WorldWideScience

Sample records for direct normal solar

  1. Increasing the temporal resolution of direct normal solar irradiance forecasted series

    Science.gov (United States)

    Fernández-Peruchena, Carlos M.; Gastón, Martin; Schroedter-Homscheidt, Marion; Marco, Isabel Martínez; Casado-Rubio, José L.; García-Moya, José Antonio

    2017-06-01

    A detailed knowledge of the solar resource is a critical point in the design and control of Concentrating Solar Power (CSP) plants. In particular, accurate forecasting of solar irradiance is essential for the efficient operation of solar thermal power plants, the management of energy markets, and the widespread implementation of this technology. Numerical weather prediction (NWP) models are commonly used for solar radiation forecasting. In the ECMWF deterministic forecasting system, all forecast parameters are commercially available worldwide at 3-hourly intervals. Unfortunately, as Direct Normal solar Irradiance (DNI) exhibits a great variability due to the dynamic effects of passing clouds, 3-h time resolution is insufficient for accurate simulations of CSP plants due to their nonlinear response to DNI, governed by various thermal inertias due to their complex response characteristics. DNI series of hourly or sub-hourly frequency resolution are normally used for an accurate modeling and analysis of transient processes in CSP technologies. In this context, the objective of this study is to propose a methodology for generating synthetic DNI time series at 1-h (or higher) temporal resolution from 3-h DNI series. The methodology is based upon patterns as being defined with help of the clear-sky envelope approach together with a forecast of maximum DNI value, and it has been validated with high quality measured DNI data.

  2. EnviroAtlas - Average Direct Normal Solar resources kWh/m2/Day by 12-Digit HUC for the Conterminous United States

    Data.gov (United States)

    U.S. Environmental Protection Agency — The annual average direct normal solar resources by 12-Digit Hydrologic Unit (HUC) was estimated from maps produced by the National Renewable Energy Laboratory for...

  3. Semi-empirical models for the estimation of clear sky solar global and direct normal irradiances in the tropics

    International Nuclear Information System (INIS)

    Janjai, S.; Sricharoen, K.; Pattarapanitchai, S.

    2011-01-01

    Highlights: → New semi-empirical models for predicting clear sky irradiance were developed. → The proposed models compare favorably with other empirical models. → Performance of proposed models is comparable with that of widely used physical models. → The proposed models have advantage over the physical models in terms of simplicity. -- Abstract: This paper presents semi-empirical models for estimating global and direct normal solar irradiances under clear sky conditions in the tropics. The models are based on a one-year period of clear sky global and direct normal irradiances data collected at three solar radiation monitoring stations in Thailand: Chiang Mai (18.78 o N, 98.98 o E) located in the North of the country, Nakhon Pathom (13.82 o N, 100.04 o E) in the Centre and Songkhla (7.20 o N, 100.60 o E) in the South. The models describe global and direct normal irradiances as functions of the Angstrom turbidity coefficient, the Angstrom wavelength exponent, precipitable water and total column ozone. The data of Angstrom turbidity coefficient, wavelength exponent and precipitable water were obtained from AERONET sunphotometers, and column ozone was retrieved from the OMI/AURA satellite. Model validation was accomplished using data from these three stations for the data periods which were not included in the model formulation. The models were also validated against an independent data set collected at Ubon Ratchathani (15.25 o N, 104.87 o E) in the Northeast. The global and direct normal irradiances calculated from the models and those obtained from measurements are in good agreement, with the root mean square difference (RMSD) of 7.5% for both global and direct normal irradiances. The performance of the models was also compared with that of other models. The performance of the models compared favorably with that of empirical models. Additionally, the accuracy of irradiances predicted from the proposed model are comparable with that obtained from some

  4. Direct solar-pumped lasers

    Science.gov (United States)

    Lee, J. H.; Shiu, Y. J.; Weaver, W. R.

    1980-01-01

    The feasibility of direct solar pumping of an iodine photodissociation laser at lambda = 1.315 microns was investigated. Threshold inversion density and effect of elevated temperature (up to 670 K) on the laser output were measured. These results and the concentration of solar radiation required for the solar pumped iodine laser are discussed.

  5. How Normal is Our Solar System?

    Science.gov (United States)

    Kohler, Susanna

    2015-10-01

    To date, weve discovered nearly 2000 confirmed exoplanets, as well as thousands of additional candidates. Amidst this vast sea of solar systems, how special is our own? A new study explores the answer to this question.Analyzing DistributionsKnowing whether our solar system is unique among exoplanetary systems can help us to better understand future observations of exoplanets. Furthermore, if our solar system is typical, this allows us to be optimistic about the possibility of life existing elsewhere in the universe.In a recent study, Rebecca Martin (University of Nevada, Las Vegas) and Mario Livio (Space Telescope Science Institute) examine how normal our solar system is, by comparing the properties of our planets to the averages obtained from known exoplanets.Comparing PropertiesSo how do we measure up?Densities of planets as a function of their mass. Exoplanets (N=287) are shown in blue, planets in our solar system are shown in red. [MartinLivio 2015]Planet masses and densitiesThose of the gas giants in our solar system are pretty typical. The terrestrial planets are on the low side for mass, but thats probably a selection effect: its very difficult to detect low-mass planets.Age of the solar systemRoughly half the stars in the disk of our galaxy are younger than the Sun, and half are older. Were definitely not special in age.Orbital locations of the planetsThis is actually a little strange: our solar system is lacking close-in planets. All of our planets, in fact, orbit at a distance that is larger than the mean distance observed in exoplanetary systems. Again, however, this might be a selection effect at work: its easier to detect large planets orbiting very close to their stars.Eccentricities of the planets orbitsOur planets are on very circular orbits and that actually makes us somewhat special too, compared to typical exoplanet systems. There is a possible explanation though: eccentricity of orbits tends to decrease with more planets in the system. Because

  6. Direct solar energy and its applications

    International Nuclear Information System (INIS)

    Hamdani, A.J.

    1997-01-01

    Solar energy, which was a utopian dream forty years ago, is today already on the market, particularly for specialized uses and in remote areas. Even solar cells are now on the eve of becoming economically competitive. After a brief account of solar-cell theory, this paper gives the essential details of Photovoltaic Module Manufacturing Technologies, Single Crystal Technology, Fabrication of Wafers, Fabrication of Solar Cell, Photovoltaic Module, Multi Crystalline Silicon, Amorphous Silicon Cell. Semi-conductor based Thin-Film Technology (other than silicon), Copper-Indium Di selenide (IS), Gallium Arsenide, Multi-Junction Devices, as well as Technologies for Improving Conversion Efficiencies, Criteria for high-efficiency Cells and Module Fabrication. It concludes with a section on Direct Utilisation of solar energy, in which a brief description is presented on Solar Thermal Devices, Solar Water Heaters, Calculating hot-water requirements, Solar Stills, Solar Drying, Concentrator Collectors and, finally Measurement of the Solar Resource. At the end, there is a useful Appendix on World-Wide Photovoltaic Cell/Module Manufacturing Capacity Expansion Profile. (author)

  7. Near-term Forecasting of Solar Total and Direct Irradiance for Solar Energy Applications

    Science.gov (United States)

    Long, C. N.; Riihimaki, L. D.; Berg, L. K.

    2012-12-01

    Integration of solar renewable energy into the power grid, like wind energy, is hindered by the variable nature of the solar resource. One challenge of the integration problem for shorter time periods is the phenomenon of "ramping events" where the electrical output of the solar power system increases or decreases significantly and rapidly over periods of minutes or less. Advance warning, of even just a few minutes, allows power system operators to compensate for the ramping. However, the ability for short-term prediction on such local "point" scales is beyond the abilities of typical model-based weather forecasting. Use of surface-based solar radiation measurements has been recognized as a likely solution for providing input for near-term (5 to 30 minute) forecasts of solar energy availability and variability. However, it must be noted that while fixed-orientation photovoltaic panel systems use the total (global) downwelling solar radiation, tracking photovoltaic and solar concentrator systems use only the direct normal component of the solar radiation. Thus even accurate near-term forecasts of total solar radiation will under many circumstances include inherent inaccuracies with respect to tracking systems due to lack of information of the direct component of the solar radiation. We will present examples and statistical analyses of solar radiation partitioning showing the differences in the behavior of the total/direct radiation with respect to the near-term forecast issue. We will present an overview of the possibility of using a network of unique new commercially available total/diffuse radiometers in conjunction with a near-real-time adaptation of the Shortwave Radiative Flux Analysis methodology (Long and Ackerman, 2000; Long et al., 2006). The results are used, in conjunction with persistence and tendency forecast techniques, to provide more accurate near-term forecasts of cloudiness, and both total and direct normal solar irradiance availability and

  8. Estimating the Heading Direction Using Normal Flow

    Science.gov (United States)

    1994-01-01

    understood (Faugeras and Maybank 1990), 3 Kinetic Stabilization under the assumption that optic flow or correspon- dence is known with some uncertainty...accelerometers can achieve very It can easily be shown (Koenderink and van Doom high accuracy, the same is not true for inexpensive 1975; Maybank 1985... Maybank . ’Motion from point matches: Multi- just don’t compute normal flow there (see Section 6). plicity of solutions". Int’l J. Computer Vision 4

  9. A direct probe of dark energy interactions with a solar System laboratory

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose a mission concept for direct detection of dark energy interactions with normal matter in a Solar System laboratory. Dark energy is the leading proposal to...

  10. Radiation effects in silicon and gallium arsenide solar cells using isotropic and normally incident radiation

    Science.gov (United States)

    Anspaugh, B. E.; Downing, R. G.

    1984-01-01

    Several types of silicon and gallium arsenide solar cells were irradiated with protons with energies between 50 keV and 10 MeV at both normal and isotropic incidence. Damage coefficients for maximum power relative to 10 MeV were derived for these cells for both cases of omni-directional and normal incidence. The damage coefficients for the silicon cells were found to be somewhat lower than those quoted in the Solar Cell Radiation Handbook. These values were used to compute omni-directional damage coefficients suitable for solar cells protected by coverglasses of practical thickness, which in turn were used to compute solar cell degradation in two proton-dominated orbits. In spite of the difference in the low energy proton damage coefficients, the difference between the handbook prediction and the prediction using the newly derived values was negligible. Damage coefficients for GaAs solar cells for short circuit current, open circuit voltage, and maximum power were also computed relative to 10 MeV protons. They were used to predict cell degradation in the same two orbits and in a 5600 nmi orbit. Results show the performance of the GaAs solar cells in these orbits to be superior to that of the Si cells.

  11. Direct solar-pumped iodine laser amplifier

    Science.gov (United States)

    Han, Kwang S.

    1987-01-01

    This semiannual progress report covers the period from March 1, 1987 to September 30, 1987 under NASA grant NAG1-441 entitled 'Direct solar-pumped iodine laser amplifier'. During this period Nd:YAG and Nd:Cr:GSGG crystals have been tested for the solar-simulator pumped cw laser, and loss mechanisms of the laser output power in a flashlamp-pumped iodine laser also have been identified theoretically. It was observed that the threshold pump-beam intensities for both Nd:YAG and Nd:Cr:GSGG crystals were about 1000 solar constants, and the cw laser operation of the Nd:Cr:GSGG crystal was more difficult than that of the Nd:YAG crystal under the solar-simulator pumping. The possibility of the Nd:Cr:GSGG laser operation with a fast continuously chopped pumping was also observed. In addition, good agreement between the theoretical calculations and the experimental data on the loss mechanisms of a flashlamp-pumped iodine laser at various fill pressures and various lasants was achieved.

  12. Evaluation of directional normalization methods for Landsat TM/ETM+ over primary Amazonian lowland forests

    Science.gov (United States)

    Van doninck, Jasper; Tuomisto, Hanna

    2017-06-01

    Biodiversity mapping in extensive tropical forest areas poses a major challenge for the interpretation of Landsat images, because floristically clearly distinct forest types may show little difference in reflectance. In such cases, the effects of the bidirectional reflection distribution function (BRDF) can be sufficiently strong to cause erroneous image interpretation and classification. Since the opening of the Landsat archive in 2008, several BRDF normalization methods for Landsat have been developed. The simplest of these consist of an empirical view angle normalization, whereas more complex approaches apply the semi-empirical Ross-Li BRDF model and the MODIS MCD43-series of products to normalize directional Landsat reflectance to standard view and solar angles. Here we quantify the effect of surface anisotropy on Landsat TM/ETM+ images over old-growth Amazonian forests, and evaluate five angular normalization approaches. Even for the narrow swath of the Landsat sensors, we observed directional effects in all spectral bands. Those normalization methods that are based on removing the surface reflectance gradient as observed in each image were adequate to normalize TM/ETM+ imagery to nadir viewing, but were less suitable for multitemporal analysis when the solar vector varied strongly among images. Approaches based on the MODIS BRDF model parameters successfully reduced directional effects in the visible bands, but removed only half of the systematic errors in the infrared bands. The best results were obtained when the semi-empirical BRDF model was calibrated using pairs of Landsat observation. This method produces a single set of BRDF parameters, which can then be used to operationally normalize Landsat TM/ETM+ imagery over Amazonian forests to nadir viewing and a standard solar configuration.

  13. Performance tests and efficiency analysis of Solar Invictus 53S - A parabolic dish solar collector for direct steam generation

    Science.gov (United States)

    Jamil, Umer; Ali, Wajahat

    2016-05-01

    This paper presents the results of performance tests conducted on Solar Invictus 53S `system'; an economically effective solar steam generation solution designed and developed by ZED Solar Ltd. The system consists of a dual axis tracking parabolic solar dish and bespoke cavity type receiver, which works as a Once Through Solar Steam Generator `OTSSG' mounted at the focal point of the dish. The overall performance and efficiency of the system depends primarily on the optical efficiency of the solar dish and thermal efficiency of the OTSSG. Optical testing performed include `on sun' tests using CCD camera images and `burn plate' testing to evaluate the sunspot for size and quality. The intercept factor was calculated using a colour look-back method to determine the percentage of solar rays focused into the receiver. Solar dish tracking stability tests were carried out at different times of day to account for varying dish elevation angles and positions, movement of the sunspot centroid was recorded and logged using a CCD camera. Finally the overall performance and net solar to steam efficiency of the system was calculated by experimentally measuring the output steam parameters at varying Direct Normal Insolation (DNI) levels at ZED Solar's test facility in Lahore, Pakistan. Thermal losses from OTSSG were calculated using the known optical efficiency and measured changes in output steam enthalpy.

  14. Series-parallel method of direct solar array regulation

    Science.gov (United States)

    Gooder, S. T.

    1976-01-01

    A 40 watt experimental solar array was directly regulated by shorting out appropriate combinations of series and parallel segments of a solar array. Regulation switches were employed to control the array at various set-point voltages between 25 and 40 volts. Regulation to within + or - 0.5 volt was obtained over a range of solar array temperatures and illumination levels as an active load was varied from open circuit to maximum available power. A fourfold reduction in regulation switch power dissipation was achieved with series-parallel regulation as compared to the usual series-only switching for direct solar array regulation.

  15. Direct solar-pumped iodine laser amplifier

    Science.gov (United States)

    Han, Kwang S.; Hwang, In Heon

    1990-01-01

    The optimum conditions of a solar pumped iodine laser are found in this research for the case of a continuous wave operation and a pulsed operation. The optimum product of the pressure(p) inside the laser tube and the tube diameter(d) was pd=40 approx. 50 torr-cm on the contrary to the case of a high intensity flashlamp pumped iodine laser where the optimum value of the product is known to be pd=150 torr-cm. The pressure-diameter product is less than 1/3 of that of the high power iodine laser. During the research period, various laser materials were also studied for solar pumping. Among the laser materials, Nd:YAG is found to have the lowest laser threshold pumping intensity of about 200 solar constant. The Rhodamine 6G was also tested as the solar pumped laser material. The threshold pumping power was measured to be about 20,000 solar constant. The amplification experiment for a continuously pumped iodine laser amplifier was performed using Vortek solar simulator and the amplification factors were measured for single pass amplification and triple pass amplification of the 15 cm long amplifier tube. The amplification of 5 was obtained for the triple pass amplification.

  16. Approach to interior design for passive direct gain solar homes

    Energy Technology Data Exchange (ETDEWEB)

    Kachadorian, C.C.

    1980-01-01

    In response to requests from buyers and builders of direct gain passive solar homes interior design criteria either specific to, or emphasized by, passive solar buildings are investigated. Problems of high sunlight penetration, secondary illumination, material selection, sound control and psychology are approached. Material deterioration, fading, glare, noise, and a sense of spacial confinement can be minimized, contributing to the appeal and saleability of passive solar homes.

  17. Heat Pumps With Direct Expansion Solar Collectors

    Science.gov (United States)

    Ito, Sadasuke

    In this paper, the studies of heat pump systems using solar collectors as the evaporators, which have been done so far by reserchers, are reviwed. Usually, a solar collector without any cover is preferable to one with ac over because of the necessity of absorbing heat from the ambient air when the intensity of the solar energy on the collector is not enough. The performance of the collector depends on its area and the intensity of the convective heat transfer on the surface. Fins are fixed on the backside of the collector-surface or on the tube in which the refrigerant flows in order to increase the convective heat transfer. For the purpose of using a heat pump efficiently throughout year, a compressor with variable capacity is applied. The solar assisted heat pump can be used for air conditioning at night during the summer. Only a few groups of people have studied cooling by using solar assisted heat pump systems. In Japan, a kind of system for hot water supply has been produced commercially in a company and a kind of system for air conditioning has been installed in buildings commercially by another company.

  18. New directions for space solar power

    Science.gov (United States)

    Mankins, John C.

    2009-07-01

    Several of the central issues associated with the eventual realization of the vision of solar power from space for terrestrial markets resolve around the expect costs associated with the assembly, inspection, maintenance and repair of future solar power satellite (SPS) stations. In past studies (for example, NASA's "Fresh Look Study", c. 1995-1997) efforts were made to reduce both the scale and mass of large, systems-level interfaces (e.g., the power management and distribution (PMAD) system) and on-orbit fixed infrastructures through the use of modular systems strategies. These efforts have had mixed success (as reflected in the projected on-orbit mass of various systems concepts. However, the author remains convinced of the importance of modular strategies for exceptionally large space systems in eventually realizing the vision of power from space. This paper will introduce some of the key issues associated with cost-competitive space solar power in terrestrial markets. It will examine some of the relevant SPS concepts and will assess the 'pros and cons' of each in terms of space assembly, maintenance and servicing (SAMS) requirements. The paper discusses at a high level some relevant concepts and technologies that may play r role in the eventual, successful resolution of these challenges. The paper concludes with an example of the kind of novel architectural approach for space solar power that is needed.

  19. Direct solar-pumped iodine laser amplifier

    Science.gov (United States)

    Han, Kwang S.; Hwang, In Heon; Kim, Khong Hon; Stock, Larry V.

    1988-01-01

    A XeCl laser pumped iodine laser oscillator was developed which will be incorporated into the Master Oscillator Power Amplifier (MOPA) system. The developed XeCl laser produces output energy of about 60 mJ per pulse. The pulse duration was about 10 nsec. The kinetic model for the solar-pumped laser was refined and the algorithm for the calculation of a set of rate equations was improved to increase the accuracy and the efficiency of the calculation. The improved algorithm was applied to explain the existing experimental data taken from a flashlamp pumped iodine laser for three kinds of lasants, i-C3F7I, n-C4F9I, and t-C4F9I. Various solid laser materials were evaluated for solar-pumping. The materials studied were Nd:YAG, Nd:YLF, and Cr:Nd:GSGG crystals. The slope efficiency of 0.17 percent was measured for the Nd:YLF near the threshold pump intensity which was 211 solar constants (29W/sq cm). The threshold pump intensity of the Nd:YAG was measured to be 236 solar constants (32W/sq cm) and the near-threshold slope efficiency was 0.12 percent. True CW laser operation of Cr:Nd:GSGG was possible only at pump intensities less than or equal to 1,500 solar constants (203 W/sq cm). This fact was attributed to the high thermal focusing effect of the Cr:Nd:GSGG rod.

  20. A combination of HARMONIE short time direct normal irradiance forecasts and machine learning: The #hashtdim procedure

    Science.gov (United States)

    Gastón, Martín; Fernández-Peruchena, Carlos; Körnich, Heiner; Landelius, Tomas

    2017-06-01

    The present work describes the first approach of a new procedure to forecast Direct Normal Irradiance (DNI): the #hashtdim that treats to combine ground information and Numerical Weather Predictions. The system is centered in generate predictions for the very short time. It combines the outputs from the Numerical Weather Prediction Model HARMONIE with an adaptive methodology based on Machine Learning. The DNI predictions are generated with 15-minute and hourly temporal resolutions and presents 3-hourly updates. Each update offers forecasts to the next 12 hours, the first nine hours are generated with 15-minute temporal resolution meanwhile the last three hours present hourly temporal resolution. The system is proved over a Spanish emplacement with BSRN operative station in south of Spain (PSA station). The #hashtdim has been implemented in the framework of the Direct Normal Irradiance Nowcasting methods for optimized operation of concentrating solar technologies (DNICast) project, under the European Union's Seventh Programme for research, technological development and demonstration framework.

  1. Correlation of total, diffuse, and direct solar radiation

    Science.gov (United States)

    Buyco, E. H.; Namkoong, D.

    1977-01-01

    Present requirements for realistic solar energy system evaluations necessitate a comprehensive body of solar-radition data. The data should include both diffuse and direct solar radiation as well as their total on an hourly (or shorter) basis. In general, however, only the total solar radiation values were recorded. This report presents a correlation that relates the diffuse component of an hourly total solar radiation value to the total radiation ratio of the maximum value attainable. The data used were taken at the Blue Hill Observatory in Milton, Massachusetts, for the period 1952. The relation - in the form of the data plots - can be used in situations in which only the hourly total radiation data are available but the diffuse component is desired.

  2. Accurate measurement of directional emittance of solar energy materials

    NARCIS (Netherlands)

    Nijnatten, van P.A.; Hugo-Le Gof, A.; Granqvist, C.-G.; Lampert, C.M.

    1992-01-01

    Directional emittance plays an important role in the calculation of radiative heat exchange. It partly determines the thermal insulation of single and multiple glazing and the efficiency of solar collectors. An emissiometer has been designed and built, capable for measurements of the directional

  3. Design of direct solar PV driven air conditioner

    KAUST Repository

    Huang, Bin-Juine

    2015-12-05

    © 2015 Elsevier Ltd. Solar air conditioning system directly driven by stand-alone solar PV is studied. The air conditioning system will suffer from loss of power if the solar PV power generation is not high enough. It requires a proper system design to match the power consumption of air conditioning system with a proper PV size. Six solar air conditioners with different sizes of PV panel and air conditioners were built and tested outdoors to experimentally investigate the running probabilities of air conditioning at various solar irradiations. It is shown that the instantaneous operation probability (OPB) and the runtime fraction (RF) of the air conditioner are mainly affected by the design parameter rpL (ratio of maximum PV power to load power). The measured OPB is found to be greater than 0.98 at instantaneous solar irradiation IT > 600 W m-2 if rpL > 1.71 RF approaches 1.0 (the air conditioner is run in 100% with solar power) at daily-total solar radiation higher than 13 MJ m-2 day-1, if rpL > 3.

  4. A comparative study of direct and indirect solar drying of mango ...

    African Journals Online (AJOL)

    A comparative study of direct and indirect solar drying of mango. ... Thus, indirect solar dryer was found to be suitable for industrial or semi industrial mango drying, whereas direct solar dryer was appropriate to a family ... HOW TO USE AJOL.

  5. Estimating hourly direct and diffuse solar radiation for the compilation of solar radiation distribution maps

    International Nuclear Information System (INIS)

    Ueyama, H.

    2005-01-01

    This paper presents a new method for estimating hourly direct and diffuse solar radiation. The essence of the method is the estimation of two important factors related to solar radiation, atmospheric transmittance and a dimensionless parameter, using empirical and physical equations and data from general meteorological observation stations. An equation for atmospheric transmittance of direct solar radiation and a dimensionless parameter representing diffuse solar radiation are developed. The equation is based on multiple regression analysis and uses three parameters as explanatory variates: calculated hourly extraterrestrial solar radiation on a horizontal plane, observed hourly sunshine duration and hourly precipitation as observed at a local meteorological observatory. The dimensionless parameter for estimating a diffuse solar radiation is then determined by linear least squares using observed hourly solar radiation at a local meteorological observatory. The estimated root mean square error (RMSE) of hourly direct and diffuse solar radiation is about 0.0-0.2 MJ¥m(-2)¥h(-1) in each mean period. The RMSE of the ten-day and monthly means of these quantities is about 0.0-0.2 MJ¥m(-2)¥h(-1), based on comparisons with AMeDAS station data, located at a distance of 6 km

  6. Towards the intrahour forecasting of direct normal irradiance using sky-imaging data.

    Science.gov (United States)

    Nou, Julien; Chauvin, Rémi; Eynard, Julien; Thil, Stéphane; Grieu, Stéphane

    2018-04-01

    Increasing power plant efficiency through improved operation is key in the development of Concentrating Solar Power (CSP) technologies. To this end, one of the most challenging topics remains accurately forecasting the solar resource at a short-term horizon. Indeed, in CSP plants, production is directly impacted by both the availability and variability of the solar resource and, more specifically, by Direct Normal Irradiance (DNI). The present paper deals with a new approach to the intrahour forecasting (the forecast horizon [Formula: see text] is up to [Formula: see text] ahead) of DNI, taking advantage of the fact that this quantity can be split into two terms, i.e. clear-sky DNI and the clear sky index. Clear-sky DNI is forecasted from DNI measurements, using an empirical model (Ineichen and Perez, 2002) combined with a persistence of atmospheric turbidity. Moreover, in the framework of the CSPIMP (Concentrating Solar Power plant efficiency IMProvement) research project, PROMES-CNRS has developed a sky imager able to provide High Dynamic Range (HDR) images. So, regarding the clear-sky index, it is forecasted from sky-imaging data, using an Adaptive Network-based Fuzzy Inference System (ANFIS). A hybrid algorithm that takes inspiration from the classification algorithm proposed by Ghonima et al. (2012) when clear-sky anisotropy is known and from the hybrid thresholding algorithm proposed by Li et al. (2011) in the opposite case has been developed to the detection of clouds. Performance is evaluated via a comparative study in which persistence models - either a persistence of DNI or a persistence of the clear-sky index - are included. Preliminary results highlight that the proposed approach has the potential to outperform these models (both persistence models achieve similar performance) in terms of forecasting accuracy: over the test data used, RMSE (the Root Mean Square Error) is reduced of about [Formula: see text], with [Formula: see text], and [Formula: see

  7. A methodology for the stochastic generation of hourly synthetic direct normal irradiation time series

    Science.gov (United States)

    Larrañeta, M.; Moreno-Tejera, S.; Lillo-Bravo, I.; Silva-Pérez, M. A.

    2018-02-01

    Many of the available solar radiation databases only provide global horizontal irradiance (GHI) while there is a growing need of extensive databases of direct normal radiation (DNI) mainly for the development of concentrated solar power and concentrated photovoltaic technologies. In the present work, we propose a methodology for the generation of synthetic DNI hourly data from the hourly average GHI values by dividing the irradiance into a deterministic and stochastic component intending to emulate the dynamics of the solar radiation. The deterministic component is modeled through a simple classical model. The stochastic component is fitted to measured data in order to maintain the consistency of the synthetic data with the state of the sky, generating statistically significant DNI data with a cumulative frequency distribution very similar to the measured data. The adaptation and application of the model to the location of Seville shows significant improvements in terms of frequency distribution over the classical models. The proposed methodology applied to other locations with different climatological characteristics better results than the classical models in terms of frequency distribution reaching a reduction of the 50% in the Finkelstein-Schafer (FS) and Kolmogorov-Smirnov test integral (KSI) statistics.

  8. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  9. First principle analyses of direct bandgap solar cells with absorbing substrates versus mirrors

    Energy Technology Data Exchange (ETDEWEB)

    Kirk, Alexander P. [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, Arizona 85287 (United States); Kirk, Wiley P. [Department of Materials Science and Engineering, University of Texas at Arlington, Arlington, Texas 76019 (United States)

    2013-11-07

    Direct bandgap InP, GaAs, CdTe, and Ga{sub 0.5}In{sub 0.5}P solar cells containing backside mirrors as well as parasitically absorbing substrates are analyzed for their limiting open circuit voltage and power conversion efficiency with comparison to record solar cells. From the principle of detailed balance, it is shown quantitatively that mirror solar cells have greater voltage and power conversion efficiency than their substrate counterparts. Next, the radiative recombination coefficient and maximum radiative lifetime of GaAs mirror and substrate solar cells are calculated and compared to the nonradiative Auger and Shockley-Read-Hall (SRH) lifetimes. Mirror solar cells have greater radiative lifetime than their substrate variants. Auger lifetime exceeds radiative lifetime for both substrate and mirror cells while SRH lifetime may be less or greater than radiative lifetime depending on trap concentration and capture cross section. Finally, the change in free energy of the photogenerated carriers is analyzed in a comparison between InP, GaAs, CdTe, and Ga{sub 0.5}In{sub 0.5}P mirror and substrate solar cells in order to characterize the relationship between solar photon quality and free energy management in solar cells with differing bandgaps. Wider bandgap visible threshold Ga{sub 0.5}In{sub 0.5}P solar cells make better use of the available change in free energy of the photogenerated charge carriers, even when normalized to the bandgap energy, than narrower bandgap near-IR threshold InP, GaAs, and CdTe solar cells.

  10. Direct solar pumping of semiconductor lasers: A feasibility study

    Science.gov (United States)

    Anderson, Neal G.

    1992-01-01

    This report describes results of NASA Grant NAG-1-1148, entitled Direct Solar Pumping of Semiconductor Lasers: A Feasibility Study. The goals of this study were to provide a preliminary assessment of the feasibility of pumping semiconductor lasers in space with directly focused sunlight and to identify semiconductor laser structures expected to operate at the lowest possible focusing intensities. It should be emphasized that the structures under consideration would provide direct optical-to-optical conversion of sunlight into laser light in a single crystal, in contrast to a configuration consisting of a solar cell or storage battery electrically pumping a current injection laser. With external modulation, such lasers could perhaps be efficient sources for intersatellite communications. We proposed specifically to develop a theoretical model of semiconductor quantum-well lasers photopumped by a broadband source, test it against existing experimental data where possible, and apply it to estimating solar pumping requirements and identifying optimum structures for operation at low pump intensities. These tasks have been accomplished, as described in this report of our completed project. The report is organized as follows: Some general considerations relevant to the solar-pumped semiconductor laser problem are discussed in Section 2, and the types of structures chosen for specific investigation are described. The details of the laser model we developed for this work are then outlined in Section 3. In Section 4, results of our study are presented, including designs for optimum lattice-matched and strained-layer solar-pumped quantum-well lasers and threshold pumping estimates for these structures. It was hoped at the outset of this work that structures could be identified which could be expected to operate continuously at solar photoexcitation intensities of several thousand suns, and this indeed turned out to be the case as described in this section. Our project is

  11. Performance of direct absorption solar collector with nanofluid mixture

    International Nuclear Information System (INIS)

    Turkyilmazoglu, Mustafa

    2016-01-01

    Highlights: • Neat approximations for temperature and solar collector efficiency are presented. • The non-adiabatic and isothermal base mechanisms optimize the surface absorption. • Heat transferring material at the bottom panel enhances the thermal efficiency. • Isothermal base panel leads to maximum thermal efficiency of the solar receiver. - Abstract: The enhancement of performance by increasing the thermal efficiency of a direct absorption solar collector based on an alumina–water nanofluid is the prime target of the present research. The base panel of the collector channel is subject to either a non adiabatic or an isothermal wall condition both of which introduce two new physical parameters. Analytical solutions for the temperature field are worked out in both cases for a two dimensional steady-state model recently outlined in the literature. The desired increase in the temperature of the heat transferring nanofluid is achieved either by slightly rising the heat transfer coefficient of the bottom panel coating or by prescribing a bottom surface temperature. As a consequence of the increase in the final outlet mean temperature, the solar collector thermal efficiency is found to be enhanced via increasing the new physical parameters as compared to the traditional adiabatic wall case. For instance, 85.63% thermal efficiency of solar collector is achievable for non adiabatic bottom panel by adding suspended aluminum nanoparticles into the pure water. Even better than this, considering isothermal base panels, 100% efficiency is attained more rapidly with lesser base temperatures in the presence of higher nanoparticle volume fractions.

  12. Virginia Solar Pathways Project: Economic Study of Utility-Administered Solar Programs: Soft Costs, Community Solar, and Tax Normalization Considerations

    Energy Technology Data Exchange (ETDEWEB)

    Reiter, Emerson [National Renewable Energy Lab. (NREL), Golden, CO (United States); Lowder, Travis [National Renewable Energy Lab. (NREL), Golden, CO (United States); Mathur, Shivani [National Renewable Energy Lab. (NREL), Golden, CO (United States); Mercer, Megan [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-06-23

    This report presents economic considerations for solar development in support of the Virginia Solar Pathways Project (VSPP), an effort funded by the U.S. Department of Energy (DOE) SunShot Initiative that seeks to develop a collaborative utility-administered solar strategy for the Commonwealth of Virginia. The results presented are intended to be considered alongside the results of other studies conducted under the VSPP that evaluate the impacts of solar energy on the electric distribution, transmission, and generation systems in Virginia.

  13. Nanofluid Types, Their Synthesis, Properties and Incorporation in Direct Solar Thermal Collectors: A Review

    Directory of Open Access Journals (Sweden)

    Wisut Chamsa-ard

    2017-05-01

    Full Text Available The global demand for energy is increasing and the detrimental consequences of rising greenhouse gas emissions, global warming and environmental degradation present major challenges. Solar energy offers a clean and viable renewable energy source with the potential to alleviate the detrimental consequences normally associated with fossil fuel-based energy generation. However, there are two inherent problems associated with conventional solar thermal energy conversion systems. The first involves low thermal conductivity values of heat transfer fluids, and the second involves the poor optical properties of many absorbers and their coating. Hence, there is an imperative need to improve both thermal and optical properties of current solar conversion systems. Direct solar thermal absorption collectors incorporating a nanofluid offers the opportunity to achieve significant improvements in both optical and thermal performance. Since nanofluids offer much greater heat absorbing and heat transfer properties compared to traditional working fluids. The review summarizes current research in this innovative field. It discusses direct solar absorber collectors and methods for improving their performance. This is followed by a discussion of the various types of nanofluids available and the synthesis techniques used to manufacture them. In closing, a brief discussion of nanofluid property modelling is also presented.

  14. Nanofluid Types, Their Synthesis, Properties and Incorporation in Direct Solar Thermal Collectors: A Review.

    Science.gov (United States)

    Chamsa-Ard, Wisut; Brundavanam, Sridevi; Fung, Chun Che; Fawcett, Derek; Poinern, Gerrard

    2017-05-31

    The global demand for energy is increasing and the detrimental consequences of rising greenhouse gas emissions, global warming and environmental degradation present major challenges. Solar energy offers a clean and viable renewable energy source with the potential to alleviate the detrimental consequences normally associated with fossil fuel-based energy generation. However, there are two inherent problems associated with conventional solar thermal energy conversion systems. The first involves low thermal conductivity values of heat transfer fluids, and the second involves the poor optical properties of many absorbers and their coating. Hence, there is an imperative need to improve both thermal and optical properties of current solar conversion systems. Direct solar thermal absorption collectors incorporating a nanofluid offers the opportunity to achieve significant improvements in both optical and thermal performance. Since nanofluids offer much greater heat absorbing and heat transfer properties compared to traditional working fluids. The review summarizes current research in this innovative field. It discusses direct solar absorber collectors and methods for improving their performance. This is followed by a discussion of the various types of nanofluids available and the synthesis techniques used to manufacture them. In closing, a brief discussion of nanofluid property modelling is also presented.

  15. Anode catalysts for direct ethanol fuel cells utilizing directly solar light illumination.

    Science.gov (United States)

    Chu, Daobao; Wang, Shuxi; Zheng, Peng; Wang, Jian; Zha, Longwu; Hou, Yuanyuan; He, Jianguo; Xiao, Ying; Lin, Huashui; Tian, Zhaowu

    2009-01-01

    Shine a light: A PtNiRu/TiO(2) anode catalyst for direct ethanol fuel cells shows photocatalytic activity. The peak current density for ethanol oxidation under solar light illumination is 2-3 times greater than that in the absence of solar light. Ethanol is oxidized by light-generated holes, and the electrons are collected by the TiO(2) support to generate the oxidation current.Novel PtNiRu/TiO(2) anode catalysts for direct ethanol fuel cells (DEFCs) were prepared from PtNiRu nanoparticles (1:1:1 atomic ratios) and a nanoporous TiO(2) film by a sol-gel and electrodeposition method. The performances of the catalysts for ethanol oxidation were investigated by cyclic voltammetry, chronoamperometry and electrochemical impedance spectroscopy. The results indicate a remarkable enhancement of activity for ethanol oxidation under solar light illumination. Under solar light illumination, the generated oxidation peak current density is 24.6 mA cm(-2), which is about 2.5 times higher than that observed without solar light (9.9 mA cm(-2)). The high catalytic activity of the PtNiRu/TiO(2) complex catalyst for the electrooxidation of ethanol may be attributed to the modified metal/nanoporous TiO(2) film, and the enhanced electrooxidation of ethanol under solar light may be due to the photogeneration of holes in the modified nanoporous TiO(2) film.

  16. Nanofluid optical property characterization: towards efficient direct absorption solar collectors

    Directory of Open Access Journals (Sweden)

    Otanicar Todd

    2011-01-01

    Full Text Available Abstract Suspensions of nanoparticles (i.e., particles with diameters < 100 nm in liquids, termed nanofluids, show remarkable thermal and optical property changes from the base liquid at low particle loadings. Recent studies also indicate that selected nanofluids may improve the efficiency of direct absorption solar thermal collectors. To determine the effectiveness of nanofluids in solar applications, their ability to convert light energy to thermal energy must be known. That is, their absorption of the solar spectrum must be established. Accordingly, this study compares model predictions to spectroscopic measurements of extinction coefficients over wavelengths that are important for solar energy (0.25 to 2.5 μm. A simple addition of the base fluid and nanoparticle extinction coefficients is applied as an approximation of the effective nanofluid extinction coefficient. Comparisons with measured extinction coefficients reveal that the approximation works well with water-based nanofluids containing graphite nanoparticles but less well with metallic nanoparticles and/or oil-based fluids. For the materials used in this study, over 95% of incoming sunlight can be absorbed (in a nanofluid thickness ≥10 cm with extremely low nanoparticle volume fractions - less than 1 × 10-5, or 10 parts per million. Thus, nanofluids could be used to absorb sunlight with a negligible amount of viscosity and/or density (read: pumping power increase.

  17. Magnetosheath Propagation Time of Solar Wind Directional Discontinuities

    Science.gov (United States)

    Samsonov, A. A.; Sibeck, D. G.; Dmitrieva, N. P.; Semenov, V. S.; Slivka, K. Yu.; Å afránkova, J.; Němeček, Z.

    2018-05-01

    Observed delays in the ground response to solar wind directional discontinuities have been explained as the result of larger than expected magnetosheath propagation times. Recently, Samsonov et al. (2017, https://doi.org/10.1002/2017GL075020) showed that the typical time for a southward interplanetary magnetic field (IMF) turning to propagate across the magnetosheath is 14 min. Here by using a combination of magnetohydrodynamic simulations, spacecraft observations, and analytic calculations, we study the dependence of the propagation time on solar wind parameters and near-magnetopause cutoff speed. Increases in the solar wind speed result in greater magnetosheath plasma flow velocities, decreases in the magnetosheath thickness and, as a result, decreases in the propagation time. Increases in the IMF strength result in increases in the magnetosheath thickness and increases in the propagation time. Both magnetohydrodynamic simulations and observations suggest that propagation times are slightly smaller for northward IMF turnings. Magnetosheath flow deceleration must be taken into account when predicting the arrival times of solar wind structures at the dayside magnetopause.

  18. Direct coupling of a solar-hydrogen system in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Arriaga, L.G. [Gerencia de Energias No Convencionales, Instituto de Investigaciones Electricas (IIE), Av. Reforma 113, Col. Palmira, 62490 Cuernavaca, Morelos (Mexico); Centro de Investigacion y Desarrollo Tecnologico en Electroquimica S.C., Parque tecnologico Queretaro Sanfandila, Pedro Escobedo, C.P. 76703 Queretaro (Mexico); Martinez, W. [Departamento de Materiales Solares, CIE-UNAM, Av. Xochicalco s/n, Col. Centro, 62580 Temixco, Morelos (Mexico); Cano, U.; Blud, H. [Gerencia de Energias No Convencionales, Instituto de Investigaciones Electricas (IIE), Av. Reforma 113, Col. Palmira, 62490 Cuernavaca, Morelos (Mexico)

    2007-09-15

    The scope of this article is to show the initial results obtained in the interconnection of a 2.7 kW solar panel system with a solid polymer electrolyte (SPE) electrolyzer. The Non-Conventional Energies Department (ENC) at the Electrical Research Institute (IIE) considers that the storage of this intermittent energy by a chemical element such as hydrogen can be advantageous for certain applications. One of the arguments is that unlike traditional battery systems, hydrogen presents the great advantage of not discharging its energy content as long as it is not used. The solar-hydrogen (S-H) system proposed consists of a commercial electrolyzer stack by Proton Energy Systems and a photovoltaic (PV) solar system of 36 panels (75 W each) of monocrystalline silicon (Siemens) interconnected in a configuration for 2.7 kW power at 48V{sub DC}. The complete electrolyzer (stack plus auxiliaries) has a maximum capacity of 1000lN/h of hydrogen with a power energy consumption of 8 kVA (220V{sub AC}, 32 A) and uses a stack of 25 cells of SPE with an energy consumption of 5.6 kW. We present voltage, current and energy consumption of the electrolyzer as a whole system and of the stack alone, as well as hydrogen quantification for the Hogen 40 operating in laboratory. These results allowed us to estimate the possibilities of coupling the electrolyzer stack alone, i.e. no auxiliaries nor power conditioning, with the solar PV system. Results such as I-E curves of the solar PV system obtained at different irradiances and temperatures, as well as I-E curve of SPE electrolyzer stack, gave direction for confirming that PV system configuration was sufficiently good to have the electrolyzer stack working near the maximum power point at a good range of irradiances ({proportional_to}600-800W/m{sup 2}). (author)

  19. A solar simulator-pumped gas laser for the direct conversion of solar energy

    Science.gov (United States)

    Weaver, W. R.; Lee, J. H.

    1981-01-01

    Most proposed space power systems are comprised of three general stages, including the collection of the solar radiation, the conversion to a useful form, and the transmission to a receiver. The solar-pumped laser, however, effectively eliminates the middle stage and offers direct photon-to-photon conversion. The laser is especially suited for space-to-space power transmission and communication because of minimal beam spread, low power loss over large distances, and extreme energy densities. A description is presented of the first gas laser pumped by a solar simulator that is scalable to high power levels. The lasant is an iodide C3F7I that as a laser-fusion driver has produced terawatt peak power levels.

  20. Overview and future direction for blackbody solar-pumped lasers

    Science.gov (United States)

    Deyoung, R. J.

    1988-01-01

    A review of solar-pumped blackbody lasers is given which addresses their present status and suggests future research directions. The blackbody laser concept is one system proposed to scale to multimegawatt power levels for space-to-space power transmissions for such applications as onboard spacecraft electrical or propulsion needs. Among the critical technical issues are the scalability to high powers and the laser wavelength which impacts the transmission optics size as well as the laser-to-electric converter at the receiver. Because present blackbody solar-pumped lasers will have laser wavelengths longer than 4 microns, simple photovoltaic converters cannot be used, and transmission optics will be large. Thus, future blackbody laser systems should emphasize near visible laser wavelengths.

  1. Starting characteristics of direct current motors powered by solar cells

    Science.gov (United States)

    Singer, S.; Appelbaum, J.

    1989-01-01

    Direct current motors are used in photovoltaic systems. Important characteristics of electric motors are the starting to rated current and torque ratios. These ratios are dictated by the size of the solar cell array and are different for the various dc motor types. Discussed here is the calculation of the starting to rated current ratio and starting to rated torque ratio of the permanent magnet, and series and shunt excited motors when powered by solar cells for two cases: with and without a maximum-power-point-tracker (MPPT) included in the system. Comparing these two cases, one gets a torque magnification of about 3 for the permanent magnet motor and about 7 for other motor types. The calculation of the torques may assist the PV system designer to determine whether or not to include an MPPT in the system.

  2. The normalization in the use of solar heaters; La normalizacion en el uso de calentadores solares

    Energy Technology Data Exchange (ETDEWEB)

    Pilatowsky F, I.; Terrones B, A.; Garcia H, C.R. [Departamento de Sistemas Energeticos, Centro de Investigacion en Energia, UNAM, Mexico, D. F. (Mexico)

    1997-12-31

    This paper presents the different criteria in the establishment of the standard for the converter devices and solar systems for water heating for domestic, commercial and services use, as well as the criteria needed for the standard required for the installation of the equipment and systems. Together with the former, it discusses the establishment of the criteria for the creation of: training programs, of a regulatory commission for the implementation, follow up and penalties derived of the application of the norm, a legal frame, to regulate the legal relationship among the manufacturers and service providers with the consumers, as well as a permanent program for the diffusion of the characteristics, energy saving and the environmental impact derived of the utilization of solar energy. Additionally, a description is made of the first experimental results obtained in a test bench, where the norm ASHRAE 93-77 was applied. [Espanol] En el presente articulo se presentan los diferentes criterios tanto para el establecimiento de la normatividad de los dispositivos conversores y sistemas solares para el calentamiento de agua para uso domestico, comercial y de servicios, asi como los necesarios para la normatividad requerida en la instalacion de los equipos y sistemas. Aunado a lo anterior se analiza el establecimiento de criterios para la creacion de: programas de capacitacion de una comision reguladora de la implantacion, seguimiento y sanciones derivadas de la aplicacion de la norma, un marco legal, regulador de la relacion juridica entre los fabricantes y prestadores de servicios y los consumidores, asi como un programa permanente de difusion sobre las caracteristicas, ahorro de energia e impacto ambiental derivado del uso de la energia solar. Adicionalmente se describen los primeros resultados experimentales obtenidos en un banco de pruebas, en donde se aplico la normas ASHRAE 93-77.

  3. The normalization in the use of solar heaters; La normalizacion en el uso de calentadores solares

    Energy Technology Data Exchange (ETDEWEB)

    Pilatowsky F, I; Terrones B, A; Garcia H, C R [Departamento de Sistemas Energeticos, Centro de Investigacion en Energia, UNAM, Mexico, D. F. (Mexico)

    1998-12-31

    This paper presents the different criteria in the establishment of the standard for the converter devices and solar systems for water heating for domestic, commercial and services use, as well as the criteria needed for the standard required for the installation of the equipment and systems. Together with the former, it discusses the establishment of the criteria for the creation of: training programs, of a regulatory commission for the implementation, follow up and penalties derived of the application of the norm, a legal frame, to regulate the legal relationship among the manufacturers and service providers with the consumers, as well as a permanent program for the diffusion of the characteristics, energy saving and the environmental impact derived of the utilization of solar energy. Additionally, a description is made of the first experimental results obtained in a test bench, where the norm ASHRAE 93-77 was applied. [Espanol] En el presente articulo se presentan los diferentes criterios tanto para el establecimiento de la normatividad de los dispositivos conversores y sistemas solares para el calentamiento de agua para uso domestico, comercial y de servicios, asi como los necesarios para la normatividad requerida en la instalacion de los equipos y sistemas. Aunado a lo anterior se analiza el establecimiento de criterios para la creacion de: programas de capacitacion de una comision reguladora de la implantacion, seguimiento y sanciones derivadas de la aplicacion de la norma, un marco legal, regulador de la relacion juridica entre los fabricantes y prestadores de servicios y los consumidores, asi como un programa permanente de difusion sobre las caracteristicas, ahorro de energia e impacto ambiental derivado del uso de la energia solar. Adicionalmente se describen los primeros resultados experimentales obtenidos en un banco de pruebas, en donde se aplico la normas ASHRAE 93-77.

  4. Renewable water: Direct contact membrane distillation coupled with solar ponds

    International Nuclear Information System (INIS)

    Suárez, Francisco; Ruskowitz, Jeffrey A.; Tyler, Scott W.; Childress, Amy E.

    2015-01-01

    Highlights: • Experimental investigation of direct contact membrane distillation driven by solar ponds. • The DCMD/SGSP system treats ∼6 times the water flow treated by an AGMD/SGSP system. • Half of the energy extracted from the SGSP was used to transport water across the membrane. • Reducing heat losses through the DCMD/SGSP system would yield higher water fluxes. - Abstract: Desalination powered by renewable energy sources is an attractive solution to address the worldwide water-shortage problem without contributing significant to greenhouse gas emissions. A promising system for renewable energy desalination is the utilization of low-temperature direct contact membrane distillation (DCMD) driven by a thermal solar energy system, such as a salt-gradient solar pond (SGSP). This investigation presents the first experimental study of fresh water production in a coupled DCMD/SGSP system. The objectives of this work are to determine the experimental fresh water production rates and the energetic requirements of the different components of the system. From the laboratory results, it was found that the coupled DCMD/SGSP system treats approximately six times the water flow treated by a similar system that consisted of an air–gap membrane distillation unit driven by an SGSP. In terms of the energetic requirements, approximately 70% of the heat extracted from the SGSP was utilized to drive thermal desalination and the rest was lost in different locations of the system. In the membrane module, only half of the useful heat was actually used to transport water across the membrane and the remainder was lost by conduction in the membrane. It was also found that by reducing heat losses throughout the system would yield higher water fluxes, pointing out the need to improve the efficiency throughout the DCMD/SGSP coupled system. Therefore, further investigation of membrane properties, insulation of the system, or optimal design of the solar pond must be addressed in

  5. X-ray photographs of a solar active region with a multilayer telescope at normal incidence

    Science.gov (United States)

    Underwood, J. H.; Bruner, M. E.; Haisch, B. M.; Brown, W. A.; Acton, L. W.

    1987-01-01

    An astronomical photograph was obtained with a multilayer X-ray telescope. A 4-cm tungsten-carbon multilayer mirror was flown as part of an experimental solar rocket payload, and successful images were taken of the sun at normal incidence at a wavelength of 44 A. Coronal Si XII emission from an active region was recorded on film; as expected, the structure is very similar to that observed at O VIII wavelengths by the Solar Maximum Mission flat-crystal spectrometer at the same time. The small, simple optical system used in this experiment appears to have achieved a resolution of 5 to 10 arcsec.

  6. Photocatalytic hydrogen production under direct solar light in a CPC based solar reactor: Reactor design and preliminary results

    International Nuclear Information System (INIS)

    Jing Dengwei; Liu Huan; Zhang Xianghui; Zhao Liang; Guo Liejin

    2009-01-01

    In despite of so many types of solar reactors designed for solar detoxification purposes, few attempts have been made for photocatalytic hydrogen production, which in our option, is one of the most promising approaches for solar to chemical energy conversion. Addressing both the similarity and dissimilarity for these two processes and by fully considering the special requirements for the latter reaction, a Compound Parabolic Concentrator (CPC) based photocatalytic hydrogen production solar reactor has been designed for the first time. The design and optimization of this CPC based solar reactor has been discussed in detail. Preliminary results demonstrated that efficient photocatalytic hydrogen production under direct solar light can be accomplished by coupling tubular reactors with CPC concentrators. It is anticipated that this first demonstration of concentrator-based solar photocatalytic hydrogen production would draw attention for further studies in this promising direction.

  7. Leaf color is fine-tuned on the solar spectra to avoid strand direct solar radiation.

    Science.gov (United States)

    Kume, Atsushi; Akitsu, Tomoko; Nasahara, Kenlo Nishida

    2016-07-01

    The spectral distributions of light absorption rates by intact leaves are notably different from the incident solar radiation spectra, for reasons that remain elusive. Incident global radiation comprises two main components; direct radiation from the direction of the sun, and diffuse radiation, which is sunlight scattered by molecules, aerosols and clouds. Both irradiance and photon flux density spectra differ between direct and diffuse radiation in their magnitude and profile. However, most research has assumed that the spectra of photosynthetically active radiation (PAR) can be averaged, without considering the radiation classes. We used paired spectroradiometers to sample direct and diffuse solar radiation, and obtained relationships between the PAR spectra and the absorption spectra of photosynthetic pigments and organs. As monomers in solvent, the spectral absorbance of Chl a decreased with the increased spectral irradiance (W m(-2) nm(-1)) of global PAR at noon (R(2) = 0.76), and was suitable to avoid strong spectral irradiance (λmax = 480 nm) rather than absorb photon flux density (μmol m(-2) s(-1) nm(-1)) efficiently. The spectral absorption of photosystems and the intact thallus and leaves decreased linearly with the increased spectral irradiance of direct PAR at noon (I dir-max), where the wavelength was within the 450-650 nm range (R(2) = 0.81). The higher-order structure of photosystems systematically avoided the strong spectral irradiance of I dir-max. However, when whole leaves were considered, leaf anatomical structure and light scattering in leaf tissues made the leaves grey bodies for PAR and enabled high PAR use efficiency. Terrestrial green plants are fine-tuned to spectral dynamics of incident solar radiation and PAR absorption is increased in various structural hierarchies.

  8. Solar radiation and cooling load calculation for radiant systems: Definition and evaluation of the Direct Solar Load

    DEFF Research Database (Denmark)

    Causone, Francesco; Corgnati, Stefano P.; Filippi, Marco

    2010-01-01

    The study of the influence of solar radiation on the built environment is a basic issue in building physics and currently it is extremely important because glazed envelopes are widely used in contemporary architecture. In the present study, the removal of solar heat gains by radiant cooling systems...... is investigated. Particular attention is given to the portion of solar radiation converted to cooling load, without taking part in thermal absorption phenomena due to the thermal mass of the room. This specific component of the cooling load is defined as the Direct Solar Load. A simplified procedure to correctly...... calculate the magnitude of the Direct Solar Load in cooling load calculations is proposed and it is implemented with the Heat Balance method and the Radiant Time Series method. The F ratio of the solar heat gains directly converted to cooling load, in the case of a low thermal mass radiant ceiling...

  9. First direct detection of solar pp neutrinos by Borexino

    Energy Technology Data Exchange (ETDEWEB)

    Maneschg, Werner [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Collaboration: Werner Maneschg on behalf of the Borexino collaboration

    2015-07-01

    According to the Standard Solar Model (SSM) the radiative energy of our Sun is produced by a series of nuclear reactions that convert hydrogen into helium. In 99% of cases these processes are supposed to start with a fusion of two protons and the emission of a positron and a low-energy neutrino. These so-called pp neutrinos vastly outnumber those emitted in other sub-reactions, but only the large volume organic liquid scintillator detector Borexino has recently succeeded to perform a spectroscopic and direct measurement of them. The present talk reviews the procedure adopted by the Borexino collaboration to detect pp neutrinos. The key requirements, i.e. unprecedented radiopurity levels at low energies and a precise spectral description of the main background arising from 14C decays, and their fulfillment are discussed. The measured pp neutrino flux is then compared with the predictions of the SSM including neutrino oscillation mechanisms, and with the solar luminosity constraint deduced from photospheric observations.

  10. Direct solar steam generation inside evacuated tube absorber

    Directory of Open Access Journals (Sweden)

    Khaled M. Bataineh

    2016-12-01

    Full Text Available Direct steam generation by solar radiation falling on absorber tube is studied in this paper. A system of single pipe covered by glass material in which the subcooled undergoes heating and evaporation process is analyzed. Mathematical equations are derived based on energy, momentum and mass balances for system components. A Matlab code is built to simulate the flow of water inside the absorber tube and determine properties of water along the pipe. Widely accepted empirical correlations and mathematical models of turbulent flow, pressure drop for single and multiphase flow, and heat transfer are used in the simulation. The influences of major parameters on the system performance are investigated. The pressure profiles obtained by present numerical solution for each operation condition (3 and 10 MPa matches very well experimental data from the DISS system of Plataforma Solar de Almería. Furthermore, results obtained by simulation model for pressure profiles are closer to the experimental data than those predicted by already existed other numerical model.

  11. Decontamination of drinking water by direct heating in solar panels.

    Science.gov (United States)

    Fjendbo Jørgensen, A J; Nøhr, K; Sørensen, H; Boisen, F

    1998-09-01

    A device was developed for direct heating of water by solar radiation in a flow-through system of copper pipes. An adjustable thermostat valve prevents water below the chosen temperature from being withdrawn. The results show that it is possible to eliminate coliform and thermotolerant coliform bacteria from naturally contaminated river water by heating to temperatures of 65 degrees C or above. Artificial additions of Salmonella typhimurium, Streptococcus faecalis and Escherichia coli to contaminated river water were also inactivated after heating to 65 degrees C and above. The total viable count could be reduced by a factor of 1000. The heat-resistant bacteria isolated from the Mlalakuva River (Tanzania) were spore-forming bacteria which exhibited greater heat resistance than commonly used test bacteria originating from countries with colder climates. To provide a good safety margin it is recommended that an outlet water temperature of 75 degrees C be used. At that temperature the daily production was about 501 of decontaminated water per m2 of solar panel, an amount that could be doubled by using a heat exchanger to recycle the heat.

  12. Directional output distance functions: endogenous directions based on exogenous normalization constraints

    Science.gov (United States)

    In this paper we develop a model for computing directional output distance functions with endogenously determined direction vectors. We show how this model is related to the slacks-based directional distance function introduced by Fare and Grosskopf and show how to use the slacks-based function to e...

  13. Financing options and economic impact: distributed generation using solar photovoltaic systems in Normal, Illinois

    Directory of Open Access Journals (Sweden)

    Jin H. Jo

    2016-04-01

    Full Text Available Due to increasing price volatility in fossil-fuel-produced energy, the demand for clean, renewable, and abundant energy is more prevalent than in past years. Solar photovoltaic (PV systems have been well documented for their ability to produce electrical energy while at the same time offering support to mitigate the negative externalities associated with fossil fuel combustion. Prices for PV systems have decreased over the past few years, however residential and commercial owners may still opt out of purchasing a system due to the overall price required for a PV system installation. Therefore, determining optimal financing options for residential and small-scale purchasers is a necessity. We report on payment methods currently used for distributed community solar projects throughout the US and suggest appropriate options for purchasers in Normal, Illinois given their economic status. We also examine the jobs and total economic impact of a PV system implementation in the case study area.

  14. Design of direct solar PV driven air conditioner

    KAUST Repository

    Huang, Bin-Juine; Hou, Tung-Fu; Hsu, Po-Chien; Lin, Tse-Han; Chen, Yan-Tze; Chen, Chi-Wen; Li, Kang; Lee, K.Y.

    2015-01-01

    ). The measured OPB is found to be greater than 0.98 at instantaneous solar irradiation IT > 600 W m-2 if rpL > 1.71 RF approaches 1.0 (the air conditioner is run in 100% with solar power) at daily-total solar radiation higher than 13 MJ m-2 day-1, if rpL > 3.

  15. Assessment of ANN and SVM models for estimating normal direct irradiation (H_b)

    International Nuclear Information System (INIS)

    Santos, Cícero Manoel dos; Escobedo, João Francisco; Teramoto, Érico Tadao; Modenese Gorla da Silva, Silvia Helena

    2016-01-01

    Highlights: • The performance of SVM and ANN in estimating Normal Direct Irradiation (H_b) was evaluated. • 12 models using different input variables are developed (hourly and daily partitions). • The most relevant input variables for DNI are kt, H_s_c and insolation ratio (r′ = n/N). • Support Vector Machine (SVM) provides accurate estimates and outperforms the Artificial Neural Network (ANN). - Abstract: This study evaluates the estimation of hourly and daily normal direct irradiation (H_b) using machine learning techniques (ML): Artificial Neural Network (ANN) and Support Vector Machine (SVM). Time series of different meteorological variables measured over thirteen years in Botucatu were used for training and validating ANN and SVM. Seven different sets of input variables were tested and evaluated, which were chosen based on statistical models reported in the literature. Relative Mean Bias Error (rMBE), Relative Root Mean Square Error (rRMSE), determination coefficient (R"2) and “d” Willmott index were used to evaluate ANN and SVM models. When compared to statistical models which use the same set of input variables (R"2 between 0.22 and 0.78), ANN and SVM show higher values of R"2 (hourly models between 0.52 and 0.88; daily models between 0.42 and 0.91). Considering the input variables, atmospheric transmissivity of global radiation (kt), integrated solar constant (H_s_c) and insolation ratio (n/N, n is sunshine duration and N is photoperiod) were the most relevant in ANN and SVM models. The rMBE and rRMSE values in the two time partitions of SVM models are lower than those obtained with ANN. Hourly ANN and SVM models have higher rRMSE values than daily models. Optimal performance with hourly models was obtained with ANN4"h (rMBE = 12.24%, rRMSE = 23.99% and “d” = 0.96) and SVM4"h (rMBE = 1.75%, rRMSE = 20.10% and “d” = 0.96). Optimal performance with daily models was obtained with ANN2"d (rMBE = −3.09%, rRMSE = 18.95% and “d” = 0

  16. Impact of unbalanced charge transport on the efficiency of normal and inverted solar cells (Applied Physics Letters 100 (013306))

    NARCIS (Netherlands)

    Kotlarski, J.D.; Blom, P.W.M.

    2012-01-01

    In a normal solar cell, most charge carriers are generated close to the anode, such that electrons have to travel a longer distance as compared to the holes. In an inverted solar cell, holes have to travel a longer distance. We use a combined optical and electronic model to simulate the effect of

  17. Strong normalization by type-directed partial evaluation and run-time code generation

    DEFF Research Database (Denmark)

    Balat, Vincent; Danvy, Olivier

    1998-01-01

    We investigate the synergy between type-directed partial evaluation and run-time code generation for the Caml dialect of ML. Type-directed partial evaluation maps simply typed, closed Caml values to a representation of their long βη-normal form. Caml uses a virtual machine and has the capability...... to load byte code at run time. Representing the long βη-normal forms as byte code gives us the ability to strongly normalize higher-order values (i.e., weak head normal forms in ML), to compile the resulting strong normal forms into byte code, and to load this byte code all in one go, at run time. We...... conclude this note with a preview of our current work on scaling up strong normalization by run-time code generation to the Caml module language....

  18. Strong Normalization by Type-Directed Partial Evaluation and Run-Time Code Generation

    DEFF Research Database (Denmark)

    Balat, Vincent; Danvy, Olivier

    1997-01-01

    We investigate the synergy between type-directed partial evaluation and run-time code generation for the Caml dialect of ML. Type-directed partial evaluation maps simply typed, closed Caml values to a representation of their long βη-normal form. Caml uses a virtual machine and has the capability...... to load byte code at run time. Representing the long βη-normal forms as byte code gives us the ability to strongly normalize higher-order values (i.e., weak head normal forms in ML), to compile the resulting strong normal forms into byte code, and to load this byte code all in one go, at run time. We...... conclude this note with a preview of our current work on scaling up strong normalization by run-time code generation to the Caml module language....

  19. Nonlinear techniques for forecasting solar activity directly from its time series

    Science.gov (United States)

    Ashrafi, S.; Roszman, L.; Cooley, J.

    1993-01-01

    This paper presents numerical techniques for constructing nonlinear predictive models to forecast solar flux directly from its time series. This approach makes it possible to extract dynamical in variants of our system without reference to any underlying solar physics. We consider the dynamical evolution of solar activity in a reconstructed phase space that captures the attractor (strange), give a procedure for constructing a predictor of future solar activity, and discuss extraction of dynamical invariants such as Lyapunov exponents and attractor dimension.

  20. Heat transference in flat solar collectors considering speed and wind direction; Transferencia de calor en colectores solares planos considerando velocidad y direccion del viento

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, M. C.; Rodriguez, P. A.; Salgado, R.; Venegas, M.; Lecuona, A.

    2008-07-01

    Thermal solar collector performance depends on the process temperature but also on environmental variables like solar radiation, ambient temperature, wind speed and wind direction. collector operating design parameters like insulating and optical characteristics will affect also its performance. An unsteady energy balance on the collector developing a numerical method has been carried out to evaluate thermal losses. The numerical results are validated with experimental data from the facility placed at UC3M. these data, together with environmental variables, enable to calculate experimentally the collector performance to be compared with normalization curve and model prediction. The latest ones adjust more accurately to experimental than those from normalization curve. The main causes for this discrepancy are optical degradation of the collector due to aging and the wind effects. (Author)

  1. Comparison of Direct Solar Energy to Resistance Heating for Carbothermal Reduction of Regolith

    Science.gov (United States)

    Muscatello, Anthony C.; Gustafson, Robert J.

    2011-01-01

    A comparison of two methods of delivering thermal energy to regolith for the carbo thermal reduction process has been performed. The comparison concludes that electrical resistance heating is superior to direct solar energy via solar concentrators for the following reasons: (1) the resistance heating method can process approximately 12 times as much regolith using the same amount of thermal energy as the direct solar energy method because of superior thermal insulation; (2) the resistance heating method is more adaptable to nearer-term robotic exploration precursor missions because it does not require a solar concentrator system; (3) crucible-based methods are more easily adapted to separation of iron metal and glass by-products than direct solar energy because the melt can be poured directly after processing instead of being remelted; and (4) even with projected improvements in the mass of solar concentrators, projected photovoltaic system masses are expected to be even lower.

  2. Direct observations of low-energy solar electrons associated with a type 3 solar radio burst

    Science.gov (United States)

    Frank, L. A.; Gurnett, D. A.

    1972-01-01

    On 6 April 1971 a solar X-ray flare and a type 3 solar radio noise burst were observed with instrumentation on the eccentric-orbiting satellite IMP 6. The type 3 solar radio noise burst was detected down to a frequency of 31 kHz. A highly anisotropic packet of low-energy solar electron intensities arrived at the satellite approximately 6000 seconds after the onset of the solar flare. This packet of solar electron intensities was observed for 4200 seconds. Maximum differential intensities of the solar electrons were in the energy range of one to several keV. The frequency drift rate of the type 3 radio noise at frequencies below 178 kHz also indicated an average particle speed corresponding to that of a 3-keV electron. The simultaneous observations of these solar electron intensities and of the type 3 solar radio burst are presented, and their interrelationships are explored.

  3. DEPENDENCE OF SOLAR-WIND POWER SPECTRA ON THE DIRECTION OF THE LOCAL MEAN MAGNETIC FIELD

    International Nuclear Information System (INIS)

    Podesta, J. J.

    2009-01-01

    Wavelet analysis can be used to measure the power spectrum of solar-wind fluctuations along a line in any direction (θ, φ) with respect to the local mean magnetic field B 0 . This technique is applied to study solar-wind turbulence in high-speed streams in the ecliptic plane near solar minimum using magnetic field measurements with a cadence of eight vectors per second. The analysis of nine high-speed streams shows that the reduced spectrum of magnetic field fluctuations (trace power) is approximately azimuthally symmetric about B 0 in both the inertial range and dissipation range; in the inertial range the spectra are characterized by a power-law exponent that changes continuously from 1.6 ± 0.1 in the direction perpendicular to the mean field to 2.0 ± 0.1 in the direction parallel to the mean field. The large uncertainties suggest that the perpendicular power-law indices 3/2 and 5/3 are both consistent with the data. The results are similar to those found by Horbury et al. at high heliographic latitudes. Comparisons between solar-wind observations and the theories of strong incompressible MHD turbulence developed by Goldreich and Sridhar and Boldyrev are not rigorously justified because these theories only apply to turbulence with vanishing cross-helicity although the normalized cross-helicity of solar-wind turbulence is not negligible. Assuming these theories can be generalized in such a way that the three-dimensional wavevector spectra have similar functional forms when the cross-helicity is nonzero, then for the interval of Ulysses data analyzed by Horbury et al. the ratio of the spectra perpendicular and parallel to B 0 is more consistent with the Goldreich and Sridhar scaling P perpendicular /P || ∝ ν 1/3 than with the Boldyrev scaling ν 1/2 . The analysis of high-speed streams in the ecliptic plane does not yield a reliable measurement of this scaling law. The transition from a turbulent MHD-scale energy cascade to a kinetic Alfven wave (KAW

  4. Medium level of direct solar radiation and energetic potential of solar concentrator in Minas Gerais State, Brazil; Niveis medios de radiacao solar direta e potencial energetico dos concentradores solares em Minas Gerais

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-07-01

    Basic concepts of solar energy, technical description of solar concentrators, its orientation and methodology of direct solar radiation measurement are discussed. An comparison of different solar radiation measurements methods, its methodology and its calculation steps are reported. Calculus and tables of the electric and thermal energy generation potential, through solar concentrators, on the state of Minas Gerais are also presented. 18 figs., 90 tabs., 12 refs.

  5. a comparative study of direct and indirect solar drying of mango

    African Journals Online (AJOL)

    BARTH EKWUEME

    appropriate to a family scale traditional mango drying. ... before its marketing. Also, direct ..... measured using a digital probe thermohygrometer of ...... Comparison of direct and indirect solar drying kinetics Amelie and Brooks mango varieties.

  6. Human projected area factors for detailed direct and diffuse solar radiation analysis

    DEFF Research Database (Denmark)

    Kubaha, K.; Fiala, D.; Toftum, Jørn

    2004-01-01

    Projected area factors for individual segments of the standing and sedentary human body were modelled for both direct and diffuse solar radiation using detailed 3D geometry and radiation models. The local projected area factors with respect to direct short-wave radiation are a function of the solar...

  7. Solar Shading System Based on Daylight Directing Glass Lamellas

    DEFF Research Database (Denmark)

    Laustsen, Jacob Birck; Santos, Inês; Svendsen, Svend

    2008-01-01

    The overheating problems in office buildings must be solved with efficient solar shadings in order to reduce the energy demand for cooling and ventilation. At the same time the solar shading should not reduce the daylight level in the building on overcast days because it would result in a lower...

  8. First Evidence of pep Solar Neutrinos by Direct Detection in Borexino

    Science.gov (United States)

    Bellini, G.; Benziger, J.; Bick, D.; Bonetti, S.; Bonfini, G.; Bravo, D.; Buizza Avanzini, M.; Caccianiga, B.; Cadonati, L.; Calaprice, F.; Carraro, C.; Cavalcante, P.; Chavarria, A.; Chepurnov, A.; D'Angelo, D.; Davini, S.; Derbin, A.; Etenko, A.; Fomenko, K.; Franco, D.; Galbiati, C.; Gazzana, S.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Grandi, L.; Guardincerri, E.; Hardy, S.; Ianni, Aldo; Ianni, Andrea; Korablev, D.; Korga, G.; Koshio, Y.; Kryn, D.; Laubenstein, M.; Lewke, T.; Litvinovich, E.; Loer, B.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Machulin, I.; Manecki, S.; Maneschg, W.; Manuzio, G.; Meindl, Q.; Meroni, E.; Miramonti, L.; Misiaszek, M.; Montanari, D.; Mosteiro, P.; Muratova, V.; Oberauer, L.; Obolensky, M.; Ortica, F.; Otis, K.; Pallavicini, M.; Papp, L.; Perasso, L.; Perasso, S.; Pocar, A.; Quirk, J.; Raghavan, R. S.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Sabelnikov, A.; Saldanha, R.; Salvo, C.; Schönert, S.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Vignaud, D.; Vogelaar, R. B.; von Feilitzsch, F.; Winter, J.; Wojcik, M.; Wright, A.; Wurm, M.; Xu, J.; Zaimidoroga, O.; Zavatarelli, S.; Zuzel, G.

    2012-02-01

    We observed, for the first time, solar neutrinos in the 1.0-1.5 MeV energy range. We determined the rate of pep solar neutrino interactions in Borexino to be 3.1±0.6stat±0.3systcounts/(day·100ton). Assuming the pep neutrino flux predicted by the standard solar model, we obtained a constraint on the CNO solar neutrino interaction rate of Mikheyev-Smirnov-Wolfenstein large mixing angle solution to solar neutrino oscillations, these values correspond to solar neutrino fluxes of (1.6±0.3)×108cm-2s-1 and <7.7×108cm-2s-1 (95% C.L.), respectively, in agreement with both the high and low metallicity standard solar models. These results represent the first direct evidence of the pep neutrino signal and the strongest constraint of the CNO solar neutrino flux to date.

  9. Sensitivity analysis of numerical weather prediction radiative schemes to forecast direct solar radiation over Australia

    Science.gov (United States)

    Mukkavilli, S. K.; Kay, M. J.; Taylor, R.; Prasad, A. A.; Troccoli, A.

    2014-12-01

    The Australian Solar Energy Forecasting System (ASEFS) project requires forecasting timeframes which range from nowcasting to long-term forecasts (minutes to two years). As concentrating solar power (CSP) plant operators are one of the key stakeholders in the national energy market, research and development enhancements for direct normal irradiance (DNI) forecasts is a major subtask. This project involves comparing different radiative scheme codes to improve day ahead DNI forecasts on the national supercomputing infrastructure running mesoscale simulations on NOAA's Weather Research & Forecast (WRF) model. ASEFS also requires aerosol data fusion for improving accurate representation of spatio-temporally variable atmospheric aerosols to reduce DNI bias error in clear sky conditions over southern Queensland & New South Wales where solar power is vulnerable to uncertainities from frequent aerosol radiative events such as bush fires and desert dust. Initial results from thirteen years of Bureau of Meteorology's (BOM) deseasonalised DNI and MODIS NASA-Terra aerosol optical depth (AOD) anomalies demonstrated strong negative correlations in north and southeast Australia along with strong variability in AOD (~0.03-0.05). Radiative transfer schemes, DNI and AOD anomaly correlations will be discussed for the population and transmission grid centric regions where current and planned CSP plants dispatch electricity to capture peak prices in the market. Aerosol and solar irradiance datasets include satellite and ground based assimilations from the national BOM, regional aerosol researchers and agencies. The presentation will provide an overview of this ASEFS project task on WRF and results to date. The overall goal of this ASEFS subtask is to develop a hybrid numerical weather prediction (NWP) and statistical/machine learning multi-model ensemble strategy that meets future operational requirements of CSP plant operators.

  10. Soft X-ray images of the solar corona using normal incidence optics

    Science.gov (United States)

    Bruner, M. E.; Haisch, B. M.; Brown, W. A.; Acton, L. W.; Underwood, J. H.

    1988-01-01

    A solar coronal loop system has been photographed in soft X-rays using a normal incidence telescope based on multilayer mirror technology. The telescope consisted of a spherical objective mirror of 4 cm aperture and 1 m focal length, a film cassette, and a focal plane shutter. A metallized thin plastic film filter was used to exclude visible light. The objective mirror was covered with a multilayer coating consisting of alternating layers of tungsten and carbon whose combined thicknesses satisfied the Bragg diffraction condition for 44 A radiation. The image was recorded during a rocket flight on October 25, 1985 and was dominated by emission lines arising from the Si XII spectrum. The rocket also carried a high resolution soft X-ray spectrograph that confirmed the presence of Si XII line radiation in the source. This image represents the first successful use of multilayer technology for astrophysical observations.

  11. The normalization of solar X-ray data from many experiments.

    Science.gov (United States)

    Wende, C. D.

    1972-01-01

    A conversion factor is used to convert Geiger (GM) tube count rates or ion chamber currents into units of the incident X-ray energy flux in a specified passband. A method is described which varies the passband to optimize these conversion factors such that they are relatively independent of the spectrum of the incident photons. This method was applied to GM tubes flown on Explorers 33 and 35 and Mariner 5 and to ion chambers flown on OSO 3 and OGO 4. Revised conversion factors and passbands are presented, and the resulting absolute solar X-ray fluxes based on these are shown to improve the agreement between the various experiments. Calculations have shown that, although the GM tubes on Explorer 33 viewed the Sun off-axis, the effective passband did not change appreciably, and the simple normalization of the count rates to the count rates of a similar GM tube on Explorer 35 was justified.

  12. Experimental Method for Characterizing Electrical Steel Sheets in the Normal Direction

    Directory of Open Access Journals (Sweden)

    Thierry Belgrand

    2010-10-01

    Full Text Available This paper proposes an experimental method to characterise magnetic laminations in the direction normal to the sheet plane. The principle, which is based on a static excitation to avoid planar eddy currents, is explained and specific test benches are proposed. Measurements of the flux density are made with a sensor moving in and out of an air-gap. A simple analytical model is derived in order to determine the permeability in the normal direction. The experimental results for grain oriented steel sheets are presented and a comparison is provided with values obtained from literature.

  13. The law of distribution of light beam direction fluctuations in telescopes. [normal density functions

    Science.gov (United States)

    Divinskiy, M. L.; Kolchinskiy, I. G.

    1974-01-01

    The distribution of deviations from mean star trail directions was studied on the basis of 105 star trails. It was found that about 93% of the trails yield a distribution in agreement with the normal law. About 4% of the star trails agree with the Charlier distribution.

  14. Direct solar radiation on various slopes from 0 to 60 degrees north latitude.

    Science.gov (United States)

    John Buffo; Leo J. Fritschen; James L. Murphy

    1972-01-01

    Direct beam solar radiation is presented in graphical and tabular form for hourly, daily, and yearly values for seven slopes on each of 16 aspects from the Equator to 60 degrees north in 10-degree increments. Theoretical equations necessary for the calculations are given. Solar altitude and azimuth during the day and year are also presented for the same latitude.

  15. Nanofluid optical property characterization: towards efficient direct absorption solar collectors.

    Science.gov (United States)

    Taylor, Robert A; Phelan, Patrick E; Otanicar, Todd P; Adrian, Ronald; Prasher, Ravi

    2011-03-15

    Suspensions of nanoparticles (i.e., particles with diameters solar thermal collectors. To determine the effectiveness of nanofluids in solar applications, their ability to convert light energy to thermal energy must be known. That is, their absorption of the solar spectrum must be established. Accordingly, this study compares model predictions to spectroscopic measurements of extinction coefficients over wavelengths that are important for solar energy (0.25 to 2.5 μm). A simple addition of the base fluid and nanoparticle extinction coefficients is applied as an approximation of the effective nanofluid extinction coefficient. Comparisons with measured extinction coefficients reveal that the approximation works well with water-based nanofluids containing graphite nanoparticles but less well with metallic nanoparticles and/or oil-based fluids. For the materials used in this study, over 95% of incoming sunlight can be absorbed (in a nanofluid thickness ≥10 cm) with extremely low nanoparticle volume fractions - less than 1 × 10-5, or 10 parts per million. Thus, nanofluids could be used to absorb sunlight with a negligible amount of viscosity and/or density (read: pumping power) increase.

  16. Visual damage following direct sighting of solar eclipse in Ghana ...

    African Journals Online (AJOL)

    education concerning the damaging effects of the solar eclipse. Advanced techniques, such as scanning laser Ophthalmoscopy and the multifocal electroretinography (ERG) offer the possibility of detailed examination of small retina lesions in Ghana after an eclipse of the sun. African Journal of Health Sciences Vol. 14 (3-4) ...

  17. Search for Long Period Solar Normal Modes in Ambient Seismic Noise

    Science.gov (United States)

    Caton, R.; Pavlis, G. L.

    2016-12-01

    We search for evidence of solar free oscillations (normal modes) in long period seismic data through multitaper spectral analysis of array stacks. This analysis is similar to that of Thomson & Vernon (2015), who used data from the most quiet single stations of the global seismic network. Our approach is to use stacks of large arrays of noisier stations to reduce noise. Arrays have the added advantage of permitting the use of nonparametic statistics (jackknife errors) to provide objective error estimates. We used data from the Transportable Array, the broadband borehole array at Pinyon Flat, and the 3D broadband array in Homestake Mine in Lead, SD. The Homestake Mine array has 15 STS-2 sensors deployed in the mine that are extremely quiet at long periods due to stable temperatures and stable piers anchored to hard rock. The length of time series used ranged from 50 days to 85 days. We processed the data by low-pass filtering with a corner frequency of 10 mHz, followed by an autoregressive prewhitening filter and median stack. We elected to use the median instead of the mean in order to get a more robust stack. We then used G. Prieto's mtspec library to compute multitaper spectrum estimates on the data. We produce delete-one jackknife error estimates of the uncertainty at each frequency by computing median stacks of all data with one station removed. The results from the TA data show tentative evidence for several lines between 290 μHz and 400 μHz, including a recurring line near 379 μHz. This 379 μHz line is near the Earth mode 0T2 and the solar mode 5g5, suggesting that 5g5 could be coupling into the Earth mode. Current results suggest more statistically significant lines may be present in Pinyon Flat data, but additional processing of the data is underway to confirm this observation.

  18. Illumination normalization of face image based on illuminant direction estimation and improved Retinex.

    Science.gov (United States)

    Yi, Jizheng; Mao, Xia; Chen, Lijiang; Xue, Yuli; Rovetta, Alberto; Caleanu, Catalin-Daniel

    2015-01-01

    Illumination normalization of face image for face recognition and facial expression recognition is one of the most frequent and difficult problems in image processing. In order to obtain a face image with normal illumination, our method firstly divides the input face image into sixteen local regions and calculates the edge level percentage in each of them. Secondly, three local regions, which meet the requirements of lower complexity and larger average gray value, are selected to calculate the final illuminant direction according to the error function between the measured intensity and the calculated intensity, and the constraint function for an infinite light source model. After knowing the final illuminant direction of the input face image, the Retinex algorithm is improved from two aspects: (1) we optimize the surround function; (2) we intercept the values in both ends of histogram of face image, determine the range of gray levels, and stretch the range of gray levels into the dynamic range of display device. Finally, we achieve illumination normalization and get the final face image. Unlike previous illumination normalization approaches, the method proposed in this paper does not require any training step or any knowledge of 3D face and reflective surface model. The experimental results using extended Yale face database B and CMU-PIE show that our method achieves better normalization effect comparing with the existing techniques.

  19. Illumination normalization of face image based on illuminant direction estimation and improved Retinex.

    Directory of Open Access Journals (Sweden)

    Jizheng Yi

    Full Text Available Illumination normalization of face image for face recognition and facial expression recognition is one of the most frequent and difficult problems in image processing. In order to obtain a face image with normal illumination, our method firstly divides the input face image into sixteen local regions and calculates the edge level percentage in each of them. Secondly, three local regions, which meet the requirements of lower complexity and larger average gray value, are selected to calculate the final illuminant direction according to the error function between the measured intensity and the calculated intensity, and the constraint function for an infinite light source model. After knowing the final illuminant direction of the input face image, the Retinex algorithm is improved from two aspects: (1 we optimize the surround function; (2 we intercept the values in both ends of histogram of face image, determine the range of gray levels, and stretch the range of gray levels into the dynamic range of display device. Finally, we achieve illumination normalization and get the final face image. Unlike previous illumination normalization approaches, the method proposed in this paper does not require any training step or any knowledge of 3D face and reflective surface model. The experimental results using extended Yale face database B and CMU-PIE show that our method achieves better normalization effect comparing with the existing techniques.

  20. Integration between direct steam generation in linear solar collectors and supercritical carbon dioxide Brayton power cycles

    OpenAIRE

    Coco Enríquez, Luis; Muñoz Antón, Javier; Martínez-Val Peñalosa, José María

    2015-01-01

    Direct Steam Generation in Parabolic Troughs or Linear Fresnel solar collectors is a technology under development since beginning of nineties (1990's) for replacing thermal oils and molten salts as heat transfer fluids in concentrated solar power plants, avoiding environmental impacts. In parallel to the direct steam generation technology development, supercritical Carbon Dioxide Brayton power cycles are maturing as an alternative to traditional Rankine cycles for increasing net plant efficie...

  1. Direct Measurement of the 7Be Solar Neutrino Flux with 192 Days of Borexino Data

    International Nuclear Information System (INIS)

    Arpesella, C.; Di Pietro, G.; Monzani, M. E.; Back, H. O.; Hardy, S.; Joyce, M.; Manecki, S.; Raghavan, R. S.; Rountree, D.; Vogelaar, R. B.; Balata, M.; Di Credico, A.; Gazzana, S.; Korga, G.; Laubenstein, M.; Orsini, M.; Papp, L.; Razeto, A.; Tartaglia, R.; Bellini, G.

    2008-01-01

    We report the direct measurement of the 7 Be solar neutrino signal rate performed with the Borexino detector at the Laboratori Nazionali del Gran Sasso. The interaction rate of the 0.862 MeV 7 Be neutrinos is 49±3 stat ±4 syst counts/(day·100 ton). The hypothesis of no oscillation for 7 Be solar neutrinos is inconsistent with our measurement at the 4σ C.L. Our result is the first direct measurement of the survival probability for solar ν e in the transition region between matter-enhanced and vacuum-driven oscillations. The measurement improves the experimental determination of the flux of 7 Be, pp, and CNO solar ν e , and the limit on the effective neutrino magnetic moment using solar neutrinos

  2. Studies of diffuse and direct solar radiation over snow

    International Nuclear Information System (INIS)

    Wesely, M.L.; Everett, R.G.

    1976-01-01

    Two interesting questions can be addressed by examination of solar radiation records obtained while the surface is covered with snow. One concerns the extent to which airborne particulate matter affects solar radiation received at the surface during winter conditions that are typical of those in the northeastern quarter of the United States. The other relates to the importance of complicated light scatterng in the earth-atmosphere system when the surface albedo is large. With the snow surface reflecting 50% or more of the incident radiation, it is likely that a significant addition to diffuse radiation would result from light that is reflected from the surface and then scattered back to the earth by the atmosphere. Preliminary data from measurements made during the winter of 1975 to 1976 are reported

  3. Controlled austempering of hammer forgings aimed at pseudo normalized microstructure directly after deformation

    Directory of Open Access Journals (Sweden)

    P. Skubisz

    2017-01-01

    Full Text Available The study concerns cost-effective realization of controlled thermomechanical processing (CTMP of medium-carbon and HSLA steel aimed at producing microstructure and properties equivalent to normalized condition directly after forging. The results of theoretical and physical modeling of hot forging with subsequent heat treating adopted for industrial realization in continuous manner were verified in semi-industrial conditions of a forge plant.

  4. Plasmonic Light Scattering in Textured Silicon Solar Cells with Indium Nanoparticles from Normal to Non-Normal Light Incidence

    Directory of Open Access Journals (Sweden)

    Wen-Jeng Ho

    2017-07-01

    Full Text Available In this study, we sought to improve the light trapping of textured silicon solar cells using the plasmonic light scattering of indium nanoparticles (In NPs of various dimensions. The light trapping modes of textured-silicon surfaces with and without In NPs were investigated at an angle of incidence (AOI ranging from 0° to 75°. The optical reflectance, external quantum efficiency (EQE, and photovoltaic performance were first characterized under an AOI of 0°. We then compared the EQE and photovoltaic current density-voltage (J-V as a function of AOI in textured silicon solar cells with and without In NPs. We observed a reduction in optical reflectance and an increase in EQE when the cells textured with pyramidal structures were coated with In NPs. We also observed an impressive increase in the average weighted external quantum efficiency (∆EQEw and short-circuit current-density (∆Jsc in cells with In NPs when illuminated under a higher AOI. The ∆EQEw values of cells with In NPs were 0.37% higher than those without In NPs under an AOI of 0°, and 3.48% higher under an AOI of 75°. The ∆Jsc values of cells with In NPs were 0.50% higher than those without In NPs under an AOI of 0°, and 4.57% higher under an AOI of 75°. The application of In NPs clearly improved the light trapping effects. This can be attributed to the effects of plasmonic light-scattering over the entire wavelength range as well as an expanded angle of incident light.

  5. Direct-heating solar-collector dump valve

    Science.gov (United States)

    Howikman, T. C.

    1977-01-01

    Five-port ganged valve isolates collector from primary load system pressure and drains collectors, allowing use of direct heating with all its advantages. Valve is opened and closed by same switch that controls pump or by temperature sensor set at O C, while providing direct dump option.

  6. Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

    International Nuclear Information System (INIS)

    Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

    2011-01-01

    Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

  7. Direct Heat-Flux Measurement System (MDF) for Solar central Receiver Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Ballestrin, J.

    2001-07-01

    A direct flux measurement system, MDF, has been designed, constructed and mounted on top of the SSPS-CRS tower at the Plataforma Solar de Almeria (PSA) in addition to an indirect flux measurement system based on a CCD camera. It's one of the main future objectives to compare systematically both measurements of the concentrated solar power, increasing in this way the confidence in the estimate of this quantity. Today everything is prepared to perform the direct flux measurement on the aperture of solar receivers: calorimeter array, data acquisition system and software. the geometry of the receiver determines the operation and analysis procedures to obtain the indecent power onto the defined area. The study of previous experiences with direct flux measurement systems ha been useful to define a new simpler and more accurate system. A description of each component of the MDF system is included, focusing on the heat-flux sensors or calorimeters, which enables these measurements to be done in a few seconds without water-cooling. The incident solar power and the spatial flux distribution on the aperture of the volumetric receiver Hitrec II are supplied by the above-mentioned MDF system. The first results obtained during the evaluation of this solar receiver are presented including a sunrise-sunset test. All these measurements have been concentrated in one coefficient that describes the global behavior of the Solar Power Plant. (Author) 18 refs.

  8. Novel Solvent-free Perovskite Deposition in Fabrication of Normal and Inverted Architectures of Perovskite Solar Cells

    Science.gov (United States)

    Nejand, Bahram Abdollahi; Gharibzadeh, Saba; Ahmadi, Vahid; Shahverdi, H. Reza

    2016-01-01

    We introduced a new approach to deposit perovskite layer with no need for dissolving perovskite precursors. Deposition of Solution-free perovskite (SFP) layer is a key method for deposition of perovskite layer on the hole or electron transport layers that are strongly sensitive to perovskite precursors. Using deposition of SFP layer in the perovskite solar cells would extend possibility of using many electron and hole transport materials in both normal and invert architectures of perovskite solar cells. In the present work, we synthesized crystalline perovskite powder followed by successful deposition on TiO2 and cuprous iodide as the non-sensitve and sensitive charge transport layers to PbI2 and CH3NH3I solution in DMF. The post compressing step enhanced the efficiency of the devices by increasing the interface area between perovskite and charge transport layers. The 9.07% and 7.71% cell efficiencies of the device prepared by SFP layer was achieved in respective normal (using TiO2 as a deposition substrate) and inverted structure (using CuI as deposition substrate) of perovskite solar cell. This method can be efficient in large-scale and low cost fabrication of new generation perovskite solar cells. PMID:27640991

  9. Toward an Aqueous Solar Battery: Direct Electrochemical Storage of Solar Energy in Carbon Nitrides.

    Science.gov (United States)

    Podjaski, Filip; Kröger, Julia; Lotsch, Bettina V

    2018-03-01

    Graphitic carbon nitrides have emerged as an earth-abundant family of polymeric materials for solar energy conversion. Herein, a 2D cyanamide-functionalized polyheptazine imide (NCN-PHI) is reported, which for the first time enables the synergistic coupling of two key functions of energy conversion within one single material: light harvesting and electrical energy storage. Photo-electrochemical measurements in aqueous electrolytes reveal the underlying mechanism of this "solar battery" material: the charge storage in NCN-PHI is based on the photoreduction of the carbon nitride backbone and charge compensation is realized by adsorption of alkali metal ions within the NCN-PHI layers and at the solution interface. The photoreduced carbon nitride can thus be described as a battery anode operating as a pseudocapacitor, which can store light-induced charge in the form of long-lived, "trapped" electrons for hours. Importantly, the potential window of this process is not limited by the water reduction reaction due to the high intrinsic overpotential of carbon nitrides for hydrogen evolution, potentially enabling new applications for aqueous batteries. Thus, the feasibility of light-induced electrical energy storage and release on demand by a one-component light-charged battery anode is demonstrated, which provides a sustainable solution to overcome the intermittency of solar radiation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The direct conversion of solar energy to electricity

    International Nuclear Information System (INIS)

    1992-01-01

    Half the world's population lives without access to electricity in the rural areas and villages of developing countries. In 1987, world population reached 5 billion and, according to World Bank projections, will increase to over 6 billion in the year 2000 and to over 8 billion in 2025. Such population growth is not uniformly distributed: developed countries have small or negative growth and account for a declining proportion of the world's population. Inasmuch as 95 per cent of the extra inhabitants added each year are in developing countries, rapid population growth in those countries raises serious questions about energy availability for basic human needs and, of course, more broadly about the environment's capacity to support that growth. The present report makes reference to one of the most comprehensively documented conservative scenarios for world energy demand in the year 2020, namely, Energy for a Sustainable World, which assumed that long-term world sustainability must entail constraints on (a) use of natural resources and (b) combustion of fossil fuels resulting in the greenhouse effect. Solar energy is abundant and could become a major source of electricity. Photovoltaics has three particular advantages. It accomplishes sunlight-to-electricity conversion entirely with solid-state electronic components, and with no moving parts required, thereby promising high equipment availability and very low operating and maintenance costs. PV also appears to have very limited environmental impact, with no emissions of the gaseous pollutants associated with fossil-fuel burning and few of the possible local problems associated with some other renewable energy technologies. Finally, the products of photovoltaic technology are modular in construction and can be built up on site in a flexible way, thus minimizing front-end financial risk and investment costs. Figs and tabs

  11. The Neural Substrates for Letter String Readings in The Normal and Reverse Directions: An fMRI Study

    Science.gov (United States)

    Ge, Sheng; Saito, Takashi; Wu, Jing-Long; Ogasawara, Jun-Ichi; Yamauchi, Shuichi; Matsunaga, Naofumi; Iramina, Keiji

    In order to investigate the difference in cortical activations between reading letter strings in the normal direction and the reverse direction, an fMRI study was conducted. In this study, the cortical activations elicited by Japanese letter string reading and Chinese letter string reading were investigated. The subjects performed the normal direction reading task (read letter strings from left to right), and the reverse direction reading task (read letter strings from right to left). According to the experimental results, the activated brain regions during the normal and the reverse direction reading tasks were compared. It was found that visuospatial transformation was involved in the reverse direction reading task, while this function was not significant during the normal direction reading task. Furthermore, we found that there was no significant difference in cortical activation between Japanese and Chinese letter string readings.

  12. Calculation and mapping of direct and diffuse solar radiation in Costa Rica

    International Nuclear Information System (INIS)

    Wright, Jaime

    2008-01-01

    Knowledge of direct and diffuse solar radiation has been of vital importance in assessing the energy potential of Costa Rica. The work is focused on the calculation and plotting of contour maps of the direct and diffuse solar radiation, based in sixty-two radiometric stations scattered throughout the country. In tracing these contours have been used experimental and predicted values of direct and diffuse radiation. Additionally, direct and diffuse solar radiation is compared during the dry season and the rainy season in the six climatic regions of the country: Valle Central, North Pacific, Central Pacific, South Pacific, North Zone and Caribbean Region. Daily average levels of radiation observed directly have been from 6.1 and 10.1 MJ/m 2 , with higher values in the northern sections of the Pacific Slope, west of Valle Central and the tops of the highest mountains. The lowest values have coincided with the North Zone and Caribbean Region. The highest values of diffuse radiation have coincided with the North Zone and South Pacific. An increase in direct solar radiation by 40% is observed in the month of the dry season. (author) [es

  13. Performance Evaluation of a Nanofluid-Based Direct Absorption Solar Collector with Parabolic Trough Concentrator

    Directory of Open Access Journals (Sweden)

    Guoying Xu

    2015-12-01

    Full Text Available Application of solar collectors for hot water supply, space heating, and cooling plays a significant role in reducing building energy consumption. For conventional solar collectors, solar radiation is absorbed by spectral selective coating on the collectors’ tube/plate wall. The poor durability of the coating can lead to an increased manufacturing cost and unreliability for a solar collector operated at a higher temperature. Therefore, a novel nanofluid-based direct absorption solar collector (NDASC employing uncoated collector tubes has been proposed, and its operating characteristics for medium-temperature solar collection were theoretically and experimentally studied in this paper. CuO/oil nanofluid was prepared and used as working fluid of the NDASC. The heat-transfer mechanism of the NDASC with parabolic trough concentrator was theoretically evaluated and compared with a conventional indirect absorption solar collector (IASC. The theoretical analysis results suggested that the fluid’s temperature distribution in the NDASC was much more uniform than that in the IASC, and an enhanced collection efficiency could be achieved for the NDASC operated within a preferred working temperature range. To demonstrate the feasibility of the proposed NDASC, experimental performances of an NDASC and an IASC with the same parabolic trough concentrator were furthermore evaluated and comparatively discussed.

  14. Performance Evaluation of a Nanofluid-Based Direct Absorption Solar Collector with Parabolic Trough Concentrator

    Science.gov (United States)

    Xu, Guoying; Chen, Wei; Deng, Shiming; Zhang, Xiaosong; Zhao, Sainan

    2015-01-01

    Application of solar collectors for hot water supply, space heating, and cooling plays a significant role in reducing building energy consumption. For conventional solar collectors, solar radiation is absorbed by spectral selective coating on the collectors’ tube/plate wall. The poor durability of the coating can lead to an increased manufacturing cost and unreliability for a solar collector operated at a higher temperature. Therefore, a novel nanofluid-based direct absorption solar collector (NDASC) employing uncoated collector tubes has been proposed, and its operating characteristics for medium-temperature solar collection were theoretically and experimentally studied in this paper. CuO/oil nanofluid was prepared and used as working fluid of the NDASC. The heat-transfer mechanism of the NDASC with parabolic trough concentrator was theoretically evaluated and compared with a conventional indirect absorption solar collector (IASC). The theoretical analysis results suggested that the fluid’s temperature distribution in the NDASC was much more uniform than that in the IASC, and an enhanced collection efficiency could be achieved for the NDASC operated within a preferred working temperature range. To demonstrate the feasibility of the proposed NDASC, experimental performances of an NDASC and an IASC with the same parabolic trough concentrator were furthermore evaluated and comparatively discussed. PMID:28347112

  15. Material challenges for solar cells in the twenty-first century: directions in emerging technologies

    Science.gov (United States)

    Delamarre, Amaury; Jehl, Zacharie; Suchet, Daniel; Cojocaru, Ludmila; Giteau, Maxime; Behaghel, Benoit; Julian, Anatole; Ibrahim, Camille; Tatry, Léa; Wang, Haibin; Kubo, Takaya; Uchida, Satoshi; Segawa, Hiroshi; Miyashita, Naoya; Tamaki, Ryo; Shoji, Yasushi; Yoshida, Katsuhisa; Ahsan, Nazmul; Watanabe, Kentaro; Inoue, Tomoyuki; Sugiyama, Masakazu; Nakano, Yoshiaki; Hamamura, Tomofumi; Toupance, Thierry; Olivier, Céline; Chambon, Sylvain; Vignau, Laurence; Geffroy, Camille; Cloutet, Eric; Hadziioannou, Georges; Cavassilas, Nicolas; Rale, Pierre; Cattoni, Andrea; Collin, Stéphane; Gibelli, François; Paire, Myriam; Lombez, Laurent; Aureau, Damien; Bouttemy, Muriel; Etcheberry, Arnaud; Okada, Yoshitaka

    2018-01-01

    Abstract Photovoltaic generation has stepped up within the last decade from outsider status to one of the important contributors of the ongoing energy transition, with about 1.7% of world electricity provided by solar cells. Progress in materials and production processes has played an important part in this development. Yet, there are many challenges before photovoltaics could provide clean, abundant, and cheap energy. Here, we review this research direction, with a focus on the results obtained within a Japan–French cooperation program, NextPV, working on promising solar cell technologies. The cooperation was focused on efficient photovoltaic devices, such as multijunction, ultrathin, intermediate band, and hot-carrier solar cells, and on printable solar cell materials such as colloidal quantum dots. PMID:29707072

  16. Material challenges for solar cells in the twenty-first century: directions in emerging technologies.

    Science.gov (United States)

    Almosni, Samy; Delamarre, Amaury; Jehl, Zacharie; Suchet, Daniel; Cojocaru, Ludmila; Giteau, Maxime; Behaghel, Benoit; Julian, Anatole; Ibrahim, Camille; Tatry, Léa; Wang, Haibin; Kubo, Takaya; Uchida, Satoshi; Segawa, Hiroshi; Miyashita, Naoya; Tamaki, Ryo; Shoji, Yasushi; Yoshida, Katsuhisa; Ahsan, Nazmul; Watanabe, Kentaro; Inoue, Tomoyuki; Sugiyama, Masakazu; Nakano, Yoshiaki; Hamamura, Tomofumi; Toupance, Thierry; Olivier, Céline; Chambon, Sylvain; Vignau, Laurence; Geffroy, Camille; Cloutet, Eric; Hadziioannou, Georges; Cavassilas, Nicolas; Rale, Pierre; Cattoni, Andrea; Collin, Stéphane; Gibelli, François; Paire, Myriam; Lombez, Laurent; Aureau, Damien; Bouttemy, Muriel; Etcheberry, Arnaud; Okada, Yoshitaka; Guillemoles, Jean-François

    2018-01-01

    Photovoltaic generation has stepped up within the last decade from outsider status to one of the important contributors of the ongoing energy transition, with about 1.7% of world electricity provided by solar cells. Progress in materials and production processes has played an important part in this development. Yet, there are many challenges before photovoltaics could provide clean, abundant, and cheap energy. Here, we review this research direction, with a focus on the results obtained within a Japan-French cooperation program, NextPV, working on promising solar cell technologies. The cooperation was focused on efficient photovoltaic devices, such as multijunction, ultrathin, intermediate band, and hot-carrier solar cells, and on printable solar cell materials such as colloidal quantum dots.

  17. Correlations of Mean Process Parameters for Agricultural Products Drying in Thin Bed in Solar Direct Dryers

    Directory of Open Access Journals (Sweden)

    MSc. Ciro César Bergues-Ricardo

    2015-11-01

    Full Text Available A group of correlations is given between mean parameters of drying process drying velocity, energy losses, useful energy, and thermal efficiency. Those are suitable for conditions of thin bed drying, in direct solar dryers, and may help for developing of an integral approach of solar drying in those conditions. Correlations are reliable for drying processes of diverse crop products specified, suchas roots, seeds, vegetables, fruits, wood, etc, with natural or forced convection. Correlations were validated in Cuba for usual ranges of efficiency and products in solar dryers of cover, cabinet and house types, in tropical conditions. These correlations are useful for design and exploitation ofdryers and for theoretical and practical comprehension of solar drying like a system.

  18. A New Database of Global and Direct Solar Radiation Using the Eastern Meteosat Satellite, Models and Validation

    Directory of Open Access Journals (Sweden)

    Ana Gracia Amillo

    2014-08-01

    Full Text Available We present a new database of solar radiation at ground level for Eastern Europe and Africa, the Middle East and Asia, estimated using satellite images from the Meteosat East geostationary satellites. The method presented calculates global horizontal (G and direct normal irradiance (DNI at hourly intervals, using the full Meteosat archive from 1998 to present. Validation of the estimated global horizontal and direct normal irradiance values has been performed by comparison with high-quality ground station measurements. Due to the low number of ground measurements in the viewing area of the Meteosat Eastern satellites, the validation of the calculation method has been extended by a comparison of the estimated values derived from the same class of satellites but positioned at 0°E, where more ground stations are available. Results show a low overall mean bias deviation (MBD of +1.63 Wm−2 or +0.73% for global horizontal irradiance. The mean absolute bias of the individual station MBD is 2.36%, while the root mean square deviation of the individual MBD values is 3.18%. For direct normal irradiance the corresponding values are overall MBD of +0.61 Wm−2 or +0.62%, while the mean absolute bias of the individual station MBD is 5.03% and the root mean square deviation of the individual MBD values is 6.30%. The resulting database of hourly solar radiation values will be made freely available. These data will also be integrated into the PVGIS web application to allow users to estimate the energy output of photovoltaic (PV systems not only in Europe and Africa, but now also in Asia.

  19. Performance analysis of an Integrated Solar Combined Cycle using Direct Steam Generation in parabolic trough collectors

    International Nuclear Information System (INIS)

    Montes, M.J.; Rovira, A.; Munoz, M.; Martinez-Val, J.M.

    2011-01-01

    Highlights: → Solar hybridization improves the performance of CCGT in a very hot and dry weather. → The scheme analyzed is a DSG parabolic trough field coupled to the Rankine cycle. → An annual simulation has been carried out for two locations: Almeria and Las Vegas. → Economical analysis shows that this scheme is a cheaper way to exploit solar energy. → For that, solar hybridization must be limited to a small fraction of the CCGT power. - Abstract: The contribution of solar thermal power to improve the performance of gas-fired combined cycles in very hot and dry environmental conditions is analyzed in this work, in order to assess the potential of this technique, and to feature Direct Steam Generation (DSG) as a well suited candidate for achieving very good results in this quest. The particular Integrated Solar Combined Cycle (ISCC) power plant proposed consists of a DSG parabolic trough field coupled to the bottoming steam cycle of a Combined Cycle Gas Turbine (CCGT) power plant. For this analysis, the solar thermal power plant performs in a solar dispatching mode: the gas turbine always operates at full load, only depending on ambient conditions, whereas the steam turbine is somewhat boosted to accommodate the thermal hybridization from the solar field. Although the analysis is aimed to studying such complementary effects in the widest perspective, two relevant examples are given, corresponding to two well-known sites: Almeria (Spain), with a mediterranean climate, and Las Vegas (USA), with a hot and dry climate. The annual simulations show that, although the conventional CCGT power plant works worse in Las Vegas, owing to the higher temperatures, the ISCC system operates better in Las Vegas than in Almeria, because of solar hybridization is especially well coupled to the CCGT power plant in the frequent days with great solar radiation and high temperatures in Las Vegas. The complementary effect will be clearly seen in these cases, because the thermal

  20. Direct tracking error characterization on a single-axis solar tracker

    International Nuclear Information System (INIS)

    Sallaberry, Fabienne; Pujol-Nadal, Ramon; Larcher, Marco; Rittmann-Frank, Mercedes Hannelore

    2015-01-01

    Highlights: • The solar tracker of a small-size parabolic trough collector was tested. • A testing procedure for the tracking error characterization of a single-axis tracker was proposed. • A statistical analysis on the tracking error distribution was done regarding different variables. • The optical losses due to the tracking error were calculated based on a ray-tracing simulation. - Abstract: The solar trackers are devices used to orientate solar concentrating systems in order to increase the focusing of the solar radiation on a receiver. A solar concentrator with a medium or high concentration ratio needs to be orientated correctly by an accurate solar tracking mechanism to avoid losing the sunrays out from the receiver. Hence, to obtain an appropriate operation, it is important to know the accuracy of a solar tracker in regard to the required precision of the concentrator in order to maximize the collector optical efficiency. A procedure for the characterization of the accuracy of a solar tracker is presented for a single-axis solar tracker. More precisely, this study focuses on the estimation of the positioning angle error of a parabolic trough collector using a direct procedure. A testing procedure, adapted from the International standard IEC 62817 for photovoltaic trackers, was defined. The results show that the angular tracking error was within ±0.4° for this tracker. The optical losses due to the tracking were calculated using the longitudinal incidence angle modifier obtained by ray-tracing simulation. The acceptance angles for various transversal angles were analyzed, and the average optical loss, due to the tracking, was 0.317% during the whole testing campaign. The procedure presented in this work showed that the tracker precision was adequate for the requirements of the analyzed optical system.

  1. EU Directives, national regulations and incentives for photovoltaic solar energy

    International Nuclear Information System (INIS)

    Jager-Waldau, A.; Ossenbrink, H.; Scholz, H.; Bloem, H.; Werring, L.

    2004-01-01

    The European Union long-term strategy for security of energy supply and its commitment to curb climate change led to the adoption of a series of Strategy Papers and EU Directives. In all these, it is clearly stated that climate change is a long-term challenge for the international community and that the commitments made in the Kyoto Protocol can only be a first step. The promotion of renewable energies is a most important element of this process. It regards industry, jobs and foreign trade balance as well, generating benefit to social sustainability. Photovoltaic is a key technology with the potential not only to serve the needs in energy supply of tomorrow in a sustainable way, but already today, it can improve security and stability of electricity services at peak times, due to its decentralized nature. This paper gives an update on the EU and National legislation in place to promote the implementation of photovoltaic. (authors)

  2. Block copolymer directed synthesis of mesoporous TiO 2 for dye-sensitized solar cells

    KAUST Repository

    Nedelcu, Mihaela

    2009-01-01

    The morphology of TiO2 plays an important role in the operation of solid-state dye-sensitized solar cells. By using polyisoprene-block- ethyleneoxide (PI-b-PEO) copolymers as structure directing agents for a sol-gel based synthesis of mesoporous TiO2, we demonstrate a strategy for the detailed control of the semiconductor morphology on the 10 nm length scale. The careful adjustment of polymer molecular weight and titania precursor content is used to systematically vary the material structure and its influence upon solar cell performance is investigated. Furthermore, the use of a partially sp 2 hybridized structure directing polymer enables the crystallization of porous TiO2 networks at high temperatures without pore collapse, improving its performance in solid-state dye-sensitized solar cells. © 2009 The Royal Society of Chemistry.

  3. Analysis of Direct Samples of Early Solar System Aqueous Fluids

    Science.gov (United States)

    Zolensky, Michael E.; Bodnar, R J.; Fedele, L.; Yurimoto,H.; Itoh, S.; Fries, M.; Steele, A.

    2012-01-01

    Over the past three decades we have become increasingly aware of the fundamental importance of water, and aqueous alteration, on primitive solar-system bodies. Some carbonaceous and ordinary chondrites have been altered by interactions with liquid water within the first 10 million years after formation of their parent asteroids. Millimeter to centimeter-sized aggregates of purple halite containing aqueous fluid inclusions were found in the matrix of two freshly-fallen brecciated H chondrite falls, Monahans (1998, hereafter simply "Monahans") (H5) and Zag (H3-6) (Zolensky et al., 1999; Whitby et al., 2000; Bogard et al., 2001) In order to understand origin and evolution of the aqueous fluids inside these inclusions we much measure the actual fluid composition, and also learn the O and H isotopic composition of the water. It has taken a decade for laboratory analytical techniques to catch up to these particular nanomole-sized aqueous samples. We have recently been successful in (1) measuring the isotopic composition of H and O in the water in a few fluid inclusions from the Zag and Monahans halite, (2) mineralogical characterization of the solid mineral phases associated with the aqueous fluids within the halite, and (3) the first minor element analyses of the fluid itself. A Cameca ims-1270 equipped with a cryo-sample-stage of Hokkaido University was specially prepared for the O and H isotopic measurements. The cryo-sample-stage (Techno. I. S. Corp.) was cooled down to c.a. -190 C using liquid nitrogen at which the aqueous fluid in inclusions was frozen. We excavated the salt crystal surfaces to expose the frozen fluids using a 15 keV Cs+ beam and measured negative secondary ions. The secondary ions from deep craters of approximately 10 m in depth emitted stably but the intensities changed gradually during measurement cycles because of shifting states of charge compensation, resulting in rather poor reproducibility of multiple measurements of standard fluid

  4. The measurement and analysis of normal incidence solar UVB radiation and its application to the photoclimatherapy protocol for psoriasis at the Dead Sea, Israel.

    Science.gov (United States)

    Kudish, Avraham I; Harari, Marco; Evseev, Efim G

    2011-01-01

    The broad-band normal incidence UVB beam radiation has been measured at Neve Zohar, Dead Sea basin, using a prototype tracking instrument composed of a Model 501A UV-Biometer mounted on an Eppley Solar Tracker Model St-1. The diffuse and beam fraction of the solar global UVB radiation have been determined using the concurrently measured solar global UVB radiation. The diffuse fraction was observed to exceed 80% throughout the year. The application of the results of these measurements to the possible revision of the photoclimatherapy protocol for psoriasis patients at the Dead Sea medical spas is now under investigation. The suggested revision would enable the sun-exposure treatment protocol to take advantage of the very high diffuse fraction by allowing the patient to receive the daily dose of UVB radiation without direct exposure to the sun, viz. receive the diffuse UVB radiation under a sunshade. This would require an increase in sun-exposure time intervals, as the UVB radiation intensity beneath a sunshade is less than that on an exposed surface. © 2010 The Authors. Photochemistry and Photobiology © 2010 The American Society of Photobiology.

  5. Heliosynthesis: A solar biotechnology based on direct bioconversion of solar energy by photosynthetic cells

    Science.gov (United States)

    Gudin, C.

    1982-12-01

    Certain limiting aspects of current technology should be studied, such as the lifetimes of tubing material and the utilization of renewable sources of energy for pumping. Only exocellular or cellular biomass with high specific value, involving small markets and small plant areas (less than 1 ha), will be economically possible for the short term and will allow improvement of this technology. A valorization of the totality of photosynthetic biomass with respect to economics and energy is an absolute necessity. There is an immediate need for genetic studies of microalgae that will allow enhancement or even creation of chemical production satisfying economic and energy needs. Such efforts should permit the rapid establishment of an aggressive and sophisticated solar biotechnology that integrates scientific and technical' developments to meet the new needs of humanity for food, chemicals, and energy, thereby complementing agriculture with a sort of cellular horticulture.

  6. Spectral and directional dependence of light-trapping in solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Ulbrich, Carolin

    2011-02-17

    This thesis investigates the directional and spectral dependence of light-incoupling and light-trapping in solar cells. The light-trapping does not notably change under increased angles of incidence. To enhance the incoupling at the front of the solar cell, the effects of a textured surface structure on the cover glass of the solar cell are investigated. The texture reduces the reflectance at the air-glass interface and, additionally, reduces the reflection losses originating at the interface between the glass and the transparent conductive oxide (TCO) as well as the TCO and the silicon (Si) absorber due to the randomization of light. On samples without a textured TCO/Si interface, the textured foil induces additional light-trapping in the photovoltaically active absorber material. This effect is not observed for samples with a textured TCO/Si interface. In this case, using tandem solar cells, a redistribution of light absorption in the top and bottom subcells is detected. The antireflective texture increases the short circuit current density in thin film silicon tandem solar cells by up to 1 mA/cm{sup 2}, and the conversion efficiency by up to 0.7 % absolute. The increase in the annual yield of solar cells is estimated to be up to 10 %. Further, the spectral dependence of the efficiency and annual yield of a tandem solar cell was investigated. The daily variation of the incident spectrum causes a change in the current matching of the serial connected subcells. Simulations determine the optimum subcell layer thicknesses of tandem solar cells. The thicknesses optimized in respect to the annual yield overlap in a wide range for both investigated locations with those for the AM1.5g standard spectrum. Though, a slight top limitation is favorable. Matching the short circuit currents of the subcells maximizes the overall current, but minimizes the fill factor. This thesis introduces a new definition for the matching condition of tandem solar cells. This definition

  7. Block copolymer directed synthesis of mesoporous TiO 2 for dye-sensitized solar cells

    KAUST Repository

    Nedelcu, Mihaela; Lee, Jinwoo; Crossland, Edward J. W.; Warren, Scott C.; Orilall, M. Christopher; Guldin, Stefan; Hü ttner, Sven; Ducati, Catarina; Eder, Dominik; Wiesner, Ulrich; Steiner, Ullrich; Snaith, Henry J.

    2009-01-01

    The morphology of TiO2 plays an important role in the operation of solid-state dye-sensitized solar cells. By using polyisoprene-block- ethyleneoxide (PI-b-PEO) copolymers as structure directing agents for a sol-gel based synthesis of mesoporous TiO

  8. Real-time dynamic analysis for complete loop of direct steam generation solar trough collector

    International Nuclear Information System (INIS)

    Guo, Su; Liu, Deyou; Chu, Yinghao; Chen, Xingying; Shen, Bingbing; Xu, Chang; Zhou, Ling; Wang, Pei

    2016-01-01

    Highlights: • A nonlinear distribution parameter dynamic model has been developed. • Real-time local heat transfer coefficient and friction coefficient are adopted. • The dynamic behavior of the solar trough collector loop are simulated. • High-frequency chattering of outlet fluid flow are analyzed and modeled. • Irradiance disturbance at subcooled water region generates larger influence. - Abstract: Direct steam generation is a potential approach to further reduce the levelized electricity cost of solar trough. Dynamic modeling of the collector loop is essential for operation and control of direct steam generation solar trough. However, the dynamic behavior of fluid based on direct steam generation is complex because of the two-phase flow in the pipeline. In this work, a nonlinear distribution parameter model has been developed to model the dynamic behaviors of direct steam generation parabolic trough collector loops under either full or partial solar irradiance disturbance. Compared with available dynamic model, the proposed model possesses two advantages: (1) real-time local values of heat transfer coefficient and friction resistance coefficient, and (2) considering of the complete loop of collectors, including subcooled water region, two-phase flow region and superheated steam region. The proposed model has shown superior performance, particularly in case of sensitivity study of fluid parameters when the pipe is partially shaded. The proposed model has been validated using experimental data from Solar Thermal Energy Laboratory of University of New South Wales, with an outlet fluid temperature relative error of only 1.91%. The validation results show that: (1) The proposed model successfully outperforms two reference models in predicting the behavior of direct steam generation solar trough. (2) The model theoretically predicts that, during solar irradiance disturbance, the discontinuities of fluid physical property parameters and the moving back and

  9. Measuring Broadband IR Irradiance in the Direct Solar Beam and Recent Developments

    Energy Technology Data Exchange (ETDEWEB)

    Reda, Ibrahim; Andreas, Afshin; Dooraghi, Mike; Habte, Aron; Sengupta, Manajit; Kutchenreiter, Mark

    2016-12-14

    Solar and atmospheric science radiometers such as pyranometers, pyrheliometers, and photovoltaic cells are calibrated with traceability to a consensus reference which is maintained by Absolute Cavity Radiometers (ACRs). An ACR is an open cavity with no window, developed to measure the extended broadband spectrum of the terrestrial direct solar beam irradiance that extends beyond the ultraviolet and infrared bands; i.e. below 0.2 um and above 50 um, respectively. On the other hand, the pyranometers and pyrheliometers were developed to measure broadband shortwave irradiance from approximately 0.3 um to 3 um, while the present photovoltaic cells are limited to the spectral range of approximately 0.3 um to 1 um. The broadband mismatch of ACR versus such radiometers causes discrepancy in radiometers' calibration methods that has not been discussed or addressed in the solar and atmospheric science literature. Pyrgeometers, which measure the atmospheric longwave irradiance, are also used for solar and atmospheric science applications and calibrated with traceability to a consensus reference, yet they are calibrated during nighttime only, because no consensus reference has been established for the daytime longwave irradiance. This poster describes a method to measure the broadband longwave irradiance in the terrestrial direct solar beam from 3 um to 50 um, as a first step that might be used to help develop calibration methods to address the mismatch between broadband ACR and shortwave radiometers, and the lack of a daytime reference for pyrgeometers. The described method is used to measure the irradiance from sunrise to sunset; the irradiance varied from approximately 1 Wm-2 to 16 Wm-2 with an estimated uncertainty of 1.5 Wm-2, for a solar zenith angle range from 80 degrees to 16 degrees, respectively. Recent development shows that there is greater than 1.1 percent bias in measuring shortwave solar irradiance.

  10. Normal incidence spectrophotometer using high density transmission grating technology and highly efficiency silicon photodiodes for absolute solar EUV irradiance measurements

    Science.gov (United States)

    Ogawa, H. S.; Mcmullin, D.; Judge, D. L.; Korde, R.

    1992-01-01

    New developments in transmission grating and photodiode technology now make it possible to realize spectrometers in the extreme ultraviolet (EUV) spectral region (wavelengths less than 1000 A) which are expected to be virtually constant in their diffraction and detector properties. Time dependent effects associated with reflection gratings are eliminated through the use of free standing transmission gratings. These gratings together with recently developed and highly stable EUV photodiodes have been utilized to construct a highly stable normal incidence spectrophotometer to monitor the variability and absolute intensity of the solar 304 A line. Owing to its low weight and compactness, such a spectrometer will be a valuable tool for providing absolute solar irradiance throughout the EUV. This novel instrument will also be useful for cross-calibrating other EUV flight instruments and will be flown on a series of Hitchhiker Shuttle Flights and on SOHO. A preliminary version of this instrument has been fabricated and characterized, and the results are described.

  11. Comparison of Heat Transfer Fluid and Direct Steam Generation technologies for Integrated Solar Combined Cycles

    International Nuclear Information System (INIS)

    Rovira, Antonio; Montes, María José; Varela, Fernando; Gil, Mónica

    2013-01-01

    At present time and in the medium term, Solar Thermal Power Plants are going to share scenario with conventional energy generation technologies, like fossil and nuclear. In such a context, Integrated Solar Combined Cycles (ISCCs) may be an interesting choice since integrated designs may lead to a very efficient use of the solar and fossil resources. In this work, different ISCC configurations including a solar field based on parabolic trough collectors and working with the so-called Heat Transfer Fluid (HTF) and Direct Steam Generation (DSG) technologies are compared. For each technology, four layouts have been studied: one in which solar heat is used to evaporate part of the high pressure steam of a bottoming Rankine cycle with two pressure levels, another that incorporates a preheating section to the previous layout, the third one that includes superheating instead of preheating and the last one including both preheating and superheating in addition to the evaporation. The analysis is made with the aim of finding out which of the different layouts reaches the best performance. For that purpose, three types of comparisons have been performed. The first one assesses the benefits of including a solar steam production fixed at 50 MW th . The second one compares the configurations with a standardised solar field size instead of a fixed solar steam production. Finally, the last one consists on an even more homogeneous comparison considering the same steam generator size for all the configurations as well as standardised solar fields. The configurations are studied by mean of exergy analyses. Several figures of merit are used to correctly assess the configurations. Results reveal that the only-evaporative DSG configuration becomes the best choice, since it benefits of both low irreversibility at the heat recovery steam generator and high thermal efficiency in the solar field. Highlights: ► ISCC configurations with DSG and HTF technologies are compared. ► Four

  12. Decentralized and direct solar hydrogen production: Towards a hydrogen economy in MENA region

    Energy Technology Data Exchange (ETDEWEB)

    Bensebaa, Farid; Khalfallah, Mohamed; Ouchene, Majid

    2010-09-15

    Hydrogen has certainly some advantages in spite of its high cost and low efficiency when compared to other energy vectors. Solar energy is an abundant, clean and renewable source of energy, currently competing with fossil fuel for water heating without subsidy. Photo-electrochemical, thermo-chemicals and photo-biological processes for hydrogen production processes have been demonstrated. These decentralised hydrogen production processes using directly solar energy do not require expensive hydrogen infrastructure for packaging and delivery in the short and medium terms. MENA region could certainly be considered a key area for a new start to a global deployment of hydrogen economy.

  13. Calculating spectral direct solar irradiance, diffuse and global in Heredia, Costa Rica

    International Nuclear Information System (INIS)

    Wright, Jaime

    2008-01-01

    A spectral model under conditions of clear skies has described the flow of solar irradiation and is verified experimentally in Heredia, Costa Rica. A description of the model is presented by comparing its results with experimental measurements. The model has calculated the spectral flows of the global solar irradiation, direct and diffuse incident on a horizontal surface. Necessary input data include latitude, altitude, surface albedo as characteristics of a locality, and atmospheric characteristics: turbidity, precipitable water vapor, total ozone content and the optical thickness of a particular subject. The results show satisfactory values. (author) [es

  14. Solar energy utilization in the direct photocarboxylation of 2,3-dihydrofuran using CO2.

    Science.gov (United States)

    Aresta, Michele; Dibenedetto, Angela; Baran, Tomasz; Wojtyła, Szymon; Macyk, Wojciech

    2015-01-01

    The conversion of CO2 into high energy products (fuels) and the direct carboxylation of C-H bonds require a high energy input. Energy cannot be derived from fossil carbon, in this case. Solar energy can be used instead, with a low environmental impact and good profit. We have studied the use of white light or solar energy in the photoreduction of CO2 and in photocarboxylation reactions, using different semiconductors modified at their surface. Two examples of reduction of CO2 to methanol and CO will be shortly discussed, and two cases of carboxylation of organic substrates. The case of carboxylation of 2,3-dihydrofuran will be discussed in detail.

  15. TiO2-photoanode-assisted direct solar energy harvesting and storage in a solar-powered redox cell using halides as active materials.

    Science.gov (United States)

    Zhang, Shun; Chen, Chen; Zhou, Yangen; Qian, Yumin; Ye, Jing; Xiong, Shiyun; Zhao, Yu; Zhang, Xiaohong

    2018-06-19

    The rapid deployment of renewable energy is resulting in significant energy security, climate change mitigation, and economic benefits. We demonstrate here the direct solar energy harvesting and storage in a rechargeable solar-powered redox cell, which can be charged solely by solar irradiation. The cell follows a conventional redox-flow cell design with one integrated TiO2 photoanode in the cathode side. Direct charging the cell by solar irradiation results in the conversion of solar energy in to chemical energy. While discharging the cell leads to the release of chemical energy in the form of electricity. The cell integrates energy conversion and storage processes in a single device, making the solar energy directly and efficiently dispatchable. When using redox couples of Br2/Br- and I3-/I- in the cathode side and anode side, respectively, the cell can be directly charged upon solar irradiation, yielding a discharge potential of 0.5V with good round-trip efficiencies. This design is expected to be a potential alternative towards the development of affordable, inexhaustible and clean solar energy technologies.

  16. The search for and analysis of direct samples of early Solar System aqueous fluids.

    Science.gov (United States)

    Zolensky, Michael E; Bodnar, Robert J; Yurimoto, Hisayoshi; Itoh, Shoichi; Fries, Marc; Steele, Andrew; Chan, Queenie H-S; Tsuchiyama, Akira; Kebukawa, Yoko; Ito, Motoo

    2017-05-28

    We describe the current state of the search for direct, surviving samples of early, inner Solar System fluids-fluid inclusions in meteorites. Meteoritic aqueous fluid inclusions are not rare, but they are very tiny and their characterization is at the state of the art for most analytical techniques. Meteoritic fluid inclusions offer us a unique opportunity to study early Solar System brines in the laboratory. Inclusion-by-inclusion analyses of the trapped fluids in carefully selected samples will, in the immediate future, provide us detailed information on the evolution of fluids as they interacted with anhydrous solid materials. Thus, real data can replace calculated fluid compositions in thermochemical calculations of the evolution of water and aqueous reactions in comets, asteroids, moons and the terrestrial planets.This article is part of the themed issue 'The origin, history and role of water in the evolution of the inner Solar System'. © 2017 The Author(s).

  17. Design of a Solar Motor Drive System Fed by a Direct-Connected Photovoltaic Array

    Directory of Open Access Journals (Sweden)

    AYDOGMUS, O.

    2012-08-01

    Full Text Available A solar motor pump drive system is modeled and simulated. The proposed drive system does not require any kind of energy storage system and dc-dc converter. The system is connected directly to a photovoltaic (PV array. Thus, a low cost solar system can be achieved. A vector controlled Permanent Magnet Synchronous Motor (PMSM is used as a solar motor to increase the efficiency of system. The motor is designed for a low rated voltage level about 24V. The hill climbing MPPT method is used for balanced the motor power and PV power to obtain a high efficiency. The results are performed by using MATLAB/SimPowerSystem blocks. In addition, the PV array is modeled to allow for the possibility of running as on-line adjustable in simulation environment without using lookup table. The performances of motor, MPPT and drive system are analyzed in different conditions as temperature and irradiation of PV array.

  18. High Voltage Solar Array Arc Testing for a Direct Drive Hall Effect Thruster System

    Science.gov (United States)

    Schneider, Todd; Carruth, M. R., Jr.; Vaughn, J. A.; Jongeward, G. A.; Mikellides, I. G.; Ferguson, D.; Kerslake, T. W.; Peterson, T.; Snyder, D.; Hoskins, A.

    2004-01-01

    The deleterious effects of spacecraft charging are well known, particularly when the charging leads to arc events. The damage that results from arcing can severely reduce system lifetime and even cause critical system failures. On a primary spacecraft system such as a solar array, there is very little tolerance for arcing. Motivated by these concerns, an experimental investigation was undertaken to determine arc thresholds for a high voltage (200-500 V) solar array in a plasma environment. The investigation was in support of a NASA program to develop a Direct Drive Hall-Effect Thruster (D2HET) system. By directly coupling the solar array to a Hall-effect thruster, the D2HET program seeks to reduce mass, cost and complexity commonly associated with the power processing in conventional power systems. In the investigation, multiple solar array technologies and configurations were tested. The cell samples were biased to a negative voltage, with an applied potential difference between them, to imitate possible scenarios in solar array strings that could lead to damaging arcs. The samples were tested in an environment that emulated a low-energy, HET-induced plasma. Short duration trigger arcs as well as long duration sustained arcs were generated. Typical current and voltage waveforms associated with the arc events are presented. Arc thresholds are also defined in terms of voltage, current and power. The data will be used to propose a new, high-voltage (greater than 300 V) solar array design for which the likelihood of damage from arcing is minimal.

  19. Explosive Evaporating Phenomena of Cryogenic Fluids by Direct Contacting Normal Temperature Fluids

    Directory of Open Access Journals (Sweden)

    T Watanabe

    2016-09-01

    Full Text Available Cryogenic fluids have characteristics such as thermal stratification and flashing by pressure release in storage vessel. The mixture of the extreme low temperature fluid and the normal temperature fluid becomes the cause which causes pressure vessel and piping system crush due to explosive boiling and rapid freezing. In recent years in Japan, the demand of cryogenic fluids like a LH2, LNG is increasing because of the advance of fuel cell device technology, hydrogen of engine, and stream of consciousness for environmental agreement. These fuel liquids are cryogenic fluids. On the other hand, as for fisheries as well, the use of a source of energy that environment load is small has been being a pressing need. And, the need of the ice is high, as before, for keeping freshness of marine products in fisheries. Therefore, we carried out the experiments related to promotion of evaporating cryogenic fluids and generation of ice, in the contact directly of the water and liquid nitrogen. From the results of visualization, phenomena of explosive evaporating and ice forming were observed by using video camera.

  20. Future mission studies: Forecasting solar flux directly from its chaotic time series

    Science.gov (United States)

    Ashrafi, S.

    1991-01-01

    The mathematical structure of the programs written to construct a nonlinear predictive model to forecast solar flux directly from its time series without reference to any underlying solar physics is presented. This method and the programs are written so that one could apply the same technique to forecast other chaotic time series, such as geomagnetic data, attitude and orbit data, and even financial indexes and stock market data. Perhaps the most important application of this technique to flight dynamics is to model Goddard Trajectory Determination System (GTDS) output of residues between observed position of spacecraft and calculated position with no drag (drag flag = off). This would result in a new model of drag working directly from observed data.

  1. Epitaxial Ge Solar Cells Directly Grown on Si (001) by MOCVD Using Isobutylgermane

    Science.gov (United States)

    Kim, Youngjo; Kim, Kangho; Lee, Jaejin; Kim, Chang Zoo; Kang, Ho Kwan; Park, Won-Kyu

    2018-03-01

    Epitaxial Ge layers have been grown on Si (001) substrates by metalorganic chemical vapor deposition (MOCVD) using an isobutylgermane (IBuGe) metalorganic source. Low and high temperature two-step growth and post annealing techniques are employed to overcome the lattice mismatch problem between Ge and Si. It is demonstrated that high quality Ge epitaxial layers can be grown on Si (001) by using IBuGe with surface RMS roughness of 2 nm and an estimated threading dislocation density of 4.9 × 107 cm -2. Furthermore, single-junction Ge solar cells have been directly grown on Si substrates with an in situ MOCVD growth. The epitaxial Ge p- n junction structures are investigated with transmission electron microscopy and electrochemical C- V measurements. As a result, a power conversion efficiency of 1.69% was achieved for the Ge solar cell directly grown on Si substrate under AM1.5G condition.

  2. Solar power satellite rectenna design study: Directional receiving elements and parallel-series combining analysis

    Science.gov (United States)

    Gutmann, R. J.; Borrego, J. M.

    1978-01-01

    Rectenna conversion efficiencies (RF to dc) approximating 85 percent were demonstrated on a small scale, clearly indicating the feasibility and potential of efficiency of microwave power to dc. The overall cost estimates of the solar power satellite indicate that the baseline rectenna subsystem will be between 25 to 40 percent of the system cost. The directional receiving elements and element extensions were studied, along with power combining evaluation and evaluation extensions.

  3. Dynamical response of the magnetotail to changes of the solar wind direction: an MHD modeling perspective

    Directory of Open Access Journals (Sweden)

    V. A. Sergeev

    2008-08-01

    Full Text Available We performed global MHD simulations to investigate the magnetotail response to the solar wind directional changes (Vz-variations. These changes, although small, cause significant variations of the neutral sheet shape and location even in the near and middle tail regions. They display a complicated temporal response, in which ~60 to 80% of the final shift of the neutral sheet in Z direction occurs within first 10–15 min (less for faster solar wind, whereas a much longer time (exceeding half hour is required to reach a new equilibrium. The asymptotic equilibrium shape of the simulated neutral sheet is consistent with predictions of Tsyganenko-Fairfield (2004 empirical model. To visualize a physical origin of the north-south tail motion we compared the values of the total pressure in the northern and southern tail lobes and found a considerable difference (10–15% for only 6° change of the solar wind direction used in the simulation. That difference builds up during the passage of the solar wind directional discontinuity and is responsible for the vertical shift of the neutral sheet, although some pressure difference remains in the near tail even near the new equilibrium. Surprisingly, at a given tailward distance, the response was found to be first initiated in the tail center (the "leader effect", rather than near the flanks, which can be explained by the wave propagation in the tail, and which may have interesting implications for the substorm triggering studies. The present results have serious implications for the data-based modeling, as they place constraints on the accuracy of tail magnetic configurations to be derived for specific events using data of multi-spacecraft missions, e.g. such as THEMIS.

  4. A concentrated solar cavity absorber with direct heat transfer through recirculating metallic particles

    Energy Technology Data Exchange (ETDEWEB)

    Sarker, M. R. I., E-mail: islamrabiul@yahoo.com; Saha, Manabendra, E-mail: manabendra.saha@adelaide.edu.au, E-mail: manab04me@gmail.com; Beg, R. A. [Department of Mechanical Engineering, Rajshahi University of Engineering and Technology, Rajshahi-6204 (Bangladesh)

    2016-07-12

    A recirculating flow solar particle cavity absorber (receiver) is modeled to investigate the flow behavior and heat transfer characteristics of a novel developing concept. It features a continuous recirculating flow of non-reacting metallic particles (black silicon carbide) with air which are used as a thermal enhancement medium. The aim of the present study is to numerically investigate the thermal behavior and flow characteristics of the proposed concept. The proposed solar particle receiver is modeled using two phase discrete particle model (DPM), RNG k-flow model and discrete ordinate (DO) radiation model. Numerical analysis is carried out considering a solar receiver with only air and the mixture of non-reacting particles and air as a heat transfer as well as heat carrying medium. The parametric investigation is conducted considering the incident solar flux on the receiver aperture and changing air flow rate and recirculation rate inside the receiver. A stand-alone feature of the recirculating flow solar particle receiver concept is that the particles are directly exposed to concentrated solar radiation monotonously through recirculating flow inside the receiver and results in efficient irradiation absorption and convective heat transfer to air that help to achieve high temperature air and consequently increase in thermal efficiency. This paper presents, results from the developed concept and highlights its flow behavior and potential to enhance the heat transfer from metallic particles to air by maximizing heat carrying capacity of the heat transfer medium. The imposed milestones for the present system will be helpful to understand the radiation absorption mechanism of the particles in a recirculating flow based receiver, the thermal transport between the particles, the air and the cavity, and the fluid dynamics of the air and particle in the cavity.

  5. DROPOUT OF DIRECTIONAL ELECTRON INTENSITIES IN LARGE SOLAR ENERGETIC PARTICLE EVENTS

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Lun C. [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Reames, Donald V., E-mail: ltan@umd.edu [Institute for Physical Science and Technology, University of Maryland, College Park, MD 20742 (United States)

    2016-01-10

    In the “gradual” solar energetic particle (SEP) event during solar cycle 23 we have observed the dispersionless modulation (“dropout”) in directional intensities of nonrelativistic electrons. The average duration of dropout periods is ∼0.8 hr, which is consistent with the correlation scale of solar wind turbulence. During the dropout period electrons could display scatter-free transport in an intermittent way. Also, we have observed a decrease in the anisotropic index of incident electrons with increasing electron energy (E{sub e}), while the index of scattered/reflected electrons is nearly independent of E{sub e}. We hence perform an observational examination of the correlation between the anisotropic index of low-energy scattered/reflected electrons and the signature of the locally measured solar wind turbulence in the dissipation range, which is responsible for resonant scattering of nonrelativistic electrons. Since during the dropout period the slab turbulence fraction is dominant (0.8 ± 0.1), we pay close attention to the effect of slab fraction on the correlation examined. Our observation is consistent with the simulation result that in the dominance of the slab turbulence component there should exist a dispatched structure of magnetic flux tubes, along which electrons could be transported in a scatter-free manner. Since a similar phenomenon is exhibited in the “impulsive” SEP event, electron dropout should be a transport effect. Therefore, being different from most ion dropout events, which are due to a compact flare source, the dropout of directional electron intensities should be caused by the change of turbulence status in the solar wind.

  6. DROPOUT OF DIRECTIONAL ELECTRON INTENSITIES IN LARGE SOLAR ENERGETIC PARTICLE EVENTS

    International Nuclear Information System (INIS)

    Tan, Lun C.; Reames, Donald V.

    2016-01-01

    In the “gradual” solar energetic particle (SEP) event during solar cycle 23 we have observed the dispersionless modulation (“dropout”) in directional intensities of nonrelativistic electrons. The average duration of dropout periods is ∼0.8 hr, which is consistent with the correlation scale of solar wind turbulence. During the dropout period electrons could display scatter-free transport in an intermittent way. Also, we have observed a decrease in the anisotropic index of incident electrons with increasing electron energy (E e ), while the index of scattered/reflected electrons is nearly independent of E e . We hence perform an observational examination of the correlation between the anisotropic index of low-energy scattered/reflected electrons and the signature of the locally measured solar wind turbulence in the dissipation range, which is responsible for resonant scattering of nonrelativistic electrons. Since during the dropout period the slab turbulence fraction is dominant (0.8 ± 0.1), we pay close attention to the effect of slab fraction on the correlation examined. Our observation is consistent with the simulation result that in the dominance of the slab turbulence component there should exist a dispatched structure of magnetic flux tubes, along which electrons could be transported in a scatter-free manner. Since a similar phenomenon is exhibited in the “impulsive” SEP event, electron dropout should be a transport effect. Therefore, being different from most ion dropout events, which are due to a compact flare source, the dropout of directional electron intensities should be caused by the change of turbulence status in the solar wind

  7. Formation and growth of crystal defects in directionally solidified multicrystalline silicon for solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Ryningen, Birgit

    2008-07-01

    Included in this thesis are five publications and one report. The common theme is characterisation of directionally solidified multicrystalline silicon for solar cells. Material characterisation of solar cell silicon is naturally closely linked to both the casting process and to the solar cell processing: Many of the material properties are determined by the casting process, and the solar cell processing will to some extend determine which properties will influence the solar cell performance. Solar grade silicon (SoG-Si) made by metallurgical refining route and supplied by Elkem Solar was directionally solidified and subsequently characterised, and a simple solar cell process was applied. Except from some metallic co-precipitates in the top of the ingot, no abnormalities were found, and it is suggested that within the limits of the tests performed in this thesis, the casting and the solar cell processing, rather than the assumed higher impurity content, was the limiting factor. It is suggested in this thesis that the main quality problem in multicrystalline silicon wafers is the existence of dislocation clusters covering large wafer areas. The clusters will reduce the effect of gettering and even if gettering could be performed successfully, the clusters will still reduce the minority carrier mobility and hence the solar cell performance. It has further been pointed out that ingots solidified under seemingly equal conditions might have a pronounced difference in minority carrier lifetime. Ingots with low minority carrier lifetime have high dislocation densities. The ingots with the substantially higher lifetime seem all to be dominated by twins. It is also found a link between a higher undercooling and the ingots dominated by twins. It is suggested that the two types of ingots are subject to different nucleation and crystal growth mechanisms: For the ingots dominated by dislocations, which are over represented, the crystal growth is randomly nucleated at the

  8. Development of a direct expansion solar assisted heat pump for hot water supply

    International Nuclear Information System (INIS)

    Abdesselam Hamloui; Ong, K.S.; Than Cheok Fah; Masjuki Hassan

    2000-01-01

    Experimental investigations were conducted on the direct expansion solar assisted Heat Pump (DESAHP). Refrigerant R-22 was expanded in the solar collector which also acted as the evaporator in a conventional vapor compression refrigerating machine. The experiments were conducted under conditions of high and low solar radiation, with evaporator completely shaded from the sun, and at night. System thermal performance was determined by measuring refrigerant flow rate, temperature and pressure at numerous points in the system. The results showed that 227-l of water could be heated from 3O degree to 55 degree C in about 105 minutes. Higher water temperatures were obtained during hot sunny days. The coefficient of performance of heating, COP h , ranged from 11 to 4.7, depending upon operating conditions. The total saving of electric energy during hot sunny days was about 460 %. It means that for 1 kWh of electrical input to the system, we achieve 4.6 kWh. This percentage decreases as the evaporator temperature decreases and is a function of solar energy input. (Author)

  9. Experimental investigation on photothermal properties of nanofluids for direct absorption solar thermal energy systems

    International Nuclear Information System (INIS)

    He, Qinbo; Wang, Shuangfeng; Zeng, Shequan; Zheng, Zhaozhi

    2013-01-01

    Highlights: • The factors affecting the transmittance of Cu–H 2 O nanofluids were studied with UV–Vis–NIR spectrophotometer. • The optical properties of Cu–H 2 O nanofluids were studied through the theoretical model. • The Cu–H 2 O nanofluids can enhance the absorption ability for solar energy. - Abstract: In this article, Cu–H 2 O nanofluids were prepared through two-step method. The transmittance of nanofluids over solar spectrum (250–2500 nm) was measured by the UV–Vis–NIR spectrophotometer based on integrating sphere principle. The factors influencing transmittance of nanofluids, such as particle size, mass fraction and optical path were investigated. The extinction coefficients measured experimentally were compared with the theoretical calculation value. Meanwhile, the photothermal properties of nanofluids were also investigated. The experimental results show that the transmittance of Cu–H 2 O nanofluids is much less than that of deionized water, and decreases with increasing nanoparticle size, mass fraction and optical depth. The highest temperature of Cu–H 2 O nanofluids (0.1 wt.%) can increased up to 25.3% compared with deionized water. The good absorption ability of Cu–H 2 O nanofluids for solar energy indicates that it is suitable for direct absorption solar thermal energy systems

  10. Development of a direct solar driven diffusion absorption chiller; Entwicklung einer direkt solarthermisch angetriebenen Diffusions-Absorptionskaeltemaschine

    Energy Technology Data Exchange (ETDEWEB)

    Schmid, Fabian; Bierling, Bernd; Spindler, Klaus [Stuttgart Univ. (Germany). Inst. fuer Thermodynamik und Waermetechnik (ITW)

    2013-03-15

    At the ITW, a decentralized solar cooling system is developed based on the diffusion-absorption refrigeration cycle. The generator and the bubble pump of the process are integrated in a solar collector, and therefore directly heated. The main research focus after reaching a stable operation of the system is a detailed investigation of the auxiliary gas circuit. (orig.)

  11. AN INVESTIGATION OF THE SOURCES OF EARTH-DIRECTED SOLAR WIND DURING CARRINGTON ROTATION 2053

    Energy Technology Data Exchange (ETDEWEB)

    Fazakerley, A. N.; Harra, L. K.; Van Driel-Gesztelyi, L., E-mail: a.fazakerley@ucl.ac.uk [Mullard Space Science Laboratory, University College London (United Kingdom)

    2016-06-01

    In this work we analyze multiple sources of solar wind through a full Carrington Rotation (CR 2053) by analyzing the solar data through spectroscopic observations of the plasma upflow regions and the in situ data of the wind itself. Following earlier authors, we link solar and in situ observations by a combination of ballistic backmapping and potential-field source-surface modeling. We find three sources of fast solar wind that are low-latitude coronal holes. The coronal holes do not produce a steady fast wind, but rather a wind with rapid fluctuations. The coronal spectroscopic data from Hinode ’s Extreme Ultraviolet Imaging Spectrometer show a mixture of upflow and downflow regions highlighting the complexity of the coronal hole, with the upflows being dominant. There is a mix of open and multi-scale closed magnetic fields in this region whose (interchange) reconnections are consistent with the up- and downflows they generate being viewed through an optically thin corona, and with the strahl directions and freeze-in temperatures found in in situ data. At the boundary of slow and fast wind streams there are three short periods of enhanced-velocity solar wind, which we term intermediate based on their in situ characteristics. These are related to active regions that are located beside coronal holes. The active regions have different magnetic configurations, from bipolar through tripolar to quadrupolar, and we discuss the mechanisms to produce this intermediate wind, and the important role that the open field of coronal holes adjacent to closed-field active regions plays in the process.

  12. An Investigation of the Sources of Earth-directed Solar Wind during Carrington Rotation 2053

    Science.gov (United States)

    Fazakerley, A. N.; Harra, L. K.; van Driel-Gesztelyi, L.

    2016-06-01

    In this work we analyze multiple sources of solar wind through a full Carrington Rotation (CR 2053) by analyzing the solar data through spectroscopic observations of the plasma upflow regions and the in situ data of the wind itself. Following earlier authors, we link solar and in situ observations by a combination of ballistic backmapping and potential-field source-surface modeling. We find three sources of fast solar wind that are low-latitude coronal holes. The coronal holes do not produce a steady fast wind, but rather a wind with rapid fluctuations. The coronal spectroscopic data from Hinode’s Extreme Ultraviolet Imaging Spectrometer show a mixture of upflow and downflow regions highlighting the complexity of the coronal hole, with the upflows being dominant. There is a mix of open and multi-scale closed magnetic fields in this region whose (interchange) reconnections are consistent with the up- and downflows they generate being viewed through an optically thin corona, and with the strahl directions and freeze-in temperatures found in in situ data. At the boundary of slow and fast wind streams there are three short periods of enhanced-velocity solar wind, which we term intermediate based on their in situ characteristics. These are related to active regions that are located beside coronal holes. The active regions have different magnetic configurations, from bipolar through tripolar to quadrupolar, and we discuss the mechanisms to produce this intermediate wind, and the important role that the open field of coronal holes adjacent to closed-field active regions plays in the process.

  13. Performance investigation of a solar-assisted direct contact membrane distillation system

    KAUST Repository

    Kim, Youngdeuk

    2013-01-01

    This paper presents a solar-assisted direct contact membrane distillation (DCMD) system with novel energy recovery concepts for a continuous 24-h-a-day operation. A temperature modulating scheme is introduced to the solar-thermal system that supplies feed seawater to the DCMD modules. This scheme attenuates extreme temperature fluctuations of the feed water by storing the collected energy during solar-peak hours and reutilizing it throughout the day. Thus, the energy savings is realized yet the feed seawater temperature is maintained within the desired range. Additionally, the system employs heat recovery from the permeate and brine streams to the feed seawater. The simulations for such a system with a shell-and-tube type DCMD modules are carried out to examine the spatial property variations and the sensitivity of system performance (i.e., transmembrane pressure, permeate flux and performance ratio) to the operating conditions (inlet temperature and flow rate) and the fiber dimensions (fiber length and packing density). It is found that there are trade-offs between mean permeate flux and performance ratio with respect to permeate inlet temperature and flow rate and between total distillate production and performance ratio with respect to packing density. For the solar-assisted DCMD system having evacuated-tube collectors of 3360m2 with 160m3 seawater storage tanks and 50 DCMD modules, the annual solar fraction and the collector efficiency are found to be 77% and 53%, respectively, whilst the overall permeate production capacity is 31m3/day. The overall specific thermal energy consumption of the DCMD system with heat recovery is found to be 436kWh/m3 and it is about 43% lower as compared to the system without heat recovery. It is observed that the specific thermal energy consumption decreases significantly by 55% with increased collector area from 1983m2 to 3360m2 whereas the specific electrical energy consumption increases slightly by 16%. © 2012 Elsevier B.V.

  14. Effect of Working Fluids on the Thermal Performance of a Bi-directional Solar Thermodiode

    International Nuclear Information System (INIS)

    Ko, Yung Joo

    2008-02-01

    An excessive use of fossil fuel leads to the limitation of coal deposits and carbon dioxide accumulation that accelerates the global warming, so the international environment regulation becomes more strict to control the greenhouse gas emission. Many researches are being made on alternative energy development to cut down fossil fuel and to decrease carbon dioxide. During the last decade, there have been active tries to utilize the solar energy that is unlimited and clean . The application of solar energy to heating and cooling of the building has much improved the economical efficiency and function with the development of high-technology materials, and it is not rare to find the recently built houses and commercial buildings equipped with solar energy systems. In particular, the advanced countries such as USA and Japan attempt the remarkable reduction of energy consumption in heating and cooling of buildings. For this, they are searching for the more effective application of various alternative energies including the solar energy. In addition, they are trying to realize the distinct zero energy conception by applying the new techniques and materials to the existing buildings. In developing the new techniques of solar energy application to heating and cooling system, the economic problems hire to be addressed, The typical problems encountered in applying the solar energy are insufficient design concept for HVAC(heating, ventilation, and air conditioning) system and low reliability, Further, the economical efficiency of the solar energy is still low to compete with the oil, and there are many limits on the realization of the actual system in a building, e.g. spatial alignments and exterior appearances. The purpose of this study is to find the improved method to increase the heat transfer efficiency of the solar energy system that are to be installed in houses and commercial buildings. For this, a series of experiments using the bi-directional thermo diode system

  15. Real time optimization of solar powered direct contact membrane distillation based on multivariable extremum seeking

    KAUST Repository

    Karam, Ayman M.; Laleg-Kirati, Taous-Meriem

    2015-01-01

    This paper presents a real time optimization scheme for a solar powered direct contact membrane distillation (DCMD) water desalination system. The sun and weather conditions vary and are inconsistent throughout the day. Therefore, the solar powered DCMD feed inlet temperature is never constant, which influences the distilled water flux. The problem of DCMD process optimization has not been studied enough. In this work, the response of the process under various feed inlet temperatures is investigated, which demonstrates the need for an optimal controller. To address this issue, we propose a multivariable Newton-based extremum seeking controller which optimizes the inlet feed and permeate mass flow rates as the feed inlet temperature varies. Results are presented and discussed for a realistic temperature profile.

  16. Direct solar energy conversion and storage through coupling between photoelectrochemical and ferroelectric effects

    Directory of Open Access Journals (Sweden)

    Chi-Wei Lo

    2011-12-01

    Full Text Available Harvesting and storing solar energy has become more and more important. Current solid-state photovoltaic cells and conventional photoelectrochemical cells are not capable of directly storing the converted energy, which has to be facilitated by connecting to external storing devices. We demonstrate a device architecture that can convert and store solar energy in the electrical form within an intrinsically single structure. Mobile charge is internally stored, based on the coupling between photoelectrochemical and ferroelectric effects. The tested device architecture can be photo-charged under 1000 W/m2 of white light to an open-circuit voltage of 0.47V with a capacity of 37.62 mC/cm2. After removal of the light source, the mobile charge stored lasts more than 8 hours, and the open-circuit output voltage lasts more than 24 hours.

  17. Thermally induced structural evolution and performance of mesoporous block copolymer-directed alumina perovskite solar cells.

    KAUST Repository

    Tan, Kwan Wee

    2014-04-11

    Structure control in solution-processed hybrid perovskites is crucial to design and fabricate highly efficient solar cells. Here, we utilize in situ grazing incidence wide-angle X-ray scattering and scanning electron microscopy to investigate the structural evolution and film morphologies of methylammonium lead tri-iodide/chloride (CH3NH3PbI(3-x)Cl(x)) in mesoporous block copolymer derived alumina superstructures during thermal annealing. We show the CH3NH3PbI(3-x)Cl(x) material evolution to be characterized by three distinct structures: a crystalline precursor structure not described previously, a 3D perovskite structure, and a mixture of compounds resulting from degradation. Finally, we demonstrate how understanding the processing parameters provides the foundation needed for optimal perovskite film morphology and coverage, leading to enhanced block copolymer-directed perovskite solar cell performance.

  18. Efficient direct solar-to-hydrogen conversion by in situ interface transformation of a tandem structure

    Science.gov (United States)

    May, Matthias M.; Lewerenz, Hans-Joachim; Lackner, David; Dimroth, Frank; Hannappel, Thomas

    2015-09-01

    Photosynthesis is nature's route to convert intermittent solar irradiation into storable energy, while its use for an industrial energy supply is impaired by low efficiency. Artificial photosynthesis provides a promising alternative for efficient robust carbon-neutral renewable energy generation. The approach of direct hydrogen generation by photoelectrochemical water splitting utilizes customized tandem absorber structures to mimic the Z-scheme of natural photosynthesis. Here a combined chemical surface transformation of a tandem structure and catalyst deposition at ambient temperature yields photocurrents approaching the theoretical limit of the absorber and results in a solar-to-hydrogen efficiency of 14%. The potentiostatically assisted photoelectrode efficiency is 17%. Present benchmarks for integrated systems are clearly exceeded. Details of the in situ interface transformation, the electronic improvement and chemical passivation are presented. The surface functionalization procedure is widely applicable and can be precisely controlled, allowing further developments of high-efficiency robust hydrogen generators.

  19. Real time optimization of solar powered direct contact membrane distillation based on multivariable extremum seeking

    KAUST Repository

    Karam, Ayman M.

    2015-09-21

    This paper presents a real time optimization scheme for a solar powered direct contact membrane distillation (DCMD) water desalination system. The sun and weather conditions vary and are inconsistent throughout the day. Therefore, the solar powered DCMD feed inlet temperature is never constant, which influences the distilled water flux. The problem of DCMD process optimization has not been studied enough. In this work, the response of the process under various feed inlet temperatures is investigated, which demonstrates the need for an optimal controller. To address this issue, we propose a multivariable Newton-based extremum seeking controller which optimizes the inlet feed and permeate mass flow rates as the feed inlet temperature varies. Results are presented and discussed for a realistic temperature profile.

  20. Thermally induced structural evolution and performance of mesoporous block copolymer-directed alumina perovskite solar cells.

    KAUST Repository

    Tan, Kwan Wee; Moore, David T; Saliba, Michael; Sai, Hiroaki; Estroff, Lara A; Hanrath, Tobias; Snaith, Henry J; Wiesner, Ulrich

    2014-01-01

    Structure control in solution-processed hybrid perovskites is crucial to design and fabricate highly efficient solar cells. Here, we utilize in situ grazing incidence wide-angle X-ray scattering and scanning electron microscopy to investigate the structural evolution and film morphologies of methylammonium lead tri-iodide/chloride (CH3NH3PbI(3-x)Cl(x)) in mesoporous block copolymer derived alumina superstructures during thermal annealing. We show the CH3NH3PbI(3-x)Cl(x) material evolution to be characterized by three distinct structures: a crystalline precursor structure not described previously, a 3D perovskite structure, and a mixture of compounds resulting from degradation. Finally, we demonstrate how understanding the processing parameters provides the foundation needed for optimal perovskite film morphology and coverage, leading to enhanced block copolymer-directed perovskite solar cell performance.

  1. Information content of sky intensity and polarization measurements at right angles to the solar direction

    Science.gov (United States)

    Holland, A. C.; Thomas, R. W. L.; Pearce, W. A.

    1978-01-01

    The paper presents the results of a Monte Carlo simulation study of the brightness and polarization at right angles to the solar direction both for ground-based observations (looking up) and for satellite-based systems (looking down). Calculations have been made for a solar zenith angle whose cosine was 0.6 and wavelengths ranging from 3500 A to 9500 A. A sensitivity of signatures to total aerosol loading, aerosol particle size distribution and refractive index, and the surface reflectance albedo has been demonstrated. For Lambertian-type surface reflection the albedo effects enter solely through the intensity sensitivity, and very high correlations have been found between the polarization term signatures for the ground-based and satellite-based systems. Potential applications of these results for local albedo predictions and satellite imaging systems recalibrations are discussed.

  2. Thermally Induced Structural Evolution and Performance of Mesoporous Block Copolymer-Directed Alumina Perovskite Solar Cells

    Science.gov (United States)

    2015-01-01

    Structure control in solution-processed hybrid perovskites is crucial to design and fabricate highly efficient solar cells. Here, we utilize in situ grazing incidence wide-angle X-ray scattering and scanning electron microscopy to investigate the structural evolution and film morphologies of methylammonium lead tri-iodide/chloride (CH3NH3PbI3–xClx) in mesoporous block copolymer derived alumina superstructures during thermal annealing. We show the CH3NH3PbI3–xClx material evolution to be characterized by three distinct structures: a crystalline precursor structure not described previously, a 3D perovskite structure, and a mixture of compounds resulting from degradation. Finally, we demonstrate how understanding the processing parameters provides the foundation needed for optimal perovskite film morphology and coverage, leading to enhanced block copolymer-directed perovskite solar cell performance. PMID:24684494

  3. Improving historical spelling normalization with bi-directional LSTMs and multi-task learning

    OpenAIRE

    Bollmann, Marcel; Søgaard, Anders

    2016-01-01

    Natural-language processing of historical documents is complicated by the abundance of variant spellings and lack of annotated data. A common approach is to normalize the spelling of historical words to modern forms. We explore the suitability of a deep neural network architecture for this task, particularly a deep bi-LSTM network applied on a character level. Our model compares well to previously established normalization algorithms when evaluated on a diverse set of texts from Early New Hig...

  4. Dynamic solar-powered multi-stage direct contact membrane distillation system: Concept design, modeling and simulation

    KAUST Repository

    Lee, Jung Gil; Kim, Woo-Seung; Choi, June-Seok; Ghaffour, NorEddine; Kim, Young-Deuk

    2017-01-01

    This paper presents a theoretical analysis of the monthly average daily and hourly performances of a solar-powered multi-stage direct contact membrane distillation (SMDCMD) system with an energy recovery scheme and dynamic operating system. Mid

  5. Assessment Of The Viability Of Kaduna City Climate For Year Round Use Of Direct Solar Thermal Cooking Fuel In Housing

    Directory of Open Access Journals (Sweden)

    Boumann Ephraim Sule

    2017-10-01

    Full Text Available Solar energy obtained from the sun is the world most abundant and cheapest source of energy as a cooking fuel. It comes in two forms Concentrated Solar Thermal direct conversion of solar energy to heat that cooks and Solar Photovoltaic PV a conversion of solar energy to electrical then to heat energy the former technology is simple and far cheaper. Despite all these architectural and engineering researches is yet to capture it for indoor cooking because of inability to cook year round due the claimed hindrances by weather condition such as clouds rainfall wind dusty atmosphere and many others. This paper attempted to look into the possibility of cooking year round in Kaduna city. It collected and analyzed ten years climatic data from three different meteorological stations strategically located round the city this showed a low solar radiation in the month of August. It further compared the result with a literature review of solar cooking carried in the same month the findings showed at the peak of each weather hindrance a another element overrides it to give enough minimum energy for cooking a meals. This paper has therefore pointed the potentials of Kaduna city climate for year round use of concentrated solar thermal as a cooking fuel in residential building and further recommends the architectural collaboration with engineers for the direct capturing of solar rays into residential dwelling as a sustainable cooking fuel.

  6. Direct detection of light dark matter and solar neutrinos via color center production in crystals

    OpenAIRE

    Budnik, Ranny; Cheshnovsky, Ori; Slone, Oren; Volansky, Tomer

    2018-01-01

    We propose a new low-threshold direct-detection concept for dark matter and for coherent nuclear scattering of solar neutrinos, based on the dissociation of atoms and subsequent creation of color center type defects within a lattice. The novelty in our approach lies in its ability to detect single defects in a macroscopic bulk of material. This class of experiments features ultra-low energy thresholds which allows for the probing of dark matter as light as O(10) MeV through nuclear scattering...

  7. Integrating a Photocatalyst into a Hybrid Lithium-Sulfur Battery for Direct Storage of Solar Energy.

    Science.gov (United States)

    Li, Na; Wang, Yarong; Tang, Daiming; Zhou, Haoshen

    2015-08-03

    Direct capture and storage of abundant but intermittent solar energy in electrical energy-storage devices such as rechargeable lithium batteries is of great importance, and could provide a promising solution to the challenges of energy shortage and environment pollution. Here we report a new prototype of a solar-driven chargeable lithium-sulfur (Li-S) battery, in which the capture and storage of solar energy was realized by oxidizing S(2-) ions to polysulfide ions in aqueous solution with a Pt-modified CdS photocatalyst. The battery can deliver a specific capacity of 792 mAh g(-1) during 2 h photocharging process with a discharge potential of around 2.53 V versus Li(+)/Li. A specific capacity of 199 mAh g(-1), reaching the level of conventional lithium-ion batteries, can be achieved within 10 min photocharging. Moreover, the charging process of the battery can proceed under natural sunlight irradiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Direct EUV/X-Ray Modulation of the Ionosphere During the August 2017 Total Solar Eclipse

    Science.gov (United States)

    Mrak, Sebastijan; Semeter, Joshua; Drob, Douglas; Huba, J. D.

    2018-05-01

    The great American total solar eclipse of 21 August 2017 offered a fortuitous opportunity to study the response of the atmosphere and ionosphere using a myriad of ground instruments. We have used the network of U.S. Global Positioning System receivers to examine perturbations in maps of ionospheric total electron content (TEC). Coherent large-scale variations in TEC have been interpreted by others as gravity wave-induced traveling ionospheric disturbances. However, the solar disk had two active regions at that time, one near the center of the disk and one at the edge, which resulted in an irregular illumination pattern in the extreme ultraviolet (EUV)/X-ray bands. Using detailed EUV occultation maps calculated from the National Aeronautics and Space Administration Solar Dynamics Observatory Atmospheric Imaging Assembly images, we show excellent agreement between TEC perturbations and computed gradients in EUV illumination. The results strongly suggest that prominent large-scale TEC disturbances were consequences of direct EUV modulation, rather than gravity wave-induced traveling ionospheric disturbances.

  9. Design and Fabrication of a Direct Natural Convection Solar Dryer for Tapioca

    Directory of Open Access Journals (Sweden)

    Diemuodeke E. OGHENERUONA

    2011-06-01

    Full Text Available Based on preliminary investigations under controlled conditions of drying experiments, a direct natural convection solar dryer was designed and fabricated to dry tapioca in the rural area. This paper describes the design considerations followed and presents the results of MS excel computed results of the design parameters. A minimum of 7.56 m2 solar collector area is required to dry a batch of 100 kg tapioca in 20 hours (two days drying period. The initial and final moisture content considered were 79 % and 10 % wet basis, respectively. The average ambient conditions are 32ºC air temperatures and 74 % relative humidity with daily global solar radiation incident on horizontal surface of 13 MJ/m2/day. The weather conditions considered are of Warri (lat. 5°30’, long. 5°41’, Nigeria. A prototype of the dryer so designed was fabricated with minimum collector area of 1.08 m2. This prototype dryer will be used in experimental drying tests under various loading conditions.

  10. Parabolic solar cooker: Cooking with heat pipe vs direct spiral copper tubes

    Science.gov (United States)

    Craig, Omotoyosi O.; Dobson, Robert T.

    2016-05-01

    Cooking with solar energy has been seen by many researchers as a solution to the challenges of poverty and hunger in the world. This is no exception in Africa, as solar coking is viewed as an avenue to eliminate the problem of food insecurity, insufficient energy supply for household and industrial cooking. There are several types of solar cookers that have been manufactured and highlighted in literature. The parabolic types of solar cookers are known to reach higher temperatures and therefore cook faster. These cookers are currently being developed for indoor cooking. This technology has however suffered low cooking efficiency and thus leads to underutilization of the high heat energy captured from the sun in the cooking. This has made parabolic solar cookers unable to compete with other conventional types of cookers. Several methods to maximize heat from the sun for indirect cooking has been developed, and the need to improve on them of utmost urgency. This paper investigates how to optimize the heat collected from the concentrating types of cookers by proposing and comparing two types of cooking sections: the spiral hot plate copper tube and the heat pipe plate. The system uses the concentrating solar parabolic dish technology to focus the sun on a conical cavity of copper tubes and the heat is stored inside an insulated tank which acts both as storage and cooking plate. The use of heat pipes to transfer heat between the oil storage and the cooking pot was compared to the use of a direct natural syphon principle which is achieved using copper tubes in spiral form like electric stove. An accurate theoretical analysis for the heat pipe cooker was achieved by solving the boiling and vaporization in the evaporator side and then balancing it with the condensation and liquid-vapour interaction in the condenser part while correct heat transfer, pressure and height balancing was calculated in the second experiment. The results show and compare the cooking time, boiling

  11. Direct expansion solar assisted heat pumps – A clean steady state approach for overall performance analysis

    International Nuclear Information System (INIS)

    Tagliafico, Luca A.; Scarpa, Federico; Valsuani, Federico

    2014-01-01

    Traditional thermal solar panel technologies have limited efficiency and the required economic investments make them noncompetitive in the space heating market. The greatest limit to the diffusion of thermal solar systems is the characteristic temperatures they can reach: the strong connection between the user temperature and the collector temperature makes it possible to achieve high thermal (collector) efficiency only at low, often useless, user temperatures. By using solar collectors as thermal exchange units (evaporators) in a heat pump system (direct expansion solar assisted heat pump, DX-SAHP), the overall efficiency greatly increases with a significative cut of the associated investment in terms of pay-back time. In this study, an approach is proposed to the steady state analysis of DX-SAHP, which is based on the simplified inverse Carnot cycle and on the second law efficiency concept. This method, without the need of calculating the refrigerant fluid properties and the detailed processes occurring in the refrigeration device, allows us to link the main features of the plant to its relevant interactions with the surroundings. The very nature of the proposed method makes the relationship explicit and meaningful among all the involved variables. The paper, after the description of the method, presents an explanatory application of this technique by reviewing various aspects of the performance of a typical DX-SAHP in which the savings on primary energy consumption is regarded as the main feature of the plant and highlighted in a monthly averaged analysis. Results agree to those coming from a common standard steady state thermodynamic analysis. The application to a typical DX-SAHP system demonstrates that a mean saved primary energy of about 50% with respect to standard gas burner can be achieved for the same user needs. Such a result is almost independent from the type of flat plate solar panel used (double or single glazed, or even bare panels) as a result of

  12. On a direct algorithm for the generation of log-normal pseudo-random numbers

    CERN Document Server

    Chamayou, J M F

    1976-01-01

    The random variable ( Pi /sub i=1//sup n/X/sub i//X/sub i+n/)/sup 1/ square root 2n/ is used to generate standard log normal variables Lambda (0, 1), where the X/sub i/ are independent uniform variables on (0, 1). (8 refs).

  13. Solvent Vapor Annealing-Mediated Crystallization Directs Charge Generation, Recombination and Extraction in BHJ Solar Cells

    KAUST Repository

    Babics, Maxime; Liang, Ru-Ze; Wang, Kai; Cruciani, Federico; Kan, Zhipeng; Wohlfahrt, Markus; Tang, Ming-Chun; Laquai, Fré dé ric; Beaujuge, Pierre

    2017-01-01

    Small-molecule (SM) donors that can be solution-processed with fullerene acceptors (e.g., PC61/71BM), or their “nonfullerene” counterparts, are proving particularly promising for the realization of high-efficiency bulk-heterojunction (BHJ) solar cells. In several recent studies, solvent vapor annealing (SVA) protocols have been found to yield significant BHJ device efficiency improvements via structural changes in the active layer morphologies. However, the mechanisms by which active layer morphologies evolve when subjected to SVA treatments, and the structural factors impacting charge generation, carrier transport, recombination and extraction in BHJ solar cells with SM donors and fullerene acceptors, remain important aspects to be elucidated. In this report, we show that – in BHJ solar cells with SM donors and fullerene acceptors – selective crystallization promoted by SVA mediates the development of optimized morphologies across the active layers, setting domain sizes and boundaries. Examining BHJ solar cells subjected to various SVA exposure times, with BDT[2F]QdC as the SM donor and PC71BM as the acceptor, we connect those morphological changes to specific carrier effects, showing that crystal growth effectively directs charge generation and recombination. We find that the SM donor-pure domains growing at the expense of a mixed donor-acceptor phase play a determining role, establishing optimum networks with 10-20nm-sized domains during the SVA treatment. Longer SVA times result in highly textured active layers with crystalline domains that can exceed the lengthscale of exciton diffusion, while inducing detrimental vertical morphologies and deep carrier traps. Last, we emphasize the field-dependence charge generation occurring upon SVA-mediated crystallization and link this carrier effect to the mixed phase depletion across the BHJ active layer.

  14. Solvent Vapor Annealing-Mediated Crystallization Directs Charge Generation, Recombination and Extraction in BHJ Solar Cells

    KAUST Repository

    Babics, Maxime

    2017-12-19

    Small-molecule (SM) donors that can be solution-processed with fullerene acceptors (e.g., PC61/71BM), or their “nonfullerene” counterparts, are proving particularly promising for the realization of high-efficiency bulk-heterojunction (BHJ) solar cells. In several recent studies, solvent vapor annealing (SVA) protocols have been found to yield significant BHJ device efficiency improvements via structural changes in the active layer morphologies. However, the mechanisms by which active layer morphologies evolve when subjected to SVA treatments, and the structural factors impacting charge generation, carrier transport, recombination and extraction in BHJ solar cells with SM donors and fullerene acceptors, remain important aspects to be elucidated. In this report, we show that – in BHJ solar cells with SM donors and fullerene acceptors – selective crystallization promoted by SVA mediates the development of optimized morphologies across the active layers, setting domain sizes and boundaries. Examining BHJ solar cells subjected to various SVA exposure times, with BDT[2F]QdC as the SM donor and PC71BM as the acceptor, we connect those morphological changes to specific carrier effects, showing that crystal growth effectively directs charge generation and recombination. We find that the SM donor-pure domains growing at the expense of a mixed donor-acceptor phase play a determining role, establishing optimum networks with 10-20nm-sized domains during the SVA treatment. Longer SVA times result in highly textured active layers with crystalline domains that can exceed the lengthscale of exciton diffusion, while inducing detrimental vertical morphologies and deep carrier traps. Last, we emphasize the field-dependence charge generation occurring upon SVA-mediated crystallization and link this carrier effect to the mixed phase depletion across the BHJ active layer.

  15. Verification of ECMWF and ECMWF/MACC's global and direct irradiance forecasts with respect to solar electricity production forecasts

    Directory of Open Access Journals (Sweden)

    M. Schroedter-Homscheidt

    2017-02-01

    Full Text Available The successful electricity grid integration of solar energy into day-ahead markets requires at least hourly resolved 48 h forecasts. Technologies as photovoltaics and non-concentrating solar thermal technologies make use of global horizontal irradiance (GHI forecasts, while all concentrating technologies both from the photovoltaic and the thermal sector require direct normal irradiances (DNI. The European Centre for Medium-Range Weather Forecasts (ECMWF has recently changed towards providing direct as well as global irradiances. Additionally, the MACC (Monitoring Atmospheric Composition & Climate near-real time services provide daily analysis and forecasts of aerosol properties in preparation of the upcoming European Copernicus programme. The operational ECMWF/IFS (Integrated Forecast System forecast system will in the medium term profit from the Copernicus service aerosol forecasts. Therefore, within the MACC‑II project specific experiment runs were performed allowing for the assessment of the performance gain of these potential future capabilities. Also the potential impact of providing forecasts with hourly output resolution compared to three-hourly resolved forecasts is investigated. The inclusion of the new aerosol climatology in October 2003 improved both the GHI and DNI forecasts remarkably, while the change towards a new radiation scheme in 2007 only had minor and partly even unfavourable impacts on the performance indicators. For GHI, larger RMSE (root mean square error values are found for broken/overcast conditions than for scattered cloud fields. For DNI, the findings are opposite with larger RMSE values for scattered clouds compared to overcast/broken cloud situations. The introduction of direct irradiances as an output parameter in the operational IFS version has not resulted in a general performance improvement with respect to biases and RMSE compared to the widely used Skartveit et al. (1998 global to direct irradiance

  16. A DIRECT METHOD TO DETERMINE THE PARALLEL MEAN FREE PATH OF SOLAR ENERGETIC PARTICLES WITH ADIABATIC FOCUSING

    International Nuclear Information System (INIS)

    He, H.-Q.; Wan, W.

    2012-01-01

    The parallel mean free path of solar energetic particles (SEPs), which is determined by physical properties of SEPs as well as those of solar wind, is a very important parameter in space physics to study the transport of charged energetic particles in the heliosphere, especially for space weather forecasting. In space weather practice, it is necessary to find a quick approach to obtain the parallel mean free path of SEPs for a solar event. In addition, the adiabatic focusing effect caused by a spatially varying mean magnetic field in the solar system is important to the transport processes of SEPs. Recently, Shalchi presented an analytical description of the parallel diffusion coefficient with adiabatic focusing. Based on Shalchi's results, in this paper we provide a direct analytical formula as a function of parameters concerning the physical properties of SEPs and solar wind to directly and quickly determine the parallel mean free path of SEPs with adiabatic focusing. Since all of the quantities in the analytical formula can be directly observed by spacecraft, this direct method would be a very useful tool in space weather research. As applications of the direct method, we investigate the inherent relations between the parallel mean free path and various parameters concerning physical properties of SEPs and solar wind. Comparisons of parallel mean free paths with and without adiabatic focusing are also presented.

  17. Thermal performance analysis of a direct-expansion solar-assisted heat pump water heater

    International Nuclear Information System (INIS)

    Kong, X.Q.; Zhang, D.; Li, Y.; Yang, Q.M.

    2011-01-01

    A direct-expansion solar-assisted heat pump water heater (DX-SAHPWH) is described, which can supply hot water for domestic use during the whole year. The system mainly employs a bare flat-plate collector/evaporator with a surface area of 4.2 m 2 , an electrical rotary-type hermetic compressor, a hot water tank with the volume of 150 L and a thermostatic expansion valve. R-22 is used as working fluid in the system. A simulation model based on lumped and distributed parameter approach is developed to predict the thermal performance of the system. Given the structure parameters, meteorological parameters, time step and final water temperature, the numerical model can output operational parameters, such as heat capacity, system COP and collector efficiency. Comparisons between the simulation results and the experimental measurements show that the model is able to give satisfactory predictions. The effect of various parameters, including solar radiation, ambient temperature, wind speed and compressor speed, has been analyzed on the thermal performance of the system. -- Highlights: ► A direct-expansion solar-assisted heat pump water heater (DX-SAHPWH) is described. ► A simulation model based on lumped and distributed parameter approach is developed to predict the thermal performance of the system. ► The numerical model can output operational parameters, such as heat capacity, system COP and collector efficiency. ► Comparisons between the simulation results and the experimental measurements show that the model is able to give satisfactory predictions. ► The effect of various parameters has been analyzed on the thermal performance of the system.

  18. Blood pressure directly correlates with blood viscosity in diabetes type 1 children but not in normals.

    Science.gov (United States)

    Vázquez, Beatriz Y Salazar; Vázquez, Miguel A Salazar; Jáquez, Manuel Guajardo; Huemoeller, Antonio H Bracho; Intaglietta, Marcos; Cabrales, Pedro

    2010-01-01

    To determine the relationship between mean arterial blood pressure (MAP) and blood viscosity in diabetic type 1 children and healthy controls to investigate whether MAP is independent of blood viscosity in healthy children, and vice versa. Children with diabetes type 1 treated by insulin injection were studied. Controls were healthy children of both sexes. MAP was calculated from systolic and diastolic pressure measurements. Blood viscosity was determined indirectly by measuring blood hemoglobin (Hb) content. The relationship between Hb, hematocrit (Hct) and blood viscosity was determined in a subgroup of controls and diabetics selected at random. 21 (10.6+/-2.5 years) type 1 diabetic children treated with insulin and 25 healthy controls age 9.6+/-1.7 years were studied. Hb was 13.8+/-0.8 g/dl in normal children vs. 14.3+/-0.9 g/dl in the diabetic group (p<0.05). MAP was 71.4+/-8.2 in the normal vs. 82.9+/-7.2 mmHg in the diabetic group (p<0.001). Glucose was 89.3+/-10.6 vs. 202.4+/-87.4 mg/dl respectively. Diabetics had a positive MAP/Hb correlation (p=0.007), while normals showed a non significant (p=0.2) negative correlation. The blood viscosity/Hb relationship was studied in a subgroup of 8 healthy controls and 8 diabetic type 1 children. There was no significant difference in Hb and Hct between groups. Diabetics showed a trend of increasing blood viscosity (+7%, p=0.15). Normal children compensate for the increase in vascular resistance due to increased blood viscosity (increased Hb and Hct) while diabetic children do not, probably due to endothelial dysfunction.

  19. A method for the direct generation of comprehensive numerical solar building transfer functions

    Energy Technology Data Exchange (ETDEWEB)

    Chen, T.Y. [The Hong Kong Polytechnic University (China). Dept. of Building Services Engineering

    2003-02-01

    This paper describes a method for the direct generation of comprehensive numerical room transfer functions with any derived parameters as output, such as operative temperature or thermal load. Complex conductive, convective and radiant heat transfer processes, or any derived thermal parameters in buildings can be explicitly and precisely described by a generalized thermal network. This allows the s-transfer and z-transfer functions to be directly generated, using semi-symbolic analysis techniques, Cayley's expansion of determinant and Heaviside's expansion theorem. A simple algorithm is developed for finding the roots of the denominator in the inverse transform of the s-transfer functions, which ensures that no single root is missing. The techniques have been applied to generating the transfer functions of a passive solar room with floor heating. The example calculation demonstrates the high efficiency of the computational method. (author)

  20. Measuring Air Temperature in Glazed Ventilated Facades in the Presence of Direct Solar Radiation

    DEFF Research Database (Denmark)

    Kalyanova, Olena; Zanghirella, Fabio; Heiselberg, Per

    2007-01-01

    A distinctive element of buildings with a double glazed façade is naturally or mechanically driven flow in a ventilated cavity. Accurate air temperature measurements in the cavity are crucial to evaluate the dynamic performance of the façade, to predict and control its behavior as a significant...... part of the complete ventilation system. Assessment of necessary cooling/heating loads and of the whole building energy performance will then depend on the accuracy of measured air temperature. The presence of direct solar radiation is an essential element for the façade operation, but it can heavily...... affect measurements of air temperature and may lead to errors of high magnitude using bare thermocouples and even adopting shielding devices. Two different research groups, from Aalborg University and Politecnico di Torino, tested separately various techniques to shield thermocouples from direct...

  1. Experimental performance analysis on a direct-expansion solar-assisted heat pump water heater

    International Nuclear Information System (INIS)

    Li, Y.W.; Wang, R.Z.; Wu, J.Y.; Xu, Y.X.

    2007-01-01

    A direct expansion solar assisted heat pump water heater (DX-SAHPWH) experimental set-up is introduced and analyzed. This DX-SAHPWH system mainly consists of 4.20 m 2 direct expansion type collector/evaporator, R-22 rotary-type hermetic compressor with rated input power 0.75 kW, 150 L water tank with immersed 60 m serpentine copper coil and external balance type thermostatic expansion valve. The experimental research under typical spring climate in Shanghai showed that the COP of the DX-SAHPWH system can reach 6.61 when the average temperature of 150 L water is heated from 13.4 deg. C to 50.5 deg. C in 94 min with average ambient temperature 20.6 deg. C and average solar radiation intensity 955 W/m 2 . And the COP of the DX-SAHPWH system is 3.11 even if at a rainy night with average ambient temperature 17.1 deg. C. The seasonal average value of the COP and the collector efficiency was measured as 5.25 and 1.08, respectively. Through exergy analysis for each component of the DX-SAHPWH system, it can be calculated that the highest exergy loss occurs in the compressor, followed by collector/evaporator, condenser and expansion valve, respectively. Further more, some methods are suggested to improve the thermal performance of each component and the whole DX-SAHPWH system

  2. Experimental analysis of a direct expansion solar assisted heat pump with integral storage tank for domestic water heating under zero solar radiation conditions

    International Nuclear Information System (INIS)

    Fernández-Seara, José; Piñeiro, Carolina; Alberto Dopazo, J.; Fernandes, F.; Sousa, Paulo X.B.

    2012-01-01

    Highlights: ► We analyze a direct expansion solar assisted heat pump under zero solar radiation. ► We determine the COP and equivalent seasonal performance factors (SPFe). ► We determine the main components’ performance under transient operating conditions. ► The Huang and Lee performance evaluation method provides a characteristic COP of 3.23. - Abstract: This paper deals with the experimental evaluation of the performance of a direct expansion solar assisted heat pump water heating (DX-SAHPWH) system working under zero solar radiation conditions at static heating operation mode of the storage tank. The DX-SAHPWH system includes two bare solar collectors as evaporator, a R134a rotary-type hermetic compressor, a thermostatic expansion valve and a helical coil condenser immersed in a 300 L water storage tank. The zero solar radiation and stable ambient air temperature working conditions were established by placing the solar collectors into a climate chamber. The analysis is based on experimental data taken from the DX-SAHPWH provided by the manufacturer and equipped with an appropriate data acquisition system. In the paper, the experimental facility, the data acquisition system and the experimental methodology are described. Performance parameters to evaluate the energy efficiency, such as COP and equivalent seasonal performance factors (SPFe) for the heating period, and the water thermal stratification in the storage tank are defined and obtained from the experimental data. Results from the experimental analysis under transient operating working conditions of the DX-SAHPWH system and its main components are shown and discussed. Lastly, the Huang and Lee DX-SAHPWH performance evaluation method was applied resulting in a characteristic COP of 3.23 for the DX-SAHPWH system evaluated under zero solar radiation condition.

  3. Generación directa de vapor con colectores solares cilindro parabólicos Proyecto DIrect Solar Steam (DISS)

    OpenAIRE

    Zarza Moya, Eduardo

    2003-01-01

    La Generación Directa de Vapor (GDV) en los tubos absorbedores de los colectores solares cilindro parabólicos es considerada la opción tecnológica más atractiva para conseguir una sustancial reducción del coste de la energía térmica producida por este tipo de colector solar. Sin embargo, antes de poder comercializar sistemas solares con GDV e s necesario aclarar todas aquellas cuestiones técnicas que conlleva la existencia de un flujo bifásico circulando por el interior de los tubos absorbedo...

  4. Analysis of direct to diffuse partitioning of global solar irradiance at the radiometric station in Badajoz (Spain)

    Science.gov (United States)

    Sanchez, G.; Cancillo, M. L.; Serrano, A.

    2010-09-01

    This study is aimed at the analysis of the partitioning of global solar irradiance into its direct and diffuse components at the radiometric station in Badajoz (Spain). The detailed knowledge of the solar radiation field is of increasing interest in Southern Europe due to its use as renewable energy. In particular, the knowledge of the solar radiation partitioning into direct and diffuse radiation has become a major demand for the design and suitable orientation of solar panels in solar power plants. In this study the first measurements of solar diffuse irradiance performed in the radiometric station in Badajoz (Spain) are presented and analyzed in the framework of the partitioning of solar global radiation. Thus, solar global and diffuse irradiance were measured at one-minute basis from 23 November 2009 to 31 March 2010. Solar irradiances were measured by two Kipp&Zonen CMP11 pyranometers, using a Kipp&Zonen CM121 shadow ring for the measurements of solar diffuse irradiance. Diffuse measurements were corrected from the solid angle hidden by the ring and direct irradiance was calculated as the difference between global and diffuse measurements. Irradiance was obtained from the pyranomenters by applying calibration coefficients obtained in an inter-comparison campaign performed at INTA/El Arenosillo, in Huelva (Spain), last September 2009. There, calibration coefficients were calculated using as a reference a CMP11 pyranometer which had been previously calibrated by the Physikalisch-Meteorologisches Observatorium Davos/World Radiation Centre in Switzerland. In order to study the partitioning of the solar radiation, the global and diffuse irradiances have been analyzed for three typical different sky conditions: cloud-free, broken clouds and overcast. Particular days within the period of study have been selected by visual inspection. Along with the analysis of the global and diffuse irradiances themselves, ratios of these irradiances to the downward irradiance at the

  5. Model and control scheme for recirculation mode direct steam generation parabolic trough solar power plants

    International Nuclear Information System (INIS)

    Guo, Su; Liu, Deyou; Chen, Xingying; Chu, Yinghao; Xu, Chang; Liu, Qunming; Zhou, Ling

    2017-01-01

    steam generation Technology for Electricity Production and experimental data obtained from the DIrect Solar Steam project.

  6. On Possibility of Direct Asteroid Deflection by Electric Solar Wind Sail

    Science.gov (United States)

    Merikallio, Sini; Janhunen, Pekka

    2010-05-01

    The Electric Solar Wind Sail (E-sail) is a new propulsion method for interplanetary travel which was invented in 2006 and is currently under development. The E-sail uses charged tethers to extract momentum from the solar wind particles to obtain propulsive thrust. According to current estimates, the E-sail is 2-3 orders of magnitude better than traditional propulsion methods (chemical rockets and ion engines) in terms of produced lifetime-integrated impulse per propulsion system mass. Here we analyze the problem of using the E-sail for directly deflecting an Earth-threatening asteroid. The problem then culminates into how to attach the E-sail device to the asteroid. We assess a number of alternative attachment strategies and arrive at a recommendation of using the gravity tractor method because of its workability for a wide variety of asteroid types. We also consider possible techniques to scale up the E-sail force beyond the baseline one Newton level to deal with more imminent or larger asteroid or cometary threats. As a baseline case we consider a 3 million ton asteroid which can be deflected with a baseline 1 N E-sail in 5-10 years. Once developed, the E-sail would appear to provide a safe and reasonably low-cost way of deflecting dangerous asteroids and other heavenly bodies in cases where the collision threat becomes known several years in advance.

  7. Numerical and experimental investigation of direct solar crop dryer for farmers

    Science.gov (United States)

    Kareem, M. W.; Habib, Khairul; Sulaiman, S. A.

    2015-07-01

    This article presents a theoretical and experimental investigation on effects of weather on direct solar crop drying technique. The SIMULINK tool was employed to analyze the energy balance equations of the transient system model. A prototype of the drying system was made and data were collected between the months of June and July in Perak, Malaysia. The contribution of intense sunny days was encouraging despite the wet season, and the wind velocity was dynamic during the period of investigation. However, high percentage of relative humidity was observed. This constitutes a hindrance to efficient drying process. The reported studies were silent on the effect of thick atmospheric moisture content on drying rate of agricultural products in tropic climate. This finding has revealed the mean values of insolation, wind speed, moisturized air, system performance efficiency and chili microscopy image morphology. The predicted and measured results were compared with good agreement.

  8. Direct observations of the charge states of low energy solar particles

    Science.gov (United States)

    Gloeckler, G.; Fan, C. Y.; Hovestadt, D.

    1974-01-01

    The charge states of carbon and oxygen of solar origin have been measured directly in interplanetary space. At 100 keV per nucleon the C(+5)/C(+6) and O(+7)/O(+8) ratios are 1.8 and 1.6, respectively. Abundance ratios of low energy heavy nuclei to He are found which are significantly larger than the corresponding photospheric values. The enhancement of O/He is 35, and both Si/He and Fe/He are overabundant by a factor of 100. To explain these observations a mechanism is proposed which first preferentially accelerates heavy ions and is followed by either storage of these ions in the coronal regions or strong adiabatic deceleration.

  9. Simulation of Solar Heat Pump Dryer Directly Driven by Photovoltaic Panels

    Science.gov (United States)

    Houhou, H.; Yuan, W.; Wang, G.

    2017-05-01

    This paper investigates a new type of solar heat pump dryer directly driven by photovoltaic panels. In order to design this system, a mathematical model has been established describing the whole drying process, including models of key components and phenomena of heat and mass transfer at the product layer and the air. The results of simulation at different drying air temperatures and velocities have been calculated and it indicate that the temperature of drying air is crucial external parameter compared to the velocity, with the increase of drying temperature from 45°C to 55°C, the product moisture content (Kg water/Kg dry product) decreased from 0.75 Kg/Kg to 0.3 Kg/Kg.

  10. Direct battery-driven solar LED lighting using constant-power control

    KAUST Repository

    Huang, Bin-Juine

    2012-11-01

    A direct battery-driven LED lighting technique using constant-power control is proposed in the present study. A system dynamics model of LED luminaire was derived and used in the design of the feedback constant-power control system. The test result has shown that the power of 18. W and 100. W LED luminaires can be controlled accurately with error at 2-5%. A solar LED street lighting system using constant-power and dimming control was designed and built for field test in a remote area. The long-term performance was satisfactory and no any failure since the installation. Since no high-power capacitor is used in the present constant-power control circuit, a longer lifetime is expected. © 2012 Elsevier Ltd.

  11. Fatal Pasteurella haemolytica pneumonia in bighorn sheep after direct contact with clinically normal domestic sheep.

    Science.gov (United States)

    Foreyt, W J

    1989-03-01

    Six Rocky Mountain bighorn sheep were raised in captivity from birth (n = 5) or taken from the wild as a lamb (n = 1). After the bighorn sheep were in captivity for over a year, 6 clinically normal domestic sheep were placed on the 2 ha of pasture on which the bighorn sheep were kept. Nasal swab specimens were obtained from all sheep at the time the domestic sheep were introduced. Pasteurella haemolytica was isolated from swab specimens obtained from 4 of 6 domestic sheep, but not from specimens obtained from the bighorn sheep. All 6 bighorn sheep died of acute hemorrhagic pneumonia after exposure to domestic sheep. Death in the bighorn sheep occurred on days 4, 27, 27, 29, 36, or 71 after initial exposure to domestic sheep. Pasteurella haemolytica was isolated from respiratory tract tissue specimens of all bighorn sheep at the time of death. None of the domestic sheep were clinically ill during the study. At the end of the study, 3 of 6 domestic sheep were euthanatized, and at necropsy, P haemolytica was isolated from 2 of them. The most common serotypes in bighorn and domestic sheep were P haemolytica T-3 and A-2. Other serotypes isolated included P haemolytica A-1, A-9, and A-11 in bighorn sheep and A-1 in domestic sheep. On the basis of results of this study and of other reports, domestic sheep and bighorn sheep should not be managed in proximity to each other because of the potential fatal consequences in bighorn sheep.

  12. Characterisation of a smartphone image sensor response to direct solar 305nm irradiation at high air masses.

    Science.gov (United States)

    Igoe, D P; Amar, A; Parisi, A V; Turner, J

    2017-06-01

    This research reports the first time the sensitivity, properties and response of a smartphone image sensor that has been used to characterise the photobiologically important direct UVB solar irradiances at 305nm in clear sky conditions at high air masses. Solar images taken from Autumn to Spring were analysed using a custom Python script, written to develop and apply an adaptive threshold to mitigate the effects of both noise and hot-pixel aberrations in the images. The images were taken in an unobstructed area, observing from a solar zenith angle as high as 84° (air mass=9.6) to local solar maximum (up to a solar zenith angle of 23°) to fully develop the calibration model in temperatures that varied from 2°C to 24°C. The mean ozone thickness throughout all observations was 281±18 DU (to 2 standard deviations). A Langley Plot was used to confirm that there were constant atmospheric conditions throughout the observations. The quadratic calibration model developed has a strong correlation between the red colour channel from the smartphone with the Microtops measurements of the direct sun 305nm UV, with a coefficient of determination of 0.998 and very low standard errors. Validation of the model verified the robustness of the method and the model, with an average discrepancy of only 5% between smartphone derived and Microtops observed direct solar irradiances at 305nm. The results demonstrate the effectiveness of using the smartphone image sensor as a means to measure photobiologically important solar UVB radiation. The use of ubiquitous portable technologies, such as smartphones and laptop computers to perform data collection and analysis of solar UVB observations is an example of how scientific investigations can be performed by citizen science based individuals and groups, communities and schools. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Extinction of direct solar radiation in Puławy in the years 1969–1989

    International Nuclear Information System (INIS)

    Uscka-Kowalkowska, J.

    2007-01-01

    The paper presents the problem of attenuation of the direct solar radiation in Puławy in the years 1969–1989. The extinction was expressed with the help of the Linke’s turbidity factor counted on the basis of measurements of the direct solar irradiance at the Institute of Soil Science and Plant Cultivation in the years 1969–1989. The turbidity factor was counted and reduced to 2 optical mass of the atmosphere according to the method proposed by Grenier et al. (6). The mean value of the turbidity factor for the atmosphere in the study period was in the class of raised turbidity and equalled 3.41. However, an improvement was noted in the optical conditions of the atmosphere expressed by the decrease of the value of Linke’s turbidity factor during the whole study period. The annual course of the turbidity is typical, i.e. it increases in the warm half-year and decreases in the cold half-year. In the daily course, the mean turbidity of the atmosphere increases with the altitude of the Sun above the horizon. The atmospheric turbidity also depends on the kind of the air masses present. During the study period in Puławy, the lowest value of the atmospheric turbidity occurred in the case of arctic air masses (2.79), while the highest in tropical air (4.05). Polar-continental and polar-maritime air masses are characterised by similar turbidity level of the atmosphere, 3.44 and 3.50, respectively. (author) [pl

  14. Heat transfer analysis and the effect of CuO/Water nanofluid on direct absorption concentrating solar collector

    International Nuclear Information System (INIS)

    Menbari, Amir; Alemrajabi, Ali Akbar; Rezaei, Amin

    2016-01-01

    Highlights: • The effect of CuO/Water on a direct absorption parabolic collector is investigated. • The power-law is used for simulating the turbulent flow into the receiver pipe. • In this collector the solar irradiance is absorbed directly and converted to heat. • Nanofluid as the working fluid improves the thermal efficiency of the collector. - Abstract: Direct absorption solar collectors (DASCs) form a new class of collectors that directly harvest sun beams via a working fluid. They offer several advantages over their conventional surface absorption counterparts such as reduced surface heat loss and increased solar irradiance absorption. The optical and thermo-physical properties of the working fluid may be improved and system efficiency may be enhanced in direct absorption solar collectors (DASCs) by introducing nanoparticles into the base fluid. The present study investigates, both analytically and experimentally, the effects of CuO/Water nanofluid on the efficiency of a direct absorption parabolic trough collector (DAPTC). The theoretical analysis of DAPTC is based on the power-law with the objective of simulating a turbulent flow into the receiver pipe. Comparison of the results obtained from the model and the experimental measurements reveals a good agreement between the two sets of data, indicating that they can be exploited to validate the numerical solution. Moreover, modeling results indicate that the average radial temperature and energy generation terms due to the solar irradiance absorbed and scattered by the nanoparticles decrease with increasing distance from the receiver pipe wall. It is also found that the solar irradiance is absorbed and converted into a significant amount of sensible heat along the length of the receiver pipe. Finally, the results of both the numerical and the experimental investigations of the DAPTC collector show that the thermal efficiency of the system improves as a result of increased nanoparticle volume fraction

  15. Directional and hemispherical solar energy transmittance of single and double glazing

    NARCIS (Netherlands)

    Nijnatten, van P.A.; Hugot-Le Goff, le A; Granqvist, C.-G.; Lampert, C.M.

    1992-01-01

    Solar and visual light transmittance, color appearance, thermal emissivity, and other optical properties of architectural glazing are in general angular dependent. Realistic computation of solar properties, therefore, requires the angular behavior to be known. Determination of these properties for

  16. Numerical simulation of a Linear Fresnel Reflector Concentrator used as direct generator in a Solar-GAX cycle

    Energy Technology Data Exchange (ETDEWEB)

    Velazquez, N.; Sauceda, D.; Beltran, R. [Instituto de Ingenieria, Universidad Autonoma de Baja California, Blvd. Benito Juarez y Calle de la Normal s/n, Mexicali, Baja California 21280 (Mexico); Garcia-Valladares, O. [Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Privada Xochicalco s/n, Temixco, Morelos 62580 (Mexico)

    2010-03-15

    In this work a methodological analysis to design and evaluate the technical feasibility of use a Linear Fresnel Reflector Concentrator (LFRC) as generator in an advanced absorption refrigeration system (Solar-GAX cycle) has been carried out. For this purpose, a detailed one-dimensional numerical simulation of the thermal and fluid-dynamic behavior of a LFRC that solves, in a segregated manner, four subroutines: (a) fluid flow inside the receptor tube, (b) heat transfer in the receptor tube wall, (c) heat transfer in cover tube wall, and (d) solar thermal analysis in the solar concentrator has been developed. The LFRC numerical model has been validated with experimental data obtained from the technical literature; after that, a parametric study for different configurations of design has been carried out in order to obtain the highest solar concentration with the lowest thermal losses, keeping in mind both specific weather conditions and construction restrictions. The numerical result obtained demonstrates that using a LFRC as a direct generator in a Solar-GAX cycle satisfy not only the quantity and quality of the energy demanded by the advanced cooling system, it also allows to obtain higher global efficiencies of the system due to it can be operated in conditions where the maximum performance of the Solar-GAX cycle is obtained without affecting in any significant way the solar collector efficiency. (author)

  17. Numerical simulation of a Linear Fresnel Reflector Concentrator used as direct generator in a Solar-GAX cycle

    International Nuclear Information System (INIS)

    Velazquez, N.; Garcia-Valladares, O.; Sauceda, D.; Beltran, R.

    2010-01-01

    In this work a methodological analysis to design and evaluate the technical feasibility of use a Linear Fresnel Reflector Concentrator (LFRC) as generator in an advanced absorption refrigeration system (Solar-GAX cycle) has been carried out. For this purpose, a detailed one-dimensional numerical simulation of the thermal and fluid-dynamic behavior of a LFRC that solves, in a segregated manner, four subroutines: (a) fluid flow inside the receptor tube, (b) heat transfer in the receptor tube wall, (c) heat transfer in cover tube wall, and (d) solar thermal analysis in the solar concentrator has been developed. The LFRC numerical model has been validated with experimental data obtained from the technical literature; after that, a parametric study for different configurations of design has been carried out in order to obtain the highest solar concentration with the lowest thermal losses, keeping in mind both specific weather conditions and construction restrictions. The numerical result obtained demonstrates that using a LFRC as a direct generator in a Solar-GAX cycle satisfy not only the quantity and quality of the energy demanded by the advanced cooling system, it also allows to obtain higher global efficiencies of the system due to it can be operated in conditions where the maximum performance of the Solar-GAX cycle is obtained without affecting in any significant way the solar collector efficiency.

  18. Assessment of High-Voltage Photovoltaic Technologies for the Design of a Direct Drive Hall Effect Thruster Solar Array

    Science.gov (United States)

    Mikellides, I. G.; Jongeward, G. A.; Schneider, T.; Carruth, M. R.; Peterson, T.; Kerslake, T. W.; Snyder, D.; Ferguson, D.; Hoskins, A.

    2004-01-01

    A three-year program to develop a Direct Drive Hall-Effect Thruster system (D2HET) begun in 2001 as part of the NASA Advanced Cross-Enterprise Technology Development initiative. The system, which is expected to reduce significantly the power processing, complexity, weight, and cost over conventional low-voltage systems, will employ solar arrays that operate at voltages higher than (or equal to) 300 V. The lessons learned from the development of the technology also promise to become a stepping-stone for the production of the next generation of power systems employing high voltage solar arrays. This paper summarizes the results from experiments conducted mainly at the NASA Marshal Space Flight Center with two main solar array technologies. The experiments focused on electron collection and arcing studies, when the solar cells operated at high voltages. The tests utilized small coupons representative of each solar array technology. A hollow cathode was used to emulate parts of the induced environment on the solar arrays, mostly the low-energy charge-exchange plasma (1012-1013 m-3 and 0.5-1 eV). Results and conclusions from modeling of electron collection are also summarized. The observations from the total effort are used to propose a preliminary, new solar array design for 2 kW and 30-40 kW class, deep space missions that may employ a single or a cluster of Hall- Effect thrusters.

  19. Experimental Study of a Novel Direct-Expansion Variable Frequency Finned Solar/Air-Assisted Heat Pump Water Heater

    Directory of Open Access Journals (Sweden)

    Jing Qin

    2018-01-01

    Full Text Available A novel direct expansion variable frequency finned solar/air-assisted heat pump water heater was fabricated and tested in the enthalpy difference lab with a solar simulator. A solar/air source evaporator-collector with an automatic lifting glass cover plate was installed on the system. The system could be operated in three modes, namely, air, solar, and dual modes. The effects of the ambient temperature, solar irradiation, compressor frequency, and operating mode on the performance of this system were studied in this paper. The experimental results show that the ambient temperature, solar irradiation, and operating mode almost have no effect on the energy consumption of the compressor. When the ambient temperature and the solar irradiation were increased, the COP was found to increase with decreasing heating time. Also, when the compressor frequency was increased, an increase in the energy consumption of the compressor and the heat gain of the evaporator were noted with a decrease in the heating time.

  20. On the relationship between cardboard burning in a sunshine recorder and the direct solar irradiance.

    Science.gov (United States)

    Sanchez, A.; Calbó, J.; González, J. A.

    2012-04-01

    Since the end of XIX century, the Campbell-Stokes recorder (CSR) has been the instrument used to measure the insolation (hours of sunshine during per day). Due to the large number of records that exist worldwide (some of them extending over more than 100 years), valuable climatic information can be extracted from them. There are various articles that relate the insolation with the cloudiness and the global solar irradiation (Angstrom-Prescott type formulas). Theoretically, the insolation is defined as the number of hours that direct solar irradiance (DSI) exceeds 120 W/m2, thus corresponding to the total length of the burning in the bands. The width of the burn has not been well studied, so the aim of this research is to relate this width, first with the DSI and then, with other variables. The research was carried out in Girona (NE Spain) for a period extending since February 2011. A CSR from Thies Clima and a pyrheliometer from Kipp&Zonen were used to measure insolation and the direct solar irradiance. Other meteorological variables were also stored for the study. For each band, we made two independent measurements of the width of the burn every 10 minutes: first, we measured directly the width of the perforated portion of the burn; second, we measured the width of the burn after applying a digital image process that increases the contrast of the burn. The burn in a band has a direct relationship with the DSI. Specifically, correlation coefficients of the perforation width and the burning width with DSI were 0.838 and 0.864 respectively. However, we found that there are times when despite of DSI is as high as 400 W/m2 (i.e. much greater than 120 W/m2), there is no burn in the band. Contrarily, sometimes a burn occurs with almost no DSI. Furthermore, a higher DSI does not always correspond to a wider burn of the band. Because of this, we consider that characteristics of band burns must also depend on other meteorological variables (temperature, humidity...). The

  1. Parameter Improved Particle Swarm Optimization Based Direct-Current Vector Control Strategy for Solar PV System

    Directory of Open Access Journals (Sweden)

    NAMMALVAR, P.

    2018-02-01

    Full Text Available This paper projects Parameter Improved Particle Swarm Optimization (PIPSO based direct current vector control technology for the integration of photovoltaic array in an AC micro-grid to enhance the system performance and stability. A photovoltaic system incorporated with AC micro-grid is taken as the pursuit of research study. The test system features two power converters namely, PV side converter which consists of DC-DC boost converter with Perturbation and Observe (P&O MPPT control to reap most extreme power from the PV array, and grid side converter which consists of Grid Side-Voltage Source Converter (GS-VSC with proposed direct current vector control strategy. The gain of the proposed controller is chosen from a set of three values obtained using apriori test and tuned through the PIPSO algorithm so that the Integral of Time multiplied Absolute Error (ITAE between the actual and the desired DC link capacitor voltage reaches a minimum and allows the system to extract maximum power from PV system, whereas the existing d-q control strategy is found to perform slowly to control the DC link voltage under varying solar insolation and load fluctuations. From simulation results, it is evident that the proposed optimal control technique provides robust control and improved efficiency.

  2. A 50-kW Module Power Station of Directly Solar-Pumped Iodine Laser

    Science.gov (United States)

    Choi, S. H.; Lee, J. H.; Meador, W. E.; Conway, E. J.

    1997-01-01

    The conceptual design of a 50 kW Directly Solar-Pumped Iodine Laser (DSPIL) module was developed for a space-based power station which transmits its coherent-beam power to users such as the moon, Martian rovers, or other satellites with large (greater than 25 kW) electric power requirements. Integration of multiple modules would provide an amount of power that exceeds the power of a single module by combining and directing the coherent beams to the user's receiver. The model developed for the DSPIL system conservatively predicts the laser output power (50 kW) that appears much less than the laser output (93 kW) obtained from the gain volume ratio extrapolation of experimental data. The difference in laser outputs may be attributed to reflector configurations adopted in both design and experiment. Even though the photon absorption by multiple reflections in experimental cavity setup was more efficient, the maximum secondary absorption amounts to be only 24.7 percent of the primary. However, the gain volume ratio shows 86 percent more power output than theoretical estimation that is roughly 60 percent more than the contribution by the secondary absorption. Such a difference indicates that the theoretical model adopted in the study underestimates the overall performance of the DSPIL. This fact may tolerate more flexible and radical selection of design parameters than used in this design study. The design achieves an overall specific power of approximately 5 W/kg and total mass of 10 metric tons.

  3. DIRECT OBSERVATION OF SOLAR CORONAL MAGNETIC FIELDS BY VECTOR TOMOGRAPHY OF THE CORONAL EMISSION LINE POLARIZATIONS

    International Nuclear Information System (INIS)

    Kramar, M.; Lin, H.; Tomczyk, S.

    2016-01-01

    We present the first direct “observation” of the global-scale, 3D coronal magnetic fields of Carrington Rotation (CR) Cycle 2112 using vector tomographic inversion techniques. The vector tomographic inversion uses measurements of the Fe xiii 10747 Å Hanle effect polarization signals by the Coronal Multichannel Polarimeter (CoMP) and 3D coronal density and temperature derived from scalar tomographic inversion of Solar Terrestrial Relations Observatory (STEREO)/Extreme Ultraviolet Imager (EUVI) coronal emission lines (CELs) intensity images as inputs to derive a coronal magnetic field model that best reproduces the observed polarization signals. While independent verifications of the vector tomography results cannot be performed, we compared the tomography inverted coronal magnetic fields with those constructed by magnetohydrodynamic (MHD) simulations based on observed photospheric magnetic fields of CR 2112 and 2113. We found that the MHD model for CR 2112 is qualitatively consistent with the tomography inverted result for most of the reconstruction domain except for several regions. Particularly, for one of the most noticeable regions, we found that the MHD simulation for CR 2113 predicted a model that more closely resembles the vector tomography inverted magnetic fields. In another case, our tomographic reconstruction predicted an open magnetic field at a region where a coronal hole can be seen directly from a STEREO-B/EUVI image. We discuss the utilities and limitations of the tomographic inversion technique, and present ideas for future developments

  4. Workshop on Direct Contact Heat Transfer at the Solar Energy Research Institute

    CERN Document Server

    Boehm, R

    1988-01-01

    to increase the use of direct contact processes, the National Science Foundation sup­ ported a workshop on direct contact heat transfer at the Solar Energy Research Insti­ tute in the summer of 1985. We served as organizers for this workshop, which em­ phasized an area of thermal engineering that, in our opinion, has great promise for the future, but has not yet reached the point of wide-spread commercial application. Hence, a summary of the state of knowledge at this point is timely. The workshop had a dual objective: 1. To summarize the current state of knowledge in such a form that industrial practi­ tioners can make use of the available information. 2. To indicate the research and development needed to advance the state-of-the-art, indicating not only what kind of research is needed, but also the industrial poten­ tial that could be realized if the information to be obtained through the proposed research activities were available.

  5. Plasma polyunsaturated fatty acids are directly associated with cognition in overweight children but not in normal weight children.

    Science.gov (United States)

    Haapala, E A; Viitasalo, A; Venäläinen, T; Eloranta, A-M; Ågren, J; Lindi, V; Lakka, T A

    2016-12-01

    Polyunsaturated fatty acids are essential nutrients for the normal development of the brain. We investigated the associations between plasma polyunsaturated fatty acids and cognition in normal weight and overweight children. The study recruited 386 normal weight children and 58 overweight children aged six to eight years and blood samples were drawn after a 12-hour fast. We assessed plasma polyunsaturated fatty acids using gas chromatography, cognition using Raven's Coloured Progressive Matrices, and overweight and obesity using the age-specific and sex-specific cut-offs from the International Obesity Task Force. The data were analysed by linear regression analyses adjusted for age and sex. Higher proportions of eicosapentaenoic acid in plasma triacylglycerols (β = 0.311, p = 0.020, p = 0.029 for interaction) and docosahexaenoic acid in plasma triacylglycerols (β = 0.281, p = 0.038, p = 0.049 for interaction) were both associated with higher Raven's scores in overweight children but not in normal weight children. Higher eicosapentaenoic acid to arachidonic acid ratios in triacylglycerols (β = 0.317, p = 0.019) and phospholipids (β = 0.273, p = 0.046) were directly associated with the Raven's score in overweight children but not in normal weight children. These findings suggest that increasing the consumption of fish and other sources of eicosapentaenoic acid and docosahexaenoic acid may improve cognition among overweight children. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  6. Direct Solar Charging of an Organic-Inorganic, Stable, and Aqueous Alkaline Redox Flow Battery with a Hematite Photoanode.

    Science.gov (United States)

    Wedege, Kristina; Azevedo, João; Khataee, Amirreza; Bentien, Anders; Mendes, Adélio

    2016-06-13

    The intermittent nature of the sunlight and its increasing contribution to electricity generation is fostering the energy storage research. Direct solar charging of an auspicious type of redox flow battery could make solar energy directly and efficiently dispatchable. The first solar aqueous alkaline redox flow battery using low cost and environmentally safe materials is demonstrated. The electrolytes consist of the redox couples ferrocyanide and anthraquinone-2,7-disulphonate in sodium hydroxide solution, yielding a standard cell potential of 0.74 V. Photovoltage enhancement strategies are demonstrated for the ferrocyanide-hematite junction by employing an annealing treatment and growing a layer of a conductive polyaniline polymer on the electrode surface, which decreases electron-hole recombination. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. The NASA POWER SSE: Deriving the Direct Normal Counterpart from the CERES SYN1deg Hourly Global Horizontal Irradiance during Early 2000 to Near Present

    Science.gov (United States)

    Zhang, T.; Stackhouse, P. W., Jr.; Westberg, D. J.

    2017-12-01

    The NASA Prediction of Worldwide Energy Resource (POWER) Surface meteorology and Solar Energy (SSE) provides solar direct normal irradiance (DNI) data as well as a variety of other solar parameters. The currently available DNIs are monthly means on a quasi-equal-area grid system with grid boxes roughly equivalent to 1 degree longitude by 1 degree latitude around the equator from July 1983 to June 2005, and the data were derived from the GEWEX Surface Radiation Budget (SRB) monthly mean global horizontal irradiance (GHI, Release 3) and regression analysis of the Baseline Surface Radiation Network (BSRN) data. To improve the quality of the DNI data and push the temporal coverage of the data to near present, we have applied a modified version of the DIRINDEX global-to-beam model to the GEWEX SRB (Release 3) all-sky and clear-sky 3-hourly GHI data and derived their DNI counterparts for the period from July 1983 to December 2007. The results have been validated against the BSRN data. To further expand the data in time to near present, we are now applying the DIRINDEX model to the Clouds and the Earth's Radiant Energy System (CERES) data. The CERES SYN1deg (Edition 4A) offers hourly all-sky and clear-sky GHIs on a 1 degree longitude by 1 degree latitude grid system from March 2000 to October 2016 as of this writing. Comparisons of the GHIs with their BSRN counterparts show remarkable agreements. Besides the GHIs, the inputs will also include the atmospheric water vapor and surface pressure from the Modern Era Retrospective-Analysis for Research and Applications (MERRA) and the aerosol optical depth from the Max-Planck Institute Climatology (MAC-v1). Based on the performance of the DIRINDEX model with the GEWEX SRB GHI data, we expect at least equally good or even better results. In this paper, we will show the derived hourly, daily, and monthly mean DNIs from the CERES SYN1deg hourly GHIs from March 2000 to October 2016 and how they compare with the BSRN data.

  8. Optimisation of a Kalina cycle for a central receiver solar thermal power plant with direct steam generation

    DEFF Research Database (Denmark)

    Modi, Anish; Haglind, Fredrik

    2014-01-01

    Central receiver solar thermal power plants are regarded as one of the promising ways to generate electricity in near future. They offer the possibility of using high temperatures and pressures to achieve high efficiencies with standard power cycles. A direct steam generation approach can be used...

  9. Carbazole-based copolymers via direct arylation polymerization (DArP) for Suzuki-convergent polymer solar cell performance

    DEFF Research Database (Denmark)

    Gobalasingham, Nemal S.; Ekiz, Seyma; Pankow, Robert M.

    2017-01-01

    Although direct arylation polymerization (DArP) has recently emerged as an alternative to traditional cross-coupling methods like Suzuki polymerization, the evaluation of DArP polymers in practical applications like polymer solar cells (PSCs) is limited. Because even the presence of minute...

  10. Direct synthesis of platelet graphitic-nanofibres as a highly porous counter-electrode in dye-sensitized solar cells.

    Science.gov (United States)

    Hsieh, Chien-Kuo; Tsai, Ming-Chi; Yen, Ming-Yu; Su, Ching-Yuan; Chen, Kuei-Fu; Ma, Chen-Chi M; Chen, Fu-Rong; Tsai, Chuen-Horng

    2012-03-28

    We synthesized platelet graphitic-nanofibres (GNFs) directly onto FTO glass and applied this forest of platelet GNFs as a highly porous structural counter-electrode in dye-sensitized solar cells (DSSCs). We investigated the electrochemical properties of counter-electrodes made from the highly porous structural GNFs and the photoconversion performance of the cells made with these electrodes.

  11. Pros and cons of rotating ground motion records to fault-normal/parallel directions for response history analysis of buildings

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2014-01-01

    According to the regulatory building codes in the United States (e.g., 2010 California Building Code), at least two horizontal ground motion components are required for three-dimensional (3D) response history analysis (RHA) of building structures. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHAs should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here, for the first time, using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak values of engineering demand parameters (EDPs) were computed for rotation angles ranging from 0 through 180° to quantify the difference between peak values of EDPs over all rotation angles and those due to FN/FP direction rotated motions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  12. The direct effect of aerosols on solar radiation over the broader Mediterranean basin

    Directory of Open Access Journals (Sweden)

    C. D. Papadimas

    2012-08-01

    Full Text Available For the first time, the direct radiative effect (DRE of aerosols on solar radiation is computed over the entire Mediterranean basin, one of the most climatically sensitive world regions, using a deterministic spectral radiation transfer model (RTM. The DRE effects on the outgoing shortwave radiation at the top of atmosphere (TOA, DRETOA, on the absorption of solar radiation in the atmospheric column, DREatm, and on the downward and absorbed surface solar radiation (SSR, DREsurf and DREnetsurf, respectively, are computed separately. The model uses input data for the period 2000–2007 for various surface and atmospheric parameters, taken from satellite (International Satellite Cloud Climatology Project, ISCCP-D2, Global Reanalysis projects (National Centers for Environmental Prediction – National Center for Atmospheric Research, NCEP/NCAR, and other global databases. The spectral aerosol optical properties (aerosol optical depth, AOD, asymmetry parameter, gaer and single scattering albedo, ωaer, are taken from the MODerate resolution Imaging Spectroradiometer (MODIS of NASA (National Aeronautics and Space Administration and they are supplemented by the Global Aerosol Data Set (GADS. The model SSR fluxes have been successfully validated against measurements from 80 surface stations of the Global Energy Balance Archive (GEBA covering the period 2000–2007.

    A planetary cooling is found above the Mediterranean on an annual basis (regional mean DRETOA = −2.4 W m−2. Although a planetary cooling is found over most of the region, of up to −7 W m−2, large positive DRETOA values (up to +25 W m−2 are found over North Africa, indicating a strong planetary warming, and a weaker warming over the Alps (+0.5 W m−2. Aerosols are found to increase the absorption of solar radiation in the atmospheric

  13. Detailed partial load investigation of a thermal energy storage concept for solar thermal power plants with direct steam generation

    Science.gov (United States)

    Seitz, M.; Hübner, S.; Johnson, M.

    2016-05-01

    Direct steam generation enables the implementation of a higher steam temperature for parabolic trough concentrated solar power plants. This leads to much better cycle efficiencies and lower electricity generating costs. For a flexible and more economic operation of such a power plant, it is necessary to develop thermal energy storage systems for the extension of the production time of the power plant. In the case of steam as the heat transfer fluid, it is important to use a storage material that uses latent heat for the storage process. This leads to a minimum of exergy losses during the storage process. In the case of a concentrating solar power plant, superheated steam is needed during the discharging process. This steam cannot be superheated by the latent heat storage system. Therefore, a sensible molten salt storage system is used for this task. In contrast to the state-of-the-art thermal energy storages within the concentrating solar power area of application, a storage system for a direct steam generation plant consists of a latent and a sensible storage part. Thus far, no partial load behaviors of sensible and latent heat storage systems have been analyzed in detail. In this work, an optimized fin structure was developed in order to minimize the costs of the latent heat storage. A complete system simulation of the power plant process, including the solar field, power block and sensible and latent heat energy storage calculates the interaction between the solar field, the power block and the thermal energy storage system.

  14. Effect of working fluids on the performance of a novel direct vapor generation solar organic Rankine cycle system

    International Nuclear Information System (INIS)

    Li, Jing; Alvi, Jahan Zeb; Pei, Gang; Ji, Jie; Li, Pengcheng; Fu, Huide

    2016-01-01

    Highlights: • A novel, flexible direct vapor generation solar ORC is proposed. • Technical feasibility of the system is discussed. • Fluid effect on collector efficiency is explored. • The system is more efficient than solar ORC with HTF. - Abstract: A novel solar organic Rankine cycle (ORC) system with direct vapor generation (DVG) is proposed. A heat storage unit is embedded in the ORC to guarantee the stability of power generation. Compared with conventional solar ORCs, the proposed system avoids the secondary heat transfer intermediate and shows good reaction to the fluctuation of solar radiation. The technical feasibility of the system is discussed. Performance is analyzed by using 17 dry and isentropic working fluids. Fluid effects on the efficiencies of ORC, collectors and the whole system are studied. The results indicate that the collector efficiency generally decreases while the ORC and system efficiencies increase with the increment in fluid critical temperature. At evaporation temperature of 120 °C and solar radiation of 800 Wm −2 , the ORC, collector and overall thermal efficiencies of R236fa are 10.59, 56.14 and 5.08% while their values for Benzene are 12.5, 52.58 and 6.57% respectively. The difference between collector efficiencies using R236fa and Benzene gets larger at lower solar radiation. The heat collection is strongly correlated with latent and sensible heat of the working fluid. Among the fluids, R123 exhibits the highest overall performance and seems to be suitable for the proposed system in the short term.

  15. Economic impact of latent heat thermal energy storage systems within direct steam generating solar thermal power plants with parabolic troughs

    International Nuclear Information System (INIS)

    Seitz, M.; Johnson, M.; Hübner, S.

    2017-01-01

    Highlights: • Integration of a latent heat thermal energy storage system into a solar direct steam generation power cycle. • Parametric study of solar field and storage size for determination of the optimal layout. • Evaluation of storage impact on the economic performance of the solar thermal power plant. • Economic comparison of new direct steam generation plant layout with state-of-the-art oil plant layout. - Abstract: One possible way to further reduce levelized costs of electricity of concentrated solar thermal energy is to directly use water/steam as the primary heat transfer fluid within a concentrated collector field. This so-called direct steam generation offers the opportunity of higher operating temperatures and better exergy efficiency. A technical challenge of the direct steam generation technology compared to oil-driven power cycles is a competitive storage technology for heat transfer fluids with a phase change. Latent heat thermal energy storages are suitable for storing heat at a constant temperature and can be used for direct steam generation power plants. The calculation of the economic impact of an economically optimized thermal energy storage system, based on a latent heat thermal energy storage system with phase change material, is the main focus of the presented work. To reach that goal, a thermal energy storage system for a direct steam generation power plant with parabolic troughs in the solar field was thermally designed to determine the boundary conditions. This paper discusses the economic impact of the designed thermal energy storage system based on the levelized costs of electricity results, provided via a wide parametric study. A state-of-the-art power cycle with a primary and a secondary heat transfer fluid and a two-tank thermal energy storage is used as a benchmark technology for electricity generation with solar thermal energy. The benchmark and direct steam generation systems are compared to each other, based respectively

  16. Study of coherent structures of turbulence with large wall-normal gradients in thermophysical properties using direct numerical simulation

    International Nuclear Information System (INIS)

    Reinink, Shawn K.; Yaras, Metin I.

    2015-01-01

    Forced-convection heat transfer in a heated working fluid at a thermodynamic state near its pseudocritical point is poorly predicted by correlations calibrated with data at subcritical temperatures and pressures. This is suggested to be primarily due to the influence of large wall-normal thermophysical property gradients that develop in proximity of the pseudocritical point on the concentration of coherent turbulence structures near the wall. The physical mechanisms dominating this influence remain poorly understood. In the present study, direct numerical simulation is used to study the development of coherent vortical structures within a turbulent spot under the influence of large wall-normal property gradients. A turbulent spot rather than a fully turbulent boundary layer is used for the study, for the coherent structures of turbulence in a spot tend to be in a more organized state which may allow for more effective identification of cause-and-effect relationships. Large wall-normal gradients in thermophysical properties are created by heating the working fluid which is near the pseudocritical thermodynamic state. It is found that during improved heat transfer, wall-normal gradients in density accelerate the growth of the Kelvin-Helmholtz instability mechanism in the shear layer enveloping low-speed streaks, causing it to roll up into hairpin vortices at a faster rate. It is suggested that this occurs by the baroclinic vorticity generation mechanism which accelerates the streamwise grouping of vorticity during shear layer roll-up. The increased roll-up frequency leads to reduced streamwise spacing between hairpin vortices in wave packets. The density gradients also promote the sinuous instability mode in low-speed streaks. The resulting oscillations in the streaks in the streamwise-spanwise plane lead to locally reduced spanwise spacing between hairpin vortices forming over adjacent low-speed streaks. The reduction in streamwise and spanwise spacing between

  17. Advances in solar photoelectro-Fenton: Decolorization and mineralization of the Direct Yellow 4 diazo dye using an autonomous solar pre-pilot plant

    International Nuclear Information System (INIS)

    Garcia-Segura, Sergi; Brillas, Enric

    2014-01-01

    Highlights: • Assessment of an autonomous solar pre-pilot plant for solar photoelectro-Fenton. • Total decolorization and 96-97% mineralization for solutions of Direct Yellow 4 diazo dye at pH 3.0. • More rapid dye decay and mineralization at 0.50 mmol dm −3 Fe 2+ and maximum current of 5.0 A. • 11 aromatics, 22 hydroxylated derivatives and 9 carboxylic acids detected as intermediates. • Release of NH 4 + and SO 4 2− as main inorganic ions. - Abstract: Here, an overview on the advances in solar photoelectro-Fenton (SPEF) is initially presented to show that it is the more potent electrochemical advanced oxidation process based on Fenton's reaction chemistry to remove organic pollutants from waters, due to the synergistic action of generated hydroxyl radicals and solar irradiation. As a novel advance for SPEF, an autonomous solar pre-pilot plant is proposed to make an energetically inexpensive process that can be viable at industrial level. The plant of 10 dm 3 capacity contained a Pt/air-diffusion cell with 90.2 cm 2 electrode area, coupled to a solar compound parabolic collectors (CPCs) photoreactor of 1.57 dm 3 irradiation volume and to a solar photovoltaic panel that provides a maximum average current of 5.0 A. The oxidation ability of this plant was assessed by studying the degradation of Direct Yellow 4 (DY4) diazo dye, which involved the predominant destruction of organics by ·OH formed from Fenton's reaction between H 2 O 2 generated at the cathode and added Fe 2+ , along with the photolysis of Fe(III)-carboxylate complexes with sunlight in the CPCs photoreactor. The effect of Fe 2+ and dye contents as well as current on decolorization rate, substrate decay and mineralization rate was examined. About 96-97% mineralization was rapidly attained using 0.50 mmol dm −3 Fe 2+ and up to 0.32 mmol dm −3 DY4 at 5.0 A. The DY4 decay always obeyed a pseudo-first-order kinetics. Eleven aromatic products, twenty two hydroxylated derivatives

  18. Directly Detecting MeV-Scale Dark Matter Via Solar Reflection.

    Science.gov (United States)

    An, Haipeng; Pospelov, Maxim; Pradler, Josef; Ritz, Adam

    2018-04-06

    If dark matter (DM) particles are lighter than a few   MeV/c^{2} and can scatter off electrons, their interaction within the solar interior results in a considerable hardening of the spectrum of galactic dark matter received on Earth. For a large range of the mass versus cross section parameter space, {m_{e},σ_{e}}, the "reflected" component of the DM flux is far more energetic than the end point of the ambient galactic DM energy distribution, making it detectable with existing DM detectors sensitive to an energy deposition of 10-10^{3}  eV. After numerically simulating the small reflected component of the DM flux, we calculate its subsequent signal due to scattering on detector electrons, deriving new constraints on σ_{e} in the MeV and sub-MeV range using existing data from the XENON10/100, LUX, PandaX-II, and XENON1T experiments, as well as making projections for future low threshold direct detection experiments.

  19. Experimental performance analysis and optimization of a direct expansion solar-assisted heat pump water heater

    International Nuclear Information System (INIS)

    Li, Y.W.; Wang, R.Z.; Wu, J.Y.; Xu, Y.X.

    2007-01-01

    In this study, a direct expansion solar-assisted heat pump water heater (DX-SAHPWH) with rated input power 750 W was tested and analyzed. Through experimental research in spring and thermodynamics analysis about the system performance, some suggestions for the system optimization are proposed. Then, a small-type DX-SAHPWH with rated input power 400 W was built, tested and analyzed. Through exergy analysis for each component of DX-SAHPWH (A) and (B), it can be seen that the highest exergy loss occurs in the compressor and collector/evaporator, followed by the condenser and expansion valve, respectively. Furthermore, some methods are suggested to improve the performance of each component, especially the collector/evaporator. A methodology for the design optimization of the collector/evaporator was introduced and applied. In order to maintain a proper matching between the heat pumping capacity of the compressor and the evaporative capacity of the collector/evaporator under widely varying ambient conditions, the electronic expansion valve and variable frequency compressor are suggested to be utilized for the DX-SAHPWH

  20. Development of a Vsible-Light-Active Film for Direct Solar Energy Storage

    Science.gov (United States)

    Salazar, Audrey

    We conceived of a two-compartment photocatalytic assembly for direct storage of solar energy as chemical potential. Our approach was to maintain reductant and oxidant in separate compartments and develop a visible light (wavelength >400nm) photo-active film to effect an uphill photoreaction between compartments. A proton exchange membrane was included in the assembly to complete the electrical circuit. Towards obtaining a working prototype of the assembly, we developed a freeze-drying method to adhere visible-light photoactive nanoparticles to a self- standing, non-porous and conductive indium tin oxide-polyvinylidene difluoride (ITO-PVDF) support film, developed in-house. We explored the possibility of employing an iron-rich metal oxide as the photocatalytic component of the film and several were explored utilizing the sodium tartrate-assisted photoreduction of Cr(VI) to Cr(III). Although the Fe2O3-coated TiO2 nanoparticles were active for photoreduction, the initial reaction rate was modest and was slowed by substantial deactivation, making it unsuitable as a photo-active material for the composite film. A complete, two-compartment assembly was prepared using cadmium sulfide (CdS) and preliminarily examined for the Cr(VI) probe reaction, however, no catalytic activity was observed. To identify the reason(s) for this observation, further testing of the apparatus and the composite film is required.

  1. Conversion of solar energy into electricity by using duckweed in Direct Photosynthetic Plant Fuel Cell.

    Science.gov (United States)

    Hubenova, Yolina; Mitov, Mario

    2012-10-01

    In the present study we demonstrate for the first time the possibility for conversion of solar energy into electricity on the principles of Direct Photosynthetic Plant Fuel Cell (DPPFC) technology by using aquatic higher plants. Lemna minuta duckweed was grown autotrophically in specially constructed fuel cells under sunlight irradiation and laboratory lighting. Current and power density up to 1.62±0.10 A.m(-2) and 380±19 mW.m(-2), respectively, were achieved under sunlight conditions. The influence of the temperature, light intensity and day/night sequencing on the current generation was investigated. The importance of the light intensity was demonstrated by the higher values of generated current (at permanently connected resistance) during daytime than those through the nights, indicating the participation of light-dependent photosynthetic processes. The obtained DPPFC outputs in the night show the contribution of light-independent reactions (respiration). The electron transfer in the examined DPPFCs is associated with a production of endogenous mediator, secreted by the duckweed. The plants' adaptive response to the applied polarization is also connected with an enhanced metabolism resulting in an increase of the protein and carbohydrate intracellular content. Further investigations aiming at improvement of the DPPFC outputs and elucidation of the electron transfer mechanism are required for practical application. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Directly Detecting MeV-Scale Dark Matter Via Solar Reflection

    Science.gov (United States)

    An, Haipeng; Pospelov, Maxim; Pradler, Josef; Ritz, Adam

    2018-04-01

    If dark matter (DM) particles are lighter than a few MeV /c2 and can scatter off electrons, their interaction within the solar interior results in a considerable hardening of the spectrum of galactic dark matter received on Earth. For a large range of the mass versus cross section parameter space, {me,σe}, the "reflected" component of the DM flux is far more energetic than the end point of the ambient galactic DM energy distribution, making it detectable with existing DM detectors sensitive to an energy deposition of 10 -103 eV . After numerically simulating the small reflected component of the DM flux, we calculate its subsequent signal due to scattering on detector electrons, deriving new constraints on σe in the MeV and sub-MeV range using existing data from the XENON10/100, LUX, PandaX-II, and XENON1T experiments, as well as making projections for future low threshold direct detection experiments.

  3. Simple Moving Voltage Average Incremental Conductance MPPT Technique with Direct Control Method under Nonuniform Solar Irradiance Conditions

    Directory of Open Access Journals (Sweden)

    Amjad Ali

    2015-01-01

    Full Text Available A new simple moving voltage average (SMVA technique with fixed step direct control incremental conductance method is introduced to reduce solar photovoltaic voltage (VPV oscillation under nonuniform solar irradiation conditions. To evaluate and validate the performance of the proposed SMVA method in comparison with the conventional fixed step direct control incremental conductance method under extreme conditions, different scenarios were simulated. Simulation results show that in most cases SMVA gives better results with more stability as compared to traditional fixed step direct control INC with faster tracking system along with reduction in sustained oscillations and possesses fast steady state response and robustness. The steady state oscillations are almost eliminated because of extremely small dP/dV around maximum power (MP, which verify that the proposed method is suitable for standalone PV system under extreme weather conditions not only in terms of bus voltage stability but also in overall system efficiency.

  4. Effects of vernal equinox solar eclipse on temperature and wind direction in Switzerland

    Science.gov (United States)

    Eugster, Werner; Emmel, Carmen; Wolf, Sebastian; Buchmann, Nina; McFadden, Joseph P.; Whiteman, Charles David

    2017-12-01

    The vernal equinox total solar eclipse of 20 March 2015 produced a maximum occultation of 65.8-70.1 % over Switzerland during the morning hours (09:22 to 11:48 CET). Skies were generally clear over the Swiss Alps due to a persistent high-pressure band between the UK and Russia associated with a rather weak pressure gradient over the continent. To assess the effects of penumbral shading on near-surface meteorology across Switzerland, air temperature data measured at 10 min intervals at 184 MeteoSwiss weather stations were used. Wind speed and direction data were available from 165 of these stations. Additionally, six Swiss FluxNet eddy covariance flux (ECF) sites provided turbulent measurements at 20 Hz resolution. During maximum occultation, the temperature drop was up to 5.8 K at a mountain site where cold air can pool in a topographic depression. The bootstrapped average of the maximum temperature drops of all 184 MeteoSwiss sites during the solar eclipse was 1.51 ± 0.02 K (mean ± SE). A detailed comparison with literature values since 1834 showed a temperature decrease of 2.6 ± 1.7 K (average of all reports), with extreme values up to 11 K. On fair weather days under weak larger-scale pressure gradients, local thermo-topographic wind systems develop that are driven by small-scale pressure and temperature gradients. At one ECF site, the penumbral shading delayed the morning transition from down-valley to up-valley wind conditions. At another site, it prevented this transition from occurring at all. Data from the 165 MeteoSwiss sites measuring wind direction did not show a consistent pattern of wind direction response to the passing of the penumbral shadow. These results suggest that the local topographic setting had an important influence on the temperature drop and the wind flow patterns during the eclipse. A significant cyclonic effect of the passing penumbral shadow was found in the elevation range ≈ 1700-2700 m a. s. l., but not at lower

  5. Effects of vernal equinox solar eclipse on temperature and wind direction in Switzerland

    Directory of Open Access Journals (Sweden)

    W. Eugster

    2017-12-01

    Full Text Available The vernal equinox total solar eclipse of 20 March 2015 produced a maximum occultation of 65.8–70.1 % over Switzerland during the morning hours (09:22 to 11:48 CET. Skies were generally clear over the Swiss Alps due to a persistent high-pressure band between the UK and Russia associated with a rather weak pressure gradient over the continent. To assess the effects of penumbral shading on near-surface meteorology across Switzerland, air temperature data measured at 10 min intervals at 184 MeteoSwiss weather stations were used. Wind speed and direction data were available from 165 of these stations. Additionally, six Swiss FluxNet eddy covariance flux (ECF sites provided turbulent measurements at 20 Hz resolution. During maximum occultation, the temperature drop was up to 5.8 K at a mountain site where cold air can pool in a topographic depression. The bootstrapped average of the maximum temperature drops of all 184 MeteoSwiss sites during the solar eclipse was 1.51 ± 0.02 K (mean ± SE. A detailed comparison with literature values since 1834 showed a temperature decrease of 2.6 ± 1.7 K (average of all reports, with extreme values up to 11 K. On fair weather days under weak larger-scale pressure gradients, local thermo-topographic wind systems develop that are driven by small-scale pressure and temperature gradients. At one ECF site, the penumbral shading delayed the morning transition from down-valley to up-valley wind conditions. At another site, it prevented this transition from occurring at all. Data from the 165 MeteoSwiss sites measuring wind direction did not show a consistent pattern of wind direction response to the passing of the penumbral shadow. These results suggest that the local topographic setting had an important influence on the temperature drop and the wind flow patterns during the eclipse. A significant cyclonic effect of the passing penumbral shadow was found in the elevation range

  6. A Nonlinear Autoregressive Exogenous (NARX Neural Network Model for the Prediction of the Daily Direct Solar Radiation

    Directory of Open Access Journals (Sweden)

    Zina Boussaada

    2018-03-01

    Full Text Available The solar photovoltaic (PV energy has an important place among the renewable energy sources. Therefore, several researchers have been interested by its modelling and its prediction, in order to improve the management of the electrical systems which include PV arrays. Among the existing techniques, artificial neural networks have proved their performance in the prediction of the solar radiation. However, the existing neural network models don’t satisfy the requirements of certain specific situations such as the one analyzed in this paper. The aim of this research work is to supply, with electricity, a race sailboat using exclusively renewable sources. The developed solution predicts the direct solar radiation on a horizontal surface. For that, a Nonlinear Autoregressive Exogenous (NARX neural network is used. All the specific conditions of the sailboat operation are taken into account. The results show that the best prediction performance is obtained when the training phase of the neural network is performed periodically.

  7. Solar power conversion system with directionally- and spectrally-selective properties based on a reflective cavity

    Science.gov (United States)

    Boriskina, Svetlana; Kraemer, Daniel; McEnaney, Kenneth; Weinstein, Lee A.; Chen, Gang

    2018-03-13

    Solar power conversion system. The system includes a cavity formed within an enclosure having highly specularly reflecting in the IR spectrum inside walls, the enclosure having an opening to receive solar radiation. An absorber is positioned within the cavity for receiving the solar radiation resulting in heating of the absorber structure. In a preferred embodiment, the system further contains an energy conversion and storage devices thermally-linked to the absorber by heat conduction, convection, far-field or near-field thermal radiation.

  8. Solar-simulated ultraviolet irradiation induces selective influx of CD4+ T lymphocytes in normal human skin

    NARCIS (Netherlands)

    Di Nuzzo, S.; de Rie, M. A.; van der Loos, C. M.; Bos, J. D.; Teunissen, M. B.

    1996-01-01

    The proportion and composition of the human cutaneous CD3+ T lymphocyte population was determined in situ following a single exposure to physiological, erythema-inducing doses of simulated solar radiation, mainly consisting of UV radiation. Biopsies were taken 1, 2 and 7 days after local irradiation

  9. Energy and exergy analysis of the Kalina cycle for use in concentrated solar power plants with direct steam generation

    DEFF Research Database (Denmark)

    Knudsen, Thomas; Clausen, Lasse Røngaard; Haglind, Fredrik

    2014-01-01

    In concentrated solar power plants using direct steam generation, the usage of a thermal storage unit based only on sensible heat may lead to large exergetic losses during charging and discharging, due to a poor matching of the temperature profiles. By the use of the Kalina cycle, in which...... evaporation and condensation takes place over a temperature range, the efficiency of the heat exchange processes can be improved, possibly resulting also in improved overall performance of the system. This paper is aimed at evaluating the prospect of using the Kalina cycle for concentrated solar power plants...... with direct steam generation. The following two scenarios were addressed using energy and exergy analysis: generating power using heat from only the receiver and using only stored heat. For each of these scenarios comparisons were made for mixture concentrations ranging from 0.1 mole fraction of ammonia to 0...

  10. Performance analysis of a Kalina cycle for a central receiver solar thermal power plant with direct steam generation

    International Nuclear Information System (INIS)

    Modi, Anish; Haglind, Fredrik

    2014-01-01

    Solar thermal power plants have attracted increasing interest in the past few years – with respect to both the design of the various plant components, and extending the operation hours by employing different types of storage systems. One approach to improve the overall plant efficiency is to use direct steam generation with water/steam as both the heat transfer fluid in the solar receivers and the cycle working fluid. This enables operating the plant with higher turbine inlet temperatures. Available literature suggests that it is feasible to use ammonia-water mixtures at high temperatures without corroding the equipment by using suitable additives with the mixture. The purpose of the study reported here was to investigate if there is any benefit of using a Kalina cycle for a direct steam generation, central receiver solar thermal power plant with high live steam temperature (450 °C) and pressure (over 100 bar). Thermodynamic performance of the Kalina cycle in terms of the plant exergy efficiency was evaluated and compared with a simple Rankine cycle. The rates of exergy destruction for the different components in the two cycles were also calculated and compared. The results suggest that the simple Rankine cycle exhibits better performance than the Kalina cycle when the heat input is only from the solar receiver. However, when using a two-tank molten-salt storage system as the primary source of heat input, the Kalina cycle showed an advantage over the simple Rankine cycle because of about 33 % reduction in the storage requirement. The solar receiver showed the highest rate of exergy destruction for both the cycles. The rates of exergy destruction in other components of the cycles were found to be highly dependent on the amount of recuperation, and the ammonia mass fraction and pressure at the turbine inlet. - Highlights: •Kalina cycle for a central receiver solar thermal power plant with direct steam generation. •Rankine cycle shows better plant exergy

  11. Direct transformation of solar energy into three-phase current for technical uses

    Energy Technology Data Exchange (ETDEWEB)

    von Hacht, G [Ingenieurbuero Opto-Sensor-Technik, Frankfurt am Main (Germany, F.R.)

    1977-08-01

    The author proposes a method which may increase the 15% efficiency of present solar plants. In principle, the device consists of an optical waveguide tube containing a chain of solar elements. The tube serves as conductive wire for the primary coil of an a.c. or three-phase current transformer. The 50 Hz cycle of the a.c. or three-phase current is generated by rotor or cylindrical diaphragms and/or electronic pilot/thyristor control. The solar energy is focussed axially and/or vertically to the axis of the optical waveguide tube. The light going through the optical waveguide tube makes it possible for solar elements to be equipped with light-sensitive layers on both sides instead of just on one side, as until now. This means a higher efficiency than for conventional solar elements exposed to light only on one side. In addition, the optical waveguide tube is designed in its length as Fabry-Perot resonator. This way, it may also be used as a gas laser. The light generated in this gas laser would multiply the luminous intensity which again acts on the two light-sensitive sides of the solar elements, thus again increasing their efficiency.

  12. Satellite orbits perturbed by direct solar radiation pressure: general expansion of the disturbing function

    International Nuclear Information System (INIS)

    Hughes, S.

    1977-01-01

    An expression is derived for the solar radiation pressure disturbing function on an Earth satellite orbit which takes into account the variation of the solar radiation flux with distance from the Sun's centre and the absorption of radiation by the satellite. This expression is then expanded in terms of the Keplerian elements of the satellite and solar orbits using Kaula's method (Astr. J.; 67:300 (1962)). The Kaula inclination functions are replaced by an equivalent set of modified Allan (Proc. R. Soc. A.; 288:60 (1965)) inclination functions. The resulting expression reduces to the form commonly used in solar radiation pressure perturbation studies (e.g. Aksnes, Cel. Mech.; 13:89 (1976)), when certain terms are neglected. If, as happens quite often in practice, a satellite's orbit is in near-resonance with certain of these neglected terms, these near-resonant terms can cause changes in the satellite's orbital elements comparable to those produced by the largest term in Aksnes's expression. A new expression for the solar radiation pressure disturbing function expansion is suggested for use in future studies of satellite orbits perturbed by solar radiation pressure. (author)

  13. Direct imaging of enhanced current collection on grain boundaries of Cu(In,Ga)Se{sub 2} solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, JunHo, E-mail: jhk@incheon.ac.kr [Department of Physics, Incheon National University, Incheon 406-772 (Korea, Republic of); National Center for Photovoltaics, National Renewable Energy Laboratory (NREL), Golden, Colorado 80401 (United States); Kim, SeongYeon [Department of Physics, Incheon National University, Incheon 406-772 (Korea, Republic of); Jiang, Chun-Sheng; Ramanathan, Kannan; Al-Jassim, Mowafak M. [National Center for Photovoltaics, National Renewable Energy Laboratory (NREL), Golden, Colorado 80401 (United States)

    2014-02-10

    We report on direct imaging of current collection by performing conductive atomic force microscopy (C-AFM) measurement on a complete Cu(In,Ga)Se{sub 2} solar cell. The localized current was imaged by milling away the top conductive layer of the device by repeated C-AFM scans. The result exhibits enhanced photocurrent collection on grain boundaries (GBs) of CIGS films, consistent with the argument for electric-field-assisted carrier collection on the GBs.

  14. Advancing Solar Irradiance Measurement for Climate-Related Studies: Accurate Constraint on Direct Aerosol Radiative Effect (DARE)

    Science.gov (United States)

    Tsay, Si-Chee; Ji, Q. Jack

    2011-01-01

    Earth's climate is driven primarily by solar radiation. As summarized in various IPCC reports, the global average of radiative forcing for different agents and mechanisms, such as aerosols or CO2 doubling, is in the range of a few W/sq m. However, when solar irradiance is measured by broadband radiometers, such as the fleet of Eppley Precision Solar Pyranometers (PSP) and equivalent instrumentation employed worldwide, the measurement uncertainty is larger than 2% (e.g., WMO specification of pyranometer, 2008). Thus, out of the approx. 184 W/sq m (approx.263 W/sq m if cloud-free) surface solar insolation (Trenberth et al. 2009), the measurement uncertainty is greater than +/-3.6 W/sq m, overwhelming the climate change signals. To discern these signals, less than a 1 % measurement uncertainty is required and is currently achievable only by means of a newly developed methodology employing a modified PSP-like pyranometer and an updated calibration equation to account for its thermal effects (li and Tsay, 2010). In this talk, we will show that some auxiliary measurements, such as those from a collocated pyrgeometer or air temperature sensors, can help correct historical datasets. Additionally, we will also demonstrate that a pyrheliometer is not free of the thermal effect; therefore, comparing to a high cost yet still not thermal-effect-free "direct + diffuse" approach in measuring surface solar irradiance, our new method is more economical, and more likely to be suitable for correcting a wide variety of historical datasets. Modeling simulations will be presented that a corrected solar irradiance measurement has a significant impact on aerosol forcing, and thus plays an important role in climate studies.

  15. Experimental study on direct-contact liquid film cooling simulated dense-array solar cells in high concentrating photovoltaic system

    International Nuclear Information System (INIS)

    Wang, Yiping; Shi, Xusheng; Huang, Qunwu; Cui, Yong; Kang, Xue

    2017-01-01

    Highlights: • Direct-contact liquid film cooling dense-array solar cells was first proposed. • Average temperature was controlled well below 80 °C. • The maximum temperature difference was less than 10 °C. • The heat transfer coefficient reached up to 11.91 kW/(m"2·K) under 589X. - Abstract: This paper presented a new method of cooling dense-array solar cells in high concentrating photovoltaic system by direct-contact liquid film, and water was used as working fluid. An electric heating plate was designed to simulate the dense-array solar cells in high concentrating photovoltaic system. The input power of electric heating plate simulated the concentration ratios. By heat transfer experiments, the effect of water temperatures and flow rates on heat transfer performance was investigated. The results indicated that: the average temperature of simulated solar cells was controlled well below 80 °C under water temperature of 30 °C and flow rate of 300 L/h when concentration ratio ranged between 300X and 600X. The maximum temperature difference among temperature measurement points was less than 10 °C, which showed the temperature distribution was well uniform. The heat transfer coefficient reached up to 11.91 kW/(m"2·K) under concentration ratio of 589X. To improve heat transfer performance and obtain low average temperature of dense-array solar cells, lower water temperature and suitable water flow rate are preferred.

  16. Study on direct-contact phase-change liquid immersion cooling dense-array solar cells under high concentration ratios

    International Nuclear Information System (INIS)

    Kang, Xue; Wang, Yiping; Huang, Qunwu; Cui, Yong; Shi, Xusheng; Sun, Yong

    2016-01-01

    Highlights: • Direct-contact phase-change liquid immersion cooling for solar cells was proposed. • A self-regulating system investigated the feasibility in temperature control. • Temperature was well controlled between 87.3 °C and 88.5 °C. • Surface heat transfer coefficient was up to 23.49 kW/(m"2·K) under 398.4×. • A model illustrated the interface function was the main reason to affect light. - Abstract: A new cooling method by directly immersing the solar cells into phase-change liquid was put forward to cool dense-array solar cells in high concentrating photovoltaic system. A self-running system was built to study the feasibility of temperature control and the effect of bubbles generated by ethanol phase change under concentration ratio ranged between 219.8× and 398.4×. The results show that the cooling system is self-regulating without consuming extra energy and ethanol flow rate reaches up to 180.6 kg/(s·m"2) under 398.4×. The temperature of solar cells distributes in the range between 87.3 °C and 88.5 °C, the surface heat transfer coefficient of electric heating plate is up to 23.49 kW/(m"2·K) under 398.4×. The bubble effect on electrical performance of triple-junction solar cells is reported and the results show that I_s_c and P_m_a_x decline 10.2% and 7.3%, respectively. A model based on bubble images illustrates that light loss at the interface between ethanol and bubble is the main reason to cut down the electrical performance.

  17. Use of a solar panel as a directionally sensitive large-area radiation monitor for direct and scattered x-rays and gamma-rays.

    Science.gov (United States)

    Abdul-Majid, S

    1987-01-01

    The characteristics of a 25.4 X 91 cm solar cell panel used as an x-ray and gamma-ray radiation monitor are presented. Applications for monitoring the primary x-ray beam are described at different values of operating currents and voltages as well as for directional dependence of scattered radiation. Other applications in gamma-ray radiography are also given. The detector showed linear response to both x-ray and gamma-ray exposures. The equipment is rigid, easy to use, relatively inexpensive and requires no power supply or any complex electronic equipment.

  18. Experimental validation of a theoretical model for a direct-expansion solar-assisted heat pump applied to heating

    International Nuclear Information System (INIS)

    Moreno-Rodriguez, A.; Garcia-Hernando, N.; González-Gil, A.; Izquierdo, M.

    2013-01-01

    This paper discusses the experimental validation of a theoretical model that determines the operating parameters of a DXSAHP (direct-expansion solar-assisted heat pump) applied to heating. For this application, the model took into account the variable condensing temperature, and it was developed from the following environmental variables: outdoor temperature, solar radiation and wind. The experimental data were obtained from a prototype installed at the University Carlos III, which is located south of Madrid. The prototype uses a solar collector with a total area of 5.6 m 2 , a compressor with a rated capacity of 1100 W, a thermostatic expansion valve and fan-coil units as indoor terminals. The monitoring results were analyzed for several typical days in the climatic zone where the machine was located to understand the equipment's seasonal behavior. The experimental coefficient of the performance varies between 1.9 and 2.7, and the equipment behavior in extreme outdoor conditions has also been known to determine the thermal demand that can be compensated for. - Highlights: • The study aims to present an experimental validation of a theoretical model. • The experimental COP can vary between 1.9 and 2.7 (max. condensation temperature 59 °C). • A “dragging term” relates condensation and evaporation temperature. • The operating parameters respond to the solar radiation. The COP may increase up to 25%

  19. An automatic measuring system for mapping of spectral and angular dependence of direct and diffuse solar radiation; Et automatisk maalesystem for kartlegging av vinkel- og spektralfordeling av direkte og diffus solstraaling

    Energy Technology Data Exchange (ETDEWEB)

    Grandum, Oddbjoern

    1997-12-31

    In optimizing solar systems, it is necessary to know the spectral and angular dependence of the radiation. The general nonlinear character of most solar energy systems accentuates this. This thesis describes a spectroradiometer that will measure both the direct component of the solar radiation and the angular dependence of the diffuse component. Radiation from a selected part of the sky is transported through a movable set of tube sections on to a stationary set of three monochromators with detectors. The beam transport system may effectively be looked upon as a single long tube aimed at a particular spot in the sky. The half value of the effective opening angle is 1.3{sup o} for diffuse radiation and 2.8{sup o} for direct radiation. The whole measurement process is controlled and operated by a PC and normally runs without manual attention. The instrument is built into a caravan. The thesis describes in detail the experimental apparatus, calibration and measurement accuracies. To map the diffuse radiation, one divides the sky into 26 sectors of equal solid angle. A complete measurement cycle is then made at a random point within each sector. These measurements are modelled by fitting to spherical harmonics, enforcing symmetry around the solar direction and the horizontal plane. The direct radiation is measured separately. Also the circumsolar sector is given special treatment. The measurements are routinely checked against global radiation measured in parallel by a standard pyranometer, and direct solar radiation by a pyrheliometer. An extensive improvement programme is being planned for the instrument, including the use of a photomultiplier tube to measure the UV part of the spectrum, a diode array for the 400-1100 nm range, and use of a Ge diode for the 1000-1900 nm range. 78 refs., 90 figs., 31 tabs.

  20. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  1. Aerosol direct effect on solar radiation over the eastern Mediterranean Sea based on AVHRR satellite measurements

    Science.gov (United States)

    Georgakaki, Paraskevi; Papadimas, Christos D.; Hatzianastassiou, Nikos; Fotiadi, Aggeliki; Matsoukas, Christos; Stackhouse, Paul; Kanakidou, Maria; Vardavas, Ilias M.

    2017-04-01

    Despite the improved scientific understanding of the direct effect of aerosols on solar radiation (direct radiative effect, DRE) improvements are necessary, for example regarding the accuracy of the magnitude of estimated DREs and their spatial and temporal variability. This variability cannot be ensured by in-situ surface and airborne measurements, while it is also relatively difficult to capture through satellite observations. This becomes even more difficult when complete spatial coverage of extended areas is required, especially concerning areas that host various aerosol types with variable physico-chemical and optical aerosol properties. Better assessments of aerosol DREs are necessary, relying on aerosol optical properties with high spatial and temporal variation. The present study aims to provide a refined, along these lines, assessment of aerosol DREs over the eastern Mediterranean (EM) Sea, which is a key area for aerosol studies. Daily DREs are computed for 1˚ x1˚ latitude-longitude grids with the FORTH detailed spectral radiation transfer model (RTM) using input data for various atmospheric and surface parameters, such as clouds, water vapor, ozone and surface albedo, taken from the NASA-Langley Global Earth Observing System (GEOS) database. The model spectral aerosol optical depth (AOD), single scattering albedo and asymmetry parameter are taken from the Global Aerosol Data Set and the NOAA Climate Data Record (CDR) version 2 of Advanced Very High resolution Radiometer (AVHRR) AOD dataset which is available over oceans at 0.63 microns and at 0.1˚ x0.1˚ . The aerosol DREs are computed at the surface, the top-of-atmosphere and within the atmosphere, over the period 1985-1995. Preliminary model results for the period 1990-1993 reveal a significant spatial and temporal variability of DREs over the EM Sea, for example larger values over the Aegean and Black Seas, surrounded by land areas with significant anthropogenic aerosol sources, and over the

  2. Prediction of SEP Peak Proton Intensity Based on CME Speed, Direction and Observations of Associated Solar Phenomena

    Science.gov (United States)

    Richardson, I. G.; Mays, M. L.; Thompson, B. J.; Kwon, R.; Frechette, B. P.

    2017-12-01

    We assess whether a formula obtained by Richardson et al. (Solar Phys., 289, 3059, 2014; DOI 10.1007/s11207-014-0524-8) relating the intensity of 14-24 MeV protons in a solar energetic particle event at 1 AU to the solar event location and the speed of the associated coronal mass ejection (CME), may be used to "predict" the intensity of a solar energetic particle event. Starting with a subset of several hundred CMEs in the CCMC/SWRC DONKI real-time database (http://kauai.ccmc.gsfc.nasa.gov/DONKI/) selected without consideration of whether they were associated with SEP events, we first use the CME speed and direction to predict the proton intensity at Earth or the STEREO spacecraft using this formula. Since most of these CMEs were not in fact associated with SEP events, many "false alarms" result. We then examine whether considering other phenomena which may accompany the CMEs, such as the X-ray flare intensity and the properties of type II and type III radio emissions, may help to reduce the false alarm rate. We also use CME parameters calculated from an ellipsoidal shell fit to multi-spacecraft CME shock observations for a smaller number of events to predict the SEP intensity. We calculate skill scores for each case and assess whether the Richardson et al. (2014) formula, using additional observations to reduce the false alarm rate, has any potential as a SEP prediction tool, assuming that the required observations could be acquired sufficiently rapidly following the onset of the related solar event/CME.

  3. All solution processing of ITO-free organic solar cell modules directly on barrier foil

    DEFF Research Database (Denmark)

    Angmo, Dechan; Hösel, Markus; Krebs, Frederik C

    2012-01-01

    In this study, we demonstrate fully solution processed semi-transparent silver electrodes on flexible substrates having a sheet resistance as low as 5Ω/□ and transmittance of ∼30% at 550nm. We demonstrate the use of this electrode as a substitute for ITO in an inverted organic solar cell (OSC...

  4. Characterization of extra-solar planets with direct-imaging techniques

    NARCIS (Netherlands)

    Tinetti, G.; Cash, W.; Glassman, T.; Keller, C.U.; Oakley, P.; Snik, F.; Stam, D.; Turnbull, M.

    2009-01-01

    In order to characterize the physical properties of an extra-solar planet one needs to detect planetary radiation, either visible (VIS) to near-infrared (NIR) reflected starlight or infrared (IR) thermal radiation. Both the reflected and thermal flux depend on the size of the planet, the distance

  5. Transient heat transfer in a directly-irradiated solar chemical reactor for the thermal dissociation of ZnO

    International Nuclear Information System (INIS)

    Mueller, R.; Lipinski, W.; Steinfeld, A.

    2008-01-01

    A numerical and experimental investigation is carried out in a solar thermochemical reactor for the thermal dissociation of ZnO at 2000 K using concentrated solar energy. The reactor consists of a cavity-receiver lined with ZnO particles and directly exposed to high-flux irradiation. A transient heat transfer model is formulated to link the rate of radiation, convection, and conduction heat transfer to the reaction kinetics. The radiosity and Monte Carlo methods are applied to obtain the distribution of net radiative fluxes at the internal surfaces of the reactor cavity and at the surface of the ZnO bed. Validation is accomplished in terms of the calculated and measured transient temperature profiles and chemical reaction rates

  6. Software for determining the direction of movement, shear and normal stresses of a fault under a determined stress state

    Science.gov (United States)

    Álvarez del Castillo, Alejandra; Alaniz-Álvarez, Susana Alicia; Nieto-Samaniego, Angel Francisco; Xu, Shunshan; Ochoa-González, Gil Humberto; Velasquillo-Martínez, Luis Germán

    2017-07-01

    In the oil, gas and geothermal industry, the extraction or the input of fluids induces changes in the stress field of the reservoir, if the in-situ stress state of a fault plane is sufficiently disturbed, a fault may slip and can trigger fluid leakage or the reservoir might fracture and become damaged. The goal of the SSLIPO 1.0 software is to obtain data that can reduce the risk of affecting the stability of wellbores. The input data are the magnitudes of the three principal stresses and their orientation in geographic coordinates. The output data are the slip direction of a fracture in geographic coordinates, and its normal (σn) and shear (τ) stresses resolved on a single or multiple fracture planes. With this information, it is possible to calculate the slip tendency (τ/σn) and the propensity to open a fracture that is inversely proportional to σn. This software could analyze any compressional stress system, even non-Andersonian. An example is given from an oilfield in southern Mexico, in a region that contains fractures formed in three events of deformation. In the example SSLIPO 1.0 was used to determine in which deformation event the oil migrated. SSLIPO 1.0 is an open code application developed in MATLAB. The URL to obtain the source code and to download SSLIPO 1.0 are: http://www.geociencias.unam.mx/ alaniz/main_code.txt, http://www.geociencias.unam.mx/ alaniz/ SSLIPO_pkg.exe.

  7. Direct conversion of light to radio frequency energy. [using photoklystrons for solar power satellites

    Science.gov (United States)

    Freeman, J. W.; Simons, S.

    1981-01-01

    A description is presented of the test results obtained with the latest models of the phototron. The phototron was conceived as a replacement for the high voltage solar cell-high power klystron combination for the solar power satellite concept. Physically, the phototron is a cylindrical evacuated glass tube with a photocathode, two grids, and a reflector electrode in a planar configuration. The phototron can be operated either in a biased mode where a low voltage is used to accelerate the electron beam produced by the photocathode or in an unbiased mode referred to as self-oscillation. The device is easily modulated by light input or voltage to broadcast in AM or FM. The range of operation of the present test model phototrons is from 2 to 200 MHz.

  8. Multidisciplinary research program directed toward utilization of solar energy through bioconversion of renewable resources. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    Finnerty, W. R.

    1976-07-01

    Progress is reported in four research areas of solar bioconversion. The first program deals with the genetic selection of superior trees, physiological basis of vigor, tissue culture, haploid cell lines, and somatic hybridization. The second deals with the physiology of paraquat-induced oleoresin biogenesis. Separate abstracts were prepared for the other two program areas: biochemical basis of paraquat-induced oleoresin production in pines and biochemistry of methanogenesis. (JSR)

  9. Nanocrystalline diamond on Si solar cells for direct photoelectrochemical water splitting

    Czech Academy of Sciences Publication Activity Database

    Ashcheulov, Petr; Kusko, M.; Fendrych, František; Poruba, A.; Taylor, Andrew; Jäger, Aleš; Fekete, Ladislav; Kraus, I.; Kratochvílová, Irena

    2014-01-01

    Roč. 211, č. 10 (2014), s. 2347-2352 ISSN 1862-6300 R&D Projects: GA ČR GA13-31783S; GA MŠk(CZ) LM2011026 EU Projects: European Commission(XE) 238201 - MATCON Institutional support: RVO:68378271 Keywords : boron-doped diamond * solar cell * heterostructure * water splitting Subject RIV: JI - Composite Materials Impact factor: 1.616, year: 2014

  10. Investigating the collector efficiency of silver nanofluids based direct absorption solar collectors

    International Nuclear Information System (INIS)

    Chen, Meijie; He, Yurong; Zhu, Jiaqi; Wen, Dongsheng

    2016-01-01

    Highlights: • An analysis coupled with Radiation transfer, Maxwell and Energy equation is developed. • Plasmonic Au and Ag nanofluids show better photo-thermal conversion properties. • Collector height and particle concentration exist optimum solutions for efficiency. - Abstract: A one-dimensional transient heat transfer analysis was carried out to analyze the effects of the Nanoparticle (NP) volume fraction, collector height, irradiation time, solar flux, and NP material on the collector efficiency. The numerical results were compared with the experimental results obtained by silver nanofluids to validate the model, and good agreement was obtained. The numerical results show that the collector efficiency increases as the collector height and NP volume fraction increase and then reaches a maximum value. An optimum collector height (∼10 mm) and particle concentration (∼0.03%) achieving a collector efficiency of 90% of the maximum efficiency can be obtained under the conditions used in the simulation. However, the collector efficiency decreases as the irradiation time increases owing to the increased heat loss. A high solar flux is desirable to maintain a high efficiency over a wide temperature range, which is beneficial for subsequent energy utilization. The modeling results also show silver and gold nanofluids obtain higher photothermal conversion efficiencies than the titanium dioxide nanofluid because their absorption spectra are similar to the solar radiation spectrum.

  11. Cosmic ray intensity distribution in the vertical direction to solar equator plane

    International Nuclear Information System (INIS)

    Nosaka, Toru; Mori, Satoru; Sagisaka, Shuji.

    1983-01-01

    The data of the annual variation of cosmic ray intensity measured by neutron detectors were used to study the distribution of cosmic ray intensity vertical to the solar equator plane and its long term variation. The data used were obtained at Deep River, Kiel, Kerguelen Island, McMurdo, Ottawa, and Mt. Washington. All data showed annual variation. The patterns and degree of variation obtained in northern and southern hemisphere were similar. The summation dial representation of the annual variation and semi-annual variation of cosmic ray was obtained. The inversion of annual variation in 1958 - 1959 and 1968 - 1969 corresponded to the inversion of polarity of solar pole magnetic field. The semi-annual variation showed a complex behavior. The helio-latitudial distribution of cosmic ray intensity was obtained. The asymmetric distribution in relation to the solar equator was observed in the annual variation. The northward gradient of density in 1955 - 1958 and southward gradient in 1959 - 1968 were seen. (Kato, T.)

  12. Solution for Direct Solar Impingement Problem on Landsat-7 ETM+ Cooler Door During Cooler Outgas in Flight

    Science.gov (United States)

    Choi, Michael K.

    1999-01-01

    There was a thermal anomaly of the Landsat-7 Enhanced Thematic Mapper Plus (ETM+) radiative cooler cold stage during the cooler outgas phase in flight. With the cooler door in the outgas position and the outgas heaters enabled, the cold stage temperature increased to a maximum of 323 K when the spacecraft was in the sunlight, which was warmer than the 316.3 K upper set point of the outgas heater controller on the cold stage. Also, the outgas heater cycled off when the cold stage was warming up to 323 K. A corrective action was taken before the attitude of the spacecraft was changed during the first week in flight. One orbit before the attitude was changed, the outgas heaters were disabled to cool off the cold stage. The cold stage temperature increase was strongly dependent on the spacecraft roll and yaw. It provided evidence that direct solar radiation entered the gap between the cooler door and cooler shroud. There was a concern that the direct solar radiation could cause polymerization of hydrocarbons, which could contaminate the cooler and lead to a thermal short. After outgas with the cooler door in the outgas position for seven days, the cooler door was changed to the fully open position. With the cooler door fully open, the maximum cold stage temperature was 316.3 K when the spacecraft was in the sunlight, and the duty cycle of the outgas heater in the eclipse was the same as that in the sunlight. It provided more evidence that direct solar radiation had entered the gap between the cooler door and cooler shroud. Cooler outgas continued for seven more days, with the cooler door fully open. The corrective actions had prevented overheating of the cold stage and cold focal plane array (CFPA), which could damage these two components. They also minimized the risk of contamination on the cold stage, which could lead to a thermal short.

  13. MoO3 Thickness, Thermal Annealing and Solvent Annealing Effects on Inverted and Direct Polymer Photovoltaic Solar Cells

    Directory of Open Access Journals (Sweden)

    Guillaume Wantz

    2012-11-01

    Full Text Available Several parameters of the fabrication process of inverted polymer bulk heterojunction solar cells based on titanium oxide as an electron selective layer and molybdenum oxide as a hole selective layer were tested in order to achieve efficient organic photovoltaic solar cells. Thermal annealing treatment is a common process to achieve optimum morphology, but it proved to be damageable for the performance of this kind of inverted solar cells. We demonstrate using Auger analysis combined with argon etching that diffusion of species occurs from the MoO3/Ag top layers into the active layer upon thermal annealing. In order to achieve efficient devices, the morphology of the bulk heterojunction was then manipulated using the solvent annealing technique as an alternative to thermal annealing. The influence of the MoO3 thickness was studied on inverted, as well as direct, structure. It appeared that only 1 nm-thick MoO3 is enough to exhibit highly efficient devices (PCE = 3.8% and that increasing the thickness up to 15 nm does not change the device performance. 

  14. Characterization of Cr-O cermet solar selective coatings deposited by using direct-current magnetron sputtering technology

    International Nuclear Information System (INIS)

    Lee, Kil Dong

    2006-01-01

    Cr-O (Cr-CrO) cermet solar selective coatings with a double cermet layer film structure were prepared by using a special direct-current (dc) magnetron sputtering technology. The typical film structure from the surface to the bottom substrate was an Al 2 O 3 anti-reflection layer on a double Cr-O cermet layer on an Al metal infrared reflection layer. The deposited Cr-O cermet solar selective coating had an absorptance of α = 0.93 - 0.95 and an emittance of ε = 0.09 - 0.10(100 .deg. C). The absorption layers of the Cr-O cermet coatings deposited on glass and silicon substrates were identified as being amorphous by using X-ray diffraction (XRD). Atomic force microscopy (AFM) showed that Cr-O cermet layers were very smooth and that their grain sizes were very small. The result of thermal stability test showed that the Cr-O cermet solar selective coating was stable for use at temperatures of under 400 .deg. C.

  15. Assessment of R290 as a possible alternative to R22 in direct expansion solar assisted heat pumps

    Directory of Open Access Journals (Sweden)

    Paradeshi Lokesh

    2017-01-01

    Full Text Available In this paper, the energy performance of a direct expansion solar assisted heat pump has been experimentally assessed with R290 as an alternative to R22 to meet the requirements of Kigali agreement. The experiments have been performed at Calicut climatic conditions (latitude of 11.15° N, longitude of 75.49° E during the winter climates of 2016. The performance parameters such as, compressor power consumption, condenser heating capacity, energy performance ratio, and solar energy input ratio were evaluated for energy performance comparison. The results showed that, R290 has 6.8% higher energy performance ratio when compared to R22, with 11% reduction in compressor power consumption. Moreover, R290 has negligible global warming impact and zero ozone depletion potential when compared to R22. The effect of wind speed, collector area, ambient temperature, and solar insolation on the system performance found to be with an average value of 0.85%, 12%, 2.5%, and 4.5% for the selected refrigerants, respectively.

  16. Utilization of solar energy for direct contact membrane distillation process: An experimental study for desalination of real seawater

    International Nuclear Information System (INIS)

    Palanisami, Nallasamy; He, Ke; Moon, Il Shik

    2014-01-01

    Membrane distillation (MD), a non-isothermal membrane separation process, is based on the phenomenon that pure water in its vapor state can be extracted from aqueous solutions by passing vapor through a hydrophobic microporous membrane when a temperature difference is established across it. We used three commercially available hydrophobic microporous membranes (C02, C07 and C12; based on the pore size 0.2, 0.7 and 1.2 µm respectively) for desalination via direct contact MD (DCMD). The effects of operating parameters on permeation flux were studied. In addition, the desalination of seawater by solar assisted DCMD process was experimentally investigated. First, using solar power only short-term (one day), successful desalination of real seawater was achieved without temperature control under the following conditions: feed inlet temperature 65.0 .deg. C, permeate inlet temperature 25.0 .deg. C, and a flow rate of 2.5 L/min. The developed system also worked well in the long-term (150 days) for seawater desalination using both solar and electric power. Long-term test flux was reduced from 28.48 to only 26.50 L/m 2 hr, indicating system feasibility

  17. Utilization of solar energy for direct contact membrane distillation process: An experimental study for desalination of real seawater

    Energy Technology Data Exchange (ETDEWEB)

    Palanisami, Nallasamy; He, Ke; Moon, Il Shik [Sunchon National University, Suncheon (Korea, Republic of)

    2014-01-15

    Membrane distillation (MD), a non-isothermal membrane separation process, is based on the phenomenon that pure water in its vapor state can be extracted from aqueous solutions by passing vapor through a hydrophobic microporous membrane when a temperature difference is established across it. We used three commercially available hydrophobic microporous membranes (C02, C07 and C12; based on the pore size 0.2, 0.7 and 1.2 µm respectively) for desalination via direct contact MD (DCMD). The effects of operating parameters on permeation flux were studied. In addition, the desalination of seawater by solar assisted DCMD process was experimentally investigated. First, using solar power only short-term (one day), successful desalination of real seawater was achieved without temperature control under the following conditions: feed inlet temperature 65.0 .deg. C, permeate inlet temperature 25.0 .deg. C, and a flow rate of 2.5 L/min. The developed system also worked well in the long-term (150 days) for seawater desalination using both solar and electric power. Long-term test flux was reduced from 28.48 to only 26.50 L/m{sup 2}hr, indicating system feasibility.

  18. Solar reforming of methane in a direct absorption catalytic reactor on a parabolic dish. 2: Modeling and analysis

    Science.gov (United States)

    Skocypec, Russell D.; Hogan, Roy E., Jr.; Muir, James F.

    1991-01-01

    The catalytically enhanced solar absorption receiver (CAESAR) experiment was conducted to determine the thermal, chemical, and mechanical performance of a commercial-scale, dish-mounted, direct catalytic absorption receiver (DCAR) reactor over a range of steady state and transient (cloud) operating conditions. The focus of the experiment is on global performance such as receiver efficiencies and overall methane conversion; it was not intended to provide data for code validation. A numerical model was previously developed to provide guidance in the design of the absorber. The one-dimensional, planar and steady-state model incorporates, the following energy transfer mechanisms: solar and infrared radiation, heterogeneous chemical reaction, conduction in the solid phase, and convection between the fluid and solid phases. A number of upgrades to the model and improved property values are presented here. Model predictions are shown to bound the experimental axial thermocouple data when experimental uncertainties are included. Global predictions are made using a technique in which the incident solar flux distribution is subdivided into flux contour bands. Model predictions for each band are then spatially integrated to provide global predictions such as reactor efficiencies and methane conversions. Global predictions are shown to compare well with experimental data. Reactor predictions for anticipated operating conditions suggest a further decrease in optical density at the front of the absorber inner disk may be beneficial. The need to conduct code-validation experiments is identified as being essential in improving the confidence in the capability to predict large-scale reactor operation.

  19. Exclusion of UV-B radiation from normal solar spectrum on the growth of mung bean and maize

    International Nuclear Information System (INIS)

    Pal, M.; Sharma, A.; Abrol, Y.P.; Sengupta, U.K.

    1997-01-01

    The increase in UV-B radiation due to depletion of the ozone layer has potentially harmful effects on plant growth and performance. The bulk of these studies conducted in growth chambers, greenhouses or in the field use different types of exposure systems which may be responsible for differences in the sensitivity of a crop to UV-B radiation. A field study using selective filters to remove the UV-B portion of the solar spectrum was conducted with mung bean (a dicotyledonous C 3 plant) and maize (a monocotyledonous C 4 plant) to determine the sensitivity of these crop plants to ambient UV-B levels without disturbing the microenvironment. Mung bean was found to be sensitive to ambient UV-B levels in terms of leaf area development, plant height attained and net photosynthesis, while maize was found to be unaffected by ambient UV-B levels (22.8 |GmW cm −2 nm −1 ) found in Delhi, India (28°38′N, 77°13′E). The level of ambient UV-B radiation thus appears to be inhibitory for optimal growth of plants, especially dicotyledonous mung bean. (author)

  20. Direct Observations of Magnetic Flux Rope Formation during a Solar Coronal Mass Ejection

    Science.gov (United States)

    Song, H.; Zhang, J.; Chen, Y.; Cheng, X.

    2014-12-01

    Coronal mass ejections (CMEs) are the most spectacular eruptive phenomena in the solar atmosphere. It is generally accepted that CMEs are results of eruptions of magnetic flux ropes (MFRs). However, a heated debate is on whether MFRs pre-exist before the eruptions or they are formed during the eruptions. Several coronal signatures, e.g., filaments, coronal cavities, sigmoid structures and hot channels (or hot blobs), are proposed as MFRs and observed before the eruption, which support the pre existing MFR scenario. There is almost no reported observation about MFR formation during the eruption. In this presentation, we present an intriguing observation of a solar eruptive event with the Atmospheric Imaging Assembly on board the Solar Dynamic Observatory, which shows a detailed formation process of the MFR during the eruption. The process started with the expansion of a low lying coronal arcade, possibly caused by the flare magnetic reconnection underneath. The newly-formed ascending loops from below further pushed the arcade upward, stretching the surrounding magnetic field. The arcade and stretched magnetic field lines then curved-in just below the arcade vertex, forming an X-point. The field lines near the X-point continued to approach each other and a second magnetic reconnection was induced. It is this high-lying magnetic reconnection that led to the formation and eruption of a hot blob (~ 10 MK), presumably a MFR, producing a CME. We suggest that two spatially-separated magnetic reconnections occurred in this event, responsible for producing the flare and the hot blob (CME), respectively.

  1. DIRECT OBSERVATIONS OF MAGNETIC FLUX ROPE FORMATION DURING A SOLAR CORONAL MASS EJECTION

    International Nuclear Information System (INIS)

    Song, H. Q.; Chen, Y.; Zhang, J.; Cheng, X.

    2014-01-01

    Coronal mass ejections (CMEs) are the most spectacular eruptive phenomena in the solar atmosphere. It is generally accepted that CMEs are the results of eruptions of magnetic flux ropes (MFRs). However, there is heated debate on whether MFRs exist prior to the eruptions or if they are formed during the eruptions. Several coronal signatures, e.g., filaments, coronal cavities, sigmoid structures, and hot channels (or hot blobs), are proposed as MFRs and observed before the eruption, which support the pre-existing MFR scenario. There is almost no reported observation of MFR formation during the eruption. In this Letter, we present an intriguing observation of a solar eruptive event that occurred on 2013 November 21 with the Atmospheric Imaging Assembly on board the Solar Dynamic Observatory, which shows the formation process of the MFR during the eruption in detail. The process began with the expansion of a low-lying coronal arcade, possibly caused by the flare magnetic reconnection underneath. The newly formed ascending loops from below further pushed the arcade upward, stretching the surrounding magnetic field. The arcade and stretched magnetic field lines then curved in just below the arcade vertex, forming an X-point. The field lines near the X-point continued to approach each other and a second magnetic reconnection was induced. It is this high-lying magnetic reconnection that led to the formation and eruption of a hot blob (∼10 MK), presumably an MFR, producing a CME. We suggest that two spatially separated magnetic reconnections occurred in this event, which were responsible for producing the flare and the hot blob (CME)

  2. DIRECT OBSERVATIONS OF MAGNETIC FLUX ROPE FORMATION DURING A SOLAR CORONAL MASS EJECTION

    Energy Technology Data Exchange (ETDEWEB)

    Song, H. Q.; Chen, Y. [Shandong Provincial Key Laboratory of Optical Astronomy and Solar-Terrestrial Environment and Institute of Space Sciences, Shandong University, Weihai, Shandong 264209 (China); Zhang, J. [School of Physics, Astronomy and Computational Sciences, George Mason University, Fairfax, VA 22030 (United States); Cheng, X., E-mail: hqsong@sdu.edu.cn [School of Astronomy and Space Science, Nanjing University, Nanjing, Jiangsu 210093 (China)

    2014-09-10

    Coronal mass ejections (CMEs) are the most spectacular eruptive phenomena in the solar atmosphere. It is generally accepted that CMEs are the results of eruptions of magnetic flux ropes (MFRs). However, there is heated debate on whether MFRs exist prior to the eruptions or if they are formed during the eruptions. Several coronal signatures, e.g., filaments, coronal cavities, sigmoid structures, and hot channels (or hot blobs), are proposed as MFRs and observed before the eruption, which support the pre-existing MFR scenario. There is almost no reported observation of MFR formation during the eruption. In this Letter, we present an intriguing observation of a solar eruptive event that occurred on 2013 November 21 with the Atmospheric Imaging Assembly on board the Solar Dynamic Observatory, which shows the formation process of the MFR during the eruption in detail. The process began with the expansion of a low-lying coronal arcade, possibly caused by the flare magnetic reconnection underneath. The newly formed ascending loops from below further pushed the arcade upward, stretching the surrounding magnetic field. The arcade and stretched magnetic field lines then curved in just below the arcade vertex, forming an X-point. The field lines near the X-point continued to approach each other and a second magnetic reconnection was induced. It is this high-lying magnetic reconnection that led to the formation and eruption of a hot blob (∼10 MK), presumably an MFR, producing a CME. We suggest that two spatially separated magnetic reconnections occurred in this event, which were responsible for producing the flare and the hot blob (CME)

  3. Characterization of extra-solar planets with direct-imaging techniques

    OpenAIRE

    Tinetti, G.; Cash, W.; Glassman, T.; Keller, C.U.; Oakley, P.; Snik, F.; Stam, D.; Turnbull, M.

    2009-01-01

    In order to characterize the physical properties of an extra-solar planet one needs to detect planetary radiation, either visible (VIS) to near-infrared (NIR) reflected starlight or infrared (IR) thermal radiation. Both the reflected and thermal flux depend on the size of the planet, the distance between the planet and the star, the distance between the observer and the planet, and the planet’s phase angle (i.e. the angle between the star and the observer as seen from the planet). Moreover, t...

  4. Rational Design of Molecular Hole-Transporting Materials for Perovskite Solar Cells: Direct versus Inverted Device Configurations.

    Science.gov (United States)

    Grisorio, Roberto; Iacobellis, Rosabianca; Listorti, Andrea; De Marco, Luisa; Cipolla, Maria Pia; Manca, Michele; Rizzo, Aurora; Abate, Antonio; Gigli, Giuseppe; Suranna, Gian Paolo

    2017-07-26

    Due to a still limited understanding of the reasons making 2,2',7,7'-tetrakis(N,N-di-p-methoxyphenylamine)-9,9'-spirobifluorene (Spiro-OMeTAD) the state-of-the-art hole-transporting material (HTM) for emerging photovoltaic applications, the molecular tailoring of organic components for perovskite solar cells (PSCs) lacks in solid design criteria. Charge delocalization in radical cationic states can undoubtedly be considered as one of the essential prerequisites for an HTM, but this aspect has been investigated to a relatively minor extent. In marked contrast with the 3-D structure of Spiro-OMeTAD, truxene-based HTMs Trux1 and Trux2 have been employed for the first time in PSCs fabricated with a direct (n-i-p) or inverted (p-i-n) architecture, exhibiting a peculiar behavior with respect to the referential HTM. Notwithstanding the efficient hole extraction from the perovskite layer exhibited by Trux1 and Trux2 in direct configuration devices, their photovoltaic performances were detrimentally affected by their poor hole transport. Conversely, an outstanding improvement of the photovoltaic performances in dopant-free inverted configuration devices compared to Spiro-OMeTAD was recorded, ascribable to the use of thinner HTM layers. The rationalization of the photovoltaic performances exhibited by different configuration devices discussed in this paper can provide new and unexpected prospects for engineering the interface between the active layer of perovskite-based solar cells and the hole transporters.

  5. Adaption of an array spectroradiometer for total ozone column retrieval using direct solar irradiance measurements in the UV spectral range

    Science.gov (United States)

    Zuber, Ralf; Sperfeld, Peter; Riechelmann, Stefan; Nevas, Saulius; Sildoja, Meelis; Seckmeyer, Gunther

    2018-04-01

    A compact array spectroradiometer that enables precise and robust measurements of solar UV spectral direct irradiance is presented. We show that this instrument can retrieve total ozone column (TOC) accurately. The internal stray light, which is often the limiting factor for measurements in the UV spectral range and increases the uncertainty for TOC analysis, is physically reduced so that no other stray-light reduction methods, such as mathematical corrections, are necessary. The instrument has been extensively characterised at the Physikalisch-Technische Bundesanstalt (PTB) in Germany. During an international total ozone measurement intercomparison at the Izaña Atmospheric Observatory in Tenerife, the high-quality applicability of the instrument was verified with measurements of the direct solar irradiance and subsequent TOC evaluations based on the spectral data measured between 12 and 30 September 2016. The results showed deviations of the TOC of less than 1.5 % from most other instruments in most situations and not exceeding 3 % from established TOC measurement systems such as Dobson or Brewer.

  6. Automatic control of plants of direct steam generation with cylinder-parabolic solar collectors; Control automatico de plantas de generacion directa de vapor con colectores solares cilindro-parabolicos

    Energy Technology Data Exchange (ETDEWEB)

    Valenzuela Gutierrez, L.

    2008-07-01

    The main objective of this dissertation has been the contributions to the operation in automatic mode of a new generation of direct steam generation solar plants with parabolic-trough collectors. The dissertation starts introducing the parabolic-trough collectors solar thermal technology for the generation of process steam or steam for a Rankine cycle in the case of power generation generation, which is currently the most developed and commercialized technology. Presently, the parabolic-trough collectors technology is based on the configuration known as heat-exchanger system, based in the use of a heat transfer fluid in the solar field which is heated during the recirculation through the absorber tubes of the solar collectors, transferring later on the that thermal energy to a heat-exchanger for steam generation. Direct steam generation in the absorber tubes has always been shown as an ideal pathway to reduce generation cost by 15% and increase conversion efficiency by 20% (DISS, 1999). (Author)

  7. Solar Energy Perspectives In Egypt

    International Nuclear Information System (INIS)

    Comsan, M.N.H.

    2010-01-01

    Egypt belongs to the global sun-belt. The country is in advantageous position with solar energy. In 1991 solar atlas for Egypt was issued indicating that the country enjoys 2900-3200 hours of sunshine annually with annual direct normal energy density 1970-3200 kWh/m2 and technical solar-thermal electricity generating potential of 73.6 Peta watt hour (PWh). Egypt was among the first countries to utilize solar energy. In 1910, a practical industrial scale solar system engine was built at Maadi south to Cairo using solar thermal parabolic collectors. The engine was used to produce steam which drove a series of large water pumps for irrigation. Nowadays utilization of solar energy includes use of photovoltaic cells, solar water heating and solar thermal power. Use of solar thermal technology may include both electricity generation and water desalination, which is advantageous for Egypt taking in consideration its shortage in water supply. The article discusses perspectives of solar energy in Egypt and developmental trends till 2050

  8. Measurement of solar radiation at the Earth's surface

    Science.gov (United States)

    Bartman, F. L.

    1982-01-01

    The characteristics of solar energy arriving at the surface of the Earth are defined and the history of solar measurements in the United States presented. Radiation and meteorological measurements being made at solar energy meteorological research and training sites and calibration procedures used there are outlined. Data illustrating the annual variation in daily solar radiation at Ann Arbor, Michigan and the diurnal variation in radiation at Albuquerque, New Mexico are presented. Direct normal solar radiation received at Albuquerque is contrasted with that received at Maynard, Massachusetts. Average measured global radiation for a period of one year for four locations under clear skies, 50% cloud cover, and 100% cloud cover is given and compared with the solar radiation at the top of the atmosphere. The May distribution of mean daily direct solar radiation and mean daily global solar radiation over the United States is presented. The effects of turbidity on the direct and circumsolar radiation are shown.

  9. Daytime relapse of the mean radiant temperature based on the six-directional method under unobstructed solar radiation.

    Science.gov (United States)

    Kántor, Noémi; Lin, Tzu-Ping; Matzarakis, Andreas

    2014-09-01

    This study contributes to the knowledge about the capabilities of the popular "six-directional method" describing the radiation fields outdoors. In Taiwan, measurements were carried out with three orthogonally placed net radiometers to determine the mean radiant temperature (T(mrt)). The short- and long-wave radiation flux densities from the six perpendicular directions were recorded in the daylight hours of 12 days. During unobstructed direct irradiation, a specific daytime relapse was found in the temporal course of the T(mrt) values referring to the reference shapes of a standing man and also of a sphere. This relapse can be related to the short-wave fluxes reaching the body from the lateral directions. Through deeper analysis, an instrumental shortcoming of the six-directional technique was discovered. The pyranometer pairs of the same net radiometer have a 10-15-min long "blind spot" when the sun beams are nearly perpendicular to them. The blind-spot period is supposed to be shorter with steeper solar azimuth curve on the daylight period. This means that the locations with lower geographical latitude, and the summertime measurements, are affected less by this instrumental problem. A methodological shortcoming of the six-directional technique was also demonstrated. Namely, the sum of the short-wave flux densities from the lateral directions is sensitive to the orientation of the radiometers, and therefore by deviating from the original directions, the T(mrt) decrease on clear sunny days will occur in different times and will be different in extent.

  10. Lyman-alpha detector designed for rocket measurements of the direct solar radiation at 121.5 nm

    International Nuclear Information System (INIS)

    Guineva, V.; Tashev, V.; Witt, G.; Gumbel, J.; Khaplanov, M.

    2007-01-01

    Rocket measurements of the direct Lyman-alpha radiation penetrating in the atmosphere were planned during the HotPay I rocket experiment, June 2006, Project ASLAF (Attenuation of the Solar Lyman-Alpha Flux), Andoya Rocket Range (ARR), Norway. The basic goal of ASLAF project was the study of the processes in the summer mesosphere and thermosphere (up to 110 km), at high latitudes using the Lyman-alpha measurements. The resonance transition 2 P- 2 S of the atomic hydrogen (Lyman-alpha emission) is the strongest and most conspicuous feature in the solar EUV spectrum. Due to the favourable circumstance, that the Lyman-alpha wavelength (121.5 nm) coincides with a minimum of the O 2 absorption spectrum, the direct Lyman-alpha radiation penetrates well in the mesosphere. The Lyman-alpha radiation is the basic agent of the NO molecules ionization, thus generating the ionospheric D-layer, and of the water vapour photolysis, being one of the main H 2 O loss processes. The Lyman-alpha radiation transfer depends on the resonance scattering from the hydrogen atoms in the atmosphere and on the O 2 absorption. Since the Lyman-alpha extinction in the atmosphere is a measure for the column density of the oxygen molecules, the atmospheric temperature profile can be calculated thereof. The detector of solar Lyman-alpha radiation was manufactured in the Stara Zagora Department of the Solar-Terrestrial Influences Laboratory (STIL). Its basic part is an ionization chamber, filled in with NO. A 60 V power supply is applied to the chamber. The produced photoelectric current from the sensor is fed to a 2-channels amplifier, providing an analogue signal. The characteristics of the Lyman-alpha detector were studied. It passed successfully all tests and the results showed that the instrument could be used in rocket experiments to measure the Lyman-alpha flux. From the measurements of the detector, the Lyman-alpha vertical profile can be obtained. The forthcoming scientific data analysis will

  11. Energy performance of water hybrid PV/T collectors applied to combisystems of Direct Solar Floor type

    Energy Technology Data Exchange (ETDEWEB)

    Fraisse, G.; Johannes, K. [Laboratoire Optimisation de la Conception et Ingenierie de l' Environnement, Ecole Superieure d' Ingenieurs de Chambery, Campus Scientifique Savoie Technolac, 73376 Le Bourget du Lac Cedex (France); Menezo, C. [Centre de Thermique de Lyon, Domaine Scientifique de La Doua, Bat. Freyssinet, 20, Avenue A. Einstein, 69621 Villeurbanne Cedex (France)

    2007-11-15

    The integration of photovoltaic (PV) modules in buildings allows one to consider a multifunctional frame and then to reduce the cost by substitution of components. In order to limit the rise of the cell operating temperature, a photovoltaics/thermal (PV/T) collector combines a solar water heating collector and PV cells. The recovered heat energy can be used for heating systems and domestic hot water. A combination with a Direct Solar Floor is studied. Its low operating temperature level is appropriate for the operating conditions of the mono- or poly-crystalline photovoltaic modules which are selected in that study. However, for a system including a glass covered collector and localised in Macon area in France, we show that the annual photovoltaic cell efficiency is 6.8% which represents a decrease of 28% in comparison with a conventional non-integrated PV module of 9.4% annual efficiency. This is obviously due to a temperature increase related to the cover. On the other hand, we show that without a glass cover, the efficiency is 10% which is 6% better than a standard module due to the cooling effect. Moreover, in the case of a glazed PV/T collector with a conventional control system for Direct Solar Floor, the maximum temperature reached at the level of the PV modules is higher than 100{sup o}C. This is due to the oversize of the collectors during the summer when the heating needs are null, i.e. without a heated swimming pool for example. This temperature level does not allow the use of EVA resin (ethylene vinyl acetate) in PV modules due to strong risks of degradation. The current solution consists of using amorphous cells or, if we do not enhance the thermal production, uncovered PV/T collector. Further research led to water hybrid PV/T solar collectors as a one-piece component, both reliable and efficient, and including the thermal absorber, the heat exchanger and the photovoltaic functions. (author)

  12. Direct Current Sputter Epitaxy of Heavily Doped p+ Layer for Monocrystalline Si Solar Cells

    Directory of Open Access Journals (Sweden)

    Wenchang Yeh

    2017-01-01

    Full Text Available Sputter epitaxy of p+ layer for fabrication of Si solar cells (SCs was demonstrated. Hall carrier concentration of p+ layer was 2.6 × 1020 cm−3 owing to cosputtering of B with Si at low temperature, which had enabled heavy and shallow p+ dope layer. p+nn+ SCs were fabricated and influence of p+ and n+ layers was investigated. Internal quantum efficiency (IQE of p+nn+ SCs was 95% at visible light and was larger than 60% at ultraviolet (UV light when the p+ layer was thinner than 30 nm. At near infrared (NIR, extra increment on IQE was achieved by rear n+ back surface field (BSF layer with a thickness thinner than 100 nm.

  13. The Search for Surviving Direct Samples of Early Solar System Water

    Science.gov (United States)

    Zolensky, Michael

    2016-01-01

    We have become increasingly aware of the fundamental importance of water, and aqueous alteration, on primitive solar-system bodies. All classes of astromaterials studied show some degree of interaction with aqueous fluids. Nevertheless, we are still lacking fundamental information such as the location and timing of the aqueous alteration and the detailed nature of the aqueous fluids. Halite crystals in two meteorite regolith breccias were found to contain aqueous fluid inclusions (brines) trapped approx. 4.5 BYBP. Heating/freezing studies of the aqueous fluid inclusions in these halites demonstrated that they were trapped near 25 C. The initial results of our O and H isotopic measurements on these brine inclusions can be explained by a simple model mixing asteroidal and cometary water. We have been analyzing solids and organics trapped alongside the brines in the halites by FTIR, C-XANES, SXRD and Raman, as clues to the origin of the water. The organics show thermal effects that span the entire range witnessed by organics in all chondrite types. Since we identified water-soluble aromatics, including partially halogenated methanol, in some of the halite, we suspected amino acids were also present, but have thus far found that levels of amino acids were undetectable (which is very interesting). We have also been locating aqueous fluid inclusions in other astromaterials, principally carbonates in CI and CM chondrites. Although we have advanced slowly towards detailed analysis of these ancient brines, since they require techniques right at or just beyond current analytical capabilities, their eventual full characterization will completely open the window onto the origin and activity of early solar system water.

  14. An experimental investigation of a novel design air humidifier using direct solar thermal heating

    International Nuclear Information System (INIS)

    Abd-ur-Rehman, Hafiz M.; Al-Sulaiman, Fahad A.

    2016-01-01

    Highlights: • A novel solar driven multi-stage bubble column humidifier is developed and tested. • Single stage, two stage, and three stage configuration were tested. • Average day round absolute humidity is increased by 9% for 2 stage configuration. • Average day round absolute humidity is increased by 23% for 3 stage configuration. • Air absolute humidity increases up to 26% with the integration of Fresnel lens. - Abstract: In this study, a novel solar heated multi-stage bubble column humidifier is designed and tested. The overall objective of this work is to investigate the main operating parameters of the new humidifier. The study addresses the significance of the perforated plate geometric features, optimum balance of air superficial velocity and water column height, and the influence of inlet water temperature and inlet air relative humidity on the performance of the humidifier. The day round performance of the humidifier is investigated in single stage, two stage, and three stage configuration, in which each configuration was tested with and without the integration of the Fresnel lens. Findings show that the average day round absolute humidity, without Fresnel lens, increased up to 9% for the two stage configuration and 23% for the three stage configuration as compared to the single stage configuration of the humidifier. The integration of the Fresnel lens further increased the absolute humidity up to 25% as compared to the results obtained without the integration of the Fresnel lens under the same prevailing conditions, which is significant. Moreover, the current humidifier shows a higher humidification efficiency in the climatic conditions that have a lower inlet air relative humidity. Furthermore, the finding demonstrates that the newly developed multi-stage bubble column humidifier has better performance as compared to the conventional single stage bubble column humidifier. The findings from this study are of pivotal importance to understand

  15. For a fistful of dollars. Increasingly, solar plant operators are marketing their power directly, at the expense of the public; Fuer eine Handvoll Dollar. Immer mehr Anlagenbetreiber verkaufen ihren Solarstrom direct - auf Kosten der Allgemeinheit

    Energy Technology Data Exchange (ETDEWEB)

    Podewils, Christoph

    2012-04-15

    Since 1 January 2012, the German Renewables Act permits direct marketing of solar power. Some new organizations have been founded that provide better profits for plant owners than the former reimbursement rates. Plant owners are opting for direct marketing increasingly often, but it is only possible with power in the range of a few hundred kW.

  16. The roles of direct input of energy from the solar wind and unloading of stored magnetotail energy in driving magnetospheric substorms

    Science.gov (United States)

    Rostoker, G.; Akasofu, S. I.; Baumjohann, W.; Kamide, Y.; Mcpherron, R. L.

    1987-01-01

    The contributions to the substorm expansive phase of direct energy input from the solar wind and from energy stored in the magnetotail which is released in an unpredictable manner are considered. Two physical processes for the dispensation of the energy input from the solar wind are identified: (1) a driven process in which energy supplied from the solar wind is directly dissipated in the ionosphere; and (2) a loading-unloading process in which energy from the solar wind is first stored in the magnetotail and then is suddenly released to be deposited in the ionosphere. The pattern of substorm development in response to changes in the interplanetary medium has been elucidated for a canonical isolated substorm.

  17. Experimental evaluation of a direct air-cooled lithium bromide-water absorption prototype for solar air conditioning

    International Nuclear Information System (INIS)

    Gonzalez-Gil, A.; Izquierdo, M.; Marcos, J.D.; Palacios, E.

    2011-01-01

    A new direct air-cooled single-effect LiBr-H 2 O absorption prototype is described and proposed for use in solar cooling. As distinguishing aspects, it presents: an adiabatic absorber using flat-fan sheets; an air-cooling system that directly refrigerates both the condenser and the absorber and; the possibility of being operated also as a double-effect unit. A solar facility comprising a 48 m 2 field of flat-plate collectors was used to test the single-effect operation mode of the prototype. Results from an experimental campaign carried out in Madrid during summer 2010 are shown and operation parameters corresponding to two typical summer days are detailed. The prototype worked efficiently, with COP values around 0.6. Cooling power varied from 2 kW to 3.8 kW, which represented about 85% of the prototype's nominal capacity. Chilled water temperatures mostly ranged between 14 o C and 16 o C, although the lowest measured value was of 12.8 o C. Condensation and absorption temperatures were under 50 o C and 46 o C, respectively, even with outdoor temperatures of 40 o C. Driving water temperature ranged between 85 o C and 110 o C. As a mean, the system was able to meet 65% of the cooling demand corresponding to a room of 40 m 2 . No signs of crystallization were observed during about a hundred hours of operation. - Highlights: → A novel direct air-cooled single-effect absorption prototype is described. → Feasibility of air-cooled technology for LiBr-H 2 O absorption cooling is proved. → An adiabatic absorber using flat-fan sheets avoids crystallization of the solution. → A field of flat-plate collectors powers the chiller at temperatures from 85 to 110 o C. → The prototype works with thermal COP about 0.6.

  18. Operating conditions of an open and direct solar thermal Brayton cycle with optimised cavity receiver and recuperator

    International Nuclear Information System (INIS)

    Le Roux, W.G.; Bello-Ochende, T.; Meyer, J.P.

    2011-01-01

    The small-scale open and direct solar thermal Brayton cycle with recuperator has several advantages, including low cost, low operation and maintenance costs and it is highly recommended. The main disadvantages of this cycle are the pressure losses in the recuperator and receiver, turbomachine efficiencies and recuperator effectiveness, which limit the net power output of such a system. The irreversibilities of the solar thermal Brayton cycle are mainly due to heat transfer across a finite temperature difference and fluid friction. In this paper, thermodynamic optimisation is applied to concentrate on these disadvantages in order to optimise the receiver and recuperator and to maximise the net power output of the system at various steady-state conditions, limited to various constraints. The effects of wind, receiver inclination, rim angle, atmospheric temperature and pressure, recuperator height, solar irradiance and concentration ratio on the optimum geometries and performance were investigated. The dynamic trajectory optimisation method was applied. Operating points of a standard micro-turbine operating at its highest compressor efficiency and a parabolic dish concentrator diameter of 16 m were considered. The optimum geometries, minimum irreversibility rates and maximum receiver surface temperatures of the optimised systems are shown. For an environment with specific conditions and constraints, there exists an optimum receiver and recuperator geometry so that the system produces maximum net power output. -- Highlights: → Optimum geometries exist such that the system produces maximum net power output. → Optimum operating conditions are shown. → Minimum irreversibility rates and minimum entropy generation rates are shown. → Net power output was described in terms of total entropy generation rate. → Effects such as wind, recuperator height and irradiance were investigated.

  19. MODELING OF DIRECT SOLAR RADIATION IN A COMPOUND PARABOLIC COLLECTOR (CPC WITH THE RAY TRACING TECHNIQUE

    Directory of Open Access Journals (Sweden)

    JOSÉ A. COLINA MÁRQUEZ

    2010-01-01

    Full Text Available El colector parabólico compuesto (CPC es una tecnología ampliamente usada en aplicaciones fotoquímicas, como las reacciones fotocatalíticas. Para propósitos cinéticos en esta clase de reacciones, se debe conocer la distribución de la radiación ya que la velocidad de reacción depende la absorción de fotones. En el presente trabajo desarrolló un modelo matemático que permitió simular el fenómeno de reflexión de la radiación solar directa en un CPC. Las ecuaciones se evaluaron usando geometría analítica y cálculo vectorial, primero para calcular las coordenadas cartesianas de la superficie reflectiva. Luego estos puntos se usaron para calcular las trayectorias de los rayos incidentes y reflejados en cualquier instante. La radiación incidente en el receptor se graficó independientemente, mostrando la distribución de la energía directa que llega directamente al absorbedor. La longitud de la involuta también se calculó a partir de estos datos, los cuales pueden resultar muy útiles para su construcción. Los resultados obtenidos a partir de las simulaciones muestran que la distribución de la energía incidente en la superficie del absorbedor depende de la reflectividad de la superficie del CPC. La energía incidente es mayor en la parte superior que en la inferior del absorbedor, y son más convenientes valores altos de reflectividad para distribuciones de energía más uniformes. Este modelo matemático puede ser una primera aproximación para modelos más complejos de absorción de fotones que incluyan radiación solar directa en aplicaciones fotoquímicas o fototérmicas.

  20. Device Strategies Directed to Improving the Efficiency of Solution-Processed Organic Solar Cells

    KAUST Repository

    Liang, Ru-Ze

    2018-04-18

    In the last decade, organic photovoltaics (OPVs) have been attracting much attention for their low cost, and feasibility of mass production in large-area modules. Reported power conversion efficiencies (PCE) of organic solar cells have reached more than 10%. These promising PCEs can be realized by uncovering important principles: (1) rational molecular design, (2) matching of the material energy level, (3) favorable morphology of donor-acceptor (D/A) network, (4) higher carrier mobilities, and (5) suppression of charge recombination within the bulk heterojunction (BHJ). Though these key properties are frequently stated, the relationships between these principles remain unclear, which motivates us to fill these gaps. In the beginning, we show that changing the sequence of donor and acceptor units of the benzodithiophene-core (BDT) SM donors critically impacts molecular packing and charge transport in BHJ solar cells. Moreover, we find out that by adding small amount of the external solvent additive, the domain size of the SMFQ1 become relatively smaller, resulting in the FF enhancement of ~70% and thus pushing PCE to >6.5%. To further improve the device performance, we utilize another technique of device optimization: Solvent Vapor Annealing (SVA). Compared with solvent additive, the SVA creates a solvent-saturated environment for SMs to re-arrange and crystalize, leading to PCE of >8%, with nearly-free bimolecular recombination. When the systems are shifted from fullerene acceptors to nonfullerene acceptors, using solvent additives in indacenodithiophene-core (IDT) systems significantly reduces the domain size from >500nm to <50nm and also allows the SM donors to orderly packed, rising the PCE from <1% to 4.5%. Furthermore in a similar IDT-based system, it shows unexpectedly high VOC and low energy loss, and high PCE > 6% can be reached by employing the dimethyl disulfide (DMDS) as the SVA solvent to re-organize the morphology from excessive mixing to ordered phase

  1. Comparison of multiple assays for detecting human antibodies directed against antigens on normal and malignant tissue culture cells

    International Nuclear Information System (INIS)

    Rosenberg, S.A.; Schwarz, S.; Anding, H.; Hyatt, C.; Williams, G.M.; Johns Hopkins Univ., Baltimore, Md.

    1977-01-01

    Four separate assays of human antibody reactivity to four separate normal and malignant human tissue culture cells lines from two patients have been evaluated using a single highly-reactive allogeneic serum. The visual end-point cytolysis assay and the chromium-51 release assay were equally sensitive in measuring complement mediated antibody cytotoxicity and both were far more sensitive than a trypan blue dye exclusion assay. The assay of antibody reactivity by hemadsorption technique was about 10 times more sensitive than any of the cytotoxicity assays. This latter assay measures only IgG antibody however. These assays showed that cell lines from different patients may differ greatly in 'reactivity' to an allogeneic serum and emphasized the importance of utilizing tumor and normal cells from the same patient when using tissue culture cells to search for tumor specific reactivity. These observations emphasize the importance of utilizing multiple assays against paired normal and malignant cells from the same patient to be certain of the specificity and magnitude of the measured antibody

  2. Theoretical model and experimental validation of a direct-expansion solar assisted heat pump for domestic hot water applications

    International Nuclear Information System (INIS)

    Moreno-Rodríguez, A.; González-Gil, A.; Izquierdo, M.; Garcia-Hernando, N.

    2012-01-01

    This paper has shown the development of a theoretical model to determine the operating parameters and consumption of a domestic hot water (DHW) installation, which uses a direct-expansion solar assisted heat pump (DXSAHP) with refrigerant R-134a, a compressor with a rated capacity of 1.1 kW and collectors with a total area of 5.6 m 2 . The model results have been compared and validated the experimental results obtained with the equipment installed at the University Carlos III, South of Madrid. The analysis was conducted over the course of a year, and the results have been represented depending on the meteorological and process variables of several representative days. Taking into account the thermal losses of the installation and the dependency on the operating conditions, the acquired experimental coefficient of performance is between 1.7 and 2.9, while the DHW tank temperature over the course of the study is 51 °C. -- Highlights: ► The study aims to present a new theoretical model and an experimental validation. ► The experimental COP vary between 1.7 and 2.9 (max. condensation temperature 57 °C). ► The operating parameters respond to the solar radiation. The COP may increase up to 50%. ► The useful surface area varies between 50% and 85% of the total surface. ► The system stops if conditions exceed the maximum value of the absorbed heat.

  3. Dynamic solar-powered multi-stage direct contact membrane distillation system: Concept design, modeling and simulation

    KAUST Repository

    Lee, Jung Gil

    2017-04-26

    This paper presents a theoretical analysis of the monthly average daily and hourly performances of a solar-powered multi-stage direct contact membrane distillation (SMDCMD) system with an energy recovery scheme and dynamic operating system. Mid-latitude meteorological data from Busan, Korea is employed, featuring large climate variation over the course of one year. The number of module stages used by the dynamic operating scheme changes dynamically based on the inlet feed temperature of the successive modules, which results in an improvement of the water production and thermal efficiency. The simulations of the SMDCMD system are carried out to investigate the spatial and temporal variations in the feed and permeate temperatures and permeate flux. The monthly average daily water production increases from 0.37m3/day to 0.4m3/day and thermal efficiency increases from 31% to 45% when comparing systems both without and with dynamic operation in December. The water production with respect to collector area ranged from 350m2 to 550m2 and the seawater storage tank volume ranged from 16m3 to 28.8m3, and the solar fraction at various desired feed temperatures from 50°C to 80°C have been investigated in October and December.

  4. Direct evidence of an eruptive, filament-hosting magnetic flux rope leading to a fast solar coronal mass ejection

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Bin; Gary, D. E. [Center for Solar-Terrestrial Research, New Jersey Institute of Technology, Newark, NJ 07102 (United States); Bastian, T. S., E-mail: bin.chen@cfa.harvard.edu [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States)

    2014-10-20

    Magnetic flux ropes (MFRs) are believed to be at the heart of solar coronal mass ejections (CMEs). A well-known example is the prominence cavity in the low corona that sometimes makes up a three-part white-light (WL) CME upon its eruption. Such a system, which is usually observed in quiet-Sun regions, has long been suggested to be the manifestation of an MFR with relatively cool filament material collecting near its bottom. However, observational evidence of eruptive, filament-hosting MFR systems has been elusive for those originating in active regions. By utilizing multi-passband extreme-ultraviolet (EUV) observations from Solar Dynamics Observatory/Atmospheric Imaging Assembly, we present direct evidence of an eruptive MFR in the low corona that exhibits a hot envelope and a cooler core; the latter is likely the upper part of a filament that undergoes a partial eruption, which is later observed in the upper corona as the coiled kernel of a fast, WL CME. This MFR-like structure exists more than 1 hr prior to its eruption, and displays successive stages of dynamical evolution, in which both ideal and non-ideal physical processes may be involved. The timing of the MFR kinematics is found to be well correlated with the energy release of the associated long-duration C1.9 flare. We suggest that the long-duration flare is the result of prolonged energy release associated with the vertical current sheet induced by the erupting MFR.

  5. Direct Evidence of an Eruptive, Filament-hosting Magnetic Flux Rope Leading to a Fast Solar Coronal Mass Ejection

    Science.gov (United States)

    Chen, Bin; Bastian, T. S.; Gary, D. E.

    2014-10-01

    Magnetic flux ropes (MFRs) are believed to be at the heart of solar coronal mass ejections (CMEs). A well-known example is the prominence cavity in the low corona that sometimes makes up a three-part white-light (WL) CME upon its eruption. Such a system, which is usually observed in quiet-Sun regions, has long been suggested to be the manifestation of an MFR with relatively cool filament material collecting near its bottom. However, observational evidence of eruptive, filament-hosting MFR systems has been elusive for those originating in active regions. By utilizing multi-passband extreme-ultraviolet (EUV) observations from Solar Dynamics Observatory/Atmospheric Imaging Assembly, we present direct evidence of an eruptive MFR in the low corona that exhibits a hot envelope and a cooler core; the latter is likely the upper part of a filament that undergoes a partial eruption, which is later observed in the upper corona as the coiled kernel of a fast, WL CME. This MFR-like structure exists more than 1 hr prior to its eruption, and displays successive stages of dynamical evolution, in which both ideal and non-ideal physical processes may be involved. The timing of the MFR kinematics is found to be well correlated with the energy release of the associated long-duration C1.9 flare. We suggest that the long-duration flare is the result of prolonged energy release associated with the vertical current sheet induced by the erupting MFR.

  6. Direct evidence of an eruptive, filament-hosting magnetic flux rope leading to a fast solar coronal mass ejection

    International Nuclear Information System (INIS)

    Chen, Bin; Gary, D. E.; Bastian, T. S.

    2014-01-01

    Magnetic flux ropes (MFRs) are believed to be at the heart of solar coronal mass ejections (CMEs). A well-known example is the prominence cavity in the low corona that sometimes makes up a three-part white-light (WL) CME upon its eruption. Such a system, which is usually observed in quiet-Sun regions, has long been suggested to be the manifestation of an MFR with relatively cool filament material collecting near its bottom. However, observational evidence of eruptive, filament-hosting MFR systems has been elusive for those originating in active regions. By utilizing multi-passband extreme-ultraviolet (EUV) observations from Solar Dynamics Observatory/Atmospheric Imaging Assembly, we present direct evidence of an eruptive MFR in the low corona that exhibits a hot envelope and a cooler core; the latter is likely the upper part of a filament that undergoes a partial eruption, which is later observed in the upper corona as the coiled kernel of a fast, WL CME. This MFR-like structure exists more than 1 hr prior to its eruption, and displays successive stages of dynamical evolution, in which both ideal and non-ideal physical processes may be involved. The timing of the MFR kinematics is found to be well correlated with the energy release of the associated long-duration C1.9 flare. We suggest that the long-duration flare is the result of prolonged energy release associated with the vertical current sheet induced by the erupting MFR.

  7. Clear sky solar insolation data for Islamabad

    International Nuclear Information System (INIS)

    Akhter, P.; Baig, A.; Mufti, A.

    1990-09-01

    Monthly average values of both integrated and instantaneous clear sky solar radiation components for Islamabad territory have been presented and discussed. The components include total, direct normal, direct horizontal, global and diffuse radiations, sun hours, number of clear days and temperature for solar energy applications. Beam irradiance values are used to get clear sky (maximum) sun hours by ab-initio. The need for replacing the conventional sunshine recorder is discussed. (author). 8 refs, 1 fig, 2 tabs

  8. ADA-07 Suppresses Solar Ultraviolet-Induced Skin Carcinogenesis by Directly Inhibiting TOPK.

    Science.gov (United States)

    Gao, Ge; Zhang, Tianshun; Wang, Qiushi; Reddy, Kanamata; Chen, Hanyong; Yao, Ke; Wang, Keke; Roh, Eunmiri; Zykova, Tatyana; Ma, Weiya; Ryu, Joohyun; Curiel-Lewandrowski, Clara; Alberts, David; Dickinson, Sally E; Bode, Ann M; Xing, Ying; Dong, Zigang

    2017-09-01

    Cumulative exposure to solar ultraviolet (SUV) irradiation is regarded as the major etiologic factor in the development of skin cancer. The activation of the MAPK cascades occurs rapidly and is vital in the regulation of SUV-induced cellular responses. The T-LAK cell-originated protein kinase (TOPK), an upstream activator of MAPKs, is heavily involved in inflammation, DNA damage, and tumor development. However, the chemopreventive and therapeutic effects of specific TOPK inhibitors in SUV-induced skin cancer have not yet been elucidated. In the current study, ADA-07, a novel TOPK inhibitor, was synthesized and characterized. Pull-down assay results, ATP competition, and in vitro kinase assay data revealed that ADA-07 interacted with TOPK at the ATP-binding pocket and inhibited its kinase activity. Western blot analysis showed that ADA-07 suppressed SUV-induced phosphorylation of ERK1/2, p38, and JNKs and subsequently inhibited AP-1 activity. Importantly, topical treatment with ADA-07 dramatically attenuated tumor incidence, multiplicity, and volume in SKH-1 hairless mice exposed to chronic SUV. Our findings suggest that ADA-07 is a promising chemopreventive or potential therapeutic agent against SUV-induced skin carcinogenesis that acts by specifically targeting TOPK. Mol Cancer Ther; 16(9); 1843-54. ©2017 AACR . ©2017 American Association for Cancer Research.

  9. Direct battery-driven solar LED lighting using constant-power control

    KAUST Repository

    Huang, Bin-Juine; Chen, Chun-Wei; Hsu, Po-Chien; Tseng, Wei-Min; Wu, Min-Sheng

    2012-01-01

    A direct battery-driven LED lighting technique using constant-power control is proposed in the present study. A system dynamics model of LED luminaire was derived and used in the design of the feedback constant-power control system. The test result

  10. Software simulation and experimental characterisation of a rotationally asymmetrical concentrator under direct and diffuse solar radiation

    International Nuclear Information System (INIS)

    Freier, Daria; Muhammad-Sukki, Firdaus; Abu-Bakar, Siti Hawa; Ramirez-Iniguez, Roberto; Abubakar Mas’ud, Abdullahi; Albarracín, Ricardo; Ardila-Rey, Jorge Alfredo; Munir, Abu Bakar; Mohd Yasin, Siti Hajar; Bani, Nurul Aini

    2016-01-01

    Highlights: • The performance of the RADTIRC was analysed under direct and diffuse radiation. • Optical gains of 4.66 under direct and 1.94 under diffuse light were achieved. • The experiments show good agreement with the simulations. • The RADTIRC is an attractive alternative for BICPV systems. - Abstract: Making housing carbon neutral is one of the European Union (EU) targets with the aim to reduce energy consumption and to increase on-site renewable energy generation in the domestic sector. Optical concentrators have a strong potential to minimise the cost of building integrated photovoltaic (BIPV) systems by replacing expensive photovoltaic (PV) material whilst maintaining the same electrical output. In this work, the performance of a recently patented optical concentrator known as the rotationally asymmetrical dielectric totally internally reflective concentrator (RADTIRC) was analysed under direct and diffuse light conditions. The RADTIRC has a geometrical concentration gain of 4.969 and two half acceptance angles of ±40° and ±30° respectively along the two axes. Simulation and experimental work has been carried out to determine the optical concentration gain and the angular response of the concentrator. It was found that the RADTIRC has an optical concentration gain of 4.66 under direct irradiance and 1.94 under diffuse irradiance. The experimental results for the single concentrator showed a reduction in concentration gain of 4.2% when compared with simulation data.

  11. Rectal compliance as a routine measurement: extreme volumes have direct clinical impact and normal volumes exclude rectum as a problem.

    Science.gov (United States)

    Felt-Bersma, R J; Sloots, C E; Poen, A C; Cuesta, M A; Meuwissen, S G

    2000-12-01

    The clinical impact of rectal compliance and sensitivity measurement is not clear. The aim of this study was to measure the rectal compliance in different patient groups compared with controls and to establish the clinical effect of rectal compliance. Anorectal function tests were performed in 974 consecutive patients (284 men). Normal values were obtained from 24 controls. Rectal compliance measurement was performed by filling a latex rectal balloon with water at a rate of 60 ml per minute. Volume and intraballoon pressure were measured. Volume and pressure at three sensitivity thresholds were recorded for analysis: first sensation, urge, and maximal toleration. At maximal toleration, the rectal compliance (volume/pressure) was calculated. Proctoscopy, anal manometry, anal mucosal sensitivity, and anal endosonography were also performed as part of our anorectal function tests. No effect of age or gender was observed in either controls or patients. Patients with fecal incontinence had a higher volume at first sensation and a higher pressure at maximal toleration (P = 0.03), the presence of a sphincter defect or low or normal anal pressures made no difference. Patients with constipation had a larger volume at first sensation and urge (P 500 ml had complaints of constipation. No correlation between rectal and anal mucosal sensitivity was found. Rectal compliance measurement with a latex balloon is easily feasible. In this series of 974 patients, some patient groups showed an abnormal rectal visceral sensitivity and compliance, but there was an overlap with controls. Rectal compliance measurement gave a good clinical impression about the contribution of the rectum to the anorectal problem. Patients with proctitis and pouchitis had the smallest rectal compliance. A maximal toleration volume 500 ml was only seen in constipated patients, and therapy should be given to prevent further damage to the pelvic floor. Values close to or within the normal range rule out the

  12. Evaluating new methods for direct measurement of the moderator temperature coefficient in nuclear power plants during normal operation

    International Nuclear Information System (INIS)

    Makai, M.; Kalya, Z.; Nemes, I.; Pos, I.; Por, G.

    2007-01-01

    Moderator temperature coefficient of reactivity is not monitored during fuel cycles in WWER reactors, because it is not very easy or impossible to measure it without disturbing the normal operation. Two new methods were tested in our WWER type nuclear power plant to try methodologies, which enable to measure that important to safety parameter during the fuel cycle. One is based on small perturbances, and only small changes are requested in operation, the other is based on noise methods, which means it is without interference with reactor operation. Both method is new that aspects that they uses the plant computer data(VERONA) based signals calculated by C P ORCA diffusion code (Authors)

  13. The angular interval between the direction of progression and body orientation in normal, alcohol- and cocaine treated fruit flies.

    Directory of Open Access Journals (Sweden)

    Anna Gakamsky

    Full Text Available In this study we characterize the coordination between the direction a fruit-fly walks and the direction it faces, as well as offer a methodology for isolating and validating key variables with which we phenotype fly locomotor behavior. Our fundamental finding is that the angular interval between the direction a fly walks and the direction it faces is actively managed in intact animals and modulated in a patterned way with drugs. This interval is small in intact flies, larger with alcohol and much larger with cocaine. The dynamics of this interval generates six coordinative modes that flow smoothly into each other. Under alcohol and much more so under cocaine, straight path modes dwindle and modes involving rotation proliferate. To obtain these results we perform high content analysis of video-tracked open field locomotor behavior. Presently there is a gap between the quality of descriptions of insect behaviors that unfold in circumscribed situations, and descriptions that unfold in extended time and space. While the first describe the coordination between low-level kinematic variables, the second quantify cumulative measures and subjectively defined behavior patterns. Here we reduce this gap by phenotyping extended locomotor behavior in terms of the coordination between low-level kinematic variables, which we quantify, combining into a single field two disparate fields, that of high content phenotyping and that of locomotor coordination. This will allow the study of the genes/brain/locomotor coordination interface in genetically engineered and pharmacologically manipulated animal models of human diseases.

  14. Multidisciplinary research program directed toward utilization of solar energy through bioconversion of renewable resources

    Energy Technology Data Exchange (ETDEWEB)

    1980-07-01

    Progress is reported in this multidisciplinary research program. Genetic selection of superior trees, physiological basis of vigor, tissue culture systems leading to cloning of diploid and haploid cell lines are discussed in the Program A report. The physiological basis of enhanced oleoresin formation in southern pines when treated with sublethal concentrations of the herbicide paraquat was investigated in Program B. In Program C, metabolic changes in the stems of slash pine, in vivo, after application with paraquat were determined. The use of phdoem and xylem tissue slices as a laboratory model for studying paraquat associated- and normal-terpene synthesis in pines is discussed. The biochemistry and physiology of methane formation from cellulose during anaerobic fermentation are discussed in the Program D report. (DMC)

  15. Direct measurements of the 160.01-min oscillation in the solar radio brightness

    International Nuclear Information System (INIS)

    Efanov, V.A.; Moiseev, I.G.; Nesterov, N.S.

    1983-01-01

    Direct (nondifferential) brightness measurements of the quiet sun at lambda = 8.2 and 13.5 mm, corrected by the Bouguer law for absorption in the terrestrial atmosphere, confirm the presence of a 160.009 +- 0.002 min periodicity. At the two wavelengths the relative amplitudes are roughly-equal0.6 x 10 -3 , 1 x 10 -3 . Maximum radio brightness occurs at the phase when optical data indicate the photosphere radius is largest

  16. Experimental investigation of a multi-stage humidification-dehumidification desalination system heated directly by a cylindrical Fresnel lens solar concentrator

    International Nuclear Information System (INIS)

    Wu, Gang; Zheng, Hongfei; Ma, Xinglong; Kutlu, Cagri; Su, Yuehong

    2017-01-01

    Highlights: • A solar desalination system heated directly by curved Fresnel lens concentrator. • Desalination system is based on the humidification-dehumidification process. • Four-stage multi-effect desalination system is proposed. • Condensation latent heat and residual heat in the brine are recycled and reutilized. • The maximum yield and GOR of the unit can reach 3.4 kg/h and 2.1, respectively. - Abstract: This study demonstrates a multi-stage humidification-dehumidification (HDH) solar desalination system heated directly by a cylindrical Fresnel lens concentrator. In this novel system, the solar radiation is sent directly into desalination unit. That is to say, the solar receiver and the evaporator of the system are a whole in which the black fillers in seawater directly absorb the concentrated solar lights to heat the seawater film to produce the evaporation. The configuration and working processes of the proposed design are described in detail. In order to analyze its performance, a small solar desalination prototype unit incorporated with a cylindrical Fresnel lens concentrator was designed and built in our laboratory. Using three-stage isothermal tandem heating mode, the variation of the fresh water yield rate and the absorber temperature with time were measured experimentally and were compared with theoretical calculations. The experimental results show that the maximum yield of the unit is about 3.4 kg/h, the maximum gained output ratio (GOR) is about 2.1, when the average intensity of solar radiation is about 867 W/m"2. This study indicates that the proposed system has the characteristics of compact structure and GOR high. It still can be improved when the design and operation are optimized further.

  17. Salt flow direction and velocity during subsalt normal faulting and syn-kinematic sedimentation—implications from analytical calculations

    Science.gov (United States)

    Warsitzka, M.; Kukowski, N.; Kley, J.

    2018-04-01

    Salt flow induced by subsalt normal faulting is mainly controlled by tilting of the salt layer, the amount of differential loading due to syn-kinematic deposition, and tectonic shearing at the top or the base of the salt layer. Our study addresses the first two mechanisms and aims to examine salt flow patterns above a continuously moving subsalt normal fault and beneath a syn-kinematic minibasin. In such a setting, salt either tends to flow down towards the basin centre driven by its own weight or is squeezed up towards the footwall side owing to loading differences between the minibasin and the region above the footwall block. Applying isostatic balancing in analytical models, we calculated the steady-state flow velocity in a salt layer. This procedure gives insights into (1) the minimum vertical offset required for upward flow to occur, (2) the magnitude of the flow velocity, and (3) the average density of the supra-salt cover layer at the point at which upward flow starts. In a sensitivity study, we examined how the point of flow reversal and the velocity patterns are influenced by changes of the salt and cover layer thickness, the geometry of the cover flexure, the dip of the subsalt fault, compaction parameters of the supra-salt cover, the salt viscosity and the salt density. Our model results reveal that in most geological scenarios, salt flow above a continuously displacing subsalt normal fault goes through an early phase of downward flow. At sufficiently high fault offset in the range of 700-2600 m, salt is later squeezed upward towards the footwall side. This flow reversal occurs at smaller vertical fault displacement, if the thickness of the pre-kinematic layer is larger, the sedimentation rate of the syn-kinematic cover is higher, the compaction coefficient of cover sediments (i.e. the density increase with depth) is larger or the average density of the salt is lower. Other geometrical parameters such as the width of the cover monocline, the dip of the

  18. The heliothermic lake: a direct method of collecting and storing solar energy

    Science.gov (United States)

    Kirkland, Douglas W.; Bradbury, J. Platt; Dean, Walter E.

    1980-01-01

    Heliothermic lakes contain a sun-heated layer of warm, saline water beneath a surface layer of cooler, less saline water. The two layers are separated by a chemocline, a stratum in which salinity increases progressively with depth. The chemocline, the position of which varies from lake to lake, functions as a heat trap. Most sunlight that penetrates this stratum is transformed into heat, which cannot escape by radiation because water is opaque to infrared light, and which cannot escape by convection because the specific gravity of the dense water below the chemocline is not significantly decreased by the increasing temperature. Heat can escape only by conduction through the chemocline, and water or brine is a very poor conductor. As a result, the temperature within and commonly below the chemocline rises. Under ideal conditions of a clear solution, high isolation, and a suitable salinity distribution, the temperature of the chemocline will increase to the boiling point. The lower part of the chemocline in a shallow (0.8-m) manmade heliothermic lake at Sedom, Israel, for example, reached a temperature of 96°C (205°F) in spite of a brine with poor light transmissibility.About 30 natural heliothermic lakes have been reported. The best known, Lake Ursului, occurs in Transylvania, Romania (latitude, 46°35'N). During four consecutive summers, 1899 to 1902, this lake had temperatures of 60-70°C (140-158°F) at a depth of 1-2 m. Heliothermic conditions have persisted in this lake for at least 28 and probably for more than 77 years. The most unusual, Lake Vanda, Victoria Land, Antarctica (latitude, 77°35'S), has a temperature of 26°C near the base of the chemocline at a depth of 61 despite a mean atmospheric temperature of -20°C. Sunlight penetrates into the chemocline through 5 m of remarkably clear ice.Maintenance of the chemocline is the chief problem preventing commercial use of manmade heliothermic lakes for the collection and storage of solar energy. The most

  19. Direct assignment of molecular vibrations via normal mode analysis of the neutron dynamic pair distribution function technique

    International Nuclear Information System (INIS)

    Fry-Petit, A. M.; Sheckelton, J. P.; McQueen, T. M.; Rebola, A. F.; Fennie, C. J.; Mourigal, M.; Valentine, M.; Drichko, N.

    2015-01-01

    For over a century, vibrational spectroscopy has enhanced the study of materials. Yet, assignment of particular molecular motions to vibrational excitations has relied on indirect methods. Here, we demonstrate that applying group theoretical methods to the dynamic pair distribution function analysis of neutron scattering data provides direct access to the individual atomic displacements responsible for these excitations. Applied to the molecule-based frustrated magnet with a potential magnetic valence-bond state, LiZn 2 Mo 3 O 8 , this approach allows direct assignment of the constrained rotational mode of Mo 3 O 13 clusters and internal modes of MoO 6 polyhedra. We anticipate that coupling this well known data analysis technique with dynamic pair distribution function analysis will have broad application in connecting structural dynamics to physical properties in a wide range of molecular and solid state systems

  20. Normal and system lupus erythematosus red blood cell interactions studied by double trap optical tweezers: direct measurements of aggregation forces

    Science.gov (United States)

    Khokhlova, Maria D.; Lyubin, Eugeny V.; Zhdanov, Alexander G.; Rykova, Sophia Yu.; Sokolova, Irina A.; Fedyanin, Andrey A.

    2012-02-01

    Direct measurements of aggregation forces in piconewton range between two red blood cells in pair rouleau are performed under physiological conditions using double trap optical tweezers. Aggregation and disaggregation properties of healthy and pathologic (system lupus erythematosis) blood samples are analyzed. Strong difference in aggregation speed and behavior is revealed using the offered method which is proposed to be a promising tool for SLE monitoring at single cell level.

  1. Detection of solar radio brightness oscillations with 160.01-min period from direct measurements

    International Nuclear Information System (INIS)

    Efanov, V.A.; Moiseev, I.G.; Nesterov, N.S.

    1983-01-01

    It is shown that direct measurements of the quiet Sun brightness at 8.2 and 13.5 mm wavelengths corrected for extinction in the Earth atmosphere by means of the Bouguer law reveal the 160.01-min periodic component. The relative amplitudes of variations are of approximately 6x10 -4 at the shorter wavelength and of 10 -3 at the longer one. The brightness maximum coincides with the phase of the maximal radius of the photosphere as derived from the optical data

  2. Direct imaging of extra-solar planetary systems with the Circumstellar Imaging Telescope (CIT)

    International Nuclear Information System (INIS)

    Terrile, R.J.

    1988-01-01

    In a joint study conducted by the Jet Propulsion Laboratory and the Perkin-Elmer Corporation it was found that an earth orbital, 1.5 meter diameter low scattered light coronagraphic telescope can achieve a broad range of scientific objectives including the direct detection of Jupiter-sized planets around the nearby stars. Recent major advances in the understanding of coronagraphic performance and in the field of super smooth mirror fabrication allow such an instrument to be designed and built within current technology. Such a project, called the Circumstellar Imaging Telescope (CIT), is currently being proposed. 10 references

  3. The 2010 Russian Drought Impact on Satellite Measurements of Solar-Induced Chlorophyll Fluorescence: Insights from Modeling and Comparisons with the Normalized Differential Vegetation Index (NDVI)

    Science.gov (United States)

    Yoshida, Y.; Joiner, J.; Tucker, C.; Berry, J.; Lee, J. -E.; Walker, G.; Reichle, R.; Koster, R.; Lyapustin, A.; Wang, Y.

    2015-01-01

    We examine satellite-based measurements of chlorophyll solar-induced fluorescence (SIF) over the region impacted by the Russian drought and heat wave of 2010. Like the popular Normalized Difference Vegetation Index (NDVI) that has been used for decades to measure photosynthetic capacity, SIF measurements are sensitive to the fraction of absorbed photosynthetically-active radiation (fPAR). However, in addition, SIF is sensitive to the fluorescence yield that is related to the photosynthetic yield. Both SIF and NDVI from satellite data show drought-related declines early in the growing season in 2010 as compared to other years between 2007 and 2013 for areas dominated by crops and grasslands. This suggests an early manifestation of the dry conditions on fPAR. We also simulated SIF using a global land surface model driven by observation-based meteorological fields. The model provides a reasonable simulation of the drought and heat impacts on SIF in terms of the timing and spatial extents of anomalies, but there are some differences between modeled and observed SIF. The model may potentially be improved through data assimilation or parameter estimation using satellite observations of SIF (as well as NDVI). The model simulations also offer the opportunity to examine separately the different components of the SIF signal and relationships with Gross Primary Productivity (GPP).

  4. Off-axis holographic lens spectrum-splitting photovoltaic system for direct and diffuse solar energy conversion.

    Science.gov (United States)

    Vorndran, Shelby D; Chrysler, Benjamin; Wheelwright, Brian; Angel, Roger; Holman, Zachary; Kostuk, Raymond

    2016-09-20

    This paper describes a high-efficiency, spectrum-splitting photovoltaic module that uses an off-axis volume holographic lens to focus and disperse incident solar illumination to a rectangular shaped high-bandgap indium gallium phosphide cell surrounded by strips of silicon cells. The holographic lens design allows efficient collection of both direct and diffuse illumination to maximize energy yield. We modeled the volume diffraction characteristics using rigorous coupled-wave analysis, and simulated system performance using nonsequential ray tracing and PV cell data from the literature. Under AM 1.5 illumination conditions the simulated module obtained a 30.6% conversion efficiency. This efficiency is a 19.7% relative improvement compared to the more efficient cell in the system (silicon). The module was also simulated under a typical meteorological year of direct and diffuse irradiance in Tucson, Arizona, and Seattle, Washington. Compared to a flat panel silicon module, the holographic spectrum splitting module obtained a relative improvement in energy yield of 17.1% in Tucson and 14.0% in Seattle. An experimental proof-of-concept volume holographic lens was also fabricated in dichromated gelatin to verify the main characteristics of the system. The lens obtained an average first-order diffraction efficiency of 85.4% across the aperture at 532 nm.

  5. Reduced-Order Dynamic Modeling, Fouling Detection, and Optimal Control of Solar-Powered Direct Contact Membrane Distillation

    KAUST Repository

    Karam, Ayman M.

    2016-12-01

    Membrane Distillation (MD) is an emerging sustainable desalination technique. While MD has many advantages and can be powered by solar thermal energy, its main drawback is the low water production rate. However, the MD process has not been fully optimized in terms of its manipulated and controlled variables. This is largely due to the lack of adequate dynamic models to study and simulate the process. In addition, MD is prone to membrane fouling, which is a fault that degrades the performance of the MD process. This work has three contributions to address these challenges. First, we derive a mathematical model of Direct Contact Membrane Distillation (DCMD), which is the building block for the next parts. Then, the proposed model is extended to account for membrane fouling and an observer-based fouling detection method is developed. Finally, various control strategies are implemented to optimize the performance of the DCMD solar-powered process. In part one, a reduced-order dynamic model of DCMD is developed based on lumped capacitance method and electrical analogy to thermal systems. The result is an electrical equivalent thermal network to the DCMD process, which is modeled by a system of nonlinear differential algebraic equations (DAEs). This model predicts the water-vapor flux and the temperature distribution along the module length. Experimental data is collected to validate the steady-state and dynamic responses of the proposed model, with great agreement demonstrated in both. The second part proposes an extension of the model to account for membrane fouling. An adaptive observer for DAE systems is developed and convergence proof is presented. A method for membrane fouling detection is then proposed based on adaptive observers. Simulation results demonstrate the performance of the membrane fouling detection method. Finally, an optimization problem is formulated to maximize the process efficiency of a solar-powered DCMD. The adapted method is known as Extremum

  6. INITIATION AND ERUPTION PROCESS OF MAGNETIC FLUX ROPE FROM SOLAR ACTIVE REGION NOAA 11719 TO EARTH-DIRECTED CME

    Energy Technology Data Exchange (ETDEWEB)

    Vemareddy, P. [Udaipur Solar Observatory, Physical Research Laboratory, Badi Road, Dewali, Udaipur 313 001 (India); Zhang, J., E-mail: vema@prl.res.in [School of Physics, Astronomy and Computational Sciences, George Mason University, Fairfax, VA 22030 (United States)

    2014-12-20

    An eruption event launched from the solar active region (AR) NOAA 11719 is investigated based on coronal EUV observations and photospheric magnetic field measurements obtained from the Solar Dynamic Observatory. The AR consists of a filament channel originating from a major sunspot and its south section is associated with an inverse-S sigmoidal system as observed in Atmospheric Imaging Assembly passbands. We regard the sigmoid as the main body of the flux rope (FR). There also exists a twisted flux bundle crossing over this FR. This overlying flux bundle transforms in shape similar to kink-rise evolution, which corresponds with the rise motion of the FR. The emission measure and temperature along the FR exhibits an increasing trend with its rising motion, indicating reconnection in the thinning current sheet underneath the FR. Net magnetic flux of the AR, evaluated at north and south polarities, showed decreasing behavior whereas the net current in these fluxes exhibits an increasing trend. Because the negative (positive) flux has a dominant positive (negative) current, the chirality of AR flux system is likely negative (left handed) in order to be consistent with the chirality of inverse S-sigmoidal FR. This analysis of magnetic fields of the source AR suggests that the cancelling fluxes are prime factors of the monotonous twisting of the FR system, reaching to a critical state to trigger kink instability and rise motion. This rise motion may have led to the onset of the torus instability, resulting in an Earth-directed coronal mass ejection, and the progressive reconnection in the thinning current sheet beneath the rising FR led to the M6.5 flare.

  7. INITIATION AND ERUPTION PROCESS OF MAGNETIC FLUX ROPE FROM SOLAR ACTIVE REGION NOAA 11719 TO EARTH-DIRECTED CME

    International Nuclear Information System (INIS)

    Vemareddy, P.; Zhang, J.

    2014-01-01

    An eruption event launched from the solar active region (AR) NOAA 11719 is investigated based on coronal EUV observations and photospheric magnetic field measurements obtained from the Solar Dynamic Observatory. The AR consists of a filament channel originating from a major sunspot and its south section is associated with an inverse-S sigmoidal system as observed in Atmospheric Imaging Assembly passbands. We regard the sigmoid as the main body of the flux rope (FR). There also exists a twisted flux bundle crossing over this FR. This overlying flux bundle transforms in shape similar to kink-rise evolution, which corresponds with the rise motion of the FR. The emission measure and temperature along the FR exhibits an increasing trend with its rising motion, indicating reconnection in the thinning current sheet underneath the FR. Net magnetic flux of the AR, evaluated at north and south polarities, showed decreasing behavior whereas the net current in these fluxes exhibits an increasing trend. Because the negative (positive) flux has a dominant positive (negative) current, the chirality of AR flux system is likely negative (left handed) in order to be consistent with the chirality of inverse S-sigmoidal FR. This analysis of magnetic fields of the source AR suggests that the cancelling fluxes are prime factors of the monotonous twisting of the FR system, reaching to a critical state to trigger kink instability and rise motion. This rise motion may have led to the onset of the torus instability, resulting in an Earth-directed coronal mass ejection, and the progressive reconnection in the thinning current sheet beneath the rising FR led to the M6.5 flare

  8. DIRECT OBSERVATIONS OF TETHER-CUTTING RECONNECTION DURING A MAJOR SOLAR EVENT FROM 2014 FEBRUARY 24 TO 25

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Huadong; Zhang, Jun; Yang, Shuhong; Li, Ting [Key Laboratory of Solar Activity, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China); Cheng, Xin [School of Astronomy and Space Science, Nanjing University, Nanjing 210093 (China); Ma, Suli, E-mail: hdchen@nao.cas.cn [College of Science, China University of Petroleum, Qingdao 266580 (China)

    2014-12-20

    Using multi-wavelength data from the Atmospheric Imaging Assembly on board the Solar Dynamics Observatory, we investigated two successive solar flares, a C5.1 confined flare and an X4.9 ejective flare with a halo coronal mass ejection, in NOAA active region 11990 from 2014 February 24 to 25. Before the confined flare onset, EUV brightening beneath the filament was detected. As the flare began, a twisted helical flux rope (FR) wrapping around the filament moved upward and then stopped, and in the meantime an obvious X-ray source below it was observed. Prior to the ejective X4.9 flare, some pre-existing loop structures in the active region interacted with each other, which produced a brightening region beneath the filament. Meanwhile, a small flaring loop appeared below the interaction region and some new helical lines connecting the far ends of the loop structures were gradually formed and continually added into the former twisted FR. Then, due to the resulting imbalance between the magnetic pressure and tension, the new FR, together with the filament, erupted outward. Our observations coincide well with a tether-cutting model, suggesting that the two flares probably have the same triggering mechanism, i.e., tether-cutting reconnection. To our knowledge, this is the first direct observation of tether-cutting reconnection occurring between pre-existing loops in an active region. In the ejective flare case, the erupting filament exhibited an Ω-like kinked structure and underwent an exponential rise after a slow-rise phase, indicating that the kink instability might be also responsible for the eruption initiation.

  9. Two-phase flow pattern measurements with a wire mesh sensor in a direct steam generating solar thermal collector

    Science.gov (United States)

    Berger, Michael; Mokhtar, Marwan; Zahler, Christian; Willert, Daniel; Neuhäuser, Anton; Schleicher, Eckhard

    2017-06-01

    At Industrial Solar's test facility in Freiburg (Germany), two phase flow patterns have been measured by using a wire mesh sensor from Helmholtz Zentrum Dresden-Rossendorf (HZDR). Main purpose of the measurements was to compare observed two-phase flow patterns with expected flow patterns from models. The two-phase flow pattern is important for the design of direct steam generating solar collectors. Vibrations should be avoided in the peripheral piping, and local dry-outs or large circumferential temperature gradients should be prevented in the absorber tubes. Therefore, the choice of design for operation conditions like mass flow and steam quality are an important step in the engineering process of such a project. Results of a measurement with the wire mesh sensor are the flow pattern and the plug or slug frequency at the given operating conditions. Under the assumption of the collector power, which can be assumed from previous measurements at the same collector and adaption with sun position and incidence angle modifier, also the slip can be evaluated for a wire mesh sensor measurement. Measurements have been performed at different mass flows and pressure levels. Transient behavior has been tested for flashing, change of mass flow, and sudden changes of irradiation (cloud simulation). This paper describes the measurements and the method of evaluation. Results are shown as extruded profiles in top view and in side view. Measurement and model are compared. The tests have been performed at low steam quality, because of the limits of the test facility. Conclusions and implications for possible future measurements at larger collectors are also presented in this paper.

  10. Direct calculation of unambiguous electron-density distributions of Langmuir-Blodgett films normal to the membrane plane

    International Nuclear Information System (INIS)

    Frieling, M. von; Bradaczek, H.

    1990-01-01

    In regard to X-ray diffraction, Langmuir-Blodgett (LB) films consisting of lipid bilayers represent a 'one-dimensional crystal' with a very small number of unit cells in the direction of stacking. Such bounded systems yield X-ray diffraction diagrams which, in certain respects, contain more information than those of the conventional effectively infinite single crystals. This additional information consists of the profiles of the broadened reflections and their dislocation from the reciprocal-lattice points. These profiles are specific for each different structure and hence enable the direct calculation of unambiguous electron-density distributions from a single set of intensity data. At first, the Q function (the generalized Patterson function), i.e. the distance statistics of the structure sought after is calculated from the intensity data. Thereafter, the unambiguous convolution square root of the Q function must be determined, which is identical to the unknown electron-density distribution. For this purpose two mathematically completely different methods were established and compared. They were applied to diffraction patterns of Langmuir-Blodgett films of simple synthetic lipids with characteristic molecular subunits and showed identical results within the experimental resolution. This verifies the structures and the methods to calculate them. Furthermore, all features of the simple structures were compatible with the expectations. All one-dimensional electron-density distributions showed the common features of lipid bilayers. The characteristic molecular subunits can be recognized and reveal some interesting details. In general, they yield information about orientation, conformation and localization of molecular subunits and membrane components. (orig.)

  11. Using deep recurrent neural network for direct beam solar irradiance cloud screening

    Science.gov (United States)

    Chen, Maosi; Davis, John M.; Liu, Chaoshun; Sun, Zhibin; Zempila, Melina Maria; Gao, Wei

    2017-09-01

    Cloud screening is an essential procedure for in-situ calibration and atmospheric properties retrieval on (UV-)MultiFilter Rotating Shadowband Radiometer [(UV-)MFRSR]. Previous study has explored a cloud screening algorithm for direct-beam (UV-)MFRSR voltage measurements based on the stability assumption on a long time period (typically a half day or a whole day). To design such an algorithm requires in-depth understanding of radiative transfer and delicate data manipulation. Recent rapid developments on deep neural network and computation hardware have opened a window for modeling complicated End-to-End systems with a standardized strategy. In this study, a multi-layer dynamic bidirectional recurrent neural network is built for determining the cloudiness on each time point with a 17-year training dataset and tested with another 1-year dataset. The dataset is the daily 3-minute cosine corrected voltages, airmasses, and the corresponding cloud/clear-sky labels at two stations of the USDA UV-B Monitoring and Research Program. The results show that the optimized neural network model (3-layer, 250 hidden units, and 80 epochs of training) has an overall test accuracy of 97.87% (97.56% for the Oklahoma site and 98.16% for the Hawaii site). Generally, the neural network model grasps the key concept of the original model to use data in the entire day rather than short nearby measurements to perform cloud screening. A scrutiny of the logits layer suggests that the neural network model automatically learns a way to calculate a quantity similar to total optical depth and finds an appropriate threshold for cloud screening.

  12. Understanding S-shaped current-voltage characteristics of organic solar cells: Direct measurement of potential distributions by scanning Kelvin probe

    Science.gov (United States)

    Saive, Rebecca; Mueller, Christian; Schinke, Janusz; Lovrincic, Robert; Kowalsky, Wolfgang

    2013-12-01

    We present a comparison of the potential distribution along the cross section of bilayer poly(3-hexylthiophene)/1-(3-methoxycarbonyl)propyl-1-phenyl[6,6]C61 (P3HT/PCBM) solar cells, which show normal and anomalous, S-shaped current-voltage (IV) characteristics. We expose the cross sections of the devices with a focussed ion beam and measure them with scanning Kelvin probe microscopy. We find that in the case of S-shaped IV-characteristics, there is a huge potential drop at the PCBM/Al top contact, which does not occur in solar cells with normal IV-characteristics. This behavior confirms the assumption that S-shaped curves are caused by hindered charge transport at interfaces.

  13. Understanding S-shaped current-voltage characteristics of organic solar cells: Direct measurement of potential distributions by scanning Kelvin probe

    International Nuclear Information System (INIS)

    Saive, Rebecca; Kowalsky, Wolfgang; Mueller, Christian; Schinke, Janusz; Lovrincic, Robert

    2013-01-01

    We present a comparison of the potential distribution along the cross section of bilayer poly(3-hexylthiophene)/1-(3-methoxycarbonyl)propyl-1-phenyl[6,6]C61 (P3HT/PCBM) solar cells, which show normal and anomalous, S-shaped current-voltage (IV) characteristics. We expose the cross sections of the devices with a focussed ion beam and measure them with scanning Kelvin probe microscopy. We find that in the case of S-shaped IV-characteristics, there is a huge potential drop at the PCBM/Al top contact, which does not occur in solar cells with normal IV-characteristics. This behavior confirms the assumption that S-shaped curves are caused by hindered charge transport at interfaces

  14. Hypoxyradiotherapy: lack of experimental evidence for a preferential radioprotective effect on normal versus tumor tissue as shown by direct oxygenation measurements in experimental sarcomas

    International Nuclear Information System (INIS)

    Kelleher, Debra K.; Thews, Oliver; Vaupel, Peter

    1997-01-01

    Aim: In order to investigate possible pathophysiological mechanisms underlying the postulated preferential protective effect of hypoxia on normal tissue during radiotherapy, the impact of acute respiratory hypoxia (8.2% O 2 + 91.8% N 2 ) on tissue oxygenation was assessed. Methods: Tumor and normal tissue oxygenation was directly determined using O 2 -sensitive electrodes in two experimental rat tumors (DS and Yoshida sarcomas) and in the normal subcutis of the hind foot dorsum. Results: During respiratory hypoxia, arterial blood O 2 tension (pO 2 ), oxyhemoglobin saturation and mean arterial blood pressure decreased. Changes in the arterial blood gas status were accompanied by a reflex hyperventilation leading to hypocapnia and respiratory alkalosis. In the subcutis, tissue oxygenation worsened during acute hypoxia, with decreases in the mean and median pO 2 . Significant increases in the hypoxic fractions were, however, not seen. In tumor tissues, oxygenation also worsened upon hypoxic hypoxia with significant decreases in the mean and median pO 2 and increases in the size of the hypoxic fractions for both sarcomas. Conclusion: These results suggest that during respiratory hypoxia, radiobiologically relevant reductions in the oxygenation (and a subsequent selective radioprotection) of normal tissue may not be achieved. In addition, in the tumor models studied, a worsening of tumor oxygenation was seen which could result in an increased radioresistance

  15. Asymptotic normalization coefficients (nuclear vertex constants) for the p+7Be→8B and the 7Be(p, γ)8B astrophysical S-factors at solar energies

    International Nuclear Information System (INIS)

    Igamov, S.B.; Yarmukhamedov, R.

    2007-01-01

    Full text: The 7 Be(p,γ) 8 B reaction rate given by in terms of the zero-energy astrophysical S-factor S(0) is one of the main input data in the solar neutrino problem because the high energy neutrinos are produced via the decay 8 B→ 7 Be+e + + n e . This quantity is determined by both extrapolating the measured absolute cross sections σexp (E) (or equivalently its experimental S-factors S exp (E) ) to solar energies (≅ 25 keV) and the theoretical predictions. Despite the steady and impressive progress in our understanding of this reaction have been made in last years in measurements S exp (E) at extremely low energies and the theoretical predictions S(E) at solar energies (E≤25 keV), ambiguities (up to about 35%) associated with prediction for S(0) however still exist, and it may considerably influence the predictions of the standard solar model. In this work the modified two - body potential approach is applied for a new analysis of the highly precise experimental astrophysical S-factors for the direct capture 7 Be(p, γ) 8 B reaction at E≤400 keV and 1000≤E≤1200 keV to obtain 'indirectly measured' values both of the asymptotic normalization coefficient (ANC) for the p+ 7 Be→ 8 B and of S(E) at E≤115 keV, including E=0. In this approach S(E) is expressed in the terms of ANC C Aα;lj 2 but not in the terms of the usual spectroscopic factor Z Aα;lj , which is related to the ANC C Aα;l. j as Z aα;lj =C Aα;lj 2 /b lj 2 , where b lj is the single-particle ANC for the wave function of the bound 8 B( 7 Be+p) state calculated within the shell model using the phenomenological Woods-Saxon potential with the geometric parameters (a radius r o and a diffuseness a). The approach allows one to remove the model dependence of the calculated direct on S(E) on the geometric parameters r o and a both for the two-body bound ( 7 Be+p) state and the p 7 Be- scattering state in minimum. The analysis of the experimental S exp (E) is performed by verifying values of

  16. Anodal transcranial direct current stimulation transiently improves contrast sensitivity and normalizes visual cortex activation in individuals with amblyopia.

    Science.gov (United States)

    Spiegel, Daniel P; Byblow, Winston D; Hess, Robert F; Thompson, Benjamin

    2013-10-01

    Amblyopia is a neurodevelopmental disorder of vision that is associated with abnormal patterns of neural inhibition within the visual cortex. This disorder is often considered to be untreatable in adulthood because of insufficient visual cortex plasticity. There is increasing evidence that interventions that target inhibitory interactions within the visual cortex, including certain types of noninvasive brain stimulation, can improve visual function in adults with amblyopia. We tested the hypothesis that anodal transcranial direct current stimulation (a-tDCS) would improve visual function in adults with amblyopia by enhancing the neural response to inputs from the amblyopic eye. Thirteen adults with amblyopia participated and contrast sensitivity in the amblyopic and fellow fixing eye was assessed before, during and after a-tDCS or cathodal tDCS (c-tDCS). Five participants also completed a functional magnetic resonance imaging (fMRI) study designed to investigate the effect of a-tDCS on the blood oxygen level-dependent response within the visual cortex to inputs from the amblyopic versus the fellow fixing eye. A subgroup of 8/13 participants showed a transient improvement in amblyopic eye contrast sensitivity for at least 30 minutes after a-tDCS. fMRI measurements indicated that the characteristic cortical response asymmetry in amblyopes, which favors the fellow eye, was reduced by a-tDCS. These preliminary results suggest that a-tDCS deserves further investigation as a potential tool to enhance amblyopia treatment outcomes in adults.

  17. Frosting characteristics and heating performance of a direct-expansion solar-assisted heat pump for space heating under frosting conditions

    International Nuclear Information System (INIS)

    Huang, Wenzhu; Ji, Jie; Xu, Ning; Li, Guiqiang

    2016-01-01

    Highlights: • Frosting and heating performance of DX-SAHP under frosting conditions is investigated. • The conditions when DX-SAHP frosts are studied. • The frosting process is observed during 360 min of operating. • The effect of ambient temperature, relative humidity and solar irradiation is analyzed. - Abstract: Direct expansion solar-assisted heat pump system (DX-SAHP) is promising in energy saving applications, but the performance of DX-SAHP under frosting conditions is rarely reported in the published literatures. In this paper, a DX-SAHP system with bare solar collectors for space heating is designed and experimentally investigated in the enthalpy difference lab with a solar simulator. The system is tested under a range of frosting conditions, with the ambient temperatures from 7 °C to −3 °C, the relative humidities of 50%, 70% and 90% and the solar irradiances of 0 W/m"2, 100 W/m"2, 200 W/m"2 and 300 W/m"2. The conditions when the DX-SAHP system frosts are studied. Results show that solar irradiance as low as 100 W/m"2 can totally prevent frosting when the ambient temperature is above −3 °C and the relative humidity is 70%. Besides, the frosting process is observed to be slower than that of fin-and-tube heat exchangers. The evaporator is not seriously frosted and the system performance is not significantly influenced after 360 min of continuous operating. Moreover the effects of ambient parameters, including the ambient temperature and the relative humidity, especially solar irradiation, on the system performance are studied and analyzed. Solar irradiation can effectively prevent or retard frosting, and also improve the heating performance of the DX-SAHP system. The DX-SAHP system is proved to be applicable under frosting conditions.

  18. ANALYSIS OF MEASURED AND MODELED SOLAR RADIATION AT THE TARS SOLAR HEATING PLANT IN DENMARK

    DEFF Research Database (Denmark)

    Tian, Zhiyong; Perers, Bengt; Furbo, Simon

    2017-01-01

    , such as solar radiation, inlet and outlet temperature for the solar collector field, flow rate and pressure, ambient temperature, Wind speed and wind direction were measured. Global horizontal radiation, direct normal irradiation (DNI) and total radiation on the tilted collector plane of the flat plate...... collector field have been measured in Tars solar heating plant. To determine the accuracy of modeled and measured solar radiation in Tars solar heating plant, monthly comparisons of measured and calculated radiation using 6 empirical models have been carried out. Comparisons of measured and modeled total......A novel combined solar heating plant with tracking parabolic trough collectors (PTC) and flat plate collectors (FPC) has been constructed and put into operation in Tars, 30 km north of Aalborg, Denmark in August 2015. To assess the operation performance of the plant, detailed parameters...

  19. Dual direction blower system powered by solar energy to reduce car cabin temperature in open parking condition

    Science.gov (United States)

    Hamdan, N. S.; Radzi, M. F. M.; Damanhuri, A. A. M.; Mokhtar, S. N.

    2017-10-01

    El-nino phenomenon that strikes Malaysia with temperature recorded more than 35°C can lead to extreme temperature rise in car cabin up to 80°C. Various problems will arise due to this extreme rising of temperature such as the occupant are vulnerable to heat stroke, emission of benzene gas that can cause cancer due to reaction of high temperature with interior compartments, and damage of compartments in the car. The current solution available to reduce car cabin temperature including tinted of window and portable heat rejection device that are available in the market. As an alternative to reduce car cabin temperature, this project modifies the car’s air conditioning blower motor into dual direction powered by solar energy and identifies its influence to temperature inside the car, parked under scorching sun. By reducing the car cabin temperature up to 10°C which equal to 14% of reduction in the car cabin temperature, this simple proposed system aims to provide comfort to users due to its capability in improving the quality of air and moisture in the car cabin.

  20. Modulation of dayside on and neutral distributions at Venus Evidence of direct and indirect solar energy inputs

    Science.gov (United States)

    Taylor, H. A., Jr.; Mayr, H. G.; Grebowsky, J. M.; Niemann, H. B.; Hartle, R. E.; Cloutier, P. A.; Barnes, A.; Daniell, R. E., Jr.

    1982-01-01

    The details of solar variability and its coupled effects on the Venusian dayside are examined for evidence of short-term perturbations and associated energy inputs. Ion and neutral measurements obtained from the Orbiter Ion Mass Spectrometer and Orbital Neutral mass Spectrometer are used to show that the dayside concentrations of CO2(+) and the neutral gas temperature are smoothly modulated with a 28-day cycle reasonably matching that of the solar F(10.7) and EUV fluxes. Earlier measurements show less pronounced and more irregular modulations and more conspicuous short-term day-to-day fluctuations in the ions and neutrals, as well as relatively large enhancements in the solar wind, which appear consistent with differences in solar coronal behavior during the two periods. It is suggested that the solar wind variations cause fluctuations in joule heating, producing the observed short-term ion and neutral variations.

  1. Solar Wind Halo Formation by the Scattering of the Strahl via Direct Cluster/PEACE Observations of the 3D Velocity Distribution Function

    Science.gov (United States)

    Figueroa-Vinas, Adolfo; Gurgiolo, Chris A.; Nieves-Chinchilla, Teresa; Goldstein, Melvyn L.

    2010-01-01

    It has been suggested by a number of authors that the solar wind electron halo can be formed by the scattering of the strahl. On frequent occasions we have observed in electron angular skymaps (Phi/Theta-plots) of the electron 3D velocity distribution functions) a bursty-filament of particles connecting the strahl to the solar wind core-halo. These are seen over a very limited energy range. When the magnetic field is well off the nominal solar wind flow direction such filaments are inconsistent with any local forces and are probably the result of strong scattering. Furthermore, observations indicates that the strahl component is frequently and significantly anisotropic (Tper/Tpal approx.2). This provides a possible free energy source for the excitation of whistler waves as a possible scattering mechanism. The empirical observational evidence between the halo and the strahl suggests that the strahl population may be, at least in part, the source of the halo component.

  2. Evaluation of fault-normal/fault-parallel directions rotated ground motions for response history analysis of an instrumented six-story building

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2012-01-01

    According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  3. Effects of cathodal trans-spinal direct current stimulation on lower urinary tract function in normal and spinal cord injury mice with overactive bladder

    Science.gov (United States)

    Ahmed, Zaghloul

    2017-10-01

    Objective. Lower urinary tract (LUT) dysfunction is a monumental problem affecting quality of life following neurotrauma, such as spinal cord injury (SCI). Proper function of the bladder and its associated structures depends on coordinated activity of the neuronal circuitry in the spinal cord and brain. Disconnection between the spinal and brain centers controlling the LUT causes fundamental changes in the mechanisms involved in the micturition and storage reflexes. We investigated the effects of cathodal trans-spinal direct current stimulation (c-tsDCS) of the lumbosacral spine on bladder and external urinary sphincter (EUS) functions. Approach. We used cystometry and electromyography (EMG), in mice with and without SCI. Main results. c-tsDCS caused initiation of the micturition reflex in urethane-anesthetized normal mice with depressed micturition reflexes. This effect was associated with normalized EUS-EMG activity. Moreover, in urethane-anesthetized normal mice with expressed micturition reflexes, c-tsDCS increased the firing frequency, amplitude, and duration of EUS-EMG activity. These effects were associated with increased maximum intravesical pressure (P max) and intercontraction interval (ICI). In conscious normal animals, c-tsDCS caused significant increases in P max, ICI, threshold pressure (P thres), baseline pressure (P base), and number and amplitude of non-voiding contractions (NVCnumb and P im, respectively). In conscious mice with severe contusive SCI and overactive bladder, c-tsDCS increased P max, ICI, and P thres, but decreased P base, NVCnumb, and P im. c-tsDCS reduced the detrusor-overactivity/cystometry ratio, which is a measure of bladder overactivity associated with renal deterioration. Significance. These results indicate that c-tsDCS induces robust modulation of the lumbosacral spinal-cord circuitry that controls the LUT.

  4. Coordinated weather balloon solar radiation measurements during a solar eclipse.

    Science.gov (United States)

    Harrison, R G; Marlton, G J; Williams, P D; Nicoll, K A

    2016-09-28

    Solar eclipses provide a rapidly changing solar radiation environment. These changes can be studied using simple photodiode sensors, if the radiation reaching the sensors is unaffected by cloud. Transporting the sensors aloft using standard meteorological instrument packages modified to carry extra sensors, provides one promising but hitherto unexploited possibility for making solar eclipse radiation measurements. For the 20 March 2015 solar eclipse, a coordinated campaign of balloon-carried solar radiation measurements was undertaken from Reading (51.44°N, 0.94°W), Lerwick (60.15°N, 1.13°W) and Reykjavik (64.13°N, 21.90°W), straddling the path of the eclipse. The balloons reached sufficient altitude at the eclipse time for eclipse-induced variations in solar radiation and solar limb darkening to be measured above cloud. Because the sensor platforms were free to swing, techniques have been evaluated to correct the measurements for their changing orientation. In the swing-averaged technique, the mean value across a set of swings was used to approximate the radiation falling on a horizontal surface; in the swing-maximum technique, the direct beam was estimated by assuming that the maximum solar radiation during a swing occurs when the photodiode sensing surface becomes normal to the direction of the solar beam. Both approaches, essentially independent, give values that agree with theoretical expectations for the eclipse-induced radiation changes.This article is part of the themed issue 'Atmospheric effects of solar eclipses stimulated by the 2015 UK eclipse'. © 2016 The Authors.

  5. Experimental Investigation of a Direct-drive Hall Thruster and Solar Array System at Power Levels up to 10 kW

    Science.gov (United States)

    Snyder, John S.; Brophy, John R.; Hofer, Richard R.; Goebel, Dan M.; Katz, Ira

    2012-01-01

    As NASA considers future exploration missions, high-power solar-electric propulsion (SEP) plays a prominent role in achieving many mission goals. Studies of high-power SEP systems (i.e. tens to hundreds of kilowatts) suggest that significant mass savings may be realized by implementing a direct-drive power system, so NASA recently established the National Direct-Drive Testbed to examine technical issues identified by previous investigations. The testbed includes a 12-kW solar array and power control station designed to power single and multiple Hall thrusters over a wide range of voltages and currents. In this paper, single Hall thruster operation directly from solar array output at discharge voltages of 200 to 450 V and discharge powers of 1 to 10 kW is reported. Hall thruster control and operation is shown to be simple and no different than for operation on conventional power supplies. Thruster and power system electrical oscillations were investigated over a large range of operating conditions and with different filter capacitances. Thruster oscillations were the same as for conventional power supplies, did not adversely affect solar array operation, and were independent of filter capacitance from 8 to 80 ?F. Solar array current and voltage oscillations were very small compared to their mean values and showed a modest dependence on capacitor size. No instabilities or anomalous behavior were observed in the thruster or power system at any operating condition investigated, including near and at the array peak power point. Thruster startup using the anode propellant flow as the power 'switch' was shown to be simple and reliable with system transients mitigated by the proper selection of filter capacitance size. Shutdown via cutoff of propellant flow was also demonstrated. A simple electrical circuit model was developed and is shown to have good agreement with the experimental data.

  6. Reports on 1979 result of Sunshine Project. Research on solar energy system (meteorological investigation); 1979 nendo taiyo energy system no kenkyu seika hokokusho. Kisho chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1980-03-31

    The following were implemented with the purpose of collecting, measuring and putting in order the meteorological data required for the R and D on solar energy technology. (1) Observation of direct solar radiation (Nagoya/Sendai), (2) Meteorological observation for the pilot plant site of 1,000kW solar thermal power generation, (3) Studies on estimation of quantity of direct solar radiation, and (4) Studies on characteristics of quantity of direct solar radiation. In (1), the summary and the results were explained on the continuous observation of the quantity of the direct solar radiation conducted in Nagoya and Sendai using a self-recording actinometer. In (2), meteorological observation was conducted for building lots reclaimed from a salt pan at Nio-cho, Mitoyo county, Kagawa prefecture, a scheduled site for the pilot plant. The items were the quantity of global solar radiation, quantity of sky solar radiation, quantity of direct solar radiation, temperature, wet-bulb temperature, wind direction and wind velocity. In (3), A method was developed for estimating the monthly average quantity of the global solar radiation, normal direct solar radiation, horizontal sky solar radiation at an arbitrary spot. In (4), the characteristics of direct/specified direct solar radiation flux curves were elucidated as the basic data for the technological development of solar energy utilization using a sun follower type heat collecting device, with research done on a method for estimating these curves from other meteorological factors. (NEDO)

  7. Optimum performance of the small scale open and direct solar thermal Brayton cycle at various environmental conditions and constraints

    Energy Technology Data Exchange (ETDEWEB)

    Le Roux, W.G.; Bello-Ochende, T.; Meyer, J.P. [Department of Mechanical and Aeronautical Engineering, University of Pretoria, (South Africa)

    2011-07-01

    The energy of the sun can be transformed into mechanical power through the use of concentrated solar power systems. The use of the Brayton cycle with recuperator has significant advantages but also raises issues such as pressure loss and low net power output which are mainly due to irreversibilities of heat transfer and fluid friction. The aim of this study is to optimize the system to generate maximum net power output. Thermodynamic and dynamic trajectory optimizations were performed on a dish concentrator and an off-the-shelf micro-turbine and the effects of wind, solar irradiance and other environmental conditions and constraints on the power output were analyzed. Results showed that the maximum power output is increased when wind decreases and irradiance increases; solar irradiance was found to have a more significant impact than wind. This study highlighted the factors which impact the power generation of concentrated solar power systems so that designers can take them into account.

  8. Removal of spurious normal polarity directions in the Kanapoi Formation with progressive thermal demagnetization: implications for dating Pliocene hominin fossils from the Turkana Basin of Kenya

    Science.gov (United States)

    Lepre, C. J.; Kent, D.

    2017-12-01

    The Kanapoi Formation is a 75-m-thick sedimentary unit in northern Kenya whose fossil record documents the evolution of the genus Australopithecus and habitual bipedalism in Pliocene hominins. Published 40Ar/39Ar dates of 4.20 to 4.10 Ma for three aqueously reworked tuffs from the lower and middle stratigraphic intervals of the formation and a whole-rock K-Ar date of 3.4 ± 0.1 Ma on the Kalokwanya Basalt, which caps the succession, coupled with paleomagnetic data from an unpublished thesis have been used to constrain the age of the unit (McDougall+2012 J Geol Soc). Normal polarities at the base of the formation were correlated to normal subchron C3n.1n (Cochiti Subchron) and would extend the Kanapoi chronostratigraphy back to between 4.29 and 4.18 Ma. The credibility of the normal polarities at the base and elsewhere in the formation as records of the geomagnetic field at the time of deposition, however, is called into question by the ubiquity of the high-coercivity mineral hematite in the Kanapoi sediments and the alternating field demagnetization methods exclusively used to generate the polarity directions. We tested this proposed chronostratigraphy of the Kanapoi Fm by collecting nearly 70 independently orientated block samples from 10 outcrop localities, which sampled roughly two-thirds of the total stratigraphic thickness of the formation and covered the entire vertical extent of the supposed basal normal polarity magnetozone. For most every specimen, stepwise thermal demagnetization (TD) resolved well-defined characteristic magnetizations of uniformly reverse polarity and were carried by a high-temperature component consistent with hematite. TD of the Kalokwanya Basalt confirmed its reverse magnetic polarity, which implies emplacement most likely prior to the base of normal Chron C2An (Gauss Chron) at 3.58 Ma. Kanapoi sediments thus accumulated sometime during reverse subchron C2Ar (4.18-3.58 Ma) but over a period of much less than 600 kyr. Basal age control

  9. Energy Harvesting Through Optical Properties of TiO2 and C- TiO2 Nanofluid for Direct Absorption Solar Collectors

    OpenAIRE

    alagappan, subramaniyan; Subramaniyan, A. L.; Lakshmi Priya, S.; Ilangovan, R.

    2016-01-01

    Nanofluids are tailored suspensions of nanoparticles in a suitable base fluid. The discovery of  nanofluids by Stephen choi opened a new heat transfer mechanism. Since then several research has taken place to explore thermal, electrical and magnetic property of nanofluids. Nanofluids showed enhanced electrical and thermal conductivities. The nanofluids are also proved as a potential candidate for direct absorption solar collectors (DASC). The present work investigates the effect of nanopartic...

  10. Solar radiation on Mars: Update 1991

    Science.gov (United States)

    Appelbaum, Joseph; Landis, Geoffrey A.

    1991-01-01

    Detailed information on solar radiation characteristics on Mars are necessary for effective design of future planned solar energy systems operating on the surface of Mars. A procedure and solar radiation related data are presented from which the daily variation of the global, direct beam and diffuse insolation on Mars are calculated. Given the optical depth of the Mars atmosphere, the global radiation is calculated from the normalized net flux function based on multiple wavelength and multiple scattering of the solar radiation. The direct beam was derived from the optical depth using Beer's law, and the diffuse component was obtained from the difference of the global and the direct beam radiation. The optical depths of the Mars atmosphere were derived from images taken of the Sun with a special diode on the cameras used on the two Viking Landers.

  11. Design and simulation of a heat transformer of a directly solar-driven diffusion absorption chiller; Auslegung und Simulation von Waermeuebertragern einer direkt solarthermisch angetriebenen Diffusions-Absorptionskaeltemaschine

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Josua; Schmid, Fabian; Spindler, Klaus [Stuttgart Univ. (DE). Inst. fuer Thermodynamik und Waermetechnik (ITW)

    2011-07-01

    The ITW is working on a directly solar-driven diffusion absorption chiller. Solar cooling offers vast potential for saving fossil resources, e.g. owing to the good temporal agreement between insolation and cold demand for cooling of office buildings and domestic buildings. So far, the focus has been on central systems with indirect solar thermal operation. Direct solar thermal plants can be decentral. A diffusion-absorption refrigeration system without mechanical components was constructed. Solvent circulation is achieved by the thermosyphon principle, which makes the plant noiseless, wear-free, and low-maintenance. In the course of a study, a mathematical model of the heat exchangers was established on the basis of the heat transfer equations, and optimisation suggestions for the heat exchanger were identified on this basis. The influence of the pressure gradient - which is decisive -, and the influence of geometry and materials were investigated. The simulations were validated by measurements. Concrete optimisation potentials were identified, and first suggestions were implemented. [German] Am ITW wird intensiv an einer direkt solarthermisch angetriebenen Diffusions-Absorptionskaeltemaschine (DAKM) geforscht. Die solare Kuehlung bietet grosse Potentiale zur Einsparung fossiler Energietraeger. Ein Grund dafuer ist die gute zeitliche Uebereinstimmung zwischen Solarstrahlung und dem Kaeltebedarf fuer die Kuehlung von Wohngebaeuden und Bueros. Bislang standen zentrale und indirekt solarthermisch angetriebene Systeme zur Kaelteerzeugung im Fokus. Die direkt solarthermisch angetriebene Anlage kann auf Grund ihres neuen Konzepts dezentral aufgebaut und betrieben werden. Auf Grundlage des Diffusions-Absorptionskaelteprozesses wurde eine Anlage gebaut, die ohne mechanische Bauteile funktioniert. Der Loesungsmittelumlauf erfolgt durch das Thermosiphonprinzip. Dadurch ist die Anlage im Betrieb geraeuschlos, verschleissfrei und wartungsarm. Im Rahmen einer Studienarbeit

  12. Development of the apparatus for measuring magnetic properties of electrical steel sheets in arbitrary directions under compressive stress normal to their surface

    Directory of Open Access Journals (Sweden)

    Yoshitaka Maeda

    2017-05-01

    Full Text Available In designing motors, one must grasp the magnetic properties of electrical steel sheets considering actual conditions in motors. Especially important is grasping the stress dependence of magnetic power loss. This paper describes a newly developed apparatus to measure two-dimensional (2-D magnetic properties (properties under the arbitrary alternating and the rotating flux conditions of electrical steel sheets under compressive stress normal to the sheet surface. The apparatus has a 2-D magnetic excitation circuit to generate magnetic fields in arbitrary directions in the evaluation area. It also has a pressing unit to apply compressive stress normal to the sheet surface. During measurement, it is important to apply uniform stress throughout the evaluation area. Therefore, we have developed a new flux density sensor using needle probe method. It is composed of thin copper foils sputtered on electrical steel sheets. By using this sensor, the stress can be applied to the surface of the specimen without influence of this sensor. This paper described the details of newly developed apparatus with this sensor, and measurement results of iron loss by using are shown.

  13. Development of the apparatus for measuring magnetic properties of electrical steel sheets in arbitrary directions under compressive stress normal to their surface

    Science.gov (United States)

    Maeda, Yoshitaka; Urata, Shinya; Nakai, Hideo; Takeuchi, Yuuya; Yun, Kyyoul; Yanase, Shunji; Okazaki, Yasuo

    2017-05-01

    In designing motors, one must grasp the magnetic properties of electrical steel sheets considering actual conditions in motors. Especially important is grasping the stress dependence of magnetic power loss. This paper describes a newly developed apparatus to measure two-dimensional (2-D) magnetic properties (properties under the arbitrary alternating and the rotating flux conditions) of electrical steel sheets under compressive stress normal to the sheet surface. The apparatus has a 2-D magnetic excitation circuit to generate magnetic fields in arbitrary directions in the evaluation area. It also has a pressing unit to apply compressive stress normal to the sheet surface. During measurement, it is important to apply uniform stress throughout the evaluation area. Therefore, we have developed a new flux density sensor using needle probe method. It is composed of thin copper foils sputtered on electrical steel sheets. By using this sensor, the stress can be applied to the surface of the specimen without influence of this sensor. This paper described the details of newly developed apparatus with this sensor, and measurement results of iron loss by using are shown.

  14. normal'>Be7 solar neutrino measurement with KamLAND

    Energy Technology Data Exchange (ETDEWEB)

    Gando, A.; Gando, Y.; Hanakago, H.; Ikeda, H.; Inoue, K.; Ishidoshiro, K.; Ishikawa, H.; Kishimoto, Y.; Koga, M.; Matsuda, R.; Matsuda, S.; Mitsui, T.; Motoki, D.; Nakajima, K.; Nakamura, K.; Obata, A.; Oki, A.; Oki, Y.; Otani, M.; Shimizu, I.; Shirai, J.; Suzuki, A.; Tamae, K.; Ueshima, K.; Watanabe, H.; Xu, B. D.; Yamada, S.; Yamauchi, Y.; Yoshida, H.; Kozlov, A.; Takemoto, Y.; Yoshida, S.; Grant, C.; Keefer, G.; McKee, D. W.; Piepke, A.; Banks, T. I.; Bloxham, T.; Freedman, S. J.; Fujikawa, B. K.; Han, K.; Hsu, L.; Ichimura, K.; Murayama, H.; O' Donnell, T.; Steiner, H. M.; Winslow, L. A.; Dwyer, D.; Mauger, C.; McKeown, R. D.; Zhang, C.; Berger, B. E.; Lane, C. E.; Maricic, J.; Miletic, T.; Learned, J. G.; Sakai, M.; Horton-Smith, G. A.; Tang, A.; Downum, K. E.; Tolich, K.; Efremenko, Y.; Kamyshkov, Y.; Perevozchikov, O.; Karwowski, H. J.; Markoff, D. M.; Tornow, W.; Detwiler, J. A.; Enomoto, S.; Heeger, K.; Decowski, M. P.

    2015-11-30

    We report a measurement of the neutrino-electron elastic scattering rate of 862 keV 7Be solar neutrinos based on a 165.4 kt d exposure of KamLAND. The observed rate is 582±94(kt d)₋1, which corresponds to an 862-keV 7Be solar neutrino flux of (3.26±0.52)×109cm₋2s₋1, assuming a pure electron-flavor flux. Comparing this flux with the standard solar model prediction and further assuming three-flavor mixing, a νe survival probability of 0.66±0.15 is determined from the KamLAND data. Lastly, utilizing a global three-flavor oscillation analysis, we obtain a total 7Be solar neutrino flux of (5.82±1.02)×109cm₋2s₋1, which is consistent with the standard solar model predictions.

  15. The Direct and Indirect Impact of Pharmaceutical Industry in Economic Expansion and Job Creation: Evidence from Bootstrapping and Normal Theory Methods

    Directory of Open Access Journals (Sweden)

    Rizwan Raheem Ahmed

    2018-05-01

    Full Text Available The objective of this research article is to examine the role of Pakistan’s pharmaceutical industry in job creation opportunities, with the sacred intention to eradicate poverty, and expansion in economic activities. This research is quantitative in nature, and the data is directly gathered through closed-ended questionnaires from 300 respondents. Besides predictors’, four mediating variables have also been taken into consideration that contribute indirectly in job creation opportunities. Bootstrapping and Normal theory methods have been employed in order to examine the impact of predictors’ and mediating variables. The result of this research confirmed that pharmaceutical industry plays a vital role in job creation in Pakistan. It is further concluded that the pharmaceutical industry has a direct and significant impact in job creation by providing indigenous and direct job opportunities in sales, marketing, and other supporting departments for both skilled and unskilled workers. Pharmaceutical industry also provides indirect job opportunities through other industries, which are very much linked with this industry, such as: pharmaceutical distributors, dealers, retailers, wholesalers, hotel industry, and event management industry. It is also determined that pharmaceutical industry is acting like knowledge and skills imparting institutions. Therefore, skilled-based training and organizational learning are major mediating variables that transform unskilled people into human assets, which further trigger the future job prospects. Since pharmaceutical industry is one of the biggest industries in Pakistan, providing plenteous opportunities of new jobs with consistent growth. Thus, mediating variables such as motivation and interpersonal influence also preceded an active role in new job creation

  16. Performance analysis of a Kalina cycle for a central receiver solar thermal power plant with direct steam generation

    DEFF Research Database (Denmark)

    Modi, Anish; Haglind, Fredrik

    2014-01-01

    Solar thermal power plants have attracted increasing interest in the past few years - with respect to both the design of the various plant components, and extending the operation hours by employing different types of storage systems. One approach to improve the overall plant efficiency is to use ...

  17. Feasibility of using ammonia-water mixture in high temperature concentrated solar power plants with direct vapour generation

    DEFF Research Database (Denmark)

    Modi, Anish; Knudsen, Thomas; Haglind, Fredrik

    2014-01-01

    Concentrated solar power plants have attracted an increasing interest in the past few years – both with respect to the design of various plant components, and extending the operation hours by employing different types of storage systems. One approach to improve the overall plant performance is to...

  18. Radial direct bandgap p-i-n GaNP microwire solar cells with enhanced short circuit current

    Energy Technology Data Exchange (ETDEWEB)

    Sukrittanon, Supanee [Graduate Program of Materials Science and Engineering, University of California, San Diego, La Jolla, California 92037 (United States); Liu, Ren; Pan, Janet L. [Department of Electrical and Computer Engineering, University of California, San Diego, La Jolla, California 92037 (United States); Breeden, Michael C. [Department of Nanoengineering, University of California, San Diego, La Jolla, California 92037 (United States); Jungjohann, K. L. [Center for Integrated Nanotechnologies, Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Tu, Charles W., E-mail: ctu@ece.ucsd.edu, E-mail: sdayeh@ece.ucsd.edu; Dayeh, Shadi A., E-mail: ctu@ece.ucsd.edu, E-mail: sdayeh@ece.ucsd.edu [Graduate Program of Materials Science and Engineering, University of California, San Diego, La Jolla, California 92037 (United States); Department of Electrical and Computer Engineering, University of California, San Diego, La Jolla, California 92037 (United States)

    2016-08-07

    We report the demonstration of dilute nitride heterostructure core/shell microwire solar cells utilizing the combination of top-down reactive-ion etching to create the cores (GaP) and molecular beam epitaxy to create the shells (GaNP). Systematic studies of cell performance over a series of microwire lengths, array periods, and microwire sidewall morphologies examined by transmission electron microscopy were conducted to shed light on performance-limiting factors and to optimize the cell efficiency. We show by microscopy and correlated external quantum efficiency characterization that the open circuit voltage is degraded primarily due to the presence of defects at the GaP/GaNP interface and in the GaNP shells, and is not limited by surface recombination. Compared to thin film solar cells in the same growth run, the microwire solar cells exhibit greater short circuit current but poorer open circuit voltage due to greater light absorption and number of defects in the microwire structure, respectively. The comprehensive understanding presented in this work suggests that performance benefits of dilute nitride microwire solar cells can be achieved by further tuning of the epitaxial quality of the underlying materials.

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. Direct C-H Arylation Meets Perovskite Solar Cells: Sn-Free Synthesis Shortcut to High Performance Hole-Transporting Materials.

    Science.gov (United States)

    Chang, Yu-Chieh; Lee, Kun-Mu; Lai, Chia-Hsin; Liu, Ching-Yuan

    2018-03-30

    In contrast to the traditional multistep synthesis, we demonstrate herein a two-step synthesis-shortcut to triphenylamine-based hole-transporting materials (HTMs) through sequential direct C-H arylations. These hole-transporting molecules are fabricated in perovskite-based solar cells (PSCs), exhibiting promising efficiencies up to 17.69%, which is comparable to PSCs utilizing the commercially available spiro-OMeTAD as HTM. This is the first report describing the use of step-saving C-H activations/arylations in the facile synthesis of small-molecule HTMs for perovskite solar cells. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Solar electricity and solar fuels

    Science.gov (United States)

    Spiers, David J.

    1989-04-01

    The nature of solar radiation and its variation with location is described. The distribution of energy in the solar spectrum places immediate limits on the theoretical efficiency of conversion processes, since practical absorbers cannot convert all wavelengths received to useful energy. The principles of solar energy conversion methods are described. Absorption of solar energy can give rise to direct electrical generation, heating, or chemical change. Electrical generation from sunlight can be achieved by photovoltaic systems directly or by thermal systems which use solar heat to drive a heat engine and generator. The technology used and under research for promising ways of producing electricity or fuel from solar energy is described. Photovoltaic technology is established today for remote area, small power applications, and photovoltaic module sales alone are over 100 million dollars per year at present. The photovoltaic market has grown steadily since the mid-1970's, as prices have fallen continuously. Future energy options are briefly described. The merits of a sustainable energy economy, based on renewable energy resources, including solar energy, are emphasized, as this seems to provide the only hope of eliminating the problems caused by the build-up of atmospheric carbon dioxide, acid rain pollution and nuclear waste disposal. There is no doubt that clean fuels which were derived from solar energy and either did not involve carbon dioxide and used atmospheric carbon dioxide as the source dioxide as the source of carbon would be a worthy ideal. Methods described could one day achieve this.

  2. Modified two-body potential approach to the peripheral direct capture astrophysical a+A->B+γ reaction and asymptotic normalization coefficients

    International Nuclear Information System (INIS)

    Igamov, S.B.; Yarmukhamedov, R.

    2007-01-01

    A modified two-body potential approach is proposed for determination of both the asymptotic normalization coefficient (ANC) (or the respective nuclear vertex constant (NVC)) for the A+a->B (for the virtual decay B->A+a) from an analysis of the experimental S-factor for the peripheral direct capture a+A->B+γ reaction and the astrophysical S-factor, S(E), at low experimentally inaccessible energy regions. The approach proposed involves two additional conditions which verify the peripheral character of the considered reaction and expresses S(E) in terms of the ANC. The connection between NVC (ANC) and the effective range parameters for Aa-scattering is derived. To test this approach we reanalyse the precise experimental astrophysical S-factors for t+α->Li7+γ reaction at energies E= Li7(g.s.), α+t->Li7(0.478 MeV) and of S(E) at E=<50 keV. These ANC values have been used for getting information about the ''indirect'' measured values of the effective range parameters and the p-wave phase shift for αt-scattering in the energy range of 100-bar E-bar 180 keV

  3. 直膨式太阳能热泵系统仿真%Simulation of Direct Expansion Solar Assisted Heat Pump System

    Institute of Scientific and Technical Information of China (English)

    汪坤海; 闫金州; 邢琳; 关欣

    2017-01-01

    随着太阳能热利用和热泵技术的成熟及商品化,直膨式太阳能热泵技术将太阳能资源的清洁性、可再生性等特点和热泵系统的节能、高效的优点相结合,极具研究价值.但是目前直膨式太阳能热泵不能产品化推广的主要限制因素是系统设计不合理、运行不稳定、整体性能不佳等问题.现以直膨式太阳能热泵系统的优化和设计匹配为研究目标,同时,建立压缩机、集热器/蒸发器、热力膨胀阀、冷凝器及储热水箱的数学模型.从理论上分析集热器中集热面积、太阳能辐照度、环境温度、压缩机容积及冷凝温度等因素对直膨式太阳能热泵系统热工性能的影响,通过系统仿真及实验研究系统的整体热力性能,并在此基础上给出改善系统性能的建议.%With the use of solar thermal energy and the development and commercialization of heat pump technology, the direct - expansion solar - assisted heat pump which combines both the clean, renewable and other properties of solar energy resources with energy-saving and high efficient advantages of heat pump system, has great research values. But now major limiting factors of the direct-expansion solar- assisted heat pump cannot be promoted include the unreasonable system design, the unstable operation, the overall poor performance and other issues. The optimization and design matching of the direct-expansion solar-assisted heat pump system are researched; at the same time, a mathematical model of the heat collector/evaporator, compressor, thermostatic expansion valve, condenser and heat storage water tank is established. The area of heat, solar irradiance, ambient temperature, volume of compressor and condensation temperature and other factors on the effect of direct expansion solar-assisted heat pump system of the thermal performance are analyzed from the theory analysis; the overall thermal performance of the system is simulated and studied with

  4. Behavior of current sheets at directional magnetic discontinuities in the solar wind at 0.72 AU

    Czech Academy of Sciences Publication Activity Database

    Zhang, T. L.; Russell, C. T.; Zambelli, W.; Vörös, Zoltán; Wang, C.; Cao, J. B.; Jian l, L. K.; Strangeway, R. J.; Balikhin, M.; Baumjohann, W.; Delva, M.; Volwerk, M.; Glassmeier, K.; H.

    2008-01-01

    Roč. 35, č. 24 (2008), L24102/1-L24102/5 ISSN 0094-8276 Grant - others:Austrian Wissenschaftfonds(AT) P20131-N16; NNSFC(CN) 40628003; 973 Program(CN) 2006CB806305; NASA (US) NNG06GC62G Institutional research plan: CEZ:AV0Z30420517 Keywords : solar wind * current sheets * magnetic annihilation Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 2.959, year: 2008

  5. Photothermal response of CVD synthesized carbon (nanospheres/aqueous nanofluids for potential application in direct solar absorption collectors: a preliminary investigation

    Directory of Open Access Journals (Sweden)

    Poinern GE

    2012-07-01

    Full Text Available Gérrard Eddy Jai Poinern,1 Sridevi Brundavanam,1 Monaliben Shah,1 Iafeta Laava,2 Derek Fawcett11Murdoch Applied Nanotechnology Research Group, 2Department of Physics, Energy Studies and Nanotechnology, Murdoch University, Perth, AustraliaAbstract: Direct-absorption solar collectors have the potential to offer an unlimited source of renewable energy with minimal environmental impact. Unfortunately, their performance is limited by the absorption efficiency of the working fluid. Nanoparticles of functionalized carbon nanospheres (CNS have the potential to improve the photothermal properties of the working fluid. CNS are produced by the pyrolysis of acetylene gas in a tube-based electric furnace/chemical vapor deposition apparatus. The reaction takes place at 1000°C in the presence of nitrogen gas without the use of a catalyst. The synthesized CNS were examined and characterized using field-emission scanning electron microscopy, transmission electron microscopy, X-ray diffraction spectroscopy, Raman spectroscopy, thermal gravimetric analysis, and ultraviolet-visible analysis. The CNS powders with a mean particle size of 210 nm were then functionalized using tetraethylammonium hydroxide ([C2H5]4 N[OH] and used to produce a series of aqueous nanofluids with varying mass content. The photothermal response of both the nanofluids and films composed of CNS were investigated under 1000 W/m2 solar irradiation.Keywords: solar absorption, carbon nanospheres, nanofluids, photothermal

  6. Solar chulha

    Energy Technology Data Exchange (ETDEWEB)

    Jadhao, P. H. [Department of Physics J.D. Institute of Engg. & Tech. Yavatmal (India); Patrikar, S. R. [Department of Physics VNIT, Nagpur (India)

    2016-05-06

    The main goal of the proposed system is to transfer energy from sun to the cooking load that is located in the kitchen. The energy is first collected by the solar collector lens system and two curve bars of same radius of curvature are mounted parallel and adjacent to each other at different height the solar collector is clamed on this two bars such that solar collector is exactly perpendicular to sunlight. The topology includes an additional feature which is window in the wall through which the beam is collimated is directed in the of kitchen. The solar energy that is collected is directed by the mirror system into the kitchen, where it is redirected to cooking platform located in the kitchen. The special feature in this system full Indian meal can be made since cooking platform is indoors.

  7. Reduction of Energy Consumption and CO2 Emissions in Domestic Water Heating by Means of Direct Expansion Solar Assisted Heat Pump

    International Nuclear Information System (INIS)

    Baleta, J.; Curko, T.; Cutic, T.; Pasanec, J.; Soldo, V.

    2012-01-01

    Domestic water heating in households sector is usually performed by either fossil fuel fired or electric boilers. Both the combustion process of the former and large electricity consumption of the latter strongly influence overall greenhouse gas emissions. Moreover, very high specific heat of water requires large quantity of energy for water heating making a significant impact on the overall energy consumption in the households sector whose total consumption of 80,81 PJ equals to 19,6% of total primary energy supply in Croatia in 2010. Considering the mentioned impact on energy consumption and CO 2 emissions as well as goals set by European Commission (so called 20-20-20), new technologies based on renewable energy sources are more than welcome in the field of domestic water heating. Direct expansion solar assisted heat pump is presented in this paper. Its working principle is based on single-stage vapour-compression cycle. Representing a gradual step to commercial application with a water tank of 300 l, the developed mobile unit is designed as a test rig enabling all necessary measurements to evaluate potential of solar irradiation for domestic water heating on various locations. Besides the unit description, trial testing results are presented and analyzed as well as a basic comparison of CO 2 emissions between solar assisted heat pump and conventionally used water heating systems. Taking into account both the decentralized water heating and favourable climatic conditions (especially along the Croatian Adriatic coast) as well as rising fossil fuel prices, it is expected that solar assisted heat pumps will be commercialized in the near future.(author)

  8. Techno-Economic Assessment of Concentrating Solar Power and Wind Hybridization in Jordan

    Directory of Open Access Journals (Sweden)

    Osama Ayadi

    2018-03-01

    A strong complementarity between wind and direct normal solar radiation was observed in the selected location in Jordan, which emphasizes the attractiveness of the selected hybrid system. The optimal configuration of the CSP-wind hybrid system was obtained with a solar field of a 2.6 solar multiple and a 5 hours energy storage. The achieved capacity factor was 94%, and the LCOE is lower than those resulted for standalone CSP plants.

  9. Possible effect of extreme solar energetic particle event of 20 January 2005 on polar stratospheric aerosols: direct observational evidence

    Directory of Open Access Journals (Sweden)

    I. A. Mironova

    2012-01-01

    Full Text Available Energetic cosmic rays are the main source of ionization of the low-middle atmosphere, leading to associated changes in atmospheric properties. Via the hypothetical influence of ionization on aerosol growth and facilitated formation of clouds, this may be an important indirect link relating solar variability to climate. This effect is highly debated, however, since the proposed theoretical mechanisms still remain illusive and qualitative, and observational evidence is inconclusive and controversial. Therefore, important questions regarding the existence and magnitude of the effect, and particularly the fraction of aerosol particles that can form and grow, are still open. Here we present empirical evidence of the possible effect caused by cosmic rays upon polar stratospheric aerosols, based on a case study of an extreme solar energetic particle (SEP event of 20 January 2005. Using aerosol data obtained over polar regions from different satellites with optical instruments that were operating during January 2005, such as the Stratospheric Aerosol and Gas Experiment III (SAGE III, and Optical Spectrograph and Infrared Imaging System (OSIRIS, we found a significant simultaneous change in aerosol properties in both the Southern and Northern Polar regions in temporal association with the SEP event. We speculate that ionization of the atmosphere, which was abnormally high in the lower stratosphere during the extreme SEP event, might have led to formation of new particles and/or growth of preexisting ultrafine particles in the polar stratospheric region. However, a detailed interpretation of the effect is left for subsequent studies. This is the first time high vertical resolution measurements have been used to discuss possible production of stratospheric aerosols under the influence of cosmic ray induced ionization. The observed effect is marginally detectable for the analyzed severe SEP event and can be undetectable for the majority of weak

  10. Possible effect of extreme solar energetic particle event of 20 January 2005 on polar stratospheric aerosols: direct observational evidence

    Science.gov (United States)

    Mironova, I. A.; Usoskin, I. G.; Kovaltsov, G. A.; Petelina, S. V.

    2012-01-01

    Energetic cosmic rays are the main source of ionization of the low-middle atmosphere, leading to associated changes in atmospheric properties. Via the hypothetical influence of ionization on aerosol growth and facilitated formation of clouds, this may be an important indirect link relating solar variability to climate. This effect is highly debated, however, since the proposed theoretical mechanisms still remain illusive and qualitative, and observational evidence is inconclusive and controversial. Therefore, important questions regarding the existence and magnitude of the effect, and particularly the fraction of aerosol particles that can form and grow, are still open. Here we present empirical evidence of the possible effect caused by cosmic rays upon polar stratospheric aerosols, based on a case study of an extreme solar energetic particle (SEP) event of 20 January 2005. Using aerosol data obtained over polar regions from different satellites with optical instruments that were operating during January 2005, such as the Stratospheric Aerosol and Gas Experiment III (SAGE III), and Optical Spectrograph and Infrared Imaging System (OSIRIS), we found a significant simultaneous change in aerosol properties in both the Southern and Northern Polar regions in temporal association with the SEP event. We speculate that ionization of the atmosphere, which was abnormally high in the lower stratosphere during the extreme SEP event, might have led to formation of new particles and/or growth of preexisting ultrafine particles in the polar stratospheric region. However, a detailed interpretation of the effect is left for subsequent studies. This is the first time high vertical resolution measurements have been used to discuss possible production of stratospheric aerosols under the influence of cosmic ray induced ionization. The observed effect is marginally detectable for the analyzed severe SEP event and can be undetectable for the majority of weak-moderate events. The present

  11. Analysis of diverse direct arylation polymerization (DArP) conditions toward the efficient synthesis of polymers converging with stille polymers in organic solar cells

    DEFF Research Database (Denmark)

    Livi, Francesco; Gobalasingham, Nemal S.; Thompson, Barry C.

    2016-01-01

    Despite the emergence of direct arylation polymerization (DArP) as an alternative method to traditional cross-coupling routes like Stille polymerization, the exploration of DArP polymers in practical applications like polymer solar cells (PSCs) is limited. DArP polymers tend to have a reputation...... for being marginally inferior to Stille counterparts due to the increased presence of defects that result from unwanted side reactions in direct arylation, such as unselective C-H bond activation and homocoupling. We report ten DArP protocols across the three major classes of DArP to generate poly[(2,5-bis...... was synthesized in superheated THF with Cs2CO3, neodecanoic acid, and P(o-anisyl)3, it generated polymers of exceptional quality that performed comparably to Stille counterparts in both roll coated ITO-free and spin-coated ITO devices....

  12. A direct gravitational lensing test for 10 exp 6 solar masses black holes in halos of galaxies

    Science.gov (United States)

    Wambsganss, Joachim; Paczynski, Bohdan

    1992-01-01

    We propose a method that will be able to detect or exclude the existence of 10 exp 6 solar masses black holes in the halos of galaxies. VLBA radio maps of two milliarcsecond jets of a gravitationally lensed quasar will show the signature of these black holes - if they exist. If there are no compact objects in this mass range along the line of sight, the two jets should be linear mappings of each other. If they are not, there must be compact objects of about 10 exp 6 solar masses in the halo of the galaxy that deform the images by gravitational deflection. We present numerical simulations for the two jets A and B of the double quasar 0957 + 561, but the method is valid for any gravitationally lensed quasar with structure on milliarcsecond scales. As a by-product from high-quality VLBA maps of jets A and B, one will be able to tell which features in the maps are intrinsic in the original jet and which are only an optical illusion, i.e., gravitational distortions by black holes along the line of sight.

  13. Solar-powered single-and double-effect directly air-cooled LiBr–H2O absorption prototype built as a single unit

    International Nuclear Information System (INIS)

    Izquierdo, M.; González-Gil, A.; Palacios, E.

    2014-01-01

    Highlights: • This work presents a novel solar cooling air-cooled absorption prototype for buildings. • The solution (LiB r –H 2 O) and the refrigerant (H 2 O) are cooled directly by air. • The cooling is produced from solar energy when operates in single-effect mode. • If the demand is not met the prototype is able to operate in double-effect mode. - Abstract: This work describes an installation in Madrid, Spain, designed to test a new solar-powered air-cooled absorption refrigeration system. This installation essentially consists of a-48 m 2 field of flat-plate solar collectors, a 1500-L hot water storage tank and a single and-double effect air-cooled lithium bromide absorption prototype. Designed and built by our research group, this prototype is able to operate either as a single-effect unit (4.5 kW) or as a double-effect unit (7 kW). In operation as single-effect mode, the prototype is driven by solar energy, whereas in operation as a double effect mode, an external energy source may be used. The prototype’s evaporator is connected to a fan-coil placed inside an 80-m 2 laboratory that represent the average size of a Spanish housing unit. In August 2009, the cooling system was tested in the single-effect operation mode. The results show that the system is able to meet approximately 65% of the laboratory’s seasonal cooling demand, although 100% may be reached for a few days. The prototype can also operate in double-effect mode to meet the cooling demand. In that case, the prototype is fed by thermal oil, which is warmed until it reaches the process temperature in the high-temperature generator. The prototype can operate in either single-effect mode or in double-effect mode or can also operate simultaneously both modes using the components common to both modes, namely, the absorber, evaporator, condenser, solution pumps and control equipment. This paper reports the experimental results from the prototype operating separately in single-effect and

  14. Thin-Film Solar Cells with InP Absorber Layers Directly Grown on Nonepitaxial Metal Substrates

    KAUST Repository

    Zheng, Maxwell

    2015-08-25

    The design and performance of solar cells based on InP grown by the nonepitaxial thin-film vapor-liquid-solid (TF-VLS) growth technique is investigated. The cell structure consists of a Mo back contact, p-InP absorber layer, n-TiO2 electron selective contact, and indium tin oxide transparent top electrode. An ex situ p-doping process for TF-VLS grown InP is introduced. Properties of the cells such as optoelectronic uniformity and electrical behavior of grain boundaries are examined. The power conversion efficiency of first generation cells reaches 12.1% under simulated 1 sun illumination with open-circuit voltage (VOC) of 692 mV, short-circuit current (JSC) of 26.9 mA cm-2, and fill factor (FF) of 65%. The FF of the cell is limited by the series resistances in the device, including the top contact, which can be mitigated in the future through device optimization. The highest measured VOC under 1 sun is 692 mV, which approaches the optically implied VOC of ≈795 mV extracted from the luminescence yield of p-InP. The design and performance of solar cells based on indium phosphide (InP) grown by the nonepitaxial thin-film vapor-liquid-solid growth technique is investigated. The cell structure consists of a Mo back contact, p-InP absorber layer, n-TiO2 electron selective contact, and an indium tin oxide transparent top electrode. The highest measured open circuit voltage (VOC) under 1 sun is 692 mV, which approaches the optically implied VOC of ≈795 mV extracted from the luminescence yield of p-InP.

  15. Long-Term Effects of Repeated Prefrontal Cortex Transcranial Direct Current Stimulation (tDCS) on Food Craving in Normal and Overweight Young Adults.

    Science.gov (United States)

    Ljubisavljevic, M; Maxood, K; Bjekic, J; Oommen, J; Nagelkerke, N

    The dorsolateral prefrontal cortex (DLPFC) plays an important role in the regulation of food intake. Several previous studies demonstrated that a single session of transcranial direct current stimulation (tDCS) of the DLPFC reduces food craving and caloric intake. We hypothesized that repeated tDCS of the right DLPFC cortex may exert long-term changes in food craving in young, healthy adults and that these changes may differ between normal and overweight subjects. Thirty healthy individuals who reported frequent food cravings without a prior history of eating disorders were initially recruited. Subjects were randomized into an ACTIVE group who received 5 days of real tDCS (20 minutes, anode right-cathode left montage, 2 mA with current density kept at 0.06 mA/cm2, 1 min ramp-up/ramp-down), and a SHAM group, who received one day of real tDCS, on the first day (same parameters), followed by 4 days of sham tDCS. Food craving intensity was examined by Food Craving Questionnaires State and Trait and Food Craving Inventory before, during, (5-days) and one month (30-days) after tDCS. Single session of tDCS significantly reduced the intensity of current food craving (FCQ-S). Five days of active tDCS significantly reduced habitual experiences of food craving (FCQ-T), when compared to baseline pre-stimulation levels. Furthermore, both current (FCQ-S) and habitual craving (FCQ-T) were significantly reduced 30 days after active tDCS, while sham tDCS, i.e. a single tDCS session did not have significant effects. Also, active tDCS significantly decreased craving for fast food and sweets, and to a lesser degree for fat, while it did not have significant effects on craving for carbohydrates (FCI). There were no significant differences between individual FCQ-T subscales (craving dimensions) after 5 or 30 days of either sham or active tDCS. Changes in craving were not significantly associated with the initial weight, or with weight changes 30 days after the stimulation in the

  16. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  17. A differential optical absorption spectroscopy method for retrieval from ground-based Fourier transform spectrometers measurements of the direct solar beam

    Science.gov (United States)

    Huo, Yanfeng; Duan, Minzheng; Tian, Wenshou; Min, Qilong

    2015-08-01

    A differential optical absorption spectroscopy (DOAS)-like algorithm is developed to retrieve the column-averaged dryair mole fraction of carbon dioxide from ground-based hyper-spectral measurements of the direct solar beam. Different to the spectral fitting method, which minimizes the difference between the observed and simulated spectra, the ratios of multiple channel-pairs—one weak and one strong absorption channel—are used to retrieve from measurements of the shortwave infrared (SWIR) band. Based on sensitivity tests, a super channel-pair is carefully selected to reduce the effects of solar lines, water vapor, air temperature, pressure, instrument noise, and frequency shift on retrieval errors. The new algorithm reduces computational cost and the retrievals are less sensitive to temperature and H2O uncertainty than the spectral fitting method. Multi-day Total Carbon Column Observing Network (TCCON) measurements under clear-sky conditions at two sites (Tsukuba and Bremen) are used to derive xxxx for the algorithm evaluation and validation. The DOAS-like results agree very well with those of the TCCON algorithm after correction of an airmass-dependent bias.

  18. Alternatives in solar energy

    Science.gov (United States)

    Schueler, D. G.

    1978-01-01

    Although solar energy has the potential of providing a significant source of clean and renewable energy for a variety of applications, it is expected to penetrate the nation's energy economy very slowly. The alternative solar energy technologies which employ direct collection and conversion of solar radiation as briefly described.

  19. Toxicological evaluation of liquids proposed for use in direct contact liquid--liquid heat exchangers for solar heated and cooled buildings

    Energy Technology Data Exchange (ETDEWEB)

    Buchan, R.M.; Majestic, J.R.; Billau, R.

    1976-09-01

    This report contains the results of the toxicological evaluation part of the project entitled, ''Direct Contact Liquid-Liquid Heat Exchangers for Solar Heated and Cooled Buildings.'' Obviously any liquid otherwise suitable for use in such a device should be subjected to a toxicological evaluation. 34 liquids (24 denser than water, 10 less dense) have physical and chemical properties that would make them suitable for use in such a device. In addition to the complexity involved in selecting the most promising liquids from the standpoint of their chemical and physical properties is added the additional difficulty of also considering their toxicological properties. Some of the physical and chemical properties of these liquids are listed. The liquids are listed in alphabetical order within groups, the denser than water liquids are listed first followed by those liquids less dense than water.

  20. Solar neutrinos as a signal and background in direct-detection experiments searching for sub-GeV dark matter with electron recoils

    Science.gov (United States)

    Essig, Rouven; Sholapurkar, Mukul; Yu, Tien-Tien

    2018-05-01

    Direct-detection experiments sensitive to low-energy electron recoils from sub-GeV dark matter interactions will also be sensitive to solar neutrinos via coherent neutrino-nucleus scattering (CNS), since the recoiling nucleus can produce a small ionization signal. Solar neutrinos constitute both an interesting signal in their own right and a potential background to a dark matter search that cannot be controlled or reduced by improved shielding, material purification and handling, or improved detector design. We explore these two possibilities in detail for semiconductor (silicon and germanium) and xenon targets, considering several possibilities for the unmeasured ionization efficiency at low energies. For dark-matter-electron-scattering searches, neutrinos start being an important background for exposures larger than ˜1 - 10 kg -years in silicon and germanium, and for exposures larger than ˜0.1 - 1 kg -year in xenon. For the absorption of bosonic dark matter (dark photons and axion-like particles) by electrons, neutrinos are most relevant for masses below ˜1 keV and again slightly more important in xenon. Treating the neutrinos as a signal, we find that the CNS of 8B neutrinos can be observed with ˜2 σ significance with exposures of ˜2 , 7, and 20 kg-years in xenon, germanium, and silicon, respectively, assuming there are no other backgrounds. We give an example for how this would constrain nonstandard neutrino interactions. Neutrino components at lower energy can only be detected if the ionization efficiency is sufficiently large. In this case, observing pep neutrinos via CNS requires exposures ≳10 - 100 kg -years in silicon or germanium (˜1000 kg -years in xenon), and observing CNO neutrinos would require an order of magnitude more exposure. Only silicon could potentially detect 7Be neutrinos. These measurements would allow for a direct measurement of the electron-neutrino survival probability over a wide energy range.

  1. Analysis of the ozone profile specifications in the WRF-ARW model and their impact on the simulation of direct solar radiation

    Directory of Open Access Journals (Sweden)

    A. Montornès

    2015-03-01

    Full Text Available Although ozone is an atmospheric gas with high spatial and temporal variability, mesoscale numerical weather prediction (NWP models simplify the specification of ozone concentrations used in their shortwave schemes by using a few ozone profiles. In this paper, a two-part study is presented: (i an evaluation of the quality of the ozone profiles provided for use with the shortwave schemes in the Advanced Research version of the Weather Research and Forecasting (WRF-ARW model and (ii an assessment of the impact of deficiencies in those profiles on the performance of model simulations of direct solar radiation. The first part compares simplified data sets used to specify the total ozone column in six schemes (i.e., Goddard, New Goddard, RRTMG, CAM, GFDL and Fu–Liou–Gu with the Multi-Sensor Reanalysis data set during the period 1979–2008 examining the latitudinal, longitudinal and seasonal limitations in the ozone profile specifications of each parameterization. The results indicate that the maximum deviations are over the poles and show prominent longitudinal patterns in the departures due to the lack of representation of the patterns associated with the Brewer–Dobson circulation and the quasi-stationary features forced by the land–sea distribution, respectively. In the second part, the bias in the simulated direct solar radiation due to these deviations from the simplified spatial and temporal representation of the ozone distribution is analyzed for the New Goddard and CAM schemes using the Beer–Lambert–Bouguer law and for the GFDL using empirical equations. For radiative applications those simplifications introduce spatial and temporal biases with near-zero departures over the tropics throughout the year and increasing poleward with a maximum in the high middle latitudes during the winter of each hemisphere.

  2. Solar Schematic

    Science.gov (United States)

    1979-01-01

    The home shown at right is specially designed to accommodate solar heating units; it has roof planes in four directions, allowing placement of solar collectors for best exposure to the sun. Plans (bottom) and complete working blueprints for the solar-heated house are being marketed by Home Building Plan Service, Portland, Oregon. The company also offers an inexpensive schematic (center) showing how a homeowner only moderately skilled in the use of tools can build his own solar energy system, applicable to new or existing structures. The schematic is based upon the design of a low-cost solar home heating system built and tested by NASA's Langley Research Center; used to supplement a warm-air heating system, it can save the homeowner about 40 percent of his annual heating bill for a modest investment in materials and components. Home Building Plan Service saved considerable research time by obtaining a NASA technical report which details the Langley work. The resulting schematic includes construction plans and simplified explanations of solar heat collection, collectors and other components, passive heat factors, domestic hot water supply and how to work with local heating engineers.

  3. Parameterization models for solar radiation and solar technology applications

    International Nuclear Information System (INIS)

    Khalil, Samy A.

    2008-01-01

    Solar radiation is very important for the evaluation and wide use of solar renewable energy systems. The development of calibration procedures for broadband solar radiation photometric instrumentation and the improvement of broadband solar radiation measurement accuracy have been done. An improved diffuse sky reference and photometric calibration and characterization software for outdoor pyranometer calibrations are outlined. Parameterizations for direct beam, total hemispherical and diffuse sky radiation and solar radiation technology are briefly reviewed. The uncertainties for various broadband solar radiations of solar energy and atmospheric effects are discussed. The varying responsivities of solar radiation with meteorological, statistical and climatological parameters and possibility atmospheric conditions was examined

  4. Parameterization models for solar radiation and solar technology applications

    Energy Technology Data Exchange (ETDEWEB)

    Khalil, Samy A. [National Research Institute of Astronomy and Geophysics, Solar and Space Department, Marsed Street, Helwan, 11421 Cairo (Egypt)

    2008-08-15

    Solar radiation is very important for the evaluation and wide use of solar renewable energy systems. The development of calibration procedures for broadband solar radiation photometric instrumentation and the improvement of broadband solar radiation measurement accuracy have been done. An improved diffuse sky reference and photometric calibration and characterization software for outdoor pyranometer calibrations are outlined. Parameterizations for direct beam, total hemispherical and diffuse sky radiation and solar radiation technology are briefly reviewed. The uncertainties for various broadband solar radiations of solar energy and atmospheric effects are discussed. The varying responsivities of solar radiation with meteorological, statistical and climatological parameters and possibility atmospheric conditions was examined. (author)

  5. Study of the lacustrine phytoplankton productivity dependence on solar radiation, on the basis of direct high-frequency measurements

    Science.gov (United States)

    Provenzale, Maria; Ojala, Anne; Heiskanen, Jouni; Erkkilä, Kukka-Maaria; Mammarella, Ivan; Hari, Pertti; Vesala, Timo

    2016-04-01

    One of the main components of the carbon cycle in lakes is phytoplankton. Its in situ photosynthesis and respiration are usually studied with traditional methods (dark and light bottle method, 14C labelling technique). These methods, relying on sampling and incubation, may lead to unrealistic results. They also have a poor temporal resolution, which does not allow the non-linear relationship between photosynthetically active solar radiation (PAR) and photosynthesis to be properly investigated. As a consequence, the phytoplankton net primary productivity (NPP) cannot be parameterised as a function of ambient variables. In 2008 an innovative free-water approach was proposed. It is based on non-dispersive infrared air CO2 probes that, by building an appropriate system, can be used to measure the CO2 concentration in the water at a high-frequency. At that time, the method was tested only on 3 days of data. Here, we deployed it on a boreal lake in Finland for four summers, in order to calculate the NPP and verify its dependence on PAR. The set-up was completed by an eddy-covariance system and water PAR and temperature sensors. In analogy with the procedure typically used in terrestrial ecology, we obtained the phytoplankton NPP computing the mass balance of CO2 in the mixed layer of the lake, i.e. the superficial layer where the conditions are homogeneous and most of the photosynthetic activity takes place. After calculating the NPP , we verified its dependence on PAR. The theoretical model we used was a saturating Michaelis-Menten curve, in which the variables are water temperature and PAR. The equation also contains parameters typical of the phytoplankton communities, which represent their maximum potential photosynthetic rate, their half-saturation constant and their basal respiration. These parameters allow the NPP to be parameterised as a function of T and PAR. For all the analysed year, we found a very good agreement between theory and data (R2 ranged from 0.80 to

  6. The Effects of Solar Irradience and Ambient Temperature on Solar ...

    African Journals Online (AJOL)

    Solar energy is abundant. It is however low grade energy and cannot be easily used in the form it occurs for work. Converting solar energy directly to electricity, using solar photovoltaic (PV) modules is however a low efficiency process. Optimizing this conversion, especially in the face of the high cost of solar panels, is thus ...

  7. Organic wavelength selective mirrors for luminescent solar concentrators

    NARCIS (Netherlands)

    Verbunt, P.P.C.; Debije, M.G.; Broer, D.J.; Bastiaansen, C.W.M.; Boer, de D.K.G.; Wehrspohn, R.; Gombert, A.

    2012-01-01

    Organic polymeric chiral nematic liquid crystalline (cholesteric) wavelength selective mirrors can increase the efficiency of luminescent solar concentrators (LSCs) when they are illuminated with direct sunlight normal to the device. However, due to the angular dependence of the reflection band, at

  8. Efficient small molecule bulk heterojunction solar cells with high fill factors via pyrene-directed molecular self-assembly

    KAUST Repository

    Lee, Olivia P.; Yiu, Alan T.; Beaujuge, Pierre; Woo, Claire; Holcombe, Thomas W.; Millstone, Jill E.; Douglas, Jessica D.; Chen, Mark S.; Frechet, Jean

    2011-01-01

    Efficient organic photovoltaic (OPV) materials are constructed by attaching completely planar, symmetric end-groups to donor-acceptor electroactive small molecules. Appending C2-pyrene as the small molecule end-group to a diketopyrrolopyrrole core leads to materials with a tight, aligned crystal packing and favorable morphology dictated by π-π interactions, resulting in high power conversion efficiencies and high fill factors. The use of end-groups to direct molecular self-assembly is an effective strategy for designing high-performance small molecule OPV devices. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Efficient small molecule bulk heterojunction solar cells with high fill factors via pyrene-directed molecular self-assembly

    KAUST Repository

    Lee, Olivia P.

    2011-10-21

    Efficient organic photovoltaic (OPV) materials are constructed by attaching completely planar, symmetric end-groups to donor-acceptor electroactive small molecules. Appending C2-pyrene as the small molecule end-group to a diketopyrrolopyrrole core leads to materials with a tight, aligned crystal packing and favorable morphology dictated by π-π interactions, resulting in high power conversion efficiencies and high fill factors. The use of end-groups to direct molecular self-assembly is an effective strategy for designing high-performance small molecule OPV devices. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Production of solar radiation bankable datasets from high-resolution solar irradiance derived with dynamical downscaling Numerical Weather prediction model

    Directory of Open Access Journals (Sweden)

    Yassine Charabi

    2016-11-01

    Full Text Available A bankable solar radiation database is required for the financial viability of solar energy project. Accurate estimation of solar energy resources in a country is very important for proper siting, sizing and life cycle cost analysis of solar energy systems. During the last decade an important progress has been made to develop multiple solar irradiance database (Global Horizontal Irradiance (GHI and Direct Normal Irradiance (DNI, using satellite of different resolution and sophisticated models. This paper assesses the performance of High-resolution solar irradiance derived with dynamical downscaling Numerical Weather Prediction model with, GIS topographical solar radiation model, satellite data and ground measurements, for the production of bankable solar radiation datasets. For this investigation, NWP model namely Consortium for Small-scale Modeling (COSMO is used for the dynamical downscaling of solar radiation. The obtained results increase confidence in solar radiation data base obtained from dynamical downscaled NWP model. The mean bias of dynamical downscaled NWP model is small, on the order of a few percents for GHI, and it could be ranked as a bankable datasets. Fortunately, these data are usually archived in the meteorological department and gives a good idea of the hourly, monthly, and annual incident energy. Such short time-interval data are valuable in designing and operating the solar energy facility. The advantage of the NWP model is that it can be used for solar radiation forecast since it can estimate the weather condition within the next 72–120 hours. This gives a reasonable estimation of the solar radiation that in turns can be used to forecast the electric power generation by the solar power plant.

  11. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  12. Increase of solar radiation due to climate change and its impact on solar energy use

    International Nuclear Information System (INIS)

    Kuhnke, K.; Rahme, A.; Harling, J.; Arensmann, R.

    2008-01-01

    Full text: There is a significant change in solar radiation in Central Europe coinciding with the IPCC climate change model calculations. The increase of yearly solar radiation on the horizontal surface is about 0.38 percent/year. On the other hand, photovoltaic solar modules show an ageing effect of the same order of magnitude, i.e. a reduction of yearly energy yield between 0.3 and 0.5 percent/year. This reduction is normally taken into account in economic calculations such as payback time and internal rate of interest. As the two trends of increase in radiation and ageing of solar modules are in opposite direction to each other, they will - with their uncertainties - neutralize one another to zero. Thus, the energy production of photovoltaic systems can be calculated without any deductions due to ageing in the future. (authors)

  13. High efficiency direct thermal to electric energy conversion from radioisotope decay using selective emitters and spectrally tuned solar cells

    Science.gov (United States)

    Chubb, Donald L.; Flood, Dennis J.; Lowe, Roland A.

    1993-01-01

    Thermophotovoltaic (TPV) systems are attractive possibilities for direct thermal-to-electric energy conversion, but have typically required the use of black body radiators operating at high temperatures. Recent advances in both the understanding and performance of solid rare-earth oxide selective emitters make possible the use of TPV at temperatures as low as 1200K. Both selective emitter and filter system TPV systems are feasible. However, requirements on the filter system are severe in order to attain high efficiency. A thin-film of a rare-earth oxide is one method for producing an efficient, rugged selective emitter. An efficiency of 0.14 and power density of 9.2 W/KG at 1200K is calculated for a hypothetical thin-film neodymia (Nd2O3) selective emitter TPV system that uses radioisotope decay as the thermal energy source.

  14. High efficiency direct thermal to electric energy conversion from radioisotope decay using selective emitters and spectrally tuned solar cells

    International Nuclear Information System (INIS)

    Chubb, D.L.; Flood, D.J.; Lowe, R.A.

    1993-08-01

    Thermophotovoltaic (TPV) systems are attractive possibilities for direct thermal-to-electric energy conversion, but have typically required the use of black body radiators operating at high temperatures. Recent advances in both the understanding and performance of solid rare-earth oxide selective emitters make possible the use of TPV at temperatures as low as 1200K. Both selective emitter and filter system TPV systems are feasible. However, requirements on the filter system are severe in order to attain high efficiency. A thin-film of a rare-earth oxide is one method for producing an efficient, rugged selective emitter. An efficiency of 0.14 and power density of 9.2 W/KG at 1200K is calculated for a hypothetical thin-film neodymia (Nd2O3) selective emitter TPV system that uses radioisotope decay as the thermal energy source

  15. Improvement in performance of a direct solar-thermally driven diffusion-absorption refrigerator; Leistungssteigerung einer direkt solarthermisch angetriebenen Diffusions-Absorptionskaeltemaschine

    Energy Technology Data Exchange (ETDEWEB)

    Schmid, Fabian; Bierling, Bernd; Spindler, Klaus [Stuttgart Univ. (Germany). Inst. fuer Thermodynamik und Waermetechnik (ITW)

    2012-07-01

    The diffusion-absorption refrigeration process offers the possibility of a wear-free refrigeration system without electricity and noise. At the Institute for Thermodynamics and Thermal Engineering (Stuttgart, Federal Republic of Germany), a decentralized solar refrigeration system is developed based on this process. The expeller and the thermosiphon pump of this process are integrated in the collector, and thus are heated directly. The diffusion-absorption refrigeration process also can be used for domestic water heating by means of a second cycle in the collector. A cooling capacity of 400 W is to be achieved for each solar collector (2.5 m{sup 2}). Several refrigeration systems can be modular interconnected for higher cooling capacities. As part of the DKV Conference 2011, the construction of the plant, the first measurement data and results were presented. Since then, both the cooling capacity and the coefficient of performance of the diffusion-absorption refrigeration system could be increased significantly. For this, solvent heat exchanger, evaporator, absorber and gas heat exchanger have been optimized in terms of system efficiency. In addition, a stable system operation could be achieved by means of a bypass line. About this line, an exaggerated refrigerant already is removed in the solvent heat exchanger. In addition, a condensate pre-cooler was integrated in order to increase the efficiency. For a detailed investigation of the auxiliary gas cycle facilities, the volume flow and the concentration of the auxiliary gas circuit were examined under utilization of an ultrasonic sensor. In order to evaluate the influence factors by means of a parametric study, the mass transfer in the auxiliary gas circuit was simulated using the two-fluid model. The results of these studies, the current system configuration and the current results are presented in the contribution under consideration.

  16. A theoretical study of a direct contact membrane distillation system coupled to a salt-gradient solar pond for terminal lakes reclamation.

    Science.gov (United States)

    Suárez, Francisco; Tyler, Scott W; Childress, Amy E

    2010-08-01

    Terminal lakes are water bodies that are located in closed watersheds with the only output of water occurring through evaporation or infiltration. The majority of these lakes, which are commonly located in the desert and influenced by human activities, are increasing in salinity. Treatment options are limited, due to energy costs, and many of these lakes provide an excellent opportunity to test solar-powered desalination systems. This paper theoretically investigates utilization of direct contact membrane distillation (DCMD) coupled to a salt-gradient solar pond (SGSP) for sustainable freshwater production at terminal lakes. A model for heat and mass transport in the DCMD module and a thermal model for an SGSP were developed and coupled to evaluate the feasibility of freshwater production. The construction of an SGSP outside and inside of a terminal lake was studied. As results showed that freshwater flows are on the same order of magnitude as evaporation, these systems will only be successful if the SGSP is constructed inside the terminal lake so that there is little or no net increase in surface area. For the study site of this investigation, water production on the order of 2.7 x 10(-3) m(3) d(-1) per m(2) of SGSP is possible. The major advantages of this system are that renewable thermal energy is used so that little electrical energy is required, the coupled system requires low maintenance, and the terminal lake provides a source of salts to create the stratification in the SGSP. (c) 2010 Elsevier Ltd. All rights reserved.

  17. Solar Spots - Activities to Introduce Solar Energy into the K-8 Curricula.

    Science.gov (United States)

    Longe, Karen M.; McClelland, Michael J.

    Following an introduction to solar technology which reviews solar heating and cooling, passive solar systems (direct gain systems, thermal storage walls, sun spaces, roof ponds, and convection loops), active solar systems, solar electricity (photovoltaic and solar thermal conversion systems), wind energy, and biomass, activities to introduce solar…

  18. Solar Indices - Solar Flares

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of indices related to solar activity contributed by a number of national and private solar observatories located worldwide. This...

  19. Solar Indices - Solar Ultraviolet

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of indices related to solar activity contributed by a number of national and private solar observatories located worldwide. This...

  20. Solar Indices - Solar Corona

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of indices related to solar activity contributed by a number of national and private solar observatories located worldwide. This...

  1. Solar Indices - Solar Irradiance

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of indices related to solar activity contributed by a number of national and private solar observatories located worldwide. This...

  2. Annual energy and environment analysis of solarized steam injection gas turbine (STIG) cycle for Indian regions

    International Nuclear Information System (INIS)

    Selwynraj, A. Immanuel; Iniyan, S.; Suganthi, L.; Livshits, Maya; Polonsky, Guy; Kribus, Abraham

    2016-01-01

    Highlights: • Study on the influence of local climatic conditions on solar STIG cycle is presented. • The annual solar to electricity efficiency ranges between 11.2 and 17.1% and the solar fraction ranges 9.3–41.7%. • The range of annual specific CO_2 emission is 312–408 kg/MWh and incremental CO_2 avoidance is 4.2–104 kg/MWh. • The levelized tariff (LT) is 0.2–0.23 $/kWh, and the solar levelized tariff (SLT) ranges from 0.11 to 0.27 $/kWh. - Abstract: The solarized steam injection gas turbine (STIG) cycle uses both the fuel and solar heat simultaneously for power generation. The annual thermodynamic performances of the cycle for sites in India with local climatic conditions such as ambient temperature, relative humidity and availability of direct normal irradiance (DNI) to the solar concentrators under two modes of constant and variable power are presented in this paper. The results reveal that the solar to electricity efficiency of solar hybrid STIG plant with a simple parabolic trough collector (PTC) is similar to existing solar thermal technologies, and also higher solar share is obtained. The study also reveals that the annual CO_2 emission is similar to combined cycle plants and lower than gas turbine technologies. The incremental CO_2 avoidance is also computed due to solar participation. The annual values of exergetic solar fraction and exergetic efficiency at Indore are higher than Jaipur. Results of an improved economic assessment show that the levelized tariff (LT) of solar hybrid STIG plant is 0.2–0.23 $/kWh and the levelized tariff (solar only) or solar levelized tariff (SLT) of solar STIG plant ranges from 0.11 to 0.27 $/kWh for both constant and variable power scenarios.

  3. Power Conversion Efficiency of Arylamine Organic Dyes for Dye-Sensitized Solar Cells (DSSCs) Explicit to Cobalt Electrolyte: Understanding the Structural Attributes Using a Direct QSPR Approach

    OpenAIRE

    Supratik Kar; Juganta K. Roy; Danuta Leszczynska; Jerzy Leszczynski

    2016-01-01

    Post silicon solar cell era involves light-absorbing dyes for dye-sensitized solar systems (DSSCs). Therefore, there is great interest in the design of competent organic dyes for DSSCs with high power conversion efficiency (PCE) to bypass some of the disadvantages of silicon-based solar cell technologies, such as high cost, heavy weight, limited silicon resources, and production methods that lead to high environmental pollution. The DSSC has the unique feature of a distance-dependent electron...

  4. Solar Air Heaters with Thermal Heat Storages

    OpenAIRE

    Saxena, Abhishek; Goel, Varun

    2013-01-01

    Solar energy can be converted into different forms of energy, either to thermal energy or to electrical energy. Solar energy is converted directly into electrical power by photovoltaic modules, while solar collector converts solar energy into thermal energy. Solar collector works by absorbing the direct solar radiation and converting it into thermal energy, which can be stored in the form of sensible heat or latent heat or a combination of sensible and latent heats. A theoretical study has be...

  5. Normalized modes at selected points without normalization

    Science.gov (United States)

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  6. TiO2 film decorated with highly dispersed polyoxometalate nanoparticles synthesized by micelle directed method for the efficiency enhancement of dye-sensitized solar cells

    Science.gov (United States)

    He, Lifei; Chen, Li; Zhao, Yue; Chen, Weilin; Shan, Chunhui; Su, Zhongmin; Wang, Enbo

    2016-10-01

    In this work, two kinds of polyoxometalate (POM) nanoparticles with controlled shapes and structures were synthesized by micelle directed method and then composited with TiO2 via calcination to remove the surfactants owing to the excellent electronic storage and transmission ability of POM, finally obtaining two kinds of TiO2 composites with highly dispersed and small-sized POM nanoparticles (∼1 nm). The TiO2 composites were then induced into the photoanodes of dye-sensitized (N719) solar cells (DSSCs). The separation of electron-holes becomes more favorable due to the nanostructure and high dispersion of POM which provide more active sites than pure POM tending to agglomeration. The TiO2 composite photoanodes finally yielded the power conversion efficiency (PCE) of 8.4% and 8.2%, respectively, which were 42% and 39% higher than the pristine TiO2 based anodes. In addition, the mechanisms of POM in DSSC are proposed.

  7. Network-directed cis-mediator analysis of normal prostate tissue expression profiles reveals downstream regulatory associations of prostate cancer susceptibility loci.

    Science.gov (United States)

    Larson, Nicholas B; McDonnell, Shannon K; Fogarty, Zach; Larson, Melissa C; Cheville, John; Riska, Shaun; Baheti, Saurabh; Weber, Alexandra M; Nair, Asha A; Wang, Liang; O'Brien, Daniel; Davila, Jaime; Schaid, Daniel J; Thibodeau, Stephen N

    2017-10-17

    Large-scale genome-wide association studies have identified multiple single-nucleotide polymorphisms associated with risk of prostate cancer. Many of these genetic variants are presumed to be regulatory in nature; however, follow-up expression quantitative trait loci (eQTL) association studies have to-date been restricted largely to cis -acting associations due to study limitations. While trans -eQTL scans suffer from high testing dimensionality, recent evidence indicates most trans -eQTL associations are mediated by cis -regulated genes, such as transcription factors. Leveraging a data-driven gene co-expression network, we conducted a comprehensive cis -mediator analysis using RNA-Seq data from 471 normal prostate tissue samples to identify downstream regulatory associations of previously identified prostate cancer risk variants. We discovered multiple trans -eQTL associations that were significantly mediated by cis -regulated transcripts, four of which involved risk locus 17q12, proximal transcription factor HNF1B , and target trans -genes with known HNF response elements ( MIA2 , SRC , SEMA6A , KIF12 ). We additionally identified evidence of cis -acting down-regulation of MSMB via rs10993994 corresponding to reduced co-expression of NDRG1 . The majority of these cis -mediator relationships demonstrated trans -eQTL replicability in 87 prostate tissue samples from the Gene-Tissue Expression Project. These findings provide further biological context to known risk loci and outline new hypotheses for investigation into the etiology of prostate cancer.

  8. The inconstant solar constant

    International Nuclear Information System (INIS)

    Willson, R.C.; Hudson, H.

    1984-01-01

    The Active Cavity Radiometer Irradiance Monitor (ACRIM) of the Solar Maximum Mission satellite measures the radiant power emitted by the sun in the direction of the earth and has worked flawlessly since 1980. The main motivation for ACRIM's use to measure the solar constant is the determination of the extent to which this quantity's variations affect earth weather and climate. Data from the solar minimum of 1986-1987 is eagerly anticipated, with a view to the possible presence of a solar cycle variation in addition to that caused directly by sunspots

  9. Efficient Near-Infrared-Transparent Perovskite Solar Cells Enabling Direct Comparison of 4-Terminal and Monolithic Perovskite/Silicon Tandem Cells

    OpenAIRE

    Werner, Jérémie; Barraud, Loris; Walter, Arnaud; Bräuninger, Matthias; Sahli, Florent; Sacchetto, Davide; Tétreault, Nicolas; Paviet-Salomon, Bertrand; Moon, Soo-Jin; Allebé, Christophe; Despeisse, Matthieu; Nicolay, Sylvain; De Wolf, Stefaan; Niesen, Bjoern; Ballif, Christophe

    2016-01-01

    Combining market-proven silicon solar cell technology with an efficient wide band gap top cell into a tandem device is an attractive approach to reduce the cost of photovoltaic systems. For this, perovskite solar cells are promising high-efficiency top cell candidates, but their typical device size (

  10. Assessment of four shadow band correction models using beam normal irradiance data from the United Kingdom and Israel

    International Nuclear Information System (INIS)

    Lopez, G.; Muneer, T.; Claywell, R.

    2004-01-01

    Diffuse irradiance is a fundamental factor for all solar resource considerations. Diffuse irradiance is accurately determined by calculation from global and beam normal (direct) measurements. However, beam solar measurements and related support can be very expensive, and therefore, shadow bands are often used, along with pyranometers, to block the solar disk. The errors that result from the use of shadow bands are well known and have been studied by many authors. The thrust of this article is to examine four recognized techniques for correcting shadow band based, diffuse irradiance and statistically evaluate their individual performance using data culled from two contrasting sites within the United Kingdom and Israel

  11. Integrated Photoelectrochemical Solar Energy Conversion and Organic Redox Flow Battery Devices

    KAUST Repository

    Li, Wenjie

    2016-09-21

    Building on regenerative photoelectrochemical solar cells and emerging electrochemical redox flow batteries (RFBs), more efficient, scalable, compact, and cost-effective hybrid energy conversion and storage devices could be realized. An integrated photoelectrochemical solar energy conversion and electrochemical storage device is developed by integrating regenerative silicon solar cells and 9,10-anthraquinone-2,7-disulfonic acid (AQDS)/1,2-benzoquinone-3,5-disulfonic acid (BQDS) RFBs. The device can be directly charged by solar light without external bias, and discharged like normal RFBs with an energy storage density of 1.15 Wh L−1 and a solar-to-output electricity efficiency (SOEE) of 1.7 % over many cycles. The concept exploits a previously undeveloped design connecting two major energy technologies and promises a general approach for storing solar energy electrochemically with high theoretical storage capacity and efficiency.

  12. Integrated Photoelectrochemical Solar Energy Conversion and Organic Redox Flow Battery Devices.

    Science.gov (United States)

    Li, Wenjie; Fu, Hui-Chun; Li, Linsen; Cabán-Acevedo, Miguel; He, Jr-Hau; Jin, Song

    2016-10-10

    Building on regenerative photoelectrochemical solar cells and emerging electrochemical redox flow batteries (RFBs), more efficient, scalable, compact, and cost-effective hybrid energy conversion and storage devices could be realized. An integrated photoelectrochemical solar energy conversion and electrochemical storage device is developed by integrating regenerative silicon solar cells and 9,10-anthraquinone-2,7-disulfonic acid (AQDS)/1,2-benzoquinone-3,5-disulfonic acid (BQDS) RFBs. The device can be directly charged by solar light without external bias, and discharged like normal RFBs with an energy storage density of 1.15 Wh L -1 and a solar-to-output electricity efficiency (SOEE) of 1.7 % over many cycles. The concept exploits a previously undeveloped design connecting two major energy technologies and promises a general approach for storing solar energy electrochemically with high theoretical storage capacity and efficiency. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Solar building

    OpenAIRE

    Zhang, Luxin

    2014-01-01

    In my thesis I describe the utilization of solar energy and solar energy with building integration. In introduction it is also mentioned how the solar building works, trying to make more people understand and accept the solar building. The thesis introduces different types of solar heat collectors. I compared the difference two operation modes of solar water heating system and created examples of solar water system selection. I also introduced other solar building applications. It is conv...

  14. Plerocercoid growth factor (PGF), a human growth hormone (hGH) analogue produced by the tapeworm Spirometra mansonoides, has direct insulin-like action in adipose tissue of normal rats in vitro

    International Nuclear Information System (INIS)

    Salem, M.A.M.; Phares, C.K.

    1986-01-01

    The metabolic actions of GH can be divided into acute (insulin-like) and chronic (lipolytic/anti-insulin). The insulin-like actions of GH are most readily elicited in GH-deficient animals as GH induces resistance to its own insulin-like action. Like GH, PGF stimulates growth and cross-reacts with anti-hGH antibodies. Independent experiments were conducted comparing the direct actions of PGF to insulin or hGH in vitro. Insulin-like effects were determined by the ability of PGF, insulin or hGH to stimulate [U- 14 C]glucose metabolism in epidydimal fat pads from normal rats and by inhibition of epinephrine-stimulated lipolysis. Direct stimulation of lipolysis was used as anti-insulin activity. To determine if PGF competes for insulin or GH receptors, adipocytes (3 x 10 5 cells/ml) were incubated with either [ 125 I]insulin or [ 125 I]hGH +/- PGF, +/- insulin or +/- hGH. PGF stimulated glucose oxidation and 14 C-incorporation into lipids. Insulin, hGH and PGF inhibited lipolysis (33%, 29% and 34%, respectively). Adipose tissue was very sensitive to the lipolytic effect of hGH but PGF was neither lipolytic nor did it confer refractoriness to its insulin-like action. PGF bound to GH but not to insulin receptors. Therefore, PGF had direct insulin-like effects but did not stimulate lipolysis in tissue from normal rats in vitro

  15. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  16. Solar energy

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This chapter discusses the role solar energy may have in the energy future of the US. The topics discussed in the chapter include the solar resource, solar architecture including passive solar design and solar collectors, solar-thermal concentrating systems including parabolic troughs and dishes and central receivers, photovoltaic cells including photovoltaic systems for home use, and environmental, health and safety issues

  17. Simulation and economic analysis of a liquid-based solar system with a direct-contact liquid-liquid heat exchanger, in comparison to a system with a conventional heat exchanger

    Science.gov (United States)

    Brothers, P.; Karaki, S.

    Using a solar computer simulation package called TRNSYS, simulations of the direct contact liquid-liquid heat exchanger (DCLLHE) solar system and a system with conventional shell-and-tube heat exchanger were developed, based in part on performance measurements of the actual systems. The two systems were simulated over a full year on an hour-by-hour basis at five locations; Boston, Massachusetts, Charleston, South Carolina, Dodge City, Kansas, Madison, Wisconsin, and Phoenix, Arizona. Typically the direct-contact system supplies slightly more heat for domestic hot water and space heating in all locations and about 5 percentage points more cooling as compared to the conventional system. Using a common set of economic parameters and the appropriate federal and state income tax credits, as well as property tax legislation for solar systems in the corresponding states, the results of the study indicate for heating-only systems, the DCLLHE system has a slight life-cycle cost disadvantage compared to the conventional system. For combined solar heating and cooling systems, the DCLLHE has a slight life-cycle cost advantage which varies with location and amounts to one to three percent difference from the conventional system.

  18. Luminescent solar concentrators with fiber geometry.

    Science.gov (United States)

    Edelenbosch, Oreane Y; Fisher, Martyn; Patrignani, Luca; van Sark, Wilfried G J H M; Chatten, Amanda J

    2013-05-06

    The potential of a fibre luminescent solar concentrator has been explored by means of both analytical and ray-tracing techniques. Coated fibres have been found to be more efficient than homogeneously doped fibres, at low absorption. For practical fibres concentration is predicted to be linear with fibre length. A 1 m long, radius 1 mm, fibre LSC doped with Lumogen Red 305 is predicted to concentrate the AM1.5 g spectrum up to 1100 nm at normal incidence by ~35 x. The collection efficiency under diffuse and direct irradiance in London has been analysed showing that, even under clear sky conditions, in winter the diffuse contribution equals the direct.

  19. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  20. Polymer tandem solar cells

    NARCIS (Netherlands)

    Gilot, J.

    2010-01-01

    Solar cells convert solar energy directly into electricity and are attractive contribute to the increasing energy demand of modern society. Commercial mono-crystalline silicon based devices are infiltrating the energy market but their expensive, time and energy consuming production process

  1. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  2. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  3. Harnessing solar heat

    CERN Document Server

    Norton, Brian

    2013-01-01

    Systems engineered by man to harness solar heat in a controlled manner now include a diverse range of technologies each serving distinctive needs in particular climate contexts. This text covers the breadth of solar energy technologies for the conversion of solar energy to provide heat, either as the directly-used output or as an intermediary to other uses such as power generation or cooling. It is a wholly updated, extended and revised version of “Solar Energy Thermal Technology” first published in 1992. The text draws on the own author’s research and that of numerous colleagues and

  4. Sweat Rate Prediction Equations for Outdoor Exercise with Transient Solar Radiation

    Science.gov (United States)

    2012-01-01

    AD] 15 Interchangeable variables gSL W/m2 Global solar load Direct weather station data; pyranometer values 25 Direct measurement from weather station... pyranometer (to measure short-wave radiation fluxes) and pyrgeometer (to measure long-wave radiation fluxes). Normally, the value of the solar load...as described below. During field operations, Rsol (W/m2) can be calculated from 0.835 ·ERF. If Rsol (in W/m2) is known by direct pyranometer mea

  5. Solar energy policy review

    Energy Technology Data Exchange (ETDEWEB)

    None

    1978-08-17

    A number of memoranda and reports are collected which deal with evaluations of solar energy policy options, including direct and indirect labor impacts and costs of different options and consumer protection. (LEW)

  6. Solar energy conversion

    Energy Technology Data Exchange (ETDEWEB)

    Kistler, J.

    1981-08-05

    The photovoltaic generator is the central part of all solar systems. Flat solar cells embedded in glass are preferred which can also convert diffuse solar radiation. Hybrid modules generate electrical and thermal energy simultaneously. With decreasing generator cost, the cost of energy storage becomes critical. Development activities are mostly directed on the development of stationary lead accumulator batteries and the electronic charging and protective systems. The block diagram of the current converter is presented, and applications of solar systems in domestic heating engineering, transportation technology, communications, and hydrological engineering. Solar villages are recommended which, established in bilateral cooperation with Third World authorities, may demonstrate the advantages of solar energy in heat and electric power generation.

  7. Normalization of satellite imagery

    Science.gov (United States)

    Kim, Hongsuk H.; Elman, Gregory C.

    1990-01-01

    Sets of Thematic Mapper (TM) imagery taken over the Washington, DC metropolitan area during the months of November, March and May were converted into a form of ground reflectance imagery. This conversion was accomplished by adjusting the incident sunlight and view angles and by applying a pixel-by-pixel correction for atmospheric effects. Seasonal color changes of the area can be better observed when such normalization is applied to space imagery taken in time series. In normalized imagery, the grey scale depicts variations in surface reflectance and tonal signature of multi-band color imagery can be directly interpreted for quantitative information of the target.

  8. Solar flares

    International Nuclear Information System (INIS)

    Kaastra, J.S.

    1985-01-01

    In this thesis an electrodynamic model for solar flares is developed. The main theoretical achievements underlying the present study are treated briefly and the observable flare parameters are described within the framework of the flare model of this thesis. The flare model predicts large induced electric fields. Therefore, acceleration processes of charged particles by direct electric fields are treated. The spectrum of the accelerated particles in strong electric fields is calculated, 3 with the electric field and the magnetic field perpendicular and in the vicinity of an X-type magnetic neutral line. An electromagnetic field configuration arises in the case of a solar flare. A rising current filament in a quiescent background bipolar magnetic field causes naturally an X-type magnetic field configuration below the filament with a strong induced electric field perpendicular to the ambient magnetic field. This field configuration drives particles and magnetic energy towards the neutral line, where a current sheet is generated. The global evolution of the fields in the flare is determined by force balance of the Lorentz forces on the filament and the force balance on the current sheet. The X-ray, optical and radio observations of a large solar flare on May 16, 1981 are analyzed. It is found that these data fit the model very well. (Auth.)

  9. Solar Features - Solar Flares

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A solar flare is a short-lived sudden increase in the intensity of radiation emitted in the neighborhood of sunspots. For many years it was best monitored in the...

  10. Solar-powered Gossamer Penguin in flight

    Science.gov (United States)

    1979-01-01

    determine the power required to fly the airplane, optimize the airframe/propulsion system, and train the pilot. He made the first flights on April 7, 1980, and made a brief solar-powered flight on May 18. The official project pilot was Janice Brown, a Bakersfield school teacher who weighed in at slightly under 100 pounds and was a charter pilot with commercial, instrument, and glider ratings. She checked out in the plane at Shafter and made about 40 flights under battery and solar power there. Wind direction, turbulence, convection, temperature and radiation at Shafter in mid-summer proved to be less than ideal for Gossamer Penguin because takeoffs required no crosswind and increases in temperature reduced the power output from the solar cells. Consequently, the project moved to Dryden in late July, although conditions there also were not ideal. Nevertheless, Janice finished the testing, and on August 7, 1980, she flew a public demonstration of the aircraft at Dryden in which it went roughly 1.95 miles in 14 minutes and 21 seconds. This was significant as the first sustained flight of an aircraft relying solely on direct solar power rather than batteries. It provided the designers with practical experience for developing a more advanced, solar-powered aircraft, since the Gossamer Penguin was fragile and had limited controllability. This necessitated its flying early in the day when there were minimal wind and turbulence levels, but the angle of the sun was also low, requiring a panel for the solar cells that could be tilted toward the sun. Using the specific conclusions derived from their experience with Gossamer Penguin, the AeroVironment engineers designed Solar Challenger, a piloted, solar-powered aircraft strong enough to handle both long and high flights when encountering normal turbulence.

  11. Understanding Solar Cycle Variability

    Energy Technology Data Exchange (ETDEWEB)

    Cameron, R. H.; Schüssler, M., E-mail: cameron@mps.mpg.de [Max-Planck-Institut für Sonnensystemforschung, Justus-von-Liebig-Weg 3, D-37077 Göttingen (Germany)

    2017-07-10

    The level of solar magnetic activity, as exemplified by the number of sunspots and by energetic events in the corona, varies on a wide range of timescales. Most prominent is the 11-year solar cycle, which is significantly modulated on longer timescales. Drawing from dynamo theory, together with the empirical results of past solar activity and similar phenomena for solar-like stars, we show that the variability of the solar cycle can be essentially understood in terms of a weakly nonlinear limit cycle affected by random noise. In contrast to ad hoc “toy models” for the solar cycle, this leads to a generic normal-form model, whose parameters are all constrained by observations. The model reproduces the characteristics of the variable solar activity on timescales between decades and millennia, including the occurrence and statistics of extended periods of very low activity (grand minima). Comparison with results obtained with a Babcock–Leighton-type dynamo model confirm the validity of the normal-mode approach.

  12. Solar storms; Tormentas solares

    Energy Technology Data Exchange (ETDEWEB)

    Collaboration: Pereira Cuesta, S.; Pereira Pagan, B.

    2016-08-01

    Solar storms begin with an explosion, or solar flare, on the surface of the sun. The X-rays and extreme ultraviolet radiation from the flare reach the Earths orbit minutes later-travelling at light speed. The ionization of upper layers of our atmosphere could cause radio blackouts and satellite navigation errors (GPS). Soon after, a wave of energetic particles, electrons and protons accelerated by the explosion crosses the orbit of the Earth, and can cause real and significant damage. (Author)

  13. NREL Solar Radiation Resource Assessment Project: Status and outlook

    Science.gov (United States)

    Renne, D.; Riordan, C.; Maxwell, E.; Stoffel, T.; Marion, B.; Rymes, M.; Wilcox, S.; Myers, D.

    1992-05-01

    This report summarizes the activities and accomplishments of NREL's Solar Radiation Resource Assessment Project during fiscal year 1991. Currently, the primary focus of the SRRAP is to produce a 1961 - 1990 National Solar Radiation Data Base, providing hourly values of global horizontal, diffuse, and direct normal solar radiation at approximately 250 sites around the United States. Because these solar radiation quantities were measured intermittently at only about 50 of these sites, models were developed and applied to the majority of the stations to provide estimates of these parameters. Although approximately 93 percent of the data base consists of modeled data this represents a significant improvement over the SOLMET/ERSATZ 1952 - 1975 data base. The magnitude and importance of this activity are such that the majority of SRRAP human and financial resources were devoted to the data base development. However, in FY 1991 the SRRAP was involved in many other activities, which are reported here. These include the continued maintenance of a solar radiation monitoring network in the southeast United States at six Historically Black Colleges and Universities (HBCU's), the transfer of solar radiation resource assessment technology through a variety of activities, participation in international programs, and the maintenance and operation of NREL's Solar Radiation Research Laboratory.

  14. Spectral Monte Carlo simulation of collimated solar irradiation transfer in a water-filled prismatic louver.

    Science.gov (United States)

    Cai, Yaomin; Guo, Zhixiong

    2018-04-20

    The Monte Carlo model was developed to simulate the collimated solar irradiation transfer and energy harvest in a hollow louver made of silica glass and filled with water. The full solar spectrum from the air mass 1.5 database was adopted and divided into various discrete bands for spectral calculations. The band-averaged spectral properties for the silica glass and water were obtained. Ray tracing was employed to find the solar energy harvested by the louver. Computational efficiency and accuracy were examined through intensive comparisons of different band partition approaches, various photon numbers, and element divisions. The influence of irradiation direction on the solar energy harvest efficiency was scrutinized. It was found that within a 15° polar angle of incidence, the harvested solar energy in the louver was high, and the total absorption efficiency reached 61.2% under normal incidence for the current louver geometry.

  15. Evaluating Solar Resource Data Obtained from Multiple Radiometers Deployed at the National Renewable Energy Laboratory: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Habte, A.; Sengupta, M.; Andreas, A.; Wilcox, S.; Stoffel, T.

    2014-09-01

    Solar radiation resource measurements from radiometers are used to predict and evaluate the performance of photovoltaic and concentrating solar power systems, validate satellite-based models for estimating solar resources, and advance research in solar forecasting and climate change. This study analyzes the performance of various commercially available radiometers used for measuring global horizontal irradiances (GHI) and direct normal irradiances (DNI). These include pyranometers, pyrheliometers, rotating shadowband irradiometers, and a pyranometer with a shading ring deployed at the National Renewable Energy Laboratory's Solar Radiation Research Laboratory (SRRL). The radiometers in this study were deployed for one year (from April 1, 2011, through March 31, 2012) and compared to measurements from radiometers with the lowest values of estimated measurement uncertainties for producing reference GHI and DNI.

  16. Evaluation of Radiometers Deployed at the National Renewable Energy Laboratory's Solar Radiation Research Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Habte, Aron; Wilcox, Stephen; Stoffel, Thomas

    2015-12-23

    This study analyzes the performance of various commercially available radiometers used for measuring global horizontal irradiances and direct normal irradiances. These include pyranometers, pyrheliometers, rotating shadowband radiometers, and a pyranometer with fixed internal shading and are all deployed at the National Renewable Energy Laboratory's Solar Radiation Research Laboratory. Data from 32 global horizontal irradiance and 19 direct normal irradiance radiometers are presented. The radiometers in this study were deployed for one year (from April 1, 2011, through March 31, 2012) and compared to measurements from radiometers with the lowest values of estimated measurement uncertainties for producing reference global horizontal irradiances and direct normal irradiances.

  17. CERN... Solar Style

    CERN Multimedia

    2001-01-01

    Inventor William van Sprolant presenting the Solar Club's latest invention, the solar fountain. The CERN Solar Club is giving new meaning to the phrase 'fun in the sun' with their most recently developed contraption, the Solar Fountain. The Fountain was presented to the public just outside of Restaurant 1 on Wednesday October, 17th and uses solar energy to run a water pump at its base to propel a golden plastic ball up into the air. As lovely as the fountain is, the funny thing about it is that the height of the water jet and the ball are an artistic method of measuring the amount of solar power being captured by the photovoltaique panel (no batteries included). The day it was presented started out cloudy, but as the afternoon wore on, the weather brightened and the fountain jumped to life. William van Sprolant, the Solar Fountain's inventor, had great fun with the fountain in front of a group of visiting children swiveling the solar panel in multiple directions. 'Everyone who installs solar panels worrie...

  18. Direct Extraction of InP/GaAsSb/InP DHBT Equivalent-Circuit Elements From S-Parameters Measured at Cut-Off and Normal Bias Conditions

    DEFF Research Database (Denmark)

    Johansen, Tom Keinicke; Leblanc, Rémy; Poulain, Julien

    2016-01-01

    A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base-collector......A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base......-collector capacitance at zero collector current and the collector-to-emitter overlap capacitance $C_{ceo}$ present in InP DHBT devices. Low-frequency $S$-parameters measured at normal bias conditions then allows the extraction of the external access resistances $R_{bx}$, $R_{e}$, and $R_{cx}$ as well as the intrinsic...

  19. Hybrids of Solar Sail, Solar Electric, and Solar Thermal Propulsion for Solar-System Exploration

    Science.gov (United States)

    Wilcox, Brian H.

    2012-01-01

    Solar sails have long been known to be an attractive method of propulsion in the inner solar system if the areal density of the overall spacecraft (S/C) could be reduced to approx.10 g/sq m. It has also long been recognized that the figure (precise shape) of useful solar sails needs to be reasonably good, so that the reflected light goes mostly in the desired direction. If one could make large reflective surfaces with reasonable figure at an areal density of approx.10 g/sq m, then several other attractive options emerge. One is to use such sails as solar concentrators for solar-electric propulsion. Current flight solar arrays have a specific output of approx. 100W/kg at 1 Astronomical Unit (AU) from the sun, and near-term advances promise to significantly increase this figure. A S/C with an areal density of 10 g/sq m could accelerate up to 29 km/s per year as a solar sail at 1 AU. Using the same sail as a concentrator at 30 AU, the same spacecraft could have up to approx. 45 W of electric power per kg of total S/C mass available for electric propulsion (EP). With an EP system that is 50% power-efficient, exhausting 10% of the initial S/C mass per year as propellant, the exhaust velocity is approx. 119 km/s and the acceleration is approx. 12 km/s per year. This hybrid thus opens attractive options for missions to the outer solar system, including sample-return missions. If solar-thermal propulsion were perfected, it would offer an attractive intermediate between solar sailing in the inner solar system and solar electric propulsion for the outer solar system. In the example above, both the solar sail and solar electric systems don't have a specific impulse that is near-optimal for the mission. Solar thermal propulsion, with an exhaust velocity of the order of 10 km/s, is better matched to many solar system exploration missions. This paper derives the basic relationships between these three propulsion options and gives examples of missions that might be enabled by

  20. Energy storage using phase-change materials for active solar heating and cooling: An evaluation of future research and development direction

    Science.gov (United States)

    Borkowski, R. J.; Stovall, T. K.; Kedl, R. J.; Tomlinson, J. J.

    1982-04-01

    The current state of the art and commercial potential of active solar heating and cooling systems for buildings, and the use of thermal energy storage with these systems are assessed. The need for advanced latent heat storage subsystems in these applications and priorities for their development are determined. Latent storage subsystems are advantageous in applications where their compactness may be exploited. It is suggested that subsystems could facilitate storage in retrofit applications in which storage would be physically impossible otherwise.

  1. Power Conversion Efficiency of Arylamine Organic Dyes for Dye-Sensitized Solar Cells (DSSCs Explicit to Cobalt Electrolyte: Understanding the Structural Attributes Using a Direct QSPR Approach

    Directory of Open Access Journals (Sweden)

    Supratik Kar

    2016-12-01

    Full Text Available Post silicon solar cell era involves light-absorbing dyes for dye-sensitized solar systems (DSSCs. Therefore, there is great interest in the design of competent organic dyes for DSSCs with high power conversion efficiency (PCE to bypass some of the disadvantages of silicon-based solar cell technologies, such as high cost, heavy weight, limited silicon resources, and production methods that lead to high environmental pollution. The DSSC has the unique feature of a distance-dependent electron transfer step. This depends on the relative position of the sensitized organic dye in the metal oxide composite system. In the present work, we developed quantitative structure-property relationship (QSPR models to set up the quantitative relationship between the overall PCE and quantum chemical molecular descriptors. They were calculated from density functional theory (DFT and time-dependent DFT (TD-DFT methods as well as from DRAGON software. This allows for understanding the basic electron transfer mechanism along with the structural attributes of arylamine-organic dye sensitizers for the DSSCs explicit to cobalt electrolyte. The identified properties and structural fragments are particularly valuable for guiding time-saving synthetic efforts for development of efficient arylamine organic dyes with improved power conversion efficiency.

  2. Short-term solar irradiation forecasting based on Dynamic Harmonic Regression

    International Nuclear Information System (INIS)

    Trapero, Juan R.; Kourentzes, Nikolaos; Martin, A.

    2015-01-01

    Solar power generation is a crucial research area for countries that have high dependency on fossil energy sources and is gaining prominence with the current shift to renewable sources of energy. In order to integrate the electricity generated by solar energy into the grid, solar irradiation must be reasonably well forecasted, where deviations of the forecasted value from the actual measured value involve significant costs. The present paper proposes a univariate Dynamic Harmonic Regression model set up in a State Space framework for short-term (1–24 h) solar irradiation forecasting. Time series hourly aggregated as the Global Horizontal Irradiation and the Direct Normal Irradiation will be used to illustrate the proposed approach. This method provides a fast automatic identification and estimation procedure based on the frequency domain. Furthermore, the recursive algorithms applied offer adaptive predictions. The good forecasting performance is illustrated with solar irradiance measurements collected from ground-based weather stations located in Spain. The results show that the Dynamic Harmonic Regression achieves the lowest relative Root Mean Squared Error; about 30% and 47% for the Global and Direct irradiation components, respectively, for a forecast horizon of 24 h ahead. - Highlights: • Solar irradiation forecasts at short-term are required to operate solar power plants. • This paper assesses the Dynamic Harmonic Regression to forecast solar irradiation. • Models are evaluated using hourly GHI and DNI data collected in Spain. • The results show that forecasting accuracy is improved by using the model proposed

  3. Solar Energy.

    Science.gov (United States)

    Eaton, William W.

    Presented is the utilization of solar radiation as an energy resource principally for the production of electricity. Included are discussions of solar thermal conversion, photovoltic conversion, wind energy, and energy from ocean temperature differences. Future solar energy plans, the role of solar energy in plant and fossil fuel production, and…

  4. Variations in Solar Parameters and Cosmic Rays with Solar Magnetic Polarity

    Energy Technology Data Exchange (ETDEWEB)

    Oh, S. [Department of Earth Science Education, Chonnam National University, Gwangju, 61186 (Korea, Republic of); Yi, Y., E-mail: suyeonoh@jnu.ac.kr [Department of Astronomy, Space Science and Geology, Chungnam National University, Daejeon, 34134 (Korea, Republic of)

    2017-05-01

    The sunspot number varies with the 11-year Schwabe cycle, and the solar magnetic polarity reverses every 11 years approximately at the solar maximum. Because of polarity reversal, the difference between odd and even solar cycles is seen in solar activity. In this study, we create the mean solar cycle expressed by phase using the monthly sunspot number for all solar cycles 1–23. We also generate the mean solar cycle for sunspot area, solar radio flux, and cosmic ray flux within the allowance of observational range. The mean solar cycle has one large peak at solar maximum for odd solar cycles and two small peaks for most even solar cycles. The odd and even solar cycles have the statistical difference in value and shape at a confidence level of at least 98%. For solar cycles 19–23, the second peak in the even solar cycle is larger than the first peak. This result is consistent with the frequent solar events during the declining phase after the solar maximum. The difference between odd and even solar cycles can be explained by a combined model of polarity reversal and solar rotation. In the positive/negative polarity, the polar magnetic field introduces angular momentum in the same/opposite direction as/to the solar rotation. Thus the addition/subtraction of angular momentum can increase/decrease the motion of plasma to support the formation of sunspots. Since the polarity reverses at the solar maximum, the opposite phenomenon occurs in the declining phase.

  5. Solar energy

    Science.gov (United States)

    Rapp, D.

    1981-01-01

    The book opens with a review of the patterns of energy use and resources in the United States, and an exploration of the potential of solar energy to supply some of this energy in the future. This is followed by background material on solar geometry, solar intensities, flat plate collectors, and economics. Detailed attention is then given to a variety of solar units and systems, including domestic hot water systems, space heating systems, solar-assisted heat pumps, intermediate temperature collectors, space heating/cooling systems, concentrating collectors for high temperatures, storage systems, and solar total energy systems. Finally, rights to solar access are discussed.

  6. Solar Combisystems

    DEFF Research Database (Denmark)

    Thür, Alexander

    2006-01-01

    This note first introduces what is a solar combisystem, the structure how a solar combisystem is build up and what are criteria’s to evaluate a solar combisystem concept. Further on the main components of a solar combisystem, the main characteristics and possible advantages and disadvantages...... compared to each other are described. It is not the goal of this note to explain the technical details how to design all components of a solar combisystem. This is done during other lectures of the solar course and in other basic courses as well. This note tries to explain how a solar combisystem...

  7. Wireless transmission of metering data from a photovoltaic solar ...

    African Journals Online (AJOL)

    The data from direct cable connection was highly reliable because data ... aggregated solar home systems instead of establishing grid connected solar farms. ... Key words: PV solar home system, DC power meter, GSM, data adaptor software ...

  8. Solar Systems

    Science.gov (United States)

    1979-01-01

    The solar collectors shown are elements of domestic solar hot water systems produced by Solar One Ltd., Virginia Beach, Virginia. Design of these systems benefited from technical expertise provided Solar One by NASA's Langley Research Center. The company obtained a NASA technical support package describing the d e sign and operation of solar heating equipment in NASA's Tech House, a demonstration project in which aerospace and commercial building technology are combined in an energy- efficient home. Solar One received further assistance through personal contact with Langley solar experts. The company reports that the technical information provided by NASA influenced Solar One's panel design, its selection of a long-life panel coating which increases solar collection efficiency, and the method adopted for protecting solar collectors from freezing conditions.

  9. Study of direct beam radiation and standardization of (Engineering) insolation data in korea. 4

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, H S; Auh, C M; Lee, T K; Kim, E I; Jo, D K; Kim, H J; Kim, D H; Jeon, M S; Lee, S M; Chun, I S [Korea Inst. of Energy Research, Taejon (Korea, Republic of)

    1995-12-01

    Owing to the world-wide environmental issue and the unbalance on energy demands-offers, it is inevitable to conduct the research and development on clean alternative energy resource. The solar energy resource is recognized as one of the alternatives. A preparation for basic data should, therefore, arise for the extensive utilization of solar energy. Engineering solar (weather) data measured for at least a 30-year period should be needed for solar energy and energy conservation applications. These data should contain hourly averages of global horizontal, direct normal, and diffuse horizontal irradiation with hourly observations of other meteorological parameters such as sky cover, temperature, humidity, and wind speed. Normals, means, and extremes serving as system design data are to be selected from the 30 years basic data. However, collection of reasonable solar data has merely been carried out for global horizontal insolation since 1882 and direct normal insolation since 1991 in Korea. It still requires the considerable effort and time to square the reliability and to standardize the solar data. In parallel, the related techniques are to be developed such as data quality assessments and control, missing data and inconsistent data treatments, inter- and extra-potation techniques for the intermediate region among the weather stations. The R and D on these subject should be done advancing the practical applications. (author). 43 refs., 31 figs., 16 tabs.

  10. Design and performance evaluation of a new hybrid solar dryer for banana

    International Nuclear Information System (INIS)

    Amer, B.M.A.; Hossain, M.A.; Gottschalk, K.

    2010-01-01

    A hybrid solar dryer was designed and constructed using direct solar energy and a heat exchanger. The dryer consists of solar collector, reflector, heat exchanger cum heat storage unit and drying chamber. The drying chamber was located under the collector. The dryer was operated during normal sunny days as a solar dryer, and during cloudy day as a hybrid solar dryer. Drying was also carried out at night with stored heat energy in water which was collected during the time of sun-shine and with electric heaters located at water tank. The efficiency of the solar dryer was raised by recycling about 65% of the drying air in the solar dryer and exhausting a small amount of it outside the dryer. Under Mid-European summer conditions it can raise up the air temperature from 30 to 40 deg. C above the ambient temperature. The solar dryer was tested for drying of ripe banana slices. The capacity of the dryer was to dry about 30 kg of banana slices in 8 h in sunny day from an initial moisture content of 82% to the final moisture content of 18% (wb). In the same time it reduced to only 62% (wb) moisture content in open sun drying method. The colour, aroma and texture of the solar dried products were better than the sun drying products.

  11. Solar radiophysics

    International Nuclear Information System (INIS)

    McLean, D.J.; Labrum, N.R.

    1985-01-01

    This book treats all aspects of solar radioastronomy at metre wavelengths, particularly work carried out on the Australian radioheliograph at Culgoora, with which most of the authors have been associated in one way or another. After an introductory section on historical aspects, the solar atmosphere, solar flares, and coronal radio emission, the book deals with instrumentation, theory, and details of observations and interpretations of the various aspects of metrewave solar radioastronomy, including burst types, solar storms, and the quiet sun. (U.K.)

  12. Transparent solar cell window module

    Energy Technology Data Exchange (ETDEWEB)

    Chau, Joseph Lik Hang; Chen, Ruei-Tang; Hwang, Gan-Lin; Tsai, Ping-Yuan [Nanopowder and Thin Film Technology Center, ITRI South, Industrial Technology Research Institute, Tainan County 709 (China); Lin, Chien-Chu [I-Lai Acrylic Corporation, Tainan City (China)

    2010-03-15

    A transparent solar cell window module based on the integration of traditional silicon solar cells and organic-inorganic nanocomposite material was designed and fabricated. The transparent solar cell window module was composed of a nanocomposite light-guide plate and traditional silicon solar cells. The preparation of the nanocomposite light-guide plate is easy without modification of the traditional casting process, the nanoparticles sol can be added directly to the polymethyl methacrylate (PMMA) monomer syrup during the process. The solar energy collected by this window can be used to power up small household electrical appliances. (author)

  13. Normalization of multidirectional red and NIR reflectances with the SAVI

    Science.gov (United States)

    Huete, A. R.; Hua, G.; Qi, J.; Chehbouni, A.; Van Leeuwen, W. J. D.

    1992-01-01

    Directional reflectance measurements were made over a semi-desert gramma grassland at various times of the growing season. View angle measurements from +40 to -40 degrees were made at various solar zenith angles and soil moisture conditions. The sensitivity of the Normalized Difference Vegetation Index (NDVI) and the Soil Adjusted Vegetation Index (SAVI) to bidirectional measurements was assessed for purposes of improving remote temporal monitoring of vegetation dynamics. The SAVI view angle response was found to be symmetric about nadir while the NDVI response was strongly anisotropic. This enabled the view angle behavior of the SAVI to be normalized with a cosine function. In contrast to the NDVI, the SAVI was able to minimize soil moisture and shadow influences for all measurement conditions.

  14. A Solar Position Sensor Based on Image Vision.

    Science.gov (United States)

    Ruelas, Adolfo; Velázquez, Nicolás; Villa-Angulo, Carlos; Acuña, Alexis; Rosales, Pedro; Suastegui, José

    2017-07-29

    Solar collector technologies operate with better performance when the Sun beam direction is normal to the capturing surface, and for that to happen despite the relative movement of the Sun, solar tracking systems are used, therefore, there are rules and standards that need minimum accuracy for these tracking systems to be used in solar collectors' evaluation. Obtaining accuracy is not an easy job, hence in this document the design, construction and characterization of a sensor based on a visual system that finds the relative azimuth error and height of the solar surface of interest, is presented. With these characteristics, the sensor can be used as a reference in control systems and their evaluation. The proposed sensor is based on a microcontroller with a real-time clock, inertial measurement sensors, geolocation and a vision sensor, that obtains the angle of incidence from the sunrays' direction as well as the tilt and sensor position. The sensor's characterization proved how a measurement of a focus error or a Sun position can be made, with an accuracy of 0.0426° and an uncertainty of 0.986%, which can be modified to reach an accuracy under 0.01°. The validation of this sensor was determined showing the focus error on one of the best commercial solar tracking systems, a Kipp & Zonen SOLYS 2. To conclude, the solar tracking sensor based on a vision system meets the Sun detection requirements and components that meet the accuracy conditions to be used in solar tracking systems and their evaluation or, as a tracking and orientation tool, on photovoltaic installations and solar collectors.

  15. Design and Implementation of Dual Axis Solar Tracking system

    OpenAIRE

    Sirigauri N,; Raghav S

    2015-01-01

    Solar energy is a promising technology that can have huge long term benefits. Solar cells convert the solar energy into electrical energy. Solar tracking system is the most suited technology to improve the efficiency and enhance the performance by utilizing maximum solar energy through the solar cell. In hardware development we utilize LDR’s as sensors and two servomotors to direct the position of the solar panel. The software part is implemented on a code written using an Arduino...

  16. Solar Heating Systems with Evacuated Tubular Solar Collector

    DEFF Research Database (Denmark)

    Qin, Lin; Furbo, Simon

    1998-01-01

    Recently different designed evacuated tubular solar collectors were introduced on the market by different Chinese companies. In the present study, investigations on the performance of four different Chinese evacuated tubular collectors and of solar heating systems using these collectors were...... carried out, employing both laboratory test and theoretical calculations. The collectors were tested in a small solar domestic hot water (SDHW) system in a laboratory test facility under realistic conditions. The yearly thermal performance of solar heating systems with these evacuated tubular collectors......, as well as with normal flat-plate collectors was calculated under Danish weather conditions. It is found that, for small SDHW systems with a combi tank design, an increase of 25% -55% net utilized solar energy can be achieved by using these evacuated tubular collectors instead of normal flat...

  17. Solar powered Stirling engine

    Energy Technology Data Exchange (ETDEWEB)

    Meijer, R.J.

    1987-11-24

    In a solar dish module which comprises a dish which receives incident solar rays and reflects them to a focus at which is located the combination of a receiver and a heat engine organized and arranged so that the heat energy of the reflected solar rays collected at the receiver powers the engine, and wherein the receiver and heat engine are supported from the dish by a framework, the improvement is described which comprises journal means for journaling at least the engine on the framework to maintain certain predetermined spatial orientation for the engine in relation to the direction of gravity irrespective of spatial orientation of the dish.

  18. High-Fidelity Solar Power Income Modeling for Solar-Electric UAVs: Development and Flight Test Based Verification

    OpenAIRE

    Oettershagen, Philipp

    2017-01-01

    Solar power models are a crucial element of solar-powered UAV design and performance analysis. During the conceptual design phase, their accuracy directly relates to the accuracy of the predicted performance metrics and thus the final design characteristics of the solar-powered UAV. Likewise, during the operations phase of a solar-powered UAV accurate solar power income models are required to predict and assess the solar power system performance. However, the existing literature on solar-powe...

  19. Energy from solar balloons

    Energy Technology Data Exchange (ETDEWEB)

    Grena, Roberto [C. R. Casaccia, via Anguillarese 301, 00123 Roma (Italy)

    2010-04-15

    Solar balloons are hot air balloons in which the air is heated directly by the sun, by means of a black absorber. The lift force of a tethered solar balloon can be used to produce energy by activating a generator during the ascending motion of the balloon. The hot air is then discharged when the balloon reaches a predefined maximum height. A preliminary study is presented, along with an efficiency estimation and some considerations on possible realistic configurations. (author)

  20. Sunmotor Solar Shack 120

    International Nuclear Information System (INIS)

    Jensen, E.

    2009-01-01

    This article described a solar pump that was developed by Alberta-based Sunmotor International Ltd. The prototype Solar Shack 120 was recently deployed in central Alberta for a remediation project for Devon Canada. The portable solar pump unit is well suited for environmental remediation in the oilpatch where conventional electricity is not available. The solar panels automatically run the pump whenever there is enough sunlight and there is liquid in the sump. Devon Canada wanted a system that continues to pump during cloudy weather to avoid the accumulation of effluent in the sump. The Solar Shack 120 delivers 120 volts of alternating current (vac) power. Solar panels are used to charge a bank of large sealed batteries that supply direct power (DC) to an inverter, which converts it into AC. A thermostat control was added to shut off the pumps in cold weather to avoid battery discharging. The Solar Shack unit has possibilities in countries with unreliable electricity supplies. It could provide a backup power supply that automatically kicks in whenever the power grid goes down. Sunmotor International Ltd. can supply complete remote power systems for both AC and DC electrical requirements. The systems are designed for each application to ensure customer satisfaction. The company is currently building a unit that integrates solar power with a generator backup, thereby eliminating the annoying noise of a continually running generator. 1 fig

  1. Direct and seamless coupling of TiO{sub 2} nanotube photonic crystal to dye-sensitized solar cell: a single-step approach

    Energy Technology Data Exchange (ETDEWEB)

    Yip, Cho Tung; Zhou, Limin [Department of Mechanical Engineering, Hong Kong Polytechnic University, Hung Hom, Kowloon (China); Huang, Haitao; Xie, Keyu; Wang, Yu. [Department of Applied Physics and Materials Research Center, Hong Kong Polytechnic University, Hung Hom, Kowloon (China); Feng, Tianhua; Li, Jensen [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon (China); Tam, Wing Yim [Department of Physics, Hong Kong University of Science and Technology, Clear Water Bay, Kowloon (China)

    2011-12-15

    A TiO{sub 2} nanotube layer with a periodic structure is used as a photonic crystal to greatly enhance light harvesting in TiO{sub 2} nanotube-based dye-sensitized solar cells. Such a tube-on-tube structure fabricated by a single-step approach facilitates good physical contact, easy electrolyte infiltration, and efficient charge transport. An increase of over 50% in power conversion efficiency is obtained in comparison to reference cells without a photonic crystal layer (under similar total thickness and dye loading). (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  2. Solar Energy Educational Material, Activities and Science Projects

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Solar Energy Educational Materials Solar with glasses " ;The sun has produced energy for billions of years. Solar energy is the solar radiation that reaches the earth. Solar energy can be converted directly or indirectly into other forms of energy, such as

  3. Triblock-Terpolymer-Directed Self-Assembly of Mesoporous TiO2: High-Performance Photoanodes for Solid-State Dye-Sensitized Solar Cells

    KAUST Repository

    Docampo, Pablo

    2012-04-30

    A new self-assembly platform for the fast and straightforward synthesis of bicontinuous, mesoporous TiO 2 films is presented, based on the triblock terpolymer poly(isoprene - b - styrene - b - ethylene oxide). This new materials route allows the co-assembly of the metal oxide as a fully interconnected minority phase, which results in a highly porous photoanode with strong advantages over the state-of-the-art nanoparticle-based photoanodes employed in solidstate dye-sensitized solar cells. Devices fabricated through this triblock terpolymer route exhibit a high availability of sub-bandgap states distributed in a narrow and low enough energy band, which maximizes photoinduced charge generation from a state-of-the-art organic dye, C220. As a consequence, the co-assembled mesoporous metal oxide system outperformed the conventional nanoparticle-based electrodes fabricated and tested under the same conditions, exhibiting solar power-conversion efficiencies of over 5%. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Triblock-Terpolymer-Directed Self-Assembly of Mesoporous TiO2: High-Performance Photoanodes for Solid-State Dye-Sensitized Solar Cells

    KAUST Repository

    Docampo, Pablo; Stefik, Morgan; Guldin, Stefan; Gunning, Robert; Yufa, Nataliya A.; Cai, Ning; Wang, Peng; Steiner, Ullrich; Wiesner, Ulrich; Snaith, Henry J.

    2012-01-01

    A new self-assembly platform for the fast and straightforward synthesis of bicontinuous, mesoporous TiO 2 films is presented, based on the triblock terpolymer poly(isoprene - b - styrene - b - ethylene oxide). This new materials route allows the co-assembly of the metal oxide as a fully interconnected minority phase, which results in a highly porous photoanode with strong advantages over the state-of-the-art nanoparticle-based photoanodes employed in solidstate dye-sensitized solar cells. Devices fabricated through this triblock terpolymer route exhibit a high availability of sub-bandgap states distributed in a narrow and low enough energy band, which maximizes photoinduced charge generation from a state-of-the-art organic dye, C220. As a consequence, the co-assembled mesoporous metal oxide system outperformed the conventional nanoparticle-based electrodes fabricated and tested under the same conditions, exhibiting solar power-conversion efficiencies of over 5%. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Control of Solid-State Dye-Sensitized Solar Cell Performance by Block-Copolymer-Directed TiO2 Synthesis

    KAUST Repository

    Docampo, Pablo

    2010-04-21

    Hybrid dye-sensitized solar cells are typically composed of mesoporous titania (TiO2), light-harvesting dyes, and organic molecular hole-transporters. Correctly matching the electronic properties of the materials is critical to ensure efficient device operation. In this study, TiO 2 is synthesized in a welldefined morphological confinement that arises from the self-assembly of a diblock copolymer - poly(isoprene-b-ethylene oxide) (Pl-b-PEO). The crystallization environment, tuned by the inorganic (TiO2 mass) to organic (polymer) ratio, is shown to be a decisive factor in determining the distribution of sub-bandgap electronic states and the associated electronic function in solid-state dye-sensitized solar cells. Interestingly, the tuning of the sub-bandgap states does not appear to strongly influence the charge transport and recombination in the devices. However, increasing the depth and breadth of the density of sub-bandgap states correlates well with an increase in photocurrent generation, suggesting that a high density of these sub-bandgap states is critical for efficient photo-induced electron transfer and charge separation. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Control of Solid-State Dye-Sensitized Solar Cell Performance by Block-Copolymer-Directed TiO2 Synthesis

    KAUST Repository

    Docampo, Pablo; Guldin, Stefan; Stefik, Morgan; Tiwana, Priti; Orilall, M. Christopher; Hü ttner, Sven; Sai, Hiroaki; Wiesner, Ulrich; Steiner, Ulrich; Snaith, Henry J.

    2010-01-01

    Hybrid dye-sensitized solar cells are typically composed of mesoporous titania (TiO2), light-harvesting dyes, and organic molecular hole-transporters. Correctly matching the electronic properties of the materials is critical to ensure efficient device operation. In this study, TiO 2 is synthesized in a welldefined morphological confinement that arises from the self-assembly of a diblock copolymer - poly(isoprene-b-ethylene oxide) (Pl-b-PEO). The crystallization environment, tuned by the inorganic (TiO2 mass) to organic (polymer) ratio, is shown to be a decisive factor in determining the distribution of sub-bandgap electronic states and the associated electronic function in solid-state dye-sensitized solar cells. Interestingly, the tuning of the sub-bandgap states does not appear to strongly influence the charge transport and recombination in the devices. However, increasing the depth and breadth of the density of sub-bandgap states correlates well with an increase in photocurrent generation, suggesting that a high density of these sub-bandgap states is critical for efficient photo-induced electron transfer and charge separation. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. In vitro and in vivo assessment of direct effects of simulated solar and galactic cosmic radiation on human hematopoietic stem/progenitor cells.

    Science.gov (United States)

    Rodman, C; Almeida-Porada, G; George, S K; Moon, J; Soker, S; Pardee, T; Beaty, M; Guida, P; Sajuthi, S P; Langefeld, C D; Walker, S J; Wilson, P F; Porada, C D

    2017-06-01

    Future deep space missions to Mars and near-Earth asteroids will expose astronauts to chronic solar energetic particles (SEP) and galactic cosmic ray (GCR) radiation, and likely one or more solar particle events (SPEs). Given the inherent radiosensitivity of hematopoietic cells and short latency period of leukemias, space radiation-induced hematopoietic damage poses a particular threat to astronauts on extended missions. We show that exposing human hematopoietic stem/progenitor cells (HSC) to extended mission-relevant doses of accelerated high-energy protons and iron ions leads to the following: (1) introduces mutations that are frequently located within genes involved in hematopoiesis and are distinct from those induced by γ-radiation; (2) markedly reduces in vitro colony formation; (3) markedly alters engraftment and lineage commitment in vivo; and (4) leads to the development, in vivo, of what appears to be T-ALL. Sequential exposure to protons and iron ions (as typically occurs in deep space) proved far more deleterious to HSC genome integrity and function than either particle species alone. Our results represent a critical step for more accurately estimating risks to the human hematopoietic system from space radiation, identifying and better defining molecular mechanisms by which space radiation impairs hematopoiesis and induces leukemogenesis, as well as for developing appropriately targeted countermeasures.

  8. Triblock-terpolymer-directed self-assembly of mesoporous TiO{sub 2}: High-performance photoanodes for solid-state dye-sensitized solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Docampo, Pablo; Gunning, Robert; Snaith, Henry J. [Clarendon Laboratory, Department of Physics, University of Oxford, Parks Road, Oxford OX1 3PU (United Kingdom); Stefik, Morgan; Wiesner, Ulrich [Department of Materials Science and Engineering, Cornell University, Ithaca, NY 14853 (United States); Guldin, Stefan; Yufa, Nataliya A.; Steiner, Ullrich [Department of Physics, University of Cambridge, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom); Cai, Ning; Wang, Peng [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

    2012-06-15

    A new self-assembly platform for the fast and straightforward synthesis of bicontinuous, mesoporous TiO{sub 2} films is presented, based on the triblock terpolymer poly(isoprene-b-styrene-b-ethylene oxide). This new materials route allows the co-assembly of the metal oxide as a fully interconnected minority phase, which results in a highly porous photoanode with strong advantages over the state-of-the-art nanoparticle-based photoanodes employed in solid-state dye-sensitized solar cells. Devices fabricated through this triblock terpolymer route exhibit a high availability of sub-bandgap states distributed in a narrow and low enough energy band, which maximizes photoinduced charge generation from a state-of-the-art organic dye, C220. As a consequence, the co-assembled mesoporous metal oxide system outperformed the conventional nanoparticle-based electrodes fabricated and tested under the same conditions, exhibiting solar power-conversion efficiencies of over 5%. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  9. Anaerobic biogasification of domestic wastes and direct solar energy use to produce biogas, biofertilizer and distilled water in a city - a pilot plant

    Energy Technology Data Exchange (ETDEWEB)

    kumar, R.A.; Pandya, N.H.; Patil, A.M.; Annamalai, M.; Iyer, M.V.; Nirmala, K.A.; Venkatesh, P.; Prasad, C.R.; Subramani, C.

    1982-01-01

    Domestic wastes are a source of gas of high calorific value as well as biofertilizer and distilled water. A pilot project undertaken by the Tata Electric Cos., Bombay on recycling sewage, garbage and garden wastes of a community by converting them into biogas, organic fertilizer and distilled water is described. Techniques used are anaerobic fermentation and Solar drying using Solar stills. A fish pond also can be fed the output slurry as feed material. In this pilot plant, 1 to 2 m/sup 3/ raw sewage and one to two tons of processed garden wastes and garbage would be input daily into the digester. The production is expected to be about 100 m/sup 3/ of gas per day, along with about 1500 litres of slurry from which organic fertilizer of 100 200 Kgs can be bagged and transported as well as distilled water of about 500 to 1000 litres Laboratory studies and studies on an approximate scale model of the plant are described. Scaling up to a pilot plant by about 2000 times would increase the efficiency of the rate of gas production as has been found by other workers. These tests and studies have shown that the project is technically and eonomically viable. Applications of the process on a mass scale would result in increasing replacement of fossil energy intensive processes with negentropic methods of economic and social activities.

  10. Radiation hard solar cell and array

    International Nuclear Information System (INIS)

    Russell, R.L.

    1975-01-01

    A power generating solar cell for a spacecraft solar array is hardened against transient response to nuclear radiation while permitting normal operation of the cell in a solar radiation environment by shunting the cell with a second solar cell whose contacts are reversed relative to the power cell to form a cell module, exposing the power cell only to the solar radiation in a solar radiation environment to produce an electrical output at the module terminals, and exposing both cells to the nuclear radiation in a nuclear radiation environment so that the radiation induced currents generated by the cells suppress one another

  11. Evaluation of the National Solar Radiation Database (NSRDB): 1998-2015

    Energy Technology Data Exchange (ETDEWEB)

    Habte, Aron [National Renewable Energy Lab. (NREL), Golden, CO (United States); Sengupta, Manajit [National Renewable Energy Lab. (NREL), Golden, CO (United States); Lopez, Anthony [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2017-04-01

    This paper validates the performance of the physics-based Physical Solar Model (PSM) data set in the National Solar Radiation Data Base (NSRDB) to quantify the accuracy of the magnitude and the spatial and temporal variability of the solar radiation data. Achieving higher penetrations of solar energy on the electric grid and reducing integration costs requires accurate knowledge of the available solar resource. Understanding the impacts of clouds and other meteorological constituents on the solar resource and quantifying intra-/inter-hour, seasonal, and interannual variability are essential for accurately designing utility-scale solar energy projects. Solar resource information can be obtained from ground-based measurement stations and/or from modeled data sets. The availability of measurements is scarce, both temporally and spatially, because it is expensive to maintain a high-density solar radiation measurement network that collects good quality data for long periods of time. On the other hand, high temporal and spatial resolution gridded satellite data can be used to estimate surface radiation for long periods of time and is extremely useful for solar energy development. Because of the advantages of satellite-based solar resource assessment, the National Renewable Energy Laboratory developed the PSM. The PSM produced gridded solar irradiance -- global horizontal irradiance (GHI), direct normal irradiance (DNI), and diffuse horizontal irradiance -- for the NSRDB at a 4-km by 4-km spatial resolution and half-hourly temporal resolution covering the 18 years from 1998-2015. The NSRDB also contains additional ancillary meteorological data sets, such as temperature, relative humidity, surface pressure, dew point, and wind speed. Details of the model and data are available at https://nsrdb.nrel.gov. The results described in this paper show that the hourly-averaged satellite-derived data have a systematic (bias) error of approximately +5% for GHI and less than +10% for

  12. Solar energy

    International Nuclear Information System (INIS)

    Kruisheer, N.

    1992-01-01

    In five brief articles product information is given on solar energy applications with special attention to the Netherlands. After an introduction on solar energy availability in the Netherlands the developments in solar boiler techniques are dealt with. Solar water heaters have advantages for the environment, and government subsidies stimulate different uses of such water heaters. Also the developments of solar cells show good prospects, not only for developing countries, but also for the industrialized countries. In brief the developments in solar energy storage and the connection of solar equipment to the grid are discussed. Finally attention is paid to the applications of passive solar energy in the housing construction, the use of transparent thermal insulation and the developments of translucent materials. 18 figs., 18 ills

  13. Solar Imagery

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of solar photographic and illustrated datasets contributed by a number of national and private solar observatories located worldwide....

  14. Solar Features

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of solar feature datasets contributed by a number of national and private solar observatories located worldwide.

  15. Solar Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of indices related to solar activity contributed by a number of national and private solar observatories located worldwide. This...

  16. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  17. Solar Special

    International Nuclear Information System (INIS)

    Van Roekel, A.; Osborne, J.; Schroeter, S.; De Jong, R.; De Saint Jacob, Y.

    2009-01-01

    Solar power is growing much faster than most policymakers and analysts realise. As costs come down and feed-in tariffs go up across Europe, a number of countries have started in pursuit of market leader Germany. But in Germany criticism is growing of the multi-billion-euro support schemes that keep the solar industry booming. In this section of the magazine several articles are dedicated to developments in solar energy in Europe. The first article is an overview story on the strong growing global market for solar cells, mainly thanks to subsidy schemes. The second article is on the position of foreign companies in the solar market in Italy. Article number three is dedicated to the conditions for solar technology companies to establish themselves in the German state of Saxony. Also the fifth article deals with the development of solar cells in Saxony: scientists, plant manufacturers and module producers in Saxony are working on new technologies that can be used to produce solar electricity cost-effectively. The goal is to bring the price down to match that of conventionally generated electricity within the next few years. The sixth article deals with the the solar power market in Belgium, which may be overheated or 'oversubsidized'. Article seven is on France, which used to be a pioneer in solar technology, but now produces only a fraction of the solar output of market leader Germany. However, new attractive feed-in-tariffs are changing the solar landscape drastically

  18. Solar effects on communications

    International Nuclear Information System (INIS)

    Cleveland, F.; Malcolm, W.; Nordell, D.E.; Zirker, J.

    1991-01-01

    When people involved in the power industry think of Solar Magnetic Disturbances (SMD), they normally consider the potential for disrupting power transmission which results form solar-induced disturbances to the earth's magnetic field known as geomagnetic storms. However, in addition to the disruption of power transmission, solar phenomena can interfere with utility communication systems. Utilities use many different types of communication media, some of which can be affected by various solar phenomena. These include wire-based facilities (metallic cables and power line carrier), radio systems (HF, VHF, UHF mobile radio, microwave networks, and satellite transmissions), and fiber optic systems. This paper reports that the solar flares and other solar phenomena can affect these media through different mechanisms: Radio communications can be disturbed by flare-induced changes in the ionispheric layer of the atmosphere; Cable communications can be disrupted by the flare-induced changes in the magnetosphere which surrounds the earth. These changes, in turn, induce currents in the power equipment that energizes long communications cables; Satellite communications can be disrupted by the flare-induced perturbations of satellite orbits and equipment

  19. Solar Indices - Solar Radio Flux

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of indices related to solar activity contributed by a number of national and private solar observatories located worldwide. This...

  20. Coupled solar still, solar heater

    Energy Technology Data Exchange (ETDEWEB)

    Davison, R R; Harris, W B; Moor, D H; Delyannis, A; Delyannis, E [eds.

    1976-01-01

    Computer simulation of combinations of solar stills and solar heaters indicates the probable economic advantage of such an arrangement in many locations if the size of the heater is optimized relative to that of the still. Experience with various low cost solar heaters is discussed.

  1. Solar Sailing

    Science.gov (United States)

    Johnson, Les

    2009-01-01

    Solar sailing is a topic of growing technical and popular interest. Solar sail propulsion will make space exploration more affordable and offer access to destinations within (and beyond) the solar system that are currently beyond our technical reach. The lecture will describe solar sails, how they work, and what they will be used for in the exploration of space. It will include a discussion of current plans for solar sails and how advanced technology, such as nanotechnology, might enhance their performance. Much has been accomplished recently to make solar sail technology very close to becoming an engineering reality and it will soon be used by the world s space agencies in the exploration of the solar system and beyond. The first part of the lecture will summarize state-of-the-art space propulsion systems and technologies. Though these other technologies are the key to any deep space exploration by humans, robots, or both, solar-sail propulsion will make space exploration more affordable and offer access to distant and difficult destinations. The second part of the lecture will describe the fundamentals of space solar sail propulsion and will describe the near-, mid- and far-term missions that might use solar sails as a propulsion system. The third part of the lecture will describe solar sail technology and the construction of current and future sailcraft, including the work of both government and private space organizations.

  2. Solar energy applications in Nigeria

    Energy Technology Data Exchange (ETDEWEB)

    Ilenikhena, P.A.; Ezemonye, L.I.N.

    2010-09-15

    Solar radiation being abundantly present in Nigeria was one area of focus in renewable energy sources. Researches were carried out and technologies produced for direct harnessing of the energy in six energy centres across the country. Some state governments in collaboration with non-governmental agencies also sponsored solar energy projects in some villages that are not connected to the national grid.

  3. Integration of Solar Cells on Top of CMOS Chips - Part II: CIGS Solar Cells

    NARCIS (Netherlands)

    Lu, J.; Liu, Wei; Kovalgin, Alexeij Y.; Sun, Yun; Schmitz, Jurriaan

    2011-01-01

    We present the monolithic integration of deepsubmicrometer complementary metal–oxide–semiconductor (CMOS) microchips with copper indium gallium (di)selenide (CIGS) solar cells. Solar cells are manufactured directly on unpackaged CMOS chips. The microchips maintain comparable electronic performance,

  4. Graphene oxide-based efficient and scalable solar desalination under one sun with a confined 2D water path.

    Science.gov (United States)

    Li, Xiuqiang; Xu, Weichao; Tang, Mingyao; Zhou, Lin; Zhu, Bin; Zhu, Shining; Zhu, Jia

    2016-12-06

    Because it is able to produce desalinated water directly using solar energy with minimum carbon footprint, solar steam generation and desalination is considered one of the most important technologies to address the increasingly pressing global water scarcity. Despite tremendous progress in the past few years, efficient solar steam generation and desalination can only be achieved for rather limited water quantity with the assistance of concentrators and thermal insulation, not feasible for large-scale applications. The fundamental paradox is that the conventional design of direct absorber-bulk water contact ensures efficient energy transfer and water supply but also has intrinsic thermal loss through bulk water. Here, enabled by a confined 2D water path, we report an efficient (80% under one-sun illumination) and effective (four orders salinity decrement) solar desalination device. More strikingly, because of minimized heat loss, high efficiency of solar desalination is independent of the water quantity and can be maintained without thermal insulation of the container. A foldable graphene oxide film, fabricated by a scalable process, serves as efficient solar absorbers (>94%), vapor channels, and thermal insulators. With unique structure designs fabricated by scalable processes and high and stable efficiency achieved under normal solar illumination independent of water quantity without any supporting systems, our device represents a concrete step for solar desalination to emerge as a complementary portable and personalized clean water solution.

  5. Momentum flux of the solar wind near planetary magnetospheres: a comparative study

    International Nuclear Information System (INIS)

    Perez de Tejada, H.

    1985-01-01

    A study of the velocity profiles of the shocked solar wind exterior to the magnetospheres of the Earth, Mars and Venus is presented. A characteristic difference exists between the conditions present in planets with and without a strong intrinsic magnetic field. In a strongly magnetized planet (as it is the case in the earth), the velocity of the solar wind near the magnetopause remains nearly constant along directions normal to that boundary. In weakly magnetized planets (Venus, Mars), on the other hand, the velocity profile near the magnetopause/ionopause exhibits a transverse gradient which implies decreased values of the momentum flux of the solar wind in those regions. The implications of the different behavior of the shocked solar wind are discussed in connection with the nature of the interaction process that takes place in each case. (author)

  6. Solar wind parameters responsible for the plasma injection into the magnetospheric ring current region

    International Nuclear Information System (INIS)

    Bobrov, M.S.

    1977-01-01

    Solar wind effect on the magnetospheric ring-current region has been considered. The correlations with solar wind parameters of the magnitude qsub(o) proportional to the total energy of particles being injected into the magnetospheric ring-current region per one hour are studied statistically and by comparison of time variations. The data on 8 sporadic geomagnetic storms of various intensity, from moderate to very severe one, are used. It is found that qsub(o) correlates not only with the magnitude and the direction of the solar-wind magnetic field component normal to the ecliptic plane, Bsub(z), but also with the variability, sigmasub(B), of the total magnetic-field strength vector. The solar-wind flux velocity ν influences the average storm intensity but the time variations of ν during any individual storm do not correlate with those of qsub(o)

  7. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  8. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  9. Passive-solar construction handbook

    Energy Technology Data Exchange (ETDEWEB)

    Levy, E.; Evans, D.; Gardstein, C.

    1981-02-01

    Many of the basic elements of passive solar design are reviewed. Passive solar construction is covered according to system type, each system type discussion including a general discussion of the important design and construction issues which apply to the particular system and case studies illustrating designed and built examples of the system type. The three basic types of passive solar systems discussed are direct gain, thermal storage wall, and attached sunspace. Thermal performance and construction information is presented for typical materials used in passive solar collector components, storage components, and control components. Appended are an overview of analysis methods and a technique for estimating performance. (LEW)

  10. Speed of sound in the solar interior

    International Nuclear Information System (INIS)

    Christensen-Dalsgaard, J.; Rhodes, E.J. Jr.

    1985-01-01

    Frequencies of solar 5-min oscillations can be used to determine directly the sound speed of the solar interior. The determination described does not depend on a solar model, but relies only on a simple asymptotic description of the oscillations in terms of trapped acoustic waves. (author)

  11. SolarChill - a solar PV refrigerator without battery

    Energy Technology Data Exchange (ETDEWEB)

    Pedersen, P.H.; Poulsen, S.; Katic, I. [Danish Technological Inst., Taastrup (Denmark)

    2004-07-01

    A solar powered refrigerator (SolarChill) has been developed in an international project involving Greenpeace International, GTZ, UNICEF, UNEP, WHO, industrial partners and Danish Technological Institute. The refrigerator is able to operate directly on solar PV panels, without battery or additional electronics, and is therefore suitable for locations where little maintenance and reliable operation is mandatory. The main objective of the SolarChill Project is to help deliver vaccines and refrigeration to the rural poor. To achieve this objective, the SolarChill Project developed - and plans to make freely available a versatile refrigeration technology that is environmentally sound, technologically reliable, and affordable. SolarChill does not use any fluorocarbons in its cooling system or in the insulation. For domestic and small business applications, another type of solar refrigerator is under development. This is an upright type, suitable for cool storage of food and beverages in areas where grid power is non-existent or unstable. The market potential for this type is thus present in industrialised countries as well as in countries under development. The unique feature of SolarChill is that energy is stored in ice instead of in batteries. An ice compartment keeps the cabinet at desired temperatures during the night. The paper describes the product development, possible SolarChill applications and experience with the two types of solar refrigerators, as well as results from the laboratory and field test. (orig.)

  12. 3j Symbols: To Normalize or Not to Normalize?

    Science.gov (United States)

    van Veenendaal, Michel

    2011-01-01

    The systematic use of alternative normalization constants for 3j symbols can lead to a more natural expression of quantities, such as vector products and spherical tensor operators. The redefined coupling constants directly equate tensor products to the inner and outer products without any additional square roots. The approach is extended to…

  13. Solar pumped laser

    Science.gov (United States)

    Lee, J. H.; Hohl, F.; Weaver, W. R. (Inventor)

    1984-01-01

    A solar pumped laser is described in which the lasant is a gas that will photodissociate and lase when subjected to sunrays. Sunrays are collected and directed onto the gas lasant to cause it to lase. Applications to laser propulsion and laser power transmission are discussed.

  14. Experimental investigations of a chimney-dependent solar crop dryer

    Energy Technology Data Exchange (ETDEWEB)

    Afriyie, J.K.; Nazha, M.A.A.; Rajakaruna, H. [School of Engineering and Technology, De Montfort University, Queens Building, The Gateway, Leicester LE1 9BH (United Kingdom); Forson, F.K. [Department of Mechanical Engineering, Kwame Nkrumah University of Science and Technology, Kumasi (Ghana)

    2009-01-15

    An experimental investigation into the performance of a solar crop dryer with solar chimney and no air preheating is described. Tests were first performed on the cabinet dryer, using a normal chimney. The trials were repeated with a solar chimney. Still with the solar chimney, further trials were carried out with the roof of the drying chamber inclined further to form a tent dryer. The described tests include no-load tests for airflow rate measurements and drying tests, with cassava as the crop. Air velocities, temperatures, ambient relative humidity and the drop in crop moisture contents at different stages of the drying process are also presented. The effects of the various configurations described above on the drying process are deduced and discussed while comparing the experimental results with one another. In addition, the performance of the dryer in relation to other natural convection dryers is discussed. The results show that the solar chimney can increase the airflow rate of a direct-mode dryer especially when it is well designed with the appropriate angle of drying-chamber roof. However, the increase in flow rate only increases the drying rate when the relative humidity (RH) of the ambient air is below a certain mark (60% for cassava). (author)

  15. Variable solar control using thermotropic core/shell particles

    Energy Technology Data Exchange (ETDEWEB)

    Muehling, Olaf; Seeboth, Arno; Ruhmann, Ralf; Potechius, Elvira; Vetter, Renate [Fraunhofer Institute for Applied Polymer Research (IAP), Department of Chromogenic Polymers, Volmerstr. 7B, 12489 Berlin (Germany); Haeusler, Tobias [Brandenburg University of Technology (BTU Cottbus), Chair of Applied Physics/Thermophysics, Konrad-Zuse-Str. 1, 03046 Cottbus (Germany)

    2009-09-15

    Subject of our recent investigations is the utilization of a reversible thermotropic material for a self-regulating sun protection glazing that controls the solar energy input in order to avoid overheating. Based on the well-established UV curing technology for laminated glass a superior thermotropic material with tunable switching characteristics and of low material costs was developed. The polymer layer contains core/shell particles homogeneously dispersed in a UV-cured resin. The particle core in turn consists of an n-alkane mixture that is responsible for the temperature-induced clear/opaque switching. To obtain particles of well-defined size and with a narrow size distribution, the miniemulsion polymerization technique was used. The visible and solar optical properties (normal-normal, normal-hemispherical, and normal-diffuse transmittance) in the off (clear) and in the on state (opaque) were determined by UV/Vis/NIR spectroscopy. Samples containing particles of high median diameter (>800 nm) primarily scatter in the forward direction. However, with smaller particles (300-600 nm) a higher backscattering (reflection) efficiency was achieved. The largest difference in the normal-hemispherical transmittance could be found with a particle amount of 6% and a median scattering domain diameter of {proportional_to}380 nm. (author)

  16. Solar Photovoltaic

    OpenAIRE

    Wang, Chen; Lu, Yuefeng

    2016-01-01

    In the 21st century, human demand for new energy sources is urgent, because the traditional fossil energy is unable to meet human needs, and the fossil resource will make pollution, in this situation, solar energy gradually into the vision of scientists. As science advances, humans can already extensive use of solar energy to generate electricity. Solar energy is an inexhaustible and clean energy. In the global energy crisis, environmental pollution is the growing problem of today. The us...

  17. Solar magnetohydrodynamics

    International Nuclear Information System (INIS)

    Priest, E.R.

    1982-01-01

    The book serves several purposes. First set of chapters gives a concise general introduction to solar physics. In a second set the basic methods of magnetohydrodynamics are developed. A third set of chapters is an account of current theories for observed phenomena. The book is suitable for a course in solar physics and it also provides a comprehensive review of present magnetohydrodynamical models in solar physics. (SC)

  18. Solar constraints

    International Nuclear Information System (INIS)

    Provost, J.

    1984-01-01

    Accurate tests of the theory of stellar structure and evolution are available from the Sun's observations. The solar constraints are reviewed, with a special attention to the recent progress in observing global solar oscillations. Each constraint is sensitive to a given region of the Sun. The present solar models (standard, low Z, mixed) are discussed with respect to neutrino flux, low and high degree five-minute oscillations and low degree internal gravity modes. It appears that actually there do not exist solar models able to fully account for all the observed quantities. (Auth.)

  19. Solar Simulator

    Science.gov (United States)

    1981-01-01

    Oriel Corporation's simulators have a high pressure xenon lamp whose reflected light is processed by an optical system to produce a uniform solar beam. Because of many different types of applications, the simulators must be adjustable to replicate many different areas of the solar radiation spectrum. Simulators are laboratory tools for such purposes as testing and calibrating solar cells, or other solar energy systems, testing dyes, paints and pigments, pharmaceuticals and cosmetic preparations, plant and animal studies, food and agriculture studies and oceanographic research.

  20. Dependence of the solar absorptance of selective absorber coatings on the angle of incidence

    Energy Technology Data Exchange (ETDEWEB)

    Reed, K A

    1977-01-01

    The directional solar absorptances ..cap alpha../sub s/(theta) of samples of a number of selective absorber coatings have been determined. The spectral directional hemispherical reflectances plambda(theta;2..pi..) of each sample was measured over the wavelength range 0.3..mu.. to 2.5..mu.. at angles of incidence theta between 10/sup 0/ and 80/sup 0/. The quantity (1-plambda(theta;2..pi..)) was convoluted over an AM2 solar spectrum to obtain ..cap alpha../sub s/(theta) at each angle of incidence. The solar absorptance at near normal incidence varied from sample to sample and from coating to coating, as expected, given the present state of the art. All the absorptances show similar angular dependences, however. When normalized to unity at normal incidence, the data nearly describe a single curve, for which a power series in theta was found. For comparison, the solar absorptance was also determined for freshly prepared lamp black.

  1. Normal forms in Poisson geometry

    NARCIS (Netherlands)

    Marcut, I.T.

    2013-01-01

    The structure of Poisson manifolds is highly nontrivial even locally. The first important result in this direction is Conn's linearization theorem around fixed points. One of the main results of this thesis (Theorem 2) is a normal form theorem in Poisson geometry, which is the Poisson-geometric

  2. Inhibition and recovery of semiconservative DNA synthesis in normal and solar UV sensitive ICR 2A frog cell lines following the induction of non-dimer DNA damage by sunlamp UV > 315 nm

    Energy Technology Data Exchange (ETDEWEB)

    Rosenstein, B.S. (Brown Univ., Providence, RI (USA). Dept. of Radiation Medicine)

    1989-08-01

    Cultures of solar UV-sensitive cell lines DRP 36 and DRP 153, and of the parental ICR 2A cell line, were exposed to 150 kJ/m{sup 2} of sunlamp UV>315nm plus photoreactivating light, resulting in the induction primarily of non-dimer DNA damage. Following either 0, 3, 6, 12 or 24 h incubation, cultures were pulse-labelled with ({sup 3}H) thymidine, and the synthesis of different size classes of replicon intermediates measured using alkaline step elution assay. For all three cell lines tested, an immediate depression of low molecular weight DNA synthesis was observed, followed by inhibition of all size classes of replicon intermediates. Within 12 h following irradiation, recovery of DNA synthesis was observed, generally most apparent for low molecular weight DNA. The ICR 2A cells exhibited a nearly full recovery in all size classes of DNA synthesized by 24 h. A much smaller recovery of continued inhibition was primarily in the synthesis of full replicon size DNA, and most pronounced for DRP 36 cells. (author).

  3. Concentrator photovoltaic module architectures with capabilities for capture and conversion of full global solar radiation

    KAUST Repository

    Lee, Kyu Tae

    2016-12-06

    Emerging classes ofconcentrator photovoltaic (CPV) modules reach efficiencies that are far greater than those of even the highest performance flat-plate PV technologies, with architectures that have the potential to provide the lowest cost of energy in locations with high direct normal irradiance (DNI). A disadvantage is their inability to effectively use diffuse sunlight, thereby constraining widespread geographic deployment and limiting performance even under the most favorable DNI conditions. This study introduces a module design that integrates capabilities in flat-plate PV directly with the most sophisticated CPV technologies, for capture of both direct and diffuse sunlight, thereby achieving efficiency in PV conversion of the global solar radiation. Specific examples of this scheme exploit commodity silicon (Si) cells integrated with two different CPV module designs, where they capture light that is not efficiently directed by the concentrator optics onto large-scale arrays of miniature multijunction (MJ) solar cells that use advanced III-V semiconductor technologies. In this CPV scheme (

  4. Concentrator photovoltaic module architectures with capabilities for capture and conversion of full global solar radiation

    KAUST Repository

    Lee, Kyu Tae; Yao, Yuan; He, Junwen; Fisher, Brent; Sheng, Xing; Lumb, Matthew; Xu, Lu; Anderson, Mikayla A.; Scheiman, David; Han, Seungyong; Kang, Yongseon; Gumus, Abdurrahman; Bahabry, Rabab R.; Lee, Jung Woo; Paik, Ungyu; Bronstein, Noah D.; Alivisatos, A. Paul; Meitl, Matthew; Burroughs, Scott; Hussain, Muhammad Mustafa; Lee, Jeong Chul; Nuzzo, Ralph G.; Rogers, John A.

    2016-01-01

    Emerging classes ofconcentrator photovoltaic (CPV) modules reach efficiencies that are far greater than those of even the highest performance flat-plate PV technologies, with architectures that have the potential to provide the lowest cost of energy in locations with high direct normal irradiance (DNI). A disadvantage is their inability to effectively use diffuse sunlight, thereby constraining widespread geographic deployment and limiting performance even under the most favorable DNI conditions. This study introduces a module design that integrates capabilities in flat-plate PV directly with the most sophisticated CPV technologies, for capture of both direct and diffuse sunlight, thereby achieving efficiency in PV conversion of the global solar radiation. Specific examples of this scheme exploit commodity silicon (Si) cells integrated with two different CPV module designs, where they capture light that is not efficiently directed by the concentrator optics onto large-scale arrays of miniature multijunction (MJ) solar cells that use advanced III-V semiconductor technologies. In this CPV scheme (

  5. Manhattan Solar Cannon

    Science.gov (United States)

    Treffers, Richard R.; Loisos, George; Ubbelohde, Susan; Douglas, Susanna; Pintos, Eduardo; Mulherin, James; Pasley, David

    2015-01-01

    We describe a 2.4 m hexagonal solar collector atop a Manhattan office building used for a solar / arts project. The collector uses an afocal design to concentrate the sunlight into a 0.6 m diameter beam which is directed by mirrors into a 80 m long fiber optic sculpture which descends an interior stairwell. The collector is fully steerable and follows the sun each day robotically. The control system and the optical design of the collector as well as the fiber optic sculpture will be discussed.

  6. Solar noise storms

    CERN Document Server

    Elgaroy, E O

    2013-01-01

    Solar Noise Storms examines the properties and features of solar noise storm phenomenon. The book also presents some theories that can be used to gain a better understanding of the phenomenon. The coverage of the text includes topics that cover the features and behavior of noise storms, such as the observable features of noise storms; the relationship between noise storms and the observable features on the sun; and ordered behavior of storm bursts in the time-frequency plane. The book also covers the spectrum, polarization, and directivity of noise storms. The text will be of great use to astr

  7. Solar cooking

    Science.gov (United States)

    Over two billion people face fuel wood shortages, causing tremendous personal and environmental stress. Over 4 million people die prematurely from indoor air pollution. Solar cooking can reduce fuel wood consumption and indoor air pollution. Solar cooking has been practiced and published since th...

  8. Solar Sprint

    Science.gov (United States)

    Tabor, Richard; Anderson, Stephen

    2007-01-01

    In the "Solar Sprint" activity, students design, test, and race a solar-powered car built with Legos. The use of ratios is incorporated to simulate the actual work of scientists and engineers. This method encourages fourth-grade students to think about multiple variables and stimulates their curiosity when an activity doesn't come out as…

  9. Morphology control and device optimization for efficient organic solar cells

    NARCIS (Netherlands)

    Gevaerts, Veronique

    2013-01-01

    Renewable energy is paramount for a sustainable global future. Solar cells convert solar light directly into electricity and are therefore of great interest in meeting the world’s energy demand. Currently crystalline silicon solar cells dominate the market. Solution processed organic solar cells can

  10. Space solar power - An energy alternative

    Science.gov (United States)

    Johnson, R. W.

    1978-01-01

    The space solar power concept is concerned with the use of a Space Power Satellite (SPS) which orbits the earth at geostationary altitude. Two large symmetrical solar collectors convert solar energy directly to electricity using photovoltaic cells woven into blankets. The dc electricity is directed to microwave generators incorporated in a transmitting antenna located between the solar collectors. The antenna directs the microwave beam to a receiving antenna on earth where the microwave energy is efficiently converted back to dc electricity. The SPS design promises 30-year and beyond lifetimes. The SPS is relatively pollution free as it promises earth-equivalence of 80-85% efficient ground-based thermal power plant.

  11. Controlling the directionality of charge transfer in phthalocyaninato zinc sensitizer for a dye-sensitized solar cell: density functional theory studies.

    Science.gov (United States)

    Wan, Liang; Qi, Dongdong; Zhang, Yuexing; Jiang, Jianzhuang

    2011-01-28

    Density functional theory (DFT) calculation on the molecular structures, charge distribution, molecular orbitals, electronic absorption spectra of a series of eight unsymmetrical phthalocyaninato zinc complexes with one peripheral (E)-2-cyano-3-(5-vinylthiophen-2-yl) acrylic acid substituent at 2 or 3 position as an electron-withdrawing group and a different number of electron-donating amino groups at the remaining peripheral positions (9, 10, 16, 17, 23, 24) of the phthalocyanine ring, namely ZnPc-β-A, ZnPc-β-A-I-NH(2), ZnPc-β-A-II-NH(2), ZnPc-β-A-III-NH(2), ZnPc-β-A-I,II-NH(2), ZnPc-β-A-I,III-NH(2), ZnPc-β-A-II,III-NH(2), and ZnPc-β-A-I,II,III-NH(2), reveals the effects of amino groups on the charge transfer properties of these phthalocyanine derivatives with a typical D-π-A electronic structure. The introduction of amino groups was revealed altering of the atomic charge distribution, lifting the frontier molecular orbital level, red-shift of the near-IR bands in the electronic absorption spectra, and finally resulting in enhanced charge transfer directionality for the phthalocyanine compounds. Along with the increase of the peripheral amino groups at the phthalocyanine ring from 0, 2, 4, to 6, the dihedral angle between the phthalocyanine ring and the average plane of the (E)-2-cyano-3-(5-vinylthiophen-2-yl) acrylic acid substituent increases from 0 to 3.3° in an irregular manner. This is in good contrast to the regular and significant change in the charge distribution, destabilization of frontier orbital energies, and red shift of near-IR bands of phthalocyanine compounds along the same order. In addition, comparative studies indicate the smaller effect of incorporating two amino groups onto the 16 and 17 than on 9 and 10 or 23 and 24 peripheral positions of the phthalocyanine ring onto the aforementioned electronic properties, suggesting the least effect on tuning the charge transfer property of the phthalocyanine compound via introducing two

  12. Solar thermal

    International Nuclear Information System (INIS)

    Jones, J.

    2006-01-01

    While wind power is widely acknowledged as the most developed of the 'new' renewables, the number two technology, in terms of installed capacity functioning worldwide, is solar heating, or solar thermal. The author has investigated recent industry reports on how these markets are developing. The authors of an International Energy Agency (IEA) survey studied 41 countries in depth at the end of 2004, revealing that 141 million m 3 - corresponding to an installed capacity of 98.4 GWth - were installed in the sample countries (these nations represent 3.74 billion people, about 57% of the world's population). The installed capacity within the areas studied represents approximately 85%-90% of the solar thermal market worldwide. The use of solar heating varies greatly between countries - even close neighbours - and between economic regions. Its uptake often has more to do with policy than solar resource. There is also different uptake of technology. In China, Europe and Japan, plants with flat-plate and evacuated tube collectors are used, mainly to heat water and for space heating. Unglazed plastic collectors, used mainly for swimming pool heating, meanwhile, dominate the North American markets. Though the majority of solar heating installations today are installed on domestic rooftops, the larger-scale installations should not be overlooked. One important part of the market is the hotel sector - in particular hotels in locations that serve the seasonal summer holiday market, where solar is extremely effective. Likewise hospitals and residential homes, multi-family apartment blocks and sports centres are all good examples of places where solar thermal can deliver results. There are also a growing number of industrial applications, where solar thermal can meet the hot water needs (and possibly more) of a range of industries, such as food processing and agriculture. The ability of solar to provide a heat source for cooling is expected to become increasingly important as

  13. Solar thermal

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.

    2006-07-15

    While wind power is widely acknowledged as the most developed of the 'new' renewables, the number two technology, in terms of installed capacity functioning worldwide, is solar heating, or solar thermal. The author has investigated recent industry reports on how these markets are developing. The authors of an International Energy Agency (IEA) survey studied 41 countries in depth at the end of 2004, revealing that 141 million m{sup 3} - corresponding to an installed capacity of 98.4 GWth - were installed in the sample countries (these nations represent 3.74 billion people, about 57% of the world's population). The installed capacity within the areas studied represents approximately 85%-90% of the solar thermal market worldwide. The use of solar heating varies greatly between countries - even close neighbours - and between economic regions. Its uptake often has more to do with policy than solar resource. There is also different uptake of technology. In China, Europe and Japan, plants with flat-plate and evacuated tube collectors are used, mainly to heat water and for space heating. Unglazed plastic collectors, used mainly for swimming pool heating, meanwhile, dominate the North American markets. Though the majority of solar heating installations today are installed on domestic rooftops, the larger-scale installations should not be overlooked. One important part of the market is the hotel sector - in particular hotels in locations that serve the seasonal summer holiday market, where solar is extremely effective. Likewise hospitals and residential homes, multi-family apartment blocks and sports centres are all good examples of places where solar thermal can deliver results. There are also a growing number of industrial applications, where solar thermal can meet the hot water needs (and possibly more) of a range of industries, such as food processing and agriculture. The ability of solar to provide a heat source for cooling is expected to become

  14. Solar energy: photovoltaics

    International Nuclear Information System (INIS)

    Goetzberger, A.; Voss, B.; Knobloch, J.

    1994-01-01

    This textbooks covers the following topics: foundations of photovoltaics, solar energy, P-N junctions, physics of solar cells, high-efficiency solar cells, technology of Si solar cells, other solar cells, photovoltaic applications. (orig.)

  15. Various Barbs in Solar Filaments

    Science.gov (United States)

    Filippov, Boris

    2017-07-01

    Interest to lateral details of the solar filament shape named barbs, motivated by their relationship to filament chirality and helicity, showed their different orientation relative to the expected direction of the magnetic field. While the majority of barbs are stretched along the field, some barbs seem to be transversal to it and are referred to as anomalous barbs. We analyse the deformation of helical field lines by a small parasitic polarity using a simple flux rope model with a force-free field. A rather small and distant source of parasitic polarity stretches the bottom parts of the helical lines in its direction creating a lateral extension of dips below the flux-rope axis. They can be considered as normal barbs of the filament. A stronger and closer source of parasitic polarity makes the flux-rope field lines to be convex below its axis and creates narrow and deep dips near its position. As a result, the narrow structure, with thin threads across it, is formed whose axis is nearly perpendicular to the field. The structure resembles an anomalous barb. Hence, the presence of anomalous barbs does not contradict the flux-rope structure of a filament.

  16. A direct comparison of popular models of normal memory loss and Alzheimer's disease in samples of African Americans, Mexican Americans, and refugees and immigrants from the former Soviet Union.

    Science.gov (United States)

    Schrauf, Robert W; Iris, Madelyn

    2011-04-01

    To understand how people differentiate normal memory loss from Alzheimer's disease (AD) by investigating cultural models of these conditions. Ethnographic interviews followed by a survey. Cultural consensus analysis was used to test for the presence of group models, derive the "culturally correct" set of beliefs, and compare models of normal memory loss and AD. Chicago, Illinois. One hundred eight individuals from local neighborhoods: African Americans, Mexican Americans, and refugees and immigrants from the former Soviet Union. Participants responded to yes-or-no questions about the nature and causes of normal memory loss and AD and provided information on ethnicity, age, sex, acculturation, and experience with AD. Groups held a common model of AD as a brain-based disease reflecting irreversible cognitive decline. Higher levels of acculturation predicted greater knowledge of AD. Russian speakers favored biological over psychological models of the disease. Groups also held a common model of normal memory loss, including the important belief that "normal" forgetting involves eventual recall of the forgotten material. Popular models of memory loss and AD confirm that patients and clinicians are speaking the same "language" in their discussions of memory loss and AD. Nevertheless, the presence of coherent models of memory loss and AD, and the unequal distribution of that knowledge across groups, suggests that clinicians should include wider circles of patients' families and friends in their consultations. These results frame knowledge as distributed across social groups rather than simply the possession of individual minds. © 2011, Copyright the Authors. Journal compilation © 2011, The American Geriatrics Society.

  17. Solar Newsletter | Solar Research | NREL

    Science.gov (United States)

    more about work by this consortium, which crosses national laboratories, on new materials and designs information on NREL's research and development of solar technologies. To receive new issues by email prize, focused on solar energy technologies, and will release the prize rules and open registration

  18. Passive solar heating

    Energy Technology Data Exchange (ETDEWEB)

    Wiberg, K

    1981-11-10

    The present work treats the possibilities for heating according to the passive solar heating method. Problems of 'spatial organization in an energy-saving society' are distinguished from among other social problems. The final delimination of the actual problems under investigation consists of the use of passive solar heating and especially the 'consequences of such solar heating exploitation upon the form and structures' of planning and construction. In the concluding chapter an applied example shows how this method can be used in designing an urban area and what are its limitations. The results indicate the possibilities and difficulties in attempting to transfer this ideal and general method into models and directives for form and structure from which examples of the actual possibilities in practical planning can be given.

  19. The solar power satellite

    Energy Technology Data Exchange (ETDEWEB)

    Combes, P.F.

    1982-01-01

    The construction, launch, components, and operations of satellite solar power systems (SSPS) for direct beaming of solar energy converted to electricity to earth stations are outlined. The reference designs of either Si or concentrator GaAs solar cell assemblies large enough to project 5 GW of power are described. The beam will be furnished by klystrons or amplitrons for reception by rectennas on earth. Conforming to the law of amplitude and the equiphase law will permit high efficiencies, pointing accuracy, and low power deposition/sq cm, thus avoiding environmental problems, although some telecommunications systems may suffer interference. The construction of the dipole rectenna grid is sketched, noting that one receiver would be an ellipse sized at 10 x 13 km. Various forms of pollution which could result from the construction of an SSPS are examined.

  20. Proton solar flares

    International Nuclear Information System (INIS)

    Shaposhnikova, E.F.

    1979-01-01

    The observations of proton solar flares have been carried out in 1950-1958 using the extrablackout coronograph of the Crimea astrophysical observatory. The experiments permit to determine two characteristic features of flares: the directed motion of plasma injection flux from the solar depths and the appearance of a shock wave moving from the place of the injection along the solar surface. The appearance of the shock wave is accompanied by some phenomena occuring both in the sunspot zone and out of it. The consistent flash of proton flares in the other groups of spots, the disappearance of fibres and the appearance of eruptive prominences is accomplished in the sunspot zone. Beyond the sunspot zone the flares occur above spots, the fibres disintegrate partially or completely and the eruptive prominences appear in the regions close to the pole

  1. The Global Solar Dynamo

    Science.gov (United States)

    Cameron, R. H.; Dikpati, M.; Brandenburg, A.

    2017-09-01

    A brief summary of the various observations and constraints that underlie solar dynamo research are presented. The arguments that indicate that the solar dynamo is an alpha-omega dynamo of the Babcock-Leighton type are then shortly reviewed. The main open questions that remain are concerned with the subsurface dynamics, including why sunspots emerge at preferred latitudes as seen in the familiar butterfly wings, why the cycle is about 11 years long, and why the sunspot groups emerge tilted with respect to the equator (Joy's law). Next, we turn to magnetic helicity, whose conservation property has been identified with the decline of large-scale magnetic fields found in direct numerical simulations at large magnetic Reynolds numbers. However, magnetic helicity fluxes through the solar surface can alleviate this problem and connect theory with observations, as will be discussed.

  2. Integration of Solar Cells on Top of CMOS Chips Part I: a-Si Solar Cells

    NARCIS (Netherlands)

    Lu, J.; Kovalgin, Alexeij Y.; van der Werf, Karine H.M.; Schropp, Ruud E.I.; Schmitz, Jurriaan

    2011-01-01

    We present the monolithic integration of deepsubmicrometer complementary metal–oxide–semiconductor (CMOS) microchips with a-Si:H solar cells. Solar cells are manufactured directly on the CMOS chips. The microchips maintain comparable electronic performance, and the solar cells show efficiency values

  3. A novel high efficiency solar photovoltalic pump

    NARCIS (Netherlands)

    Diepens, J.F.L.; Smulders, P.T.; Vries, de D.A.

    1993-01-01

    The daily average overall efficiency of a solar pump system is not only influenced by the maximum efficiency of the components of the system, but just as much by the correct matching of the components to the local irradiation pattern. Normally centrifugal pumps are used in solar pump systems. The

  4. Solar magnetohydrodynamics

    International Nuclear Information System (INIS)

    Priest, E.R.

    1982-01-01

    Solar MHD is an important tool for understanding many solar phenomena. It also plays a crucial role in explaining the behaviour of more general cosmical magnetic fields and plasmas, since the Sun provides a natural laboratory in which such behaviour may be studied. While terrestrial experiments are invaluable in demonstrating general plasma properties, conclusions from them cannot be applied uncritically to solar plasmas and have in the past given rise to misconceptions about solar magnetic field behaviour. Important differences between a laboratory plasma on Earth and the Sun include the nature of boundary conditions, the energy balance, the effect of gravity and the size of the magnetic Reynolds number (generally of order unity on the Earth and very much larger on the Sun). The overall structure of the book is as follows. It begins with two introductory chapters on solar observations and the MHD equations. Then the fundamentals of MHD are developed in chapters on magnetostatics, waves, shocks, and instabilities. Finally, the theory is applied to the solar phenomena of atmospheric heating, sunspots, dynamos, flares, prominences, and the solar wind. (Auth.)

  5. Direct and semi-direct approaches to lepton mixing with a massless neutrino

    International Nuclear Information System (INIS)

    King, Stephen F.; Ludl, Patrick Otto

    2016-01-01

    We discuss the possibility of enforcing a massless Majorana neutrino in the direct and semi-direct approaches to lepton mixing, in which the PMNS matrix is partly predicted by subgroups of a discrete family symmetry, extending previous group searches up to order 1535. We find a phenomenologically viable scheme for the semi-direct approach based on Q(648) which contains Δ(27) and the quaternion group as subgroups. This leads to novel predictions for the first column of the PMNS matrix corresponding to a normal neutrino mass hierarchy with m_1=0, and sum rules for the mixing angles and phase which are characterised by the solar angle being on the low side θ_1_2∼31"∘ and the Dirac (oscillation) CP phase δ being either about ±45"∘ or ±π.

  6. Availability of solar radiation and standards for solar access

    Energy Technology Data Exchange (ETDEWEB)

    Casabianca, G.A.; Evans, J.M. [Research Centre Habitat and Energy, Facultad de Arquitectura, Diseno y Urbanismo, Universidad de Buenos Aires, Capital Federal (Argentina)

    1997-12-31

    In southern Argentina, a region between latitudes 38 deg C and 55 deg C S, the heating demand in the residential sector is high while the availability of solar radiation is limited. A new proposal for solar access standards has been developed, taking into account the climatic conditions of each location, the effective availability of solar radiation and the direct sunlight requirements. This study analyses the climatic conditions for the Patagonia, relating heating demand and solar radiation availability in different sites, and presents the development of new sunlight standards that respond to these regional conditions. As a result of this study, the new Argentine standard TRAM 11.603 includes new conditions to protect solar access and provide design recommendations. (orig.) 4 refs.

  7. Solar energy – new photovoltaic technologies

    DEFF Research Database (Denmark)

    Sommer-Larsen, Peter

    2009-01-01

    Solar energy technologies directly convert sunlight into electricity and heat, or power chemical reactions that convert simple molecules into synthetic chemicals and fuels. The sun is by far the most abundant source of energy, and a sustainable society will need to rely on solar energy as one...... of its major energy sources. Solar energy is a focus point in many strategies for a sustainable energy supply. The European Commission’s Strategic Energy Plan (SET-plan) envisages a Solar Europe Initiative, where photovoltaics and concentrated solar power (CSP) supply as much power as wind mills...... in the future. Much focus is directed towards photovoltaics presently. Installation of solar cell occurs at an unprecedented pace and the expectations of the photovoltaics industry are high: a total PV capacity of 40 GW by 2012 as reported by a recent study. The talk progresses from general solar energy topics...

  8. Solar collectors

    Energy Technology Data Exchange (ETDEWEB)

    Hullmann, H; Schmidt, B [Technische Univ. Hannover (Germany, F.R.). Inst. fuer Industrialisierung des Bauens

    1976-01-01

    The utilisation possibilities of solar energy for the energy supplying of buildings are becoming increasingly more significant. Solar research at the moment aims predominantly with a high level of efficiency and therefore making accessible a significant range of applications for solar technology. Parallel to this are attempts to effect the saving of energy, be it in the demand for energy-saving constructions or in the increasing development and application of rational energy utilisation by technologists. The most important point of these activities at the moment, is still technological methods.

  9. Solar neutrinos

    International Nuclear Information System (INIS)

    Schatzman, E.

    1983-01-01

    The solar energy is produced by a series of nuclear reactions taking place in the deep interior of the sun. Some of these reactions produce neutrinos which may be detected, the proper detection system being available. The results of the Davis experiment (with 37 Cl) are given, showing a deficiency in the solar neutrino flux. The relevant explanation is either a property of the neutrino or an important change in the physics of the solar models. The prospect of a new experiment (with 71 Ga) is important as it will decide which of the two explanations is correct [fr

  10. Nanocrystal Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Gur, Ilan [Univ. of California, Berkeley, CA (United States)

    2006-01-01

    This dissertation presents the results of a research agenda aimed at improving integration and stability in nanocrystal-based solar cells through advances in active materials and device architectures. The introduction of 3-dimensional nanocrystals illustrates the potential for improving transport and percolation in hybrid solar cells and enables novel fabrication methods for optimizing integration in these systems. Fabricating cells by sequential deposition allows for solution-based assembly of hybrid composites with controlled and well-characterized dispersion and electrode contact. Hyperbranched nanocrystals emerge as a nearly ideal building block for hybrid cells, allowing the controlled morphologies targeted by templated approaches to be achieved in an easily fabricated solution-cast device. In addition to offering practical benefits to device processing, these approaches offer fundamental insight into the operation of hybrid solar cells, shedding light on key phenomena such as the roles of electrode-contact and percolation behavior in these cells. Finally, all-inorganic nanocrystal solar cells are presented as a wholly new cell concept, illustrating that donor-acceptor charge transfer and directed carrier diffusion can be utilized in a system with no organic components, and that nanocrystals may act as building blocks for efficient, stable, and low-cost thin-film solar cells.

  11. Concentrating Solar Power Projects - Planta Solar 20 | Concentrating Solar

    Science.gov (United States)

    Power | NREL 20 This page provides information on Planta Solar 20, a concentrating solar power Solar's Planta Solar 20 (PS20) is a 20-megawatt power tower plant being constructed next to the PS10 tower and increasing incident solar radiation capture will increase net electrical power output by 10

  12. External perforated Solar Screens for daylighting in residential desert buildings: Identification of minimum perforation percentages

    KAUST Repository

    Sherif, Ahmed; Sabry, Hanan; Rakha, Tarek

    2012-01-01

    and Saudi Arabia, result in the admittance of direct solar radiation, which leads to thermal discomfort and the incidence of undesired glare. One type of shading systems that is used to permit daylight while controlling solar penetration is " Solar Screens

  13. Solar Probe Cup: Laboratory Performance

    Science.gov (United States)

    Case, A. W.; Kasper, J. C.; Korreck, K. E.; Stevens, M. L.; Larson, D. E.; Wright, K. H., Jr.; Gallagher, D. L.; Whittlesey, P. L.

    2017-12-01

    The Solar Probe Cup (SPC) is a Faraday Cup instrument that will fly on the Paker Solar Probe (PSP) spacecraft, orbiting the Sun at as close as 9.86 solar radii. The SPC instrument is designed to measure the thermal solar wind plasma (protons, alphas, and electrons) that will be encountered throughout its close encounter with the Sun. Due to the solar wind flow being primarily radial, the SPC instrument is pointed directly at the Sun, resulting in an extreme thermal environment that must be tolerated throughout the primary data collection phase. Laboratory testing has been performed over the past 6 months to demonstrate the instrument's performance relative to its requirements, and to characterize the measurements over the expected thermal range. This presentation will demonstrate the performance of the instrument as measured in the lab, describe the operational configurations planned for flight, and discuss the data products that will be created.

  14. Hydrogen production from solar energy

    Science.gov (United States)

    Eisenstadt, M. M.; Cox, K. E.

    1975-01-01

    Three alternatives for hydrogen production from solar energy have been analyzed on both efficiency and economic grounds. The analysis shows that the alternative using solar energy followed by thermochemical decomposition of water to produce hydrogen is the optimum one. The other schemes considered were the direct conversion of solar energy to electricity by silicon cells and water electrolysis, and the use of solar energy to power a vapor cycle followed by electrical generation and electrolysis. The capital cost of hydrogen via the thermochemical alternative was estimated at $575/kW of hydrogen output or $3.15/million Btu. Although this cost appears high when compared with hydrogen from other primary energy sources or from fossil fuel, environmental and social costs which favor solar energy may prove this scheme feasible in the future.

  15. Normal foot and ankle

    International Nuclear Information System (INIS)

    Weissman, S.D.

    1989-01-01

    The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

  16. Solar prominences

    CERN Document Server

    Engvold, Oddbjørn

    2015-01-01

    This volume presents the latest research results on solar prominences, including new developments on e.g. chirality, fine structure, magnetism, diagnostic tools and relevant solar plasma physics. In 1875 solar prominences, as seen out of the solar limb, were described by P.A. Secchi in his book Le Soleil as "gigantic pink or peach-flower coloured flames". The development of spectroscopy, coronagraphy and polarimetry brought tremendous observational advances in the twentieth century. The authors present and discuss exciting new challenges (resulting from observations made by space and ground-based telescopes in the 1990s and the first decade of the 21st century) concerning the diagnostics of prominences, their formation, their life time and their eruption along with their impact in the heliosphere (including the Earth). The book starts with a general introduction of the prominence “object” with some historical background on observations and instrumentation. In the next chapter, the various forms of promine...

  17. Solar Radio

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Scientists monitor the structure of the solar corona, the outer most regions of the Sun's atmosphere, using radio waves (100?s of MHz to 10?s of GHz). Variations in...

  18. Solar Energy

    Science.gov (United States)

    Building Design and Construction, 1977

    1977-01-01

    Describes 21 completed projects now using solar energy for heating, cooling, or electricity. Included are elementary schools in Atlanta and San Diego, a technical school in Detroit, and Trinity University in San Antonio, Texas. (MLF)

  19. Half-Heusler compounds with a 1 eV (1.7 eV) direct band gap, lattice-matched to GaAs (Si), for solar cell application: A first-principles study

    KAUST Repository

    Belmiloud, N.

    2016-01-10

    A systematic theoretical study of the structural and electronic properties of new half-Heusler compounds is performed to find the appropriate target key physical parameters for photovoltaic application. As a result, five ternary half-Heusler compounds ScAgC, YCuC, CaZnC, NaAgO, and LiCuS are studied by density functional theory for potential applications in multi-junction solar cells. The calculated formation enthalpies indicate that these materials are thermodynamically stable. Using state-of-the-art modified Becke-Johnson exchange potential approximation, we find a direct band gap close to 1eV (∼1.88eV) for ScAgC, YCuC, CaZnC, NaAgO (LiCuS) being quasi-lattice matched to GaAs (Si). In addition, the band offsets between half-Heusler compounds and GaAs (Si) and their consequences for heterostructures are derived using the modified Tersoff method for the branch-point energy. Furthermore, the elastic constants and phonon dispersion curves are calculated. They indicate the respective mechanical and dynamical stability of these half-Heusler compounds. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Quantum-dot-sensitized solar cells fabricated by the combined process of the direct attachment of colloidal CdSe quantum dots having a ZnS glue layer and spray pyrolysis deposition.

    Science.gov (United States)

    Im, Sang Hyuk; Lee, Yong Hui; Seok, Sang Il; Kim, Sung Woo; Kim, Sang-Wook

    2010-12-07

    We were able to attach CdSe quantum dots (QDs) having a ZnS inorganic glue layer directly to a mesoporous TiO(2) (mp-TiO(2)) surface by spray coating and thermal annealing. Quantum-dot-sensitized solar cells based on CdSe QDs having ZnS as the inorganic glue layer could easily transport generated charge carriers because of the intimate bonding between CdSe and mp-TiO(2). The application of spray pyrolysis deposition (SPD) to obtain additional CdSe layers improved the performance characteristics to V(oc) = 0.45 V, J(sc) = 10.7 mA/cm(2), fill factor = 35.8%, and power conversion efficiency = 1.7%. Furthermore, ZnS post-treatment improved the device performance to V(oc) = 0.57 V, J(sc) = 11.2 mA/cm(2), fill factor = 35.4%, and power conversion efficiency = 2.2%.