ATR-FTIR testing was confirmed by checking the obtained results against independent GC-MS or LC-MS results for the same cases/samples. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Defect detection and classification of machined surfaces under multiple illuminant directions

    Science.gov (United States)

    Liao, Yi; Weng, Xin; Swonger, C. W.; Ni, Jun

    2010-08-01

    Continuous improvement of product quality is crucial to the successful and competitive automotive manufacturing industry in the 21st century. The presence of surface porosity located on flat machined surfaces such as cylinder heads/blocks and transmission cases may allow leaks of coolant, oil, or combustion gas between critical mating surfaces, thus causing damage to the engine or transmission. Therefore 100% inline inspection plays an important role for improving product quality. Although the techniques of image processing and machine vision have been applied to machined surface inspection and well improved in the past 20 years, in today's automotive industry, surface porosity inspection is still done by skilled humans, which is costly, tedious, time consuming and not capable of reliably detecting small defects. In our study, an automated defect detection and classification system for flat machined surfaces has been designed and constructed. In this paper, the importance of the illuminant direction in a machine vision system was first emphasized and then the surface defect inspection system under multiple directional illuminations was designed and constructed. After that, image processing algorithms were developed to realize 5 types of 2D or 3D surface defects (pore, 2D blemish, residue dirt, scratch, and gouge) detection and classification. The steps of image processing include: (1) image acquisition and contrast enhancement (2) defect segmentation and feature extraction (3) defect classification. An artificial machined surface and an actual automotive part: cylinder head surface were tested and, as a result, microscopic surface defects can be accurately detected and assigned to a surface defect class. The cycle time of this system can be sufficiently fast that implementation of 100% inline inspection is feasible. The field of view of this system is 150mm×225mm and the surfaces larger than the field of view can be stitched together in software.

  10. Direct detection of a single evoked action potential with MRS in Lumbricus terrestris.

    Science.gov (United States)

    Poplawsky, Alexander J; Dingledine, Raymond; Hu, Xiaoping P

    2012-01-01

    Functional MRI (fMRI) measures neural activity indirectly by detecting the signal change associated with the hemodynamic response following brain activation. In order to alleviate the temporal and spatial specificity problems associated with fMRI, a number of attempts have been made to detect neural magnetic fields (NMFs) with MRI directly, but have thus far provided conflicting results. In this study, we used MR to detect axonal NMFs in the median giant fiber of the earthworm, Lumbricus terrestris, by examining the free induction decay (FID) with a sampling interval of 0.32 ms. The earthworm nerve cords were isolated from the vasculature and stimulated at the threshold of action potential generation. FIDs were acquired shortly after the stimulation, and simultaneous field potential recordings identified the presence or absence of single evoked action potentials. FIDs acquired when the stimulus did not evoke an action potential were summed as background. The phase of the background-subtracted FID exhibited a systematic change, with a peak phase difference of (-1.2 ± 0.3) × 10(-5) radians occurring at a time corresponding to the timing of the action potential. In addition, we calculated the possible changes in the FID magnitude and phase caused by a simulated action potential using a volume conductor model. The measured phase difference matched the theoretical prediction well in both amplitude and temporal characteristics. This study provides the first evidence for the direct detection of a magnetic field from an evoked action potential using MR. Copyright © 2011 John Wiley & Sons, Ltd.

  11. Characterization of a direct detection device imaging camera for transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Milazzo, Anna-Clare, E-mail: amilazzo@ncmir.ucsd.edu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Moldovan, Grigore [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Lanman, Jason [Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037 (United States); Jin, Liang; Bouwer, James C. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Klienfelder, Stuart [University of California at Irvine, Irvine, CA 92697 (United States); Peltier, Steven T.; Ellisman, Mark H. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Kirkland, Angus I. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Xuong, Nguyen-Huu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States)

    2010-06-15

    The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

  12. Characterization of a direct detection device imaging camera for transmission electron microscopy

    International Nuclear Information System (INIS)

    Milazzo, Anna-Clare; Moldovan, Grigore; Lanman, Jason; Jin, Liang; Bouwer, James C.; Klienfelder, Stuart; Peltier, Steven T.; Ellisman, Mark H.; Kirkland, Angus I.; Xuong, Nguyen-Huu

    2010-01-01

    The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

  13. Nuclear recoil energy scale in liquid xenon with application to the direct detection of dark matter

    International Nuclear Information System (INIS)

    Sorensen, Peter; Dahl, Carl Eric

    2011-01-01

    We show for the first time that the quenching of electronic excitation from nuclear recoils in liquid xenon is well-described by Lindhard theory, if the nuclear recoil energy is reconstructed using the combined (scintillation and ionization) energy scale proposed by Shutt et al. We argue for the adoption of this perspective in favor of the existing preference for reconstructing nuclear recoil energy solely from primary scintillation. We show that signal partitioning into scintillation and ionization is well described by the Thomas-Imel box model. We discuss the implications for liquid xenon detectors aimed at the direct detection of dark matter.

  14. PMD compensation in fiber-optic communication systems with direct detection using LDPC-coded OFDM.

    Science.gov (United States)

    Djordjevic, Ivan B

    2007-04-02

    The possibility of polarization-mode dispersion (PMD) compensation in fiber-optic communication systems with direct detection using a simple channel estimation technique and low-density parity-check (LDPC)-coded orthogonal frequency division multiplexing (OFDM) is demonstrated. It is shown that even for differential group delay (DGD) of 4/BW (BW is the OFDM signal bandwidth), the degradation due to the first-order PMD can be completely compensated for. Two classes of LDPC codes designed based on two different combinatorial objects (difference systems and product of combinatorial designs) suitable for use in PMD compensation are introduced.

  15. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    OpenAIRE

    Jnnifer A. Sánchez; Margarita M. Correa; Ángel E. Aceves Dies; Laura M. Castañeda Sandoval

    2014-01-01

    Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%), II: nheA, hbl...

  16. Method of shaping of direction-characterization of sensitivity of ionizing radiation detection probe

    International Nuclear Information System (INIS)

    Czarnecki, J.; Jaszczuk, J.; Kruczyk, M.; Slapa, M.; Wroblewski, T.

    1986-01-01

    A method of shaping of direction-characterization of sensitivity of the ionizing radiation detection probe, especially equipped with small gamma detectors is described. Two detectors are placed coaxially in the bases of the cylindrical shield. One of them is uncovered in the highest degree and the second is not covered to a maximum. The signals from them are processed on the standarized sequences of electrical impulses (taking into account the heights and the widths of the amplitude). 2 figs., 1 tab. (A.S.)

  17. LHC and Tevatron bounds on the dark matter direct detection cross-section for vector mediators

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Preston, Anthony

    2012-01-01

    We study the interactions of a new spin-1 mediator that connects the Standard Model to dark matter. We constrain its decay channels using monojet and monophoton searches, as well as searches for resonances in dijet, dilepton and diboson final states including those involving a possible Higgs. We...... then interpret the resulting limits as bounds on the cross-section for dark matter direct detection without the need to specify a particular model. For mediator masses between 300 and 1000 GeV these bounds are considerably stronger than the ones obtained under the assumption that the mediator can be integrated...

  18. Robustness and versatility of a nonlinear interdependence method for directional coupling detection from spike trains

    Science.gov (United States)

    Malvestio, Irene; Kreuz, Thomas; Andrzejak, Ralph G.

    2017-08-01

    The detection of directional couplings between dynamics based on measured spike trains is a crucial problem in the understanding of many different systems. In particular, in neuroscience it is important to assess the connectivity between neurons. One of the approaches that can estimate directional coupling from the analysis of point processes is the nonlinear interdependence measure L . Although its efficacy has already been demonstrated, it still needs to be tested under more challenging and realistic conditions prior to an application to real data. Thus, in this paper we use the Hindmarsh-Rose model system to test the method in the presence of noise and for different spiking regimes. We also examine the influence of different parameters and spike train distances. Our results show that the measure L is versatile and robust to various types of noise, and thus suitable for application to experimental data.

  19. Direct growth of graphene on quartz substrates for label-free detection of adenosine triphosphate.

    Science.gov (United States)

    Xu, Shicai; Man, Baoyuan; Jiang, Shouzhen; Yue, Weiwei; Yang, Cheng; Liu, Mei; Chen, Chuansong; Zhang, Chao

    2014-04-25

    We demonstrate that continuous, uniform graphene films can be directly synthesized on quartz substrates using a two-temperature-zone chemical vapor deposition system and that their layers can be controlled by adjusting the precursor partial pressure. Raman spectroscopy and transmission electron microscopy confirm the formation of monolayer graphene with a grain size of ∼100 nm. Hall measurements show a room-temperature carrier mobility above 1500 cm2 V(-1) s(-1). The optical transmittance and conductance of the graphene films are comparable to those of transferred metal-catalyzed graphene. The method avoids the complicated and skilled post-growth transfer process and allows the graphene to be directly incorporated into a fully functional biosensor for label-free detection of adenosine triphosphate (ATP). This device shows a fast response time of a few milliseconds and achieves a high sensitivity to ATP molecules over a very wide range from 0.002 to 5 mM.

  20. Prospects for direct detection of dark matter in an effective theory approach

    International Nuclear Information System (INIS)

    Catena, Riccardo

    2014-01-01

    We perform the first comprehensive analysis of the prospects for direct detection of dark matter with future ton-scale detectors in the general 11-dimensional effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. The theory includes 8 momentum and velocity dependent dark matter-nucleon interaction operators, besides the familiar spin-independent and spin-dependent operators. From a variegated sample of 27 benchmark points selected in the parameter space of the theory, we simulate independent sets of synthetic data for ton-scale Germanium and Xenon detectors. From the synthetic data, we then extract the marginal posterior probability density functions and the profile likelihoods of the model parameters. The associated Bayesian credible regions and frequentist confidence intervals allow us to assess the prospects for direct detection of dark matter at the 27 benchmark points. First, we analyze the data assuming the knowledge of the correct dark matter nucleon-interaction type, as it is commonly done for the familiar spin-independent and spin-dependent interactions. Then, we analyze the simulations extracting the dark matter-nucleon interaction type from the data directly, in contrast to standard analyses. This second approach requires an extensive exploration of the full 11-dimensional parameter space of the dark matter-nucleon effective theory. Interestingly, we identify 5 scenarios where the dark matter mass and the dark matter-nucleon interaction type can be reconstructed from the data simultaneously. We stress the importance of extracting the dark matter nucleon-interaction type from the data directly, discussing the main challenges found addressing this complex 11-dimensional problem

  1. Transfer Entropy Estimation and Directional Coupling Change Detection in Biomedical Time Series

    Directory of Open Access Journals (Sweden)

    Lee Joon

    2012-04-01

    Full Text Available Abstract Background The detection of change in magnitude of directional coupling between two non-linear time series is a common subject of interest in the biomedical domain, including studies involving the respiratory chemoreflex system. Although transfer entropy is a useful tool in this avenue, no study to date has investigated how different transfer entropy estimation methods perform in typical biomedical applications featuring small sample size and presence of outliers. Methods With respect to detection of increased coupling strength, we compared three transfer entropy estimation techniques using both simulated time series and respiratory recordings from lambs. The following estimation methods were analyzed: fixed-binning with ranking, kernel density estimation (KDE, and the Darbellay-Vajda (D-V adaptive partitioning algorithm extended to three dimensions. In the simulated experiment, sample size was varied from 50 to 200, while coupling strength was increased. In order to introduce outliers, the heavy-tailed Laplace distribution was utilized. In the lamb experiment, the objective was to detect increased respiratory-related chemosensitivity to O2 and CO2 induced by a drug, domperidone. Specifically, the separate influence of end-tidal PO2 and PCO2 on minute ventilation (V˙E before and after administration of domperidone was analyzed. Results In the simulation, KDE detected increased coupling strength at the lowest SNR among the three methods. In the lamb experiment, D-V partitioning resulted in the statistically strongest increase in transfer entropy post-domperidone for PO2→V˙E. In addition, D-V partitioning was the only method that could detect an increase in transfer entropy for PCO2→V˙E, in agreement with experimental findings. Conclusions Transfer entropy is capable of detecting directional coupling changes in non-linear biomedical time series analysis featuring a small number of observations and presence of outliers. The results

  2. Prospects for dark matter detection with IceCube in the context of the CMSSM

    International Nuclear Information System (INIS)

    Trotta, Roberto; Austri, Roberto Ruiz de; Heros, Carlos Pérez de los

    2009-01-01

    We study in detail the ability of the nominal configuration of the IceCube neutrino telescope (with 80 strings) to probe the parameter space of the Constrained MSSM (CMSSM) favoured by current collider and cosmological data. Adopting conservative assumptions about the galactic halo model and the expected experiment performance, we find that IceCube has a probability between 2% and 12% of achieving a 5σ detection of dark matter annihilation in the Sun, depending on the choice of priors for the scalar and gaugino masses and on the astrophysical assumptions. We identify the most important annihilation channels in the CMSSM parameter space favoured by current constraints, and we demonstrate that assuming that the signal is dominated by a single annihilation channel can lead to large systematic errors in the inferred WIMP annihilation cross section. We demonstrate that ∼ 66% of the CMSSM parameter space violates the equilibrium condition between capture and annihilation in the center of the Sun. By cross-correlating our predictions with direct detection methods, we conclude that if IceCube does detect a neutrino flux from the Sun at high significance while direct detection experiments do not find a signal above a spin-independent cross section σ p SI ∼> 7 × 10 −9 pb, the CMSSM will be strongly disfavoured, given standard astrophysical assumptions for the WIMP distribution. This result is robust with respect to a change of priors. We argue that the proposed low-energy DeepCore extension of IceCube will be an ideal instrument to focus on relevant CMSSM areas of parameter space

  3. Direct, Specific and Rapid Detection of Staphylococcal Proteins and Exotoxins Using a Multiplex Antibody Microarray.

    Directory of Open Access Journals (Sweden)

    Bettina Stieber

    Full Text Available S. aureus is a pathogen in humans and animals that harbors a wide variety of virulence factors and resistance genes. This bacterium can cause a wide range of mild to life-threatening diseases. In the latter case, fast diagnostic procedures are important. In routine diagnostic laboratories, several genotypic and phenotypic methods are available to identify S. aureus strains and determine their resistances. However, there is a demand for multiplex routine diagnostic tests to directly detect staphylococcal toxins and proteins.In this study, an antibody microarray based assay was established and validated for the rapid detection of staphylococcal markers and exotoxins. The following targets were included: staphylococcal protein A, penicillin binding protein 2a, alpha- and beta-hemolysins, Panton Valentine leukocidin, toxic shock syndrome toxin, enterotoxins A and B as well as staphylokinase. All were detected simultaneously within a single experiment, starting from a clonal culture on standard media. The detection of bound proteins was performed using a new fluorescence reading device for microarrays.110 reference strains and clinical isolates were analyzed using this assay, with a DNA microarray for genotypic characterization performed in parallel. The results showed a general high concordance of genotypic and phenotypic data. However, genotypic analysis found the hla gene present in all S. aureus isolates but its expression under given conditions depended on the clonal complex affiliation of the actual isolate.The multiplex antibody assay described herein allowed a rapid and reliable detection of clinically relevant staphylococcal toxins as well as resistance- and species-specific markers.

  4. On the Existence of Low-Mass Dark Matter and its Direct Detection

    Science.gov (United States)

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R.; Ulbricht, Hendrik

    2015-01-01

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too. PMID:25622565

  5. On the Existence of Low-Mass Dark Matter and its Direct Detection

    Science.gov (United States)

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R.; Ulbricht, Hendrik

    2015-01-01

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too.

  6. Direct detection of second harmonic and its use in alanine/EPR dosimetry

    International Nuclear Information System (INIS)

    Chen, F.; Guzman, C.S.; Graeff, C.F.O.; Baffa, O.

    2001-01-01

    In this work, the possible use of the second harmonic EPR signal from irradiated alanine for low radiation dose (∼1 Gy) was explored, aiming applications to HDR brachytherapy and teletherapy. The second harmonic signal was directly detected after overmodulation. A batch of DL-alanine/paraffin small cylindrical pellets was made. A VARIAN E-4 X-Band EPR spectrometer with optimized operation parameters like microwave power and modulation amplitude to obtain a signal with the highest amplitude was used. The modulation frequency and modulation amplitude were 100 kHz and 1.25 mT (to overmodulate the signal) respectively. The second harmonic signal was directly detected at twice the modulation frequency. One group of dosimeters was irradiated with a 192 Ir brachytherapy source and the other in a 10 MeV X-rays linear accelerator, both group at a dose range: 0.5 - 15 Gy. The second harmonic signal showed better resolution than the first harmonic one making possible a more easy localization of the signal. Moreover, for both types of radiation, the dose-response curve showed a good linear behavior for the dose range indicated. (author)

  7. On the direct detection of multi-component dark matter: sensitivity studies and parameter estimation

    Science.gov (United States)

    Herrero-Garcia, Juan; Scaffidi, Andre; White, Martin; Williams, Anthony G.

    2017-11-01

    We study the case of multi-component dark matter, in particular how direct detection signals are modified in the presence of several stable weakly-interacting-massive particles. Assuming a positive signal in a future direct detection experiment, stemming from two dark matter components, we study the region in parameter space where it is possible to distinguish a one from a two-component dark matter spectrum. First, we leave as free parameters the two dark matter masses and show that the two hypotheses can be significantly discriminated for a range of dark matter masses with their splitting being the critical factor. We then investigate how including the effects of different interaction strengths, local densities or velocity dispersions for the two components modifies these conclusions. We also consider the case of isospin-violating couplings. In all scenarios, we show results for various types of nuclei both for elastic spin-independent and spin-dependent interactions. Finally, assuming that the two-component hypothesis is confirmed, we quantify the accuracy with which the parameters can be extracted and discuss the different degeneracies that occur. This includes studying the case in which only a single experiment observes a signal, and also the scenario of having two signals from two different experiments, in which case the ratios of the couplings to neutrons and protons may also be extracted.

  8. Detectability of planetary rings around super-earths by direct infrared imaging

    International Nuclear Information System (INIS)

    Morel, Carine

    2013-01-01

    Super-Earths, of which more than 80 have already been discovered, draw a lot of attention. With masses between those of the Earth and Neptune, they are ideal targets for searching for bio-signatures. All the gas giants of the solar system have a ring system, and even the Earth is suspected to have had rings in the past; their presence around super-Earths is thus expected and could give information on the formation process of these planets. The characterization of Super-Earths and their environment has thus become an important goal of modern astronomy. They are still difficult to study because of their small size, but the potential presence of planetary rings can make them easier to observe by the transit method and by direct imaging. This PhD evaluates the possibilities of detecting and characterizing rings around super-Earths by direct infrared imaging with the ELT-METIS instrument. To do this, a model to simulate the thermal emission of a super-Earth and its rings is developed. It is then used to study the influence of physical parameters and orientation of the rings and of planetary orbit on their detectability. The results show that ELT-METIS will be able to detect rings similar to the B and C rings of Saturn, extended within the Roche limit. The super-Earths surrounded by rings will be observable in middle orbit, between about 0.4 and 1 AU, around hot stars within 20 pc of the Sun. It is also shown that the photometric monitoring along the orbit of a super-Earth surrounded by rings should help constrain some of their physical characteristics. (author) [fr

  9. Direct detection of Trichomonas vaginalis virus in Trichomonas vaginalis positive clinical samples from the Netherlands.

    Science.gov (United States)

    Jehee, Ivo; van der Veer, Charlotte; Himschoot, Michelle; Hermans, Mirjam; Bruisten, Sylvia

    2017-12-01

    Trichomonas vaginalis is the most common sexually transmitted parasitical infection worldwide. T. vaginalis can carry a virus: Trichomonas vaginalis virus (TVV). To date, four TVV species have been described. Few studies have investigated TVV prevalence and its clinical importance. We have developed a nested reverse-transcriptase PCR, with novel, type specific primers to directly detect TVV RNA in T. vaginalis positive clinical samples. A total of 119T. vaginalis positive clinical samples were collected in Amsterdam and "s-Hertogenbosch, the Netherlands, from 2012 to 2016. For all samples T. vaginalis was genotyped using multi-locus sequence typing. The T. vaginalis positive samples segregated into a two-genotype population: type I (n=64) and type II (n=55). All were tested for TVV with the new TVV PCR. We detected 3 of the 4 TVV species. Sequencing of the amplified products showed high homology with published TVV genomes (82-100%). Half of the T. vaginalis clinical samples (n=60, 50.4%) were infected with one or more TVV species, with a preponderance for TVV infections in T. vaginalis type I (n=44, 73.3%). Clinical data was available for a subset of samples (n=34) and we observed an association between testing positive for (any) TVV and reporting urogenital symptoms (p=0.023). The nested RT-PCR allowed for direct detection of TVV in T. vaginalis positive clinical samples. This may be helpful in studies and clinical settings, since T. vaginalis disease and/or treatment outcome may be influenced by the protozoa"s virus. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Development of Piezoelectric DNA-Based Biosensor for Direct Detection of Mycobacterium Tuberculosis in Clinical Specimens

    Directory of Open Access Journals (Sweden)

    Thongchai KAEWPHINIT

    2010-02-01

    Full Text Available This study was focused on establishment of piezoelectric biosensor for direct detection of Mycobacterium tuberculosis (MTB in clinical specimens. The quartz crystal immobilized via 3-mercaptopropionic acid (MPA/avidin/DNA biotinylated probe on gold surface and hybridization of the DNA target to DNA biotinylated probe. The optimal concentration of MPA, avidin and 5’-biotinylated DNA probe for immobilization of specific DNA probe on gold surface were 15 mM, 0.1 mg/ml and 1.5 μM, respectively. The detection of genomic DNA digestion in the range from 0.5 to 30 μg/ml. The fabricated biosensor was evaluated through an examination of 200 samples. No cross hybridization were observed against M. avium complex (MAC and other microorganism. This target DNA preparation without amplification will reduce time consuming, costs, and the tedious step of amplification. This study can be extended to develop the new method which is high sensitivity, specificity, cheap, easy to use, and rapid for detection of MTB in many fields.

  11. A survey of direct inversion methods having possible application to tunnel detection

    International Nuclear Information System (INIS)

    Mager, R.D.

    1985-01-01

    Within recent years there has been considerable interest in the development of geophysical methods for the location of hidden underground tunnels and cavities. Consideration of this problem has been motivated by military applications, such as the detection of shallow man-made tunnels and arm caches, as well as civilian applications such as detection of limestone cavities in karst terrain and the mapping of abandoned mine workings. There are also applications for in-situ coal gasification and for the monitoring of nuclear waste disposal sites. The most reliable method presently used to map these underground anomalies has been direct detection by closely spaced drilling. However, the high cost of drilling renders this method impractical except for detailed and localized mapping, and certainly unfeasible for any type of broad-scale reconnaissance activity. Largely motivated by petroleum and mineral exploration needs, however, the seismic industry has seen a virtual revolution in acquisition and processing techniques within the past ten years. Paralleling these developments have been corresponding developments in acoustical imaging and non-destructive testing. Researchers in the field of inverse scattering have produced a number of new methods for target imaging from backscattered reflection data

  12. Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.

    Science.gov (United States)

    Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2017-09-28

    Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.

  13. Mixed Wino Dark Matter: consequences for direct, indirect and collider detection

    International Nuclear Information System (INIS)

    Baer, Howard; Mustafayev, Azar; Park, Eun-Kyung; Profumo, Stefano

    2005-01-01

    In supersymmetric models with gravity-mediated SUSY breaking and gaugino mass unification, the predicted relic abundance of neutralinos usually exceeds the strict limits imposed by the WMAP collaboration. One way to obtain the correct relic abundance is to abandon gaugino mass universality and allow a mixed wino-bino lightest SUSY particle (LSP). The enhanced annihilation and scattering cross sections of mixed wino dark matter (MWDM) compared to bino dark matter lead to enhanced rates for direct dark matter detection, as well as for indirect detection at neutrino telescopes and for detection of dark matter annihilation products in the galactic halo. For collider experiments, MWDM leads to a reduced but significant mass gap between the lightest neutralinos so that Z-tilde 2 two-body decay modes are usually closed. This means that dilepton mass edges- the starting point for cascade decay reconstruction at the CERN LHC- should be accessible over almost all of parameter space. Measurement of the m Z-tilde2 -m Z-tilde1 mass gap at LHC plus various sparticle masses and cross sections as a function of beam polarization at the International Linear Collider (ILC) would pinpoint MWDM as the dominant component of dark matter in the universe

  14. Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD)

    Science.gov (United States)

    Generazio, Edward R.

    2015-01-01

    Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD) Manual v.1.2 The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Design of experiments for validating probability of detection capability of nondestructive evaluation (NDE) systems (DOEPOD) is a methodology that is implemented via software to serve as a diagnostic tool providing detailed analysis of POD test data, guidance on establishing data distribution requirements, and resolving test issues. DOEPOD demands utilization of observance of occurrences. The DOEPOD capability has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit-Miss or signal amplitude testing. DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required. DOEPOD applications for supporting inspector qualifications is included.

  15. Detection of the Magnetic Easy Direction in Steels Using Induced Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Edgard M. Silva

    2016-12-01

    Full Text Available Conventional manufacturing processes cause plastic deformation that leads to magnetic anisotropy in processed materials. A deeper understanding of materials characterization under rotational magnetization enables engineers to optimize the overall volume, mass, and performance of devices such as electrical machines in industry. Therefore, it is important to find the magnetic easy direction of the magnetic domains in a simple and straightforward manner. The Magnetic easy direction can be obtained through destructive tests such as the Epstein frame method and the Single Sheet Tester by taking measurements in regions of irreversible magnetization usually called domains. In the present work, samples of rolled SAE 1045 steel (formed by perlite and ferrite microstructures were submitted to induced magnetic fields in the reversibility region of magnetic domains to detect the magnetic easy direction. The magnetic fields were applied to circular samples with different thicknesses and angles varying from 0° to 360° with steps of 45°. A square sample with a fixed thickness was also tested. The results showed that the proposed non-destructive approach is promising to evaluate the magnetic anisotropy in steels independently of the geometry of the sample. The region studied presented low induction losses and was affected by magnetic anisotropy, which did not occur in other works that only took into account regions of high induction losses.

  16. Direct detection of a break in the teraelectronvolt cosmic-ray spectrum of electrons and positrons

    Science.gov (United States)

    DAMPE Collaboration; Ambrosi, G.; An, Q.; Asfandiyarov, R.; Azzarello, P.; Bernardini, P.; Bertucci, B.; Cai, M. S.; Chang, J.; Chen, D. Y.; Chen, H. F.; Chen, J. L.; Chen, W.; Cui, M. Y.; Cui, T. S.; D'Amone, A.; de Benedittis, A.; De Mitri, I.; di Santo, M.; Dong, J. N.; Dong, T. K.; Dong, Y. F.; Dong, Z. X.; Donvito, G.; Droz, D.; Duan, K. K.; Duan, J. L.; Duranti, M.; D'Urso, D.; Fan, R. R.; Fan, Y. Z.; Fang, F.; Feng, C. Q.; Feng, L.; Fusco, P.; Gallo, V.; Gan, F. J.; Gao, M.; Gao, S. S.; Gargano, F.; Garrappa, S.; Gong, K.; Gong, Y. Z.; Guo, D. Y.; Guo, J. H.; Hu, Y. M.; Huang, G. S.; Huang, Y. Y.; Ionica, M.; Jiang, D.; Jiang, W.; Jin, X.; Kong, J.; Lei, S. J.; Li, S.; Li, X.; Li, W. L.; Li, Y.; Liang, Y. F.; Liang, Y. M.; Liao, N. H.; Liu, H.; Liu, J.; Liu, S. B.; Liu, W. Q.; Liu, Y.; Loparco, F.; Ma, M.; Ma, P. X.; Ma, S. Y.; Ma, T.; Ma, X. Q.; Ma, X. Y.; Marsella, G.; Mazziotta, M. N.; Mo, D.; Niu, X. Y.; Peng, X. Y.; Peng, W. X.; Qiao, R.; Rao, J. N.; Salinas, M. M.; Shang, G. Z.; H. Shen, W.; Shen, Z. Q.; Shen, Z. T.; Song, J. X.; Su, H.; Su, M.; Sun, Z. Y.; Surdo, A.; Teng, X. J.; Tian, X. B.; Tykhonov, A.; Vagelli, V.; Vitillo, S.; Wang, C.; Wang, H.; Wang, H. Y.; Wang, J. Z.; Wang, L. G.; Wang, Q.; Wang, S.; Wang, X. H.; Wang, X. L.; Wang, Y. F.; Wang, Y. P.; Wang, Y. Z.; Wen, S. C.; Wang, Z. M.; Wei, D. M.; Wei, J. J.; Wei, Y. F.; Wu, D.; Wu, J.; Wu, L. B.; Wu, S. S.; Wu, X.; Xi, K.; Xia, Z. Q.; Xin, Y. L.; Xu, H. T.; Xu, Z. L.; Xu, Z. Z.; Xue, G. F.; Yang, H. B.; Yang, P.; Yang, Y. Q.; Yang, Z. L.; Yao, H. J.; Yu, Y. H.; Yuan, Q.; Yue, C.; Zang, J. J.; Zhang, C.; Zhang, D. L.; Zhang, F.; Zhang, J. B.; Zhang, J. Y.; Zhang, J. Z.; Zhang, L.; Zhang, P. F.; Zhang, S. X.; Zhang, W. Z.; Zhang, Y.; Zhang, Y. J.; Zhang, Y. Q.; Zhang, Y. L.; Zhang, Y. P.; Zhang, Z.; Zhang, Z. Y.; Zhao, H.; Zhao, H. Y.; Zhao, X. F.; Zhou, C. Y.; Zhou, Y.; Zhu, X.; Zhu, Y.; Zimmer, S.

    2017-12-01

    High-energy cosmic-ray electrons and positrons (CREs), which lose energy quickly during their propagation, provide a probe of Galactic high-energy processes and may enable the observation of phenomena such as dark-matter particle annihilation or decay. The CRE spectrum has been measured directly up to approximately 2 teraelectronvolts in previous balloon- or space-borne experiments, and indirectly up to approximately 5 teraelectronvolts using ground-based Cherenkov γ-ray telescope arrays. Evidence for a spectral break in the teraelectronvolt energy range has been provided by indirect measurements, although the results were qualified by sizeable systematic uncertainties. Here we report a direct measurement of CREs in the energy range 25 gigaelectronvolts to 4.6 teraelectronvolts by the Dark Matter Particle Explorer (DAMPE) with unprecedentedly high energy resolution and low background. The largest part of the spectrum can be well fitted by a ‘smoothly broken power-law’ model rather than a single power-law model. The direct detection of a spectral break at about 0.9 teraelectronvolts confirms the evidence found by previous indirect measurements, clarifies the behaviour of the CRE spectrum at energies above 1 teraelectronvolt and sheds light on the physical origin of the sub-teraelectronvolt CREs.

  17. Detection of irradiated poultry products using the direct epifluorescence filter technique

    International Nuclear Information System (INIS)

    Copin, M.P.; Bourgeois, C.

    1992-01-01

    Food irradiation has developed during the last few years. Nevertheless this development would be larger if there was a recognized method to detect whether a foodstuff had been irradiated. BETTS et al. (1988) suggested a method based on the comparison of an aerobic plate count (APC) with a count obtained using the Direct Epifluorescence Filter Technique (DEFT). They showed that the APC of an irradiated product was considerably lower than that obtained by the DEFT; in this case the DEFT count gave an indication of the number of viable microbial population in the product before irradiation; the APC of a non irradiated product was very well correlated with the DEFT count. In the present work both methods were tested on deep frozen mechanically deboned chicken meat (MDCM) and fresh chicken meat. The fluorochrome used for the DEFT was acridine orange; the mesophilic microflora was counted on 'Plate Count Agar'. According to the results obtained with the deep frozen MDCM, aerobic plate counts and DEFT counts are very similar during 100 days of storage when the product has not been irradiated; if it has been irradiated the difference between the two counts is high (about two logarithmic units). With this method it is thus possible to detect an irradiated product and to know the number of viable microbial cells in the irradiated product before the treatment. The method was tested on fresh chicken meat stored at 4 deg C. At the beginning of the storage period, it is possible to detect irradiated products, but at the end the method fails. In the latter case, irradiation can be detected, but it would be impossible to say that a product had not been irradiated. This method is potentially applicable to deep frozen products, more than to fresh products

  18. Detecting paraprotein interference on a direct bilirubin assay by reviewing the photometric reaction data.

    Science.gov (United States)

    García-González, Elena; Aramendía, Maite; González-Tarancón, Ricardo; Romero-Sánchez, Naiara; Rello, Luis

    2017-07-26

    The direct bilirubin (D-Bil) assay on the AU Beckman Coulter instrumentation can be interfered by paraproteins, which may result in spurious D-Bil results. In a previous work, we took advantage of this fact to detect this interference, thus helping with the identification of patients with unsuspected monoclonal gammopathies. In this work, we investigate the possibility to detect interference based on the review of the photometric reactions, regardless of the D-Bil result. The D-Bil assay was carried out in a set of 2164 samples. It included a group of 164 samples with paraproteins (67 of which caused interference on the assay), as well as different groups of samples for which high absorbance background readings could also be expected (i.e. hemolyzed, lipemic, or icteric samples). Photometric reaction data were reviewed and receiver operating characteristics (ROC) curves were used to establish a cut-off for absorbance that best discriminates interference. The best cut-off was 0.0100 for the absorbance at the first photometric point of the complementary wavelength in the blank cuvette. Once the optimal cut-off for probable interference was selected, all samples analyzed in our laboratory that provided absorbance values above this cut-off were further investigated to try to discover paraproteins. During a period of 6 months, we detected 44 samples containing paraproteins, five of which belonged to patients with non-diagnosed monoclonal gammopathies. Review of the photometric reaction data permits the systematic detection of paraprotein interference on the D-Bil AU assay, even for samples for which reasonable results are obtained.

  19. Direct Detection of The Lyman Continuum of Star-forming Galaxies at z~3

    Science.gov (United States)

    Vasei, Kaveh; Siana, Brian; Shapley, Alice; Alavi, Anahita; Rafelski, Marc

    2018-01-01

    Star-forming galaxies are widely believed to be responsible for the reionization of the Universe and much of the ionizing background at z>3. Therefore, there has been much interest in quantifying the escape fraction of the Lyman continuum (LyC) radiation of the star-forming galaxies. Yet direct detection of LyC has proven to be exceptionally challenging. Despite numerous efforts only 7 galaxies at z2 have been robustly confirmed as LyC leakers. To avoid these challenges many studies use indirect methods to infer the LyC escape fraction. We tested these indirect methods by attempting to detect escaping LyC with a 10-orbit Hubble near-UV (F275W) image that is just below the Lyman limit at the redshift of the Cosmic Horseshoe (a lensed galaxy at z=2.4). We concluded that the measured escape fraction is lower, by more than a factor of five, than the expected escape fraction based on the indirect methods. This emphasizes that indirect determinations should only be interpreted as upper-limits. We also investigated the deepest near-UV Hubble images of the SSA22 field to detect LyC leakage from a large sample of candidate star-forming galaxies at z~3.1, whose redshift was obtained by deep Keck/LRIS spectroscopy and for which Keck narrow-band imaging was showing possible LyC leakage. The high spatial resolution of Hubble images is crucial to confirm our detections are clean from foreground contaminating galaxies, and also to ascertain the escape fraction of our final candidates. We identify five clean LyC emitting star-forming galaxies. The follow up investigation of these galaxies will significantly increase our knowledge of the LyC escape fraction and the mechanisms allowing for LyC escape.

  20. A Search for WIMP Dark Matter Using an Optimized Chi-square Technique on the Final Data from the Cryogenic Dark Matter Search Experiment (CDMS II)

    Energy Technology Data Exchange (ETDEWEB)

    Manungu Kiveni, Joseph [Syracuse Univ., NY (United States)

    2012-12-01

    This dissertation describes the results of a WIMP search using CDMS II data sets accumulated at the Soudan Underground Laboratory in Minnesota. Results from the original analysis of these data were published in 2009; two events were observed in the signal region with an expected leakage of 0.9 events. Further investigation revealed an issue with the ionization-pulse reconstruction algorithm leading to a software upgrade and a subsequent reanalysis of the data. As part of the reanalysis, I performed an advanced discrimination technique to better distinguish (potential) signal events from backgrounds using a 5-dimensional chi-square method. This dataanalysis technique combines the event information recorded for each WIMP-search event to derive a backgrounddiscrimination parameter capable of reducing the expected background to less than one event, while maintaining high efficiency for signal events. Furthermore, optimizing the cut positions of this 5-dimensional chi-square parameter for the 14 viable germanium detectors yields an improved expected sensitivity to WIMP interactions relative to previous CDMS results. This dissertation describes my improved (and optimized) discrimination technique and the results obtained from a blind application to the reanalyzed CDMS II WIMP-search data.

  1. Limits on light WIMPs with a 1 kg-scale germanium detector at 160 eVee physics threshold at the China Jinping Underground Laboratory

    Science.gov (United States)

    Yang, Li-Tao; Li, Hau-Bin; Yue, Qian; Kang, Ke-Jun; Cheng, Jian-Ping; Li, Yuan-Jing; Tsz-King Wong, Henry; Aǧartioǧlu, M.; An, Hai-Peng; Chang, Jian-Ping; Chen, Jing-Han; Chen, Yun-Hua; Deng, Zhi; Du, Qiang; Gong, Hui; He, Li; Hu, Jin-Wei; Hu, Qing-Dong; Huang, Han-Xiong; Jia, Li-Ping; Jiang, Hao; Li, Hong; Li, Jian-Min; Li, Jin; Li, Xia; Li, Xue-Qian; Li, Yu-Lan; Lin, Fong-Kay; Lin, Shin-Ted; Liu, Shu-Kui; Liu, Zhong-Zhi; Ma, Hao; Ma, Jing-Lu; Pan, Hui; Ren, Jie; Ruan, Xi-Chao; Sevda, B.; Sharma, Vivek; Shen, Man-Bin; Singh, Lakhwinder; Singh, Manoj Kumar; Tang, Chang-Jian; Tang, Wei-You; Tian, Yang; Wang, Ji-Min; Wang, Li; Wang, Qing; Wang, Yi; Wu, Shi-Yong; Wu, Yu-Cheng; Xing, Hao-Yang; Xu, Yin; Xue, Tao; Yang, Song-Wei; Yi, Nan; Yu, Chun-Xu; Yu, Hai-Jun; Yue, Jian-Feng; Zeng, Xiong-Hui; Zeng, Ming; Zeng, Zhi; Zhang, Yun-Hua; Zhao, Ming-Gang; Zhao, Wei; Zhou, Ji-Fang; Zhou, Zu-Ying; Zhu, Jing-Jun; Zhu, Zhong-Hua; CDEX Collaboration

    2018-01-01

    We report results of a search for light weakly interacting massive particle (WIMP) dark matter from the CDEX-1 experiment at the China Jinping Underground Laboratory (CJPL). Constraints on WIMP-nucleon spin-independent (SI) and spin-dependent (SD) couplings are derived with a physics threshold of 160 eVee, from an exposure of 737.1 kg-days. The SI and SD limits extend the lower reach of light WIMPs to 2 GeV and improve over our earlier bounds at WIMP mass less than 6 GeV. Supported by the National Key Research and Development Program of China (2017YFA0402200, 2017YFA0402201), the National Natural Science Foundation of China (11175099, 11275107, 11475117, 11475099, 11475092, 11675088), the National Basic Research Program of China (973 Program) (2010CB833006). We thank the support of grants from the Tsinghua University Initiative Scientific Research Program (20121088494, 20151080354) and the Academia Sinica Investigator Award 2011-15, contracts 103-2112-M-001-024 and 104-2112-M-001-038-MY3 from the Ministry of Science and Technology of Taiwan.

  2. Laser Noise and its Impact on the Performance of Intensity-Modulation with Direct-Detection Analog Photonic Links

    National Research Council Canada - National Science Library

    Urick, Vincent J; Devgan, Preetpaul S; McKinney, Jason D; Dexter, James L

    2007-01-01

    The equations for radio-frequency gain, radio-frequency noise figure, compression dynamic range and spurious-free dynamic range are derived for an analog photonic link employing intensity modulation and direct detection...

  3. Direct electrochemistry and electrocatalysis of a glucose oxidase-functionalized bioconjugate as a trace label for ultrasensitive detection of thrombin.

    Science.gov (United States)

    Bai, Lijuan; Yuan, Ruo; Chai, Yaqin; Yuan, Yali; Wang, Yan; Xie, Shunbi

    2012-11-18

    For the first time, a glucose oxidase-functionalized bioconjugate was prepared and served as a new trace label through its direct electrochemistry and electrocatalysis in a sandwich-type electrochemical aptasensor for ultrasensitive detection of thrombin.

  4. Quantitative radioautographic determination of brain tyrosine hydroxylase after direct transfer into nitro-cellulose and immunochemical detection

    International Nuclear Information System (INIS)

    Weissmann, D.; Labatut, R.; Gillon, J.Y.

    1988-01-01

    An improved quantitative immuno chemical determination of tyrosine hydroxylase brain concentrations was designed by using direct transfer into nitro-cellulose from 20 μm thick brain sections followed by immuno-detection and quantitative radioautography [fr

  5. FIRST STUDY OF DARK MATTER PROPERTIES WITH DETECTED SOLAR GRAVITY MODES AND NEUTRINOS

    Energy Technology Data Exchange (ETDEWEB)

    Turck-Chieze, S.; Garcia, R. A. [CEA/DSM/IRFU/SAp-AIM, CE Saclay, Orme des Merisiers, 91191 Gif-sur-Yvette (France); Lopes, I. [Centro Multidisciplinar de Astrofisica, Instituto Superior Tecnico, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Ballot, J. [Institut de Recherche en Astrophysique et Planetologie, CNRS, 14 avenue Edouard Belin and Universite de Toulouse, UPS-OMP, IRAP, 31400 Toulouse (France); Couvidat, S. [W.W. Hansen. E. P. L., Stanford University, Stanford, CA 94305 (United States); Mathur, S. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Salabert, D. [CNRS, Observatoire de la Cote d' Azur, Universite de Nice Sophia-Antipolis, BP 4229, 06304 Nice Cedex 4 (France); Silk, J., E-mail: Sylvaine.Turck-Chieze@cea.fr [UPMC-CNRS, UMR7095, Institut d' Astrophysique de Paris, F-75014 Paris (France)

    2012-02-10

    We derive new limits on the cold dark matter properties for weakly interacting massive particles (WIMPs), potentially trapped in the solar core by using for the first time the central temperature constrained by boron neutrinos and the central density constrained by the dipolar gravity modes detected with the Global Oscillations at Low Frequency/Solar Helioseismic Observatory instrument. These detections disfavor the presence of non-annihilating WIMPs for masses {<=}10 GeV and spin dependent cross-sections >5 Multiplication-Sign 10{sup -36} cm{sup 2} in the solar core but cannot constrain WIMP annihilation models. We suggest that in the coming years helio- and asteroseismology will provide complementary probes of dark matter.

  6. Improved security detection strategy in quantum secure direct communication protocol based on four-particle Green-Horne-Zeilinger state

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jian; Nie, Jin-Rui; Li, Rui-Fan [Beijing Univ. of Posts and Telecommunications, Beijing (China). School of Computer; Jing, Bo [Beijing Univ. of Posts and Telecommunications, Beijing (China). School of Computer; Beijing Institute of Applied Meteorology, Beijing (China). Dept. of Computer Science

    2012-06-15

    To enhance the efficiency of eavesdropping detection in the quantum secure direct communication protocol, an improved quantum secure direct communication protocol based on a four-particle Green-Horne-Zeilinger (GHZ) state is presented. In the protocol, the four-particle GHZ state is used to detect eavesdroppers, and quantum dense coding is used to encode the message. In the security analysis, the method of entropy theory is introduced, and two detection strategies are compared quantitatively by using the constraint between the information that the eavesdroppers can obtain and the interference that has been introduced. If the eavesdropper wants to obtain all the information, the detection rate of the quantum secure direct communication using an Einstein-Podolsky-Rosen (EPR) pair block will be 50% and the detection rate of the presented protocol will be 87%. At last, the security of the proposed protocol is discussed. The analysis results indicate that the protocol proposed is more secure than the others. (orig.)

  7. The detection of irradiated foods using the Direct Epifluorescent Filter Technique

    International Nuclear Information System (INIS)

    Betts, R.P.; Bankes, P.; Stringer, M.F.; Farr, L.

    1988-01-01

    A method was evaluated which has the potential to detect a food sample which has been irradiated. The technique will give an indication of the total number of viable micro-organisms present before irradiation. It is based on the comparison of an aerobic plate count (APC) with a count obtained using the Direct Epifluorescent Filter Technique (DEFT). When the APC of an irradiated sample was compared with the DEFT count on the same sample, the APC was considerably lower than that obtained by DEFT. The count of orange fluorescing cells after irradiation, however, correlated well with an APC of the same sample before irradiation. For the samples examined the DEFT count determined the viable microbial population in the sample before irradiation. The difference between the APC and the DEFT count gave the number of organisms rendered non-viable by the process. (author)

  8. Effect of gravitational focusing on annual modulation in dark-matter direct-detection experiments.

    Science.gov (United States)

    Lee, Samuel K; Lisanti, Mariangela; Peter, Annika H G; Safdi, Benjamin R

    2014-01-10

    The scattering rate in dark-matter direct-detection experiments should modulate annually due to Earth's orbit around the Sun. The rate is typically thought to be extremized around June 1, when the relative velocity of Earth with respect to the dark-matter wind is maximal. We point out that gravitational focusing can alter this modulation phase. Unbound dark-matter particles are focused by the Sun's gravitational potential, affecting their phase-space density in the lab frame. Gravitational focusing can result in a significant overall shift in the annual-modulation phase, which is most relevant for dark matter with low scattering speeds. The induced phase shift for light O(10)  GeV dark matter may also be significant, depending on the threshold energy of the experiment.

  9. First direct detection limits on sub-GeV dark matter from XENON10.

    Science.gov (United States)

    Essig, Rouven; Manalaysay, Aaron; Mardon, Jeremy; Sorensen, Peter; Volansky, Tomer

    2012-07-13

    The first direct detection limits on dark matter in the MeV to GeV mass range are presented, using XENON10 data. Such light dark matter can scatter with electrons, causing ionization of atoms in a detector target material and leading to single- or few-electron events. We use 15  kg day of data acquired in 2006 to set limits on the dark-matter-electron scattering cross section. The strongest bound is obtained at 100 MeV where σ(e)dark-matter masses between 20 MeV and 1 GeV are bounded by σ(e)dark-matter candidates with masses well below the GeV scale.

  10. Hypercharged dark matter and direct detection as a probe of reheating.

    Science.gov (United States)

    Feldstein, Brian; Ibe, Masahiro; Yanagida, Tsutomu T

    2014-03-14

    The lack of new physics at the LHC so far weakens the argument for TeV scale thermal dark matter. On the other hand, heavier, nonthermal dark matter is generally difficult to test experimentally. Here we consider the interesting and generic case of hypercharged dark matter, which can allow for heavy dark matter masses without spoiling testability. Planned direct detection experiments will be able to see a signal for masses up to an incredible 1010  GeV, and this can further serve to probe the reheating temperature up to about 109  GeV, as determined by the nonthermal dark matter relic abundance. The Z-mediated nature of the dark matter scattering may be determined in principle by comparing scattering rates on different detector nuclei, which in turn can reveal the dark matter mass. We will discuss the extent to which future experiments may be able to make such a determination.

  11. Signatures of Earth-scattering in the direct detection of Dark Matter

    DEFF Research Database (Denmark)

    Kavanagh, Bradley J.; Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation...... of this 'Earth-scattering' effect in the regime where DM particles scatter at most once before reaching the detector. We perform the calculation self-consistently, taking into account not only those particles which are scattered away from the detector, but also those particles which are deflected towards...... the detector. Taking into account a realistic model of the Earth and allowing for a range of DM-nucleon interactions, we present the EarthShadow code, which we make publicly available, for calculating the DM velocity distribution after Earth-scattering. Focusing on low-mass DM, we find that Earth...

  12. arXiv Inelastic Boosted Dark Matter at Direct Detection Experiments

    CERN Document Server

    Giudice, Gian F.; Park, Jong-Chul; Shin, Seodong

    2018-05-10

    We explore a novel class of multi-particle dark sectors, called Inelastic Boosted Dark Matter (iBDM). These models are constructed by combining properties of particles that scatter off matter by making transitions to heavier states (Inelastic Dark Matter) with properties of particles that are produced with a large Lorentz boost in annihilation processes in the galactic halo (Boosted Dark Matter). This combination leads to new signals that can be observed at ordinary direct detection experiments, but require unconventional searches for energetic recoil electrons in coincidence with displaced multi-track events. Related experimental strategies can also be used to probe MeV-range boosted dark matter via their interactions with electrons inside the target material.

  13. Investigation of PMD in direct-detection optical OFDM with zero padding.

    Science.gov (United States)

    Li, Xiang; Alphones, Arokiaswami; Zhong, Wen-De; Yu, Changyuan

    2013-09-09

    We investigate the polarization-mode dispersion (PMD) effect of zero padding OFDM (ZP-OFDM) in direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) systems. We first study the conventional equalization method for ZP-OFDM. Then an equalization method based on sorted QR decomposition is proposed to further improve the performance. It is found that the performance improvement of ZP-OFDM is due to the frequency domain oversampling (FDO) induced inter-carrier interference (ICI). Numerical simulation results show that compared with cyclic prefix OFDM (CP-OFDM), ZP-OFDM has a significantly higher tolerance to PMD in DDO-OFDM systems when the channel spectral nulls occur at certain differential group delay (DGD) values.

  14. Direct Measurement of Trace Elemental Mercury in Hydrocarbon Matrices by Gas Chromatography with Ultraviolet Photometric Detection.

    Science.gov (United States)

    Gras, Ronda; Luong, Jim; Shellie, Robert A

    2015-11-17

    We introduce a technique for the direct measurement of elemental mercury in light hydrocarbons such as natural gas. We determined elemental mercury at the parts-per-trillion level with high precision [photometric detection (GC-UV) at 254 nm. Our approach requires a small sample volume (1 mL) and does not rely on any form of sample preconcentration. The GC-UV separation employs an inert divinylbenzene porous layer open tubular column set to separate mercury from other components in the sample matrix. We incorporated a 10-port gas-sampling valve in the GC-UV system, which enables automated sampling, as well as back flushing capability to enhance system cleanliness and sample throughput. Total analysis time is 98% over this range.

  15. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Science.gov (United States)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  16. FARADAY CUP AWARD: High Sensitivity Tune Measurement using Direct Diode Detection

    CERN Document Server

    Gasior, M

    2012-01-01

    Direct Diode Detection (3D) is a technique developed at CERN initially for the LHC tune measurement system, to reach a sensitivity allowing observation of beam betatron oscillations with amplitudes below a micrometre. In this technique simple peak diode detectors are used to convert short beam pulses from a beam position pick-up into slowly varying signals. Their DC components, constituting a large background related to beam offsets, are suppressed by series capacitors, while the small signals related to beam oscillations are passed to the subsequent stages for amplification and filtering. As the demodulated beam oscillation signals are already in the kHz range, their processing is simple and they can be digitised with high resolution audio ADCs. This paper presents the history as well as the adventures of the 3D development and prototyping, along with some technical details. It documents a very efficient collaboration between CERN and Brookhaven National Laboratory (BNL), with contributions from other labora...

  17. A multifunctional molecularly imprinted polymer-based biosensor for direct detection of doxycycline in food samples

    DEFF Research Database (Denmark)

    Ashley, Jon; Feng, Xiaotong; Sun, Yi

    2018-01-01

    In this study, we developed a new type of multifunctional molecularly imprinted polymer (MIP) composite as an all-in-one biosensor for the low-cost, rapid and sensitive detection of doxycycline in pig plasma. The MIP composite consisted of a magnetic core for ease of manipulation, and a shell...... of fluorescent MIPs for selective recognition of doxycycline. By simply incorporating a small amount of fluorescent monomer (fluorescein-Oacrylate), the fluorescent MIP layer was successfully grafted onto the magnetic core via a surface imprinting technique. The resultant MIP composites showed significant....... The multifunctional MIP composites were used to directly extract doxycycline from spiked pig plasma samples and quantify the antibiotics based on the quenched fluorescence signals. Recoveries of doxycycline were found in the range of 88–107%....

  18. Fiber-optic Michelson interferometer fixed in a tilted tube for direction-dependent ultrasonic detection

    Science.gov (United States)

    Gang, Tingting; Hu, Manli; Qiao, Xueguang; Li, JiaCheng; Shao, Zhihua; Tong, Rongxin; Rong, Qiangzhou

    2017-01-01

    A fiber-optic interferometer is proposed and demonstrated experimentally for ultrasonic detection. The sensor consists of a compact Michelson interferometer (MI), which is fixed in a tilted-tube end-face (45°). Thin gold films are used for the reflective coatings of two arms and one of the interference arms is etched serving as the sensing arm. The spectral sideband filter technique is used to interrogate the continuous and pulse ultrasonic signals (with frequency of 300 KHz). Furthermore, because of the asymmetrical structure of the sensor, it presents strong direction-dependent ultrasonic sensitivity, such that the sensor can be considered a vector detector. The experimental results show that the sensor is highly sensitive to ultrasonic signals, and thus it can be a candidate for ultrasonic imaging of seismic physical models.

  19. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    International Nuclear Information System (INIS)

    Phuong Dinh Tam; Mai Anh Tuan; Tran Trung; Nguyen Duc Chien

    2009-01-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  20. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Phuong Dinh Tam; Mai Anh Tuan [International Training Institute for Materials Science (Viet Nam); Tran Trung [Department of Electrochemistry, Hung-Yen University of Technology and Education (Viet Nam); Nguyen Duc Chien [Institute of Engineering Physics, Hanoi University of Technology, 1 Dai Co Viet Road, Hanoi (Viet Nam)], E-mail: tr_trunghut@yahoo.com

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  1. A method of simulating intensity modulation-direct detection WDM systems

    Institute of Scientific and Technical Information of China (English)

    HUANG Jing; YAO Jian-quan; LI En-bang

    2005-01-01

    In the simulation of Intensity Modulation-Direct Detection WDM Systems,when the dispersion and nonlinear effects play equally important roles,the intensity fluctuation caused by cross-phase modulation may be overestimated as a result of the improper step size.Therefore,the step size in numerical simulation should be selected to suppress false XPM intensity modulation (keep it much less than signal power).According to this criterion,the step size is variable along the fiber.For a WDM system,the step size depends on the channel separation.Different type of transmission fiber has different step size.In the split-step Fourier method,this criterion can reduce simulation time,and when the step size is bigger than 100 meters,the simulation accuracy can also be improved.

  2. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    Energy Technology Data Exchange (ETDEWEB)

    Mascagni, Daniela Branco Tavares [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Miyazaki, Celina Massumi [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil); Cruz, Nilson Cristino da [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Leite de Moraes, Marli [Federal University of São Paulo, Unifesp, Campus São José dos Campos, SP (Brazil); Riul, Antonio [University of Campinas - Unicamp, Campinas, São Paulo (Brazil); Ferreira, Marystela, E-mail: marystela@ufscar.br [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil)

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L{sup ‐1} and sensitivity of 2.47 μA·cm{sup −2}·mmol{sup −1}·L for glucose with the (GPDDA/GPSS){sub 1}/(GPDDA/GOx){sub 2} architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  3. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    International Nuclear Information System (INIS)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; Cruz, Nilson Cristino da; Leite de Moraes, Marli; Riul, Antonio; Ferreira, Marystela

    2016-01-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L ‐1 and sensitivity of 2.47 μA·cm −2 ·mmol −1 ·L for glucose with the (GPDDA/GPSS) 1 /(GPDDA/GOx) 2 architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  4. Rapid Detection of Thrombin and Other Protease Activity Directly in Whole Blood

    Science.gov (United States)

    Yu, Johnson Chung Sing

    Thrombin is a serine protease that plays a key role in the clotting cascade to promote hemostasis following injury to the endothelium. From a clinical diagnostic perspective, in-vivo thrombin activity is linked to various blood clotting disorders, as well as cardiovascular disease (DVT, arteriosclerosis, etc). Thus, the ability to rapidly measure protease activity directly in whole blood will provide important new diagnostics, and clinical researchers with a powerful tool to further elucidate the relationship between circulating protease levels and disease. The ultimate goal is to design novel point of care (POC) diagnostic devices that are capable of monitoring protease activities directly in whole blood and biological sample. A charge-changing substrate specific to the thrombin enzyme was engineered and its functionality was confirmed by a series of experiments. This led to the preliminary design, construction, and testing of two device platforms deemed fully functional for the electrophoretic separation and focusing of charged peptide fragments. The concept of using the existing charge-changing substrate platform for bacterial protease detection was also investigated. Certain strains of E coli are associated with severe symptoms such as abdominal cramps, bloody diarrhea, and vomiting. The OmpT protease is expressed on the outer membrane of E coli and plays a role in the cleavage of antimicrobial peptides, the degradation of recombinant heterologous proteins, and the activation of plasminogen in the host. Thus, a synthetic peptide substrate specific to the OmpT protease was designed and modeled for the purpose of detecting E coli in biological sample.

  5. Receiver bandwidth effects on complex modulation and detection using directly modulated lasers.

    Science.gov (United States)

    Yuan, Feng; Che, Di; Shieh, William

    2016-05-01

    Directly modulated lasers (DMLs) have long been employed for short- and medium-reach optical communications due to their low cost. Recently, a new modulation scheme called complex modulated DMLs has been demonstrated showing a significant optical signal to noise ratio sensitivity enhancement compared with the traditional intensity-only detection scheme. However, chirp-induced optical spectrum broadening is inevitable in complex modulated systems, which may imply a need for high-bandwidth receivers. In this Letter, we study the impact of receiver bandwidth effects on the performance of complex modulation and coherent detection systems based on DMLs. We experimentally demonstrate that such systems exhibit a reasonable tolerance for the reduced receiver bandwidth. For 10 Gbaud 4-level pulse amplitude modulation signals, the required electrical bandwidth is as low as 8.5 and 7.5 GHz for 7% and 20% forward error correction, respectively. Therefore, it is feasible to realize DML-based complex modulated systems using cost-effective receivers with narrow bandwidth.

  6. Directly Detecting MeV-Scale Dark Matter Via Solar Reflection.

    Science.gov (United States)

    An, Haipeng; Pospelov, Maxim; Pradler, Josef; Ritz, Adam

    2018-04-06

    If dark matter (DM) particles are lighter than a few   MeV/c^{2} and can scatter off electrons, their interaction within the solar interior results in a considerable hardening of the spectrum of galactic dark matter received on Earth. For a large range of the mass versus cross section parameter space, {m_{e},σ_{e}}, the "reflected" component of the DM flux is far more energetic than the end point of the ambient galactic DM energy distribution, making it detectable with existing DM detectors sensitive to an energy deposition of 10-10^{3}  eV. After numerically simulating the small reflected component of the DM flux, we calculate its subsequent signal due to scattering on detector electrons, deriving new constraints on σ_{e} in the MeV and sub-MeV range using existing data from the XENON10/100, LUX, PandaX-II, and XENON1T experiments, as well as making projections for future low threshold direct detection experiments.

  7. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection.

    Science.gov (United States)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; da Cruz, Nilson Cristino; de Moraes, Marli Leite; Riul, Antonio; Ferreira, Marystela

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4μmol·L(-1) and sensitivity of 2.47μA·cm(-2)·mmol(-1)·L for glucose with the (GPDDA/GPSS)1/(GPDDA/GOx)2 architecture, whose thickness was 19.80±0.28nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Direct sequencing of mitochondrial DNA detects highly divergent haplotypes in blue marlin (Makaira nigricans).

    Science.gov (United States)

    Finnerty, J R; Block, B A

    1992-06-01

    We were able to differentiate between species of billfish (Istiophoridae family) and to detect considerable intraspecific variation in the blue marlin (Makaira nigricans) by directly sequencing a polymerase chain reaction (PCR)-amplified, 612-bp fragment of the mitochondrial cytochrome b gene. Thirteen variable nucleotide sites separated blue marlin (n = 26) into 7 genotypes. On average, these genotypes differed by 5.7 base substitutions. A smaller sample of swordfish from an equally broad geographic distribution displayed relatively little intraspecific variation, with an average of 1.3 substitutions separating different genotypes. A cladistic analysis of blue marlin cytochrome b variants indicates two major divergent evolutionary lines within the species. The frequencies of these two major evolutionary lines differ significantly between Atlantic and Pacific ocean basins. This finding is important given that the Atlantic stocks of blue marlin are considered endangered. Migration from the Pacific can help replenish the numbers of blue marlin in the Atlantic, but the loss of certain mitochondrial DNA haplotypes in the Atlantic due to overfishing probably could not be remedied by an influx of Pacific fish because of their absence in the Pacific population. Fishery management strategies should attempt to preserve the genetic diversity within the species. The detection of DNA sequence polymorphism indicates the utility of PCR technology in pelagic fishery genetics.

  9. Layered ACO-OFDM for intensity-modulated direct-detection optical wireless transmission.

    Science.gov (United States)

    Wang, Qi; Qian, Chen; Guo, Xuhan; Wang, Zhaocheng; Cunningham, David G; White, Ian H

    2015-05-04

    Layered asymmetrically clipped optical orthogonal frequency division multiplexing (ACO-OFDM) with high spectral efficiency is proposed in this paper for optical wireless transmission employing intensity modulation with direct detection. In contrast to the conventional ACO-OFDM, which only utilizes odd subcarriers for modulation, leading to an obvious spectral efficiency loss, in layered ACO-OFDM, the subcarriers are divided into different layers and modulated by different kinds of ACO-OFDM, which are combined for simultaneous transmission. In this way, more subcarriers are used for data transmission and the spectral efficiency is improved. An iterative receiver is also proposed for layered ACO-OFDM, where the negative clipping distortion of each layer is subtracted once it is detected so that the signals from different layers can be recovered. Theoretical analysis shows that the proposed scheme can improve the spectral efficiency by up to 2 times compared with conventional ACO-OFDM approaches with the same modulation order. Meanwhile, simulation results confirm a considerable signal-to-noise ratio gain over ACO-OFDM at the same spectral efficiency.

  10. Direct-detection optical OFDM superchannel for long-reach PON using pilot regeneration.

    Science.gov (United States)

    Hu, Rong; Yang, Qi; Xiao, Xiao; Gui, Tao; Li, Zhaohui; Luo, Ming; Yu, Shaohua; You, Shanhong

    2013-11-04

    We demonstrate a novel long-reach PON downstream scheme based on the regenerated pilot assisted direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) superchannel transmission. We use the optical comb source to form DDO-OFDM superchannel, and reserve the center carrier as a seed pilot. The seed pilot is further tracked and reused to generate multiple optical carriers at the local exchange. Each regenerated pilot carrier is selected to beat with an adjacent OFDM sub-band at ONU, so that the electrical bandwidth limitation can be much released compared to the conventional DDO-OFDM superchannel detection. With the proposed proof-of-concept architecture, we experimentally demonstrated a 116.7 Gb/s superchannel OFDM-PON system with transmission reach of 100 km, and 1:64 splitting ratio. We analyze the impact of carrier-to-sideband power ratio (CSPR) on system performance. The experiment result shows that, 5 dB power margin is still remained at ONU using such technique.

  11. Probing GeV-scale MSSM neutralino dark matter in collider and direct detection experiments

    Science.gov (United States)

    Duan, Guang Hua; Wang, Wenyu; Wu, Lei; Yang, Jin Min; Zhao, Jun

    2018-03-01

    Given the recent constraints from the dark matter (DM) direct detections, we examine a light GeV-scale (2-30 GeV) neutralino DM in the alignment limit of the Minimal Supersymmetric Standard Model (MSSM). In this limit without decoupling, the heavy CP-even scalar H plays the role of the Standard Model (SM) Higgs boson while the other scalar h can be rather light so that the DM can annihilate through the h resonance or into a pair of h to achieve the observed relic density. With the current collider and cosmological constraints, we find that such a light neutralino DM above 6 GeV can be excluded by the XENON-1T (2017) limits while the survivied parameter space below 6 GeV can be fully tested by the future germanium-based light dark matter detections (such as CDEX), by the Higgs coupling precison measurements or by the production process e+e- → hA at an electron-positron collider (Higgs factory).

  12. Direct immune-detection of cortisol by chemiresistor graphene oxide sensor.

    Science.gov (United States)

    Kim, Yo-Han; Lee, Kyungmin; Jung, Hunsang; Kang, Hee Kyung; Jo, Jihoon; Park, In-Kyu; Lee, Hyun Ho

    2017-12-15

    In this study, a biosensor to detect a stress biomarker of cortisol using cortisol monoclonal antibody (c-Mab) covalently immobilized on reduced graphene oxide (rGO) channel as electrical sensing element was demonstrated. Highly specific immune-recognition between the c-Mab and the cortisol was identified and characterized on a basis of resistance change at the rGO channel based chemiresistor sensor achieving the limit of detection of 10pg/mL (27.6 pM). In addition, cortisol concentrations of real human salivary sample and buffer solution of rat adrenal gland acute slices, which could secret the cortisol induced by adrenocorticotropic hormone (ACTH), were directly measured by the chemiresistor corresponding to the specific sensing of the cortisol. The rGO chemiresistor could selectively measure the cortisol levels in spite of diverse neuroendocrine's existence. The potential perspective of this study can be a protocol of new cortisol sensor development, which will be applicable to point-of-care testing (POCT) targeted for salivary cortisol, in vitro psychobiological study on cortisol induction, and implantable sensor chip in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Directly Detecting MeV-Scale Dark Matter Via Solar Reflection

    Science.gov (United States)

    An, Haipeng; Pospelov, Maxim; Pradler, Josef; Ritz, Adam

    2018-04-01

    If dark matter (DM) particles are lighter than a few MeV /c2 and can scatter off electrons, their interaction within the solar interior results in a considerable hardening of the spectrum of galactic dark matter received on Earth. For a large range of the mass versus cross section parameter space, {me,σe}, the "reflected" component of the DM flux is far more energetic than the end point of the ambient galactic DM energy distribution, making it detectable with existing DM detectors sensitive to an energy deposition of 10 -103 eV . After numerically simulating the small reflected component of the DM flux, we calculate its subsequent signal due to scattering on detector electrons, deriving new constraints on σe in the MeV and sub-MeV range using existing data from the XENON10/100, LUX, PandaX-II, and XENON1T experiments, as well as making projections for future low threshold direct detection experiments.

  14. Direct detection of chicken genomic DNA for gender determination by thymine-DNA glycosylase.

    Science.gov (United States)

    Porat, N; Bogdanov, K; Danielli, A; Arie, A; Samina, I; Hadani, A

    2011-02-01

    1. Birds, especially nestlings, are generally difficult to sex by morphology and early detection of chick gender in ovo in the hatchery would facilitate removal of unwanted chicks and diminish welfare objections regarding culling after hatch. 2. We describe a method to determine chicken gender without the need for PCR via use of Thymine-DNA Glycosylase (TDG). TDG restores thymine (T)/guanine (G) mismatches to cytosine (C)/G. We show here, that like DNA Polymerase, TDG can recognise, bind and function on a primer hybridised to chicken genomic DNA. 3. The primer contained a T to mismatch a G in a chicken genomic template and the T/G was cleaved with high fidelity by TDG. Thus, the chicken genomic DNA can be identified without PCR amplification via direct and linear detection. Sensitivity was increased using gender specific sequences from the chicken genome. 4. Currently, these are laboratory results, but we anticipate that further development will allow this method to be used in non-laboratory settings, where PCR cannot be employed.

  15. Optimisation of a direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores.

    Science.gov (United States)

    Henczka, Marek; Djas, Małgorzata; Filipek, Katarzyna

    2013-01-01

    A direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores has been optimised. The results of the application of four types of growth media (BAT agar, YSG agar, K agar and SK agar) regarding the recovery and enumeration of A. acidoterrestris spores were compared. The influence of the type of applied growth medium, heat shock conditions, incubation temperature, incubation time, plating technique and the presence of apple juice in the sample on the accuracy of the detection and enumeration of A. acidoterrestris spores was investigated. Among the investigated media, YSG agar was the most sensitive medium, and its application resulted in the highest recovery of A. acidoterrestris spores, while K agar and BAT agar were the least suitable media. The effect of the heat shock time on the recovery of spores was negligible. When there was a low concentration of spores in a sample, the membrane filtration method was superior to the spread plating method. The obtained results show that heat shock carried out at 80°C for 10 min and plating samples in combination with membrane filtration on YSG agar, followed by incubation at 46°C for 3 days provided the optimal conditions for the detection and enumeration of A. acidoterrestris spores. Application of the presented method allows highly efficient, fast and sensitive identification and enumeration of A. acidoterrestris spores in food products. This methodology will be useful for the fruit juice industry for identifying products contaminated with A. acidoterrestris spores, and its practical application may prevent economic losses for manufacturers. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Search for non-baryonic dark matter with cryogenic detectors based on ionisation and heat detection. Analysis of experimental data from the Edelweiss-I experiment; Recherche de la matiere noire non-baryonique a l'aide de detecteurs cryogeniques a double composante ionisation et chaleur: Analyse et Interpretation des donnees de l'experience EDELWEISS-I

    Energy Technology Data Exchange (ETDEWEB)

    Sanglard, V

    2005-11-15

    The method of direct detection of WIMPs (weakly interactive massive particles) that are present in the halo of our galaxy rests on the detection of their interaction with a target nucleus. The Edelweiss experiment uses this technique with 3 cryogenic detectors operating on 2 modes ionization and heat. Each detector is made of a 320 g germanium crystal with 2 faces equipped with electrodes. In order to improve the collection of charges, an amorphous layer of Ge or Si is laid between the crystal surface and the electrodes. The validation of the detector system has been made with Co{sup 57} and Cs{sup 137} gamma sources and a Cf{sup 252} neutron source. We present a comparison with simulation results and experimental data for the validation of the response to nuclear recoils. The whole experimental data collected by Edelweiss-I from 2000 till 2003 has been analysed. 40 events have been selected, 6 among them with an energy over 30 keV. Limits for the interaction cross-section between a WIMP and a nucleon have been deduced from the experimental data. The Yellin method has enabled us to determine a limit without knowing the background noise. The best sensitivity appears to be 1.5*10{sup -6} pb for a WIMP's mass of 80 GeV/c{sup 2} and a confidence level of 90 per cent. In terms of events, the limit for an energy range of 30 - 100 keV is 0.12 events per kg and per day. (A.C.)

  17. Direct Detection of Protein Biomarkers in Human Fluids Using Site-Specific Antibody Immobilization Strategies

    Directory of Open Access Journals (Sweden)

    Maria Soler

    2014-01-01

    Full Text Available Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  18. Direct growth of graphene on quartz substrates for label-free detection of adenosine triphosphate

    International Nuclear Information System (INIS)

    Xu, Shicai; Man, Baoyuan; Jiang, Shouzhen; Yue, Weiwei; Yang, Cheng; Liu, Mei; Chen, Chuansong; Zhang, Chao

    2014-01-01

    We demonstrate that continuous, uniform graphene films can be directly synthesized on quartz substrates using a two-temperature-zone chemical vapor deposition system and that their layers can be controlled by adjusting the precursor partial pressure. Raman spectroscopy and transmission electron microscopy confirm the formation of monolayer graphene with a grain size of ∼100 nm. Hall measurements show a room-temperature carrier mobility above 1500 cm 2  V −1  s −1 . The optical transmittance and conductance of the graphene films are comparable to those of transferred metal-catalyzed graphene. The method avoids the complicated and skilled post-growth transfer process and allows the graphene to be directly incorporated into a fully functional biosensor for label-free detection of adenosine triphosphate (ATP). This device shows a fast response time of a few milliseconds and achieves a high sensitivity to ATP molecules over a very wide range from 0.002 to 5 mM. (paper)

  19. Detection and direction discrimination of single vortex rings by harbour seals (Phoca vitulina).

    Science.gov (United States)

    Krüger, Yvonne; Hanke, Wolf; Miersch, Lars; Dehnhardt, Guido

    2018-04-25

    Harbour seals possess highly sensitive vibrissae that enable them to track hydrodynamic trails left behind by a swimming fish. Most of these trails contain vortex rings as a main hydrodynamic component. They may reveal information about their generator as the trails differ depending on the fish species, the fish's body shape, size and swimming style. In addition, fish generate single vortex rings in diverse natural situations. In this study, the ability of blindfolded stationary harbour seals to detect and analyse single vortex rings regarding directional information has been investigated. In three different behavioural experiments, the animals were trained to respond to single artificially generated vortex rings. The results show that harbour seals are able to respond to a variety of different vortex rings upon vibrissal stimulation. The investigation of the minimum hydrodynamically perceivable angle revealed that it is at least as small as 5.7 deg, which was the smallest adjustable angle. Moreover, harbour seals are capable of analysing the travel direction of a vortex ring perceived by the mystacial vibrissae irrespective of whether the vibrissae were stimulated ipsilaterally or contralaterally. In situations in which no complex hydrodynamic trail is available, it is advantageous for a hunting seal to be able to extract information from a single vortex ring. © 2018. Published by The Company of Biologists Ltd.

  20. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection

    International Nuclear Information System (INIS)

    Ellis, John; Evans, Jason L.; Olive, Keith A.; Luo, Feng; Nagata, Natsumi; Sandick, Pearl

    2016-01-01

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale M in below the grand unification (GUT) scale M GUT , a scenario referred to as 'sub-GUT'. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if M in is close to M GUT , but it may lie within its reach if M in

  1. Direct detection of protein biomarkers in human fluids using site-specific antibody immobilization strategies.

    Science.gov (United States)

    Soler, Maria; Estevez, M-Carmen; Alvarez, Mar; Otte, Marinus A; Sepulveda, Borja; Lechuga, Laura M

    2014-01-29

    Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  2. RadSensor: Xray Detection by Direct Modulation of an Optical Probe Beam

    International Nuclear Information System (INIS)

    Lowry, M E; Bennett, C V; Vernon, S P; Bond, T; Welty, R; Behymer, E; Petersen, H; Krey, A; Stewart, R; Kobayashi, N P; Sperry, V; Stephan, P; Reinhardt, C; Simpson, S; Stratton, P; Bionta, R; McKernan, M; Ables, E; Ott, L; Bond, S; Ayers, J.; Landen, O L; Bell, P M

    2003-01-01

    We present a new x-ray detection technique based on optical measurement of the effects of x-ray absorption and electron hole pair creation in a direct band-gap semiconductor. The electron-hole pairs create a frequency dependent shift in optical refractive index and absorption. This is sensed by simultaneously directing an optical carrier beam through the same volume of semiconducting medium that has experienced an xray induced modulation in the electron-hole population. If the operating wavelength of the optical carrier beam is chosen to be close to the semiconductor band-edge, the optical carrier will be modulated significantly in phase and amplitude. This approach should be simultaneously capable of very high sensitivity and excellent temporal response, even in the difficult high-energy xray regime. At xray photon energies near 10 keV and higher, we believe that sub-picosecond temporal responses are possible with near single xray photon sensitivity. The approach also allows for the convenient and EMI robust transport of high-bandwidth information via fiber optics. Furthermore, the technology can be scaled to imaging applications. The basic physics of the detector, implementation considerations, and preliminary experimental data are presented and discussed

  3. Direction detection thresholds of passive self-motion in artistic gymnasts.

    Science.gov (United States)

    Hartmann, Matthias; Haller, Katia; Moser, Ivan; Hossner, Ernst-Joachim; Mast, Fred W

    2014-04-01

    In this study, we compared direction detection thresholds of passive self-motion in the dark between artistic gymnasts and controls. Twenty-four professional female artistic gymnasts (ranging from 7 to 20 years) and age-matched controls were seated on a motion platform and asked to discriminate the direction of angular (yaw, pitch, roll) and linear (leftward-rightward) motion. Gymnasts showed lower thresholds for the linear leftward-rightward motion. Interestingly, there was no difference for the angular motions. These results show that the outstanding self-motion abilities in artistic gymnasts are not related to an overall higher sensitivity in self-motion perception. With respect to vestibular processing, our results suggest that gymnastic expertise is exclusively linked to superior interpretation of otolith signals when no change in canal signals is present. In addition, thresholds were overall lower for the older (14-20 years) than for the younger (7-13 years) participants, indicating the maturation of vestibular sensitivity from childhood to adolescence.

  4. Evaluation of an inexpensive growth medium for direct detection of Escherichia coli in temperate and sub-tropical waters

    CSIR Research Space (South Africa)

    Bain, RES

    2015-10-01

    Full Text Available . In these settings the problem is exacerbated by the lack of inexpensive media for the detection of E. coli in drinking water. We developed a new low-cost growth medium, aquatest (AT), and validated its use for the direct detection of E. coli in temperate and sub...

  5. Direct Detection and Imaging of Low-Energy Electrons with Delta-Doped Charge-Coupled Devices

    Science.gov (United States)

    Nikzad, S.; Yu, Q.; Smith, A. L.; Jones, T. J.; Tombrello, T. A.; Elliott, S. T.

    1998-01-01

    We report the use fo delta-doped charge-coupled devices (CCDs) for direct detection of electrons in the 50-1500 eV energy range. These are the first measurements with a solid state device to detect electrons in this energy range.

  6. Development of a modular directional and spectral neutron detection system using solid-state detectors

    Energy Technology Data Exchange (ETDEWEB)

    Weltz, A., E-mail: weltza3@gmail.com; Torres, B.; McElwain, L.; Dahal, R.; Huang, J.; Bhat, I.; Lu, J.; Danon, Y.

    2015-08-21

    A detection system using room-temperature, microstructured solid-state thermal neutron detectors with very low leakage current has been developed at Rensselaer Polytechnic Institute (RPI) with the ability to provide positional and spectral information about an unknown neutron source. The Directional and Spectral Neutron Detection System (DSNDS) utilizes a set of small-but-scalable, zero-bias solid-state thermal neutron detectors which have demonstrated high thermal neutron efficiency and adequate gamma insensitivity. The DSNDS can gather spectral information about an unknown neutron source with a relatively small number of detectors, simplifying the detector electronics and minimizing cost; however, the DSNDS is modular in design, providing the capability to increase the detection efficiency and angular resolution. The system used in this paper was comprised of a stack of five high-density polyethylene (HDPE) disks with a thickness of 5 cm and a diameter of 30 cm, the middle disk containing 16 detectors positioned as one internal (moderated) and one external (unmoderated) ring of solid-state neutron detectors. These two detector rings provide the ability to determine the directionality of a neutron source. The system gathers spectral information about a neutron source in two ways: by measuring the relative responses of the internal ring of detectors as well as measuring the ratio of the internal-to-external detector responses. Experiments were performed with variable neutron spectra: a {sup 252}Cf spontaneous fission neutron source which was HDPE moderated, HDPE reflected, lead (Pb) shielded, and bare in order to benchmark the system for spectral sensitivity. Simulations were performed in order to characterize the neutron spectra corresponding to each of the source configurations and showed agreement with experimental measurements. The DSNDS demonstrates the ability to determine the relative angle of the source and the hardness of the neutron spectrum. By using the

  7. Yersinia enterocolitica in slaughter pig tonsils: enumeration and detection by enrichment versus direct plating culture.

    Science.gov (United States)

    Van Damme, Inge; Habib, Ihab; De Zutter, Lieven

    2010-02-01

    Tonsil samples from 139 slaughter pigs were examined for the presence of pathogenic Yersinia enterocolitica by enrichment procedures based on the standard method ISO 10273:2003. In addition, samples were tested by direct plating method to evaluate its efficiency compared to the enrichment culture methods and to quantify the level of contamination in porcine tonsils. In total, 52 samples (37.4%) were positive for pathogenic Y. enterocolitica, all belonging to bioserotype 4/O:3. Fifty out of the 52 positive samples (96.2%) were detected by direct plating. Enumeration showed an average concentration of 4.5 log(10) CFU g(-1) and 4.4 log(10) CFU g(-1) tonsil on Salmonella-Shigella-desoxycholate-calcium chloride (SSDC) and cefsulodin-irgasan-novobiocin (CIN) agar plates, respectively. The enrichment procedures recommended by the ISO 10273:2003 method were not optimal for the isolation of pathogenic Y. enterocolitica from pig tonsils: two days enrichment in irgasan-ticarcillin-potassium chlorate (ITC) broth resulted in an isolation rate of 84.6%, while 5 days enrichment in peptone-sorbitol-bile (PSB) broth recovered only 59.6% of positive samples. Reducing the enrichment time in PSB from 5 to 2 days resulted in a significantly higher recovery rate (94.2%) and might serve as an appropriate enrichment protocol for the isolation of pathogenic Y. enterocolitica from pig tonsils. Compared to enrichment culture methods, results based on direct plating can be obtained in a shorter time course and provide quantitative data that might be needed for further risk assessment studies.

  8. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  9. EDELWEISS-II, direct Dark Matter search experiment: first data analysis and results

    International Nuclear Information System (INIS)

    Scorza, Silvia

    2009-01-01

    One of the greatest mysteries of the universe that, for the present, puzzles the mind of most astronomers, cosmologists and physicists is the question: 'What makes up our universe?'. This is due to how a certain substance named Dark Matter came under speculation. It is believed this enigmatic substance, of type unknown, accounts for almost three-quarters of the cosmos within the universe, could be the answer to several questions raised by the models of the expanding universe astronomers have created, and even decide the fate of the expansion of the universe. There is strong observational evidence for the dominance of non-baryonic Dark Matter (DM) over baryonic matter in the universe. Such evidence comes from many independent observations over different length scales. The most stringent constraint on the abundance of DM comes from the analysis of the Cosmic Microwave Background (CMB) anisotropies. In particular, the WMAP (Wilkinson Microwave Anisotropy Probe) experiment restricts the abundance of matter and the abundance of baryonic matter in good agreement with predictions from Big Bang Nucleosynthesis. It is commonly believed that such a non-baryonic component could consist of new, as yet undiscovered, particles, usually referred to as WIMPs (Weakly Interacting Massive Particles). Some extensions of the standard model (SM) of particle physics predict the existence of particles that would be excellent DM candidates. In particular great attention has been dedicated to candidates arising in supersymmetric theories: the Lightest Supersymmetric Particle (LSP). In the most supersymmetric scenarios, the so-called neutralino seems to be a natural candidate, being stable in theories with conservation of R-parity and having masses and cross sections of typical WIMPs. The EDELWEISS collaboration is a direct dark matter search experiment, aiming to detect directly a WIMP interaction in a target material, high purity germanium crystal working at cryogenic temperatures. It

  10. Direct detection of metal-insulator phase transitions using the modified Backus-Gilbert method

    Directory of Open Access Journals (Sweden)

    Ulybyshev Maksim

    2018-01-01

    Full Text Available The detection of the (semimetal-insulator phase transition can be extremely difficult if the local order parameter which characterizes the ordered phase is unknown. In some cases, it is even impossible to define a local order parameter: the most prominent example of such system is the spin liquid state. This state was proposed to exist in the Hubbard model on the hexagonal lattice in a region between the semimetal phase and the antiferromagnetic insulator phase. The existence of this phase has been the subject of a long debate. In order to detect these exotic phases we must use alternative methods to those used for more familiar examples of spontaneous symmetry breaking. We have modified the Backus-Gilbert method of analytic continuation which was previously used in the calculation of the pion quasiparticle mass in lattice QCD. The modification of the method consists of the introduction of the Tikhonov regularization scheme which was used to treat the ill-conditioned kernel. This modified Backus-Gilbert method is applied to the Euclidean propagators in momentum space calculated using the hybrid Monte Carlo algorithm. In this way, it is possible to reconstruct the full dispersion relation and to estimate the mass gap, which is a direct signal of the transition to the insulating state. We demonstrate the utility of this method in our calculations for the Hubbard model on the hexagonal lattice. We also apply the method to the metal-insulator phase transition in the Hubbard-Coulomb model on the square lattice.

  11. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    . The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result......A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry....

  12. Inhomogeneities detection in annual precipitation time series in Portugal using direct sequential simulation

    Science.gov (United States)

    Caineta, Júlio; Ribeiro, Sara; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2014-05-01

    Climate data homogenisation is of major importance in monitoring climate change, the validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. This happens because non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on geostatistical simulation (DSS - direct sequential simulation), where local probability density functions (pdf) are calculated at candidate monitoring stations, using spatial and temporal neighbouring observations, and then are used for detection of inhomogeneities. This approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). This study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneities detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall test, Wald-Wolfowitz runs test, Von Neumann ratio test, Standard normal homogeneity test (SNHT) for a single break, Pettit test, and Buishand range test). Moreover, a sensibility analysis is implemented to investigate the number of simulated realisations that should be used to accurately infer the local pdfs. Accordingly, the number of simulations per iteration is increased from 50 to 500, which resulted in a more representative local pdf. A set of default and recommended settings is provided, which will help

  13. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system.

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  14. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  15. Assessing Compatibility of Direct Detection Data: Halo-Independent Global Likelihood Analyses

    CERN Document Server

    Gelmini, Graciela B.

    2016-10-18

    We present two different halo-independent methods utilizing a global maximum likelihood that can assess the compatibility of dark matter direct detection data given a particular dark matter model. The global likelihood we use is comprised of at least one extended likelihood and an arbitrary number of Poisson or Gaussian likelihoods. In the first method we find the global best fit halo function and construct a two sided pointwise confidence band, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a "constrained parameter goodness-of-fit" test statistic, whose $p$-value we then use to define a "plausibility region" (e.g. where $p \\geq 10\\%$). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. $p < 10 \\%$). As an example we apply these methods to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic s...

  16. Direct detection signatures of self-interacting dark matter with a light mediator

    International Nuclear Information System (INIS)

    Nobile, Eugenio Del; Kaplinghat, Manoj; Yu, Hai-Bo

    2015-01-01

    Self-interacting dark matter (SIDM) is a simple and well-motivated scenario that could explain long-standing puzzles in structure formation on small scales. If the required self-interaction arises through a light mediator (with mass ∼ 10 MeV) in the dark sector, this new particle must be unstable to avoid overclosing the universe. The decay of the light mediator could happen due to a weak coupling of the hidden and visible sectors, providing new signatures for direct detection experiments. The SIDM nuclear recoil spectrum is more peaked towards low energies compared to the usual case of contact interactions, because the mediator mass is comparable to the momentum transfer of nuclear recoils. We show that the SIDM signal could be distinguished from that of DM particles with contact interactions by considering the time-average energy spectrum in experiments employing different target materials, or the average and modulated spectra in a single experiment. Using current limits from LUX and SuperCDMS, we also derive strong bounds on the mixing parameter between hidden and visible sector

  17. DEPFET detectors for direct detection of MeV dark matter particles

    Energy Technology Data Exchange (ETDEWEB)

    Baehr, A.; Ninkovic, J.; Treis, J. [Max-Planck-Gesellschaft Halbleiterlabor, Munich (Germany); Kluck, H.; Schieck, J. [Institut fuer Hochenergiephysik, Oesterreichische Akademie der Wissenschaften, Vienna (Austria); Atominstitut, Technische Universitaet Wien, Vienna (Austria)

    2017-12-15

    The existence of dark matter is undisputed, while the nature of it is still unknown. Explaining dark matter with the existence of a new unobserved particle is among the most promising possible solutions. Recently dark matter candidates in the MeV mass region received more and more interest. In comparison to the mass region between a few GeV to several TeV, this region is experimentally largely unexplored. We discuss the application of a RNDR DEPFET semiconductor detector for direct searches for dark matter in the MeV mass region. We present the working principle of the RNDR DEPFET devices and review the performance obtained by previously performed prototype measurements. The future potential of the technology as dark matter detector is discussed and the sensitivity for MeV dark matter detection with RNDR DEPFET sensors is presented. Under the assumption of six background events in the region of interest and an exposure of 1 kg year a sensitivity of about anti σ{sub e} = 10{sup -41} cm{sup 2} for dark matter particles with a mass of 10 MeV can be reached. (orig.)

  18. Direct detection of SERCA calcium transport and small-molecule inhibition in giant unilamellar vesicles

    International Nuclear Information System (INIS)

    Bian, Tengfei; Autry, Joseph M.; Casemore, Denise; Li, Ji; Thomas, David D.; He, Gaohong; Xing, Chengguo

    2016-01-01

    We have developed a charge-mediated fusion method to reconstitute the sarco/endoplasmic reticulum Ca 2+ -ATPase (SERCA) in giant unilamellar vesicles (GUV). Intracellular Ca 2+ transport by SERCA controls key processes in human cells such as proliferation, signaling, and contraction. Small-molecule effectors of SERCA are urgently needed as therapeutics for Ca 2+ dysregulation in human diseases including cancer, diabetes, and heart failure. Here we report the development of a method for efficiently reconstituting SERCA in GUV, and we describe a streamlined protocol based on optimized parameters (e.g., lipid components, SERCA preparation, and activity assay requirements). ATP-dependent Ca 2+ transport by SERCA in single GUV was detected directly using confocal fluorescence microscopy with the Ca 2+ indicator Fluo-5F. The GUV reconstitution system was validated for functional screening of Ca 2+ transport using thapsigargin (TG), a small-molecule inhibitor of SERCA currently in clinical trials as a prostate cancer prodrug. The GUV system overcomes the problem of inhibitory Ca 2+ accumulation for SERCA in native and reconstituted small unilamellar vesicles (SUV). We propose that charge-mediated fusion provides a widely-applicable method for GUV reconstitution of clinically-important membrane transport proteins. We conclude that GUV reconstitution is a technological advancement for evaluating small-molecule effectors of SERCA.

  19. A unified explanation for dark matter and electroweak baryogenesis with direct detection and gravitational wave signatures

    International Nuclear Information System (INIS)

    Chala, Mikael; Nardini, Germano; Sobolev, Ivan; Moscow State Univ.

    2016-05-01

    A minimal extension of the Standard Model that provides both a dark matter candidate and a strong first-order electroweak phase transition (EWPT) consists of two additional Lorentz and gauge singlets. In this paper we work out a composite Higgs version of this scenario, based on the coset SO(7)/SO(6). We show that by embedding the elementary fermions in appropriate representations of SO(7), all dominant interactions are described by only three free effective parameters. Within the model dependencies of the embedding, the theory predicts one of the singlets to be stable and responsible for the observed dark matter abundance. At the same time, the second singlet introduces new CP-violation phases and triggers a strong first-order EWPT, making electroweak baryogenesis feasible. It turns out that this scenario does not conflict with current observations and it is promising for solving the dark matter and baryon asymmetry puzzles. The tight predictions of the model will be accessible at the forthcoming dark matter direct detection and gravitational wave experiments.

  20. On the Capacity Region of the Intensity-Modulation Direct-Detection Optical Broadcast Channel

    KAUST Repository

    Chaaban, Anas

    2015-08-11

    The capacity of the intensity-modulation direct-detection free-space optical broadcast channel (OBC) is investigated. The Gaussian model with input-independent Gaussian noise is used, with both average and peak intensity constraints. An outer bound on the capacity region is derived by adapting Bergmans\\' approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian distributions or discrete distributions. While the discrete input distribution achieves higher rates than the truncated-Gaussian distribution, the latter allows expressing the achievable rate region in a closed form. At high signal-to-noise ratio (SNR), it is shown that the truncated-Gaussian distribution is nearly optimal. It achieves the symmetric-capacity within a constant gap (independent of SNR), which approaches half a bit as the number of users grows large. It also achieves the capacity region within a constant gap, which depends on the number of users. At low SNR, it is shown that on-off keying with time-division multiple-access (TDMA) is optimal, as it achieves any point on the boundary of the developed outer bound. This is interesting in practice since both OOK and TDMA have low complexity. At moderate SNR (typically [0,8] dB), a discrete distribution with a small alphabet size achieves a fairly good performance in terms of symmetric rate.

  1. Direct Generation and Detection of Quantum Correlated Photons with 3.2 um Wavelength Spacing.

    Science.gov (United States)

    Sua, Yong Meng; Fan, Heng; Shahverdi, Amin; Chen, Jia-Yang; Huang, Yu-Ping

    2017-12-13

    Quantum correlated, highly non-degenerate photons can be used to synthesize disparate quantum nodes and link quantum processing over incompatible wavelengths, thereby constructing heterogeneous quantum systems for otherwise unattainable superior performance. Existing techniques for correlated photons have been concentrated in the visible and near-IR domains, with the photon pairs residing within one micron. Here, we demonstrate direct generation and detection of high-purity photon pairs at room temperature with 3.2 um wavelength spacing, one at 780 nm to match the rubidium D2 line, and the other at 3950 nm that falls in a transparent, low-scattering optical window for free space applications. The pairs are created via spontaneous parametric downconversion in a lithium niobate waveguide with specially designed geometry and periodic poling. The 780 nm photons are measured with a silicon avalanche photodiode, and the 3950 nm photons are measured with an upconversion photon detector using a similar waveguide, which attains 34% internal conversion efficiency. Quantum correlation measurement yields a high coincidence-to-accidental ratio of 54, which indicates the strong correlation with the extremely non-degenerate photon pairs. Our system bridges existing quantum technology to the challenging mid-IR regime, where unprecedented applications are expected in quantum metrology and sensing, quantum communications, medical diagnostics, and so on.

  2. Frequency interleaving towards spectrally efficient directly detected optical OFDM for next-generation optical access networks.

    Science.gov (United States)

    Mehedy, Lenin; Bakaul, Masuduzzaman; Nirmalathas, Ampalavanapillai

    2010-10-25

    In this paper, we theoretically analyze and demonstrate that spectral efficiency of a conventional direct detection based optical OFDM system (DDO-OFDM) can be improved significantly using frequency interleaving of adjacent DDO-OFDM channels where OFDM signal band of one channel occupies the spectral gap of other channel and vice versa. We show that, at optimum operating condition, the proposed technique can effectively improve the spectral efficiency of the conventional DDO-OFDM system as much as 50%. We also show that such a frequency interleaved DDO-OFDM system, with a bit rate of 48 Gb/s within 25 GHz bandwidth, achieves sufficient power budget after transmission over 25 km single mode fiber to be used in next-generation time-division-multiplexed passive optical networks (TDM-PON). Moreover, by applying 64- quadrature amplitude modulation (QAM), the system can be further scaled up to 96 Gb/s with a power budget sufficient for 1:16 split TDM-PON.

  3. What is the probability that direct detection experiments have observed dark matter?

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Schwetz, Thomas

    2014-01-01

    In Dark Matter direct detection we are facing the situation of some experiments reporting positive signals which are in conflict with limits from other experiments. Such conclusions are subject to large uncertainties introduced by the poorly known local Dark Matter distribution. We present a method to calculate an upper bound on the joint probability of obtaining the outcome of two potentially conflicting experiments under the assumption that the Dark Matter hypothesis is correct, but completely independent of assumptions about the Dark Matter distribution. In this way we can quantify the compatibility of two experiments in an astrophysics independent way. We illustrate our method by testing the compatibility of the hints reported by DAMA and CDMS-Si with the limits from the LUX and SuperCDMS experiments. The method does not require Monte Carlo simulations but is mostly based on using Poisson statistics. In order to deal with signals of few events we introduce the so-called ''signal length'' to take into account energy information. The signal length method provides a simple way to calculate the probability to obtain a given experimental outcome under a specified Dark Matter and background hypothesis

  4. Interpreting dark matter direct detection independently of the local velocity and density distribution

    International Nuclear Information System (INIS)

    Fox, Patrick J.; Kribs, Graham D.; Tait, Tim M. P.

    2011-01-01

    We demonstrate precisely what particle physics information can be extracted from a single direct detection observation of dark matter while making absolutely no assumptions about the local velocity distribution and local density of dark matter. Our central conclusions follow from a very simple observation: the velocity distribution of dark matter is positive definite, f(v)≥0. We demonstrate the utility of this result in several ways. First, we show a falling deconvoluted recoil spectrum (deconvoluted of the nuclear form factor), such as from ordinary elastic scattering, can be 'mocked up' by any mass of dark matter above a kinematic minimum. As an example, we show that dark matter much heavier than previously considered can explain the CoGeNT excess. Specifically, m χ Ge can be in just as good agreement as light dark matter, while m χ >m Ge depends on understanding the sensitivity of xenon to dark matter at very low recoil energies, E R < or approx. 6 keVnr. Second, we show that any rise in the deconvoluted recoil spectrum represents distinct particle physics information that cannot be faked by an arbitrary f(v). As examples of resulting nontrivial particle physics, we show that inelastic dark matter and dark matter with a form factor can both yield such a rise.

  5. Rate adaptive multilevel coded modulation with high coding gain in intensity modulation direct detection optical communication

    Science.gov (United States)

    Xiao, Fei; Liu, Bo; Zhang, Lijia; Xin, Xiangjun; Zhang, Qi; Tian, Qinghua; Tian, Feng; Wang, Yongjun; Rao, Lan; Ullah, Rahat; Zhao, Feng; Li, Deng'ao

    2018-02-01

    A rate-adaptive multilevel coded modulation (RA-MLC) scheme based on fixed code length and a corresponding decoding scheme is proposed. RA-MLC scheme combines the multilevel coded and modulation technology with the binary linear block code at the transmitter. Bits division, coding, optional interleaving, and modulation are carried out by the preset rule, then transmitted through standard single mode fiber span equal to 100 km. The receiver improves the accuracy of decoding by means of soft information passing through different layers, which enhances the performance. Simulations are carried out in an intensity modulation-direct detection optical communication system using MATLAB®. Results show that the RA-MLC scheme can achieve bit error rate of 1E-5 when optical signal-to-noise ratio is 20.7 dB. It also reduced the number of decoders by 72% and realized 22 rate adaptation without significantly increasing the computing time. The coding gain is increased by 7.3 dB at BER=1E-3.

  6. Assessing compatibility of direct detection data: halo-independent global likelihood analyses

    Energy Technology Data Exchange (ETDEWEB)

    Gelmini, Graciela B. [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA 90095 (United States); Huh, Ji-Haeng [CERN Theory Division,CH-1211, Geneva 23 (Switzerland); Witte, Samuel J. [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA 90095 (United States)

    2016-10-18

    We present two different halo-independent methods to assess the compatibility of several direct dark matter detection data sets for a given dark matter model using a global likelihood consisting of at least one extended likelihood and an arbitrary number of Gaussian or Poisson likelihoods. In the first method we find the global best fit halo function (we prove that it is a unique piecewise constant function with a number of down steps smaller than or equal to a maximum number that we compute) and construct a two-sided pointwise confidence band at any desired confidence level, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a “constrained parameter goodness-of-fit” test statistic, whose p-value we then use to define a “plausibility region” (e.g. where p≥10%). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. p<10%). We illustrate these methods by applying them to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic spin-independent isospin-conserving interactions or exothermic spin-independent isospin-violating interactions.

  7. Direct electrochemistry of dopamine on gold-Agaricus bisporus laccase enzyme electrode: characterization and quantitative detection.

    Science.gov (United States)

    Shervedani, Reza Karimi; Amini, Akbar

    2012-04-01

    Direct electrochemistry of a new laccase enzyme immobilized on gold and its application as a biosensor for dopamine (DA) are investigated by voltammetry and electrochemical impedance spectroscopy. The sensor demonstrated a redox adsorption behavior with E(0') = + 180 mV vs. Ag/AgCl for immobilized Agaricus bisporus laccase (LacAB) enzyme. The MPA platform was assembled on Au with and without utilization of ultrasounds. Excellent results were obtained by using the enzyme electrode fabricated based on MPA assembled with sonication. The LacAB immobilized in this condition showed a large electrocatalytic activity for oxidation of DA. Accordingly, a third-generation (mediator free) biosensor was constructed for DA. The DA concentration could be measured in the linear range of 0.5 to 13.0 and 47.0 to 430.0 μmol L(-1) with correlation coefficients of 0.999 and 0.989, respectively, and a detection limit of 29.0 nmol L(-1). The biosensor was successfully tested for determination of DA in human blood plasma and pharmaceutical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Direct Molecular Detection and Genotyping of Borrelia burgdorferi from Whole Blood of Patients with Early Lyme Disease

    Science.gov (United States)

    Eshoo, Mark W.; Crowder, Christopher C.; Rebman, Alison W.; Rounds, Megan A.; Matthews, Heather E.; Picuri, John M.; Soloski, Mark J.; Ecker, David J.; Schutzer, Steven E.; Aucott, John N.

    2012-01-01

    Direct molecular tests in blood for early Lyme disease can be insensitive due to low amount of circulating Borrelia burgdorferi DNA. To address this challenge, we have developed a sensitive strategy to both detect and genotype B. burgdorferi directly from whole blood collected during the initial patient visit. This strategy improved sensitivity by employing 1.25 mL of whole blood, a novel pre-enrichment of the entire specimen extract for Borrelia DNA prior to a multi-locus PCR and electrospray ionization mass spectrometry detection assay. We evaluated the assay on blood collected at the initial presentation from 21 endemic area patients who had both physician-diagnosed erythema migrans (EM) and positive two-tiered serology either at the initial visit or at a follow-up visit after three weeks of antibiotic therapy. Results of this DNA analysis showed detection of B. burgdorferi in 13 of 21 patients (62%). In most cases the new assay also provided the B. burgdorferi genotype. The combined results of our direct detection assay with initial physician visit serology resulted in the detection of early Lyme disease in 19 of 21 (90%) of patients at the initial visit. In 5 of 21 cases we demonstrate the ability to detect B. burgdorferi in early Lyme disease directly from whole blood specimens prior to seroconversion. PMID:22590620

  9. Joint Direction-of-Departure and Direction-of-Arrival Estimation in a UWB MIMO Radar Detecting Targets with Fluctuating Radar Cross Sections

    Directory of Open Access Journals (Sweden)

    Idnin Pasya

    2014-01-01

    Full Text Available This paper presents a joint direction-of-departure (DOD and direction-of-arrival (DOA estimation in a multiple-input multiple-output (MIMO radar utilizing ultra wideband (UWB signals in detecting targets with fluctuating radar cross sections (RCS. The UWB MIMO radar utilized a combination of two-way MUSIC and majority decision based on angle histograms of estimated DODs and DOAs at each frequency of the UWB signal. The proposed angle estimation scheme was demonstrated to be effective in detecting targets with fluctuating RCS, compared to conventional spectra averaging method used in subband angle estimations. It was found that a wider bandwidth resulted in improved estimation performance. Numerical simulations along with experimental evaluations in a radio anechoic chamber are presented.

  10. Simulation of argon response and light detection in the DarkSide-50 dual phase TPC

    Energy Technology Data Exchange (ETDEWEB)

    Agnes, P.; Albuquerque, I. F. M.; Alexander, T.; Alton, A. K.; Asner, D. M.; Back, H. O.; Biery, K.; Bocci, V.; Bonfini, G.; Bonivento, W.; Bossa, M.; Bottino, B.; Budano, F.; Bussino, S.; Cadeddu, M.; Cadoni, M.; Calaprice, F.; Canci, N.; Candela, A.; Caravati, M.; Cariello, M.; Carlini, M.; Catalanotti, S.; Cataudella, V.; Cavalcante, P.; Chepurnov, A.; Cicalò, C.; Cocco, A. G.; Covone, G.; D' Angelo, D.; D' Incecco, M.; Davini, S.; de Candia, A.; Cecco, S. De; Deo, M. De; Filippis, G. De; Vincenzi, M. De; Derbin, A. V.; Rosa, G. De; Devoto, A.; Eusanio, F. Di; Pietro, G. Di; Dionisi, C.; Edkins, E.; Empl, A.; Fan, A.; Fiorillo, G.; Fomenko, K.; Franco, D.; Gabriele, F.; Galbiati, C.; Giagu, S.; Giganti, C.; Giovanetti, G. K.; Goretti, A. M.; Granato, F.; Gromov, M.; Guan, M.; Guardincerri, Y.; Hackett, B. R.; Herner, K.; Hughes, D.; Humble, P.; Hungerford, E. V.; Ianni, An.; James, I.; Johnson, T. N.; Keeter, K.; Kendziora, C. L.; Koh, G.; Korablev, D.; Korga, G.; Kubankin, A.; Li, X.; Lissia, M.; Loer, B.; Longo, G.; Ma, Y.; Machado, A. A.; Machulin, I. N.; Mandarano, A.; Mari, S. M.; Maricic, J.; Martoff, C. J.; Meyers, P. D.; Milincic, R.; Monte, A.; Mount, B. J.; Muratova, V. N.; Musico, P.; Napolitano, J.; Agasson, A. Navrer; Oleinik, A.; Orsini, M.; Ortica, F.; Pagani, L.; Pallavicini, M.; Pantic, E.; Pelczar, K.; Pelliccia, N.; Pocar, A.; Pordes, S.; Pugachev, D. A.; Qian, H.; Randle, K.; Razeti, M.; Razeto, A.; Reinhold, B.; Renshaw, A. L.; Rescigno, M.; Riffard, Q.; Romani, A.; Rossi, B.; Rossi, N.; Sablone, D.; Sands, W.; Sanfilippo, S.; Savarese, C.; Schlitzer, B.; Segreto, E.; Semenov, D. A.; Singh, P. N.; Skorokhvatov, M. D.; Smirnov, O.; Sotnikov, A.; Stanford, C.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Tonazzo, A.; Trinchese, P.; Unzhakov, E. V.; Verducci, M.; Vishneva, A.; Vogelaar, B.; Wada, M.; Walker, S.; Wang, H.; Wang, Y.; Watson, A. W.; Westerdale, S.; Wilhelmi, J.; Wojcik, M. M.; Xiang, X.; Xiao, X.; Yang, C.; Ye, Z.; Zhu, C.; Zuzel, G.

    2017-10-01

    Geant4-based Monte Carlo package named G4DS has been developed to simulate the response of DarkSide-50, an experiment operating since 2013 at LNGS, designed to detect WIMP interactions in liquid argon. In the process of WIMP searches, DarkSide-50 has achieved two fundamental milestones: the rejection of electron recoil background with a power of ~10^7, using the pulse shape discrimination technique, and the measurement of the residual 39Ar contamination in underground argon, ~3 orders of magnitude lower with respect to atmospheric argon.

  11. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    International Nuclear Information System (INIS)

    Traviesa-Alvarez, J.M.; Costa-Fernandez, J.M.; Pereiro, R.; Sanz-Medel, A.

    2007-01-01

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10 -4 M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples

  12. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Traviesa-Alvarez, J M [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Costa-Fernandez, J M [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Pereiro, R [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Sanz-Medel, A [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain)

    2007-04-18

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10{sup -4} M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples.

  13. Microlens Array/Pinhole Mask to Suppress Starlight for Direct Exoplanet Detection

    Science.gov (United States)

    Zimmerman, Neil

    Direct imaging of habitable exoplanets is a key priority of NASA’s Astrophysics roadmap, “Enduring Quests, Daring Visions.” A coronagraphic starlight suppression system situated on a large space telescope offers a viable path to achieving this goal. This type of instrument is central to both the LUVOIR and HabEx mission concepts currently under study for the 2020 Decadal Survey. To directly image an Earth-like exoplanet, an instrument must be sensitive to objects ten billion times dimmer than their parent star. Advanced coronagraphs are designed to modify the shape of the star’s image so that it does not overwhelm the planet's light. Coronagraphs are complex to design and fabricate, tend to sacrifice a significant portion of the exoplanet light entering the telescope, and are highly sensitive to errors in the telescope. The proposed work reduces the demands on the coronagraph and its sensitivity to errors in the telescope, by changing how we implement optics in the spectrograph following the coronagraph. Through optical analysis and modeling, we have found that a microlens array with a specially arranged pattern of pinholes can suppress residual starlight in the scientific image after the coronagraph by more than two orders of magnitude. This added layer of starlight rejection could be used to relax the extreme observatory stability requirements for exo-Earth imaging applications, for example shifting the wavefront stability requirement from a few picometers to a few nanometers. Ultimately this translates to the instrument detecting and spectrally characterizing more exoplanets than a conventional coronagraph system. This microlens/pinhole concept is also compatible with starshadebased starlight suppression systems. The proposed microlens/pinhole device is entirely passive and augments the performance of existing coronagraph designs, while potentially reducing their cost and risk for mission implementation. Our APRA proposal would support a testbed

  14. Dark matter direct detection signals inferred from a cosmological N-body simulation with baryons

    International Nuclear Information System (INIS)

    Ling, F.-S.; Nezri, E.; Athanassoula, E.; Teyssier, R.

    2010-01-01

    We extract at redshift z = 0 a Milky Way sized object including gas, stars and dark matter (DM) from a recent, high-resolution cosmological N-body simulation with baryons. Its resolution is sufficient to witness the formation of a rotating disk and bulge at the center of the halo potential, therefore providing a realistic description of the birth and the evolution of galactic structures in the ΛCDM cosmology paradigm. The phase-space structure of the central galaxy reveals that, throughout a thick region, the dark halo is co-rotating on average with the stellar disk. At the Earth's location, the rotating component, sometimes called dark disk in the literature, is characterized by a minimum lag velocity v lag ≅ 75 km/s, in which case it contributes to around 25% of the total DM local density, whose value is ρ DM ≅ 0.37GeV/cm 3 . The velocity distributions also show strong deviations from pure Gaussian and Maxwellian distributions, with a sharper drop of the high velocity tail. We give a detailed study of the impact of these features on the predictions for DM signals in direct detection experiments. In particular, the question of whether the modulation signal observed by DAMA is or is not excluded by limits set by other experiments (CDMS, XENON and CRESST...) is re-analyzed and compared to the case of a standard Maxwellian halo. We consider spin-independent interactions for both the elastic and the inelastic scattering scenarios. For the first time, we calculate the allowed regions for DAMA and the exclusion limits of other null experiments directly from the velocity distributions found in the simulation. We then compare these results with the predictions of various analytical distributions. We find that the compatibility between DAMA and the other experiments is improved. In the elastic scenario, the DAMA modulation signal is slightly enhanced in the so-called channeling region, as a result of several effects that include a departure from a Maxwellian

  15. Performances of a HGCDTE APD based direct detection lidar at 2 μm. Application to dial measurements

    Science.gov (United States)

    Gibert, Fabien; Dumas, Arnaud; Rothman, Johan; Edouart, Dimitri; Cénac, Claire; Pellegrino, Jessica

    2018-04-01

    A lidar receiver with a direct detection chain adapted to a HgCdTe APD based detector with electric cooling is associated to a 2.05 μm Ho :YLF pulsed dual wavelength single mode transmitter to provide the first atmospheric lidar measurements using this technology. Experiments confirm the outstanding sensitivity of the detector and hightligth its huge potential for DIAL measurements of trace gas (CO2 and H2O) in this spectral domain. Performances of coherent vs direct detection at 2.05 μm is assessed.

  16. Performances of a HGCDTE APD based direct detection lidar at 2 μm. Application to dial measurements

    Directory of Open Access Journals (Sweden)

    Gibert Fabien

    2018-01-01

    Full Text Available A lidar receiver with a direct detection chain adapted to a HgCdTe APD based detector with electric cooling is associated to a 2.05 μm Ho :YLF pulsed dual wavelength single mode transmitter to provide the first atmospheric lidar measurements using this technology. Experiments confirm the outstanding sensitivity of the detector and hightligth its huge potential for DIAL measurements of trace gas (CO2 and H2O in this spectral domain. Performances of coherent vs direct detection at 2.05 μm is assessed.

  17. DaMaSCUS: the impact of underground scatterings on direct detection of light dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Emken, Timon; Kouvaris, Chris, E-mail: emken@cp3.sdu.dk, E-mail: kouvaris@cp3.sdu.dk [CP3-Origins, University of Southern Denmark, Campusvej 55, DK-5230 Odense (Denmark)

    2017-10-01

    Conventional dark matter direct detection experiments set stringent constraints on dark matter by looking for elastic scattering events between dark matter particles and nuclei in underground detectors. However these constraints weaken significantly in the sub-GeV mass region, simply because light dark matter does not have enough energy to trigger detectors regardless of the dark matter-nucleon scattering cross section. Even if future experiments lower their energy thresholds, they will still be blind to parameter space where dark matter particles interact with nuclei strongly enough that they lose enough energy and become unable to cause a signal above the experimental threshold by the time they reach the underground detector. Therefore in case dark matter is in the sub-GeV region and strongly interacting, possible underground scatterings of dark matter with terrestrial nuclei must be taken into account because they affect significantly the recoil spectra and event rates, regardless of whether the experiment probes DM via DM-nucleus or DM-electron interaction. To quantify this effect we present the publicly available Dark Matter Simulation Code for Underground Scatterings (DaMaSCUS), a Monte Carlo simulator of DM trajectories through the Earth taking underground scatterings into account. Our simulation allows the precise calculation of the density and velocity distribution of dark matter at any detector of given depth and location on Earth. The simulation can also provide the accurate recoil spectrum in underground detectors as well as the phase and amplitude of the diurnal modulation caused by this shadowing effect of the Earth, ultimately relating the modulations expected in different detectors, which is important to decisively conclude if a diurnal modulation is due to dark matter or an irrelevant background.

  18. Antigen detection of rabies virus in brain smear using direct Rapid Immunohistochemistry Test

    Directory of Open Access Journals (Sweden)

    Damayanti R

    2014-03-01

    Full Text Available Rabies is zoonotic disease caused by a fatal, neurotropic virus. Rabies virus is classified into the Genus of Lyssavirus under the yang family of Rhabdoviridae. Rabies affecting hot- blooded animals, as well as human. Dogs, cats, monkeys are the vectors or reservoirs for rabies and the virus was transmitted through the saliva after infected animal’s bites. The aim of this study was to conduct rapid diagnosis to detect rabies viral antigen in brain smear using immunohistochemical (IHC method namely direct Rapid Immunohistochemical Test (dRIT. A total number of 119 brain samples were achieved from Bukittinggi Veterinary Laboratory, West Sumatra. Standardisation and validation of the method were compared to Fluorescent Antibody Test (FAT as a golden standard for rabies diagnosis. Results show that dRIT was a very good method, it can be performed within two hours without the need of fluorescent microscope. The samples were tested using FAT and from 119 samples tested, 80 (67.23% samples were positive for rabies and 39 (32.77% samples were negative for rabies whereas using dRIT showed that 78 (65.54% samples were positive for rabies and 41 (34.45% samples were negative for rabies. The dRIT results were validated by comparing them with FAT results as a golden standard for rabies. The relative sensitivity of dRIT to FAT was 97.5% and the relative specificity to FAT was 100% (with Kappa value of 0.976, stated as excellent. The achievement showed that dRIT is very potential diagnostic tool and is highly recommended to be used widely as a rapid diagnosis tool for rabies.

  19. Micro-Spec: an Integrated, Direct-Detection Spectrometer for Far-Infrared and Submillimeter Astronomy

    Science.gov (United States)

    Cataldo, Giuseppe

    2014-01-01

    The far-infrared and submillimeter portions of the electromagnetic spectrum provide a unique view of the astrophysical processes present in the early universe. Our ability to fully explore this rich spectral region has been limited, however, by the size and cost of the cryogenic spectrometers required to carry out such measurements. Micro-Spec (u-Spec) is a high-sensitivity, direct-detection spectrometer concept working in the 450-1000 micromillimeter wavelength range which will enable a wide range of flight missions that would otherwise be challenging due to the large size of current instruments with the required spectral resolution and sensitivity. The spectrometer design utilizes two internal antenna arrays, one for transmitting and one for receiving, superconducting microstrip transmission lines for power division and phase delay, and an array of microwave kinetic inductance detectors (MKIDs) to achieve these goals. The instrument will be integrated on a approximately 10 square cm silicon chip and can therefore become an important capability under the low background conditions accessible via space and high-altitude borne platforms. In this paper, an optical design methodology for Micro-Spec is presented, with particular attention given to its twodimensional diffractive region, where the light of different wavelengths is focused on the different detectors. The method is based on the maximization of the instrument resolving power and minimization of the RMS phase error on the instrument focal plane. This two-step optimization can generate geometrical configurations given specific requirements on spectrometer size, operating spectral range and performance. A point design with resolving power of 257, an RMS phase error less than 0.1 radians and four stigmatic points was developed for initial demonstration and will be the basis of future instruments with resolving power up to about 1200.

  20. DaMaSCUS: the impact of underground scatterings on direct detection of light dark matter

    International Nuclear Information System (INIS)

    Emken, Timon; Kouvaris, Chris

    2017-01-01

    Conventional dark matter direct detection experiments set stringent constraints on dark matter by looking for elastic scattering events between dark matter particles and nuclei in underground detectors. However these constraints weaken significantly in the sub-GeV mass region, simply because light dark matter does not have enough energy to trigger detectors regardless of the dark matter-nucleon scattering cross section. Even if future experiments lower their energy thresholds, they will still be blind to parameter space where dark matter particles interact with nuclei strongly enough that they lose enough energy and become unable to cause a signal above the experimental threshold by the time they reach the underground detector. Therefore in case dark matter is in the sub-GeV region and strongly interacting, possible underground scatterings of dark matter with terrestrial nuclei must be taken into account because they affect significantly the recoil spectra and event rates, regardless of whether the experiment probes DM via DM-nucleus or DM-electron interaction. To quantify this effect we present the publicly available Dark Matter Simulation Code for Underground Scatterings (DaMaSCUS), a Monte Carlo simulator of DM trajectories through the Earth taking underground scatterings into account. Our simulation allows the precise calculation of the density and velocity distribution of dark matter at any detector of given depth and location on Earth. The simulation can also provide the accurate recoil spectrum in underground detectors as well as the phase and amplitude of the diurnal modulation caused by this shadowing effect of the Earth, ultimately relating the modulations expected in different detectors, which is important to decisively conclude if a diurnal modulation is due to dark matter or an irrelevant background.

  1. The New Worlds Observer: Direct Detection and Study of Exoplanets from the Habitable Zone Outward

    Science.gov (United States)

    Cash, Webster C.; New Worlds Study Team

    2009-01-01

    Direct detection and spectroscopic study of the planets around the nearby stars is generally recognized as a prime goal of astronomy. The New Worlds Observer mission concept is being studied as an Astrophysics Strategic Mission Concept Study for this purpose. NWO features two spacecraft: a general purpose 4m telescope that operates from the UV to the Near IR, and a starshade, a flower-shaped occulter about 50m in diameter flying in alignment about 70,000km away. Our study shows this is the most effective way to map nearby planetary systems. Images will show dust and debris down to a fraction of our zodiacal light level. Planets fainter than the Earth can be seen from the Habitable Zone outward, at distances up to 20pc. High throughput and low noise enable immediate follow-up spectroscopy of discovered planets. NWO can discover many more Earth-like planets than all competing approaches including astrometric, interferometric, and internal coronagraphic. Within hours of discovery, a high quality spectrum can determine the true nature of the exoplanet and open the search for biomarkers and life. Over half of the time will be spent with the starshade in transit to the next target. During those times the telescope will be available to for general astrophysics purposes. Operating from the ultraviolet to the near infrared, this will be a true HST follow-on. The study shows all needed technologies already exist. The cost scales primarily with telescope size. The mission is definitely within the financial and technical reach of NASA for the coming decade.

  2. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  3. Cryogenic scintillators for rare events detection in the Edelweiss and EURECA experiments

    International Nuclear Information System (INIS)

    Verdier, M.A.

    2010-10-01

    The riddle of the dark matter in astrophysics could be solved by the detection of WIMPs (Weakly Interactive Massive Particles), particles that are predicted by supersymmetry. The direct detection of WIMPs requires a large mass of detectors, able to identify these particles in the background of natural radioactivity and cosmic rays. This thesis takes place within the framework of the EDELWEISS and the future EURECA experiments. These experiments use a technology based on two channel cryogenic detectors (bolometers), working at a few tens of mK. They are composed of crystals in which the energy deposited by particle interactions will produce a temperature increase (phonon signal), and where the ionization of the crystals results in either a charge or photon signal, depending on their nature. In order to broaden the range of targets for scintillating bolometers, we have built a setup to study the scintillation of crystals cooled down to 3 K. It is based on a cryostat with a compact optical geometry allowing enhanced light collection. Thanks to an individual photon counting technique and a statistical treatment of data, it allows us to measure the evolution of the the light yields and the decay time components between room temperature and 3 K. Thus this thesis presents the results obtained at 3 K on two well known room temperature crystals: BGO (Bi 4 Ge 3 O 12 ) and BaF 2 . We also study the luminescence properties of titanium sapphire (Ti:Al 2 O 3 ), under VUV excitation cooled down to 8 K. (author)

  4. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  5. Detection of thrombocytic antibodies with the direct and indirect haemolysis inhibition test and the radioimmuno-Coombs test

    International Nuclear Information System (INIS)

    Mettenboerger, D.; Vith, E.

    1982-01-01

    Methods of application of the direct and indirect haemolysis inhibition test were studied in order to optimise the test parameters: The ultimate aim was to standardize the test method and compare its sensitivity in detecting various platelet antibodies with platelet indirect radioactive Coombs-test and the platelet immunofluorescence test. (orig.) [de

  6. Direct {sup 13}C-detected NMR experiments for mapping and characterization of hydrogen bonds in RNA

    Energy Technology Data Exchange (ETDEWEB)

    Fürtig, Boris, E-mail: fuertig@nmr.uni-frankfurt.de; Schnieders, Robbin; Richter, Christian; Zetzsche, Heidi; Keyhani, Sara; Helmling, Christina [Johann Wolfgang Goethe Universität Frankfurt, Center for Biomolecular Magnetic Resonance (BMRZ), Institute of Organic Chemistry and Chemical Biology (Germany); Kovacs, Helena [Bruker BioSpin (Switzerland); Schwalbe, Harald, E-mail: schwalbe@nmr.uni-frankfurt.de [Johann Wolfgang Goethe Universität Frankfurt, Center for Biomolecular Magnetic Resonance (BMRZ), Institute of Organic Chemistry and Chemical Biology (Germany)

    2016-03-15

    In RNA secondary structure determination, it is essential to determine whether a nucleotide is base-paired and not. Base-pairing of nucleotides is mediated by hydrogen bonds. The NMR characterization of hydrogen bonds relies on experiments correlating the NMR resonances of exchangeable protons and can be best performed for structured parts of the RNA, where labile hydrogen atoms are protected from solvent exchange. Functionally important regions in RNA, however, frequently reveal increased dynamic disorder which often leads to NMR signals of exchangeable protons that are broadened beyond {sup 1}H detection. Here, we develop {sup 13}C direct detected experiments to observe all nucleotides in RNA irrespective of whether they are involved in hydrogen bonds or not. Exploiting the self-decoupling of scalar couplings due to the exchange process, the hydrogen bonding behavior of the hydrogen bond donor of each individual nucleotide can be determined. Furthermore, the adaption of HNN-COSY experiments for {sup 13}C direct detection allows correlations of donor–acceptor pairs and the localization of hydrogen-bond acceptor nucleotides. The proposed {sup 13}C direct detected experiments therefore provide information about molecular sites not amenable by conventional proton-detected methods. Such information makes the RNA secondary structure determination by NMR more accurate and helps to validate secondary structure predictions based on bioinformatics.

  7. Direct detection of early-stage cancers using circulating tumor DNA

    DEFF Research Database (Denmark)

    Phallen, Jillian; Sausen, Mark; Adleff, Vilmos

    2017-01-01

    Early detection and intervention are likely to be the most effective means for reducing morbidity and mortality of human cancer. However, development of methods for noninvasive detection of early-stage tumors has remained a challenge. We have developed an approach called targeted error correction...

  8. Sensitive detection of nucleic acids by PNA hybridization directed co-localization of fluorescent beads

    DEFF Research Database (Denmark)

    Shiraishi, Takehiko; Deborggraeve, Stijn; Büscher, Philippe

    2011-01-01

    )avidin-coated fluorescent beads, differing in size and color [green beads (1 µm) and red beads (5.9 µm)], thereby allowing distinct detection of each PNA probe by conventional fluorescence microscopy. These two PNA beads showed easily detectable co-localization when simultaneously hybridizing to a target nucleic acid...

  9. Circulating tumor cell detection: A direct comparison between negative and unbiased enrichment in lung cancer.

    Science.gov (United States)

    Xu, Yan; Liu, Biao; Ding, Fengan; Zhou, Xiaodie; Tu, Pin; Yu, Bo; He, Yan; Huang, Peilin

    2017-06-01

    Circulating tumor cells (CTCs), isolated as a 'liquid biopsy', may provide important diagnostic and prognostic information. Therefore, rapid, reliable and unbiased detection of CTCs are required for routine clinical analyses. It was demonstrated that negative enrichment, an epithelial marker-independent technique for isolating CTCs, exhibits a better efficiency in the detection of CTCs compared with positive enrichment techniques that only use specific anti-epithelial cell adhesion molecules. However, negative enrichment techniques incur significant cell loss during the isolation procedure, and as it is a method that uses only one type of antibody, it is inherently biased. The detection procedure and identification of cell types also relies on skilled and experienced technicians. In the present study, the detection sensitivity of using negative enrichment and a previously described unbiased detection method was compared. The results revealed that unbiased detection methods may efficiently detect >90% of cancer cells in blood samples containing CTCs. By contrast, only 40-60% of CTCs were detected by negative enrichment. Additionally, CTCs were identified in >65% of patients with stage I/II lung cancer. This simple yet efficient approach may achieve a high level of sensitivity. It demonstrates a potential for the large-scale clinical implementation of CTC-based diagnostic and prognostic strategies.

  10. First Direct-Detection Constraints on eV-Scale Hidden-Photon Dark Matter with DAMIC at SNOLAB.

    Science.gov (United States)

    Aguilar-Arevalo, A; Amidei, D; Bertou, X; Butner, M; Cancelo, G; Castañeda Vázquez, A; Cervantes Vergara, B A; Chavarria, A E; Chavez, C R; de Mello Neto, J R T; D'Olivo, J C; Estrada, J; Fernandez Moroni, G; Gaïor, R; Guardincerri, Y; Hernández Torres, K P; Izraelevitch, F; Kavner, A; Kilminster, B; Lawson, I; Letessier-Selvon, A; Liao, J; Matalon, A; Mello, V B B; Molina, J; Privitera, P; Ramanathan, K; Sarkis, Y; Schwarz, T; Settimo, M; Sofo Haro, M; Thomas, R; Tiffenberg, J; Tiouchichine, E; Torres Machado, D; Trillaud, F; You, X; Zhou, J

    2017-04-07

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30  eV c^{-2} with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter κ is competitive with constraints from solar emission, reaching a minimum value of 2.2×10^{-14} at 17  eV c^{-2}. These results are the most stringent direct detection constraints on hidden-photon dark matter in the galactic halo with masses 3-12  eV c^{-2} and the first demonstration of direct experimental sensitivity to ionization signals dark matter interactions.

  11. First Direct-Detection Constraints on eV-Scale Hidden-Photon Dark Matter with DAMIC at SNOLAB

    Energy Technology Data Exchange (ETDEWEB)

    Aguilar-Arevalo, A.; Amidei, D.; Bertou, X.; Butner, M.; Cancelo, G.; Castañeda Vázquez, A.; Cervantes Vergara, B. A.; Chavarria, A. E.; Chavez, C. R.; de Mello Neto, J. R. T.; D’Olivo, J. C.; Estrada, J.; Fernandez Moroni, G.; Gaïor, R.; Guardincerri, Y.; Hernández Torres, K. P.; Izraelevitch, F.; Kavner, A.; Kilminster, B.; Lawson, I.; Letessier-Selvon, A.; Liao, J.; Matalon, A.; Mello, V. B. B.; Molina, J.; Privitera, P.; Ramanathan, K.; Sarkis, Y.; Schwarz, T.; Settimo, M.; Sofo Haro, M.; Thomas, R.; Tiffenberg, J.; Tiouchichine, E.; Torres Machado, D.; Trillaud, F.; You, X.; Zhou, J.

    2017-04-05

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30 eV$c^{-2}$ with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter $\\kappa$ is competitive with constraints from solar emission, reaching a minimum value of 2.2$\\times$$10^{-14}$ at 17 eV$c^{-2}$. These results are the most stringent direct detection constraints on hidden-photon dark matter with masses 3-12 eV$c^{-2}$ and the first demonstration of direct experimental sensitivity to ionization signals $<$12 eV from dark matter interactions.

  12. Direct detection of rutin-degrading isozymes with polyacrylamide gel electrophoresis.

    Science.gov (United States)

    Li, Yuping; Deng, Dandan; Zhang, Xuebin; Zhang, Haina; Wang, Cong; Chen, Peng

    2013-12-15

    Rutin-degrading enzymes (RDEs) specifically hydrolyze the glycosidic linkages of rutin, producing quercetin and rutinose. Here we report a reliable and sensitive polyacrylamide gel electrophoresis and staining method for the detection of RDE isozymes, which is based on the aqueous solubility difference between rutin and quercetin, as well as the ultraviolet absorbance of quercetin. With this novel method, we achieved a detection limit of 12 ng with 107 U of RDE activity, enabling us to detect at least five RDE isozymes in tartary buckwheat seeds. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Direct Detection of Hardly Detectable Hidden Chirality of Hydrocarbons and Deuterated Isotopomers by a Helical Polyacetylene through Chiral Amplification and Memory.

    Science.gov (United States)

    Maeda, Katsuhiro; Hirose, Daisuke; Okoshi, Natsuki; Shimomura, Kouhei; Wada, Yuya; Ikai, Tomoyuki; Kanoh, Shigeyoshi; Yashima, Eiji

    2018-03-07

    We report the first direct chirality sensing of a series of chiral hydrocarbons and isotopically chiral compounds (deuterated isotopomers), which are almost impossible to detect by conventional optical spectroscopic methods, by a stereoregular polyacetylene bearing 2,2'-biphenol-derived pendants. The polyacetylene showed a circular dichroism due to a preferred-handed helix formation in response to the hardly detectable hidden chirality of saturated tertiary or chiroptical quaternary hydrocarbons, and deuterated isotopomers. In sharp contrast to the previously reported sensory systems, the chirality detection by the polyacetylene relies on an excess one-handed helix formation induced by the chiral hydrocarbons and deuterated isotopomers via significant amplification of the chirality followed by its static memory, through which chiral information on the minute and hidden chirality can be stored as an excess of a single-handed helix memory for a long time.

  14. Direct detection of near-surface faults by migration of back-scattered surface waves

    KAUST Repository

    Yu, Han; Guo, Bowen; Hanafy, Sherif; Lin, Fan-Chi; Schuster, Gerard T.

    2014-01-01

    We show that diffraction stack migration can be used to estimate the distribution of near-surface faults. The assumption is that near-surface faults generate detectable back-scattered surface waves from impinging surface waves. The processing steps

  15. Machine Learning Techniques for Optical Performance Monitoring from Directly Detected PDM-QAM Signals

    DEFF Research Database (Denmark)

    Thrane, Jakob; Wass, Jesper; Piels, Molly

    2017-01-01

    Linear signal processing algorithms are effective in dealing with linear transmission channel and linear signal detection, while the nonlinear signal processing algorithms, from the machine learning community, are effective in dealing with nonlinear transmission channel and nonlinear signal...... detection. In this paper, a brief overview of the various machine learning methods and their application in optical communication is presented and discussed. Moreover, supervised machine learning methods, such as neural networks and support vector machine, are experimentally demonstrated for in-band optical...

  16. A surface plasmon resonance biosensor for direct detection of the rabies virus

    Directory of Open Access Journals (Sweden)

    Jing Xu

    2012-01-01

    Full Text Available A surface plasmon resonance biosensor chip was constructed for detection of rabies virus. For the construction of the biosensor chip, N protein specific antibody and N protein specific antibody combined with G protein specific antibody of rabies virus were linked on two different flow cells on one CM5 chip, respectively. The chip was tested for the detection of rabies virus antigens using the crude extract of rabies virus from infected BHK cell strain culture. Tenfold serial dilutions of SRV9 strain virus-infected cell cultures were tested by the biosensor chip to establish the detection limit. The limit detection was approximately 70 pg/ml of nucleoprotein and glycoprotein. The biosensor chip developed in this study was employed for the detection of rabies virus in five suspect infectious specimens of brain tissue from guinea pigs; the results were compared by fluorescent antibody test. Surface plasmon resonance biosensor chip could be a useful automatic tool for prompt detection of rabies virus infection.

  17. Radiative corrections for the direct detection of neutralino dark matter and its relic density

    Energy Technology Data Exchange (ETDEWEB)

    Steppeler, Patrick Norbert

    2016-07-01

    In this thesis we calculate supersymmetric one-loop corrections of the strong interaction to elastic neutralino-nucleon scattering. The calculation is described in detail and performed in full generality within the Minimal Supersymmetric Standard Model (MSSM). In order to benefit from the well-established tensor reduction method, we have to stabilise the latter for vanishing Gram determinants. Afterwards the radiative corrections are matched onto an effective field theory based on the scalar operator anti χχ anti qq and the axial-vector operator anti χγ{sub 5}γ{sub μ}χ anti qγ{sub 5}γ{sup μ}q. This matching procedure is performed at the high scale μ{sub high}∝1000 GeV, whereas the associated nuclear matrix elements are defined at the low scale μ{sub low}∝5 GeV. To link both scales, the running of the effective operators and their corresponding Wilson coefficients is taken into account via renormalisation group equations. The lightest neutralino can be considered as a canonical example for a weakly interacting, massive particle which could constitute dark matter. To verify the existence of such particles, so-called direct detection experiments are conducted currently. These are based on the interaction between dark matter and nucleons. The leading contributions to the spin-independent and spin-dependent neutralino-nucleon cross sections are governed by the effective operators mentioned above, respectively. The calculation of the associated radiative corrections corresponds to a reduction of the theoretical uncertainty and permits to identify neutralino properties more reliably in case of positive findings and to set more robust exclusion bounds in case of negative findings. Furthermore, we calculate radiative corrections to annihilation and coannihilation processes of gauginos into quarks, where we focus again on supersymmetric one-loop corrections of the strong interaction. These processes contribute dominantly to the (co)annihilation cross section

  18. Direct and indirect singlet scalar dark matter detection in the lepton-specific two-Higgs-doublet model

    International Nuclear Information System (INIS)

    Boucenna, M. S.; Profumo, S.

    2011-01-01

    A recent study of gamma-ray data from the Galactic center motivates the investigation of light (∼7-10 GeV) particle dark matter models featuring tau-lepton pairs as dominant annihilation final state. The lepton-specific two-Higgs-doublet model provides a natural framework where light, singlet scalar dark matter can pair-annihilate dominantly into tau leptons. We calculate the nucleon-dark matter cross section for singlet scalar dark matter within the lepton-specific two-Higgs-doublet model framework, and compare with recent results from direct detection experiments. We study how direct dark matter searches can be used to constrain the dark matter interpretation of gamma-ray observations, for different dominant annihilation final states. We show that models exist with the correct thermal relic abundance that could fit the claimed gamma-ray excess from the Galactic center region and have direct detection cross sections of the order of what is needed to interpret recent anomalous events reported by direct detection experiments.

  19. Accelerating object detection via a visual-feature-directed search cascade: algorithm and field programmable gate array implementation

    Science.gov (United States)

    Kyrkou, Christos; Theocharides, Theocharis

    2016-07-01

    Object detection is a major step in several computer vision applications and a requirement for most smart camera systems. Recent advances in hardware acceleration for real-time object detection feature extensive use of reconfigurable hardware [field programmable gate arrays (FPGAs)], and relevant research has produced quite fascinating results, in both the accuracy of the detection algorithms as well as the performance in terms of frames per second (fps) for use in embedded smart camera systems. Detecting objects in images, however, is a daunting task and often involves hardware-inefficient steps, both in terms of the datapath design and in terms of input/output and memory access patterns. We present how a visual-feature-directed search cascade composed of motion detection, depth computation, and edge detection, can have a significant impact in reducing the data that needs to be examined by the classification engine for the presence of an object of interest. Experimental results on a Spartan 6 FPGA platform for face detection indicate data search reduction of up to 95%, which results in the system being able to process up to 50 1024×768 pixels images per second with a significantly reduced number of false positives.

  20. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  1. Radiation-induced germ-line mutations detected by a direct comparison of parents and children DNA sequences containing SNPs

    International Nuclear Information System (INIS)

    Morimyo, M.; Hongo, E.; Higashi, T.; Wu, J.; Matsumoto, I.; Okamoto, M.; Kawano, A.; Tsuji, S.

    2003-01-01

    Full text: Germ-line mutation is detected in mice but not in humans. To estimate genetic risk of humans, a new approach to extrapolate from animal data to humans or to directly detect radiation-induced mutations in man is expected. We have developed a new method to detect germ-line mutations by directly comparing DNA sequences of parents and children. The nucleotide sequences among mouse strains are almost identical except SNP markers that are detected at 1/1000 frequency. When gamma-irradiated male mice are mated with female mice, heterogeneous nucleotide sequences induced in children DNA are a candidate of mutation, whose assignment can be done by SNP analysis. This system can easily detect all types of mutations such as transition, transversion, frameshift and deletion induced by radiation and can be applied to humans having genetically heterogeneous nucleotide sequences and many SNP markers. C3H male mice of 8 weeks of gestation were irradiated with gamma rays of 3 and 1 Gy and after 3 weeks, they were mated with the same aged C57BL female mice. After 3 weeks breeding, DNA was extracted from parents and children mice. The nucleotide sequences of 150 STS markers containing 300-900 bp and SNPs of parents and children DNA were determined by a direct sequencing; amplification of STS markers by Taq DNA polymerase, purification of PCR products, and DNA sequencing with a dye-terminator method. At each radiation dose, a total amount of 5 Mb DNA sequences were examined to detect radiation-induced mutations. We could find 6 deletions in 3 Gy irradiated mice but not in 1 Gy and control mice. The mutation frequency was about 4.0 x 10 -7 /bp/ Gy or 1.6 x 10 -4 /locus/Gy, and suggested the non-linear increase of mutation rate with dose

  2. Direct Detection of the Close Companion of Polaris With the Hubble Space Telescope

    National Research Council Canada - National Science Library

    Evans, Nancy R; Schaefer, Gail H; Bond, Howard E; Bono, Giuseppe; Karovska, Margarita; Nelan, Edmund; Sasselov, Dimitar D; Mason6, Brian D

    2008-01-01

    ... 1.04 yr later confirms orbital motion in a retrograde direction. By combining our two measures with the spectroscopic orbit of Kamper and an analysis of the Hipparcos and FK5 proper motions by Wielen et al...

  3. Criegee Intermediates: What Direct Production and Detection Can Teach Us About Reactions of Carbonyl Oxides

    Science.gov (United States)

    Taatjes, Craig A.

    2017-05-01

    The carbonyl oxide intermediates in the ozonolysis of alkenes, often known as Criegee intermediates, are potentially important reactants in Earth's atmosphere. For decades, careful analysis of ozonolysis systems was employed to derive an understanding of the formation and reactions of these species. Recently it has proved possible to synthesize at least some of these intermediates separately from ozonolysis, and hence to measure their reaction kinetics directly. Direct measurements have allowed new or more detailed understanding of each type of gas-phase reaction that carbonyl oxides undergo, often acting as a complement to highly detailed ozonolysis experiments. Moreover, the use of direct characterization methods to validate increasingly accurate theoretical investigations can enhance their impact well beyond the set of specific reactions that have been measured. Reactions that initiate particles or fuel their growth could be a new frontier for direct measurements of Criegee intermediate chemistry.

  4. Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments.

    Science.gov (United States)

    Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K

    2014-03-01

    Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

  5. Consistency of direct microscopic examination and ELISA in detection of Giardia in stool specimen among children

    Directory of Open Access Journals (Sweden)

    Zohreh Torabi

    2014-09-01

    Full Text Available Objective: To investigate the consistency of direct microscopic examination and ELISA for determination of Giadia in stool specimen. Method: Study population consisted of children with any clinical symptoms of Giardia infestation since last two weeks. Fresh stool specimen was collected from each child. The stools specimens were assessed by two methods of direct microscopic examination and ELISA.The degree of agreement between direct stool exam and ELISA was calculated by Cohen's kappa coefficient. Results: In this study, 124 children with age range 2-12 years were investigated. A total of 64 (61.7% and 79 (65.7% of children had Giardia by direct stool exam and ELISA test respectively. There was association between frequency of constipation and Giardia infection (P=0.036. The Cohen's kappa coefficient calculated for degree of agreement between direct stool exam and ELISA showed κ=0.756 (P<0.001. Conclusions: The frequency of Giardia infection in symptomatic children was high and there was high agreement rate between ELISA and direct stool smear.

  6. Direct and label-free detection of the human growth hormone in urine by an ultrasensitive bimodal waveguide biosensor.

    Science.gov (United States)

    González-Guerrero, Ana Belén; Maldonado, Jesús; Dante, Stefania; Grajales, Daniel; Lechuga, Laura M

    2017-01-01

    A label-free interferometric transducer showing a theoretical detection limit for homogeneous sensing of 5 × 10 -8 RIU, being equivalent to a protein mass coverage resolution of 2.8 fg mm -2 , is used to develop a high sensitive biosensor for protein detection. The extreme sensitivity of this transducer combined with a selective bioreceptor layer enables the direct evaluation of the human growth hormone (hGH) in undiluted urine matrix in the 10 pg mL -1 range. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Utility of Direct Fluorescent Antibody Test for detection of Chlamydia trachomatis and its detection in male patients with non gonococcal urethritis in New Delhi

    Directory of Open Access Journals (Sweden)

    Agrawal S

    2003-03-01

    Full Text Available The purpose of this study was assessment of prevalence of Chlamydia trachomatis and utility of Direct Fluorescent Antibody (DFA test for its detection in male patients with non gonococcal urethritis in New Delhi , India Thirty male patients with symptoms of dysuria showing polymorphs in their gram stained urethral smears with no evidence of Neisseria gonorrhoeae, and negative for Trichomonas vaginalis and Candida albicans by wet mount were subjected to DFA test for detection of C. trachomatis in urethral samples. Microscopic examination of gram stained urethral smears revealed 5-7 polymorphs / HPF in 90% of the patients. Evidence of C. trachomatis with DFA (MicroTrak was detected in 11 cases (36.67% when a cut off of 10 elementary bodies was considered essential. It is concluded that C. trachomatis is an important cause of non gonococcal urethritis in male patients in New Delhi and DFA test is a useful diagnostic tool in its detection. Where facilities are not available for its detection antichlamydial therapy should be recommended emperically.

  8. Proximal surface caries detection with direct-exposure and rare earth screen/film imaging

    International Nuclear Information System (INIS)

    Lundeen, R.C.; McDavid, W.D.; Barnwell, G.M.

    1988-01-01

    This laboratory study compared five imaging systems for their diagnostic accuracy in detection of proximal surface dental caries. Ten viewers provided data on radiographic detectability of carious lesions. The diagnostic accuracy of each system was determined with receiver operating characteristic (ROC) curves by comparing viewer data with the true state of the teeth as determined microscopically. D-speed film marginally outperformed the other four systems, but the three screen/film systems matched the diagnostic accuracy of E-speed film. Radiation reductions between 62% and 92% were achieved with the screen/film systems when compared to the two conventional dental films. The feasibility of designing a screen/film bite-wing cassette was shown, but the poor diagnostic accuracy of the present bite-wing system indicated a need for a new technology in caries detection

  9. Optofluidic analysis system for amplification-free, direct detection of Ebola infection

    Science.gov (United States)

    Cai, H.; Parks, J. W.; Wall, T. A.; Stott, M. A.; Stambaugh, A.; Alfson, K.; Griffiths, A.; Mathies, R. A.; Carrion, R.; Patterson, J. L.; Hawkins, A. R.; Schmidt, H.

    2015-09-01

    The massive outbreak of highly lethal Ebola hemorrhagic fever in West Africa illustrates the urgent need for diagnostic instruments that can identify and quantify infections rapidly, accurately, and with low complexity. Here, we report on-chip sample preparation, amplification-free detection and quantification of Ebola virus on clinical samples using hybrid optofluidic integration. Sample preparation and target preconcentration are implemented on a PDMS-based microfluidic chip (automaton), followed by single nucleic acid fluorescence detection in liquid-core optical waveguides on a silicon chip in under ten minutes. We demonstrate excellent specificity, a limit of detection of 0.2 pfu/mL and a dynamic range of thirteen orders of magnitude, far outperforming other amplification-free methods. This chip-scale approach and reduced complexity compared to gold standard RT-PCR methods is ideal for portable instruments that can provide immediate diagnosis and continued monitoring of infectious diseases at the point-of-care.

  10. Prospects for direct detection of inflationary gravitational waves by next generation interferometric detectors

    International Nuclear Information System (INIS)

    Kuroyanagi, Sachiko; Chiba, Takeshi; Sugiyama, Naoshi

    2011-01-01

    We study the potential impact of detecting the inflationary gravitational wave background by the future space-based gravitational wave detectors, such as DECIGO and BBO. The signal-to-noise ratio of each experiment is calculated for chaotic/natural/hybrid inflation models by using the precise predictions of the gravitational wave spectrum based on numerical calculations. We investigate the dependence of each inflation model on the reheating temperature which influences the amplitude and shape of the spectrum, and find that the gravitational waves could be detected for chaotic/natural inflation models with high reheating temperature. From the detection of the gravitational waves, a lower bound on the reheating temperature could be obtained. The implications of this lower bound on the reheating temperature for particle physics are also discussed.

  11. The inert doublet model: a new archetype of WIMP dark matter?

    International Nuclear Information System (INIS)

    Tytgat, M Hg

    2008-01-01

    The Inert Doublet Model (IDM) is a two doublet extension of the Higgs-Brout-Englert sector of the Standard Model with a Z2 symmetry in order to prevent FCNC. If the Z2 symmetry is not spontaneously broken, the lightest neutral extra scalar is a dark matter candidate. We briefly review the phenomenology of the model, emphasizing its relevance for the issue of Electroweak Symmetry Breaking (EWSB) and the prospects for detection of dark matter

  12. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  13. "Salvage microbiology": detection of bacteria directly from clinical specimens following initiation of antimicrobial treatment.

    Directory of Open Access Journals (Sweden)

    John J Farrell

    Full Text Available PCR coupled with electrospray ionization mass spectrometry (ESI-MS is a diagnostic approach that has demonstrated the capacity to detect pathogenic organisms from culture negative clinical samples after antibiotic treatment has been initiated. [1] We describe the application of PCR/ESI-MS for detection of bacteria in original patient specimens that were obtained after administration of antibiotic treatment in an open investigation analysis.We prospectively identified cases of suspected bacterial infection in which cultures were not obtained until after the initiation of antimicrobial treatment. PCR/ESI-MS was performed on 76 clinical specimens that were submitted for conventional microbiology testing from 47 patients receiving antimicrobial treatment.In our series, 72% (55/76 of cultures obtained following initiation of antimicrobial treatment were non-diagnostic (45 negative cultures; and 10 respiratory specimens with normal flora (5, yeast (4, or coagulase-negative staphylococcus (1. PCR/ESR-MS detected organisms in 83% (39/47 of cases and 76% (58/76 of the specimens. Bacterial pathogens were detected by PCR/ESI-MS in 60% (27/45 of the specimens in which cultures were negative. Notably, in two cases of relapse of prosthetic knee infections in patients on chronic suppressive antibiotics, the previous organism was not recovered in tissue cultures taken during extraction of the infected knee prostheses, but was detected by PCR/ESI-MS.Molecular methods that rely on nucleic acid amplification may offer a unique advantage in the detection of pathogens collected after initiation of antimicrobial treatment and may provide an opportunity to target antimicrobial therapy and "salvage" both individual treatment regimens as well as, in select cases, institutional antimicrobial stewardship efforts.

  14. Direct radioimmunoassay for the detection of barbiturates in blood and urine

    International Nuclear Information System (INIS)

    Mason, P.A.; Law, B.; Pocock, K.; Moffat, A.C.

    1982-01-01

    A radioimmunoassay has been developed for the detection of barbiturates in blood and urine without any pre-treatment of the sample. It is based on a radioiodinated derivative of 4-hydroxyphenobarbitone which allows use of relatively simple gamma-counting procedures. The assay can detect therapeutic levels of barbiturates in very small amounts (50 μl) of blood and urine samples. It is cheap, rapid, simple to perform and is broadly specific for the barbiturate class of drugs to the exclusion of related drugs. The assay is, therefore, very well suited to the task of screening large numbers of samples for the presence of barbiturates. (author)

  15. Preliminary evaluation of second harmonic direct detection scheme for low-dose range in alanine/EPR dosimetry

    International Nuclear Information System (INIS)

    Chen, Felipe; Graeff, Carlos F.O.; Baffa, Oswaldo

    2002-01-01

    The usefulness of a direct detection scheme of the second harmonic (2h) overmodulated signal from irradiated alanine in EPR dosimetry was studied. For this purpose, a group of DL-alanine/paraffin cylindrical pellets was produced. The dosimeters were irradiated with a 60 Co radiotherapy gamma source with doses of 0.05, 0.1, 0.5, 1 and 5 Gy. The EPR measurements were carried out in a VARIAN-E4 spectrometer operating in X-band with optimized parameters to obtain highest amplitude signals of both harmonics. The 2h signal was detected directly at twice the modulation frequency. In preliminary results, the 2h showed some advantages over the 1h such as better resolution for doses below 1 Gy, better repeatability results and better linear behaviour in the dose range indicated. (author)

  16. Getting the astrophysics and particle physics of dark matter out of next-generation direct detection experiments

    International Nuclear Information System (INIS)

    Peter, Annika H. G.

    2010-01-01

    The next decade will bring massive new data sets from experiments of the direct detection of weakly interacting massive particle dark matter. Mapping the data sets to the particle-physics properties of dark matter is complicated not only by the considerable uncertainties in the dark-matter model, but by its poorly constrained local distribution function (the 'astrophysics' of dark matter). I propose a shift in how to think about direct-detection data analysis. I show that by treating the astrophysical and particle-physics uncertainties of dark matter on equal footing, and by incorporating a combination of data sets into the analysis, one may recover both the particle physics and astrophysics of dark matter. Not only does such an approach yield more accurate estimates of dark-matter properties, but it may illuminate how dark matter coevolves with galaxies.

  17. Astrophysical dark matter: candidates from particle physics and detection possibilities

    International Nuclear Information System (INIS)

    Freese, K.

    1989-01-01

    In this talk, I will discuss the arguments that 50% to 90% of the matter in galaxies, including our own, is made of an unknown type of dark matter. I will review the reason why cosmologists believe Ω = 1 and illustrate the contrast with the limits on the amount of baryonic matter from element abundances in Big Bang Nucleosynthesis. Other arguments for nonbaryonic dark matter will also be discussed. Candidates for the dark matter from particle physics will be presented. I will focus on cold dark matter candidates known as WIMPs, weakly interacting massive (O(GeV)) particles. I will try to illustrate why these particles are interesting for astrophysics and outline ideas for cornering them. Detection possibilities for these particles include indirect detection, which takes advantage of the annihilation products of these particles in the galactic halo, the sun, or the earth. Direct detection via newly proposed cryogenic detectors must be sensitive to <∼ keV energy deposits. Annual modulation of the dark matter signal can be used as a signature for these halo particles. I hope to motivate the interest in these particles and discuss ideas for finding them

  18. Directional Pair-Production Spectrometer Design for Airborne Stand-Off Detection of Special Nuclear Material

    Science.gov (United States)

    2011-03-01

    detectors arranged as shown in Figure 5. When the incoming gamma deposits its energy in the central detector, the resulting positron annihilates ...Compton detectors. Each pair of detectors can accomplish both spectroscopy and detection through application of energy filtering. The detectors are...electron- positron annihilation have three other detectors to interact with. Coincident techniques are used to provide real-time determination of

  19. Evaluation of the usefulness of smartphone-directed applications for measuring heart rate and arrhythmia detection

    Directory of Open Access Journals (Sweden)

    Michał Witkowski

    2017-12-01

    Conclusions: The majority of the free applications, available for smartphones, are able to measure HR precisely in patients with sinus rhythm, while in patients with AF, the exact measurement is significantly impeded by HR deficits. Only one out of 16 applications was able to measure HR in a patient with AF. None of the available applications could detect AF.

  20. Noise equalization for detection of microcalcification clusters in direct digital mammogram images.

    NARCIS (Netherlands)

    McLoughlin, K.J.; Bones, P.J.; Karssemeijer, N.

    2004-01-01

    Equalizing image noise is shown to be an important step in the automatic detection of microcalcifications in digital mammography. This study extends a well established film-screen noise equalization scheme developed by Veldkamp et al. for application to full-field digital mammogram (FFDM) images. A