WorldWideScience

Sample records for direct normal irradiation

  1. A combination of HARMONIE short time direct normal irradiance forecasts and machine learning: The #hashtdim procedure

    Gastón, Martín; Fernández-Peruchena, Carlos; Körnich, Heiner; Landelius, Tomas

    2017-06-01

    The present work describes the first approach of a new procedure to forecast Direct Normal Irradiance (DNI): the #hashtdim that treats to combine ground information and Numerical Weather Predictions. The system is centered in generate predictions for the very short time. It combines the outputs from the Numerical Weather Prediction Model HARMONIE with an adaptive methodology based on Machine Learning. The DNI predictions are generated with 15-minute and hourly temporal resolutions and presents 3-hourly updates. Each update offers forecasts to the next 12 hours, the first nine hours are generated with 15-minute temporal resolution meanwhile the last three hours present hourly temporal resolution. The system is proved over a Spanish emplacement with BSRN operative station in south of Spain (PSA station). The #hashtdim has been implemented in the framework of the Direct Normal Irradiance Nowcasting methods for optimized operation of concentrating solar technologies (DNICast) project, under the European Union's Seventh Programme for research, technological development and demonstration framework.

  2. Increasing the temporal resolution of direct normal solar irradiance forecasted series

    Fernández-Peruchena, Carlos M.; Gastón, Martin; Schroedter-Homscheidt, Marion; Marco, Isabel Martínez; Casado-Rubio, José L.; García-Moya, José Antonio

    2017-06-01

    A detailed knowledge of the solar resource is a critical point in the design and control of Concentrating Solar Power (CSP) plants. In particular, accurate forecasting of solar irradiance is essential for the efficient operation of solar thermal power plants, the management of energy markets, and the widespread implementation of this technology. Numerical weather prediction (NWP) models are commonly used for solar radiation forecasting. In the ECMWF deterministic forecasting system, all forecast parameters are commercially available worldwide at 3-hourly intervals. Unfortunately, as Direct Normal solar Irradiance (DNI) exhibits a great variability due to the dynamic effects of passing clouds, 3-h time resolution is insufficient for accurate simulations of CSP plants due to their nonlinear response to DNI, governed by various thermal inertias due to their complex response characteristics. DNI series of hourly or sub-hourly frequency resolution are normally used for an accurate modeling and analysis of transient processes in CSP technologies. In this context, the objective of this study is to propose a methodology for generating synthetic DNI time series at 1-h (or higher) temporal resolution from 3-h DNI series. The methodology is based upon patterns as being defined with help of the clear-sky envelope approach together with a forecast of maximum DNI value, and it has been validated with high quality measured DNI data.

  3. A methodology for the stochastic generation of hourly synthetic direct normal irradiation time series

    Larrañeta, M.; Moreno-Tejera, S.; Lillo-Bravo, I.; Silva-Pérez, M. A.

    2018-02-01

    Many of the available solar radiation databases only provide global horizontal irradiance (GHI) while there is a growing need of extensive databases of direct normal radiation (DNI) mainly for the development of concentrated solar power and concentrated photovoltaic technologies. In the present work, we propose a methodology for the generation of synthetic DNI hourly data from the hourly average GHI values by dividing the irradiance into a deterministic and stochastic component intending to emulate the dynamics of the solar radiation. The deterministic component is modeled through a simple classical model. The stochastic component is fitted to measured data in order to maintain the consistency of the synthetic data with the state of the sky, generating statistically significant DNI data with a cumulative frequency distribution very similar to the measured data. The adaptation and application of the model to the location of Seville shows significant improvements in terms of frequency distribution over the classical models. The proposed methodology applied to other locations with different climatological characteristics better results than the classical models in terms of frequency distribution reaching a reduction of the 50% in the Finkelstein-Schafer (FS) and Kolmogorov-Smirnov test integral (KSI) statistics.

  4. Assessment of ANN and SVM models for estimating normal direct irradiation (H_b)

    Santos, Cícero Manoel dos; Escobedo, João Francisco; Teramoto, Érico Tadao; Modenese Gorla da Silva, Silvia Helena

    2016-01-01

    Highlights: • The performance of SVM and ANN in estimating Normal Direct Irradiation (H_b) was evaluated. • 12 models using different input variables are developed (hourly and daily partitions). • The most relevant input variables for DNI are kt, H_s_c and insolation ratio (r′ = n/N). • Support Vector Machine (SVM) provides accurate estimates and outperforms the Artificial Neural Network (ANN). - Abstract: This study evaluates the estimation of hourly and daily normal direct irradiation (H_b) using machine learning techniques (ML): Artificial Neural Network (ANN) and Support Vector Machine (SVM). Time series of different meteorological variables measured over thirteen years in Botucatu were used for training and validating ANN and SVM. Seven different sets of input variables were tested and evaluated, which were chosen based on statistical models reported in the literature. Relative Mean Bias Error (rMBE), Relative Root Mean Square Error (rRMSE), determination coefficient (R"2) and “d” Willmott index were used to evaluate ANN and SVM models. When compared to statistical models which use the same set of input variables (R"2 between 0.22 and 0.78), ANN and SVM show higher values of R"2 (hourly models between 0.52 and 0.88; daily models between 0.42 and 0.91). Considering the input variables, atmospheric transmissivity of global radiation (kt), integrated solar constant (H_s_c) and insolation ratio (n/N, n is sunshine duration and N is photoperiod) were the most relevant in ANN and SVM models. The rMBE and rRMSE values in the two time partitions of SVM models are lower than those obtained with ANN. Hourly ANN and SVM models have higher rRMSE values than daily models. Optimal performance with hourly models was obtained with ANN4"h (rMBE = 12.24%, rRMSE = 23.99% and “d” = 0.96) and SVM4"h (rMBE = 1.75%, rRMSE = 20.10% and “d” = 0.96). Optimal performance with daily models was obtained with ANN2"d (rMBE = −3.09%, rRMSE = 18.95% and “d” = 0

  5. Towards the intrahour forecasting of direct normal irradiance using sky-imaging data.

    Nou, Julien; Chauvin, Rémi; Eynard, Julien; Thil, Stéphane; Grieu, Stéphane

    2018-04-01

    Increasing power plant efficiency through improved operation is key in the development of Concentrating Solar Power (CSP) technologies. To this end, one of the most challenging topics remains accurately forecasting the solar resource at a short-term horizon. Indeed, in CSP plants, production is directly impacted by both the availability and variability of the solar resource and, more specifically, by Direct Normal Irradiance (DNI). The present paper deals with a new approach to the intrahour forecasting (the forecast horizon [Formula: see text] is up to [Formula: see text] ahead) of DNI, taking advantage of the fact that this quantity can be split into two terms, i.e. clear-sky DNI and the clear sky index. Clear-sky DNI is forecasted from DNI measurements, using an empirical model (Ineichen and Perez, 2002) combined with a persistence of atmospheric turbidity. Moreover, in the framework of the CSPIMP (Concentrating Solar Power plant efficiency IMProvement) research project, PROMES-CNRS has developed a sky imager able to provide High Dynamic Range (HDR) images. So, regarding the clear-sky index, it is forecasted from sky-imaging data, using an Adaptive Network-based Fuzzy Inference System (ANFIS). A hybrid algorithm that takes inspiration from the classification algorithm proposed by Ghonima et al. (2012) when clear-sky anisotropy is known and from the hybrid thresholding algorithm proposed by Li et al. (2011) in the opposite case has been developed to the detection of clouds. Performance is evaluated via a comparative study in which persistence models - either a persistence of DNI or a persistence of the clear-sky index - are included. Preliminary results highlight that the proposed approach has the potential to outperform these models (both persistence models achieve similar performance) in terms of forecasting accuracy: over the test data used, RMSE (the Root Mean Square Error) is reduced of about [Formula: see text], with [Formula: see text], and [Formula: see

  6. Semi-empirical models for the estimation of clear sky solar global and direct normal irradiances in the tropics

    Janjai, S.; Sricharoen, K.; Pattarapanitchai, S.

    2011-01-01

    Highlights: → New semi-empirical models for predicting clear sky irradiance were developed. → The proposed models compare favorably with other empirical models. → Performance of proposed models is comparable with that of widely used physical models. → The proposed models have advantage over the physical models in terms of simplicity. -- Abstract: This paper presents semi-empirical models for estimating global and direct normal solar irradiances under clear sky conditions in the tropics. The models are based on a one-year period of clear sky global and direct normal irradiances data collected at three solar radiation monitoring stations in Thailand: Chiang Mai (18.78 o N, 98.98 o E) located in the North of the country, Nakhon Pathom (13.82 o N, 100.04 o E) in the Centre and Songkhla (7.20 o N, 100.60 o E) in the South. The models describe global and direct normal irradiances as functions of the Angstrom turbidity coefficient, the Angstrom wavelength exponent, precipitable water and total column ozone. The data of Angstrom turbidity coefficient, wavelength exponent and precipitable water were obtained from AERONET sunphotometers, and column ozone was retrieved from the OMI/AURA satellite. Model validation was accomplished using data from these three stations for the data periods which were not included in the model formulation. The models were also validated against an independent data set collected at Ubon Ratchathani (15.25 o N, 104.87 o E) in the Northeast. The global and direct normal irradiances calculated from the models and those obtained from measurements are in good agreement, with the root mean square difference (RMSD) of 7.5% for both global and direct normal irradiances. The performance of the models was also compared with that of other models. The performance of the models compared favorably with that of empirical models. Additionally, the accuracy of irradiances predicted from the proposed model are comparable with that obtained from some

  7. The NASA POWER SSE: Deriving the Direct Normal Counterpart from the CERES SYN1deg Hourly Global Horizontal Irradiance during Early 2000 to Near Present

    Zhang, T.; Stackhouse, P. W., Jr.; Westberg, D. J.

    2017-12-01

    The NASA Prediction of Worldwide Energy Resource (POWER) Surface meteorology and Solar Energy (SSE) provides solar direct normal irradiance (DNI) data as well as a variety of other solar parameters. The currently available DNIs are monthly means on a quasi-equal-area grid system with grid boxes roughly equivalent to 1 degree longitude by 1 degree latitude around the equator from July 1983 to June 2005, and the data were derived from the GEWEX Surface Radiation Budget (SRB) monthly mean global horizontal irradiance (GHI, Release 3) and regression analysis of the Baseline Surface Radiation Network (BSRN) data. To improve the quality of the DNI data and push the temporal coverage of the data to near present, we have applied a modified version of the DIRINDEX global-to-beam model to the GEWEX SRB (Release 3) all-sky and clear-sky 3-hourly GHI data and derived their DNI counterparts for the period from July 1983 to December 2007. The results have been validated against the BSRN data. To further expand the data in time to near present, we are now applying the DIRINDEX model to the Clouds and the Earth's Radiant Energy System (CERES) data. The CERES SYN1deg (Edition 4A) offers hourly all-sky and clear-sky GHIs on a 1 degree longitude by 1 degree latitude grid system from March 2000 to October 2016 as of this writing. Comparisons of the GHIs with their BSRN counterparts show remarkable agreements. Besides the GHIs, the inputs will also include the atmospheric water vapor and surface pressure from the Modern Era Retrospective-Analysis for Research and Applications (MERRA) and the aerosol optical depth from the Max-Planck Institute Climatology (MAC-v1). Based on the performance of the DIRINDEX model with the GEWEX SRB GHI data, we expect at least equally good or even better results. In this paper, we will show the derived hourly, daily, and monthly mean DNIs from the CERES SYN1deg hourly GHIs from March 2000 to October 2016 and how they compare with the BSRN data.

  8. Oxygen delivery in irradiated normal tissue

    Kiani, M.F.; Ansari, R. [Univ. of Tennessee Health Science Center, Memphis, TN (United States). School of Biomedical Engineering; Gaber, M.W. [St. Jude Children' s Research Hospital, Memphis, TN (United States)

    2003-03-01

    Ionizing radiation exposure significantly alters the structure and function of microvascular networks, which regulate delivery of oxygen to tissue. In this study we use a hamster cremaster muscle model to study changes in microvascular network parameters and use a mathematical model to study the effects of these observed structural and microhemodynamic changes in microvascular networks on oxygen delivery to the tissue. Our experimental observations indicate that in microvascular networks while some parameters are significantly affected by irradiation (e.g. red blood cell (RBC) transit time), others remain at the control level (e.g. RBC path length) up to 180 days post-irradiation. The results from our mathematical model indicate that tissue oxygenation patterns are significantly different in irradiated normal tissue as compared to age-matched controls and the differences are apparent as early as 3 days post irradiation. However, oxygen delivery to irradiated tissue was not found to be significantly different from age matched controls at any time between 7 days to 6 months post-irradiation. These findings indicate that microvascular late effects in irradiated normal tissue may be due to factors other than compromised tissue oxygenation. (author)

  9. Direct electrical heating of irradiated metal fuel

    Fenske, G.R.; Emerson, J.E.; Savoie, F.E.; Johanson, E.W.

    1985-01-01

    The Integral Fast Reactor (IFR) concept proposed by Argonne National Laboratory utilizes a metal fuel core. Reactor safety analysis requires information on the potential for fuel axial expansion during severe thermal transients. In addition to a comparatively large thermal expansion coefficient, metallic fuel has a unique potential for enhanced pre-failure expansion driven by retained fission gas and ingested bond sodium. In this paper, the authors present preliminary results from three direct electrical heating (DEH) experiments performed on irradiated metal fuel to investigate axial expansion behavior. The test samples were from Experimental Breeder Reactor II (EBR-II) driver fuel ML-11 irradiated to 8 at.% burnup. Preliminary analysis of the results suggest that enhanced expansion driven by trapped fission gas can occur

  10. Analytical formulae in fractionated irradiation of normal tissue

    Kozubek, S.

    1982-01-01

    The new conception of the modeling of the cell tissue kinetics after fractionated irradiation is proposed. The formulae given earlier are compared with experimental data on various normal tissues and further adjustments are considered. The tissues are shown to exhibit several general patterns of behaviour. The repopulation, if it takes place, seems to start after some time, independently of fractionation in first approximation and can be treated as simple autogenesis. The results are compared with the commonly used NSD conception and the well-known Cohen cell tissue kinetic model

  11. Estimating the Heading Direction Using Normal Flow

    1994-01-01

    understood (Faugeras and Maybank 1990), 3 Kinetic Stabilization under the assumption that optic flow or correspon- dence is known with some uncertainty...accelerometers can achieve very It can easily be shown (Koenderink and van Doom high accuracy, the same is not true for inexpensive 1975; Maybank 1985... Maybank . ’Motion from point matches: Multi- just don’t compute normal flow there (see Section 6). plicity of solutions". Int’l J. Computer Vision 4

  12. Mutation direction by irradiation in rice

    Wang Cailian; Chen Qiufang; Jin Wei; Lu Yimei

    2001-01-01

    The mutation directions of rice were studied. The results indicated that the mutation directions of rice induced by 14 C were invert correlation to their genetic backgrounds of tested rice varieties, i.e. early mature and short stem varieties produced later mature and higher stem mutation; late mature and high stem varieties produced earlier mature and shorter stem mutation; the varieties of middle maturity and height produced both direction mutations of earlier and later maturity or shorter and higher stem. The mutation directions induced by 14 C were also related to treated doses and stages. Frequency of earlier maturity mutation by protons treatment were higher than those induced by other mutagens. Frequency of later maturity by γ-rays were higher than those induced by other mutagens. Frequency of short stem mutation by synchronous irradiation (soft X-rays) were higher than those induced by other mutagens. Frequency of beneficial mutation induced by proton treatment were higher than those induced by γ-rays

  13. Technique for sparing previously irradiated critical normal structures in salvage proton craniospinal irradiation

    McDonald, Mark W; Wolanski, Mark R; Simmons, Joseph W; Buchsbaum, Jeffrey C

    2013-01-01

    Cranial reirradiation is clinically appropriate in some cases but cumulative radiation dose to critical normal structures remains a practical concern. The authors developed a simple technique in 3D conformal proton craniospinal irradiation (CSI) to block organs at risk (OAR) while minimizing underdosing of adjacent target brain tissue. Two clinical cases illustrate the use of proton therapy to provide salvage CSI when a previously irradiated OAR required sparing from additional radiation dose. The prior radiation plan was coregistered to the treatment planning CT to create a planning organ at risk volume (PRV) around the OAR. Right and left lateral cranial whole brain proton apertures were created with a small block over the PRV. Then right and left lateral “inverse apertures” were generated, creating an aperture opening in the shape of the area previously blocked and blocking the area previously open. The inverse aperture opening was made one millimeter smaller than the original block to minimize the risk of dose overlap. The inverse apertures were used to irradiate the target volume lateral to the PRV, selecting a proton beam range to abut the 50% isodose line against either lateral edge of the PRV. Together, the 4 cranial proton fields created a region of complete dose avoidance around the OAR. Comparative photon treatment plans were generated with opposed lateral X-ray fields with custom blocks and coplanar intensity modulated radiation therapy optimized to avoid the PRV. Cumulative dose volume histograms were evaluated. Treatment plans were developed and successfully implemented to provide sparing of previously irradiated critical normal structures while treating target brain lateral to these structures. The absence of dose overlapping during irradiation through the inverse apertures was confirmed by film. Compared to the lateral X-ray and IMRT treatment plans, the proton CSI technique improved coverage of target brain tissue while providing the least

  14. Food irradiation in the UK and the European Directive

    Woolston, John E-mail: johnw@isotron.co.uk

    2000-03-01

    Food irradiation in the UK has been authorised since the early 1990s. In principle it is possible to irradiate a wide range of foods for a variety of purposes. In practice food irradiation is virtually non-existent. The structure of food retailing in the UK, a continual stream of food safety scares and a developing public 'crisis of confidence' in the food producer/supply chain have combined to make the future for food irradiation look bleak. The new European Directive on Food Irradiation is unlikely to alter this outlook. (author)

  15. Food irradiation in the UK and the European Directive

    Woolston, John

    2000-01-01

    Food irradiation in the UK has been authorised since the early 1990s. In principle it is possible to irradiate a wide range of foods for a variety of purposes. In practice food irradiation is virtually non-existent. The structure of food retailing in the UK, a continual stream of food safety scares and a developing public 'crisis of confidence' in the food producer/supply chain have combined to make the future for food irradiation look bleak. The new European Directive on Food Irradiation is unlikely to alter this outlook. (author)

  16. Assessment of four shadow band correction models using beam normal irradiance data from the United Kingdom and Israel

    Lopez, G.; Muneer, T.; Claywell, R.

    2004-01-01

    Diffuse irradiance is a fundamental factor for all solar resource considerations. Diffuse irradiance is accurately determined by calculation from global and beam normal (direct) measurements. However, beam solar measurements and related support can be very expensive, and therefore, shadow bands are often used, along with pyranometers, to block the solar disk. The errors that result from the use of shadow bands are well known and have been studied by many authors. The thrust of this article is to examine four recognized techniques for correcting shadow band based, diffuse irradiance and statistically evaluate their individual performance using data culled from two contrasting sites within the United Kingdom and Israel

  17. Effect of endotoxin preparations (LPS) with irradiation decreased toxicity on the immune response of normal and irradiated rats

    Elekes, E; Bertok, L [Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszsegugyi Kutato Intezet, Budapest (Hungary)

    1979-03-01

    A comparison of the immunostimulating effect of parent and radiodetoxified with 50, 100, 150 and 200 kGy (5, 10, 15 and 20 Mrad) /sup 60/Co ..gamma..-rays endotoxin preparations in normal and irradiated rats is given. By increasing the dose of irradiation the immunostimulating effect decreased. The preparations detoxified even with the highest (200 kGy) dose is characterized by a pronounced adjuvant effect in irradiated animals.

  18. Reproductive function in mice exposed to ancestral and direct irradiation

    Nash, D.J.; Sprackling, L.S.

    1978-01-01

    Reproduction was studied in 13 inbred strains of mice that had been exposed continuously to 60 Co gamma radiation for varying numbers of generations. At weaning the mice were removed from the irradiation chamber and were tested for reproductive performance. Ancestral and direct levels of irradiation were determined for each animal. Each irradiated or control female was scored as fertile or sterile, and in utero litter counts were made in pregnant females that were dissected past the 10th day of pregnancy. The number of resorptions, dead embryos, and live embryos were counted, and the ratio of living embryos to the total number of embryos was determined for each litter. The overall fertility curves were sigmoid in the range of doses below those which caused complete sterility, which indicated some sort of cumulative damage. In 11 of the 13 strains studied, an increase in ancestral and/or direct irradiation led to significant decreases in fertility. The means of the number alive in the litters for the control and irradiated mice in each strain showed a definite trend toward fewer live mice in utero after irradiation. Least-squares analyses of variance were made to detect possible effects of any of six irradiation variables (ancestral linear, ancestral quadratic, ancestral cubic, direct linear, direct quadratic, or direct cubic) or of strain differences on total litter size and on ratio. Strain effects were significant in each instance. Litter size was more likely to be affected by radiation variables than ratios were

  19. Responses of vibrissa-sensitive cortical neurons in normal and prenatally x-irradiated rat

    Ito, M.; Kawabata, M.; Shoji, R.

    1979-01-01

    Rats were irradiated by 200 R of x ray on day 17 of gestation through the body wall of the mother. When they underwent the following electrophysiological tests at the age of 3 to 4 month, the somatosensory cortex showed a lack of layers II, III, IV, and Va. Spike responses to quick whisker deflections were recorded from single cells in the somatosenory cortex of normal and prenatally x-irradiated rats. For the irradiated rats the response latency was prolonged when compared to the normal controls. Cortical laminar analysis of field potentials revealed that there was no difference in the latency of these potentials between the two groups, suggesting that vibrissal sensory signals reach the cortical level normally even in the irradiated rats. The prolonged latency of the irradiated cortical neuronal response could thus be ascribed to an abnormal intracortical delay, which was most likely associated with the failure of development of layer IV stellate cells in these preparations

  20. The effects of normal paraffins mobilizers on irradiated polypropylene

    Chen Wenxiu; Gao Ling

    1995-01-01

    The n-paraffins blended with polypropylene (PP) as mobilizer had been investigated. The effectiveness of mobilizer (n-paraffins) on irradiated polypropylene is dependent on the molecular weight of mobilizer and its content on polypropylene. The n-docosame (n-C 22 ) possesses the best effectiveness of radiation tolerance on PP among the mobilizer paraffins: n-decane (n-C 10 ), n-hexadecane (n-C 16 ), n-docosane (n-C 22 ) and n-hexatriacontane (n-C 36 ). The 2% (w/w) content of a given mobilizer is the most effective at reducing the embrittlement of irradiated PP as evidenced by the elongation at break. The physical properties of polypropylene with mobilizers such as density, Young's modulus, the Fraction of free volume and the weight swelling ratio in p-xylene at room temperature were measured. Above phenomena are related with the constructive of blended PP and demonstrated by its physical properties

  1. Tissue reactions in lambs and kids vaccinated with irradiated and normal amphistome metacercariae (Cercariae indicae XXVI)

    Hafeez, Md.; Rao, B.V.

    1986-01-01

    The intensity of gross and histopathological changes were inversely related to the dose of irradiation. Severe catarrhal enteritis was noticed with non-irradiated metacercariae while with increased irradiation doses the intensity of changes were in decreasing order, however, with 3 Krad dose no severe change was seen. The severe changes of gastro-enteritic lesions were seen from the challenge dose of normal metacercariae in the lambs and kids previously vaccinated with non-irradiated metacercariae. The moderate catarrhal enteritis, mild necrotic lesions and absence of severe lesions produced by the challenge dose of normal metacercariae in the lambs and kids previously vaccinated with 2, 2.5 and 3 Krad level of irradiated metacercariae suggested that the lesions produced by challenge doses were in order of reduced intensity as the dose of irradiation for initial vaccination increased. The cellular infiltration with round cells, plasma cells and macrophages in the mucosa of the small intestine was more in lambs and kids vaccinated with irradiated metacercariae and the order of increase was in correspondent with the level of irradiation. The present study showed that the optimal dose of irradiation for amphistome metacercariae was 3 Krad, where maximum immunological response could be obtained. This also suggests the possibility of immunizing lambs and kids against intestinal amphistomiasis with 3 Krad irradiated metacercariae. (author)

  2. Human fibroblast strain with normal survival but abnormal postreplication repair after ultraviolet light irradiation

    Doniger, J.; Barrett, S.F.; Robbins, J.H.

    1980-01-01

    Postreplication repair has been studied in ultraviolet light (UV-irradiated) fibroblast strains derived from eight apparently normal control donors and seven xeroderma pigmentosum patients. One control donor strain had an intermediate defect in postreplication repair similar to that in excision-deficient xeroderma pigmentosum fibroblasts. However, unlike the xeroderma pigmentosum strains, this control donor strain had normal UV-induced unscheduled DNA synthesis and normal survival after irradiation with UV. This unique fibroblast strain should be useful in studies designed to elucidate the possible role of postreplication repair in UV-induced carcinogenesis and mutagenesis

  3. Cell survival of human tumor cells compared with normal fibroblasts following 60Co gamma irradiation

    Lloyd, E.L.; Henning, C.B.; Reynolds, S.D.; Holmblad, G.L.; Trier, J.E.

    1982-01-01

    Three tumor cell lines, two of which were shown to be HeLa cells, were irradiated with 60 Co gamma irradiation, together with two cell cultures of normal human diploid fibroblasts. Cell survival was studied in three different experiments over a dose range of 2 to 14 gray. All the tumor cell lines showed a very wide shoulder in the dose response curves in contrast to the extremely narrow shoulder of the normal fibroblasts. In addition, the D/sub o/ values for the tumor cell lines were somewhat greater. These two characteristics of the dose response curves resulted in up to 2 orders of magnitude less sensitivity for cell inactivation of HeLa cells when compared with normal cells at high doses (10 gray). Because of these large differences, the extrapolation of results from the irradiation of HeLa cells concerning the mechanisms of normal cell killing should be interpreted with great caution

  4. Effects of low dose irradiation on NK activity of normal individuals and patients with cancer

    Tian Hailin; Su Liaoyuan

    1994-10-01

    Effects of low dose irradiation on NK activity of lymphocytes and on K 562 cells were studied. The NK activity was determined by means of 3 H-TdR release assay. While 3 H-TdR incorporation was used to reflect functional changes of K 562 cells after low dose irradiation. 21 patients with cancer and 10 normal individuals were detected. The results indicated that the NK activity of lymphocytes in normal individuals increased significantly after 10 and 50 cGy γ-ray irradiation, while in patients with cancer the NK activity of lymphocytes increased only at the dose of 50 cGy irradiation. The increase of NK activity in normal individuals was higher than that in patients with cancer after same doses of irradiation. When K 562 cells were irradiated by 10 cGy γ-rays, the 3 H-TdR incorporation value increased. After exposed to over 50 cGy the stimulating effect disappeared

  5. The cardiac pacemaker patient. Might the pacer be directly irradiated?

    Tsekos, A.; Momm, F.; Brunner, M.; Guttenberger, R.

    2000-01-01

    According to recommendations listed in a recent review, pacemakers generally should not be irradiated directly. They should be shielded from ionizing radiation or their position changed. Direct irradiation can cause pacemaker failure. There are no clinical signals to indicate a near failure. When controlling pacemaker function, there is often a change in the magnetic frequency before malfunction occurs. If a malfunction results in a partial heart failure only, there would be enough time to implant another pacemaker. As can be seen from a case described here, a policy of 'wait and see' may be adopted even if there are changes in the magnetic frequency. if there is any danger to the patient's life, the feasibility of using an external pacemaker system may be explored, especially in cases where there is a strong need for radiotherapy (severe pain, infiltration of plexus). Risks and benefits should be carefully weighed and discussed with the patient

  6. Enhanced reactivation and mutagenesis of UV-irradiated adenovirus in normal human fibroblasts

    Bennett, C.B.; Rainbow, A.J.

    1988-01-01

    UV-enhanced reactivation (UVER) and UV-enhanced mutagenesis (UVEM) for two adenovirus temperature-sensitive mutants were examined following the infection of normal human fibroblasts. UV-irradiation of the virus alone resulted in dose-dependent increase in the UV-induced reversion frequency (RF) of viral progeny and a dose-dependent exponential decrease in progeny survival, when infecting non-irradiated cells. Analysis of the slopes of the UV-induced reversion curves suggested that 2.5 ± 0.3 and 2.4 ± 0.5 'hits' were required to produce a targeted reversion event among the viral progeny of Ad5ts36 and Ad5ts125 respectively. UV-irradiation of cells 24 h prior to infection resulted in a significant increase in progeny survival for UV-irradiated virus (UVER factor = 3.4 ± 0.8) concomitant with a significant increase in RF for UV-irradiated virus (targeted increase = 1.9 ± 0.3). The UV-induced RF per lethal hit to the virus was also significantly greater in UV-irradiated compared with non-irradiated cells. These results are consistent with the existence of a UV-inducible error-prone DNA repair mechanism in normal human cells. (author)

  7. Serum protein concentration in low-dose total body irradiation of normal and malnourished rats

    Viana, W.C.M.; Lambertz, D.; Borges, E.S.; Neto, A.M.O.; Lambertz, K.M.F.T.; Amaral, A.

    2016-01-01

    Among the radiotherapeutics' modalities, total body irradiation (TBI) is used as treatment for certain hematological, oncological and immunological diseases. The aim of this study was to evaluate the long-term effects of low-dose TBI on plasma concentration of total protein and albumin using prematurely and undernourished rats as animal model. For this, four groups with 9 animals each were formed: Normal nourished (N); Malnourished (M); Irradiated Normal nourished (IN); Irradiated Malnourished (IM). At the age of 28 days, rats of the IN and IM groups underwent total body gamma irradiation with a source of cobalt-60. Total protein and Albumin in the blood serum was quantified by colorimetry. This research indicates that procedures involving low-dose total body irradiation in children have repercussions in the reduction in body-mass as well as in the plasma levels of total protein and albumin. Our findings reinforce the periodic monitoring of total serum protein and albumin levels as an important tool in long-term follow-up of pediatric patients in treatments associated to total body irradiation. - Highlights: • Low-dose total body irradiation (TBI) in children have repercussions in their body-mass. • Long-term total protein and albumin levels are affected by TBI. • The monitoring of total protein and albumin levels are useful in the follow-up of TBI pediatric patients.

  8. Early radiation changes of normal dog brain following internal and external brain irradiation: A preliminary report

    Chin, H.; Maruyama, Y.; Markesbery, W.; Goldstein, S.; Wang, P.; Tibbs, P.; Young, B.; Feola, J.; Beach, L.

    1984-01-01

    To examine radiation-induced changes in the normal brain, internal or external radiation was given to normal dog brain. Seven medium-sized dogs were used in this study. Two dogs were controls and an ice-pick (plastic implant applicator) was placed in the right frontal lobe for about 5 hours but no irradiation. Two dogs underwent Cs-137 brain implantation for 4 and 5 hours, respectively using an ice-pick technique. Two dogs were given internal neutron irradiation using the same technique of intracerebral ice-pick brachytherapy. One dog received an external photon irradiation using 6-Mev Linear Accelerator. Postmortem microscopic examination was made to study the early cerebral changes to irradiation in three dogs: one control with no irradiation; one received intracerebral Cesium implantation; and one external photon irradiation. Vascular change was the most prominent microscopic finding. There were hemorrhage, endothelial proliferation and fibrinoid changes of small vessel wall. Most of the changes were localized in the white matter and the cortex remained intact. Details (CT, NMR and histological studies) are discussed

  9. Effect of 60Co-irradiation on normal and low protein diet fed rat brain

    Hasan, S.S.; Habibullah, M.

    1980-01-01

    The effect of whole-body irradiation (Co-60) on the brain tissue in Holtzmann strain adult male rats was studied. Two doses of irradiation (450 R,950 R) were tried on animals which were fed on normal as well as low protein diets over a period of 10 generations. In the normal rats, 450 R initially caused a lowered total protein. DNA and RNA content in the brain. After 7 days a tendency towards normalcy was observed. In the 950 R irradiated normal rats the diminution of protein content appeared irreversible. In malnourished 450 R irradiated rats, the protein content rose less steeply over the 7 days of observation. A higher dose of 950 R enhanced this effect on protein and also lowered the DNA content on day 5. The RNA content in the 950 R group with malnutrition showed a marked increase towards or beyond control perhaps as an expression of uncoupled feedback control. The paper gives evidence that protein deficiency may interfere with cellular regeneration in irradiated brain. (orig.) [de

  10. Effect of /sup 60/Co-irradiation on normal and low protein diet fed rat brain

    Hasan, S S [Garhwal Univ., Srinagar, Uttar Pradesh (India). Dept. of Zoology; Habibullah, M [Jawaharlal Nehru Univ., New Delhi (India). Neurobiology Lab.

    1980-06-01

    The effect of whole-body irradiation (Co-60) on the brain tissue in Holtzmann strain adult male rats was studied. Two doses of irradiation (450 R,950 R) were tried on animals which were fed on normal as well as low protein diets over a period of 10 generations. In the normal rats, 450 R initially caused a lowered total protein. DNA and RNA content in the brain. After 7 days a tendency towards normalcy was observed. In the 950 R irradiated normal rats the diminution of protein content appeared irreversible. In malnourished 450 R irradiated rats, the protein content rose less steeply over the 7 days of observation. A higher dose of 950 R enhanced this effect on protein and also lowered the DNA content on day 5. The RNA content in the 950 R group with malnutrition showed a marked increase towards or beyond control perhaps as an expression of uncoupled feedback control. The paper gives evidence that protein deficiency may interfere with cellular regeneration in irradiated brain.

  11. Chromosomal Aberrations in Normal and AT Cells Exposed to High Dose of Low Dose Rate Irradiation

    Kawata, T.; Shigematsu, N.; Kawaguchi, O.; Liu, C.; Furusawa, Y.; Hirayama, R.; George, K.; Cucinotta, F.

    2011-01-01

    Ataxia telangiectasia (A-T) is a human autosomally recessive syndrome characterized by cerebellar ataxia, telangiectases, immune dysfunction, and genomic instability, and high rate of cancer incidence. A-T cell lines are abnormally sensitive to agents that induce DNA double strand breaks, including ionizing radiation. The diverse clinical features in individuals affected by A-T and the complex cellular phenotypes are all linked to the functional inactivation of a single gene (AT mutated). It is well known that cells deficient in ATM show increased yields of both simple and complex chromosomal aberrations after high-dose-rate irradiation, but, less is known on how cells respond to low-dose-rate irradiation. It has been shown that AT cells contain a large number of unrejoined breaks after both low-dose-rate irradiation and high-dose-rate irradiation, however sensitivity for chromosomal aberrations at low-dose-rate are less often studied. To study how AT cells respond to low-dose-rate irradiation, we exposed confluent normal and AT fibroblast cells to up to 3 Gy of gamma-irradiation at a dose rate of 0.5 Gy/day and analyzed chromosomal aberrations in G0 using fusion PCC (Premature Chromosomal Condensation) technique. Giemsa staining showed that 1 Gy induces around 0.36 unrejoined fragments per cell in normal cells and around 1.35 fragments in AT cells, whereas 3Gy induces around 0.65 fragments in normal cells and around 3.3 fragments in AT cells. This result indicates that AT cells can rejoin breaks less effectively in G0 phase of the cell cycle? compared to normal cells. We also analyzed chromosomal exchanges in normal and AT cells after exposure to 3 Gy of low-dose-rate rays using a combination of G0 PCC and FISH techniques. Misrejoining was detected in the AT cells only? When cells irradiated with 3 Gy were subcultured and G2 chromosomal aberrations were analyzed using calyculin-A induced PCC technique, the yield of unrejoined breaks decreased in both normal and AT

  12. Accumulation of DNA Double-Strand Breaks in Normal Tissues After Fractionated Irradiation

    Ruebe, Claudia E.; Fricke, Andreas; Wendorf, Juliane; Stuetzel, Annika; Kuehne, Martin; Ong, Mei Fang; Lipp, Peter; Ruebe, Christian

    2010-01-01

    Purpose: There is increasing evidence that genetic factors regulating the recognition and/or repair of DNA double-strand breaks (DSBs) are responsible for differences in radiosensitivity among patients. Genetically defined DSB repair capacities are supposed to determine patients' individual susceptibility to develop adverse normal tissue reactions after radiotherapy. In a preclinical murine model, we analyzed the impact of different DSB repair capacities on the cumulative DNA damage in normal tissues during the course of fractionated irradiation. Material and Methods: Different strains of mice with defined genetic backgrounds (SCID -/- homozygous, ATM -/- homozygous, ATM +/- heterozygous, and ATM +/+ wild-type mice) were subjected to single (2 Gy) or fractionated irradiation (5 x 2 Gy). By enumerating γH2AX foci, the formation and rejoining of DSBs were analyzed in organs representative of both early-responding (small intestine) and late-responding tissues (lung, kidney, and heart). Results: In repair-deficient SCID -/- and ATM -/- homozygous mice, large proportions of radiation-induced DSBs remained unrepaired after each fraction, leading to the pronounced accumulation of residual DNA damage after fractionated irradiation, similarly visible in early- and late-responding tissues. The slight DSB repair impairment of ATM +/- heterozygous mice was not detectable after single-dose irradiation but resulted in a significant increase in unrepaired DSBs during the fractionated irradiation scheme. Conclusions: Radiation-induced DSBs accumulate similarly in acute- and late-responding tissues during fractionated irradiation, whereas the whole extent of residual DNA damage depends decisively on the underlying genetically defined DSB repair capacity. Moreover, our data indicate that even minor impairments in DSB repair lead to exceeding DNA damage accumulation during fractionated irradiation and thus may have a significant impact on normal tissue responses in clinical

  13. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  14. A normalization of the physical tests for external irradiation measuring detectors

    1977-05-01

    This report is the result of a normalization work, realized within the Radioprotection Services of the C.E.A., of the physical tests for detectors measuring external irradiation. Among the various tests mentionned are treated more in details, calibration and the establishment of the relative spectral response. As far as calibration is concerned, the normalization refers to: the reference detector, the reference radiation source, the installation and calibration procedure. As for the relative spectral response the normalization refers to: the reference detector, the radiation sources to be used. Finally, a chapter is consecrated to the high flux detectors and to those for pulsed electromagnetic radiations [fr

  15. Diarylethene microcrystals make directional jumps upon ultraviolet irradiation

    Colombier, I.; Spagnoli, S.; Corval, A.; Baldeck, P. L.; Giraud, M.; Leaustic, A.; Yu, P.; Irie, M.

    2007-01-01

    Microcrystals of a diarylethene {1,2-bis[5 ' -methyl-2 ' -(2 '' -pyridyl)thiazolyl]perfluorocyclo-pentene } undergo jumps upon photoirradiation. These photochromic crystals present molecular structural changes upon irradiation with ultraviolet light because of reversible photocyclization reactions. When the energy absorbed by crystals reaches about 10 μJ, the uniaxial stress induced in the crystal lattice relaxes through directional jumps. If one prevents crystals from jumping, then parallel, equidistant cracks appear on crystal surfaces. These photomechanical effects could result from a Grinfeld surface instability

  16. Expression of UV-irradiated adenovirus in normal and UV-sensitive Chinese hamster ovary cells

    Rainbow, A.J.

    1985-01-01

    The chinese hamster ovary (CHO) cell mutants UV-20, UV-24, and UV-41 are abnormally sensitive to UV and harbour various defects lin their ability to repair cellular DNA. This study has examined the expression of UV-irradiated AD2 in these cells. HCR of UV-irradiated Ad2, as measured by viral structural antigen (Vag) formation or progeny production, was found to be similar for the normal and the UV-sensitive CHO strains. UV-irradiation of Ad2 (1200 J/m/sup 2/) resulted in a delay of Vag expression of 18 hours in normal human fibroblasts, which is thought to reflect the time required for removal of UV-induced lesions from the DNA before viral DNA synthesis can proceed. However, a similar UV-irradiation of Ad2 did not result in a delay of Vag expression for infection of CHO cells, suggesting that UV-induced lesions in Ad2 DNA do not inhibit its replication in CHO cells. These results indicate a fundamental difference in the processing of UV-irradiated AD2-DNA in CHO as compared to human cells

  17. Gamma irradiation does not induce detectable changes in DNA methylation directly following exposure of human cells.

    Christoph Lahtz

    Full Text Available Environmental chemicals and radiation have often been implicated in producing alterations of the epigenome thus potentially contributing to cancer and other diseases. Ionizing radiation, released during accidents at nuclear power plants or after atomic bomb explosions, is a potentially serious health threat for the exposed human population. This type of high-energy radiation causes DNA damage including single- and double-strand breaks and induces chromosomal rearrangements and mutations, but it is not known if ionizing radiation directly induces changes in the epigenome of irradiated cells. We treated normal human fibroblasts and normal human bronchial epithelial cells with different doses of γ-radiation emitted from a cesium 137 ((137Cs radiation source. After a seven-day recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA in combination with high-resolution microarrays. Bioinformatics analysis revealed only a small number of potential methylation changes with low fold-difference ratios in the irradiated cells. These minor methylation differences seen on the microarrays could not be verified by COBRA (combined bisulfite restriction analysis or bisulfite sequencing of selected target loci. Our study shows that acute γ-radiation treatment of two types of human cells had no appreciable direct effect on DNA cytosine methylation patterns in exposed cells.

  18. ALK1 heterozygosity delays development of late normal tissue damage in the irradiated mouse kidney

    Scharpfenecker, Marion; Floot, Ben; Korlaar, Regina; Russell, Nicola S.; Stewart, Fiona A.

    2011-01-01

    Background and Purpose: Activin receptor-like kinase 1 (ALK1) is a transforming growth factor β (TGF-β) receptor, which is mainly expressed in endothelial cells regulating proliferation and migration in vitro and angiogenesis in vivo. Endothelial cells also express the co-receptor endoglin, which modulates ALK1 effects on endothelial cells. Our previous studies showed that mice with reduced endoglin levels develop less irradiation-induced vascular damage and fibrosis, caused by an impaired inflammatory response. This study was aimed at investigating the role of ALK1 in late radiation toxicity. Material and Methods: Kidneys of ALK +/+ and ALK1 +/- mice were irradiated with 14 Gy. Mice were sacrificed at 10, 20, and 30 weeks after irradiation and gene expression and protein levels were analyzed. Results: Compared to wild type littermates, ALK1 +/- mice developed less inflammation and fibrosis at 20 weeks after irradiation, but displayed an increase in pro-inflammatory and pro-fibrotic gene expression at 30 weeks. In addition, ALK1 +/- mice showed superior vascular integrity at 10 and 20 weeks after irradiation which deteriorated at 30 weeks coinciding with changes in the VEGF pathway. Conclusions: ALK1 +/- mice develop a delayed normal tissue response by modulating the inflammatory response and growth factor expression after irradiation.

  19. Superconducting and normal state properties of carbon doped and neutron irradiated MgB2

    Wilke, R.H.T.; Samuely, P.; Szabo, P.; Holanova, Z.; Bud'ko, S.L.; Canfield, P.C.; Finnemore, D.K.

    2007-01-01

    Current research in MgB 2 focuses on the effects various types of perturbations have on the superconducting properties of this novel two-gap superconductor. In this article we summarize the effects of carbon doping and neutron irradiation in bulk MgB 2 . Low levels of carbon doping and light neutron irradiation result in significant enhancements in H c2 . At high fluences, where superconductivity is nearly fully suppressed, superconductivity can be restored through post exposure annealing. However, this results in a change in the interdependencies of the normal state and superconducting properties (ρ 0 , T c , H c2 ), with little or no enhancement in H c2

  20. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  1. Survival of human osteosarcoma cells and normal human fibroblasts following alpha particle irradiation

    Lloyd, E.L.; Gemmell, M.A.

    1981-01-01

    Cell survival of human osteosarcoma cells in culture following alpha particle irradiation is reported here for the first time. The osteosarcoma cell line (TE-85) is found to be less sensitive to inactivation by 5.6 MeV alpha particles (LET 86 keV/μm) than normal diploid human fibroblasts (NFS). Values for the mean lethal doses were estimated to be 103 rads for the TE-85 cells compared with 68 rads for the NFS cultures irradiated under identical conditions. It is postulated that the aneuploidy of the tumor cells with increased DNA chromosomal material may confer a selective advantage for the survival of tumor cells relative to normal cells with diploid chromosomes

  2. Glycogen accumulation in normal and irradiated minced muscle autografts on frog gastrocnemius

    Malhotra, R.K.; Kaul, R.; Malhotra, N.

    1989-01-01

    Alterations induced in glycogen content and phosphorylase activity have been studied in normal and irradiated minced muscle autografts on frog gastrocnemius at days 1, 3, 5, 7, 10, 15 and 30 postgrafting. The changes observed in the glycogen content and phosphorylase activity conform to the degeneration and regeneration phases of muscle repair. An attempt has been made to explain the altered glycogen utilizing capacities of the frog skeletal muscle during its repair and regeneration. (author)

  3. Natural pregnancy and normal delivery after intracapsular irradiation for symptomatic craniopharyngioma

    Kodama, Takafumi; Matsukado, Yasuhiko; Miura, Masaki; Takada, Akira

    1986-01-01

    Treatment for craniopharyngioma, particularly in adults and cases of recurrence, is still fraught with problems. One difficulty is that postoperative hormonal function may be abnormal even after successful surgery. We have treated craniopharyngioma primarily with simple evacuation and intracapsular irradiation, using 198 Au-colloid. Only a few cases of natural pregnancy and normal delivery following treatment for craniopharyngioma with hypothalamic extension have been reported. We will describe and discuss a case in which natural pregnancy and normal delivery occurred twice after such treatment. (author)

  4. Palatal shelf epithelium: a morphologic and histochemical study in X-irradiated and normal mice

    Gartner, L.P.; Hiatt, J.L.; Provenza, D.V.

    1978-01-01

    The palatal shelf epithelium of normal and irradiated mice was examined morphologically and histochemically, utilizing the periodic acid-Schiff (PAS) technique for the demonstration of the basement membrane and the Nitro BT method for succinate dehydrogenase activity in order to demonstrate the metabolic competence of its cells. The 'programmed cell death theory' was not supported by the present investigation, since the cells of the medial ridge epithelium retained their structural and metabolic integrity even subsequent to the formation of cell nests. Additionally, the medial ridge epithelium of mice with radiation-induced cleft palates demonstrated normal structural and metabolic integrity long past the prospective time of fusion. (author)

  5. Natural pregnancy and normal delivery after intracapsular irradiation for symptomatic craniopharyngioma. Case report

    Kodama, Takafumi; Matsukado, Yasuhiko; Miura, Masaki; Takada, Akira

    1986-01-01

    Treatment for craniopharyngioma, particularly in adults and cases of recurrence, is still fraught with problems. One difficulty is that postoperative hormonal function may be abnormal even after successful surgery. We have treated craniopharyngioma primarily with simple evacuation and intracapsular irradiation, using /sup 198/Au-colloid. Only a few cases of natural pregnancy and normal delivery following treatment for craniopharyngioma with hypothalamic extension have been reported. We will describe and discuss a case in which natural pregnancy and normal delivery occurred twice after such treatment.

  6. Repair of chromosome damage induced by X-irradiation during G2 phase in a line of normal human fibroblasts and its malignant derivative

    Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.

    1982-01-01

    A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G2 phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. The gaps may represent single-strand breaks. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or beta-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G2 phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G2 phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives

  7. Repair of chromosome damage induced by X-irradiation during G2 phase in a line of normal human fibroblasts and its malignant derivative

    Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.

    1982-01-01

    A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G 2 phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or #betta#-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G 2 phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, which destroys H 2 O 2 , or mannitol, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G 2 phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives

  8. Temporally distinct response of irradiated normal human fibroblasts and their bystander cells to energetic heavy ions

    Hamada, Nobuyuki; Ni, Meinan; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko

    2008-01-01

    Ionizing radiation-induced bystander effects have been documented for a multitude of endpoints such as mutations, chromosome aberrations and cell death, which arise in nonirradiated bystander cells having received signals from directly irradiated cells; however, energetic heavy ion-induced bystander response is incompletely characterized. To address this, we employed precise microbeams of carbon and neon ions for targeting only a very small fraction of cells in confluent fibroblast cultures. Conventional broadfield irradiation was conducted in parallel to see the effects in irradiated cells. Exposure of 0.00026% of cells led to nearly 10% reductions in the clonogenic survival and twofold rises in the apoptotic incidence regardless of ion species. Whilst apoptotic frequency increased with time up to 72 h postirradiation in irradiated cells, its frequency escalated up to 24 h postirradiation but declined at 48 h postirradiation in bystander cells, indicating that bystander cells exhibit transient commitment to apoptosis. Carbon- and neon-ion microbeam irradiation similarly caused almost twofold increments in the levels of serine 15-phosphorylated p53 proteins, irrespective of whether 0.00026, 0.0013 or 0.0066% of cells were targeted. Whereas the levels of phosphorylated p53 were elevated and remained unchanged at 2 h and 6 h postirradiation in irradiated cells, its levels rose at 6 h postirradiation but not at 2 h postirradiation in bystander cells, suggesting that bystander cells manifest delayed p53 phosphorylation. Collectively, our results indicate that heavy ions inactivate clonogenic potential of bystander cells, and that the time course of the response to heavy ions differs between irradiated and bystander cells. These induced bystander responses could be a defensive mechanism that minimizes further expansion of aberrant cells

  9. Radiogenic responses of normal cells induced by fractionated irradiation -a simulation study. Pt. 2. Late responses

    Duechting, W.; Ulmer, W.; Ginsberg, T.; Kikhounga-N'Got, O.; Saile, C.

    1995-01-01

    Based on controlled theory, a computed simulation model has been constructed which describes the time course of slowly responding normal cells after irradiation exposure. Subsequently, different clinical irradiation schemes are compared in regard to their delayed radiogenic responses referred to as late effects in radiological terminology. A cybernetic model of a paraenchymal tissue consisting of dominantly resting functional cells has been developed and transferred into a computer model. The radiation effects are considered by characteristic cell parameters as well as by the linear-quadratic model. Three kinds of tissue (brain and lung parenchym of the mouse, liver parenchym of rat) have been irradiated in the model according to standard-, super-, hyperfractionation and a single high dose per week. The simulation studies indicate that the late reaction of brain parenchym to hyperfractionation (3 x 1.5 Gy per day) and of lung parenchym tissue with regard to all fractionation schemes applied is particularly severe. The behavior of liver parenchym is not unique. A comparison of the simulation results basing to the survival of cell numbers with clinical experience and practice shows that the clinical reality can qualitatively be represented by the model. This opens the door for connecting side effects to normal tissue with the corresponding tumor efficacy (discussed in previous papers). The model is open to further refinement and to discussions referring to the phenomenon of late effects. (orig.) [de

  10. In vitro radiation response studies on bone marrow fibroblasts (CFU-F) obtained from normal and chronically irradiated dogs

    Klein, A.K.; Stitzel, K.A.; Greenberg, B.; Woo, L.

    1984-01-01

    The radiation resistance of bone marrow fibroblasts as measured by their proliferative potential was evaluated in chronically irradiated dogs. Bone marrows were obtained from eight dogs that had been chronically irradiated beginning at 21 days of gestation or after birth and eight age-matched controls. Of these irradiated dogs, four were either preleukemic or exhibited frank acute nonlymphocytic leukemia. The other four were clinically normal but demonstrated abnormalities in their marrow that could be attributed to radiation effects and/or other pathologic changes. Fibroblasts from six of the irradiated dogs were significantly more radioresistant than those of their controls. Five of these six dogs subsequently succumbed to hematopathologic disease, while the two irradiated dogs with normal fibroblasts remained clinically normal, suggesting that this observed radioresistance may be linked to the disease process. (author)

  11. Expression profiles are different in carbon ion-irradiated normal human fibroblasts and their bystander cells

    Iwakawa, Mayumi; Hamada, Nobuyuki; Imadome, Kaori; Funayama, Tomoo; Sakashita, Testuya; Kobayashi, Yasuhiko; Imai, Takashi

    2008-01-01

    Evidence has accumulated that ionizing radiation induces biological effects in non-irradiated bystander cells having received signals from directly irradiated cells; however, energetic heavy ion-induced bystander response is incompletely characterized. Here we performed microarray analysis of irradiated and bystander fibroblasts in confluent cultures. To see the effects in bystander cells, each of 1, 5 and 25 sites was targeted with 10 particles of carbon ions (18.3 MeV/u, 103 keV/μm) using microbeams, where particles traversed 0.00026, 0.0013 and 0.0066% of cells, respectively. diated cells, cultures were exposed to 10% survival dose (D), 0.1D and 0.01D of corresponding broadbeams (108 keV/μm). Irrespective of the target numbers (1, 5 or 25 sites) and the time (2 or 6 h postirradiation), similar expression changes were observed in bystander cells. Among 874 probes that showed more than 1.5-fold changes in bystander cells, 25% were upregulated and the remainder downregulated. These included genes related to cell communication (PIK3C2A, GNA13, FN1, ANXA1 and IL1RAP), stress response (RAD23B, ATF4 and EIF2AK4) and cell cycle (MYCN, RBBP4 and NEUROG1). Pathway analysis revealed serial bystander activation of G protein/PI-3 kinase pathways. Instead, genes related to cell cycle or death (CDKN1A, GADD45A, NOTCH1 and BCL2L1), and cell communication (IL1B, TCF7 and ID1) were upregulated in irradiated cells, but not in bystander cells. Our results indicate different expression profiles in irradiated and bystander cells, and imply that intercellular signaling between irradiated and bystander cells activate intracellular signaling, leading to the transcriptional stress response in bystander cells

  12. Immunological investigations of antigens released by normal and irradiated schistosomasa mansoni cercariae in vitro. Part of a coordinated programme on preparation of irradiated vaccines against some human diseases

    Catty, D.

    1982-07-01

    S.mansoni cercariae were γ-irradiated at 1-15 K rads, syringe transformed, and injected into groups of 20 mice (200 dose), with unirradiated controls. Aliquots of 1,500 cercariae irradiated at 1-40 K rads (plus unirradiated controls) were cultured in serum-free medium. It was found that irradiation does not inhibit release of a broad spectrum of antigens in culture over 6 hours until 20 K rads is delivered. Mice used as hosts for the graded cercarial irradiation vaccine were subdivided into groups of 10 and either left unchallenged or challenged at 6 weeks with a normal infection of 200 cercariae. Serum samples were taken from every mouse at regular intervals and antibodies titrated by solid phase radioimmunoassay. Injected parasites, whether irradiated or normal, always gave higher antibody titres to cercarial and egg antigens than the equivalent dose of normal (challenge) parasites infecting by the natural route. Challenge infection depressed anti-cercarial responses in mice exposed to irradiated larvae but boosted the response to normal injected parasites. Antibodies to SEA were in lower titre in all groups but rose from week 7 (1 week post-challenge) in the groups injected with normal and 1 K rad-treated parasites, where adults were previously established in the hosts. At 12 weeks all mice were sacrificed and perfused for adults. Egg yields in liver and intestine were determined. There was no evidence of protective immunity to challenge infection induced by injected unirradiated or 1 K rad-irradiated, transformed, cercariae, even though both sources of parasite gave rise to egg-laying adults. By contrast, the 5, 10 and 15 K rad vaccines gave protection of 36-49%, even though they gave rise to no persistent adults or any deposited eggs. The protective (immunising) properties of irradiation-attenuated vaccines of S.mansoni cercariae can thus be clearly correlated with their capacity to release antigens in the immediate post irradiation period

  13. Cell Survival and DNA Damage in Normal Prostate Cells Irradiated Out-of-Field.

    Shields, L

    2014-10-31

    Interest in out-of-field radiation dose has been increasing with the introduction of new techniques, such as volumetric modulated arc therapy (VMAT). These new techniques offer superior conformity of high-dose regions to the target compared to conventional techniques, however more normal tissue is exposed to low-dose radiation with VMAT. There is a potential increase in radiobiological effectiveness associated with lower energy photons delivered during VMAT as normal cells are exposed to a temporal change in incident photon energy spectrum. During VMAT deliveries, normal cells can be exposed to the primary radiation beam, as well as to transmission and scatter radiation. The impact of low-dose radiation, radiation-induced bystander effect and change in energy spectrum on normal cells are not well understood. The current study examined cell survival and DNA damage in normal prostate cells after exposure to out-of-field radiation both with and without the transfer of bystander factors. The effect of a change in energy spectrum out-of-field compared to in-field was also investigated. Prostate cancer (LNCaP) and normal prostate (PNT1A) cells were placed in-field and out-of-field, respectively, with the PNT1A cells being located 1 cm from the field edge when in-field cells were being irradiated with 2 Gy. Clonogenic and γ-H2AX assays were performed postirradiation to examine cell survival and DNA damage. The assays were repeated when bystander factors from the LNCaP cells were transferred to the PNT1A cells and also when the PNT1A cells were irradiated in-field to a different energy spectrum. An average out-of-field dose of 10.8 ± 4.2 cGy produced a significant reduction in colony volume and increase in the number of γ-H2AX foci\\/cell in the PNT1A cells compared to the sham-irradiated control cells. An adaptive response was observed in the PNT1A cells having first received a low out-of-field dose and then the bystander factors. The PNT1A cells showed a significant

  14. The effect of irradiation on function in self-renewing normal tissues with differing proliferative organisation

    Wheldon, T.E.; Michalowski, A.S.

    1982-01-01

    The primary effect of irradiation on self-renewing normal tissues is sterilisation of their proliferative cells, but how this translates into failure of tissue function depends on the mode of organisation of the tissue concerned. It has recently been suggested (Michalowski, 1981) that proliferative normal tissues may be classed as ''hierarchical'' (like haemopoietic tissues) or as ''flexible'' (like liver parenchyma) and that radiation injury to tissue function develops by different pathways in these tissues. Mathematical model studies confirm the different radiation responses of differently organized tissues. Tissues of the ''flexible'' or ''F-type'' category display a variety of novel radiobiological properties, different from those of the more familiar ''hierarchical'' or ''H-type'' tissues. The ''F-type'' responses are strongly influenced by radiation-sterilised (''doomed'') cells, and is is suggested that the role of ''doomed'' cells has been undervalued relative to that of clonogenic survivors. Since ''F-type'' tissues have characteristically low rates of cell renewal, it is possible that these tissues are preferentially responsible for late effects of irradiation in clinical radiotherapy. (author)

  15. Damaging and protective bystander cross-talk between human lung cancer and normal cells after proton microbeam irradiation

    Desai, Sejal; Kobayashi, Alisa; Konishi, Teruaki; Oikawa, Masakazu; Pandey, Badri N.

    2014-01-01

    Graphical abstract: - Highlights: • Proton-microbeam irradiated A549 cells send damaging signals to bystander A549 cells. • Irradiated A549–A549 bystander response is through gap junctional communication. • Bystander WI38 cells exert protective signalling in irradiated A549 cells. • Rescue of irradiated A549 cells by WI38 cells is independent of gap junctions. - Abstract: Most of the studies of radiation-induced bystander effects (RIBE) have been focused on understanding the radiobiological changes observed in bystander cells in response to the signals from irradiated cells in a normal cell population with implications to radiation risk assessment. However, reports on RIBE with relevance to cancer radiotherapy especially investigating the bidirectional and criss-cross bystander communications between cancer and normal cells are limited. Hence, in present study employing co-culture approach, we have investigated the bystander cross-talk between lung cancer (A549) and normal (WI38) cells after proton-microbeam irradiation using γ-H2AX foci fluorescence as a measure of DNA double-strand breaks (DSBs). We observed that in A549–A549 co-cultures, irradiated A549 cells exert damaging effects in bystander A549 cells, which were found to be mediated through gap junctional intercellular communication (GJIC). However, in A549–WI38 co-cultures, irradiated A549 did not affect bystander WI38 cells. Rather, bystander WI38 cells induced inverse protective signalling (rescue effect) in irradiated A549 cells, which was independent of GJIC. On the other hand, in response to irradiated WI38 cells neither of the bystander cells (A549 or WI38) showed significant increase in γ-H2AX foci. The observed bystander signalling between tumour and normal cells may have potential implications in therapeutic outcome of cancer radiotherapy

  16. Damaging and protective bystander cross-talk between human lung cancer and normal cells after proton microbeam irradiation

    Desai, Sejal [Radiation Signalling and Cancer Biology Section, Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai 400 085 (India); Kobayashi, Alisa; Konishi, Teruaki; Oikawa, Masakazu [Radiation System and Engineering Section, Department of Technical Support and Development, Research, Development and Support Center, National Institute of Radiological Sciences, Chiba 263-8555 (Japan); Pandey, Badri N., E-mail: badrinarain@yahoo.co.in [Radiation Signalling and Cancer Biology Section, Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai 400 085 (India)

    2014-05-15

    Graphical abstract: - Highlights: • Proton-microbeam irradiated A549 cells send damaging signals to bystander A549 cells. • Irradiated A549–A549 bystander response is through gap junctional communication. • Bystander WI38 cells exert protective signalling in irradiated A549 cells. • Rescue of irradiated A549 cells by WI38 cells is independent of gap junctions. - Abstract: Most of the studies of radiation-induced bystander effects (RIBE) have been focused on understanding the radiobiological changes observed in bystander cells in response to the signals from irradiated cells in a normal cell population with implications to radiation risk assessment. However, reports on RIBE with relevance to cancer radiotherapy especially investigating the bidirectional and criss-cross bystander communications between cancer and normal cells are limited. Hence, in present study employing co-culture approach, we have investigated the bystander cross-talk between lung cancer (A549) and normal (WI38) cells after proton-microbeam irradiation using γ-H2AX foci fluorescence as a measure of DNA double-strand breaks (DSBs). We observed that in A549–A549 co-cultures, irradiated A549 cells exert damaging effects in bystander A549 cells, which were found to be mediated through gap junctional intercellular communication (GJIC). However, in A549–WI38 co-cultures, irradiated A549 did not affect bystander WI38 cells. Rather, bystander WI38 cells induced inverse protective signalling (rescue effect) in irradiated A549 cells, which was independent of GJIC. On the other hand, in response to irradiated WI38 cells neither of the bystander cells (A549 or WI38) showed significant increase in γ-H2AX foci. The observed bystander signalling between tumour and normal cells may have potential implications in therapeutic outcome of cancer radiotherapy.

  17. Modelling 1-minute directional observations of the global irradiance.

    Thejll, Peter; Pagh Nielsen, Kristian; Andersen, Elsa; Furbo, Simon

    2016-04-01

    Direct and diffuse irradiances from the sky has been collected at 1-minute intervals for about a year from the experimental station at the Technical University of Denmark for the IEA project "Solar Resource Assessment and Forecasting". These data were gathered by pyrheliometers tracking the Sun, as well as with apertured pyranometers gathering 1/8th and 1/16th of the light from the sky in 45 degree azimuthal ranges pointed around the compass. The data are gathered in order to develop detailed models of the potentially available solar energy and its variations at high temporal resolution in order to gain a more detailed understanding of the solar resource. This is important for a better understanding of the sub-grid scale cloud variation that cannot be resolved with climate and weather models. It is also important for optimizing the operation of active solar energy systems such as photovoltaic plants and thermal solar collector arrays, and for passive solar energy and lighting to buildings. We present regression-based modelling of the observed data, and focus, here, on the statistical properties of the model fits. Using models based on the one hand on what is found in the literature and on physical expectations, and on the other hand on purely statistical models, we find solutions that can explain up to 90% of the variance in global radiation. The models leaning on physical insights include terms for the direct solar radiation, a term for the circum-solar radiation, a diffuse term and a term for the horizon brightening/darkening. The purely statistical model is found using data- and formula-validation approaches picking model expressions from a general catalogue of possible formulae. The method allows nesting of expressions, and the results found are dependent on and heavily constrained by the cross-validation carried out on statistically independent testing and training data-sets. Slightly better fits -- in terms of variance explained -- is found using the purely

  18. Studies with normal and gamma irradiated third stage larvae of Oesophagostomum columbianum in lambs

    Sharma, R.L.; Dhar, D.N.

    1979-01-01

    Results of work on the host-parasite relationship of Oesophagostomum columbianum in sheep, carried out at the Regional Centre, Srinagar, are presented. Primary infections with small numbers of O. columbianum third larvae in lambs caused establishment of more adult worms in the intestine. As the number of larvae administered to lambs in primary infections was increased, a significant decrease in the establishment of adult worms in the intestine was observed. Higher levels of primary infections in lambs resulted in stunting of both male and female adult worms in intestine but this did not affect the resultant egg production by the worms. The severity of the disease in lambs was directly related to the number of larvae administered in primary infections. Attenuation of the third stage larvae of O.columbianum was obtained when they were irradiated at 40 and 50 Krad doses from a gamma source. Whereas it was possible to stimulate only a partial protection in young lambs to O. columbianum with a single dose of 2000, 40 Krad irradiated larvae. Vaccination with the same numbers of larvae, but irradiated at 50 Krad failed to protect the animals. The presence of adult worms of O.columbianum in sites outside the intestine in lambs has been reported for the first time. (auth.)

  19. Cell Proliferation during Lymphopoiesis in the Thymus of Normal and Continuously Irradiated Mice

    Fabrikant, J. I. [Department of Radiological Science, Johns Hopkins University, Baltimore, MD (United States)

    1968-08-15

    The patterns of lymphoid cell proliferation in the thymus and spleen in normal and continuously irradiated young C57BL mice have been examined with techniques of flash and repeated labelling with tritiated thymidine and high resolution autoradiography. Changes in percentage labelling indices and labelled mitoses data have provided information on sites and rates of lymphoid cell proliferation in the thymus cortex (reticular cells, large, medium and small lymphocytes) and the spleen white pulp (germinal centre cells, large, medium and small lymphocytes). Labelling rates were fastest in the more primitive cell forms; in both lymphoid organs, the stem-cell labelling - reticular cells and germinal centre cells - reached 100% rapidly, whereas this was not the case for the different lymphocyte populations, and thymic lymphopoiesis was more rapid than splenic lymphopoiesis. Mean cycle times for thymus lymphoid cells were {approx} 12.5 hours for reticular cells, {approx} 9.5 hours for large lymphocytes, and {approx} 10.0 hours for medium and small lymphocytes; in the spleen, representative cycle times were significantly longer. Small lymphocytes were replaced at a greater rate in the thymus than in the spleen. Under continuous {gamma}-irradiation (caesium-137) at 45 rad/day and 75 rad/day for 15 days, there was a progressive depopulation of all lymphoid cell classes, an increase in the relative proportion of the more primitive forms, and a marked decrease in the numbers of small lymphocytes in both tissues. In the thymus and in the spleen, there was an increase in proliferation rates in both stem-cell populations and in all lymphoid cell forms, a decrease in mean cell cycle times to shorter values and a possible reduction in the spread of cell cycle times. In irradiated tissues, there was little evidence for lymphoid cell emigration. Tentative patterns of lymphopoiesis in the normal thymus and spleen based on the autoradiographic data aredescribed and changes in the

  20. Cellular and molecular effects for mutation induction in normal human cells irradiated with accelerated neon ions

    Suzuki, Masao; Tsuruoka, Chizuru; Kanai, Tatsuaki; Kato, Takeshi; Yatagai, Fumio; Watanabe, Masami

    2006-01-01

    We investigated the linear energy transfer (LET) dependence of mutation induction on the hypoxanthine-guanine phosphoribosyl transferase (HPRT) locus in normal human fibroblast-like cells irradiated with accelerated neon-ion beams. The cells were irradiated with neon-ion beams at various LETs ranging from 63 to 335 keV/μm. Neon-ion beams were accelerated by the Riken Ring Cyclotron at the Institute of Physical and Chemical Research in Japan. Mutation induction at the HPRT locus was detected to measure 6-thioguanine-resistant clones. The mutation spectrum of the deletion pattern of exons of mutants was analyzed using the multiplex polymerase chain reaction (PCR). The dose-response curves increased steeply up to 0.5 Gy and leveled off or decreased between 0.5 and 1.0 Gy, compared to the response to 137 Cs γ-rays. The mutation frequency increased up to 105 keV/μm and then there was a downward trend with increasing LET values. The deletion pattern of exons was non-specific. About 75-100% of the mutants produced using LETs ranging from 63 to 335 keV/μm showed all or partial deletions of exons, while among γ-ray-induced mutants 30% showed no deletions, 30% partial deletions and 40% complete deletions. These results suggested that the dose-response curves of neon-ion-induced mutations were dependent upon LET values, but the deletion pattern of DNA was not

  1. Radiation damage to the normal monkey brain. Experimental study induced by interstitial irradiation

    Mishima, Nobuya; Tamiya, Takashi; Matsumoto, Kengo; Furuta, Tomohisa; Ohmoto, Takashi

    2003-01-01

    Radiation damage to normal brain tissue induced by interstitial irradiation with iridium-192 seeds was sequentially evaluated by computed tomography (CT), magnetic resonance imaging (MRI), and histological examination. This study was carried out in 14 mature Japanese monkeys. The experimental area received more than 200-260 Gy of irradiation developed coagulative necrosis. Infiltration of macrophages to the periphery of the necrotic area was seen. In addition, neovascularization, hyalinization of vascular walls, and gliosis were found in the periphery of the area invaded by the macrophages. All sites at which the vascular walls were found to have acute stage fibrinoid necrosis eventually developed coagulative necrosis. The focus of necrosis was detected by MRI starting 1 week after the end of radiation treatment, and the size of the necrotic area did not change for 6 months. The peripheral areas showed clear ring enhancement with contrast material. Edema surrounding the lesions was the most significant 1 week after radiation and was reduced to a minimum level 1 month later. However, the edema then expanded once again and was sustained for as long as 6 months. CT did not provide as clear of a presentation as MRI, but it did reveal similar findings for the most part, and depicted calcification in the necrotic area. This experimental model is considered useful for conducting basic research on brachytherapy, as well as for achieving a better understanding of delayed radiation necrosis. (author)

  2. Growth of normal or irradiated vaginal epithelium in in vivo cultures

    Tileva, M.

    1975-01-01

    Growth of normal or irradiated vaginal epithelium was studied by the method of F.M.Lazarenko (1959). Pieces of vaginal mucosa from immature albino rats, normal or exposed to 1000 or 2000 R, were embedded in celloidin and implanted into the abdominal wall of female immature rats. Implants were recovered for histological examinations from day 1 to day 10 after surgery. At day 1 post implantation, vaginal epithelium was found to have dedifferentiated. Cells showed a high mitotic index (MI = 16.2%). Cell proliferation progressed further to attain a peak rate at 3 days (MI = 32.7%). At 5 days, newly formed structures began to differentiate, and concurrently manifested a gradual decrease in cell proliferative activity (at 10 days, MI = 15.6%). Following exposure to 1000 R, vaginal epithelium displayed a similar pattern of growth and differentiation, the only difference from non-irradiated epithelium being that there was a transient mitotic delay over the first 3 days; mitotic rates reached a peak at 5 days (MI = 47.0%), were still high at 7 days (MI = 31.3%), and fell to 19% at 10 days. With this longer proliferation period, newly formed structures appeared ''luxuriant''. After a dose of 2000 R, vaginal epithelium failed to show any signs of growth at all investigated time intervals. These data are in agreement with evidence obtained by K.M.Svetikova (1961) and L.I.Chekulaeva (1969, 1974) for a good restitutional ability of epithelia of epidermal origin following exposure to 1200 R X-rays. By Warren' rule (1944), i.e., that cells should be considered radiosensitive if severely damaged by less than 2500 R, vaginal epithelium cells may be designated as relatively susceptible to radiation. (author)

  3. Patterns of proliferation and differentiation of irradiated haemopoietic stem cells cultured on normal 'stromal' cell colonies in vitro

    Mori, K.J.

    1981-01-01

    Experiments were designed to elucidate whether or not the irradiated bone marrow cells receive any stimulation for the self-replication and differentiation from normal 'stromal' cell colonies in the bone marrow cell culture in vitro. When irradiated or unirradiated bone marrow cells were overlaid on the normal adherent cell colonies, the proliferation of haemopoietic stem cells was supported, the degree of the stimulation depending on the starting cellular concentration. There was, however, no significant changes in the concentration of either CFUs or CFUc regardless of the dose of irradiation on the bone marrow cells overlaid. This was a great contrast to the dose-dependent decrease of CFUs or CFUc within the culture in which both the stem cells and stromal cells were simultaneously irradiated. These results suggest that the balance of self-replication and differentiation of the haemopoietic stem cells is affected only when haemopoietic microenvironment is perturbed. (author)

  4. Directional output distance functions: endogenous directions based on exogenous normalization constraints

    In this paper we develop a model for computing directional output distance functions with endogenously determined direction vectors. We show how this model is related to the slacks-based directional distance function introduced by Fare and Grosskopf and show how to use the slacks-based function to e...

  5. Evaluation of the desert dust effects on global, direct and diffuse spectral ultraviolet irradiance

    R. Román

    2013-01-01

    Full Text Available This paper presents a study of a strong desert dust episode over the Iberian Peninsula, and its effect on the spectral ultraviolet (UV irradiance in Granada, Spain. Remote sensing measurements, forecast models, and synoptic analysis are used to identify a Saharan desert dust outbreak that affected the Iberian Peninsula starting 20 July 2009. Additionally, a Bentham DMc150 spectroradiometer is employed to obtain global, direct and diffuse spectral UV irradiances every 15 minutes in Granada. The desert dust caused a large attenuation of the direct UV irradiance (up to 55%, while the diffuse UV irradiance increased up to 40% at 400 nm. The UVSPEC/LibRadtran radiative transfer model is used to study the spectral dependence of the experimental UV irradiance ratios (ratios of spectral irradiance for the day with the highest aerosol load to that measured in days with low–moderate load. The spectral increase or decrease of the UV direct irradiance ratios depends on a new parameter: a threshold wavelength. The spectral dependence of the UV diffuse irradiance ratio can be explained because under the influence of the intense dust outbreak, the Mie scattering by aerosols at shorter wavelengths is stronger than the Rayleigh scattering by gases. Finally, the sensitivity analysis of the aerosol absorption properties shows a substantial attenuation of UV spectral irradiance with a weak spectral dependence.

  6. Qualitative dose response of the normal canine head to epithermal neutron irradiation with and without boron capture

    DeHaan, C.E.; Gavin, P.R.; Kraft, S.L.; Wheeler, F.J.; Atkinson, C.A.

    1992-01-01

    Boron Neutron Capture Therapy is being re-evaluated for the treatment of intracranial tumors. Prior to human clinical trials, determination of normal tissue tolerance is critical. Dogs were chosen as a large animal model for the following reasons. Dogs can be evaluated with advanced imaging, diagnostic and therapeutic modalities. Dogs are amenable to detailed neurologic examination and subtle behavioral changes are easily detected. Specifically, Labrador retrievers were chosen for their large body and head size. The dogs received varying doses of epithermal neutron irradiation and boron neutron capture irradiation using an epithermal neutron source. The dogs were closely monitored for up to one year post irradiation

  7. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y. [Royal Postgraduate Medical School, London (United Kingdom)

    1995-10-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author).

  8. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y.

    1995-01-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author)

  9. Histopathological investigation of radiation necrosis. Coagulation necrosis in the irradiated and non-irradiated brain tumors and in the normal brain tissue

    Nakamura, N [Niigata Univ. (Japan). Brain Research Inst.

    1977-01-01

    Eighty four irradiated tumors (including 59 gliomas) and the surrounding brain tissue were analyzed. In 'normal' brain tissue, typical coagulation necrosis attributable to irradiation was observed in the cerebral white matter, presenting a whitish-yellow color but no remarkable changes in volume. Histologically there was complete desintegration of myelin and axon. Vascular changes included hyalinous thickening, concentric cleavage, fibrinoid degeneration, adventitial fibrosis and edema of small arteries, fibrin thrombi or occlusion of arterioles and capillaries, and telangiectasia of small veins and venules. While other tumors showed hyalinous or fibrous scar tissue and decrease in volume, the gliomas maintained their original volume without residual tumor cells. Massive coagulation necrosis was occasionally found even in full volume, non-irradiated gliomas (controls), although the changes were fewer and not so varied as in typical radiation necrosis. With small dosages, it was difficult to judge whether the necrosis was caused by irradiation or occurred spontaneously. Coagulation necrosis in tumor tissue was found in 25 of 59 cases (42%) of irradiated gliomas, but in only 2 of 49 cases (4%) of the nonirradiated gliomas. In 49 cases no coagulation necrosis of the surrounding tissue was found. Although histopathological judgement is difficult, it is suggested that there is a significant correlation between coagulation necrosis and irradiation. Discussion of the relationship between coagulation necrosis and NSD (nominal standard dose) led to the conclusion that coagulation necrosis will not be caused by irradiation of less than 1400 rets in NSD.

  10. Strong normalization by type-directed partial evaluation and run-time code generation

    Balat, Vincent; Danvy, Olivier

    1998-01-01

    We investigate the synergy between type-directed partial evaluation and run-time code generation for the Caml dialect of ML. Type-directed partial evaluation maps simply typed, closed Caml values to a representation of their long βη-normal form. Caml uses a virtual machine and has the capability...... to load byte code at run time. Representing the long βη-normal forms as byte code gives us the ability to strongly normalize higher-order values (i.e., weak head normal forms in ML), to compile the resulting strong normal forms into byte code, and to load this byte code all in one go, at run time. We...... conclude this note with a preview of our current work on scaling up strong normalization by run-time code generation to the Caml module language....

  11. Strong Normalization by Type-Directed Partial Evaluation and Run-Time Code Generation

    Balat, Vincent; Danvy, Olivier

    1997-01-01

    We investigate the synergy between type-directed partial evaluation and run-time code generation for the Caml dialect of ML. Type-directed partial evaluation maps simply typed, closed Caml values to a representation of their long βη-normal form. Caml uses a virtual machine and has the capability...... to load byte code at run time. Representing the long βη-normal forms as byte code gives us the ability to strongly normalize higher-order values (i.e., weak head normal forms in ML), to compile the resulting strong normal forms into byte code, and to load this byte code all in one go, at run time. We...... conclude this note with a preview of our current work on scaling up strong normalization by run-time code generation to the Caml module language....

  12. Anisotropy in CNT composite fabricated by combining directional freezing and gamma irradiation of acrylic acid

    Osička, J.; Ilčíková, M.; Mrlík, M.; Al-Maadeed, M. A. S. A.; Šlouf, Miroslav; Tkac, J.; Kasák, P.

    2016-01-01

    Roč. 97, 5 May (2016), s. 300-306 ISSN 0261-3069 Institutional support: RVO:61389013 Keywords : directional freezing * gamma irradiation * carbon nanotubes Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.997, year: 2015

  13. The detection of irradiated foods using the Direct Epifluorescent Filter Technique

    Betts, R.P.; Bankes, P.; Stringer, M.F.; Farr, L.

    1988-01-01

    A method was evaluated which has the potential to detect a food sample which has been irradiated. The technique will give an indication of the total number of viable micro-organisms present before irradiation. It is based on the comparison of an aerobic plate count (APC) with a count obtained using the Direct Epifluorescent Filter Technique (DEFT). When the APC of an irradiated sample was compared with the DEFT count on the same sample, the APC was considerably lower than that obtained by DEFT. The count of orange fluorescing cells after irradiation, however, correlated well with an APC of the same sample before irradiation. For the samples examined the DEFT count determined the viable microbial population in the sample before irradiation. The difference between the APC and the DEFT count gave the number of organisms rendered non-viable by the process. (author)

  14. Near-term Forecasting of Solar Total and Direct Irradiance for Solar Energy Applications

    Long, C. N.; Riihimaki, L. D.; Berg, L. K.

    2012-12-01

    Integration of solar renewable energy into the power grid, like wind energy, is hindered by the variable nature of the solar resource. One challenge of the integration problem for shorter time periods is the phenomenon of "ramping events" where the electrical output of the solar power system increases or decreases significantly and rapidly over periods of minutes or less. Advance warning, of even just a few minutes, allows power system operators to compensate for the ramping. However, the ability for short-term prediction on such local "point" scales is beyond the abilities of typical model-based weather forecasting. Use of surface-based solar radiation measurements has been recognized as a likely solution for providing input for near-term (5 to 30 minute) forecasts of solar energy availability and variability. However, it must be noted that while fixed-orientation photovoltaic panel systems use the total (global) downwelling solar radiation, tracking photovoltaic and solar concentrator systems use only the direct normal component of the solar radiation. Thus even accurate near-term forecasts of total solar radiation will under many circumstances include inherent inaccuracies with respect to tracking systems due to lack of information of the direct component of the solar radiation. We will present examples and statistical analyses of solar radiation partitioning showing the differences in the behavior of the total/direct radiation with respect to the near-term forecast issue. We will present an overview of the possibility of using a network of unique new commercially available total/diffuse radiometers in conjunction with a near-real-time adaptation of the Shortwave Radiative Flux Analysis methodology (Long and Ackerman, 2000; Long et al., 2006). The results are used, in conjunction with persistence and tendency forecast techniques, to provide more accurate near-term forecasts of cloudiness, and both total and direct normal solar irradiance availability and

  15. Energetic heavy ions accelerate differentiation in the descendants of irradiated normal human diploid fibroblasts

    Hamada, Nobuyuki; Hara, Takamitsu; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko

    2008-01-01

    Ionizing radiation-induced genomic instability has been demonstrated in a variety of endpoints such as delayed reproductive death, chromosome instability and mutations, which occurs in the progeny of survivors many generations after the initial insult. Dependence of these effects on the linear energy transfer (LET) of the radiation is incompletely characterized; however, our previous work has shown that delayed reductions in clonogenicity can be most pronounced at LET of 108 keV/μm. To gain insight into potential cellular mechanisms involved in LET-dependent delayed loss of clonogenicity, we investigated morphological changes in colonies arising from normal human diploid fibroblasts exposed to γ-rays or energetic carbon ions (108 keV/μm). Exposure of confluent cultures to carbon ions was 4-fold more effective at inactivating cellular clonogenic potential and produced more abortive colonies containing reduced number of cells per colony than γ-rays. Second, colonies were assessed for clonal morphotypic heterogeneity. The yield of differentiated cells was elevated in a dose- and LET-dependent fashion in clonogenic colonies, whereas differentiated cells predominated to a comparable extent irrespective of radiation type or dose in abortive colonies. The incidence of giant or multinucleated cells was also increased but much less frequent than that of differentiated cells. Collectively, our results indicate that carbon ions facilitate differentiation more effectively than γ-rays as a major response in the progeny of irradiated fibroblasts. Accelerated differentiation may account, at least in part, for dose- and LET-dependent delayed loss of clonogenicity in normal human diploid cells, and could be a defensive mechanism that minimizes further expansion of aberrant cells

  16. Characteristics and function of bone marrow stromal adherent cells in normal and irradiated mice and guinea pigs

    Changyu, Zheng; Ji, Liu; Xiaoying, Bi

    1986-04-01

    It has been shown from cytochemical and other characteristic studies of bone marrow stromal cells in CFU-F that there are seven types of stromal cells in the stromal adherent cell layer of normal and irradiated C/sub 57/ mice whereas there are only six types in guinea pigs. On the other hand, a radioresistant cell subtype appears in adherent layer after irradiation of both C/sub 57/ mice and guinea pig since the supernatant of cultured CFU-F of the normal and irradiated C/sub 57/ mice can stimulate production of CFU-Gm. It is justifiable that the bone marrow stromal adherent cells of the C/sub 57/ mice could produce CSF.

  17. Metabolism of neutral lipids in nuclei and chromatin of thymocytes from normal and γ-irradiated rats

    Kulagina, T.P.; Shuruta, S.A.; Kolomijtseva, I.K.

    1993-01-01

    The levels ans specific radioactivities of cholesterol and free fatty acids in nuclei and chromatin of thymocytes from normal and γ-irradiated (10 Gy) rats have been studied. The radioactivity of the total lipid fraction of γ-irradiated cells was decreased significantly in the absence of inhibition of [2- 14 C]acetete incorporation into the total proteil and lipid reactions and the [ 3 H]uracyl incorporation into the acid-insoluble RNA. The concentration of free fatty acids in the nuclei increased significantly after irradiation. The specific radioactivity of cholesterol in chromatin was higher than in the nuclei. The differences in specific radioactivities of free fatty acids were less pronounced. After irradiation the ratio of specific radioactivities of free fatty acids in chromatin to that in the nucleai showed a tendency to increase

  18. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  19. Detection of irradiated poultry products using the direct epifluorescence filter technique

    Copin, M.P.; Bourgeois, C.

    1992-01-01

    Food irradiation has developed during the last few years. Nevertheless this development would be larger if there was a recognized method to detect whether a foodstuff had been irradiated. BETTS et al. (1988) suggested a method based on the comparison of an aerobic plate count (APC) with a count obtained using the Direct Epifluorescence Filter Technique (DEFT). They showed that the APC of an irradiated product was considerably lower than that obtained by the DEFT; in this case the DEFT count gave an indication of the number of viable microbial population in the product before irradiation; the APC of a non irradiated product was very well correlated with the DEFT count. In the present work both methods were tested on deep frozen mechanically deboned chicken meat (MDCM) and fresh chicken meat. The fluorochrome used for the DEFT was acridine orange; the mesophilic microflora was counted on 'Plate Count Agar'. According to the results obtained with the deep frozen MDCM, aerobic plate counts and DEFT counts are very similar during 100 days of storage when the product has not been irradiated; if it has been irradiated the difference between the two counts is high (about two logarithmic units). With this method it is thus possible to detect an irradiated product and to know the number of viable microbial cells in the irradiated product before the treatment. The method was tested on fresh chicken meat stored at 4 deg C. At the beginning of the storage period, it is possible to detect irradiated products, but at the end the method fails. In the latter case, irradiation can be detected, but it would be impossible to say that a product had not been irradiated. This method is potentially applicable to deep frozen products, more than to fresh products

  20. DNA double-strand breaks measured by pulsed-field gel electrophoresis in irradiated lymphocytes from normal humans and those with Alzheimer's disease

    Tobi, S.E.; Itzhaki, R.F.

    1993-01-01

    The authors previously found that radiation-induced chromosome aberrations (dicentrics) are more numerous in lymphocytes from Alzheimer's disease (AD) patients than in those from age-matched normal individuals (Tobi et al. 1990). They have examined double-strand breaks (dsb) produced by g amma - irradiation in the DNA of AD and normal lymphocytes by using pulsed-field gel electrophoresis. The percentage of DNA migrating into the gels is an indirect measure of the number of dsb; DNA content of sequential slices of the gel was assayed by direct fluorometry and the percentage migrating was dose dependent. Results show that the level of damage is similar in AD and normal lymphocytes and preliminary assays of the rate of repair suggest that the half-time is also similar, the value being > 1 h. The latter is consistent with the known rate of rejoining of chromosome fragments in interphase lymphocytes (Pantelias and Maillie 1985). (Author)

  1. Effect of irradiation on cell cycle, cell death and expression of its related proteins in normal human oral keratinocytes

    Kang, Mi Ae; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Jeon, In Seong

    2003-01-01

    To investigate the radiosensitivity of the normal human oral keratinocytes (NHOK), and the effect of irradiation on cell cycle and protein expression. To evaluate the radiosensitivity of NHOK, the number of colonies and cells were counted after irradiation and the SF2 (survival fraction as 2 Gy) value, and the cell survival curve fitted on a linear-quadratic model were obtained. LDH analysis was carried out to evaluate the necrosis of NHOK at 1, 2,3, and 4 days after 2, 10, and 20 Gy irradiation. Cell cycle arrest and the induction of apoptosis were analyzed using flow cytometry at 1, 2, 3, and 4 days after 2, 10, and 20 Gy irradiation. Finally, proteins related cell cycle arrest and apoptosis were analysed by Western blot. The number of survival cell was significantly decreased in a dose-dependent manner. The cell survival curve showed SF2, α, and β values to be 0.568, 0.209, and 0.020 respectively. At 20 Gy irradiated cells showed higher optical density than the control group. After irradiation, apoptosis was not observed but G2 arrest was observed in the NHOK cells. 1 day after 10 Gy irradiation, the expression of p53 remained unchanged, the p21 WAF1/Cip1 increased and the mdm2 decreased. The expression of bax, bcl-2, cyclin B1, and cyclin D remained unchanged. These results indicate that NHOK responds to irradiation by G2 arrest, which is possibly mediated by the expression of p21 WAF1/Cip1 , and that cell necrosis occurs by high dose irradiation.

  2. Broadband Direct UVA irradiance measurement for clear skies evaluated using a smartphone

    Igoe, D.; Parisi, A.V.

    2015-01-01

    UVA wavelengths (320-400 nm) have been implicated in recent studies to contribute to melanoma induction and skin photo-aging in humans and damage to plants. The use of smartphones in UVA observations is a way to supplement measurements made by traditional radiometric and spectro-radiometric technology. Although the smartphone image sensor is not capable of determining broadband UVA irradiances, these can be reconstructed from narrowband irradiances, which the smartphone, with narrowband and neutral density filters, can quantify with discrepancies not exceeding 5 %. Three models that reconstruct direct broadband clear sky UVA were developed from narrowband irradiances derived from smartphone image sensor pixel data with coefficients of determination of between 0.97 and 0.99. Reasonable accuracy and precision in determining the direct broadband UVA was maintained for observations made with solar zenith angles as high as 70 deg. . The developed method has the potential to increase the uptake of the measurement of broadband UVA irradiances. (authors)

  3. Direct or indirect UV-Irradiation in insect killers and similar equipment

    Heinz, G.

    1978-01-01

    UV sterilisation equipment is used in the refrigerating and storage rooms of food and meat processing factories. The UV radiation used has a wavelength of 254 nm. Due to possible side effects on the food, the packing is directly irradiated but the food itself only indirectly. This method makes high irradiation energies necessary for the inhibition of bacterial growth on the foodstuffs. (AJ) 891 AJ [de

  4. Experimental Method for Characterizing Electrical Steel Sheets in the Normal Direction

    Thierry Belgrand

    2010-10-01

    Full Text Available This paper proposes an experimental method to characterise magnetic laminations in the direction normal to the sheet plane. The principle, which is based on a static excitation to avoid planar eddy currents, is explained and specific test benches are proposed. Measurements of the flux density are made with a sensor moving in and out of an air-gap. A simple analytical model is derived in order to determine the permeability in the normal direction. The experimental results for grain oriented steel sheets are presented and a comparison is provided with values obtained from literature.

  5. Impairments of DNA synthesization and normal tissue after irradiation with carbon ions

    Takai, Nobuhiko; Watanabe, Masahiko; Ando, Koichi; Furusawa, Yoshiya; Uzawa, Akiko; Koike, Sachiko; Fukawa, Takeshi; Monobe, Manami; Hirayama, Ryoichi

    2006-01-01

    The purpose of this study is to evaluate [2- 14 C]thymidine as a tracer, to detect radiation damages in gut. We examined the radiolabeled thymidine accumulation in gut after irradiated with carbon-ion. Mice were given whole body irradiation with carbon-ion (290 MeV/u, 6 cm-spread-out Bragg peak (SOBP), 20 keV/μm). Gut [2- 14 C]thymidine accumulation significantly decreased 4 hr after irradiated with 9 Gy, and did not recover until 24 hr after irradiation. Furthermore, we investigated the dose dependency of [2- 14 C]thymidine accumulation in gut. At 12 hr after irradiation, accumulation of thymidine decreased with an increase of carbon-ion doses (1-9 Gy), whereas that of [6- 3 H]thymidine was independent of radiation dose. These results suggest that the difference of isotope-labeled position causes change of thymidine kinetics. At 84 hr after irradiation, [2- 14 C]thymidine accumulation showed no dose dependence. However, a clear dose dependence was obtained when [2- 14 C]thymidine accumulation was corrected by blood flow. Uptake of a regional blood flow marker 14 C-N-isopropyl-p-iodoamphetamine (IMP) in gut increased after 9-18 Gy irradiation. These findings demonstrated that the [2- 14 C]thymidine uptake in vivo could be an appropriate marker for investigating gut responses and blood flow should be taken account for the evaluation by [2- 14 C]thymidine. (author)

  6. Cellular proliferation and infiltration following interstitial irradiation of normal dog brain is altered by an inhibitor of polyamine synthesis

    Fike, John R.; Gobbel, Glenn T.; Chou, Dean; Wijnhoven, Bas P. L.; Bellinzona, Mattia; Nakagawa, Minoru; Seilhan, Theresa M.

    1995-01-01

    Purpose: The objectives of this study were to quantitatively define proliferative and infiltrative cell responses after focal 125 I irradiation of normal brain, and to determine the effects of an intravenous infusion of α-difluoromethylornithine (DFMO) on those responses. Methods and Materials: Adult beagle dogs were irradiated using high activity 125 I sources. Saline (control) or DFMO (150 mg/kg/day) was infused for 18 days starting 2 days before irradiation. At varying times up to 8 weeks after irradiation, brain tissues were collected and the cell responses in and around the focal lesion were quantified. Immunohistochemical stains were used to label astrocytes (GFAP), vascular endothelial cells (Factor VIII), polymorphonuclear leukocytes (PMNs; MAC 387) and cells synthesizing deoxyribonucleic acid (DNA) (BrdU). Cellular responses were quantified using a histomorphometric analysis. Results: After radiation alone, cellular events included a substantial acute inflammatory response followed by increased BrdU labeling and progressive increases in numbers of capillaries and astrocytes. α-Difluoromethylornithine treatment significantly affected the measured cell responses. As in controls, an early inflammatory response was measured, but after 2 weeks there were more PMNs/unit area than in controls. The onset of measurable BrdU labeling was delayed in DFMO-treated animals, and the magnitude of labeling was significantly reduced. Increases in astrocyte and vessel numbers/mm 2 were observed after a 2-week delay. At the site of implant, astrocytes from DFMO-treated dogs were significantly smaller than those from controls. Conclusions: There is substantial cell proliferation and infiltration in response to interstitial irradiation of normal brain, and these responses are significantly altered by DFMO treatment. Although the precise mechanisms by which DFMO exerts its effects in this model are not known, the results from this study suggest that modification of radiation

  7. The law of distribution of light beam direction fluctuations in telescopes. [normal density functions

    Divinskiy, M. L.; Kolchinskiy, I. G.

    1974-01-01

    The distribution of deviations from mean star trail directions was studied on the basis of 105 star trails. It was found that about 93% of the trails yield a distribution in agreement with the normal law. About 4% of the star trails agree with the Charlier distribution.

  8. Elevation of extracellular adenosine enhances haemopoiesis-stimulating effects of G-CSF in normal and gamma-irradiated mice

    Hofer, M.; Pospisil, M.; Netikiva, J.; Hola, J. [Institute of Biophysics, Academy of Sciences of the Czech Republic (Czech Republic)

    1997-03-01

    Effects of combined treatment with drugs elevating extracellular adenosine (dipyridamole /DP/, inhibiting the extracellular uptake of adenosine, and adenosine monophosphate /AMP/, an adenosine pro-drug), and G-CSF (granulocyte colony-stimulating factor) on haemopoiesis of normal and gamma-irradiated mice were ascertained. The agents were administered alone or in combination in a 4-day regimen. In normal, unirradiated animals, the haematological endpoints were determined 24 hours after the completion of the treatment. It was shown that the effects of G-CSF, i.e., increases in peripheral blood neutrophils, granulocyte-macrophage progenitor cells (GM-CFC) and morphologically recognizable granulocyte cells in femoral marrow and a decrease in the marrow erythroid cells, can be enhanced by the combination of DP plus AMP administrated 30 minutes before G-CSF. Furthermore, it was found that the stimulatory action of DP plus AMP was expressed particularly at lower doses of G-CSF (1.5, 3, and 4.5 {mu}g/d). In experiments with irradiated mice, when the 4-day therapeutic regimen was applied on days 3 to 6 following irradiation with the dose of 4 Gy, analogical stimulation of granulopoiesis was observed in the recovery phase on days 14 and 18 after irradiation. As example, see Fig. 1 for counts of granulocyte cells in femoral bone marrow. (authors)

  9. Elevation of extracellular adenosine enhances haemopoiesis-stimulating effects of G-CSF in normal and gamma-irradiated mice

    Hofer, M.; Pospisil, M.; Netikiva, J.; Hola, J.

    1997-01-01

    Effects of combined treatment with drugs elevating extracellular adenosine (dipyridamole /DP/, inhibiting the extracellular uptake of adenosine, and adenosine monophosphate /AMP/, an adenosine pro-drug), and G-CSF (granulocyte colony-stimulating factor) on haemopoiesis of normal and gamma-irradiated mice were ascertained. The agents were administered alone or in combination in a 4-day regimen. In normal, unirradiated animals, the haematological endpoints were determined 24 hours after the completion of the treatment. It was shown that the effects of G-CSF, i.e., increases in peripheral blood neutrophils, granulocyte-macrophage progenitor cells (GM-CFC) and morphologically recognizable granulocyte cells in femoral marrow and a decrease in the marrow erythroid cells, can be enhanced by the combination of DP plus AMP administrated 30 minutes before G-CSF. Furthermore, it was found that the stimulatory action of DP plus AMP was expressed particularly at lower doses of G-CSF (1.5, 3, and 4.5 μg/d). In experiments with irradiated mice, when the 4-day therapeutic regimen was applied on days 3 to 6 following irradiation with the dose of 4 Gy, analogical stimulation of granulopoiesis was observed in the recovery phase on days 14 and 18 after irradiation. As example, see Fig. 1 for counts of granulocyte cells in femoral bone marrow. (authors)

  10. Dispersal of normal and irradiated laboratory strains and wild strains of the olive fly Dacus oleae in an olive grove

    Fletcher, B.S.; Economopoulos, A.P.

    1976-01-01

    Studies on the dispersal rates of normal and γ-irradiated laboratory-reared as well as wild Dacus oleae (Gmelin) were carried out in an olive grove using protein-baited McPhail traps. No differences were found in the dispersal rates of normal and irradiated laboratory-cultured flies or between males and females. The mean distance travelled by the surviving flies up to 2 weeks after release was 180-190 m, and by that time only ca. 13% of the flies remained alive in the grove. No laboratory-reared flies were trapped outside the olive grove. The limited amount of data obtained with wild flies suggested that they may disperse over greater distances than laboratory-reared flies

  11. Evaluation of directional normalization methods for Landsat TM/ETM+ over primary Amazonian lowland forests

    Van doninck, Jasper; Tuomisto, Hanna

    2017-06-01

    Biodiversity mapping in extensive tropical forest areas poses a major challenge for the interpretation of Landsat images, because floristically clearly distinct forest types may show little difference in reflectance. In such cases, the effects of the bidirectional reflection distribution function (BRDF) can be sufficiently strong to cause erroneous image interpretation and classification. Since the opening of the Landsat archive in 2008, several BRDF normalization methods for Landsat have been developed. The simplest of these consist of an empirical view angle normalization, whereas more complex approaches apply the semi-empirical Ross-Li BRDF model and the MODIS MCD43-series of products to normalize directional Landsat reflectance to standard view and solar angles. Here we quantify the effect of surface anisotropy on Landsat TM/ETM+ images over old-growth Amazonian forests, and evaluate five angular normalization approaches. Even for the narrow swath of the Landsat sensors, we observed directional effects in all spectral bands. Those normalization methods that are based on removing the surface reflectance gradient as observed in each image were adequate to normalize TM/ETM+ imagery to nadir viewing, but were less suitable for multitemporal analysis when the solar vector varied strongly among images. Approaches based on the MODIS BRDF model parameters successfully reduced directional effects in the visible bands, but removed only half of the systematic errors in the infrared bands. The best results were obtained when the semi-empirical BRDF model was calibrated using pairs of Landsat observation. This method produces a single set of BRDF parameters, which can then be used to operationally normalize Landsat TM/ETM+ imagery over Amazonian forests to nadir viewing and a standard solar configuration.

  12. Direct measurement technique for shock wave velocity with irradiation drive

    Wang Feng; Peng Xiaoshi; Liu Shenye; Jiang Xiaohua; Ding Yongkun

    2011-01-01

    According to the ionization mechanism of transparent material under super high pressure, the direct diagnosis method of shock wave has been analyzed. With the Drude free electron model, the reflectivity difference of shock wave front under different pressures was analyzed. The blank effect in the detector was studied, which is caused by the X-ray ionization of transparent material, after analyzing the reflectivity data in space-time scale. The experiment shows that the beginning point and duration of blank effect are consistent with the start point and duration of laser pulse, respectively. And the reflectivity of shock wave front is about 35% when the shock velocity is 32 km/s. The reason and solution for blank effect was presented. The formula to calculate the shock wave velocity in transparent material was also deduced and verified. (authors)

  13. Direct digital control of furnaces irradiated in nuclear reactors

    Joumard, R.

    1969-01-01

    An experimental direct digital control system has been realised in the 'C.E.N.G.', in order to verify that a computer makes easier the control of the experiments done in the nuclear reactors and to solve the theoretical and technical difficulties. The regulation is applied to thermal processes. The sampled data systems theory permits to choose the type of an efficient and simple digital compensator, and to establish a diagram which gives the values of the correcting parameters (obtained by minimizing the difference between the output and the input when perturbations occur). The programme execute, in simultaneity, supervision and regulation. Complex possibilities of printing out measures and alarms existed. The computer works out an incremental correction which makes step motors to turn. These motors act on the heating organs. The theoretical values and answers have been confirmed. The accuracy was limited essentially by the input quantification (1/1000 th). The comfort of such a system has been noticeable. (author) [fr

  14. Design practice and operational experience of highly irradiated, high-performance normal magnets

    Schultz, J.H.

    1982-09-01

    The limitations of high performance magnets are discussed in terms of mechanical, temperature, and electrical limits. The limitations of magnets that are highly irradiated by neutrons, gamma radiation, or x radiation are discussed

  15. Effect Of Extensive Use Of Garlic In Feed On Normal And Irradiated Stressed Male Rats

    KASSAB, F.M.A.; ABDEL-KHALEK, L.G.; KAMAL, A.M.

    2009-01-01

    Fifty mature male albino rats were used in the present study to evaluate the effect of using crude garlic for one month on general heath condition and to compare between garlic intakes pre and post-irradiated stressed rats.Fresh minced cloves (8-10) of garlic were added to the rat diet twice per day for 30 days in garlic group and for 7 and 15 days prior to and after 4 Gy irradiation in pre and post-irradiated garlic groups, respectively. The results denoted that the extensive use of garlic in food improved the general condition in non-stressed rats while in irradiated stressed rats, the immediate intake of garlic after radiation was more efficient in ameliorating the undesirable radiation effects, where some biochemical and hematological parameters were examined in pre and post-garlic intake such as Hb, RBCs, platelets, T 3 , testosterone and insulin.

  16. Blood biochemical changes in lambs infected with normal and gamma irradiated third stage larvae of Dictyocaulus filaria

    Bhat, T.K.; Dhar, D.N.; Bansal, G.C.; Sharma, R.L. (Indian Veterinary Research Inst., Srinagar (India). Regional Centre)

    1984-09-01

    Primary infections with normal third stage larvae of Dictyocaulus filaria at a dose of 150 1/kg caused significant decrease in the levels of haemoglobin, blood glucose, serum total proteins, serum albumin, albumin/globulin ratio and increase in levels of total globulins and lactate dehydrogenase (LDH) activity in lambs. Almost similar changes in the above blood constituents excepting for haemoglobin, blood glucose and LDH activity were noticed in lambs immunised with two doses of gamma irradiation larvae and subsequently challenged with normal larvae of D. filaria at a dose of 150 1/kg. In both the infected groups, serum calcium, inorganic phosphorus, malate dehydrogenase and alkaline phosphatase activities were, however, not affected.

  17. The inhibition of DNA repair by aphidicolin or cytosine arabinoside in X-irradiated normal and xeroderma pigmentosum fibroblasts

    Waters, R.; Crocombe, K.; Mirzayans, R.

    1981-01-01

    Normal and excision-deficient xeroderma pigmentosum fibroblasts were X-irradiated and the influence on DNA repair of either the repair inhibitor cytosine arabinoside or the specific inhibitor of DNA polymerase α, aphidicolin, investigated. The data indicated that the repair of a certain fraction of X-ray-induced lesions can be inhibited in both cell lines by both compounds. Thus, as aphidicolin blocks the operation of polymerase α, this enzyme must be involved in an excision repair pathway operating in both normal and excision-deficient xeroderma pigmentosum cells. (orig.)

  18. Changes in regional blood flow of normal and tumor tissues following hyperthermia and combined X-ray irradiation

    Suga, Kazuyoshi

    1986-01-01

    Hyperthermia and X-ray irradiation were given to Ehrlich tumors, which were induced in the ventrum of the right hind foot of ICR mice, and to the normal tissues. Their effects on regional blood flow were examined using Xe-133 local clearance method. Blood flow of the normal tissues remained unchanged by heating at 41 deg C for 30 minutes, and increased by heating at 43 deg C and 45 deg C for 30 minutes. On the contrary, blood flow of the tumors decreased with an increase in temperature. When hypertermia (43 deg C for 30 minutes) was combined with irradiation of 30 Gy, decrease in blood flow of the tumors was greater than the normal tissues at 24 hours. Blood flow of the tumors depended on tumor size. The decreased amount of blood flow by hyperthermia was more for tumors > 250 mm 3 than tumors 3 . Blood flow ratios of tumor to normal tissues were also smaller in tumors > 250 mm 3 than tumors 3 . In the case of tumors 3 , blood flow tended to return to normal at 3 hr after heating at 43 deg C for 30 min. However, this was not seen in tumors > 250 mm 3 . (Namekawa, K.)

  19. Measuring Broadband IR Irradiance in the Direct Solar Beam and Recent Developments

    Reda, Ibrahim; Andreas, Afshin; Dooraghi, Mike; Habte, Aron; Sengupta, Manajit; Kutchenreiter, Mark

    2016-12-14

    Solar and atmospheric science radiometers such as pyranometers, pyrheliometers, and photovoltaic cells are calibrated with traceability to a consensus reference which is maintained by Absolute Cavity Radiometers (ACRs). An ACR is an open cavity with no window, developed to measure the extended broadband spectrum of the terrestrial direct solar beam irradiance that extends beyond the ultraviolet and infrared bands; i.e. below 0.2 um and above 50 um, respectively. On the other hand, the pyranometers and pyrheliometers were developed to measure broadband shortwave irradiance from approximately 0.3 um to 3 um, while the present photovoltaic cells are limited to the spectral range of approximately 0.3 um to 1 um. The broadband mismatch of ACR versus such radiometers causes discrepancy in radiometers' calibration methods that has not been discussed or addressed in the solar and atmospheric science literature. Pyrgeometers, which measure the atmospheric longwave irradiance, are also used for solar and atmospheric science applications and calibrated with traceability to a consensus reference, yet they are calibrated during nighttime only, because no consensus reference has been established for the daytime longwave irradiance. This poster describes a method to measure the broadband longwave irradiance in the terrestrial direct solar beam from 3 um to 50 um, as a first step that might be used to help develop calibration methods to address the mismatch between broadband ACR and shortwave radiometers, and the lack of a daytime reference for pyrgeometers. The described method is used to measure the irradiance from sunrise to sunset; the irradiance varied from approximately 1 Wm-2 to 16 Wm-2 with an estimated uncertainty of 1.5 Wm-2, for a solar zenith angle range from 80 degrees to 16 degrees, respectively. Recent development shows that there is greater than 1.1 percent bias in measuring shortwave solar irradiance.

  20. Illumination normalization of face image based on illuminant direction estimation and improved Retinex.

    Yi, Jizheng; Mao, Xia; Chen, Lijiang; Xue, Yuli; Rovetta, Alberto; Caleanu, Catalin-Daniel

    2015-01-01

    Illumination normalization of face image for face recognition and facial expression recognition is one of the most frequent and difficult problems in image processing. In order to obtain a face image with normal illumination, our method firstly divides the input face image into sixteen local regions and calculates the edge level percentage in each of them. Secondly, three local regions, which meet the requirements of lower complexity and larger average gray value, are selected to calculate the final illuminant direction according to the error function between the measured intensity and the calculated intensity, and the constraint function for an infinite light source model. After knowing the final illuminant direction of the input face image, the Retinex algorithm is improved from two aspects: (1) we optimize the surround function; (2) we intercept the values in both ends of histogram of face image, determine the range of gray levels, and stretch the range of gray levels into the dynamic range of display device. Finally, we achieve illumination normalization and get the final face image. Unlike previous illumination normalization approaches, the method proposed in this paper does not require any training step or any knowledge of 3D face and reflective surface model. The experimental results using extended Yale face database B and CMU-PIE show that our method achieves better normalization effect comparing with the existing techniques.

  1. Illumination normalization of face image based on illuminant direction estimation and improved Retinex.

    Jizheng Yi

    Full Text Available Illumination normalization of face image for face recognition and facial expression recognition is one of the most frequent and difficult problems in image processing. In order to obtain a face image with normal illumination, our method firstly divides the input face image into sixteen local regions and calculates the edge level percentage in each of them. Secondly, three local regions, which meet the requirements of lower complexity and larger average gray value, are selected to calculate the final illuminant direction according to the error function between the measured intensity and the calculated intensity, and the constraint function for an infinite light source model. After knowing the final illuminant direction of the input face image, the Retinex algorithm is improved from two aspects: (1 we optimize the surround function; (2 we intercept the values in both ends of histogram of face image, determine the range of gray levels, and stretch the range of gray levels into the dynamic range of display device. Finally, we achieve illumination normalization and get the final face image. Unlike previous illumination normalization approaches, the method proposed in this paper does not require any training step or any knowledge of 3D face and reflective surface model. The experimental results using extended Yale face database B and CMU-PIE show that our method achieves better normalization effect comparing with the existing techniques.

  2. Verification of ECMWF and ECMWF/MACC's global and direct irradiance forecasts with respect to solar electricity production forecasts

    M. Schroedter-Homscheidt

    2017-02-01

    Full Text Available The successful electricity grid integration of solar energy into day-ahead markets requires at least hourly resolved 48 h forecasts. Technologies as photovoltaics and non-concentrating solar thermal technologies make use of global horizontal irradiance (GHI forecasts, while all concentrating technologies both from the photovoltaic and the thermal sector require direct normal irradiances (DNI. The European Centre for Medium-Range Weather Forecasts (ECMWF has recently changed towards providing direct as well as global irradiances. Additionally, the MACC (Monitoring Atmospheric Composition & Climate near-real time services provide daily analysis and forecasts of aerosol properties in preparation of the upcoming European Copernicus programme. The operational ECMWF/IFS (Integrated Forecast System forecast system will in the medium term profit from the Copernicus service aerosol forecasts. Therefore, within the MACC‑II project specific experiment runs were performed allowing for the assessment of the performance gain of these potential future capabilities. Also the potential impact of providing forecasts with hourly output resolution compared to three-hourly resolved forecasts is investigated. The inclusion of the new aerosol climatology in October 2003 improved both the GHI and DNI forecasts remarkably, while the change towards a new radiation scheme in 2007 only had minor and partly even unfavourable impacts on the performance indicators. For GHI, larger RMSE (root mean square error values are found for broken/overcast conditions than for scattered cloud fields. For DNI, the findings are opposite with larger RMSE values for scattered clouds compared to overcast/broken cloud situations. The introduction of direct irradiances as an output parameter in the operational IFS version has not resulted in a general performance improvement with respect to biases and RMSE compared to the widely used Skartveit et al. (1998 global to direct irradiance

  3. Directional and Spectral Irradiance in Ocean Models: Effects on Simulated Global Phytoplankton, Nutrients, and Primary Production

    Gregg, Watson W.; Rousseaux, Cecile S.

    2016-01-01

    The importance of including directional and spectral light in simulations of ocean radiative transfer was investigated using a coupled biogeochemical-circulation-radiative model of the global oceans. The effort focused on phytoplankton abundances, nutrient concentrations and vertically-integrated net primary production. The importance was approached by sequentially removing directional (i.e., direct vs. diffuse) and spectral irradiance and comparing results of the above variables to a fully directionally and spectrally-resolved model. In each case the total irradiance was kept constant; it was only the pathways and spectral nature that were changed. Assuming all irradiance was diffuse had negligible effect on global ocean primary production. Global nitrate and total chlorophyll concentrations declined by about 20% each. The largest changes occurred in the tropics and sub-tropics rather than the high latitudes, where most of the irradiance is already diffuse. Disregarding spectral irradiance had effects that depended upon the choice of attenuation wavelength. The wavelength closest to the spectrally-resolved model, 500 nm, produced lower nitrate (19%) and chlorophyll (8%) and higher primary production (2%) than the spectral model. Phytoplankton relative abundances were very sensitive to the choice of non-spectral wavelength transmittance. The combined effects of neglecting both directional and spectral irradiance exacerbated the differences, despite using attenuation at 500 nm. Global nitrate decreased 33% and chlorophyll decreased 24%. Changes in phytoplankton community structure were considerable, representing a change from chlorophytes to cyanobacteria and coccolithophores. This suggested a shift in community function, from light-limitation to nutrient limitation: lower demands for nutrients from cyanobacteria and coccolithophores favored them over the more nutrient-demanding chlorophytes. Although diatoms have the highest nutrient demands in the model, their

  4. A branching process model for the analysis of abortive colony size distributions in carbon ion-irradiated normal human fibroblasts

    Sakashita, Tetsuya; Kobayashi, Yasuhiko; Hamada, Nobuyuki; Kawaguchi, Isao; Hara, Takamitsu; Saito, Kimiaki

    2014-01-01

    A single cell can form a colony, and ionizing irradiation has long been known to reduce such a cellular clonogenic potential. Analysis of abortive colonies unable to continue to grow should provide important information on the reproductive cell death (RCD) following irradiation. Our previous analysis with a branching process model showed that the RCD in normal human fibroblasts can persist over 16 generations following irradiation with low linear energy transfer (LET) γ-rays. Here we further set out to evaluate the RCD persistency in abortive colonies arising from normal human fibroblasts exposed to high-LET carbon ions (18.3 MeV/u, 108 keV/μm). We found that the abortive colony size distribution determined by biological experiments follows a linear relationship on the log–log plot, and that the Monte Carlo simulation using the RCD probability estimated from such a linear relationship well simulates the experimentally determined surviving fraction and the relative biological effectiveness (RBE). We identified the short-term phase and long-term phase for the persistent RCD following carbon-ion irradiation, which were similar to those previously identified following γ-irradiation. Taken together, our results suggest that subsequent secondary or tertiary colony formation would be invaluable for understanding the long-lasting RCD. All together, our framework for analysis with a branching process model and a colony formation assay is applicable to determination of cellular responses to low- and high-LET radiation, and suggests that the long-lasting RCD is a pivotal determinant of the surviving fraction and the RBE. (author)

  5. Quantification of 5-hydroxytryptamine1A receptors in the cerebellum of normal and x-irradiated rats during postnatal development

    Matthiessen, L.; Daval, G.; Bailly, Y.; Gozlan, H.; Hamon, M.; Verge, D.

    1992-01-01

    5-Hydroxytryptamine 1A receptors were studied in rats during the first postnatal month in the normal cerebellum and in the granule cell-deprived cerebellum produced by X-irradiation at postnatal day 5. Quantitative autoradiographic studies on sagittal sections of cerebellar vermis, using [ 125 1]BH-8-MeO-N-PAT as radioligand or specific anti-receptor antibodies, revealed that 5-hydroxytryptamine 1A receptors existed in the molecular/Purkinje cell layer but at variable density from one lobule to another. Thus, in both normal and X-irradiated rats, the posterior lobules were more heavily labelled than the anterior ones, and the density of 5-hydroxytryptamine 1A sites decreased progressively in all the cerebellar folia down to hardly detectable levels at postnatal day 21. However, the intensity of labelling remained higher at postnatal day 8 and postnatal day 12 in X-irradiated rats than in age-paired controls. Measurements of [ 3 H]8-OH-DPAT [8-hydroxy-2-(di-n-propylamino)tetralin] specific binding to membranes from whole cerebellum confirmed that the density of 5-hydroxytryptamine 1A sites per mg membrane protein (B max ) was higher in X-irradiated animals than in age-paired controls. However, on a ''per cerebellum'' basis, no significant difference could be detected between the total number of 5-hydroxytryptamine 1A sites, which progressively increased in both control and X-irradiated animals during the first postnatal month. These results therefore show that 5-hydroxytryptamine 1A receptors are not located on developing granule cells. (author)

  6. Ultrastructural changes following electron irradiation in three-dimensional culture of normal human dermal fibroblasts

    Han, Chunmao; Ishikura, Naotaka; Tsukada, Sadao

    1994-01-01

    The present study was designed to examine the effect of electron irradiation on fibroblasts and extracellular matrices electron-microscopically. The three-dimensional dermal fibroblast culture was exposed to one, 4 or 10 Gy of electron beams. One day after irradiation, fibroblasts were vacuolated in all irradiated groups and intercellular spaces were increased in a dose-dependent manner. Seven days later, intercellular spaces became dense in both one and 4 Gy groups, although they were still extremely increased in the 10 Gy group. The remaining fibroblasts were still activated in all groups. Thirty days after irradiation, myofibroblastic cells were scarcely observed, but extracellular fine fibrils and collagen fibrils were observed in all irradiated groups. The other ultrastructural findings were similar to those in the control group. In conclusion, electron beams damaged not only cells but also extracellular matrix. The extracellular matrix may be repaired by activated residual fibroblasts, resulting in the mixture of new and old collagen fibrils having different diamters. (N.K.)

  7. Irradiation of pre-packaged sliced cooked meat products with low and normal sodium content

    Stekelenburg, F.K.

    1990-01-01

    Irradiation experiments were carried out with pre-packaged sliced cooked meat products with different initial counts of Enterobacteriaceae and mesophilic aerobic bacteria. In low-sodium meat products Enterobacteriaceae could effectively be inactivated in refrigerated or frozen products by irradiation with a dose of 1 or 2 kGy respectively, provided the number of these bacteria was below 10(3) to 10(4) per g. The low-sodium meat products involved endured above treatment without being seriously affected as to sensory qualities. Shelf-life of salted cooked meat products could be prolonged by irradiating the frozen product. Irradiation with a dose of 2 kGy enabled uncooled storage of the product for a restricted period (5-7 days). Best results were obtained for meat products with a salt content in the brine phase of greater than 4.0% (w/w) and having a good hygienic quality, i.e. an initial bacterial count below 10(4)/g. Packaging in a gas atmosphere (CO2) slightly enhanced protection as compared to vacuum packaging. Off-flavours as a result of irradiation of salted cooked meat products varied from slight to strong and depended on the type of product

  8. The Elemental Composition of Normal and Irradiated Rice Moth Corcyra Cephalonica (Staint) (Lepidoptera-Pyralidae)

    Abassy, S.A.

    2012-01-01

    The objective of this study was to determine the variation induced in the elemental composition of the total body tissue of corcyra cephalonica Adult males and females wear irradiated as adult with 50,150 and 250 Gy or as, 5 days old egg with 25 Gy and 5 days old pupae with 50 Gy .The result obtained showed that phosphorus was the highest concentrated element in males but in case of female, potassium was the most abundant element. We notice that the arrangement of the ten elements was changed as a result of irradiation. In general, there was a slight difference in elemental composition between sexes in irradiated adults and immature stages. The effect of gamma irradiation was extended from 5 days old eggs to adults. The results indicated that adults emerged from irradiated 5 days old eggs were more sensitive than older one. The difference was always dose dependent. Radiation dis infestations method could be used for the control of insects. It is safer than other means of control and, the minimal required dose does not cause undesirable changes

  9. Direct comparison between the angular distributions of the erythemal and eye-damaging UV irradiances: a pilot study.

    Schouten, P; Parisi, A V

    2011-02-07

    Several broadband ultraviolet (UV) radiation angular distribution investigations have been previously presented. As the biologically damaging effectiveness of UV radiation is known to be wavelength dependent, it is necessary to expand this research into the distribution of the spectral UV. UV radiation is also susceptible to Rayleigh and Mie scattering processes, both of which are completely wavelength dependent. Additionally, the majority of previous measurements detailing the biologically damaging effect of spectral UV radiation have been oriented with respect to the horizontal plane or in a plane directed towards the sun (sun-normal), with the irradiance weighted against action spectra formulated specifically for human skin and tissue. However, the human body consists of very few horizontal or sun-normal surfaces. Extending the previous research by measuring the distribution of the spectral irradiance across the sky for the complete terrestrial solar UV waveband and weighting it against erythemal, photoconjunctivital and photokeratital action spectra allowed for the analysis of the differences between the biologically effective irradiance (UV(BE)) values intercepted at different orientations and the effect of scattering processes upon the homogeneity of these UV(BE) distributions. It was established that under the local atmospheric environment, the distribution profile of the UV(BE) for each biological response was anisotropic, with the highest intensities generally intercepted at inclination angles situated between the horizontal and vertical planes along orientations closely coinciding with the sun-normal. A finding from this was that the angular distributions of the erythemal UV(BE) and the photoconjunctivital UV(BE) were different, due to the differential scattering between the shorter and longer UV wavelengths within the atmosphere. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. SU-F-T-150: Comparing Normal Tissue Irradiated Volumes for Proton Vs. Photon Treatment Plans On Lung Patients

    Liu, A; Mohan, R; Liao, Z [UT MD Anderson Cancer Center, Houston, TX (United States)

    2016-06-15

    Purpose: The aim of this work is to compare the “irradiated volume” (IRV) of normal tissues receiving 5, 20, 50, 80 and 90% or higher of the prescription dose with passively scattered proton therapy (PSPT) vs. IMRT of lung cancer patients. The overall goal of this research is to understand the factors affecting outcomes of a randomized PSPT vs. IMRT lung trial. Methods: Thirteen lung cancer patients, selected randomly, were analyzed. Each patient had PSPT and IMRT 74 Gy (RBE) plans meeting the same normal tissue constraints generated. IRVs were created for pairs of IMRT and PSPT plans on each patient. The volume of iGTV, (respiratory motion-incorporated GTV) was subtracted from each IRV to create normal tissue irradiated volume IRVNT. The average of IRVNT DVHs over all patients was also calculated for both modalities and inter-compared as were the selected dose-volume indices. Probability (p value) curves were calculated based on the Wilcoxon matched-paired signed-rank test to determine the dose regions where the statistically significant differences existed. Results: As expected, the average 5, 20 and 50% IRVNT’s for PSPT was found to be significantly smaller than for IMRT (p < 0.001, 0.01, and 0.001 respectively). However, the average 90% IRVNT for PSPT was greater than for IMRT (p = 0.003) presumably due to larger penumbra of protons and the long range of protons in lower density media. The 80% IRVNT for PSPT was also larger but not statistically distinguishable (p = .224). Conclusion: PSPT modality has smaller irradiated volume at lower doses, but larger volume at high doses. A larger cohort of lung patients will be analyzed in the future and IRVNT of patients treated with PSPT and IMRT will be compared to determine if the irradiated volumes (the magnitude of “dose bath”) correlate with outcomes.

  11. Histologic alterations of the normal bladder wall following to variably fractionated irradiation - an experimentation on animals

    Fueller, J.; Fritzsche, V.; Kob, D.; Arndt, J.; Kriester, A.; Friedrich-Schiller-Universitaet, Jena

    1986-01-01

    The histopathologic alterations of the bladder wall were investigated in 180 rabbits irradiated with different fractionations and total focal doses. Animals sacrified one week after the end of irradiation showed alterations of the urothelium (desquamation, increased polymorphism of nuclei vacuolizations) as well as oedematous and hyperemic reactions in submucosa and muscularis. These alterations became stronger when the single and total focal dose and the ret values were increased. Animals sacrified three to six months after the end of irradiation showed dystrophic-sclerotic processes as well as vascular obliterations in the submucosa and muscularis. The alterations were only clearly visible in case of a total focal dose of at least 30 Gy. With regard to a minimization of histopathologic alterations of the bladder wall, a fractionation of 1.5 Gy per day has to be considered as favorable in radiotherapy of the carcinoma of the urinary bladder. (orig.) [de

  12. Histopathological changes in the irradiated normal organs of guinea pigs with conventional fractionation and hyperfractionation

    Inomata, Taisuke; Itoh, Satoshi; Tsuboi, Nobuaki

    1998-01-01

    Guinea pigs were divided into groups according to four irradiation schedules : 2 Gy/3 Gy x 1/day, five fractions/week, total 80 Gy/81 Gy (A/C group) and 1.0 Gy/1.5 Gy x 2/day, ten fractions/week, total 80 Gy/81 Gy (B/D group). The A group and the C group pathologically caused severe damage in the kidney six and three months after irradiation, respectively. In the B group pathological analysis suggested that only slight-to-moderate changes were occurred in the Bowman's capsule. The D group caused slight damage in the kidney six months after irradiation. Hyperfractionation (B/D group) used in this protocol can clearly reduce radiation damage in the kidney of guinea pigs as compared with conventional fractionation (A/C group). (author)

  13. Effect of x-irradiation in rats bearing walker-256-carcinosarcoma and normal rats

    Ehara, Kazuhiko

    1978-01-01

    Serum protein fractions and total proteins were studied with bloods obtained from the rats exposed each to the partial-, whole-bodies and the transplanted tumors (Walker-256-carcinosarcoma transplanted in the right hind leg). The electrophoretic variation induced in the sera of tumor-bearing rats (Group II), and the content of total proteins decreased. Early irradiation to the tumor part of rats less induced the variations of the electrophoretic pattern and the decrease of the amount of serum total proteins. When the distant metastasis appeared during irradiation treatment, the electrophoretic patterns and content of total proteins changed proportionally to the variation in sera of Group II. On the other hand, the γ-globulin (G) fraction increased in the long-term survival rat. The separation of the rat serum β-G into two peaks of β 1 - and β 2 -G was shown only in Group IV (late irradiation to the right hind leg). This finding supposed that some factors involve in the sera of rats with transplanted primary tumor grown up to a fixed size and guessed the appearance of the distant metastasis during x-irradiation. The percentages of the albumin and γ-G decreased slightly and those of the α 1 -, α 2 - and β-G increased slightly in the rats with 300 rad partial-body (the right hind leg) x-irradiation daily for 20 days. The remarkable decrease of the albumin and γ-G, the increase of the α 1 - and β-G, the marked increase of the α 2 -G and the decrease of serum total proteins were demonstrated for the sera of rats with 1,000 rad whole-body x-irradiation at a time. These phenomena seem to be related to the destructive and reticuloendothelial injury by the exposure. (auth.)

  14. Study on electric parameters of wild and cultivated cotton forms being in normal state and irradiated

    Nazirov, N.N.; Kamalov, N.; Norbaev, N.

    1978-01-01

    The radiation effect on electric conductivity of tissues in case of alternating current, electrical capacity and cell impedance has been studied. Gamma irradiation of seedlings results in definite changes of electric factors of cells (electric conductivity, electric capacity, impedance). It is shown that especially strong changes have been revealed during gamma irradiation of radiosensitive wild form of cotton plants. The deviation of cell electric factors from the standard depends on the violation of evolutionally composed ion heterogeneity and cell colloid system state, which results in changes in their structure and metabolism in them

  15. Controlled austempering of hammer forgings aimed at pseudo normalized microstructure directly after deformation

    P. Skubisz

    2017-01-01

    Full Text Available The study concerns cost-effective realization of controlled thermomechanical processing (CTMP of medium-carbon and HSLA steel aimed at producing microstructure and properties equivalent to normalized condition directly after forging. The results of theoretical and physical modeling of hot forging with subsequent heat treating adopted for industrial realization in continuous manner were verified in semi-industrial conditions of a forge plant.

  16. A framework for analysis of abortive colony size distributions using a model of branching processes in irradiated normal human fibroblasts.

    Sakashita, Tetsuya; Hamada, Nobuyuki; Kawaguchi, Isao; Ouchi, Noriyuki B; Hara, Takamitsu; Kobayashi, Yasuhiko; Saito, Kimiaki

    2013-01-01

    Clonogenicity gives important information about the cellular reproductive potential following ionizing irradiation, but an abortive colony that fails to continue to grow remains poorly characterized. It was recently reported that the fraction of abortive colonies increases with increasing dose. Thus, we set out to investigate the production kinetics of abortive colonies using a model of branching processes. We firstly plotted the experimentally determined colony size distribution of abortive colonies in irradiated normal human fibroblasts, and found the linear relationship on the log-linear or log-log plot. By applying the simple model of branching processes to the linear relationship, we found the persistent reproductive cell death (RCD) over several generations following irradiation. To verify the estimated probability of RCD, abortive colony size distribution (≤ 15 cells) and the surviving fraction were simulated by the Monte Carlo computational approach for colony expansion. Parameters estimated from the log-log fit demonstrated the good performance in both simulations than those from the log-linear fit. Radiation-induced RCD, i.e. excess probability, lasted over 16 generations and mainly consisted of two components in the early (probability over 5 generations, whereas abortive colony size distribution was robust against it. These results suggest that, whereas short-term RCD is critical to the abortive colony size distribution, long-lasting RCD is important for the dose response of the surviving fraction. Our present model provides a single framework for understanding the behavior of primary cell colonies in culture following irradiation.

  17. Calculating spectral direct solar irradiance, diffuse and global in Heredia, Costa Rica

    Wright, Jaime

    2008-01-01

    A spectral model under conditions of clear skies has described the flow of solar irradiation and is verified experimentally in Heredia, Costa Rica. A description of the model is presented by comparing its results with experimental measurements. The model has calculated the spectral flows of the global solar irradiation, direct and diffuse incident on a horizontal surface. Necessary input data include latitude, altitude, surface albedo as characteristics of a locality, and atmospheric characteristics: turbidity, precipitable water vapor, total ozone content and the optical thickness of a particular subject. The results show satisfactory values. (author) [es

  18. Induction of carcinomas in rat glandular stomach by direct X-irradiation of the stomach wall

    Kondratenko, A.G.; Bykorez, A.I.

    1980-01-01

    To induce carcinoma in rat stomach the direct irradiation of the organ wall with X-rays in a dose of 16.22 Gy has been used. In the period from the 8-th to the 15-th month after irradiation in mucous membrane of stomach foci of atrophy, sections of regenerating hyperplasia of glands and methaplasia of stomach gland cells in the epithelium of the intestine type have been observed. Highly differentiated adenocarcinomas growing through all the walls of stomach are found in 18.5% rats [ru

  19. Determination of haemolymph volume of irradiated and normal males and females of Tenebrio molitor L. (Coleoptera, Tenebrionidae)

    Ahmed, M.Y.Y.; Kloft, W.J.

    1985-01-01

    The haemolymph volume of Tenebrio molitor L. adults was determined by a radioisotope dilution technique. Two myl (14)C-inulin were injected into the haemolymph with a micro-syringe. After sufficient time for through mixing, the labelled haemolymph was collected individually under separation of sexes. Total haemolymph was calculated by a conventional formula for radioisotope dilution. The mean haemolymph volume of normal newly emerged males was 61.1+-14.2 myl and remained constant between day 2 (61.2 +-2.1) and day 3 (55.6+-9.2) after emergence. In comparison newly emerged females had a volume of 53.5+-2.3 myl which increased to 69.4+-11.7 myl day 2 resp. 64.0+-16.7 myl by day 3. The haemolymph volume of X-irradiated (5000 R) males remains almost constant. However in case of irradiated females the haemolymph volume also remains constant in contrast to unirradiated individuals

  20. Blood leukocyte responses to extracorporeal circulation. 3. Long term extracorporeal circulation without and with irradiation in normal and splenectomized dogs

    Szemere, P.; Fliedner, T.M. (Ulm Univ. (Germany, F.R.). Abt. Klinische Physiologie)

    1983-01-01

    Long term (12-48 h) extracorporeal circulation without and with irradiation of the blood was performed in normal and splenectomized dogs in order to observe the effect of these procedures on blood leukocyte counts including CFU-C. A transient granulocytopenia and a decrease of lymphocyte count were observed. The blood CFU-C level diminished to a very low level and remained low for the whole time of the experiments. There was no significant difference between the results of procedures with or without irradiation. The similar effect of a shortened tubing system on the blood leukocyte count is also reported. Heparin infusion alone did not decrease the peripheral CFU-C concentration. The possible explanations for the observed phenomena are discussed.

  1. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  2. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  3. Effects of irradiation on the copper normal metal of a composite superconductor

    Williams, J.M.; Klabunde, C.E.; Redman, J.K.; Coltman, R.R. Jr.; Chaplin, R.L.

    1978-01-01

    This report presents a new body of magnetoresistance data for copper that were obtained in neutron irradiation experiments at 4K and 330K. These data are combined with previously obtained results on initial damage rates and saturation effects to yield a projection of total resistivity vs neutron dose (expressed in displacements per atom) for copper in service at < 10 K in a magnetic field

  4. Effects of ultraviolet irradiation on the cell cycle in normal and UV-sensitive cell lines with reference to the nature of the defect in xeroderma pigmentosum variant

    Imray, P.; Mangan, T.; Saul, A.; Kidson, C.

    1983-01-01

    Analysis of the distribution of cells through the phases of the cell cycle by DNA flow cytofluorimetry has been utilized to investigate the effects of ultraviolet (UV) irradiation on cell-cycle progression in normal and UV-sensitive lymphoblastoid cell lines. In time-course studies only slight perturbation of DNA distribution was seen in normal cells, or UV-sensitive familial melanoma (FM) lines in the 48 h following irradiation. Xeroderma pigmentosum (XPA) excision-deficient cells showed a large increase in the proportion of cells in S phase 16-40 h post-irradiation. XP variant (XPV) cells were blocked in G 1 and S phases with the complete absence of cells with G 2 DNA content 16-28 h after irradiation. By 48 h post-irradiation the DNA distribution of XPA and XPV cells had returned to that of an unirradiated control. When colcemid was added to the cultures immediately after irradiation to prevent mitotic cells dividing and re-entering the cell cycle, progression through the first cycle after irradiation was followed. UV irradiation did not affect the rate of movement of cells out of G 1 into S phase in normal, FM or XPA cells. The proportion of cells in S phase was increased in UV-irradiated cultures in these cell types and the number of cells entering the G 2 +M compartment was reduced. (orig./AJ)

  5. Lethality and the depression on DNA synthesis in UV-irradiated normal human and xeroderma pigmentosum cells

    Shinohara, K. (Kobe Univ. (Japan). School of Medicine)

    1983-12-01

    Ultraviolet radiation suppresses the semiconservative DNA replication in mammalian cells. The rate of DNA synthesis is initially depressed and later recovers after low doses of UV radiation in human cells. Such a response is more sensitive to UV radiation in cells derived from patients with xeroderma pigmentosum (XP) than that in normal human cells. The relative rate of DNA synthesis is not always correlated with cell survival because, unlike cell survival, the dose-response curve of the relative rate of DNA synthesis shows the biphasic nature of the sensitivity. In the experiments reported herein, the total amount (not the rate) of DNA synthesized during a long interval of incubation which covers the period of inhibition and recovery (but not longer than one generation time) after irradiation with various doses of UV radiation was examined in normal human and XP cells, and was found to be well correlated with cell survival in all the cells tested.

  6. Estimating functional liver reserve following hepatic irradiation: Adaptive normal tissue response models

    Stenmark, Matthew H.; Cao, Yue; Wang, Hesheng; Jackson, Andrew; Ben-Josef, Edgar; Ten Haken, Randall K.; Lawrence, Theodore S.; Feng, Mary

    2014-01-01

    Purpose: To estimate the limit of functional liver reserve for safe application of hepatic irradiation using changes in indocyanine green, an established assay of liver function. Materials and methods: From 2005 to 2011, 60 patients undergoing hepatic irradiation were enrolled in a prospective study assessing the plasma retention fraction of indocyanine green at 15-min (ICG-R15) prior to, during (at 60% of planned dose), and after radiotherapy (RT). The limit of functional liver reserve was estimated from the damage fraction of functional liver (DFL) post-RT [1 − (ICG-R15 pre-RT /ICG-R15 post-RT )] where no toxicity was observed using a beta distribution function. Results: Of 48 evaluable patients, 3 (6%) developed RILD, all within 2.5 months of completing RT. The mean ICG-R15 for non-RILD patients pre-RT, during-RT and 1-month post-RT was 20.3%(SE 2.6), 22.0%(3.0), and 27.5%(2.8), and for RILD patients was 6.3%(4.3), 10.8%(2.7), and 47.6%(8.8). RILD was observed at post-RT damage fractions of ⩾78%. Both DFL assessed by during-RT ICG and MLD predicted for DFL post-RT (p < 0.0001). Limiting the post-RT DFL to 50%, predicted a 99% probability of a true complication rate <15%. Conclusion: The DFL as assessed by changes in ICG during treatment serves as an early indicator of a patient’s tolerance to hepatic irradiation

  7. Extraction and identification of cyclobutanones from irradiated cheese employing a rapid direct solvent extraction method.

    Tewfik, Ihab

    2008-01-01

    2-Alkylcyclobutanones (cyclobutanones) are accepted as chemical markers for irradiated foods containing lipid. However, current extraction procedures (Soxhlet-florisil chromatography) for the isolation of these markers involve a long and tedious clean-up regime prior to gas chromatography-mass spectrophotometry identification. This paper outlines an alternative isolation and clean-up method for the extraction of cyclobutanones in irradiated Camembert cheese. The newly developed direct solvent extraction method enables the efficient screening of large numbers of food samples and is not as resource intensive as the BS EN 1785:1997 method. Direct solvent extraction appears to be a simple, robust method and has the added advantage of a considerably shorter extraction time for the analysis of foods containing lipid.

  8. Effect of histones on hematopoietic stem cells-precursor in normal and irradiated organism

    Semina, O.V.; Semenets, T.N.; Zeppezauer, M.; Cebecauer, L.; Poverenny, A.M.

    1994-01-01

    Radiotherapeutic activity of histone fractions H 1 and H 2A /H 2B were studied. It was demonstrated that both fractions are able to reduce the damaging effect of ionizing radiation on spleen colony forming unit (CFU-S) population. Histone preparations stimulated colony-forming activity of bone marrow cells exposed to dose of 0.5-3.0 Gy both in the case of incubation with preparations and intravenous or intraperitoneal administration into recipients of irradiated cells. The effect of histones and accessory thymocytes on CFU-S population is compared

  9. Inheritance of fruit colour in normal and irradiated progenies of brinjal

    Gopimony, R.; George, M.K.; Gopinathan Nair, V.

    1980-01-01

    The inheritance of fruit colour in brinjal (Solanum melongena) was studied by analysing the progeny belonging to the F 1 M 2 , F 1 M 1 and F 2 M 2 generations resulting from a cross between varieties insanum and purple giant followed by gamma irradiation. The F 2 phenotypic frequencies fitted very well with the dihybrid ratio indicating that the fruit colour is governed by two independently inherited genes. Three colour mutants, namely, purple, mottled green and white were induced in the F 1 M 1 generation by the irradiation. The appearance of these mutants is explained as due to independent mutations at either or both of the two goenetic loci. The colour pattern in the F 2 M 2 progenies derived from the F 1 M 1 mutants substantiates the two gene mechanism for the inheritance of fruit colour. The genotypes for the different colour types in the F 1 , F 2 and F 1 M 1 mutants have been indicated and discussed. (author)

  10. The Neural Substrates for Letter String Readings in The Normal and Reverse Directions: An fMRI Study

    Ge, Sheng; Saito, Takashi; Wu, Jing-Long; Ogasawara, Jun-Ichi; Yamauchi, Shuichi; Matsunaga, Naofumi; Iramina, Keiji

    In order to investigate the difference in cortical activations between reading letter strings in the normal direction and the reverse direction, an fMRI study was conducted. In this study, the cortical activations elicited by Japanese letter string reading and Chinese letter string reading were investigated. The subjects performed the normal direction reading task (read letter strings from left to right), and the reverse direction reading task (read letter strings from right to left). According to the experimental results, the activated brain regions during the normal and the reverse direction reading tasks were compared. It was found that visuospatial transformation was involved in the reverse direction reading task, while this function was not significant during the normal direction reading task. Furthermore, we found that there was no significant difference in cortical activation between Japanese and Chinese letter string readings.

  11. Persistence of normal cardiac function and myocardial perfusion in irradiated long-term survivors of Hodgkin's disease

    Constine, L.S.; Schwartz, R.G.; Savage, D.E.; King, V.; Muhs, A.; Rubin, P.

    1996-01-01

    Purpose: The risk of myocardial infarction and cardiac dysfunction following mantle irradiation (RT) for Hodgkin's disease is controversial. The relative risk of fatal myocardial infarction is 2.8 in our Hodgkin's patients, similar to other reports. Sensitive evaluations of cardiac function and myocardial perfusion might be expected to reveal pre-clinical abnormalities of potential significance. We hypothesized the presence of pre-clinical cardiac toxicity and progressive deterioration of left ventricular performance and myocardial ischemia over time in long-term survivors of Hodgkin's disease. The data reported herein extend our previous study in patient number (n=50) and follow-up duration (mean 16.5 years). Materials and Methods: Equilibrium radionuclide angiocardiography (ERNA) was used to quantify left ventricular (LV) systolic and diastolic function with LV ejection fraction (LVEF) and peak filling rate (PFR), respectively. Quantitative myocardial perfusion scintigraphy (MPS) and ECG stress testing with exercise or dipyridamole were used to assess myocardial perfusion and electrical function. Patients at least 1.0 year after RT were eligible if ≤ 50 years old at RT and without known Hodgkin's or cardiac disease. Fifty patients, ages 10-46 years (mean 26.0) at RT, were tested 1.1 to 29.1 years (mean 9.1) after RT. Seventeen patients were tested 2 - 3 times separated by 0.5 - 6.5 years (mean 3.3). The mean central cardiac RT dose was 35.1 Gy (range 18.5 - 47.5) in daily 1.5-2.0 Gy fractions. Twelve patients were additionally irradiated to the left ventricle (LVRT), usually through partial transmission left lung shields (range 14.3-21.3 Gy). Results: No patient had symptomatic cardiac disease at the time of evaluation. The mean LVEF (first test, n = 50) was 60 ± 6% (range 42-73%) [normal ≥ 50%], and PFR (first test, n=44) was 3.43 ± 0.83 end diastolic volume per second (range 1.5-5.2 EDV/sec) [normal ≥ 2.54 EDV/sec] with 2 and 7 patients below normal

  12. Effect of gamma irradiation on membranes of normal and pathological erythrocytes (beta-thalassemia)

    Sportelli, L.; Bonincontro, A.; Cametti, C.; Consiglio Nazionale delle Ricerche, Rome

    1987-01-01

    The influence of ionizing radiation on the membrane of human normal erythrocytes has extensively been studied and a variety of effects including changes in the cation fluxes or in non-electrolytes permeability, in membrane fluidity, in peroxidation of unsaturated lipids as well as chemical composition or structural modifications has been observed. However, only few studies deal with the effects of ionizing radiation on pathological red blood cells. In this work, we have investigated by means of electron spin resonance (ESR) spectroscopy the effects of 60 Co γ-radiation on the normal and homozygous β-thalassemic human erythrocyte membranes. (orig.)

  13. The rate of DNA synthesis in normal human and ataxia telangiectasia cells after exposure to X-irradiation

    Wit, J. de; Bootsma, D.; Jaspers, N.G.J.; Rijksverdedigingsorganisatie TNO, Rijswijk

    1981-01-01

    The rate of DNA synthesis was studied in normal cell strains and in strains from patients suffering from the inherited disorder ataxia telangiectasia (AT). After exposure to relatively low doses of oxic X-rays (0- 4 krad) DNA synthesis was depressed in AT cell strains to a significantly lesser extent than in normal cells. This response was observed in both an excision-deficient and an excision-proficient strain. In contrast, there was no difference in DNA-synthesis inhibition between AT and normal cells after UV exposure. After X-irradiation of cells from patients with xeroderma pigmentosum, both complementation group A and XP variants, the observed rate of DNA synthesis was equal to that in normal cells. An exception was the strain XP3BR which has been shown to be X-ray-sensitive. This strain exhibited diminished DNA synthesis inhibition after X-ray doses below 1 krad. These data suggest a relationship between hypersensitivity to X-rays and diminished depression of DNA synthesis. (orig.)

  14. Normal state resistivity of single crystalline V3Si as a function of neutron irradiation

    Caton, R.; Viswanathan, R.

    1978-01-01

    Analysis of the normal state resistivity of a neutron damaged single crystal of V 3 Si shows two different regions of behavior: one for T/sub c/ equal to or greater than 10 0 K and another for T/sub c/ equal to or less than 10 0 K

  15. Pluripotent stem cells with normal or reduced self renewal survive lethal irradiation

    Brecher, G.; Neben, S.; Yee, M.; Bullis, J.; Cronkite, E.P.

    1988-01-01

    Transfusion with 10,000 or 20,000 marrow cells resulted in 30+ days survival of 15%-50% of mice exposed to an Ld90 or LD100 or radiation. The use of congenic mice with alloenzyme markers permitted the identification of host and donor cells in the peripheral blood of transfused animals. Donor cells were present initially in all hosts. Between 55% and 92% of the animals became 100% host type by 12-24 weeks after transfusion in three separate experiments. To explore whether the temporary repopulation by donor cells was due to short-lived stem cells, the marrows of several primary hosts were transfused into secondary, lethally irradiated hosts. Some of the retransplanted primary donor and host cells persisted only temporarily. It is suggested that some of the donor stem cells in both the primary and secondary hosts had an intrinsically shortened life span

  16. Iso-effect tables for tolerance of irradiated normal human tissues

    Cohen, L.; Creditor, M.

    1983-01-01

    Available literature on a radiation injury to human tissues (lung, brain, kidney and intestine) was surveyed. A parameter search program (RAD3) was used to derive best-fitting cell kinetic parameters, on the assumption that radiation injury arises from depletion of parenchymal cells in the irradiated organs. From these parameters iso-effect tables were constructed for a wide range of treatment schedules, including daily treatment as well as fractionation at longer intervals, for each tissue. The tables provide a set of limiting doses, above which the risk of radiation injury becomes substantial. Tolerance limits and dose-time-factors were substantially different in the four tissues. It is concluded that computed iso-effect tables provide a more reliable guide to treatment than conventional time-dose equations

  17. Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

    Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

    1988-01-01

    The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

  18. Dose rate effect of 125I irradiation on normal rabbit eyes and experimental choroidal melanoma

    Yang, C.M.; Olsen, K.R.; Schwade, J.G.; Houdek, P.V.; Markoe, A.M.; Pisciotta, V.; Xiaodong Wu

    1993-01-01

    The dose rate effect of radiation by 125 I plaque on choroidal melanoma and normal intraocular tissue was studied. In the first part of the experiment, high activity plaques (HAP) and low activity plagues (LAP) were implanted on rabbit eyes with experimental Greene choroidal melanoma to deliver a total dose of 10 000 cGy to the tumor apex. The mean dose rate calculated at 0.5 mm from the inner sclera in eight eyes with high activity plaques was 3341.5 cGy hr -1 while that in ten eyes with low activity plaques was 239.9 cGy hr -1 . For tumors less than 1.0 mm in height, both groups showed complete tumor regression at the tumor implantation site after plaque treatment. For tumours more than 1.0 mm in height, two out of two eyes in the low activity plaque group and one of four eyes in the high activity plaque group failed to show complete tumor regression. In the second part of the experiment, 125 I plaques were implanted on the sclera of 12 normal rabbits' eyes. Six received high dose rate plaque treatment, while the other six received low dose rate plaque treatment. Clinical and histologic examinations demonstrated more damaging effects to the normal chorioretinal tissues at the plaque implantation site in the high dose rate plaque group. These results suggest that high dose rate plaques are more effective than low dose rate plaques when tumor height is statistically controlled. (Author)

  19. Direct nanopatterning of polymer/silver nanoblocks under low energy electron beam irradiation.

    El Mel, Abdel-Aziz; Stephant, Nicolas; Gautier, Romain

    2016-10-06

    In this communication, we report on the growth, direct writing and nanopatterning of polymer/silver nanoblocks under low energy electron beam irradiation using a scanning electron microscope. The nanoblocks are produced by placing a droplet of an ethylene glycol solution containing silver nitrate and polyvinylpyrrolidone diluted in ethanol directly on a hot substrate heated up to 150 °C. Upon complete evaporation of the droplet, nanospheres, nano- and micro-triangles and nanoblocks made of silver-containing polymers, form over the substrate surface. Considering the nanoblocks as a model system, we demonstrate that such nanostructures are extremely sensitive to the e-beam extracted from the source of a scanning electron microscope operating at low acceleration voltages (between 5 and 7 kV). This sensitivity allows us to efficiently create various nanopatterns (e.g. arrays of holes, oblique slits and nanotrenches) in the material under e-beam irradiation. In addition to the possibility of writing, the nanoblocks revealed a self-healing ability allowing them to recover a relatively smooth surface after etching. Thanks to these properties, such nanomaterials can be used as a support for data writing and erasing on the nanoscale under low energy electron beam irradiation.

  20. Increased CD147 and MMP-9 expression in the normal rat brain after gamma irradiation

    Li Hong; Wei Ming; Li Shenghui; Zhou Ziwei; Xu Desheng

    2013-01-01

    Radiation-induced vascular injury is a major complication of Gamma knife surgery (GKS). Previous studies have shown that CD147 and MMP-9 are closely associated with vascular remodeling and pathological angiogenesis. Thus, we analysed changes in CD147 and MMP-9 expression in the cerebral cortex to investigate the correlation between CD147 and MMP-9 in the rat following GKS. Adult male Wistar rats were subjected to GKS at a maximum dose of 75 Gy and then euthanized 1 to 12 weeks later. Using immunohistochemistry and western blot analysis, we found that CD147 and MMP-9 expression were markedly upregulated in the target area 8-12 weeks after GKS when compared with the control group. Immunofluorescent double staining demonstrated that CD147 signals colocalized with CD31, GFAP and MMP-9-positive cells. Importantly, CD147 levels correlated with increased MMP-9 expression in irradiated brain tissue. For the first time, these data demonstrate a potential relationship between CD147 and MMP-9 following GKS. In addition, our study also suggests that CD147 and MMP-9 may play a role in vascular injury after GKS. (author)

  1. Physiological properties of afferents to the rat cerebellum during normal development and after postnatal x irradiation

    Puro, D.G.

    1975-01-01

    The consequences of an altered cerebellar cortical development on afferent transmission and terminal organization were analyzed in adult rats which had received x irradiation to the cerebellum postnatally. Rats, anesthetized with 0.5 percent halothane, were studied in various ages from day 3 to adult. The ascending mossy and climbing fiber systems were activated by electrical stimulation of the limbs with needle electrodes. Stimulation of the motor cortex activated the descending climbing fiber pathways. Extracellular responses from cerebellar Purkinje cells were observed on an oscilloscope as poststimulus time histograms were constructed ''on-line''. Conclusions and assertions include: (1) Synaptogenesis between incoming afferent fibers and target neurons takes place early in cerebellar cortical development. (2) Mossy fiber transmission is mature before the bulk of cerebellar synaptogenesis occurs. (3) The ascending and descending components of the climbing fiber system mature, with respect to latency, in synchrony. (4) The terminal synaptic organization has little effect on the development of transmission characteristics in these afferent systems. (5) One possible mechanism by which an adult neural structure can have an abnormal synaptic organization is to maintain immature synaptic relationships due to the neonatal loss of interneurons

  2. Analysis of direct to diffuse partitioning of global solar irradiance at the radiometric station in Badajoz (Spain)

    Sanchez, G.; Cancillo, M. L.; Serrano, A.

    2010-09-01

    This study is aimed at the analysis of the partitioning of global solar irradiance into its direct and diffuse components at the radiometric station in Badajoz (Spain). The detailed knowledge of the solar radiation field is of increasing interest in Southern Europe due to its use as renewable energy. In particular, the knowledge of the solar radiation partitioning into direct and diffuse radiation has become a major demand for the design and suitable orientation of solar panels in solar power plants. In this study the first measurements of solar diffuse irradiance performed in the radiometric station in Badajoz (Spain) are presented and analyzed in the framework of the partitioning of solar global radiation. Thus, solar global and diffuse irradiance were measured at one-minute basis from 23 November 2009 to 31 March 2010. Solar irradiances were measured by two Kipp&Zonen CMP11 pyranometers, using a Kipp&Zonen CM121 shadow ring for the measurements of solar diffuse irradiance. Diffuse measurements were corrected from the solid angle hidden by the ring and direct irradiance was calculated as the difference between global and diffuse measurements. Irradiance was obtained from the pyranomenters by applying calibration coefficients obtained in an inter-comparison campaign performed at INTA/El Arenosillo, in Huelva (Spain), last September 2009. There, calibration coefficients were calculated using as a reference a CMP11 pyranometer which had been previously calibrated by the Physikalisch-Meteorologisches Observatorium Davos/World Radiation Centre in Switzerland. In order to study the partitioning of the solar radiation, the global and diffuse irradiances have been analyzed for three typical different sky conditions: cloud-free, broken clouds and overcast. Particular days within the period of study have been selected by visual inspection. Along with the analysis of the global and diffuse irradiances themselves, ratios of these irradiances to the downward irradiance at the

  3. Normal incidence spectrophotometer using high density transmission grating technology and highly efficiency silicon photodiodes for absolute solar EUV irradiance measurements

    Ogawa, H. S.; Mcmullin, D.; Judge, D. L.; Korde, R.

    1992-01-01

    New developments in transmission grating and photodiode technology now make it possible to realize spectrometers in the extreme ultraviolet (EUV) spectral region (wavelengths less than 1000 A) which are expected to be virtually constant in their diffraction and detector properties. Time dependent effects associated with reflection gratings are eliminated through the use of free standing transmission gratings. These gratings together with recently developed and highly stable EUV photodiodes have been utilized to construct a highly stable normal incidence spectrophotometer to monitor the variability and absolute intensity of the solar 304 A line. Owing to its low weight and compactness, such a spectrometer will be a valuable tool for providing absolute solar irradiance throughout the EUV. This novel instrument will also be useful for cross-calibrating other EUV flight instruments and will be flown on a series of Hitchhiker Shuttle Flights and on SOHO. A preliminary version of this instrument has been fabricated and characterized, and the results are described.

  4. Evolution of porous network in GaSb under normally incident 60 keV Ar{sup +}-ion irradiation

    Datta, D.P. [SUNAG Laboratory, Institute of Physics, Bhubaneswar 751 005, Odisha (India); Kanjilal, A. [Department of Physics, Shiv Nadar University, Gautam Budh Nagar 203 207, Uttar Pradesh (India); Garg, S.K. [SUNAG Laboratory, Institute of Physics, Bhubaneswar 751 005, Odisha (India); Sahoo, P.K. [School of Physical Sciences, National Institute of Science Education and Research, Bhubaneswar 751 005, Odisha (India); Satpati, B. [Surface Physics and Material Science Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Kanjilal, D. [Inter-University Accelerator Center, Aruna Asaf Ali Marg, New Delhi 110 067 (India); Som, T., E-mail: tsom@iopb.res.in [SUNAG Laboratory, Institute of Physics, Bhubaneswar 751 005, Odisha (India)

    2014-08-15

    Highlights: • We show the evolution of a nanoporous layer in GaSb under Ar{sup +}-ion bombardment at normal incidence in the hitherto unexplored high fluence regime, namely 7 × 10{sup 16}–3 × 10{sup 18} ions cm{sup −2}. • Fluence dependent formation and growth of patches on top of the nanoporous layer is demonstrated by scanning electron microscopy. • We also show high amount of oxidation of such ion-beam-generated nanoporous structures, with formation of Ga{sub 2}O{sub 3} and Sb{sub 2}O{sub 3}. • Our study reveals the presence of nanocrystallites within the porous layer even at the highest fluence used in the experiment. • We interpret the experimental observations through a qualitative model where we take into account the effect of re-deposition of atoms sputtered from the nanoporous layer during Ar{sup +}-ion irradiation of GaSb. - Abstract: GaSb(1 0 0) samples were irradiated with 60 keV Ar{sup +}-ions at normal incidence for fluences in the range of 7 × 10{sup 16} to 3 × 10{sup 18} ions cm{sup −2} at room temperature, showing gradual evolution of a porous surface layer containing interconnected nanofibers. In particular, fluence dependent formation of patches on the nanoporous layer is observed by scanning electron microscopy. Combined results of grazing incidence x-ray diffraction and transmission electron microscopy reveal the presence of nanocrystallites in the porous structures. Compositional analysis by x-ray photoelectron spectroscopy indicates the development of oxide phases, mainly Ga{sub 2}O{sub 3} and Sb{sub 2}O{sub 3} where the former increases with fluence. We have proposed a model addressing a competition between ion-induced-defect driven growth of the nanoporous layer and redeposition of sputtered target atoms on the growing layer.

  5. Theory of emission spectra from metal films irradiated by low energy electrons near normal incidence

    Kretschmann, E.; Callcott, T.A.; Arakawa, E.T.

    1980-01-01

    The emission spectrum produced by low energy electrons incident on a rough metal surface has been calculated for a roughness auto-correlation function containing a prominent peak at a high wave vector. For low energy electrons near normal incidence, the high wavevector peak dominates the roughness coupled surface plasmon radiation (RCSPR) process. The calculation yields estimates of the ratio of RCSPR to transition radiation, the dependence of emission intensity on electron energy and the shape and position of the RCSPR peak. The most interesting result is that the high-wavevector roughness can split the RCSPR radiation into peaks lying above and below the asymptotic surface plasma frequency. The results are compared with data from Ag in the following paper. (orig.)

  6. Review of direct electrical heating experiments on irradiated mixed-oxide fuel

    Fenske, G.R.; Bandyopadhyay, G.

    1982-01-01

    Results of approximately 50 out-of-reactor experiments that simulated various stages of a loss-of-flow event with irradiated fuel are presented. The tests, which utilized the direct electrical heating technique to simulate nuclear heating, were performed either on fuel segments with their original cladding intact or on fuel segments that were extruded into quartz tubes. The test results demonstrated that the macro- and microscopic fuel behavior was dependent on a number of variables including fuel heating rate, thermal history prior to a transient, the number of heating cycles, type of cladding (quartz vs stainless steel), and fuel burnup

  7. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  8. Thymectomized, irradiated, and bone marrow-reconstituted chimeras have normal cytolytic T lymphocyte precursors but a defect in lymphokine production

    Duprez, V.; Maziarz, R.; Weinberger, O.; Burakoff, S.J.

    1984-01-01

    A model system has been developed to study extrathymic T cell differentiation; mice have been thymectomized, lethally irradiated, and reconstituted with bone marrow cells depleted of Thy-1 + cells. After 8 wk, the spleen cells of these athymic, bone marrow-reconstituted chimeras contain Thy-1 + precytolytic T lymphocytes (CTL) that are able to respond to antigen only if supernatant from Con A-activated T cells is added to culture. The phenotype of these pre-CTL is similar to that of thymocytes, suggesting that they may be immature T cells. Initial evaluation of the CTL repertoire of these athymic mice demonstrated that the CTL generated to trinitrophenyl-modified syngeneic cells are H-2-restricted, and that the CTL generated to alloantigens have many of the cross-reactivities observed in normal mice but not in nude mice. In this report, the authors demonstrate a helper T cell defect in these thymectomized chimeras. These chimeras lack an Ly-1 + helper cell required for thymocytes to differentiate to CTL. Further studies revealed that when spleen cells from these thymectomized chimeras were stimulated with Con A, they produced normal levels of interleukin 2. However, these splenocytes were defective in the production of another factor needed for CTL differentiation

  9. In-vitro secretion of inhibin-like activity by Sertoli cells from normal and prenatally irradiated immature rats

    Ultee-van Gessel, A.M.; Leemborg, F.G.; Jong, F.H. de; Molen, H.J. van der

    1986-01-01

    The influence of in-vitro conditions on the production of inhibin by Sertoli cells from 21-day-old normal and prenatally irradiated rat testes was studied by measuring inhibin activity in culture media, using the suppression of the release of FSH from cultured rat pituitary cells. Sertoli cells secreted inhibin-like activity during at least 21 days of culture, and cells cultured at 37 0 C produced significantly more inhibin than those cultured at 32 0 C. The presence of fetal calf serum had no significant effect on inhibin production at 32 0 C, while at 37 0 C the production was decreased. The presence of ovine FSH stimulated inhibin secretion, while inhibin concentrations in Sertoli cell culture media were decreased after the addition of testosterone. Testosterone, added together with ovine FSH, suppressed inhibin secretion when compared with the levels found in the presence of FSH alone. The presence of spermatogenic cells decreased the release of inhibin. From these results it was concluded that both Sertoli cells isolated from normal immature rat testes and those from testes without spermatogenic cells can secrete inhibin-like activity in culture. A number of discrepancies with in-vivo observations was observed. (author)

  10. Investigation of normal tissue complication probabilities in prostate and partial breast irradiation radiotherapy techniques

    Bezak, E.; Takam, R.; Bensaleh, S.; Yeoh, E.; Marcu, L.

    2011-01-01

    Full text: Normal- Tissue-Complication Probabilities of rectum, bladder and urethra following various radiation techniques for prostate cancer were evaluated using the relative-seriality and Lyman models. NTCPs of lungs, heart and skin, their dependence on sourceposition, balloon-deformation were also investigated for HDR mammosite brachytherapy. The prostate treatment techniques included external three dimentional conformal-radiotherapy, Low-Dose-Rate brachytherapy (1-125), High-Dose-Rate brachytherapy (Ir-I92). Dose- Volume-Histograms of critical structures for prostate and breast radiotherapy, retrieved from corresponding treatment planning systems, were converted to Biological Effective Dose (BEffD)-based and Equivalent Dose(Deq)-based DVHs to account for differences in radiation delivery and fractionation schedule. Literature-based model parameters were used to calculate NTCPs. Hypofractionated 3D-CRT (2.75 Gy/fraction, total dose 55 Gy) NTCPs of rectum, bladder and urethra were less than those for standard fractionated 4-field 3D-CRT (2-Gy/fraction, 64 Gy) and dose-escalated 4- and 5-field 3D-CRT (74 Gy). Rectal and bladder NTCPs (5.2% and 6.6%) following the dose-escalated 4-field 3D-CRT (74 Gy) were the highest among analyzed techniques. The average NTCP for rectum and urethra were 0.6% and 24.7% for LDRBT and 0.5% and 11.2% for HDR-BT. For Mammosite, NTCP was estimated to be 0.1 %, 0.1 %, 1.2% and 3.5% for skin desquamation, erythema, telangiectasia and fibrosis respectively (the source positioned at the balloon centre). A 4 mm Mammosite-balloon deformation leads to overdosing of PTV regions by ∼40%, resulting in excessive skin dose and increased NTCP. Conclusions Prostate brachytherapy resulted in NTCPs lower compared to external beam techniques. Mammosite-brachytherapy resulted in no heart/lung complications regardless of balloon deformation. However, 4 mm deformation caused 0.6% increase in tissue fibrosis NTCP.

  11. SU-F-P-46: Comparative Study Between Two Normalization Prescriptions for Accelerated Partial Breast Irradiation: A Dosimetric Study

    Agarwal, P; Sharma, D; Gandhi, A; Binjola, A; Subramani, V; Chander, S [All India Institute of Medical Sciences, New Delhi, New Delhi, Delhi (India)

    2016-06-15

    Purpose: To compare the Accelerated Partial Breast Irradiation (APBI) plan with the normalized basal dose points and 5mm box prescription. Methods: Five patients of APBI were planned twice in Oncentra Master planning TPS (Version 4.3) using TG-43 algorithm. The number of catheters for all the patients was 10 to 16 and implant plane 2 to 3. For planning all catheters were reconstructed. Source loading was done as per HR-CTV contoured. The HR-CTV volume range was from 75cc to 182cc. Plans were normalized in two methods. First all plans were normalized on Basal dose points (PlanA) and second all the plan were normalized on 5mm box (PlanB). The prescription dose (PD) was 35Gy in 10 fractions. All the plans were completely based on normalization and without optimization. Plan evaluation was based on certain parameters coverage Index (CI), dose homogeneity index (DHI), conformity index (COIN), over dose volume index (OI). Results: The average and median of CI for planA was 0.835 and 0.8154, for planB 0.82 and 0.799 respectively. The median and average of DHI for planA was 0.66 and 0.6062, for planB 0.67 and 0.62 respectively. The range of COIN for planA and planB was from 0.58 to 0.65 respectively. The range of OI was from 0.083 to 0.169 for planA and planB. The treatment time in planA was in average 1.13 times more than planB as V150% of HR-CTV in planA was 4–6% more. The ipsilateral lung was getting 30% of PD which was 0.6% to 3.5%. Conclusion: Treatment Planning should be individualized based on implants characteristics. Planning with prescription to basal dose points should be preferred to 5mm box prescription, in order to achieve better DHI and less treatment time.

  12. Explosive Evaporating Phenomena of Cryogenic Fluids by Direct Contacting Normal Temperature Fluids

    T Watanabe

    2016-09-01

    Full Text Available Cryogenic fluids have characteristics such as thermal stratification and flashing by pressure release in storage vessel. The mixture of the extreme low temperature fluid and the normal temperature fluid becomes the cause which causes pressure vessel and piping system crush due to explosive boiling and rapid freezing. In recent years in Japan, the demand of cryogenic fluids like a LH2, LNG is increasing because of the advance of fuel cell device technology, hydrogen of engine, and stream of consciousness for environmental agreement. These fuel liquids are cryogenic fluids. On the other hand, as for fisheries as well, the use of a source of energy that environment load is small has been being a pressing need. And, the need of the ice is high, as before, for keeping freshness of marine products in fisheries. Therefore, we carried out the experiments related to promotion of evaporating cryogenic fluids and generation of ice, in the contact directly of the water and liquid nitrogen. From the results of visualization, phenomena of explosive evaporating and ice forming were observed by using video camera.

  13. HDR monotherapy for prostate cancer: A simulation study to determine the effect of catheter displacement on target coverage and normal tissue irradiation

    Kolkman-Deurloo, Inger-Karine K.; Roos, Martin A.; Aluwini, Shafak

    2011-01-01

    Purpose: The aim of this study was to systematically analyse the effect of catheter displacements both on target coverage and normal tissue irradiation in fractionated high dose rate (HDR) prostate brachytherapy, using a simulation study, and to define tolerances for catheter displacement ensuring that both target coverage and normal tissue doses remain clinically acceptable. Besides the effect of total implant displacement, also displacements of catheters belonging to selected template rows only were evaluated in terms of target coverage and normal tissue dose, in order to analyse the change in dose distribution as a function of catheter dwell weight and catheter location. Material and methods: Five representative implant geometries, with 17 catheters each, were selected. The clinical treatment plan was compared to treatment plans in which an entire implant displacement in caudal direction over 3, 5, 7 and 10 mm was simulated. Besides, treatment plans were simulated considering a displacement of either the central, most ventral or most dorsal catheter rows only, over 5 mm caudally. Results: Due to displacement of the entire implant the target coverage drops below the tolerance of 93% for all displacements studied. The effect of displacement of the entire implant on organs at risk strongly depended on the patient anatomy; e.g., for 80% of the implant geometries the V 80 of the rectum exceeded its tolerance for all displacements. The effect of displacement of catheters belonging to selected template rows depended strongly on the relative weight of each catheter row when considering the target coverage and on its location when considering the dose in the organs at risk. Conclusion: This study supports the need for a check of the catheter locations before each fraction and correction of deviations of the catheter position exceeding 3 mm.

  14. Effectiveness of ancestral irradiation on the direct and correlated responses to selection for body weight in rats

    Gianola, D.

    1975-01-01

    The effects of ancestral irradiation of rat spermatogonia (a cumulative total of 4050 r of x-rays) were studied in a highly inbred line of rats to explore the feasibility of using irradiation to enhance the effectiveness of selection. Six generations after irradiation was terminated, a selection experiment for body weight at six weeks of age was started in both ancestrally irradiated and non-irradiated populations. There were two non-contemporaneous replicates in each of the populations. Within each of the ancestral treatment-replicate combinations one line was selected for high, one for low body weight at six weeks of age, and a third line was maintained by random selection. In each line, avoidance of mating of animals with grandparents in common was attempted. Data on the first ten progeny generations of selection were included in this study. Five types of covariances among relatives were used to estimate causal components of variance for five different genetic models within the ''non-irradiated'' and ''irradiated'' randomly selected models. The parameters in the genetic models were estimated by generalized least-squares. This analysis suggested that a genetic model including direct genetic and maternal genetic effects was adequate to describe the body weights at 3, 6 and 10 weeks of age and the weight gains between these ages. Ancestral irradiation seemed to have enhanced the maternal genetic variance and the covariance between the direct genetic and the maternal genetic effects. On the basis of the above analysis, it was deduced that mass selection should have been more effective in the descendants of irradiated males than in those of the non-irradiated males as a consequence of greater phenotypic variability in their progeny and an enhancement in the regression of the genetic value on the selection criterion

  15. Bending creep in the direction perpendicular to grain during microwave irradiation

    Iida, I.

    1989-01-01

    Bending creep tests in the radial direction perpendicular to the grain were carried out on the thirteen different wood species during the microwave irradiation and during the hot-air drying. The course of moisture content of specimen during creep tests were measured at the same time. And then, relationships between the drying rate and the moisture content, or the creep deflection and the moisture content were investigated and disscussed. Results obtained are as follows : 1) The coefficients of drying rate (K 1 ) during microwave irradiation process were from values of 3.40(hr) -1 to 5.65(hr) -1 for different species. With average value of all woods, there were of 4.73(hr) -1 . Therefore, this value show a value of 5.3 times as much as these of hot-air drying. 2) Creep deflection of woods dried by the microwave heating increase remarkably from the start of the microwave irradiation. 3) Ratio ( y 30 /y m ) of creep deflection y m , in region of ∼30% moisture content, to the maximum creep deflection y m were thought the values differ from each wood species, in no relation with the applied stresses and these values have the constant in a wood. Those were estimated about 0.73 for Icho wood and about 0.44 for Buna wood, and moreover it was about 0.6 with average value for all wood species. Consequently, it was recognized that drying rate became remarkably magnitude value during microwave heating. Creep deflection on the 30% moisture content take beyond about half of the total creep deflection. Conseqently, the large creep deformation developed during the high moisture content process, and it constitute a caractaristic frature of microwave heating

  16. Anti-Inflammatory Effect of ETAS®50 by Inhibiting Nuclear Factor-κB p65 Nuclear Import in Ultraviolet-B-Irradiated Normal Human Dermal Fibroblasts

    Ken Shirato

    2018-01-01

    Full Text Available Ultraviolet (UV irradiation induces proinflammatory responses in skin cells, including dermal fibroblasts, accelerating premature skin aging (photoaging. ETAS 50, a standardized extract from the Asparagus officinalis stem, is a novel and unique functional food that suppresses proinflammatory responses of hydrogen peroxide-stimulated skin fibroblasts and interleukin- (IL- 1β-stimulated hepatocytes. To elucidate its antiphotoaging potencies, we examined whether ETAS 50 treatment after UV-B irradiation attenuates proinflammatory responses of normal human dermal fibroblasts (NHDFs. UV-B-irradiated NHDFs showed reduced levels of the cytosolic inhibitor of nuclear factor-κB α (IκBα protein and increased levels of nuclear p65 protein. The nuclear factor-κB nuclear translocation inhibitor JSH-23 abolished UV-B irradiation-induced IL-1β mRNA expression, indicating that p65 regulates transcriptional induction. ETAS 50 also markedly suppressed UV-B irradiation-induced increases in IL-1β mRNA levels. Immunofluorescence analysis revealed that ETAS 50 retained p65 in the cytosol after UV-B irradiation. Western blotting also showed that ETAS 50 suppressed the UV-B irradiation-induced increases in nuclear p65 protein. Moreover, ETAS 50 clearly suppressed UV-B irradiation-induced distribution of importin-α protein levels in the nucleus without recovering cytosolic IκBα protein levels. These results suggest that ETAS 50 exerts anti-inflammatory effects on UV-B-irradiated NHDFs by suppressing the nuclear import machinery of p65. Therefore, ETAS 50 may prevent photoaging by suppressing UV irradiation-induced proinflammatory responses of dermal fibroblasts.

  17. Detection of irradiated food by using direct epifluorescent filter technique/aerobic plate count method (DEFT/APC)

    Zhao Yongfu; Li Lili; Wang Changbao; Ji Ping; Wang Chao; Wang Zhidong

    2010-01-01

    The Direct Epifluorescent Filter Technique/Aerobic Plate Count technique(DEFT/APC) can be used to identify the irradiated food by comparing the DEFT and APC counts of the samples prior to the irradiation and after. This technology was tested by using spice and dried marine fish as testing materials in this study. The results shows that the index, log (DEFT/APC) > 4.0, can indicate that the samples have been irradiated at a dose level higher than 1.0 kGy. It also indicates that the detecting sensitivity was affected by the initial value of APC and D 10 value of the samples. (authors)

  18. Blood leukocyte responses to extracorporeal circulation. 2. Medium term extracorporeal circulation without and with extracorporeal irradiation in normal and splenectomized dogs

    Szemere, P.; Fliedner, T.M. (Ulm Univ. (Germany, F.R.). Abt. Klinische Physiologie)

    1983-01-01

    Medium term (6-8 h) extracorporeal irradiation without and with irradiation of blood was performed in normal and splenectomized dogs to reveal the changes of blood leukocytes including CFU-C. A regular but transitory decrease of granulocytes and a longer lasting diminution of lymphocytes in the blood were observed. The CFU-C level became and mostly remained very low during the procedure. Splenectomy did not influence significantly the changes of peripheral leukocyte counts. No marked difference of leukocytes was seen in the blood samples taken from the arterial or venous side of the shunt or even from the cubital vein. Also, the irradiation did not produce any difference in the alterations of blood cell counts compared to those without irradiation. The possible explanations of these results are discussed.

  19. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  20. Effect of DNA repair on the cytotoxicity and mutagenicity of uv irradiation and of chemical carcinogens in normal and xeroderma pigmentosum cells

    Maher, V.M.; McCormick, J.J.

    1976-01-01

    The cytotoxic and mutagenic action of ultraviolet (UV) irradiation and of aromatic amides or polycyclic hydrocarbons was quantitatively compared in normally repairing strains of human cells and in several excision-repair deficient or post-replication repair-deficient xeroderma pigmentosum (XP) strains

  1. Comparison of single, fractionated and hyperfractionated irradiation on the development of normal tissue damage in rat lung

    Giri, P.G.S.; Kimler, B.F.; Giri, U.P.; Cox, G.G.; Reddy, E.K.

    1985-01-01

    The effect of fractionated thoracic irradiation on the development of normal tissue damage in rats was compared to that produced by single doses. Animals received a single dose of 15 Gy, 30 Gy in 10 daily fractions of 3 Gy each (fractionation), or 30 Gy in 30 fractions of 1 Gy each 3 times a day (hyperfractionation). The treatments produced minimal lethality since a total of only 6 animals died between days 273 and 475 after the initiation of treatment, with no difference in survival observed between the control and any of the 3 treated groups. Despite the lack of lethality, evidence of lung damage was obtained by histological examination. Animals that had received either single doses or fractionated doses had more of the pulmonary parenchyma involved than did animals that had received hyperfractionated doses. The authors conclude that, in the rat lung model, a total radiation dose of 30 Gy fractionated over 14 days produces no more lethality nor damage to lung tissue than does 15 Gy delivered as a single dose. However, long-term effects as evidenced by deposits of collagen and development of fibrosis are significantly reduced by hyperfractionation when compared to single doses and daily fractionation

  2. Direct observation of cascade defect formation at low temperatures in ion-irradiated metals

    Muroga, T.; Hirooka, K.; Ishino, S.

    1984-01-01

    Direct transmission electron microscopy observations of cascade defect formation have been carried out in gold, Type 316 stainless steel, and aluminum irradiated by Al + , Ar - , and Xe + ions with energies between 80 and 400 keV. By utilizing a link of an ion accelerator to an electron microscope, in situ observations at low temperature (-150 0 C) have become possible. In gold, subcascade structures are clearly observed in all cases. Obvious dependence on projectile mass and energy is observed for cascade structure and vacancy clustering efficiency in gold and for defect visibility in aluminum and Type 316 stainless steel. A computer simulation calculation using MARLOWE shows subcascade distributions a little smaller in size and larger in number than the present observation

  3. Direct irradiation of long-lived fission products in an ATW system

    Carter, T.F. [Univ. of Tennessee, Knoxville, TN (United States); Henderson, D. [Univ. of Wisconsin, Madison, WI (United States); Sailor, W.C. [Los Alamos National Laboratory, NM (United States)

    1995-10-01

    The feasibility of directly irradiating five long-lived fission products (LLFPs: {sup 79}Se, {sup 93}Zr, {sup 107}Pd, {sup 126}Sn, and {sup 135}Cs, each with a half-life greater than 10,000 years), by incorporating them into the target of an Accelerator Transmutation of Waste (ATW) system is discussed. The important parameters used to judge the feasibility of a direct irradiation system were the target`s neutron spallation yield (given in neutrons produced per incident proton), and the removal rate of the LLFP, with the baseline incineration rate set at two light water reactors (LWRs) worth of the LLFP waste per year. A target was constructed which consisted of a LLFP cylindrical {open_quotes}plug{close_quotes} inserted into the top (where the proton beam strikes) of a 30 cm radius, 100 cm length lead target. {sup 126}Sn and {sup 79}Se were each found to have high enough removal rates to support two LWR`s production of the LLFP per year of ATW operation. For the baseline plug geometry (5 cm radius, 30 cm length) containing {sup 126}Sn, 3.5 LWRs could be supported per year (at 75% beam availability). Furthermore, the addition of a {sup 126}Sn plus had a slightly positive effect on the target`s neutron yield. The neutron production was 36.83 {plus_minus}.0039 neutrons per proton with a pure lead target having a yield of 36.29 {plus_minus}.0038. It was also found that a plug composed of a tin-selenide compound (SnSe) had high enough removal rates to burn two or more reactor years of both LLFPs simultaneously.

  4. Prolongation of rat islet allograft survival by direct ultraviolet irradiation of the graft

    Lau, H.; Reemtsma, K.; Hardy, M.A.

    1984-01-01

    Ultraviolet irradiation of rat dendritic cells completely abrogated their allostimulatory capacity in a mixed lymphocyte reaction. Rat islets of Langerhans similarly irradiated remained hormonally functional when transplanted into syngeneic diabetic rats. Allogeneic transplantation across a major histocompatibility barrier of islets initially treated in vitro with ultraviolet irradiation resulted in prolonged allograft survival without the use of any immunosuppressive agents

  5. Enhanced proliferation of transfused marrow and reversal of normal growth inhibition of female marrow in male hosts 2 months after sublethal irradiation

    Brecher, G.; Mulcahy, K.; Tjio, J.H.; Raveche, E.

    1985-01-01

    It is well established that 0.5 to 1 million marrow cells suffice to rescue (though not necessarily fully restore) lethally irradiated mice, while even 40 million cells result only in minimal seeding in isogeneic, nonirradiated mice. It was originally suggested that the results imply the existence of special proliferative sites which are filled in the nonirradiated animal, but are emptied by high doses of irradiation. In 1982 the authors demonstrated the feasibility of establishing substantial numbers of donor cells in normal, non-irradiated hosts. After four daily transfusions of 50 million marrow cells, 20-40% of the host's marrow consisted of cells of donor origin. The present paper reports the marked enhancement of the proliferation of transfused marrow cells in mice exposed to sublethal doses of irradiation of 300-900 R. Two months later, when the peripheral blood counts of the irradiated animals had returned to normal, transfusion of 100 million cells resulted in donor cell percentages of 55-100% in the peripheral blood and marrow. The authors previously found that male donor cells proliferated as readily in female as in male hosts, while female donor cells proliferated to a comparable degree only in female hosts. In the present study, male animals that had been exposed to 600-900 R 2 months earlier sustained proliferation of male and female donor cells equally well

  6. Improving historical spelling normalization with bi-directional LSTMs and multi-task learning

    Bollmann, Marcel; Søgaard, Anders

    2016-01-01

    Natural-language processing of historical documents is complicated by the abundance of variant spellings and lack of annotated data. A common approach is to normalize the spelling of historical words to modern forms. We explore the suitability of a deep neural network architecture for this task, particularly a deep bi-LSTM network applied on a character level. Our model compares well to previously established normalization algorithms when evaluated on a diverse set of texts from Early New Hig...

  7. Effect of irradiation, cyclophosphamide, and etoposide (VP-16) on number of peripheral blood and peritoneal leukocytes in mice under normal conditions and during acute inflammatory reaction

    van't Wout, J.W.; Linde, I.; Leijh, P.C.; van Furth, R.

    1989-01-01

    In order to develop a suitable model for studying the role of granulocytes and monocytes in resistance against pathogenic microorganisms, we investigated the effect of irradiation and cytostatic treatment (cyclophosphamide and VP-16) on the number of both peripheral blood and peritoneal leukocytes in male Swiss mice. Irradiation and cyclophosphamide treatment severely decreased the number of both granulocytes and monocytes in peripheral blood, whereas VP-16 only lowered the number of blood monocytes to a significant degree and had little effect on the number of blood granulocytes or lymphocytes. When normal mice were injected intraperitoneally with newborn calf serum (NBCS) the number of peritoneal granulocytes rose about 100-fold within 6 h. In irradiated and cyclophosphamide-treated mice, this influx of granulocytes into the peritoneal cavity was virtually eliminated, as was the concomitant increase in the number of blood granulocytes; in VP-16-treated mice, on the other hand, the number of peripheral blood and peritoneal granulocytes increased to the same degree as in normal mice. An increase in the number of peripheral blood monocytes and peritoneal macrophages occurred 24-48 h after injection of NBCS in normal mice. This increase was significantly impaired by irradiation as well as by treatment with cyclophosphamide or VP-16

  8. On the relationship between cardboard burning in a sunshine recorder and the direct solar irradiance.

    Sanchez, A.; Calbó, J.; González, J. A.

    2012-04-01

    Since the end of XIX century, the Campbell-Stokes recorder (CSR) has been the instrument used to measure the insolation (hours of sunshine during per day). Due to the large number of records that exist worldwide (some of them extending over more than 100 years), valuable climatic information can be extracted from them. There are various articles that relate the insolation with the cloudiness and the global solar irradiation (Angstrom-Prescott type formulas). Theoretically, the insolation is defined as the number of hours that direct solar irradiance (DSI) exceeds 120 W/m2, thus corresponding to the total length of the burning in the bands. The width of the burn has not been well studied, so the aim of this research is to relate this width, first with the DSI and then, with other variables. The research was carried out in Girona (NE Spain) for a period extending since February 2011. A CSR from Thies Clima and a pyrheliometer from Kipp&Zonen were used to measure insolation and the direct solar irradiance. Other meteorological variables were also stored for the study. For each band, we made two independent measurements of the width of the burn every 10 minutes: first, we measured directly the width of the perforated portion of the burn; second, we measured the width of the burn after applying a digital image process that increases the contrast of the burn. The burn in a band has a direct relationship with the DSI. Specifically, correlation coefficients of the perforation width and the burning width with DSI were 0.838 and 0.864 respectively. However, we found that there are times when despite of DSI is as high as 400 W/m2 (i.e. much greater than 120 W/m2), there is no burn in the band. Contrarily, sometimes a burn occurs with almost no DSI. Furthermore, a higher DSI does not always correspond to a wider burn of the band. Because of this, we consider that characteristics of band burns must also depend on other meteorological variables (temperature, humidity...). The

  9. Converging stereotactic radiotherapy using kilovoltage X-rays: experimental irradiation of normal rabbit lung and dose-volume analysis with Monte Carlo simulation.

    Kawase, Takatsugu; Kunieda, Etsuo; Deloar, Hossain M; Tsunoo, Takanori; Seki, Satoshi; Oku, Yohei; Saitoh, Hidetoshi; Saito, Kimiaki; Ogawa, Eileen N; Ishizaka, Akitoshi; Kameyama, Kaori; Kubo, Atsushi

    2009-10-01

    To validate the feasibility of developing a radiotherapy unit with kilovoltage X-rays through actual irradiation of live rabbit lungs, and to explore the practical issues anticipated in future clinical application to humans through Monte Carlo dose simulation. A converging stereotactic irradiation unit was developed, consisting of a modified diagnostic computed tomography (CT) scanner. A tiny cylindrical volume in 13 normal rabbit lungs was individually irradiated with single fractional absorbed doses of 15, 30, 45, and 60 Gy. Observational CT scanning of the whole lung was performed every 2 weeks for 30 weeks after irradiation. After 30 weeks, histopathologic specimens of the lungs were examined. Dose distribution was simulated using the Monte Carlo method, and dose-volume histograms were calculated according to the data. A trial estimation of the effect of respiratory movement on dose distribution was made. A localized hypodense change and subsequent reticular opacity around the planning target volume (PTV) were observed in CT images of rabbit lungs. Dose-volume histograms of the PTVs and organs at risk showed a focused dose distribution to the target and sufficient dose lowering in the organs at risk. Our estimate of the dose distribution, taking respiratory movement into account, revealed dose reduction in the PTV. A converging stereotactic irradiation unit using kilovoltage X-rays was able to generate a focused radiobiologic reaction in rabbit lungs. Dose-volume histogram analysis and estimated sagittal dose distribution, considering respiratory movement, clarified the characteristics of the irradiation received from this type of unit.

  10. Direct transesterification of wet Cryptococcus curvatus cells to biodiesel through use of microwave irradiation

    Cui, Yi; Liang, Yanna

    2014-01-01

    Highlights: • Direct transesterfication of wet yeast cells using methanol and microwave irradiation is feasible. • Methanol to biomass ratio, stirring speed and KOH concentration were critical to biodiesel yield. • Under optimal conditions, the crude biodiesel contained 64% of FAMEs and was 92% of yeast lipids. - Abstract: Cryptococcus curvatus is a highly promising oleaginous yeast strain that can accumulate intracellular lipids when grown on renewable carbon sources. In order to convert yeast lipids to biodiesel in a simple but cost-effective way, we aim to react whole yeast cells with methanol to produce biodiesel eliminating the step of drying and lipid extraction while adopting microwave energy for heating and disrupting cell walls. Through use of a screening test followed by response surface methodology, optimal parameters leading to the highest yield of crude biodiesel and FAMEs were identified. Under optimal conditions of reaction time (2 min), methanol/biomass ratio (50/1, v/m), stirring speed (966 rpm), KOH concentration (5%), and water content (80%), the yield of crude biodiesel (% of total lipids) was 56.1% after the first round reaction. A second round reaction using the residual yeast cells increased the total yield to 92%. Among the crude biodiesel, 63.88% was FAMEs as revealed by GC analysis. Results from this study indicated that it is feasible to produce biodiesel from wet microbial biomass directly without the steps of drying and lipid extraction. With the assistance of microwave, this process can be accomplished in minutes with good process efficiency

  11. Suberoylanilide hydroxamic acid affects γH2AX expression in osteosarcoma, atypical teratoid rhabdoid tumor and normal tissue cell lines after irradiation

    Blattmann, C.; Oertel, S.; Thiemann, M.; Weber, K.J.; Schmezer, P.; Zelezny, O.; Lopez Perez, R.; Kulozik, A.E.; Debus, J.; Ehemann, V.

    2012-01-01

    Osteosarcoma and atypical teratoid rhabdoid tumors are tumor entities with varying response to common standard therapy protocols. Histone acetylation affects chromatin structure and gene expression which are considered to influence radiation sensitivity. The aim of this study was to investigate the effect of the combination therapy with the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) and irradiation on atypical teratoid rhabdoid tumors and osteosarcoma compared to normal tissue cell lines. Clonogenic assay was used to determine cell survival. DNA double-strand breaks (DSB) were examined by pulsed-field electrophoresis (PFGE) as well as by γH2AX immunostaining involving flow cytometry, fluorescence microscopy, and immunoblot analysis. SAHA lead to an increased radiosensitivity in tumor but not in normal tissue cell lines. γH2AX expression as an indicator for DSB was significantly increased when SAHA was applied 24 h before irradiation to the sarcoma cell cultures. In contrast, γH2AX expression in the normal tissue cell lines was significantly reduced when irradiation was combined with SAHA. Analysis of initial DNA fragmentation and fragment rejoining by PFGE, however, did not reveal differences in response to the SAHA pretreatment for either cell type. SAHA increases radiosensitivity in tumor but not normal tissue cell lines. The increased H2AX phosphorylation status of the SAHA-treated tumor cells post irradiation likely reflects its delayed dephosphorylation within the DNA damage signal decay rather than chromatin acetylation-dependent differences in the overall efficacy of DSB induction and rejoining. The results support the hypothesis that combining SAHA with irradiation may provide a promising strategy in the treatment of solid tumors. (orig.)

  12. Radiorestoring activity of few nucleotides on normal tissues of Jerusalem Artichoke after an irradiation with γ rays of 60Co

    Jonard, Robert; Bayonove, Jacqueline; Riedel, Michel.

    1978-01-01

    The nucleotides tested: adenosine triphosphate (ATP) and cyclic adenosine 3',5'-monophosphate (3',5'-cAMP), guanosine triphosphate (GTP) and cyclic guanosine 3',5'-monophosphate (3',5'-cGMP), are able to restore proliferation to irradiatedirradiation, 3,000 rad) Jesusalem Artichoke tissue. The 3',5'-cGMP shows the greater radiorestoring activity [fr

  13. Normal tissue tolerance to external beam radiation therapy: Ovaries; Tolerance a l'irradiation des tissus sains: les ovaires

    Gross, E.; Champetier, C.; Zaccariotto, A.; Duberge, T.; Guerder, C. [Departement de radiotherapie, hopital de la Timone, 13 - Marseille (France); Pointreau, Y. [Service Corad, pole Henry-S.-Kaplan, CHU Bretonneau, 37 - Tours (France); Ortholan, C. [Service de radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France); Chauvet, B. [Institut Sainte-Catherine, 84 - Avignon (France)

    2010-07-15

    Clinical situations requiring protections of ovaries are mainly paediatric irradiations and pre-menopausal pelvic irradiations. The main complication of ovarian irradiation is the induced castration. Ovaries are extremely radiosensitive organs with strong interpersonal variations. The castrative effect of irradiation depends mainly on two factors: patient's age and the dose delivered to ovaries. The surgical technique of ovarian transposition allows to minimize the dose received by ovaries by taking them away, out of irradiation fields; the aim is to exclude them from the volume receiving 5 Gy or more, and if possible from those receiving 2 Gy. This technique becomes integrated into a multidisciplinary approach of conservation of fertility for patients exposed to other cytotoxic treatments. (authors)

  14. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    Selsky, C.A.

    1978-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  15. On a direct algorithm for the generation of log-normal pseudo-random numbers

    Chamayou, J M F

    1976-01-01

    The random variable ( Pi /sub i=1//sup n/X/sub i//X/sub i+n/)/sup 1/ square root 2n/ is used to generate standard log normal variables Lambda (0, 1), where the X/sub i/ are independent uniform variables on (0, 1). (8 refs).

  16. Blood pressure directly correlates with blood viscosity in diabetes type 1 children but not in normals.

    Vázquez, Beatriz Y Salazar; Vázquez, Miguel A Salazar; Jáquez, Manuel Guajardo; Huemoeller, Antonio H Bracho; Intaglietta, Marcos; Cabrales, Pedro

    2010-01-01

    To determine the relationship between mean arterial blood pressure (MAP) and blood viscosity in diabetic type 1 children and healthy controls to investigate whether MAP is independent of blood viscosity in healthy children, and vice versa. Children with diabetes type 1 treated by insulin injection were studied. Controls were healthy children of both sexes. MAP was calculated from systolic and diastolic pressure measurements. Blood viscosity was determined indirectly by measuring blood hemoglobin (Hb) content. The relationship between Hb, hematocrit (Hct) and blood viscosity was determined in a subgroup of controls and diabetics selected at random. 21 (10.6+/-2.5 years) type 1 diabetic children treated with insulin and 25 healthy controls age 9.6+/-1.7 years were studied. Hb was 13.8+/-0.8 g/dl in normal children vs. 14.3+/-0.9 g/dl in the diabetic group (p<0.05). MAP was 71.4+/-8.2 in the normal vs. 82.9+/-7.2 mmHg in the diabetic group (p<0.001). Glucose was 89.3+/-10.6 vs. 202.4+/-87.4 mg/dl respectively. Diabetics had a positive MAP/Hb correlation (p=0.007), while normals showed a non significant (p=0.2) negative correlation. The blood viscosity/Hb relationship was studied in a subgroup of 8 healthy controls and 8 diabetic type 1 children. There was no significant difference in Hb and Hct between groups. Diabetics showed a trend of increasing blood viscosity (+7%, p=0.15). Normal children compensate for the increase in vascular resistance due to increased blood viscosity (increased Hb and Hct) while diabetic children do not, probably due to endothelial dysfunction.

  17. Photochemical degradation of crude oil: Comparison between direct irradiation, photocatalysis, and photocatalysis on zeolite

    D' Auria, Maurizio [Dipartimento di Chimica, Universita della Basilicata, Via N. Sauro 85, 85100 Potenza (Italy)], E-mail: maurizio.dauria@unibas.it; Emanuele, Lucia; Racioppi, Rocco; Velluzzi, Vincenzina [Dipartimento di Chimica, Universita della Basilicata, Via N. Sauro 85, 85100 Potenza (Italy)

    2009-05-15

    Direct irradiation for 100 h of crude oil from Basilicata (Southern Italy) gave in the case of linear and branched alkanes a reduction of 9 and 5%, respectively. On the contrary, cyclic alkanes decreased for 54% while aromatic hydrocarbons showed a reduction of 37%. These results are in agreement with a prevalent electron transfer mechanism. Photocatalysis (100 h) gave extensive degradation of crude oil: linear alkanes were degraded for 98.66%, branched alkanes were reduced for 97.31%, cyclic alkanes for 96.04%, while aromatic compounds and alkenes were reduced for 99.54 and 98.38%, respectively. These results are in agreement with a prevalent hydrogen abstraction mechanism. When photocatalysis is performed in the presence of zeolite linear alkanes were degraded for 79.85%, branched alkanes were reduced for 45.38%, cyclic alkanes for 58.10%, while aromatic compounds were reduced for 91.85%. In this case, an increase of the relative amount of alkenes (42.05%) was observed.

  18. Photochemical degradation of crude oil: Comparison between direct irradiation, photocatalysis, and photocatalysis on zeolite

    D'Auria, Maurizio; Emanuele, Lucia; Racioppi, Rocco; Velluzzi, Vincenzina

    2009-01-01

    Direct irradiation for 100 h of crude oil from Basilicata (Southern Italy) gave in the case of linear and branched alkanes a reduction of 9 and 5%, respectively. On the contrary, cyclic alkanes decreased for 54% while aromatic hydrocarbons showed a reduction of 37%. These results are in agreement with a prevalent electron transfer mechanism. Photocatalysis (100 h) gave extensive degradation of crude oil: linear alkanes were degraded for 98.66%, branched alkanes were reduced for 97.31%, cyclic alkanes for 96.04%, while aromatic compounds and alkenes were reduced for 99.54 and 98.38%, respectively. These results are in agreement with a prevalent hydrogen abstraction mechanism. When photocatalysis is performed in the presence of zeolite linear alkanes were degraded for 79.85%, branched alkanes were reduced for 45.38%, cyclic alkanes for 58.10%, while aromatic compounds were reduced for 91.85%. In this case, an increase of the relative amount of alkenes (42.05%) was observed

  19. Radiotherapy. Non-standard fractionated regimens improving cancer treatment. Part II. Response of normal tissues to fractionated irradiation

    Villar, A.; Hernandez, M.; Pera, J.; Cambray, M.; Villa, S.; Arnaiz, M.D.

    1988-01-01

    The phenomena participating in the response of tissues to fractionated irradiation are analyzed with special emphasis on the most relevant points influencing the design of non-standard fractionated regimens. (Author)

  20. Cell biological effects of total body irradiation on growth and differentiation of acute myelogenous leukemia cells compared to normal bone marrow

    Greenberger, J S; Weichselbaum, R R; Botnick, L E; Sakakeeny, M; Moloney, W C

    1979-01-01

    Radiation therapy is used as total body treatment in preparation of the acute myelogenous leukemia (AML) patient for bone marrow transplantation. Many AML patients will have residual leukemia cells at the time of total body irradiation (TBI). In the present study, the effect of TBI on leukemic myeloid cells was compared to the effect on normal marrow granulocytic stem cells (CFUc) in vitro. Little difference from that of normal CFUc was found in the radiosensitivity of two mouse myeloid leukemia cell lines. The effect of TBI on growth of WEHI-3 or J774 cells in millipore diffusion chambers was stimulatory. These AML cell lines as well as others derived from Friend or Abelson virus infected in vitro long term mouse marrow cultures showed some morphologic differentiation by 7 days growth in diffusion chambers in irradiated heterologous rat hosts, but immature cells predominated by day 21. Thus, evidence in murine models of AML indicates that residual AML cells surviving chemotherapy will show no greater susceptibility to radiation killing compared to normal stem cells and will rapidly repopulate the irradiated host.

  1. Identification of novel direct protein-protein interactions by irradiating living cells with femtosecond UV laser pulses.

    Itri, Francesco; Monti, Daria Maria; Chino, Marco; Vinciguerra, Roberto; Altucci, Carlo; Lombardi, Angela; Piccoli, Renata; Birolo, Leila; Arciello, Angela

    2017-10-07

    The identification of protein-protein interaction networks in living cells is becoming increasingly fundamental to elucidate main biological processes and to understand disease molecular bases on a system-wide level. We recently described a method (LUCK, Laser UV Cross-linKing) to cross-link interacting protein surfaces in living cells by UV laser irradiation. By using this innovative methodology, that does not require any protein modification or cell engineering, here we demonstrate that, upon UV laser irradiation of HeLa cells, a direct interaction between GAPDH and alpha-enolase was "frozen" by a cross-linking event. We validated the occurrence of this direct interaction by co-immunoprecipitation and Immuno-FRET analyses. This represents a proof of principle of the LUCK capability to reveal direct protein interactions in their physiological environment. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Direct round window membrane application of dexamethasone in the protection of the guinea pigs'cochlea against irradiation damage

    Li Ying; Guo GuangWei; Su Jiping

    2009-01-01

    Objective: To investigate the protective effect of dexamethasone applied to round window membrane (RWM) against radiation-induced inner ear damage in guinea pigs, in order to provide the evidence for preventing and treating radiation-induced inner ear damage. Methods: 130 guinea pigs were randomly divided into four groups. (1) Dexamethasone group( n = 45): The guinea pigs were injected with dexamethasone through an intact RWM on right ear for one time after being treated with 70 Gy 60 Co γ irradiation. (2) Irradiation group(n = 45) : The guinea pigs were treated with 70 Gy 60 Co γ irradiation. (3) Saline group (n = 30): Applying of normal saline through an intact RWM on right ear for one time after being treated with 70 Gy 60 Co γ irradiation. (4) Control group(n =45) : Auditory brainstem response (ABR) was tested before the 3 rd day, the second week and the second month after irradiation (treatment) in the first three groups. The animals were sacrificed right after the ABR test and the middle ear mucosa was observed simultaneously. The hair cells were observed by surface preparation of the basilar membrane and scanning electron microscope ( SEM). Results: The normal ABR threshold is (8.2 ± 2.8) dB. The ABR thresholds increased in those of the three groups treated with irradiation and were rising with time. At the 3rd day, the second week and the second month, ABR thresholds of the dexamethasone group were (24.0 ± 14.1), (27.1 ± 9.9) and (38.0 ± 15.1) dB, respectively, while the irradiation group were (24.5 ± 13.5), (39.5 ± 15.4) and (57.2 ± 18.4) dB. The saline group were (27.0 ± 14.6) and (42.8 ± 13.5) dB, respectively. ABR thresholds of the dexamethasone group at the second week and the second month both decreased compared with those of the irradiation group and saline group ( P < 0.05) . In the control group, the outer hair cell lost by 8.0 ± 2.7 and inner hair cell by 3.7 ± 1.2. The lost quantities of the inner hair cells and outer hair cells

  3. SU-E-T-501: Normal Tissue Toxicities of Pulsed Low Dose Rate Radiotherapy and Conventional Radiotherapy: An in Vivo Total Body Irradiation Study

    Cvetkovic, D; Zhang, P; Wang, B; Chen, L; Ma, C [Fox Chase Cancer Center, Philadelphia, PA (United States)

    2014-06-01

    Purpose: Pulsed low dose rate radiotherapy (PLDR) is a re-irradiation technique for therapy of recurrent cancers. We have previously shown a significant difference in the weight and survival time between the mice treated with conventional radiotherapy (CRT) and PLDR using total body irradiation (TBI). The purpose of this study was to investigate the in vivo effects of PLDR on normal mouse tissues.Materials and Methods: Twenty two male BALB/c nude mice, 4 months of age, were randomly assigned into a PLDR group (n=10), a CRT group (n=10), and a non-irradiated control group (n=2). The Siemens Artiste accelerator with 6 MV photon beams was used. The mice received a total of 18Gy in 3 fractions with a 20day interval. The CRT group received the 6Gy dose continuously at a dose rate of 300 MU/min. The PLDR group was irradiated with 0.2Gyx20 pulses with a 3min interval between the pulses. The mice were weighed thrice weekly and sacrificed 2 weeks after the last treatment. Brain, heart, lung, liver, spleen, gastrointestinal, urinary and reproductive organs, and sternal bone marrow were removed, formalin-fixed, paraffin-embedded and stained with H and E. Morphological changes were observed under a microscope. Results: Histopathological examination revealed atrophy in several irradiated organs. The degree of atrophy was mild to moderate in the PLDR group, but severe in the CRT group. The most pronounced morphological abnormalities were in the immune and hematopoietic systems, namely spleen and bone marrow. Brain hemorrhage was seen in the CRT group, but not in the PLDR group. Conclusions: Our results showed that PLDR induced less toxicity in the normal mouse tissues than conventional radiotherapy for the same dose and regimen. Considering that PLDR produces equivalent tumor control as conventional radiotherapy, it would be a good modality for treatment of recurrent cancers.

  4. Quantification of 5-hydroxytryptamine[sub 1A] receptors in the cerebellum of normal and x-irradiated rats during postnatal development

    Matthiessen, L; Daval, G; Bailly, Y [Pierre et Marie Curie Univ., Paris (France). Centre National de la Recherche Scientifique, UA; Gozlan, H; Hamon, M; Verge, D [INSERM, Paris (France). Lab. de Neurobiologie Cellulaire et Fonctionnelle

    1992-11-01

    5-Hydroxytryptamine[sub 1A] receptors were studied in rats during the first postnatal month in the normal cerebellum and in the granule cell-deprived cerebellum produced by X-irradiation at postnatal day 5. Quantitative autoradiographic studies on sagittal sections of cerebellar vermis, using [[sup 125]1]BH-8-MeO-N-PAT as radioligand or specific anti-receptor antibodies, revealed that 5-hydroxytryptamine[sub 1A] receptors existed in the molecular/Purkinje cell layer but at variable density from one lobule to another. Thus, in both normal and X-irradiated rats, the posterior lobules were more heavily labelled than the anterior ones, and the density of 5-hydroxytryptamine[sub 1A] sites decreased progressively in all the cerebellar folia down to hardly detectable levels at postnatal day 21. However, the intensity of labelling remained higher at postnatal day 8 and postnatal day 12 in X-irradiated rats than in age-paired controls. Measurements of [[sup 3]H]8-OH-DPAT [8-hydroxy-2-(di-n-propylamino)tetralin] specific binding to membranes from whole cerebellum confirmed that the density of 5-hydroxytryptamine[sub 1A] sites per mg membrane protein (B[sub max]) was higher in X-irradiated animals than in age-paired controls. However, on a ''per cerebellum'' basis, no significant difference could be detected between the total number of 5-hydroxytryptamine[sub 1A] sites, which progressively increased in both control and X-irradiated animals during the first postnatal month. These results therefore show that 5-hydroxytryptamine[sub 1A] receptors are not located on developing granule cells. (author).

  5. Converging Stereotactic Radiotherapy Using Kilovoltage X-Rays: Experimental Irradiation of Normal Rabbit Lung and Dose-Volume Analysis With Monte Carlo Simulation

    Kawase, Takatsugu; Kunieda, Etsuo; Deloar, Hossain M.; Tsunoo, Takanori; Seki, Satoshi; Oku, Yohei; Saitoh, Hidetoshi; Saito, Kimiaki; Ogawa, Eileen N.; Ishizaka, Akitoshi; Kameyama, Kaori; Kubo, Atsushi

    2009-01-01

    Purpose: To validate the feasibility of developing a radiotherapy unit with kilovoltage X-rays through actual irradiation of live rabbit lungs, and to explore the practical issues anticipated in future clinical application to humans through Monte Carlo dose simulation. Methods and Materials: A converging stereotactic irradiation unit was developed, consisting of a modified diagnostic computed tomography (CT) scanner. A tiny cylindrical volume in 13 normal rabbit lungs was individually irradiated with single fractional absorbed doses of 15, 30, 45, and 60 Gy. Observational CT scanning of the whole lung was performed every 2 weeks for 30 weeks after irradiation. After 30 weeks, histopathologic specimens of the lungs were examined. Dose distribution was simulated using the Monte Carlo method, and dose-volume histograms were calculated according to the data. A trial estimation of the effect of respiratory movement on dose distribution was made. Results: A localized hypodense change and subsequent reticular opacity around the planning target volume (PTV) were observed in CT images of rabbit lungs. Dose-volume histograms of the PTVs and organs at risk showed a focused dose distribution to the target and sufficient dose lowering in the organs at risk. Our estimate of the dose distribution, taking respiratory movement into account, revealed dose reduction in the PTV. Conclusions: A converging stereotactic irradiation unit using kilovoltage X-rays was able to generate a focused radiobiologic reaction in rabbit lungs. Dose-volume histogram analysis and estimated sagittal dose distribution, considering respiratory movement, clarified the characteristics of the irradiation received from this type of unit.

  6. Fatal Pasteurella haemolytica pneumonia in bighorn sheep after direct contact with clinically normal domestic sheep.

    Foreyt, W J

    1989-03-01

    Six Rocky Mountain bighorn sheep were raised in captivity from birth (n = 5) or taken from the wild as a lamb (n = 1). After the bighorn sheep were in captivity for over a year, 6 clinically normal domestic sheep were placed on the 2 ha of pasture on which the bighorn sheep were kept. Nasal swab specimens were obtained from all sheep at the time the domestic sheep were introduced. Pasteurella haemolytica was isolated from swab specimens obtained from 4 of 6 domestic sheep, but not from specimens obtained from the bighorn sheep. All 6 bighorn sheep died of acute hemorrhagic pneumonia after exposure to domestic sheep. Death in the bighorn sheep occurred on days 4, 27, 27, 29, 36, or 71 after initial exposure to domestic sheep. Pasteurella haemolytica was isolated from respiratory tract tissue specimens of all bighorn sheep at the time of death. None of the domestic sheep were clinically ill during the study. At the end of the study, 3 of 6 domestic sheep were euthanatized, and at necropsy, P haemolytica was isolated from 2 of them. The most common serotypes in bighorn and domestic sheep were P haemolytica T-3 and A-2. Other serotypes isolated included P haemolytica A-1, A-9, and A-11 in bighorn sheep and A-1 in domestic sheep. On the basis of results of this study and of other reports, domestic sheep and bighorn sheep should not be managed in proximity to each other because of the potential fatal consequences in bighorn sheep.

  7. Confluent holding leads to a transient enhancement in mutagenesis in UV-light-irradiated xeroderma pigmentosum, Gardner's syndrome and normal human diploid fibroblasts

    Grosovsky, A.J.; Little, J.B.

    1985-01-01

    The influence of confluent holding periods of 0-24 h of UV-light-induced mutagenesis has been investigated in several human cell strains including xeroderma pigmentosum complementation group A (XPA), Gardner's syndrome (GS) and normal human diploid fibroblasts (NHDF). Confluent cultures of NHDF exposed to UV light exhibited a time-dependent increase in survival when subculture was delayed up to 24 h after irradiation. GS and XPA fibroblasts showed no such increase. When allowed confluent holding periods of 1.5-24 h, GS, XPA and NHDF all exhibited a transient enhancement of mutagenesis such that a 5-10-fold increase in mutation frequency was observed in cells subcultured at 6-9 h after irradiation as compared to cells subcultured at 3-6 h. A decline in mutation frequency prior to the mutagenesis peak was observed in GS and normal cells but not in XPA. After 24 h of confluent holding, the mutation frequency in irradiated GS and NHDF had returned to near background levels although XPA mutation frequencies remain similar to those observed in immediately subcultured cells. A model to explain these overall results is discussed. (Auth.)

  8. The bystander cell-killing effect mediated by nitric oxide in normal human fibroblasts varies with irradiation dose but not with radiation quality.

    Yokota, Yuichiro; Funayama, Tomoo; Mutou-Yoshihara, Yasuko; Ikeda, Hiroko; Kobayashi, Yasuhiko

    2015-05-01

    To investigate the dependence of the bystander cell-killing effect on radiation dose and quality, and to elucidate related molecular mechanisms. Normal human fibroblast WI-38 cells were irradiated with 0.125 - 2 Gy of γ-rays or carbon ions and were co-cultured with non-irradiated cells. Survival rates of bystander cells were investigated using the colony formation assays, and nitrite concentrations in the medium were measured using the modified Saltzman method. Survival rates of bystander cells decreased with doses of γ-rays and carbon ions of ≤ 0.5 Gy. Treatment of the specific nitric oxide (NO) radical scavenger prevented reductions in survival rates of bystander cells. Moreover, nitrite concentrations increased with doses of less than 0.25 Gy (γ-rays) and 1 Gy (carbon ions). The dose responses of increased nitrite concentrations as well as survival reduction were similar between γ-rays and carbon ions. In addition, negative relationships were observed between survival rates and nitrite concentrations. The bystander cell-killing effect mediated by NO radicals in normal human fibroblasts depends on irradiation doses of up to 0.5 Gy, but not on radiation quality. NO radical production appears to be an important determinant of γ-ray- and carbon-ion-induced bystander effects.

  9. Comparison of normal tissue dose with three-dimensional conformal techniques for breast cancer irradiation including the internal mammary nodes

    van der Laan, Hans Paul; Dolsma, Willemtje; van t Veld, Aart; Bijl, HP; Langendijk, JA

    2005-01-01

    PURPOSE: To compare the Para Mixed technique for irradiation of the internal mammary nodes (IMN) with three commonly used strategies, by analyzing the dose to the heart and other organs at risk. METHODS AND MATERIALS: Four different three-dimensional conformal dose plans were created for 30 breast

  10. Solar-simulated ultraviolet irradiation induces selective influx of CD4+ T lymphocytes in normal human skin

    Di Nuzzo, S.; de Rie, M. A.; van der Loos, C. M.; Bos, J. D.; Teunissen, M. B.

    1996-01-01

    The proportion and composition of the human cutaneous CD3+ T lymphocyte population was determined in situ following a single exposure to physiological, erythema-inducing doses of simulated solar radiation, mainly consisting of UV radiation. Biopsies were taken 1, 2 and 7 days after local irradiation

  11. Natural killer activity and suppressor cells in irradiated mice repopulated with a mixture of cells from normal and 89Sr-treated donors

    Levy, E.M.; Kumar, V.; Bennett, M.

    1981-01-01

    Mice that have been injected with 89 Sr have fairly normal B and T cell function, but are abnormal in that they lack natural killer (NK) activity and other functions that require an intact bone marrow. These mice also have an increased potential for suppressor cell activity. We had previously shown that spleen cells from 89 Sr-treated mice could transfer low NK activity and increased suppressor cell function to lethally irradiated syngeneic recipients. To investigate the mechanisms involved in perpetuating these defects, groups of normal spleen or bone marrow cells. Recipients were assayed for their NK activity and suppressor cell function 5 to 14 wk later. it was found that the addition of normal cells in the donor inoculum resulted in normal NK activity. This indicates that low NK activity in 89 Sr-treated mice was not due to the presence of a suppressor cell that prevented NK cell generation. It was additionally found that low NK activity in recipient mice could be boosted by interferon inducers. This would indicate that NK activity in the recipients was not due to a lack of interferon-sensitive pre-NK cells. Suppressor cell function in recipient mice depended on the type and number of normal cells in the donor inoculum. Bone marrow cells were very efficient in overcoming the tendency to produce suppressor cells. It took approximately 20 times more normal spleen cells to produce the same results. The implications of these findings are discussed

  12. Axo-somatic synapses in the normal and X-irradiated dendate gyrus; factors affecting the density of afferent innervation

    Lee, K.S.; Gerbrandt, L.; Lynch, G.

    1982-01-01

    The density of synaptic input to the somata of dentate gyrus granule cells was examined utilizing quantitative electron microscopic techniques. In control (non-irradiated) material, greater numbers of axo-somatic synapses were observed in the superficial, earlier-generated cells as compared to the deep, later-generated cells. We further studied the X-irradiated dentate gyrus, in which the majority of granule cells were destroyed during postnatal genesis. The surviving cells displayed a density of innervation on their somata which exceeded that observed in either layer of the control material. These data are discussed in terms of the possible contribution of afferent-target cell interactions to the regulation of the density of synaptic innervation. (Auth.)

  13. Murine scid cells complement ataxia-telangiectasia cells and show a normal port-irradiation response of DNA synthesis

    Komatsu, K.; Yoshida, M.; Okumura, Y.

    1993-01-01

    The murine severe combined immunodeficient mutation (scid) is characterized by a lack of both B and T cells, due to a deficit in lymphoid variable-(diversity)-joining (V(D)J) rearrangement. Scid cells are highly sensitive to both radiation-induced killing and chromosomal aberrations. Significantly reduced D 0 and n values were demonstrated in scid cells and were similar to ataxia-telangiectasia (AT) cells (a unique human disease conferring whole body radiosensitivity). However, the kinetics of DNA synthesis after irradiation were different between the two cell types. In contrast with the radioresistant DNA synthesis of AT cells, DNA synthesis of scid cells was markedly inhibited after irradiation. The existence of different mutations was also supported by evidence of complementation in somatic cell hybrids between scid cells and AT cells. Results indicate that the radiobiological character of scid is similar to AT but is presumably caused by different mechanisms. (author)

  14. Axo-somatic synapses in the normal and X-irradiated dendate gyrus; factors affecting the density of afferent innervation

    Lee, K S [Max-Planck-Institut fuer Psychiatrie, Muenchen (Germany, F.R.); Gerbrandt, L [Neuroscience Research Program, Boston, MA (USA); Lynch, G [California Univ., Irvine (USA)

    1982-10-07

    The density of synaptic input to the somata of dentate gyrus granule cells was examined utilizing quantitative electron microscopic techniques. In control (non-irradiated) material, greater numbers of axo-somatic synapses were observed in the superficial, earlier-generated cells as compared to the deep, later-generated cells. We further studied the X-irradiated dentate gyrus, in which the majority of granule cells were destroyed during postnatal genesis. The surviving cells displayed a density of innervation on their somata which exceeded that observed in either layer of the control material. These data are discussed in terms of the possible contribution of afferent-target cell interactions to the regulation of the density of synaptic innervation.

  15. Plasma polyunsaturated fatty acids are directly associated with cognition in overweight children but not in normal weight children.

    Haapala, E A; Viitasalo, A; Venäläinen, T; Eloranta, A-M; Ågren, J; Lindi, V; Lakka, T A

    2016-12-01

    Polyunsaturated fatty acids are essential nutrients for the normal development of the brain. We investigated the associations between plasma polyunsaturated fatty acids and cognition in normal weight and overweight children. The study recruited 386 normal weight children and 58 overweight children aged six to eight years and blood samples were drawn after a 12-hour fast. We assessed plasma polyunsaturated fatty acids using gas chromatography, cognition using Raven's Coloured Progressive Matrices, and overweight and obesity using the age-specific and sex-specific cut-offs from the International Obesity Task Force. The data were analysed by linear regression analyses adjusted for age and sex. Higher proportions of eicosapentaenoic acid in plasma triacylglycerols (β = 0.311, p = 0.020, p = 0.029 for interaction) and docosahexaenoic acid in plasma triacylglycerols (β = 0.281, p = 0.038, p = 0.049 for interaction) were both associated with higher Raven's scores in overweight children but not in normal weight children. Higher eicosapentaenoic acid to arachidonic acid ratios in triacylglycerols (β = 0.317, p = 0.019) and phospholipids (β = 0.273, p = 0.046) were directly associated with the Raven's score in overweight children but not in normal weight children. These findings suggest that increasing the consumption of fish and other sources of eicosapentaenoic acid and docosahexaenoic acid may improve cognition among overweight children. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  16. Direct digital control of furnaces irradiated in nuclear reactors; Surveillance et regulation multiplexee par calculateur numerique de fours irradies

    Joumard, R [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires

    1969-07-01

    An experimental direct digital control system has been realised in the 'C.E.N.G.', in order to verify that a computer makes easier the control of the experiments done in the nuclear reactors and to solve the theoretical and technical difficulties. The regulation is applied to thermal processes. The sampled data systems theory permits to choose the type of an efficient and simple digital compensator, and to establish a diagram which gives the values of the correcting parameters (obtained by minimizing the difference between the output and the input when perturbations occur). The programme execute, in simultaneity, supervision and regulation. Complex possibilities of printing out measures and alarms existed. The computer works out an incremental correction which makes step motors to turn. These motors act on the heating organs. The theoretical values and answers have been confirmed. The accuracy was limited essentially by the input quantification (1/1000 th). The comfort of such a system has been noticeable. (author) [French] Une installation de controle numerique direct fut realisee a titre experimental au C.E.N.G pour verifier qu'un ordinateur rendait plus aisee l'exploitation des experiences faites en pile nucleaire et pour degager les difficultes theoriques et techniques. La regulation s'applique a des processus thermiques. La theorie des systemes echantillonnes a permis de choisir un type de correcteur numerique simple et efficace et d'etablir un abaque qui donne les valeurs des parametres correcteurs minimisant les ecarts enregistres entre la reponse et la consigne en presence de perturbations. Le programme effectuait simultanement de la surveillance et de la regulation. Une restitution complexe des informations et des alarmes sur machine a ecrire etait possible. Le calculateur elaborait une correction incrementielle qui faisait tourner des moteurs pas a pas, lesquels commandaient les organes de puissance de chauffage. Les valeurs et les reponses theoriques ont

  17. Direct digital control of furnaces irradiated in nuclear reactors; Surveillance et regulation multiplexee par calculateur numerique de fours irradies

    Joumard, R. [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires

    1969-07-01

    An experimental direct digital control system has been realised in the 'C.E.N.G.', in order to verify that a computer makes easier the control of the experiments done in the nuclear reactors and to solve the theoretical and technical difficulties. The regulation is applied to thermal processes. The sampled data systems theory permits to choose the type of an efficient and simple digital compensator, and to establish a diagram which gives the values of the correcting parameters (obtained by minimizing the difference between the output and the input when perturbations occur). The programme execute, in simultaneity, supervision and regulation. Complex possibilities of printing out measures and alarms existed. The computer works out an incremental correction which makes step motors to turn. These motors act on the heating organs. The theoretical values and answers have been confirmed. The accuracy was limited essentially by the input quantification (1/1000 th). The comfort of such a system has been noticeable. (author) [French] Une installation de controle numerique direct fut realisee a titre experimental au C.E.N.G pour verifier qu'un ordinateur rendait plus aisee l'exploitation des experiences faites en pile nucleaire et pour degager les difficultes theoriques et techniques. La regulation s'applique a des processus thermiques. La theorie des systemes echantillonnes a permis de choisir un type de correcteur numerique simple et efficace et d'etablir un abaque qui donne les valeurs des parametres correcteurs minimisant les ecarts enregistres entre la reponse et la consigne en presence de perturbations. Le programme effectuait simultanement de la surveillance et de la regulation. Une restitution complexe des informations et des alarmes sur machine a ecrire etait possible. Le calculateur elaborait une correction incrementielle qui faisait tourner des moteurs pas a pas, lesquels commandaient les organes de puissance de chauffage. Les valeurs

  18. Growing central axons deprived of normal target neurones by neonatal X-ray irradiation still terminate in a precisely laminated fashion

    Laurberg, S.; Hjorth-Simonsen, A.

    1977-01-01

    Some studies are described on rat pups. The object was to study the fate of axons that normally terminate in a highly selective laminar fashion in the molecular layer of the medial limb of the dentate gyrus of the mammalian cerebral cortex when this is removed by neonatal X-ray irradiation. The rats were shielded with Pb, except for a field above the hippocampus and the dentate gyrus, and exposed to X-rays from a 250 kV source at a distance of 34 cm. (U.K.)

  19. Genomic instability in mutation induction on normal human fibroblasts irradiated with chronic low-dose radiations in heavy-ion radiation field

    Suzuki, M.; Tsuruoka, C.; Uchihori, Y.; Yasuda, H.; Fujitaka, K.

    2003-01-01

    Full text: At a time when manned space exploration is more a reality with the planned the International Space Station (ISS) underway, the potential exposure of crews in a spacecraft to chronic low-dose radiations in the field of low-flux galactic cosmic rays (GCR) and the subsequent biological effects have become one of the major concerns of space science. We have studied both in vitro life span and genomic instability in cellular effects in normal human skin fibroblasts irradiated with chronic low-dose radiations in heavy-ion radiation field. Cells were cultured in a CO2 incubator, which was set in the irradiation room for the biological study of heavy ions in the Heavy Ion Medical Accelerator in Chiba (HIMAC) at National Institute of Radiological Sciences (NIRS), and irradiated with scattered radiations produced from heavy ions. Absorbed dose measured using a thermoluminescence dosimeter (TLD) and a Si-semiconductor detector was to be around 1.4 mGy per day when operating the HIMAC machine for biological experiments. The total population doubling number (tPDN) of low-dose irradiated cells was significantly smaller (79-93%) than that of unirradiated cells. The results indicate that the life span of the cell population shortens by irradiating with low-dose scattered radiations in the heavy-ion irradiation field. Genomic instability in cellular responses was examined to measure either cell killing or mutation induction in low-dose accumulated cells after exposing to X-ray challenging doses. The results showed that there was no enhanced effect on cell killing between low-dose accumulated and unirradiated cells after exposing to defined challenging doses of 200kV X rays. On the contrary, the mutation frequency on hprt locus of low-dose accumulated cells was much higher than that of unirradiated cells. The results suggested that genomic instability was induced in mutagenesis by the chronic low-dose irradiations in heavy-ion radiation field

  20. Pros and cons of rotating ground motion records to fault-normal/parallel directions for response history analysis of buildings

    Kalkan, Erol; Kwong, Neal S.

    2014-01-01

    According to the regulatory building codes in the United States (e.g., 2010 California Building Code), at least two horizontal ground motion components are required for three-dimensional (3D) response history analysis (RHA) of building structures. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHAs should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here, for the first time, using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak values of engineering demand parameters (EDPs) were computed for rotation angles ranging from 0 through 180° to quantify the difference between peak values of EDPs over all rotation angles and those due to FN/FP direction rotated motions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  1. Exposure to 56Fe irradiation accelerates normal brain aging and produces deficits in spatial learning and memory

    Shukitt-Hale, Barbara; Casadesus, Gemma; Carey, Amanda N.; Rabin, Bernard M.; Joseph, James A.

    Previous studies have shown that radiation exposure, particularly to particles of high energy and charge (HZE particles) such as 56Fe, produces deficits in spatial learning and memory. These adverse behavioral effects are similar to those seen in aged animals. It is possible that these shared effects may be produced by the same mechanism. For example, an increased release of reactive oxygen species, and the subsequent oxidative stress and inflammatory damage caused to the central nervous system, is likely responsible for the deficits seen in aging and following irradiation. Therefore, dietary antioxidants, such as those found in fruits and vegetables, could be used as countermeasures to prevent the behavioral changes seen in these conditions. Both aged and irradiated rats display cognitive impairment in tests of spatial learning and memory such as the Morris water maze and the radial arm maze. These rats have decrements in the ability to build spatial representations of the environment, and they utilize non-spatial strategies to solve tasks. Furthermore, they show a lack of spatial preference, due to a decline in the ability to process or retain place (position of a goal with reference to a “map” provided by the configuration of numerous cues in the environment) information. These declines in spatial memory occur in measures dependent on both reference and working memory, and in the flexibility to reset mental images. These results show that irradiation with 56Fe high-energy particles produces age-like decrements in cognitive behavior that may impair the ability of astronauts, particularly middle-aged ones, to perform critical tasks during long-term space travel beyond the magnetosphere.

  2. Distinctive Genomic Profiles of Normal and Transformed Thyrocytes Irradiated with Low vs. High Doses of X-irradiation both in vivo and in vitro

    Abou-El-Ardat, K. [Radiobiology, SCK-CEN, Mol (Belgium); Molecular Biotechnology, Universiteit Gent, Ghent (Belgium); Monsieurs, P. [Microbiology, SCK-CEN, Mol (Belgium); Janssen, A.; Beck, M; Michaux, A.; Benotmane, R.; Derradji, H.; Baatout, S. [Radiobiology, SCK-CEN, Mol (Belgium); Anastasov, N.; Atkinson, M. [Radiology, Helmholtz Zentrum Munchen, Munich (Germany); Beckaert, S.; Van Criekinge, W. [Molecular Biotechnology, Universiteit Gent, Ghent (Belgium)

    2012-07-01

    The increase in cases of papillary thyroid carcinoma (PTC) in the aftermath of the Chernobyl disaster led to an elevation of interest in the effect of radiation on the thyroid. Our work hopes to uncover some of the effects of low doses of external X-radiation in in vitro and in vivo models using several techniques and robust analysis. Here we describe the use of such models combined with micro-arrays and sound statistical analysis. we find that low doses of radiation act differently on murine thyroids carrying and lacking the RET/PTC translocation and even bear a distinctive profile to higher irradiation doses in both in vitro and in vivo models. We also find that micro-RNAs are involved in the response of these cells to radiation, even at low doses and that two in particular, let-7g and miR-106a, were significantly involved in the cells' p53-mediated anti-proliferative response

  3. Studies on c-AMP contents in sea urchin eggs fertilized with normal and x-irradiated sperm

    Kimura, Hiroshi

    1975-01-01

    Intracellular levels of cyclic 3', 5'-adenosine monophosphate (c-AMP) seemed to remain constant through the first cleavage cycle of sea urchin eggs. X-irradiation to the sperm, which induced the first cleavage delay, did not change this level. Although it was shown in the previous paper that X-ray-induced cleavage delay was reduced by caffeine but not by aminophyline, both caffeine and aminophyline caused an increase in c-AMP levels. These results indicated the possibility that c-AMP does not mediate this caffeine effect on cleavage delay. (auth.)

  4. Effect of time intervals between irradiation and chemotherapeutic agents on the normal tissue damage. Comparison between in vivo and in vitro experiments

    Ito, Hisao; Nakayama, Toshitake; Hashimoto, Shozo (Keio Univ., Tokyo (Japan). School of Medicine)

    1989-05-01

    Experiments have been carried out to determine the effect on the cell survivals at different time intervals between irradiation and chemotherapeutic agents (BLM, cisDDP, ADM and ACNU) in either the in vivo or the in vitro system. The intestinal epithelial assay was applied on the in vivo system. The clonogenic cell survivals of V/sub 79/ cells, both in the proliferative and the plateau phases, were determined in the in vitro system. The V/sub 79/ cells in the plateau phase were more sensitive to BLM, cisDDP and ACNU than those in the proliferative phase, however, the result was reverse with ADM. When BLM, cisDDP or ACNU was combined with irradiation at different time intervals, the response of the plateau phase V/sub 79/ cells to combination therapies were very similar to those of the intestinal epithelial cells. On the other hand, V/sub 79/ cells in the proliferative phase, which were treated with ADM and irradiation, showed the similar response as the intestinal cells. These results suggest that studies of chemo-radiotherapy with cultured cells which are sensitive to chemotherapeutic agents might be suitable to expect the in vivo damage of the normal tissue. (author).

  5. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    Selsky, C.A.

    1976-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  6. Normal and sublethally irradiated stem and granulocyte progenitor cell regeneration in an in vivo culture system. The cellular response to humoral factors released through the action of cyclophosphamide

    MacVittie, T.

    1977-01-01

    The in vivo diffusion chamber (DC) method of marrow culture was used to determine if the injection of host mice with cyclophosphamide (CY) caused, through its cytoxic action, the release of a humoral factor(s) capable of initiating stem cell (CFU-s) and granulocyte-macrophage progenitor cell (CFU-c) proliferation. Host mice were injected with CY 1-4 days prior to 800 rad of 60 Co WBI and implantation of DCs containing normal or 400 rad sublethally irradiated (SLI) marrow cells. The greatest proliferative response within CFU-s and CFU-c populations occurred in those mice injected with CY 3 days prior to implant. The marked CFU-s and CFU-c regeneration was initiated during the initial 24 hr of culture in both normal and SLI marrow cells. Thereafter growth rates were approximately the same. SLI marrow, however, showed a greater response to the humoral effects of CY injection than did normal marrow. These data provided evidence that CY induced the release of a diffusible factor(s) capable of accelerating regeneration of normal and sublethally irradiated CFU-s and CFU-c, the magnitude of which was dependent upon the time elapsed between CY injected and implantation of DCs. The marked proliferative response of the SLI stem and progenitor cells to the humoral stimulation may be indicative of the heterogeneity of both CFU-s and CFU-c populations surviving sublethal radiation exposure. The target cells may have possessed a differential sensitivity to the factor(s) initiating cell proliferation

  7. Study of coherent structures of turbulence with large wall-normal gradients in thermophysical properties using direct numerical simulation

    Reinink, Shawn K.; Yaras, Metin I.

    2015-01-01

    Forced-convection heat transfer in a heated working fluid at a thermodynamic state near its pseudocritical point is poorly predicted by correlations calibrated with data at subcritical temperatures and pressures. This is suggested to be primarily due to the influence of large wall-normal thermophysical property gradients that develop in proximity of the pseudocritical point on the concentration of coherent turbulence structures near the wall. The physical mechanisms dominating this influence remain poorly understood. In the present study, direct numerical simulation is used to study the development of coherent vortical structures within a turbulent spot under the influence of large wall-normal property gradients. A turbulent spot rather than a fully turbulent boundary layer is used for the study, for the coherent structures of turbulence in a spot tend to be in a more organized state which may allow for more effective identification of cause-and-effect relationships. Large wall-normal gradients in thermophysical properties are created by heating the working fluid which is near the pseudocritical thermodynamic state. It is found that during improved heat transfer, wall-normal gradients in density accelerate the growth of the Kelvin-Helmholtz instability mechanism in the shear layer enveloping low-speed streaks, causing it to roll up into hairpin vortices at a faster rate. It is suggested that this occurs by the baroclinic vorticity generation mechanism which accelerates the streamwise grouping of vorticity during shear layer roll-up. The increased roll-up frequency leads to reduced streamwise spacing between hairpin vortices in wave packets. The density gradients also promote the sinuous instability mode in low-speed streaks. The resulting oscillations in the streaks in the streamwise-spanwise plane lead to locally reduced spanwise spacing between hairpin vortices forming over adjacent low-speed streaks. The reduction in streamwise and spanwise spacing between

  8. Mutagenesis and lethality following S phase irradiation of xeroderma pigmentosum and normal human diploid fibroblasts with ultraviolet light

    Grosovsky, A.J.; Little, J.B.

    1983-01-01

    The mutagenic and lethal effects of u.v. light exposure in the DNA synthetic phase of the cell cycle were determined in xeroderma pigmentosum complementation group A (XP-A), hereditary adenomatosis of the colon and rectum (ACR), and a normal, foreskin derived cell strain (AG1522). For AG1522, an increased sensitivity to the cytotoxic effects of u.v. light was observed as compared to previous findings for confluent, non-proliferating cultures. XP-A fibroblasts were markedly hypersensitive and ACR fibroblasts exhibited an intermediate response. The mutagenic response of ACR fibroblasts, however, was similar to normal fibroblasts. A threshold of 1.5-2 J/m 2 was observed for u.v. induced mutagenesis in normal and ACR fibroblasts. XP fibroblasts, on the other hand, were strikingly hypermutable and demonstrated little or no threshold. When S phase mutagenesis was considered as a function of survival level rather than u.v. light dose, XP fibroblasts remained significantly hypermutable as compared with normal fibroblasts at all survival levels. Previous mutagenesis results with confluent, non-proliferating cultures of XP and normal fibroblasts were reanalyzed as a function of cytotoxicity; XP hypermutability at all survival levels was also observed. (author)

  9. Design and Construction of Experiment for Direct Electron Irradiation of Uranyl Sulfate Solution: Bubble Formation and Thermal Hydraulics Studies

    Chemerisov, Sergey [Argonne National Lab. (ANL), Argonne, IL (United States); Gromov, Roman [Argonne National Lab. (ANL), Argonne, IL (United States); Makarashvili, Vakho [Argonne National Lab. (ANL), Argonne, IL (United States); Heltemes, Thad [Argonne National Lab. (ANL), Argonne, IL (United States); Sun, Zaijing [Argonne National Lab. (ANL), Argonne, IL (United States); Wardle, Kent E. [Argonne National Lab. (ANL), Argonne, IL (United States); Bailey, James [Argonne National Lab. (ANL), Argonne, IL (United States); Quigley, Kevin [Argonne National Lab. (ANL), Argonne, IL (United States); Stepinski, Dominique [Argonne National Lab. (ANL), Argonne, IL (United States); Vandegrift, George [Argonne National Lab. (ANL), Argonne, IL (United States)

    2014-10-01

    Argonne is assisting SHINE Medical Technologies in developing SHINE, a system for producing fission-product 99Mo using a D/T-accelerator to produce fission in a non-critical target solution of aqueous uranyl sulfate. We have developed an experimental setup for studying thermal-hydraulics and bubble formation in the uranyl sulfate solution to simulate conditions expected in the SHINE target solution during irradiation. A direct electron beam from the linac accelerator will be used to irradiate a 20 L solution (sector of the solution vessel). Because the solution will undergo radiolytic decomposition, we will be able to study bubble formation and dynamics and effects of convection and temperature on bubble behavior. These experiments will serve as a verification/ validation tool for the thermal-hydraulic model. Utilization of the direct electron beam for irradiation allows homogeneous heating of a large solution volume and simplifies observation of the bubble dynamics simultaneously with thermal-hydraulic data collection, which will complement data collected during operation of the miniSHINE experiment. Irradiation will be conducted using a 30-40 MeV electron beam from the high-power linac accelerator. The total electron-beam power will be 20 kW, which will yield a power density on the order of 1 kW/L. The solution volume will be cooled on the front and back surfaces and central tube to mimic the geometry of the proposed SHINE solution vessel. Also, multiple thermocouples will be inserted into the solution vessel to map thermal profiles. The experimental design is now complete, and installation and testing are in progress.

  10. Normal tissue tolerance to external beam radiation therapy: Testicles; Dose de tolerance a l'irradiation des tissus sain: les testicules

    Champetier, C.; Gross, E.; Zaccariotto, A.; Duberge, T.; Guerder, C. [Service de radiotherapie, hopital de la Timone, 13 - Marseille (France); Pointreau, Y. [Pole Henry-S.-Kaplan, CHU Bretonneau, 37 - Tours (France); Ortholan, C. [Centre Antoine-Lacassagne, 06 - Nice (France); Chauvet, B. [Institut Sainte-Catherine, 84 - Avignon (France)

    2010-07-15

    Although there is very little evidence for direct irradiation of the testes, they may receive significant doses, especially in the treatment of pelvic tumors in adults and in pediatrics. The exocrine function of the testis seems to be more sensitive to radiotherapy. There is a risk of sterility, even after low doses of radiation. In the adult or the child who has reached puberty, we should propose a self-preservation of semen prior to radiotherapy. In pre-pubescent children, the problem is more delicate. In all cases, it is necessary to limit the dose to the testicles without affecting the coverage of tumour volume. Patients and/or their care-givers should be systematically informed of the risk of infertility related to irradiation. (authors)

  11. The use of biological isodoses ''IsobioGy 2'' for evaluation of tumour and normal tissues response for fractionated irradiation

    Maciejewski, B.; Skolyszewski, J.; Majewski, S.; Lobodziec, W.; Jedynak, T.; Slosarek, K.

    1988-01-01

    Divergences between physical and biological dose distributions were analysed using linear quadratic model. It was found that small variations in physical dose distribution and differences in normal tissue sensitivity for change in dose per fraction, expressed by a α/β value, can cause a high difference between physical and biological doses. This difference significantly increases when one field instead of two fields is daily treated. If there is no enough separation between treated fields, the biological dose may dramatically increase. The use of biological ''isobioGy 2'' isodoses, instead of physical isodoses, can provide an important information on biological effect in tumour or normal tissue and may diminish the risk of giving too high dose to normal tissue and too low dose to the tumour. 6 figs., 13 refs. (author)

  12. Direct determination of a radiation-damage profile with atomic resolution in ion-irradiated platinum. MSC report No. 5030

    Pramanik, D.; Seidman, D.N.

    1983-05-01

    The field-ion microscope (FIM) technique has been employed to determine directly a radiation damage profile, with atomic resolution, in a platinum specimen which had been irradiated at 80 0 K with 20-keV Kr + ions to a fluence of 5 x 10 12 cm - 2 . It is shown that the microscopic spatial-vacancy distribution (radiation-damage profile) is directly related to the elastically-deposited-energy profile. The experimentally constructed radiation-damage profile is compared with a theoretical damage profile - calculated employing the TRIM Monte Carlo code - and excellent agreement is obtained between the two, thus demonstrating that it is possible to go directly from a microscopic spatial distribution of vacancies to a continuous radiation-damage profile

  13. Simple Moving Voltage Average Incremental Conductance MPPT Technique with Direct Control Method under Nonuniform Solar Irradiance Conditions

    Amjad Ali

    2015-01-01

    Full Text Available A new simple moving voltage average (SMVA technique with fixed step direct control incremental conductance method is introduced to reduce solar photovoltaic voltage (VPV oscillation under nonuniform solar irradiation conditions. To evaluate and validate the performance of the proposed SMVA method in comparison with the conventional fixed step direct control incremental conductance method under extreme conditions, different scenarios were simulated. Simulation results show that in most cases SMVA gives better results with more stability as compared to traditional fixed step direct control INC with faster tracking system along with reduction in sustained oscillations and possesses fast steady state response and robustness. The steady state oscillations are almost eliminated because of extremely small dP/dV around maximum power (MP, which verify that the proposed method is suitable for standalone PV system under extreme weather conditions not only in terms of bus voltage stability but also in overall system efficiency.

  14. Regulation of macrophage accessory cell activity by mycobacteria. I. Ia expression in normal and irradiated mice infected with Mycobacterium mycroti

    Kaye, P.M.; Feldmann, M.

    1986-01-01

    CBA/Ca mice were infected by either the intravenous or intraperitoneal route with Mycobacterium microti and the subsequent changes in local macrophage populations examined. Following infection, the number of macrophages increased and they showed greater expression of both MHC Class II molecules. This response was not dependent on viability of the mycobacteria, in contrast to reports with other microorganisms such as Listeria. Studies in sublethally irradiated mice indicated that persistent antigen could give rise to a response after a period of host recovery which was radiation dose dependent. This procedure also highlighted differences in the regulation of different murine class II antigens in vivo, as seen by delayed re-expression of I-E antigens. Macrophage accessory cell function, as assessed by an in vitro T cell proliferation assay, correlated with Ia expression after fixation, but not after indomethacin treatment; this highlights the diverse nature of regulatory molecules produced by these cells. (author)

  15. DNA rearrangements from γ-irradiated normal human fibroblasts preferentially occur in transcribed regions of the genome

    Forrester, H.B.; Radford, I.R.

    2003-01-01

    Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not

  16. Direct observation of the point-defect structure of depleted-zones in ion-irradiated metals

    Wei, C.

    1978-01-01

    The point-defect structure of individual depleted zones has been studied systematically. Four-pass zone-refined tungsten field-ion microscope (FIM) specimens were irradiated in-situ at 10 K with 30 keV Cr + , Mo + , or W + ions to a total dose of (2 to 10) x 10 12 ion cm -2 and examined by the pulse field-evaporation technique at 10 K. The experimental conditions were such that each depleted zone was created by a single incident-ion. The number of vacant lattice sites within a depleted zone was compared with a modified Kinchin--Pease model. The radial distribution function was determined for each depleted zone; it was found that the vacant lattice sites within the volume of each depleted zone tended to exist in a highly clustered state. It was found that the diameter D of each depleted zone was described by the equation D approximately equal to [y 2 ]/sup 1 / 2 / where [y 2 ]/sup 1 / 2 / is the second moment of the theoretical distribution curve, of the fraction of incident ion energy deposited in atom motion, transverse to the direction of the incident ion-beam. The spatial distribution of self-interstitial atoms (SIAs) in a specimen irradiated with 30 keV Cr + ions and in a specimen irradiated with 18 keV Au + ions, at 10 K, was determined. A low bound to the average range of replacement collision sequences (RCSs) was found to be 175 +- 85 A. A detailed FIM study was also made of the vacancy structure of a (220) platelet created by a single 30 keV W + ion in a platinum-4.0 at. % gold alloy; the specimen was irradiated at 40 K and then isochronally warmed to 100 K. The (220) platelet was found to consist of 31 vacant lattice sites, lying in four (220) planes, and clustered in a disc-shaped region which is approximately 20 A in diameter. It was suggested that prismatic dislocation loops lying on (220) type planes in ion or fast neutron irradiated platinum can form as a result of the direct collapse of (220) type vacancy platelets

  17. Direct observation of the vacancy structure of depleted zones in tungsten ion irradiated at 100K

    Wei, C.Y.; Seidman, D.N.

    1978-12-01

    The structure of depleted zones (DZs) created by the in-situ irradiation of tungsten specimens, at 10 0 K, with 30 keV W + , Mo + or Cr + ions has been studied by field-ion microscopy. As the mass of the 30 keV ion was decreased the following observations were made: (1) the spatial extent of the DZs increased; (2) the vacancy concentration within the DZs decreased; (3) the fraction of isolated monovacancies increased; and (4) subcascades formed within the DZs

  18. Two-dimensional turning of thermal flux from normal to lateral propagation in thin metal film irradiated by femtosecond laser pulse

    Shepelev, V. V.; Inogamov, N. A.

    2018-01-01

    There are various geometrical variants of laser illumination and target design. Important direction of investigations is connected with tightly focused action (spot size may be less than micron) onto a thin metal film: thickness of a film is just few skin-layer depths. Duration of a pulse is τ L ˜ 0.1 ps. In these conditions energy absorbed in a skin layer first propagates normally to a surface: gradient ∂Te /∂x dominates, here and below x and y are normal and lateral directions. This process in 1-2 ps homogenizes electron temperature T e along thickness of a film. We consider conditions when a film or is supported by weakly conducting substrate, or is free standing. Therefore all absorbed energy is confined inside the film. At the next stage the internal energy begin to flow along the lateral direction—thus direction of energy expansion is changed from x to y because of the heat non-penetrating boundary condition imposed on the rear-side of the film. At the short two-temperature stage of lateral expansion the thermal conductivity κ is high. After that electron and ion temperatures equilibrates and later on the heat propagates with usual value of κ. Lateral expansion cools down the hot spot on long time scales and finally the molten spot recrystallizes. Two-dimensional approach allows us to consider all these stages from propagation in x direction (normal to a film) to propagation in y direction (along a film).

  19. Aerosol Direct Radiative Forcing and Forcing Efficiencies at Surface from the shortwave Irradiance Measurements in Abu Dhabi, UAE

    Beegum S, N.; Ben Romdhane, H.; Ghedira, H.

    2013-12-01

    Atmospheric aerosols are known to affect the radiation balance of the Earth-Atmospheric system directly by scattering and absorbing the solar and terrestrial radiation, and indirectly by affecting the lifetime and albedo of the clouds. Continuous and simultaneous measurements of short wave global irradiance in combination with synchronous spectral aerosol optical depth (AOD) measurements (from 340 nm to 1640 nm in 8 channels), for a period of 1 year from June 2012 to May 2013, were used for the determination of the surface direct aerosol radiative forcing and forcing efficiencies under cloud free conditions in Abu Dhabi (24.42°N, 54.61o E, 7m MSL), a coastal location in United Arab Emirates (UAE) in the Arabian Peninsula. The Rotating Shadow band Pyranometer (RSP, LI-COR) was used for the irradiance measurements (in the spectral region 400-1100 nm), whereas the AOD measurements were carried out using CIMEL Sunphotometer (CE 318-2, under AERONET program). The differential method, which is neither sensitive to calibration uncertainties nor model assumptions, has been employed for estimating forcing efficiencies from the changes in the measured fluxes. The forcing efficiency, which quantifies the net change in irradiance per unit change in AOD, is an appropriate parameter for the characterization of the aerosol radiative effects even if the microphysical and optical properties of the aerosols are not completely understood. The corresponding forcing values were estimated from the forcing efficiencies. The estimated radiative forcing and forcing efficiencies exhibited strong monthly variations. The forcing efficiencies (absolute magnitudes) were highest during March, and showed continuous decrease thereafter to reach the lowest value during September. In contrast, the forcing followed a slightly different pattern of variability, with the highest solar dimming during April ( -60 W m-2) and the minimum during February ( -20 W m-2). The results indicate that the aerosol

  20. Realization of high irradiation uniformity for direct drive ICF at the SG-III prototype laser facility

    Tian, C.; Shan, L.; Zhang, B.; Zhou, W.; Liu, D.; Bi, B.; Zhang, F.; Wang, W.; Zhang, B.; Giu, Y.

    2015-01-01

    The direct drive irradiation uniformity during the initial imprinting phase at the SG-III prototype laser facility is analyzed and optimized with different methods. At first, the polar direct drive technique is applied to reduce the root mean square deviation σ from 16.1% to 6.4%. To further reduce the non-uniformity, we propose a new method by adjusting the intensity distribution of the laser spot. The overlap of laser beams on the capsule surface is studied and a factor is introduced to adjust the intensity of the laser spot for achieving absolute irradiation uniformity while bringing wild intensity change at laser spot edges. Noting that the overlapping region at the capsule surface is symmetrically distributed, the contribution of light from the edge of a spot can be transferred to its own internal. The newly adjusted intensity distributes at two main regions and the intensity varies slowly and continuously in each, further reducing σ to about 0.35%. Taken into account that the adjusted intensity has very sharp steps, super-Gaussian spatial profiles are used to approximate the required intensity to make it more practicable, which leads σ to 0.94%. Furthermore, sensitivity analysis to beam errors is performed and results show that this scheme can tolerate a certain amount of uncertainties. (authors)

  1. Direct flow separation strategy, to isolate no-carrier-added {sup 90}Nb from irradiated Mo or Zr targets

    Radchenko, Valery; Roesch, Frank [Mainz Univ. (Germany). Inst. of Nuclear Chemistry; Filosofov, Dmitry V.; Dadakhanov, Jakhongir [Joint Institute of Nuclear Research, Dubna (Russian Federation). Dzhelepov Laboratory of Nuclear Problems; Karaivanov, Dimitar V. [Joint Institute of Nuclear Research, Dubna (Russian Federation). Dzhelepov Laboratory of Nuclear Problems; Bulgarian Academy of Sciences, Sofia (Bulgaria). Inst. for Nuclear Research and Nuclear Energy; Marinova, Atanaska [Joint Institute of Nuclear Research, Dubna (Russian Federation). Dzhelepov Laboratory of Nuclear Problems; Sofia Univ. (Bulgaria). Faculty of Chemistry and Pharmacy; Baimukhanova, Ayagoz [Joint Institute of Nuclear Research, Dubna (Russian Federation). Dzhelepov Laboratory of Nuclear Problems; Institute of Nuclear Physics of the Republic of Kazakhstan, Almaty (Kazakhstan)

    2016-11-01

    {sup 90}Nb has an intermediate half-life of 14.6 h, a high positron branching of 53% and optimal β{sup +} emission energy of only E{sub mean} 0.35 MeV per decay. These favorable characteristics suggest it may be a potential candidate for application in immuno-PET. Our recent aim was to conduct studies on distribution coefficients for Zr{sup IV} and Nb{sup V} in mixtures of HCl/H{sub 2}O{sub 2} and HCl/oxalic acid for anion exchange resin (AG 1 x 8) and UTEVA resin to develop a ''direct flow'' separation strategy for {sup 90}Nb. The direct flow concept refers to a separation accomplished using a single eluent on multiple columns, effectively streamlining the separation process and increasing the time efficiency. Finally, we also demonstrated that this separation strategy is applicable to the production of the positron emitter {sup 90}Nb via the irradiation of molybdenum targets and isolation of {sup 90}Nb from the irradiated molybdenum target.

  2. Adaption of an array spectroradiometer for total ozone column retrieval using direct solar irradiance measurements in the UV spectral range

    Zuber, Ralf; Sperfeld, Peter; Riechelmann, Stefan; Nevas, Saulius; Sildoja, Meelis; Seckmeyer, Gunther

    2018-04-01

    A compact array spectroradiometer that enables precise and robust measurements of solar UV spectral direct irradiance is presented. We show that this instrument can retrieve total ozone column (TOC) accurately. The internal stray light, which is often the limiting factor for measurements in the UV spectral range and increases the uncertainty for TOC analysis, is physically reduced so that no other stray-light reduction methods, such as mathematical corrections, are necessary. The instrument has been extensively characterised at the Physikalisch-Technische Bundesanstalt (PTB) in Germany. During an international total ozone measurement intercomparison at the Izaña Atmospheric Observatory in Tenerife, the high-quality applicability of the instrument was verified with measurements of the direct solar irradiance and subsequent TOC evaluations based on the spectral data measured between 12 and 30 September 2016. The results showed deviations of the TOC of less than 1.5 % from most other instruments in most situations and not exceeding 3 % from established TOC measurement systems such as Dobson or Brewer.

  3. Direct Coupling of Electron Beam Irradiation and Polymer Extrusion for a Continuous Polymer Modification in Molten State

    Stephan, M.

    2006-01-01

    The new approach of an e-beam initiating of chemical reactions in polymers in molten state results in some innovative results. High temperature, intensive macromolecular mobility and the absence of any crystallinity are some reasons for achieving unexpected structures, processing behaviour and properties changes in such treated thermoplastics and rubbers. Examples are a much more effective crosslinking of polyethylene and special rubbers, long chain branching of polypropylene or a partial crosslinking of polysulfone. Additionally, most of these modification effects are also achievable by a direct coupling of electron beam irradiation and conventional polymer extrusion processing for a continuous polymer modification in molten state. For realizing this unique processing technique a special MOBILE RADIATION FACILITY (MOBRAD1/T) was designed, constructed and manufactured in the IPF Dresden at which a lab-scale single screw extruder was adapted direct to an electron beam accelerator to realize a prompt irradiation of extruded polymer melt profiles before there solidification. Surprisingly, as a result of these short-time-melt reactions some effective and new polymer modification effects were found and will be presented

  4. Quantitative assessment of the ion-beam irradiation induced direct damage of nucleic acid bases through FTIR spectroscopy

    Huang, Qing, E-mail: huangq@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Institute of Technical Biology and Agriculture Engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences (China); University of Science and Technology of China, Hefei 230029, Anhui (China); Su, Xi; Yao, Guohua; Lu, Yilin; Ke, Zhigang; Liu, Jinghua; Wu, Yuejin; Yu, Zengliang [Key Laboratory of Ion Beam Bio-engineering, Institute of Technical Biology and Agriculture Engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences (China)

    2014-07-01

    Energetic particles exist ubiquitously in nature, and when they hit DNA molecules in organisms, they may induce critical biological effects such as mutation. It is however still a challenge to measure directly and quantitatively the damage imposed by the energetic ions on target DNA molecules. In this work we attempted to employ Fourier transformation infrared (FTIR) spectroscopy to assess the ion-induced direct damage of four nucleic acid bases, namely, thymine (T), cytosine (C), guanine (G), and adenine (A), which are the building blocks of DNA molecules. The samples were prepared as thin films, irradiated by argon ion-beams at raised ion fluences, and in the meantime measured by FTIR spectroscopy for the damage in a quasi-in-situ manner. It was found that the low-energy ion-beam induced radiosensitivity of the four bases shows the sequence G > T > C > A, wherein the possible mechanism was also discussed.

  5. Multi-directional self-ion irradiation of thin gold films: A new strategy for achieving full texture control

    Seita, Matteo; Muff, Daniel; Spolenak, Ralph

    2011-01-01

    Highlights: → Multi-directional self-ion bombardment of Au films. → Extensive selective grain growth leads to single crystal-like films. → Texture rotation is prevented by the multi-directional irradiation process. → Texture rotation rate depends on the film initial defect density. - Abstract: Post-deposition ion bombardment can be employed to convert polycrystalline films into single crystals through a process of selective grain growth. Here we report a new technique that enables selective grain growth in self-ion bombarded gold films - a system in which the formation of large single crystal domains was prevented by the occurrence of ion-induced texture rotation. Our findings suggest that the extent of the texture rotation is a function of the ion fluence and the film initial microstructure.

  6. Sulfonated reduced graphene oxide as a highly efficient catalyst for direct amidation of carboxylic acids with amines using ultrasonic irradiation.

    Mirza-Aghayan, Maryam; Tavana, Mahdieh Molaee; Boukherroub, Rabah

    2016-03-01

    Sulfonated reduced graphene oxide nanosheets (rGO-SO3H) were prepared by grafting sulfonic acid-containing aryl radicals onto chemically reduced graphene oxide (rGO) under sonochemical conditions. rGO-SO3H catalyst was characterized by Fourier-transform infrared (FT-IR) spectroscopy, Raman spectroscopy, scanning electron microscopy (SEM), X-ray diffraction (XRD), thermogravimetric analysis (TGA), differential scanning calorimetry (DSC) and X-ray photoelectron spectroscopy (XPS). rGO-SO3H catalyst was successfully applied as a reusable solid acid catalyst for the direct amidation of carboxylic acids with amines into the corresponding amides under ultrasonic irradiation. The direct sonochemical amidation of carboxylic acid takes place under mild conditions affording in good to high yields (56-95%) the corresponding amides in short reaction times. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. EnviroAtlas - Average Direct Normal Solar resources kWh/m2/Day by 12-Digit HUC for the Conterminous United States

    U.S. Environmental Protection Agency — The annual average direct normal solar resources by 12-Digit Hydrologic Unit (HUC) was estimated from maps produced by the National Renewable Energy Laboratory for...

  8. Direct Experimental Evidence of Back-Surface Acceleration from Laser-Irradiated Foils

    Allen, M; Patel, P; Mackinnon, A; Price, D; Wilks, S; Morse, E

    2004-01-01

    Au foils were irradiated with a 100-TW, 100-fs laser at intensities greater than 10 20 W/cm 2 producing proton beams with a total yield of ∼ 10 11 and maximum proton energy of > 9 MeV. Removing contamination from the back surface of Au foils with an Ar-ion sputter gun reduced the total yield of accelerated protons to less than 1% of the yield observed without removing contamination. Removing contamination the front surface (laser-interaction side) of the target had no observable effect on the proton beam. We present a one-dimensional particle-in-cell simulation that models the experiment. Both experimental and simulation results are consistent with the back-surface acceleration mechanism described in the text

  9. Age-related decrease in an early step of DNA-repair of normal human lymphocytes exposed to ultraviolet-irradiation

    Roth, M.; Emmons, L.R.; Haener, M.M.; Mueller, H.J.B.; Boyle, J.M.

    1989-01-01

    A monoclonal antibody-based immunoassay has been used to detect age-related changes in the rate of loss of photoproduct antigenicity from the DNA of peripheral blood lymphocytes irradiated with 10 J m-2 uv-C. Lymphocytes were obtained from 75 healthy volunteers whose ages ranged from 14 months to 82 years. The samples were divided by age decades into groups of 10 individuals, except the first decade which contained only 5 individuals. The mean loss of antigenicity +/- 1 standard deviation was determined for each group at 10, 30, and 60 min after irradiation. The data were analyzed by Mann-Whitney U test and by the Kruskal-Wallis test. After a recovery period of 10 min the loss of antigenicity was most rapid in group I (0-9 years), less rapid in group II (10-19 years), and least rapid in all other groups. The differences between groups became less at 30 min and were not significant at 60 min incubation. These data obtained from normal cells concur with our previous conclusions, that reductions in the rate of loss of antigenicity in nondiseased cells isolated from patients with melanoma and dysplastic naevus syndrome reflect genetic abnormalities in these patients

  10. Directional enhancement of selected high-order-harmonics from intense laser irradiated blazed grating targets.

    Zhang, Guobo; Chen, Min; Liu, Feng; Yuan, Xiaohui; Weng, Suming; Zheng, Jun; Ma, Yanyun; Shao, Fuqiu; Sheng, Zhengming; Zhang, Jie

    2017-10-02

    Relativistically intense laser solid target interaction has been proved to be a promising way to generate high-order harmonics, which can be used to diagnose ultrafast phenomena. However, their emission direction and spectra still lack tunability. Based upon two-dimensional particle-in-cell simulations, we show that directional enhancement of selected high-order-harmonics can be realized using blazed grating targets. Such targets can select harmonics with frequencies being integer times of the grating frequency. Meanwhile, the radiation intensity and emission area of the harmonics are increased. The emission direction is controlled by tailoring the local blazed structure. Theoretical and electron dynamics analysis for harmonics generation, selection and directional enhancement from the interaction between multi-cycle laser and grating target are carried out. These studies will benefit the generation and application of laser plasma-based high order harmonics.

  11. Differential superiority of heavy charged-particle irradiation to x-rays: Studies on biological effectivenes and side effect mechanisms in multicellular tumor and normal tissue models

    Stefan eWalenta

    2016-02-01

    Full Text Available This review is focused on the radiobiology of carbon ions compared to x-rays using multicellular models of tumors and normal mucosa. The first part summarizes basic radiobiological effects, as observed in cancer cells. The second, more clinically oriented part of the review deals with radiation-induced cell migration and mucositis.Multicellular spheroids (MCS from V79 hamster cells were irradiated with x-rays or carbon ions under ambient or restricted oxygen supply conditions. Oxygen enhancement ratios (OER were 2.9, 2.8, and 1.4 for irradiation with photons, 12C+6 in the plateau region, and 12C+6 in the Bragg peak, respectively. A relative biological effectiveness (RBE of 4.3 and 2.1 for ambient pO2 and hypoxia was obtained, respectively. The high effectiveness of carbon ions was reflected by an enhanced accumulation of cells in G2/M, and a dose-dependent massive induction of apoptosis. Clinically relevant doses (3 Gy of x-rays induced an increase in migratory activity of U87 but not of LN229 or HCT116 tumor cells. Such an increase in cell motility following irradiation in situ could be the source of recurrence. In contrast, carbon ion treatment was associated with a dose-dependent decrease in migration with all cell lines and under all conditions investigated. The radiation-induced loss of cell motility was correlated, in most cases, with corresponding changes in 1 integrin expression. Unlike with particles, the photon-induced increase in cell migration was paralleled by an elevated phosphorylation status of the epidermal growth factor receptor (EGFR and AKT-ERK1/2 pathway. Comparing the gene toxicity of x-rays with that of particles using the gamma-H2AX technique in organotypic cultures of the oral mucosa, the superior effectiveness of heavy ions was confirmed by a two-fold higher number of foci per nucleus. Pro-inflammatory signs, however, were similar for both treatment modalities, e. g., the activation of NFkappaB, and the release of IL

  12. Characterisation of a smartphone image sensor response to direct solar 305nm irradiation at high air masses.

    Igoe, D P; Amar, A; Parisi, A V; Turner, J

    2017-06-01

    This research reports the first time the sensitivity, properties and response of a smartphone image sensor that has been used to characterise the photobiologically important direct UVB solar irradiances at 305nm in clear sky conditions at high air masses. Solar images taken from Autumn to Spring were analysed using a custom Python script, written to develop and apply an adaptive threshold to mitigate the effects of both noise and hot-pixel aberrations in the images. The images were taken in an unobstructed area, observing from a solar zenith angle as high as 84° (air mass=9.6) to local solar maximum (up to a solar zenith angle of 23°) to fully develop the calibration model in temperatures that varied from 2°C to 24°C. The mean ozone thickness throughout all observations was 281±18 DU (to 2 standard deviations). A Langley Plot was used to confirm that there were constant atmospheric conditions throughout the observations. The quadratic calibration model developed has a strong correlation between the red colour channel from the smartphone with the Microtops measurements of the direct sun 305nm UV, with a coefficient of determination of 0.998 and very low standard errors. Validation of the model verified the robustness of the method and the model, with an average discrepancy of only 5% between smartphone derived and Microtops observed direct solar irradiances at 305nm. The results demonstrate the effectiveness of using the smartphone image sensor as a means to measure photobiologically important solar UVB radiation. The use of ubiquitous portable technologies, such as smartphones and laptop computers to perform data collection and analysis of solar UVB observations is an example of how scientific investigations can be performed by citizen science based individuals and groups, communities and schools. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Coupling of morphology to surface transport in ion-beam-irradiated surfaces: normal incidence and rotating targets

    Munoz-Garcia, Javier; Cuerno, Rodolfo; Castro, Mario

    2009-01-01

    Continuum models have proved their applicability to describe nanopatterns produced by ion-beam sputtering of amorphous or amorphizable targets at low and medium energies. Here we pursue the recently introduced 'hydrodynamic approach' in the cases of bombardment at normal incidence, or of oblique incidence onto rotating targets, known to lead to self-organized arrangements of nanodots. Our approach stresses the dynamical roles of material (defect) transport at the target surface and of local redeposition. By applying results previously derived for arbitrary angles of incidence, we derive effective evolution equations for these geometries of incidence, which are then numerically studied. Moreover, we show that within our model these equations are identical (albeit with different coefficients) in both cases, provided surface tension is isotropic in the target. We thus account for the common dynamics for both types of incidence conditions, namely formation of dots with short-range order and long-wavelength disorder, and an intermediate coarsening of dot features that improves the local order of the patterns. We provide for the first time approximate analytical predictions for the dependence of stationary dot features (amplitude and wavelength) on phenomenological parameters, that improve upon previous linear estimates. Finally, our theoretical results are discussed in terms of experimental data.

  14. Advancing Solar Irradiance Measurement for Climate-Related Studies: Accurate Constraint on Direct Aerosol Radiative Effect (DARE)

    Tsay, Si-Chee; Ji, Q. Jack

    2011-01-01

    Earth's climate is driven primarily by solar radiation. As summarized in various IPCC reports, the global average of radiative forcing for different agents and mechanisms, such as aerosols or CO2 doubling, is in the range of a few W/sq m. However, when solar irradiance is measured by broadband radiometers, such as the fleet of Eppley Precision Solar Pyranometers (PSP) and equivalent instrumentation employed worldwide, the measurement uncertainty is larger than 2% (e.g., WMO specification of pyranometer, 2008). Thus, out of the approx. 184 W/sq m (approx.263 W/sq m if cloud-free) surface solar insolation (Trenberth et al. 2009), the measurement uncertainty is greater than +/-3.6 W/sq m, overwhelming the climate change signals. To discern these signals, less than a 1 % measurement uncertainty is required and is currently achievable only by means of a newly developed methodology employing a modified PSP-like pyranometer and an updated calibration equation to account for its thermal effects (li and Tsay, 2010). In this talk, we will show that some auxiliary measurements, such as those from a collocated pyrgeometer or air temperature sensors, can help correct historical datasets. Additionally, we will also demonstrate that a pyrheliometer is not free of the thermal effect; therefore, comparing to a high cost yet still not thermal-effect-free "direct + diffuse" approach in measuring surface solar irradiance, our new method is more economical, and more likely to be suitable for correcting a wide variety of historical datasets. Modeling simulations will be presented that a corrected solar irradiance measurement has a significant impact on aerosol forcing, and thus plays an important role in climate studies.

  15. Kinetically directed combination therapy with adriamycin and x-irradiation in a mammary tumor model

    Braunschweiger, P.G.; Schenken, L.L.; Schiffer, L.M.

    1981-01-01

    In the present studies, the interaction of adriamycin (A) and x-irradiation (X) in T1699 mouse mammary tumors was evaluated. Mitotic indices and thymidine labeling indices were determined at various intervals after A or X alone, and after A + X given in combination. The results with A (1.0 mg/kg) and X(200 R) alone suggest that those quantities of each agent induce a G 2 progression delay of 9 to 12 h. The kinetic results after A + X in combination indicated increased S phase transit time and G 2 progression delay. Recovery kinetics after A + X were used to predict optimum sequence intervals for subsequent A + X fractions. Sequential A + X treatment schedules, up to 4 fractions, were designed and evaluated by regrowth delay measurements. The results indicated that the interaction was additive when A and X were given together in combination. Fractionation of A + X to minimize proliferative recovery between fractions resulted in an enhanced antitumor effect

  16. Differential Superiority of Heavy Charged-Particle Irradiation to X-Rays: Studies on Biological Effectiveness and Side Effect Mechanisms in Multicellular Tumor and Normal Tissue Models

    Walenta, Stefan; Mueller-Klieser, Wolfgang

    2016-01-01

    This review is focused on the radiobiology of carbon ions compared to X-rays using multicellular models of tumors and normal mucosa. The first part summarizes basic radiobiological effects, as observed in cancer cells. The second, more clinically oriented part of the review, deals with radiation-induced cell migration and mucositis. Multicellular spheroids from V79 hamster cells were irradiated with X-rays or carbon ions under ambient or restricted oxygen supply conditions. Reliable oxygen enhancement ratios could be derived to be 2.9, 2.8, and 1.4 for irradiation with photons, 12C+6 in the plateau region, and 12C+6 in the Bragg peak, respectively. Similarly, a relative biological effectiveness of 4.3 and 2.1 for ambient pO2 and hypoxia was obtained, respectively. The high effectiveness of carbon ions was reflected by an enhanced accumulation of cells in G2/M and a dose-dependent massive induction of apoptosis. These data clearly show that heavy charged particles are more efficient in sterilizing tumor cells than conventional irradiation even under hypoxic conditions. Clinically relevant doses (3 Gy) of X-rays induced an increase in migratory activity of U87 but not of LN229 or HCT116 tumor cells. Such an increase in cell motility following irradiation in situ could be the source of recurrence. In contrast, carbon ion treatment was associated with a dose-dependent decrease in migration with all cell lines and under all conditions investigated. The radiation-induced loss of cell motility was correlated, in most cases, with corresponding changes in β1 integrin expression. The photon-induced increase in cell migration was paralleled by an elevated phosphorylation status of the epidermal growth factor receptor and AKT-ERK1/2 pathway. Such a hyperphosphorylation did not occur during 12C+6 irradiation under all conditions registered. Comparing the gene toxicity of X-rays with that of particles using the γH2AX technique in organotypic cultures of the oral mucosa, the

  17. Differential Superiority of Heavy Charged-Particle Irradiation to X-Rays: Studies on Biological Effectiveness and Side Effect Mechanisms in Multicellular Tumor and Normal Tissue Models.

    Walenta, Stefan; Mueller-Klieser, Wolfgang

    2016-01-01

    This review is focused on the radiobiology of carbon ions compared to X-rays using multicellular models of tumors and normal mucosa. The first part summarizes basic radiobiological effects, as observed in cancer cells. The second, more clinically oriented part of the review, deals with radiation-induced cell migration and mucositis. Multicellular spheroids from V79 hamster cells were irradiated with X-rays or carbon ions under ambient or restricted oxygen supply conditions. Reliable oxygen enhancement ratios could be derived to be 2.9, 2.8, and 1.4 for irradiation with photons, (12)C(+6) in the plateau region, and (12)C(+6) in the Bragg peak, respectively. Similarly, a relative biological effectiveness of 4.3 and 2.1 for ambient pO2 and hypoxia was obtained, respectively. The high effectiveness of carbon ions was reflected by an enhanced accumulation of cells in G2/M and a dose-dependent massive induction of apoptosis. These data clearly show that heavy charged particles are more efficient in sterilizing tumor cells than conventional irradiation even under hypoxic conditions. Clinically relevant doses (3 Gy) of X-rays induced an increase in migratory activity of U87 but not of LN229 or HCT116 tumor cells. Such an increase in cell motility following irradiation in situ could be the source of recurrence. In contrast, carbon ion treatment was associated with a dose-dependent decrease in migration with all cell lines and under all conditions investigated. The radiation-induced loss of cell motility was correlated, in most cases, with corresponding changes in β1 integrin expression. The photon-induced increase in cell migration was paralleled by an elevated phosphorylation status of the epidermal growth factor receptor and AKT-ERK1/2 pathway. Such a hyperphosphorylation did not occur during (12)C(+6) irradiation under all conditions registered. Comparing the gene toxicity of X-rays with that of particles using the γH2AX technique in organotypic cultures of the oral

  18. The SOD Mimic, MnTE-2-PyP, Protects from Chronic Fibrosis and Inflammation in Irradiated Normal Pelvic Tissues

    Shashank Shrishrimal

    2017-11-01

    Full Text Available Pelvic radiation for cancer therapy can damage a variety of normal tissues. In this study, we demonstrate that radiation causes acute changes to pelvic fibroblasts such as the transformation to myofibroblasts and the induction of senescence, which persist months after radiation. The addition of the manganese porphyrin, MnTE-2-PyP, resulted in protection of these acute changes in fibroblasts and this protection persisted months following radiation exposure. Specifically, at two months post-radiation, MnTE-2-PyP inhibited the number of α-smooth muscle actin positive fibroblasts induced by radiation and at six months post-radiation, MnTE-2-PyP significantly reduced collagen deposition (fibrosis in the skin and bladder tissues of irradiated mice. Radiation also resulted in changes to T cells. At two months post-radiation, there was a reduction of Th1-producing splenocytes, which resulted in reduced Th1:Th2 ratios. MnTE-2-PyP maintained Th1:Th2 ratios similar to unirradiated mice. At six months post-radiation, increased T cells were observed in the adipose tissues. MnTE-2-PyP treatment inhibited this increase. Thus, MnTE-2-PyP treatment maintains normal fibroblast function and T cell immunity months after radiation exposure. We believe that one of the reasons MnTE-2-PyP is a potent radioprotector is due to its protection of multiple cell types from radiation damage.

  19. Transient heat transfer in a directly-irradiated solar chemical reactor for the thermal dissociation of ZnO

    Mueller, R.; Lipinski, W.; Steinfeld, A.

    2008-01-01

    A numerical and experimental investigation is carried out in a solar thermochemical reactor for the thermal dissociation of ZnO at 2000 K using concentrated solar energy. The reactor consists of a cavity-receiver lined with ZnO particles and directly exposed to high-flux irradiation. A transient heat transfer model is formulated to link the rate of radiation, convection, and conduction heat transfer to the reaction kinetics. The radiosity and Monte Carlo methods are applied to obtain the distribution of net radiative fluxes at the internal surfaces of the reactor cavity and at the surface of the ZnO bed. Validation is accomplished in terms of the calculated and measured transient temperature profiles and chemical reaction rates

  20. Direct synthesis of sp-bonded carbon chains on graphite surface by femtosecond laser irradiation

    Hu, A.; Rybachuk, M.; Lu, Q.-B.; Duley, W. W.

    2007-01-01

    Microscopic phase transformation from graphite to sp-bonded carbon chains (carbyne) and nanodiamond has been induced by femtosecond laser pulses on graphite surface. UV/surface enhanced Raman scattering spectra and x-ray photoelectron spectra displayed the local synthesis of carbyne in the melt zone while nanocrystalline diamond and trans-polyacetylene chains form in the edge area of gentle ablation. These results evidence possible direct 'writing' of variable chemical bonded carbons by femtosecond laser pulses for carbon-based applications

  1. ROVIBRATIONALLY RESOLVED DIRECT PHOTODISSOCIATION THROUGH THE LYMAN AND WERNER TRANSITIONS OF H2 FOR FUV/X-RAY-IRRADIATED ENVIRONMENTS

    Gay, C. D.; Porter, R. L.; Stancil, P. C.; Abel, N. P.; Ferland, G. J.; Shaw, G.; Van Hoof, P. A. M.; Williams, R. J. R.

    2012-01-01

    Using ab initio potential curves and dipole transition moments, cross-section calculations were performed for the direct continuum photodissociation of H 2 through the B 1 Σ + u 1 Σ + g (Lyman) and C 1 Π u 1 Σ + g (Werner) transitions. Partial cross-sections were obtained for wavelengths from 100 Å to the dissociation threshold between the upper electronic state and each of the 301 bound rovibrational levels v''J'' within the ground electronic state. The resulting cross-sections are incorporated into three representative classes of interstellar gas models: diffuse clouds, photon-dominated regions, and X-ray-dominated regions (XDRs). The models, which used the CLOUDY plasma/molecular spectra simulation code, demonstrate that direct photodissociation is comparable to fluorescent dissociation (or spontaneous radiative dissociation, the Solomon process) as an H 2 destruction mechanism in intense far-ultraviolet or X-ray-irradiated gas. In particular, changes in H 2 rotational column densities are found to be as large as 20% in the XDR model with the inclusion of direct photodissociation. The photodestruction rate from some high-lying rovibrational levels can be enhanced by pumping from H Lyβ due to a wavelength coincidence with cross-section resonances resulting from quasi-bound levels of the upper electronic states. Given the relatively large size of the photodissociation data set, a strategy is described to create truncated, but reliable, cross-section data consistent with the wavelength resolving power of typical observations.

  2. Software for determining the direction of movement, shear and normal stresses of a fault under a determined stress state

    Álvarez del Castillo, Alejandra; Alaniz-Álvarez, Susana Alicia; Nieto-Samaniego, Angel Francisco; Xu, Shunshan; Ochoa-González, Gil Humberto; Velasquillo-Martínez, Luis Germán

    2017-07-01

    In the oil, gas and geothermal industry, the extraction or the input of fluids induces changes in the stress field of the reservoir, if the in-situ stress state of a fault plane is sufficiently disturbed, a fault may slip and can trigger fluid leakage or the reservoir might fracture and become damaged. The goal of the SSLIPO 1.0 software is to obtain data that can reduce the risk of affecting the stability of wellbores. The input data are the magnitudes of the three principal stresses and their orientation in geographic coordinates. The output data are the slip direction of a fracture in geographic coordinates, and its normal (σn) and shear (τ) stresses resolved on a single or multiple fracture planes. With this information, it is possible to calculate the slip tendency (τ/σn) and the propensity to open a fracture that is inversely proportional to σn. This software could analyze any compressional stress system, even non-Andersonian. An example is given from an oilfield in southern Mexico, in a region that contains fractures formed in three events of deformation. In the example SSLIPO 1.0 was used to determine in which deformation event the oil migrated. SSLIPO 1.0 is an open code application developed in MATLAB. The URL to obtain the source code and to download SSLIPO 1.0 are: http://www.geociencias.unam.mx/ alaniz/main_code.txt, http://www.geociencias.unam.mx/ alaniz/ SSLIPO_pkg.exe.

  3. Design of a sun tracker for the automatic measurement of spectral irradiance and construction of an irradiance database in the 330-1100 nm range

    Canada, J.; Maj, A. [Departamento de Termodinamica Aplicada, Universidad Politecnica de Valencia, Camino de Vera, s/n. 46022 Valencia (Spain); Utrillas, M.P.; Martinez-Lozano, J.A.; Pedros, R.; Gomez-Amo, J.L. [Departamento de Fisica de la Tierra y Termodinamica, Facultat de Fisica, Universitat de Valencia, 46100 Burjassot (Valencia) (Spain)

    2007-10-15

    An automatic global and direct solar spectral irradiance system has been designed based on two LICOR spectro radiometers equipped with fibre optics and remote cosine sensors. To measure direct irradiance a sun tracker based on step motors has been developed. The whole system is autonomous and works continuously. From the measurements provided by this system a spectral irradiance database in the 330-1100 nm range has been created. This database contains normal direct and global horizontal irradiances as well as diffuse irradiance on a horizontal plane, together with total atmospheric optical thickness and aerosol optical depth. (author)

  4. A review of the irradiation evolution of dispersed oxide nanoparticles in the b.c.c. Fe-Cr system: Current understanding and future directions

    Wharry, Janelle P., E-mail: jwharry@purdue.edu [Purdue University, 400 Central Drive, West Lafayette, IN 47907 (United States); Swenson, Matthew J.; Yano, Kayla H. [Boise State University, 1910 University Drive, Boise, ID 83725 (United States)

    2017-04-01

    Thus far, a number of studies have investigated the irradiation evolution of oxide nanoparticles in b.c.c. Fe-Cr based oxide dispersion strengthened (ODS) alloys. But given the inconsistent experimental conditions, results have been widely variable and inconclusive. Crystal structure and chemistry changes differ from experiment to experiment, and the total nanoparticle volume fraction has been observed to both increase and decrease. Furthermore, there has not yet been a comprehensive review of the archival literature. In this paper, we summarize the existing studies on nanoparticle irradiation evolution. We note significant observations with respect to oxide nanoparticle crystallinity, composition, size, and number density. We discuss four possible contributing mechanisms for nanoparticle evolution: ballistic dissolution, Ostwald ripening, irradiation-enhanced diffusion, and homogeneous nucleation. Finally, we propose future directions to achieve a more comprehensive understanding of irradiation effects on oxide nanoparticles in ODS alloys.

  5. Burn-up determination of irradiated uranium oxide by means of direct gama spectrometry and by radiochemical method

    Cunha, I.I.L.; Nastasi, M.J.C.; Lima, F.W.

    1981-09-01

    The burn-up of thermal neutrons irradiated U 3 O 8 (natural uranium) samples has been determined by using both direct gamma spectrometry and radiochemical methods and the results obtained were compared. The fission products 144 Ce, 103 Ru, 106 Ru, 137 Cs and 95 Zr were chosen as burn-up monitors. In order to isolate the radioisotopes chosen as monitors, a radiochemical separation procedure has been established, in which the solvent extraction technique was used to separate cerium, cesium and ruthenium one from the other and all of them from uranium. The separation between zirconium and niobium and of both elements from the other radioisotopes and uranium was accomplished by means of adsorption on a silica-gel column, followed by selective elution of zirconium and of niobium. When use was made of the direct gamma-ray spectrometry method, the radioactivity of each nuclide of interest was measured in presence of all others. For this purpose use was made of gamma-ray spectrometry and of a Ge-Li detector. Comparison of burn-up values obtained by both methods was made by means of Student's 't' test, and this showed that results obtained in each case are statistically equal. (Author) [pt

  6. Modulation of the Rho/ROCK pathway in heart and lung after thorax irradiation reveals targets to improve normal tissue toxicity.

    Monceau, Virginie; Pasinetti, Nadia; Schupp, Charlotte; Pouzoulet, Fred; Opolon, Paule; Vozenin, Marie-Catherine

    2010-11-01

    The medical options available to prevent or treat radiation-induced injury are scarce and developing effective countermeasures is still an open research field. In addition, more than half of cancer patients are treated with radiation therapy, which displays a high antitumor efficacy but can cause, albeit rarely, disabling long-term toxicities including radiation fibrosis. Progress has been made in the definition of molecular pathways associated with normal tissue toxicity that suggest potentially effective therapeutic targets. Targeting the Rho/ROCK pathway seems a promising anti-fibrotic approach, at least in the gut; the current study was performed to assess whether this target was relevant to the prevention and/or treatment of injury to the main thoracic organs, namely heart and lungs. First, we showed activation of two important fibrogenic pathways (Smad and Rho/ROCK) in response to radiation-exposure to adult cardiomyocytes; we extended these observations in vivo to the heart and lungs of mice, 15 and 30 weeks post-irradiation. We correlated this fibrogenic molecular imprint with alteration of heart physiology and long-term remodelling of pulmonary and cardiac histological structures. Lastly, cardiac and pulmonary radiation injury and bleomycin-induced pulmonary fibrosis were successfully modulated using Rho/ROCK inhibitors (statins and Y-27632) and this was associated with a normalization of fibrogenic markers. In conclusion, the present paper shows for the first time, activation of Rho/ROCK and Smad pathways in pulmonary and cardiac radiation-induced delayed injury. Our findings thereby reveal a safe and efficient therapeutic opportunity for the abrogation of late thoracic radiation injury, potentially usable either before or after radiation exposure; this approach is especially attractive in (1) the radiation oncology setting, as it does not interfere with prior anti-cancer treatment and in (2) radioprotection, as applicable to the treatment of established

  7. Modulation of the ρ/rock pathway in heart and lung after thorax irradiation reveals targets to improve normal tissue toxicity

    Monceau, V.; Pasinetti, N.; Schupp, C.; Pouzoulet, F.; Opolon, P.; Vozenin, M.C.

    2010-01-01

    The medical options available to prevent or treat radiation-induced injury are scarce and developing effective countermeasures is still an open research field. In addition, more than half of cancer patients are treated with radiation therapy, which displays a high antitumor efficacy but can cause, albeit rarely, disabling long-term toxicities including radiation fibrosis. Progress has been made in the definition of molecular pathways associated with normal tissue toxicity that suggest potentially effective therapeutic targets. Targeting the Rho/ROCK pathway seems a promising anti-fibrotic approach, at least in the gut; the current study was performed to assess whether this target was relevant to the prevention and/or treatment of injury to the main thoracic organs, namely heart and lungs. First, we showed activation of two important fibro-genic pathways (Smad and Rho/ROCK) in response to radiation-exposure to adult cardio-myocytes; we extended these observations in vivo to the heart and lungs of mice, 15 and 30 weeks post-irradiation. We correlated this fibro-genic molecular imprint with alteration of heart physiology and long-term remodelling of pulmonary and cardiac histological structures. Lastly, cardiac and pulmonary radiation injury and bleomycin-induced pulmonary fibrosis were successfully modulated using Rho/ROCK inhibitors (statins and Y-27632) and this was associated with a normalization of fibro-genic markers. In conclusion, the present paper shows for the first time, activation of Rho/ROCK and Smad pathways in pulmonary and cardiac radiation-induced delayed injury. Our findings thereby reveal a safe and efficient therapeutic opportunity for the abrogation of late thoracic radiation injury, potentially usable either before or after radiation exposure; this approach is especially attractive in (1) the radiation oncology setting, as it does not interfere with prior anti-cancer treatment and in (2) radioprotection, as applicable to the treatment of

  8. Using deep recurrent neural network for direct beam solar irradiance cloud screening

    Chen, Maosi; Davis, John M.; Liu, Chaoshun; Sun, Zhibin; Zempila, Melina Maria; Gao, Wei

    2017-09-01

    Cloud screening is an essential procedure for in-situ calibration and atmospheric properties retrieval on (UV-)MultiFilter Rotating Shadowband Radiometer [(UV-)MFRSR]. Previous study has explored a cloud screening algorithm for direct-beam (UV-)MFRSR voltage measurements based on the stability assumption on a long time period (typically a half day or a whole day). To design such an algorithm requires in-depth understanding of radiative transfer and delicate data manipulation. Recent rapid developments on deep neural network and computation hardware have opened a window for modeling complicated End-to-End systems with a standardized strategy. In this study, a multi-layer dynamic bidirectional recurrent neural network is built for determining the cloudiness on each time point with a 17-year training dataset and tested with another 1-year dataset. The dataset is the daily 3-minute cosine corrected voltages, airmasses, and the corresponding cloud/clear-sky labels at two stations of the USDA UV-B Monitoring and Research Program. The results show that the optimized neural network model (3-layer, 250 hidden units, and 80 epochs of training) has an overall test accuracy of 97.87% (97.56% for the Oklahoma site and 98.16% for the Hawaii site). Generally, the neural network model grasps the key concept of the original model to use data in the entire day rather than short nearby measurements to perform cloud screening. A scrutiny of the logits layer suggests that the neural network model automatically learns a way to calculate a quantity similar to total optical depth and finds an appropriate threshold for cloud screening.

  9. Effect of acute irradiation on the exocrine secretion of the pancreas in the pig

    Corring, T.; Daburon, F.; Remy, J.

    1975-01-01

    Six fistulated pigs have been used in this experiment to study the effect on the exocrine pancreatic secretion of a partial acute irradiation at 600 rd and 800 rd. Whatever the dose, the irradiation provoked an immediate and temporary decrease of the pancreatic secretion. The normal values were reached after the 8th day post-irradiation. Furthermore, a direct effect on the synthesis of amylase and lipase was shown. The synthesis of trypsin and chymotrypsin was scarcely modified by irradiation. (orig.) [de

  10. Comparison of multiple assays for detecting human antibodies directed against antigens on normal and malignant tissue culture cells

    Rosenberg, S.A.; Schwarz, S.; Anding, H.; Hyatt, C.; Williams, G.M.; Johns Hopkins Univ., Baltimore, Md.

    1977-01-01

    Four separate assays of human antibody reactivity to four separate normal and malignant human tissue culture cells lines from two patients have been evaluated using a single highly-reactive allogeneic serum. The visual end-point cytolysis assay and the chromium-51 release assay were equally sensitive in measuring complement mediated antibody cytotoxicity and both were far more sensitive than a trypan blue dye exclusion assay. The assay of antibody reactivity by hemadsorption technique was about 10 times more sensitive than any of the cytotoxicity assays. This latter assay measures only IgG antibody however. These assays showed that cell lines from different patients may differ greatly in 'reactivity' to an allogeneic serum and emphasized the importance of utilizing tumor and normal cells from the same patient when using tissue culture cells to search for tumor specific reactivity. These observations emphasize the importance of utilizing multiple assays against paired normal and malignant cells from the same patient to be certain of the specificity and magnitude of the measured antibody

  11. Rectal compliance as a routine measurement: extreme volumes have direct clinical impact and normal volumes exclude rectum as a problem.

    Felt-Bersma, R J; Sloots, C E; Poen, A C; Cuesta, M A; Meuwissen, S G

    2000-12-01

    The clinical impact of rectal compliance and sensitivity measurement is not clear. The aim of this study was to measure the rectal compliance in different patient groups compared with controls and to establish the clinical effect of rectal compliance. Anorectal function tests were performed in 974 consecutive patients (284 men). Normal values were obtained from 24 controls. Rectal compliance measurement was performed by filling a latex rectal balloon with water at a rate of 60 ml per minute. Volume and intraballoon pressure were measured. Volume and pressure at three sensitivity thresholds were recorded for analysis: first sensation, urge, and maximal toleration. At maximal toleration, the rectal compliance (volume/pressure) was calculated. Proctoscopy, anal manometry, anal mucosal sensitivity, and anal endosonography were also performed as part of our anorectal function tests. No effect of age or gender was observed in either controls or patients. Patients with fecal incontinence had a higher volume at first sensation and a higher pressure at maximal toleration (P = 0.03), the presence of a sphincter defect or low or normal anal pressures made no difference. Patients with constipation had a larger volume at first sensation and urge (P 500 ml had complaints of constipation. No correlation between rectal and anal mucosal sensitivity was found. Rectal compliance measurement with a latex balloon is easily feasible. In this series of 974 patients, some patient groups showed an abnormal rectal visceral sensitivity and compliance, but there was an overlap with controls. Rectal compliance measurement gave a good clinical impression about the contribution of the rectum to the anorectal problem. Patients with proctitis and pouchitis had the smallest rectal compliance. A maximal toleration volume 500 ml was only seen in constipated patients, and therapy should be given to prevent further damage to the pelvic floor. Values close to or within the normal range rule out the

  12. Evaluating new methods for direct measurement of the moderator temperature coefficient in nuclear power plants during normal operation

    Makai, M.; Kalya, Z.; Nemes, I.; Pos, I.; Por, G.

    2007-01-01

    Moderator temperature coefficient of reactivity is not monitored during fuel cycles in WWER reactors, because it is not very easy or impossible to measure it without disturbing the normal operation. Two new methods were tested in our WWER type nuclear power plant to try methodologies, which enable to measure that important to safety parameter during the fuel cycle. One is based on small perturbances, and only small changes are requested in operation, the other is based on noise methods, which means it is without interference with reactor operation. Both method is new that aspects that they uses the plant computer data(VERONA) based signals calculated by C P ORCA diffusion code (Authors)

  13. High sensitivity but normal DNA-repair activity after UV irradiation in Epstein-Barr virus-transformed lymphoblastoid cell lines from Chediak-Higashi syndrome

    Tanaka, H.; Orii, T.

    1980-01-01

    We established lymphoblastoid cell lines from 2 children with Chediak-Higashi syndrome (CHS), 2 xeroderma pigmentosum (XP) patients and control donors after transformation of peripheral lymphocytes by Epstein-Barr virus (EBV). We used these lymphoblastoid cell lines to investigate repair activity after ultraviolet irradiation. Cell survival of both CHS lymphoblastoid cell lines after irradiation by UV and treatment by 4-nitroquinoline 1-oxide (4NQO) fell between those of the XP and control cells lines. Unscheduled DNA synthesis of CHS cells after UV irradiation occured at rates similar to those of control cells. (orig.)

  14. Ultrastructural and cytochemical study of membrane alterations in x-irradiated liver tissue from normal and vitamin E-deficient ducklings

    Huijbers, W.A.R.; Oosterbaan, J.A.; Meskendorp-Haarsma, T.J.; Hardonk, M.J.; Molenaar, I.

    1979-01-01

    An investigation into the differential susceptibility of liver cellular membranes to peroxidative processes has been performed, using x irradiation on the liver surface, resulting in a a 3-mm penetrating gradient of membrane damage. Ultrastructural, cytochemical, and histochemical findings in this area point to a differential sensitivity of cellular membranes to x irradiation. The plasma membrane and the lysosomal membrane, containing much lipid and cholesterol and little membrane and the lysosomal membrane, containing much lipid and cholesterol and little vitamin E, are highly susceptible to x irradiation. Less sensitive are the membranes of mitochondria and endoplasmic reticulum, containing relatively much vitamin E and proteins and a lower amount of lipids and cholesterol

  15. The angular interval between the direction of progression and body orientation in normal, alcohol- and cocaine treated fruit flies.

    Anna Gakamsky

    Full Text Available In this study we characterize the coordination between the direction a fruit-fly walks and the direction it faces, as well as offer a methodology for isolating and validating key variables with which we phenotype fly locomotor behavior. Our fundamental finding is that the angular interval between the direction a fly walks and the direction it faces is actively managed in intact animals and modulated in a patterned way with drugs. This interval is small in intact flies, larger with alcohol and much larger with cocaine. The dynamics of this interval generates six coordinative modes that flow smoothly into each other. Under alcohol and much more so under cocaine, straight path modes dwindle and modes involving rotation proliferate. To obtain these results we perform high content analysis of video-tracked open field locomotor behavior. Presently there is a gap between the quality of descriptions of insect behaviors that unfold in circumscribed situations, and descriptions that unfold in extended time and space. While the first describe the coordination between low-level kinematic variables, the second quantify cumulative measures and subjectively defined behavior patterns. Here we reduce this gap by phenotyping extended locomotor behavior in terms of the coordination between low-level kinematic variables, which we quantify, combining into a single field two disparate fields, that of high content phenotyping and that of locomotor coordination. This will allow the study of the genes/brain/locomotor coordination interface in genetically engineered and pharmacologically manipulated animal models of human diseases.

  16. Direct observation of solute segregation to voids in a fast-neutron irradiated (Mo/1.0 at. % Ti alloy

    Wagner, A.; Seidman, D.N.

    1978-11-01

    The atom-probe field-ion microscope was used to study segregation effects to voids in a Mo--Ti alloy which had been irradiated with fast neutrons. The Ti does not segregate significantly to voids, concentration of Ti in solid solution and the spacial distribution of Ti was not affected by irradiation, carbon was not detected, resolution of TiC or MoC precipitates did not occur

  17. Salt flow direction and velocity during subsalt normal faulting and syn-kinematic sedimentation—implications from analytical calculations

    Warsitzka, M.; Kukowski, N.; Kley, J.

    2018-04-01

    Salt flow induced by subsalt normal faulting is mainly controlled by tilting of the salt layer, the amount of differential loading due to syn-kinematic deposition, and tectonic shearing at the top or the base of the salt layer. Our study addresses the first two mechanisms and aims to examine salt flow patterns above a continuously moving subsalt normal fault and beneath a syn-kinematic minibasin. In such a setting, salt either tends to flow down towards the basin centre driven by its own weight or is squeezed up towards the footwall side owing to loading differences between the minibasin and the region above the footwall block. Applying isostatic balancing in analytical models, we calculated the steady-state flow velocity in a salt layer. This procedure gives insights into (1) the minimum vertical offset required for upward flow to occur, (2) the magnitude of the flow velocity, and (3) the average density of the supra-salt cover layer at the point at which upward flow starts. In a sensitivity study, we examined how the point of flow reversal and the velocity patterns are influenced by changes of the salt and cover layer thickness, the geometry of the cover flexure, the dip of the subsalt fault, compaction parameters of the supra-salt cover, the salt viscosity and the salt density. Our model results reveal that in most geological scenarios, salt flow above a continuously displacing subsalt normal fault goes through an early phase of downward flow. At sufficiently high fault offset in the range of 700-2600 m, salt is later squeezed upward towards the footwall side. This flow reversal occurs at smaller vertical fault displacement, if the thickness of the pre-kinematic layer is larger, the sedimentation rate of the syn-kinematic cover is higher, the compaction coefficient of cover sediments (i.e. the density increase with depth) is larger or the average density of the salt is lower. Other geometrical parameters such as the width of the cover monocline, the dip of the

  18. Effect of repeated addition of irradiated and normal sewage sludges on the uptake of macro - and micronutrients by wheat and sunflower crops grown successively on an inceptisol

    Ramachandran, V.; Patel, D.U.; Athalye, V.V.; D'Souza, T.J.

    2003-01-01

    Microplot field experiments were conducted to evaluate the uptake of macro - and micronutrients by wheat (Triticum sativum L. cv. Kalyan Sona) and sunflower (Helianthus annuus L. cv. Morden) as 5th and 6th crops. respectively, grown on an inceptisol amended with normal sewage sludge (NSS) and irradiated sewage sludge (ISS) at the application rates of 0, 2, 4, 6 and 8 t ha -1 . Results indicated no significant differences in the dry matter yield (DMY) between the various treatments of either shoot or grain of both the crops. In general DMY of shoot was more than that of grain and also the DMY of wheat crop was more than that of sunflower. Data on the N, P, K contents of the two crops revealed no significant differences at the different treatments of both NSS and ISS; however, the different levels of NSS and ISS significantly enhanced the shoot N content of wheat, whereas grain P content of sunflower was significantly reduced. Nitrogen and P uptake in grain was higher than that of shoot of both the crops, but reverse was true for K. In general, N and P contents were higher in sunflower crop as compared to wheat crop and the opposite trend was obtained for K content. Results on the micronutrient contents of the two crops indicated an enhancement in the Cu and Zn contents of wheat crop by both NSS and ISS at different rates of application. Copper and Mn contents in wheat shoot were higher than that of wheat grain and the reverse was obtained for Zn. Copper, Zn and Mn contents of wheat shoot were lower than that of previous crops. Data on the micronutrient contents of sunflower crop indicated no significant differences between the different levels of NSS and ISS application. Manganese content of sunflower grain was higher than that of shoot and the opposite trend was noticed for Cu and Zn. Soil analysis after harvest of wheat crop indicated a significant enhancement in the soil characteristics such as pH, organic C and total N due to various levels of NSS and ISS

  19. Direct assignment of molecular vibrations via normal mode analysis of the neutron dynamic pair distribution function technique

    Fry-Petit, A. M.; Sheckelton, J. P.; McQueen, T. M.; Rebola, A. F.; Fennie, C. J.; Mourigal, M.; Valentine, M.; Drichko, N.

    2015-01-01

    For over a century, vibrational spectroscopy has enhanced the study of materials. Yet, assignment of particular molecular motions to vibrational excitations has relied on indirect methods. Here, we demonstrate that applying group theoretical methods to the dynamic pair distribution function analysis of neutron scattering data provides direct access to the individual atomic displacements responsible for these excitations. Applied to the molecule-based frustrated magnet with a potential magnetic valence-bond state, LiZn 2 Mo 3 O 8 , this approach allows direct assignment of the constrained rotational mode of Mo 3 O 13 clusters and internal modes of MoO 6 polyhedra. We anticipate that coupling this well known data analysis technique with dynamic pair distribution function analysis will have broad application in connecting structural dynamics to physical properties in a wide range of molecular and solid state systems

  20. Normal and system lupus erythematosus red blood cell interactions studied by double trap optical tweezers: direct measurements of aggregation forces

    Khokhlova, Maria D.; Lyubin, Eugeny V.; Zhdanov, Alexander G.; Rykova, Sophia Yu.; Sokolova, Irina A.; Fedyanin, Andrey A.

    2012-02-01

    Direct measurements of aggregation forces in piconewton range between two red blood cells in pair rouleau are performed under physiological conditions using double trap optical tweezers. Aggregation and disaggregation properties of healthy and pathologic (system lupus erythematosis) blood samples are analyzed. Strong difference in aggregation speed and behavior is revealed using the offered method which is proposed to be a promising tool for SLE monitoring at single cell level.

  1. Differential expression of genome in the progeny doubling 40 generations of normal human liver cells irradiated by 60Co γ rays

    Zuo Yahui; Wang Fang; Geng Xiaohua; Wang Xiaoli; Li Jianguo; Wang Zhongwen; Tong Jian

    2008-01-01

    In order to investigate the differential expression of genome in nomal human liver cell irradiated by 60 Co γ rays, cDNA chip was applied to assay the alterations of transcriptional profile of nomal human liver cell'rogeny exposed to 4 Gy and 8 Gy of γ ray from 60 Co. Then Quantitative real-time PCR was used to confirm the commonly changed genes including VTN and INSIG1. The results demonstrated that the transcription level of 58 genes changed in the progeny of survival cells irradiated by 4 Gy γ rays, while 882 genes changed in the progeny of survival cells irradiated by 8 Gy γ rays. 16 genes changed in these cells irradiated by both 4 and 8 Gy γ rays. The transcription level was correlated to the original irradiation dose. Most of the genes were associated with transduction, cell cycle regulation, cellular immunity, cytoskeleton and movement, cell replication and repair mechanism, etc. The changed transcriptional level was further confirmed by RT-PCR assay for some of these genes. The results showed that differential expression of genome irradiated by different doses of γ rays. These results offer the fundamental materials for the research of genomic instability induced by radiation on the molecular level. (authors)

  2. A cytochemical study of histones in the muscular cells of Triturus cristatus limbs in normal regeneration of limbs irradiated by X-rays, of irradiated limbs in which the regenerative power is restored by cartilage implants

    Desselle, J.-C.

    1976-01-01

    The muscular cells of regenerating limbs and of limbs in which regenerative power is restored, show an important decrease in the amount of cytophotometrically detected histones. This decrease is owing to the arginine rich fraction and to the lysine rich fraction. The muscular cells of irradiated limbs show a decrease in the amount of histones. This decrease is owing only to the arginine rich fraction and continues after the thirtieth day of irradiation and amputation [fr

  3. Estimation of the dose to the nursing infant due to direct irradiation from activity present in maternal organs and tissues

    Hunt, J. G.; Nosske, D.; Dos Santos, D. S.

    2005-01-01

    Radionuclides deposited internally in the mother will give rise to a radiation dose in the infant in two ways. The radionuclides may be transferred through milk and give rise to an internal dose in the infant, or the radionuclides may emit photons that are absorbed by the infant, giving rise to an external dose. In this paper, the external dose to the newborn infant caused by direct irradiation was estimated for monoenergetic photons. Voxel models (also called voxel phantoms) of the mother and infant were made in three geometries. These models, consisting of volume elements, or voxels, were designed so that the infant model was placed in the lap, at the breast and on the shoulder of the mother model. The Visual Monte Carlo (VMC) code was used to transport the photons through the voxel models. Source regions for the emitted photons, such as the whole body, the thyroid, the lung, the liver and the skeleton, were chosen. For the validation of the calculation procedure, VMC results were favourably compared with the results obtained by using other Monte Carlo programs and also with the previously published results for specific absorbed fractions. This paper provides estimates of the external dose per photon to the infant for photon energies between 0.05 and 2.5 MeV. The external dose per photon estimates were made for the three geometries and for the sources listed above. The results show that, for the geometry of the nursing infant model at the breast, the highest dose to the infant per photon comes from radionuclides deposited in the mother's liver. For the nursing infant model at the shoulder, the highest dose to the infant per photon comes from radionuclides deposited in the mother's thyroid, and for the nursing infant model in the lap, the highest dose to the infant per photon comes from radionuclides deposited uniformly in the whole body. The dose per photon results were then used to estimate the dose an infant might receive over the lactation period (6 months

  4. Pyro-electrochemical reprocessing of irradiated MOX fast reactor fuel, testing of the reprocessing process with direct MOX fuel production

    Kormilitzyn, M.V.; Vavilov, S.K.; Bychkov, A.V.; Skiba, O.V.; Chistyakov, V.M.; Tselichshev, I.V

    2000-07-01

    One of the advanced technologies for fast reactor fuel recycle is pyro-electrochemical molten salt technology. In 1998 we began to study the next phase of the irradiated oxide fuel reprocessing new process MOX {yields} MOX. This process involves the following steps: - Dissolution of irradiated fuel in molten alkaline metal chlorides, - Purification of melt from fission products that are co-deposited with uranium and plutonium oxides, - Electrochemical co-deposition of uranium and plutonium oxides under the controlled cathode potential, - Production of granulated MOX (crushing,salt separation and sizing), and - Purification of melt from fission products by phosphate precipitation. In 1998 a series of experiments were prepared and carried out in order to validate this process. It was shown that the proposed reprocessing flowsheet of irradiated MOX fuel verified the feasibility of its decontamination from most of its fission products (rare earths, cesium) and minor-actinides (americium, curium)

  5. Pyro-electrochemical reprocessing of irradiated MOX fast reactor fuel, testing of the reprocessing process with direct MOX fuel production

    Kormilitzyn, M.V.; Vavilov, S.K.; Bychkov, A.V.; Skiba, O.V.; Chistyakov, V.M.; Tselichshev, I.V.

    2000-01-01

    One of the advanced technologies for fast reactor fuel recycle is pyro-electrochemical molten salt technology. In 1998 we began to study the next phase of the irradiated oxide fuel reprocessing new process MOX → MOX. This process involves the following steps: - Dissolution of irradiated fuel in molten alkaline metal chlorides, - Purification of melt from fission products that are co-deposited with uranium and plutonium oxides, - Electrochemical co-deposition of uranium and plutonium oxides under the controlled cathode potential, - Production of granulated MOX (crushing,salt separation and sizing), and - Purification of melt from fission products by phosphate precipitation. In 1998 a series of experiments were prepared and carried out in order to validate this process. It was shown that the proposed reprocessing flowsheet of irradiated MOX fuel verified the feasibility of its decontamination from most of its fission products (rare earths, cesium) and minor-actinides (americium, curium)

  6. Food irradiation

    Anon.

    1984-01-01

    Food preservation by irradiation is one part of Eisenhower's Atoms for Peace program that is enjoying renewed interest. Classified as a food additive by the Food, Drug, and Cosmetic Act of 1958 instead of a processing technique, irradiation lost public acceptance. Experiments have not been done to prove that there are no health hazards from gamma radiation, but there are new pressures to get Food and Drug Administration approval for testing in order to make commercial use of some radioactive wastes. Irradiation causes chemical reactions and nutritional changes, including the destruction of several vitamins, as well as the production of radiolytic products not normally found in food that could have adverse effects. The author concludes that, lacking epidemiological evidence, willing buyers should be able to purchase irradiated food as long as it is properly labeled

  7. Direct calculation of unambiguous electron-density distributions of Langmuir-Blodgett films normal to the membrane plane

    Frieling, M. von; Bradaczek, H.

    1990-01-01

    In regard to X-ray diffraction, Langmuir-Blodgett (LB) films consisting of lipid bilayers represent a 'one-dimensional crystal' with a very small number of unit cells in the direction of stacking. Such bounded systems yield X-ray diffraction diagrams which, in certain respects, contain more information than those of the conventional effectively infinite single crystals. This additional information consists of the profiles of the broadened reflections and their dislocation from the reciprocal-lattice points. These profiles are specific for each different structure and hence enable the direct calculation of unambiguous electron-density distributions from a single set of intensity data. At first, the Q function (the generalized Patterson function), i.e. the distance statistics of the structure sought after is calculated from the intensity data. Thereafter, the unambiguous convolution square root of the Q function must be determined, which is identical to the unknown electron-density distribution. For this purpose two mathematically completely different methods were established and compared. They were applied to diffraction patterns of Langmuir-Blodgett films of simple synthetic lipids with characteristic molecular subunits and showed identical results within the experimental resolution. This verifies the structures and the methods to calculate them. Furthermore, all features of the simple structures were compatible with the expectations. All one-dimensional electron-density distributions showed the common features of lipid bilayers. The characteristic molecular subunits can be recognized and reveal some interesting details. In general, they yield information about orientation, conformation and localization of molecular subunits and membrane components. (orig.)

  8. Direct writing Eu3+-doped Ba2TiSi2O8 crystalline pattern by femtosecond laser irradiation

    Zhu Bin; Dai Ye; Ma Hongliang; Zhang Songmin; Qiu Jianrong

    2008-01-01

    A femtosecond laser with 800 nm, 250 kHz and 150 fs has been used to irradiate Eu 3+ -doped BaO-TiO 2 -SiO 2 glasses. It is found from micro-Raman spectra and optical microscope that crystalline dots and lines are formed around the focal point of the femtosecond laser beam. Both blue emission at 400 nm due to the second harmonic generation and red emission due to the transitions of Eu 3+ are observed from the irradiation region with the precipitation of Ba 2 TiSi 2 O 8 crystal. The mechanism of the observed phenomenon is discussed

  9. Direct observation of gliding dislocations interactions with defects in irradiated niobium single crystals by means of the high voltage electronic microscopy (HVEM)

    Otero, M.P.

    1985-01-01

    The interactions of gliding dislocations with defects in irradiated niobium that result in the formation of dislocations channels. The effects in the mechanical behaviour of [941]- and [441]- oriented Nb single crystals due to oxygen addition, neutron and electron irradiation was observed either by macroscopic deformation in a Instron machine or 'in-situ' deformation in the HVEM-High Voltage Electron Microscope. Some specimens were irradiated at IPNS-Intense Pulsed Neutron Source, at 325 K, with 5 x 10 17 n/cm 2 , others were irradiated with electrons in the HVEM. The interactions between gliding dislocations with clusters point defects and dislocations were observed. The primary mechanism for removal of the clusters by the gliding dislocations was the 'sweeping' of the clusters along with the gliding dislocations. As to the point defects, they were 'swept' by the gliding dislocations and left as aligned loops close to the intersections of the gliding dislocations with the upper and lower specimen surfaces. For the illustration of this phenomena, a schematic drawing was made. The mechanism of 'bowing-out' interaction of dislocations with defect clusters was also observed. The reported anomalous slip observed to operate in the [941]- oriented Nb was also directly observed and a qualitive explanation along with a schematic drawing was proposed. This would explain the softenig observed after the yield stress in the [941]- oriented Nb deformed in the Instron machine. (Author) [pt

  10. Reaction of blood pressure and mesenteric blood flow to infusion of biogenic amines in normal and supralethally x-irradiated rats

    Timmermans, R.; Gerber, G.B.

    1980-01-01

    The responss of blood pressure and mesenteric blood flow were recorded during infusion of biogenic amines (noradrenaline, dopamine, serotonin, acetylcholine, and histamine) to control and x-irradiated rats (first and third days after 2 kR x irradiation). Responses to different doses of the amines were evaluated, and the results obtained correspond to those seen in other species (e.g., an increase in pressure and a decrease in flow after dopamine, an increase in pressure and a decrease in flow after serotonin, a decrease in pressure and flow after acetylcholine, and a decrease in flow after serotonin, a decrease in pressure and flow after acetylcholine, and a decrease in pressure and an increase in flow after histamine). Irradiated animals are more responsive to pressure-raising agents, in particular to noradrenaline. They also have an altered dose-pressure response curve for dopamine

  11. Normal tissue tolerance to external beam radiation therapy: Peripheral nerves; Dose de tolerance a l'irradiation des tissus sains: les nerfs peripheriques

    Henriques de Figueiredo, B.; Dejean, C.; Sargos, P.; Kantor, G. [Departement de radiotherapie, institut Bergonie, centre regional de lutte contre le cancer, 33 - Bordeaux (France); Huchet, A.; Mamou, N. [Service d' oncologie medicale et de radiotherapie, CHU Saint-Andre, 33 - Bordeaux (France); Loiseau, H. [Service de neurochirurgie, CHU Pellegrin, 33 - Bordeaux (France)

    2010-07-15

    Plexopathies and peripheral neuropathies appear progressively and with several years delay after radiotherapy. These lesions are observed principally after three clinical situations: supraclavicular and axillar irradiations for breast cancer, pelvic irradiations for various pathologies and limb irradiations for soft tissue sarcomas. Peripheral nerves and plexus (brachial and lumbosacral) are described as serial structures and are supposed to receive less than a given maximum dose linked to the occurrence of late injury. Literature data, mostly ancient, define the maximum tolerable dose to a threshold of 60 Gy and highlight also a great influence of fractionation and high fraction doses. For peripheral nerves, most frequent late effects are pain with significant differences of occurrence between 50 and 60 Gy. At last, associated pathologies (diabetes, vascular pathology, neuropathy) and associated treatments have probably to be taken into account as additional factors, which may increase the risk of these late radiation complications. (authors)

  12. Effect of Whole-Body X-Irradiation of the Synthesis of Individual Fatty Acids in Liver Slices from Normal and Fasted Rats

    Hansen, Heinz Johs. Max; Hansen, Lisbeth Grænge; Faber, M.

    1965-01-01

    (1) Using (2-14C) acetate and (1-14C) butyrate as precursors, rat-liver fatty acids were synthesized in vitro and assayed by paper chromatography. (2) Whole-body x-irradiation induced a change in the synthetic pattern of hepatic fatty acids towards a relatively enhanced synthesis of palmitic acid....... (3) X-irradiation and fasting seem to have opposite effects on fatty-acid synthesis. X-irradiation counteracts the drop in total synthesis and the relatively enhanced synthesis of palmitoleic acid induced by fasting. The relative enhancement of palmitic-acid synthesis mentioned under (2) stands...... in contrast to the effect of fasting, which specifically decreases the hepatic synthesis of palmitic acid. (4) There is a general similarity between corresponding fatty-acid patterns based on synthesis from (2-14C) acetate and (1-14C) butyrate, respectively....

  13. Hypoxyradiotherapy: lack of experimental evidence for a preferential radioprotective effect on normal versus tumor tissue as shown by direct oxygenation measurements in experimental sarcomas

    Kelleher, Debra K.; Thews, Oliver; Vaupel, Peter

    1997-01-01

    Aim: In order to investigate possible pathophysiological mechanisms underlying the postulated preferential protective effect of hypoxia on normal tissue during radiotherapy, the impact of acute respiratory hypoxia (8.2% O 2 + 91.8% N 2 ) on tissue oxygenation was assessed. Methods: Tumor and normal tissue oxygenation was directly determined using O 2 -sensitive electrodes in two experimental rat tumors (DS and Yoshida sarcomas) and in the normal subcutis of the hind foot dorsum. Results: During respiratory hypoxia, arterial blood O 2 tension (pO 2 ), oxyhemoglobin saturation and mean arterial blood pressure decreased. Changes in the arterial blood gas status were accompanied by a reflex hyperventilation leading to hypocapnia and respiratory alkalosis. In the subcutis, tissue oxygenation worsened during acute hypoxia, with decreases in the mean and median pO 2 . Significant increases in the hypoxic fractions were, however, not seen. In tumor tissues, oxygenation also worsened upon hypoxic hypoxia with significant decreases in the mean and median pO 2 and increases in the size of the hypoxic fractions for both sarcomas. Conclusion: These results suggest that during respiratory hypoxia, radiobiologically relevant reductions in the oxygenation (and a subsequent selective radioprotection) of normal tissue may not be achieved. In addition, in the tumor models studied, a worsening of tumor oxygenation was seen which could result in an increased radioresistance

  14. Anodal transcranial direct current stimulation transiently improves contrast sensitivity and normalizes visual cortex activation in individuals with amblyopia.

    Spiegel, Daniel P; Byblow, Winston D; Hess, Robert F; Thompson, Benjamin

    2013-10-01

    Amblyopia is a neurodevelopmental disorder of vision that is associated with abnormal patterns of neural inhibition within the visual cortex. This disorder is often considered to be untreatable in adulthood because of insufficient visual cortex plasticity. There is increasing evidence that interventions that target inhibitory interactions within the visual cortex, including certain types of noninvasive brain stimulation, can improve visual function in adults with amblyopia. We tested the hypothesis that anodal transcranial direct current stimulation (a-tDCS) would improve visual function in adults with amblyopia by enhancing the neural response to inputs from the amblyopic eye. Thirteen adults with amblyopia participated and contrast sensitivity in the amblyopic and fellow fixing eye was assessed before, during and after a-tDCS or cathodal tDCS (c-tDCS). Five participants also completed a functional magnetic resonance imaging (fMRI) study designed to investigate the effect of a-tDCS on the blood oxygen level-dependent response within the visual cortex to inputs from the amblyopic versus the fellow fixing eye. A subgroup of 8/13 participants showed a transient improvement in amblyopic eye contrast sensitivity for at least 30 minutes after a-tDCS. fMRI measurements indicated that the characteristic cortical response asymmetry in amblyopes, which favors the fellow eye, was reduced by a-tDCS. These preliminary results suggest that a-tDCS deserves further investigation as a potential tool to enhance amblyopia treatment outcomes in adults.

  15. Assessment of necessary regularity of internal irradiation monitoring on the basis of direct and indirect methods of dosimetry

    Malykhin, V.M.; Ivanova, N.I.

    1981-01-01

    It is shown that when assessing the necessary periodicity of internal irradiation monitoring, it is required to take account of the nature (rhythm) of radionuclide intake to the organism during the monitoring period, the effective period of radionuclide biological half-life, its activity in the organism, sensitivity of the technique applied and the labour-consumig character of the monitoring method [ru

  16. The multiplication constant of a microorganism in a colony is normally reduced by irradiation, but still remains as a characteristic constant: a new approach to determining irradiation pasteurization doses

    Yarman, T.; Kiyak, N.

    1991-01-01

    This work is based on a previous observation and on a related mathematical modeling regarding the ‘linear growth’ of a colony of microorganisms under given conditions. We had previously shown that the growth rate of the colony is merely proportional to the ‘individual exponential multiplication constant’, β, of the microorganisms. Tiny colonies of penicillium are subjected to different doses of irradiation. The subsequent observation of the colonies' growth rate beautifully furnishes a measure of how the multiplication constant, β, of the microorganism is affected by irradiation. The plot of β with respect to the irradiation dose, shows a linear interdependence between the two quantities. The extrapolation of this plot easily yields the radiation pasteurization dose of the microorganisms in hand

  17. UVB irradiation does not directly induce detectable changes of DNA methylation in human keratinocytes [v1; ref status: indexed, http://f1000r.es/np

    Christoph Lahtz

    2013-02-01

    Full Text Available Unprotected exposure to UVB radiation from the sun and the resulting DNA damage are thought to be responsible for physiological changes in the skin and for a variety of skin cancers, including basal cell and squamous cell carcinoma and malignant melanoma. Although the mutagenic effects of UVB have been well documented and studied mechanistically, there is only limited information as to whether UV light may also be responsible for inducing epigenetic changes in the genome of exposed cells. DNA methylation is a stable epigenetic modification involved in gene control. To study the effects of UVB radiation on DNA methylation, we repeatedly exposed normal human keratinocytes to a UVB light source. After a recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA method in combination with high-resolution microarrays. Bioinformatics analysis revealed only a limited number of possible differences between UVB-exposed and control cells. However, these minor apparent changes could not be independently confirmed by bisulfite sequencing-based approaches. This study reveals that UVB irradiation of keratinocytes has no recognizable global effect on DNA methylation patterns and suggests that changes in DNA methylation, as observed in skin cancers, are not immediate consequences of human exposure to solar UVB irradiation.

  18. Differential post-irradiation caffeine response in normal diploid versus SV40-transformed human fibroblasts: potential role of nuclear organization and protein-composition

    Taylor, Y.C.; Parsian, A.J.; Duncan, P.G.

    1993-01-01

    To test the hypothesis that the enhancement of cell killing by post-irradiation treatment with caffeine (CAF) is mediated by alterations in chromatin structure, several nuclear parameters were examined in both caffeine-responsive and non-responsive cell lines. (author)

  19. Differential post-irradiation caffeine response in normal diploid versus SV40-transformed human fibroblasts: potential role of nuclear organization and protein-composition

    Taylor, Y.C.; Parsian, A.J.; Duncan, P.G. (Washington Univ., St. Louis, MO (United States). School of Medicine)

    1993-07-01

    To test the hypothesis that the enhancement of cell killing by post-irradiation treatment with caffeine (CAF) is mediated by alterations in chromatin structure, several nuclear parameters were examined in both caffeine-responsive and non-responsive cell lines. (author).

  20. Ionizing radiation and autoimmunity: Induction of autoimmune disease in mice by high dose fractionated total lymphoid irradiation and its prevention by inoculating normal T cells

    Sakaguchi, N.; Sakaguchi, S.; Miyai, K.

    1992-01-01

    Ionizing radiation can functionally alter the immune system and break self-tolerance. High dose (42.5 Gy), fractionated (2.5 Gy 17 times) total lymphoid irradiation (TLI) on mice caused various organ-specific autoimmune diseases, such as gastritis, thyroiditis, and orchitis, depending on the radiation dosages, the extent of lymphoid irradiation, and the genetic background of the mouse strains. Radiation-induced tissue damage is not the primary cause of the autoimmune disease because irradiation of the target organs alone failed to elicit the autoimmunity and shielding of the organs from irradiation was unable to prevent it. In contrast, irradiation of both the thymus and the peripheral lymphoid organs/tissues was required for efficient induction of autoimmune disease by TLI. TLI eliminated the majority of mature thymocytes and the peripheral T cells for 1 mo, and inoculation of spleen cell, thymocyte, or bone marrow cell suspensions (prepared from syngeneic nonirradiated mice) within 2 wk after TLI effectively prevented the autoimmune development. Depletion of T cells from the inocula abrogated the preventive activity. CD4 + T cells mediated the autoimmune prevention but CD8 + T cells did not. CD4 + T cells also appeared to mediate the TLI-induced autoimmune disease because CD4 + T cells from disease-bearing TLI mice adoptively transferred the autoimmune disease to syngeneic naive mice. Taken together, these results indicate that high dose, fractionated ionizing radiation on the lymphoid organs/tissues can cause autoimmune disease by affecting the T cell immune system, rather than the target self-Ags, presumably by altering T cell-dependent control of self-reactive T cells. 62 refs., 9 figs., 2 tabs

  1. IMRT and 3D conformal radiotherapy with or without elective nodal irradiation in locally advanced NSCLC: A direct comparison of PET-based treatment planning.

    Fleckenstein, Jochen; Kremp, Katharina; Kremp, Stephanie; Palm, Jan; Rübe, Christian

    2016-02-01

    The potential of intensity-modulated radiation therapy (IMRT) as opposed to three-dimensional conformal radiotherapy (3D-CRT) is analyzed for two different concepts of fluorodeoxyglucose positron emission tomography (FDG PET)-based target volume delineation in locally advanced non-small cell lung cancer (LA-NSCLC): involved-field radiotherapy (IF-RT) vs. elective nodal irradiation (ENI). Treatment planning was performed for 41 patients with LA-NSCLC, using four different planning approaches (3D-CRT-IF, 3D-CRT-ENI, IMRT-IF, IMRT-ENI). ENI included a boost irradiation after 50 Gy. For each plan, maximum dose escalation was calculated based on prespecified normal tissue constraints. The maximum prescription dose (PD), tumor control probability (TCP), conformal indices (CI), and normal tissue complication probabilities (NTCP) were analyzed. IMRT resulted in statistically significant higher prescription doses for both target volume concepts as compared with 3D-CRT (ENI: 68.4 vs. 60.9 Gy, p ENI, there was a considerable theoretical increase in TCP (IMRT: 27.3 vs. 17.7 %, p ENI: 12.3 vs. 30.9 % p < 0.0001; IF: 15.9 vs. 24.1 %; p < 0.001). The IMRT technique and IF target volume delineation allow a significant dose escalation and an increase in TCP. IMRT results in an improved sparing of OARs as compared with 3D-CRT at equivalent dose levels.

  2. Experimental Results for Direct Electron Irradiation of a Uranyl Sulfate Solution: Bubble Formation and Thermal Hydraulics Studies

    Chemerisov, Sergey [Argonne National Lab. (ANL), Argonne, IL (United States); Gromov, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Makarashvili, Vakhtang [Argonne National Lab. (ANL), Argonne, IL (United States); Heltemes, Thad [Argonne National Lab. (ANL), Argonne, IL (United States); Sun, Zaijing [Argonne National Lab. (ANL), Argonne, IL (United States); Wardle, Kent E. [Argonne National Lab. (ANL), Argonne, IL (United States); Bailey, James [Argonne National Lab. (ANL), Argonne, IL (United States); Stepinski, Dominique [Argonne National Lab. (ANL), Argonne, IL (United States); Jerden, James [Argonne National Lab. (ANL), Argonne, IL (United States); Vandegrift, George F. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2015-01-30

    In support of the development of accelerator-driven production of fission product Mo-99 as proposed by SHINE Medical Technologies, a 35 MeV electron linac was used to irradiate depleted-uranium (DU) uranyl sulfate dissolved in pH 1 sulfuric acid at average power densities of 6 kW, 12 kW, and 15 kW. During these irradiations, gas bubbles were generated in the solution due to the radiolytic decomposition of water molecules in the solution. Multiple video cameras were used to record the behavior of bubble generation and transport in the solution. Seven six-channel thermocouples were used to record temperature gradients in the solution from self-heating. Measurements of hydrogen and oxygen concentrations in a helium sweep gas were recorded by a gas chromatograph to estimate production rates during irradiation. These data are being used to validate a computational fluid dynamics (CFD) model of the experiment that includes multiphase flow and a custom bubble injection model for the solution region.

  3. Experimental Results for Direct Electron Irradiation of a Uranyl Sulfate Solution: Bubble Formation and Thermal Hydraulics Studies

    Chemerisov, Sergey; Gromov, R.; Makarashvili, Vakhtang; Heltemes, Thad; Sun, Zaijing; Wardle, Kent E.; Bailey, James; Stepinski, Dominique; Jerden, James; Vandegrift, George F.

    2015-01-01

    In support of the development of accelerator-driven production of fission product Mo-99 as proposed by SHINE Medical Technologies, a 35 MeV electron linac was used to irradiate depleted-uranium (DU) uranyl sulfate dissolved in pH 1 sulfuric acid at average power densities of 6 kW, 12 kW, and 15 kW. During these irradiations, gas bubbles were generated in the solution due to the radiolytic decomposition of water molecules in the solution. Multiple video cameras were used to record the behavior of bubble generation and transport in the solution. Seven six-channel thermocouples were used to record temperature gradients in the solution from self-heating. Measurements of hydrogen and oxygen concentrations in a helium sweep gas were recorded by a gas chromatograph to estimate production rates during irradiation. These data are being used to validate a computational fluid dynamics (CFD) model of the experiment that includes multiphase flow and a custom bubble injection model for the solution region.

  4. Direct synthesis of graphitic mesoporous carbon from green phenolic resins exposed to subsequent UV and IR laser irradiations

    Sopronyi, Mihai; Sima, Felix; Vaulot, Cyril; Delmotte, Luc; Bahouka, Armel; Matei Ghimbeu, Camelia

    2016-01-01

    The design of mesoporous carbon materials with controlled textural and structural features by rapid, cost-effective and eco-friendly means is highly demanded for many fields of applications. We report herein on the fast and tailored synthesis of mesoporous carbon by UV and IR laser assisted irradiations of a solution consisting of green phenolic resins and surfactant agent. By tailoring the UV laser parameters such as energy, pulse repetition rate or exposure time carbon materials with different pore size, architecture and wall thickness were obtained. By increasing irradiation dose, the mesopore size diminishes in the favor of wall thickness while the morphology shifts from worm-like to an ordered hexagonal one. This was related to the intensification of phenolic resin cross-linking which induces the reduction of H-bonding with the template as highlighted by 13C and 1H NMR. In addition, mesoporous carbon with graphitic structure was obtained by IR laser irradiation at room temperature and in very short time periods compared to the classical long thermal treatment at very high temperatures. Therefore, the carbon texture and structure can be tuned only by playing with laser parameters, without extra chemicals, as usually required. PMID:28000781

  5. Evaluation of fault-normal/fault-parallel directions rotated ground motions for response history analysis of an instrumented six-story building

    Kalkan, Erol; Kwong, Neal S.

    2012-01-01

    According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  6. Effects of cathodal trans-spinal direct current stimulation on lower urinary tract function in normal and spinal cord injury mice with overactive bladder

    Ahmed, Zaghloul

    2017-10-01

    Objective. Lower urinary tract (LUT) dysfunction is a monumental problem affecting quality of life following neurotrauma, such as spinal cord injury (SCI). Proper function of the bladder and its associated structures depends on coordinated activity of the neuronal circuitry in the spinal cord and brain. Disconnection between the spinal and brain centers controlling the LUT causes fundamental changes in the mechanisms involved in the micturition and storage reflexes. We investigated the effects of cathodal trans-spinal direct current stimulation (c-tsDCS) of the lumbosacral spine on bladder and external urinary sphincter (EUS) functions. Approach. We used cystometry and electromyography (EMG), in mice with and without SCI. Main results. c-tsDCS caused initiation of the micturition reflex in urethane-anesthetized normal mice with depressed micturition reflexes. This effect was associated with normalized EUS-EMG activity. Moreover, in urethane-anesthetized normal mice with expressed micturition reflexes, c-tsDCS increased the firing frequency, amplitude, and duration of EUS-EMG activity. These effects were associated with increased maximum intravesical pressure (P max) and intercontraction interval (ICI). In conscious normal animals, c-tsDCS caused significant increases in P max, ICI, threshold pressure (P thres), baseline pressure (P base), and number and amplitude of non-voiding contractions (NVCnumb and P im, respectively). In conscious mice with severe contusive SCI and overactive bladder, c-tsDCS increased P max, ICI, and P thres, but decreased P base, NVCnumb, and P im. c-tsDCS reduced the detrusor-overactivity/cystometry ratio, which is a measure of bladder overactivity associated with renal deterioration. Significance. These results indicate that c-tsDCS induces robust modulation of the lumbosacral spinal-cord circuitry that controls the LUT.

  7. Origins of ion irradiation-induced Ga nanoparticle motion on GaAs surfaces

    Kang, M.; Wu, J. H.; Chen, H. Y.; Thornton, K.; Goldman, R. S.; Sofferman, D. L.; Beskin, I.

    2013-01-01

    We have examined the origins of ion irradiation-induced nanoparticle (NP) motion. Focused-ion-beam irradiation of GaAs surfaces induces random walks of Ga NPs, which are biased in the direction opposite to that of ion beam scanning. Although the instantaneous NP velocities are constant, the NP drift velocities are dependent on the off-normal irradiation angle, likely due to a difference in surface non-stoichiometry induced by the irradiation angle dependence of the sputtering yield. It is hypothesized that the random walks are initiated by ion irradiation-induced thermal fluctuations, with biasing driven by anisotropic mass transport

  8. Removal of spurious normal polarity directions in the Kanapoi Formation with progressive thermal demagnetization: implications for dating Pliocene hominin fossils from the Turkana Basin of Kenya

    Lepre, C. J.; Kent, D.

    2017-12-01

    The Kanapoi Formation is a 75-m-thick sedimentary unit in northern Kenya whose fossil record documents the evolution of the genus Australopithecus and habitual bipedalism in Pliocene hominins. Published 40Ar/39Ar dates of 4.20 to 4.10 Ma for three aqueously reworked tuffs from the lower and middle stratigraphic intervals of the formation and a whole-rock K-Ar date of 3.4 ± 0.1 Ma on the Kalokwanya Basalt, which caps the succession, coupled with paleomagnetic data from an unpublished thesis have been used to constrain the age of the unit (McDougall+2012 J Geol Soc). Normal polarities at the base of the formation were correlated to normal subchron C3n.1n (Cochiti Subchron) and would extend the Kanapoi chronostratigraphy back to between 4.29 and 4.18 Ma. The credibility of the normal polarities at the base and elsewhere in the formation as records of the geomagnetic field at the time of deposition, however, is called into question by the ubiquity of the high-coercivity mineral hematite in the Kanapoi sediments and the alternating field demagnetization methods exclusively used to generate the polarity directions. We tested this proposed chronostratigraphy of the Kanapoi Fm by collecting nearly 70 independently orientated block samples from 10 outcrop localities, which sampled roughly two-thirds of the total stratigraphic thickness of the formation and covered the entire vertical extent of the supposed basal normal polarity magnetozone. For most every specimen, stepwise thermal demagnetization (TD) resolved well-defined characteristic magnetizations of uniformly reverse polarity and were carried by a high-temperature component consistent with hematite. TD of the Kalokwanya Basalt confirmed its reverse magnetic polarity, which implies emplacement most likely prior to the base of normal Chron C2An (Gauss Chron) at 3.58 Ma. Kanapoi sediments thus accumulated sometime during reverse subchron C2Ar (4.18-3.58 Ma) but over a period of much less than 600 kyr. Basal age control

  9. Interactions between intraspinal Schwann cells and the cellular constituents normally occurring in the spinal cord: an ultrastructural study in the irradiated rat

    Sims, T.J.; Gilmore, S.A.

    1983-01-01

    Relationships between intraspinal Schwann cells and neuroglia, particularly astrocytes, were studied following X-irradiation of the spinal cord in 3-day old rats. Initially, this exposure results in a depletion of the neuroglial population. By 10 days post-irradiation (P-I), gaps occur in the glia limitans, although the overlying basal lamina remains intact. Development of and myelination by intraspinal Schwann cells is well underway by 15 days P-I. These Schwann cell-occupied regions have a paucity of astrocyte processes, a finding which persists throughout the study (60 days P-I), and several types of Schwann cell-neuroglial interfaces are observed. The gaps in the glia limitans widen as the P-I interval increases. At 45 and 60 days P-I, the basal lamina no longer forms a singular, continuous covering over the spinal cord surface, but follows instead a rather tortuous course over the disrupted glia limitans and the intraspinal Schwann cells. Although the mode of initial occurrence of Schwann cells within the spinal cord is not yet understood, the data indicate that the astrocyte population is involved in that process, as well as in limiting the further development of Schwann cells within the substance of the spinal cord. (Auth.)

  10. DNA-content in isolated nuclei of postembryonic stages of progeny from normal and irradiated males of Tetranychus urticae (Acari Tetranychidoe)

    Tempelaar, M.J.

    1980-01-01

    The lC DNA-content of isolated nuclei of postembryonic stages of Tetranychus urticae stained with the classic and a modified Schiff's reagent was cytophotometrically estimated as 0.1 pg, a low value in animals. For many tissues of this arrhenotokus species the ploidy ratio between males and females is 1:2, indicating the absence of sex-related differences in ploidy. In addition, DNA measurements were performed to evaluate irradiation-experiments, starting with X-irradiation of mature sperm in males with doses known from previous work to induce chromosomal fragments that are subject to loss and missegregation in the embryonic mitotic stages of the female progeny despite the presumed holokinetic nature of the chromosomes. The DNA-content of the nuclei of the surviving postembryonic preadult stages did not indicate the occurrence of nuclei with in-between male/female values, ruling out loss and missegregation of fragments as important factors in postembryonic lethality. Abnormally low DNA-values in some adult females could be attributed to development of embryos before oviposition caused by radiation-induced effects. (orig.) [de

  11. Study of the direct detection of crosslinking in hydrocarbons by 13C-NMR. II. Identification of crosslink in model compound and application to irradiate paraffins

    Bennett, R.L.; Keller, A.; Stejny, H.H.; Murray, M.

    1976-01-01

    A 13 C-NMR investigation was carried out in aid of direct detection of crosslinks in hydrocarbons with the future objective of studying radiation-induced crosslinking in polyethylene by a direct method. The resonance signal due to a tertiary carbon atom appropriate to a crosslink far remote from molecular ends has been identified in a definitive manner with the aid of the H-shaped model compound 1,1,2,2-tetra(tridecyl)ethane synthetized in Part I of this study. This identification was then put to use in the examination of the irradiated linear paraffins n-hexadecane and n-eicosane, where it enabled the detection of radiation-induced crosslinks. This crosslinking could then be associated with corresponding changes in molecular weight (dimer, trimer formation) as revealed by discrete peaks in the gel-permeation chromatograms of the same samples and randomness of the crosslinking process in the liquid state of these compounds being inferred

  12. Arrangement for selectively irradiating webs

    Ihme, B.

    1975-01-01

    The arrangement for selectively irradiating a web includes a perforated band of a radiation impermeable substance which is guided in an endless path via a pair of guide rollers and has two juxtaposed runs in this path. A take-up roller conveys a web of material past one of the runs at a side thereof remote from the other run, the direction of movement of the web being other than parallel to that of the band and, preferably, normal thereto. An electron accelerator is provided at the far side of the run remote from the web and is effective for directing a radiation beam at the web through the perforations

  13. Development of the apparatus for measuring magnetic properties of electrical steel sheets in arbitrary directions under compressive stress normal to their surface

    Yoshitaka Maeda

    2017-05-01

    Full Text Available In designing motors, one must grasp the magnetic properties of electrical steel sheets considering actual conditions in motors. Especially important is grasping the stress dependence of magnetic power loss. This paper describes a newly developed apparatus to measure two-dimensional (2-D magnetic properties (properties under the arbitrary alternating and the rotating flux conditions of electrical steel sheets under compressive stress normal to the sheet surface. The apparatus has a 2-D magnetic excitation circuit to generate magnetic fields in arbitrary directions in the evaluation area. It also has a pressing unit to apply compressive stress normal to the sheet surface. During measurement, it is important to apply uniform stress throughout the evaluation area. Therefore, we have developed a new flux density sensor using needle probe method. It is composed of thin copper foils sputtered on electrical steel sheets. By using this sensor, the stress can be applied to the surface of the specimen without influence of this sensor. This paper described the details of newly developed apparatus with this sensor, and measurement results of iron loss by using are shown.

  14. Development of the apparatus for measuring magnetic properties of electrical steel sheets in arbitrary directions under compressive stress normal to their surface

    Maeda, Yoshitaka; Urata, Shinya; Nakai, Hideo; Takeuchi, Yuuya; Yun, Kyyoul; Yanase, Shunji; Okazaki, Yasuo

    2017-05-01

    In designing motors, one must grasp the magnetic properties of electrical steel sheets considering actual conditions in motors. Especially important is grasping the stress dependence of magnetic power loss. This paper describes a newly developed apparatus to measure two-dimensional (2-D) magnetic properties (properties under the arbitrary alternating and the rotating flux conditions) of electrical steel sheets under compressive stress normal to the sheet surface. The apparatus has a 2-D magnetic excitation circuit to generate magnetic fields in arbitrary directions in the evaluation area. It also has a pressing unit to apply compressive stress normal to the sheet surface. During measurement, it is important to apply uniform stress throughout the evaluation area. Therefore, we have developed a new flux density sensor using needle probe method. It is composed of thin copper foils sputtered on electrical steel sheets. By using this sensor, the stress can be applied to the surface of the specimen without influence of this sensor. This paper described the details of newly developed apparatus with this sensor, and measurement results of iron loss by using are shown.

  15. IMRT and 3D conformal radiotherapy with or without elective nodal irradiation in locally advanced NSCLC. A direct comparison of PET-based treatment planning

    Fleckenstein, Jochen; Kremp, Katharina; Kremp, Stephanie; Palm, Jan; Ruebe, Christian

    2016-01-01

    The potential of intensity-modulated radiation therapy (IMRT) as opposed to three-dimensional conformal radiotherapy (3D-CRT) is analyzed for two different concepts of fluorodeoxyglucose positron emission tomography (FDG PET)-based target volume delineation in locally advanced non-small cell lung cancer (LA-NSCLC): involved-field radiotherapy (IF-RT) vs. elective nodal irradiation (ENI). Treatment planning was performed for 41 patients with LA-NSCLC, using four different planning approaches (3D-CRT-IF, 3D-CRT-ENI, IMRT-IF, IMRT-ENI). ENI included a boost irradiation after 50 Gy. For each plan, maximum dose escalation was calculated based on prespecified normal tissue constraints. The maximum prescription dose (PD), tumor control probability (TCP), conformal indices (CI), and normal tissue complication probabilities (NTCP) were analyzed. IMRT resulted in statistically significant higher prescription doses for both target volume concepts as compared with 3D-CRT (ENI: 68.4 vs. 60.9 Gy, p < 0.001; IF: 74.3 vs. 70.1 Gy, p < 0.03). With IMRT-IF, a PD of at least 66 Gy was achieved for 95 % of all plans. For IF as compared with ENI, there was a considerable theoretical increase in TCP (IMRT: 27.3 vs. 17.7 %, p < 0.00001; 3D-CRT: 20.2 vs. 9.9 %, p < 0.00001). The esophageal NTCP showed a particularly good sparing with IMRT vs. 3D-CRT (ENI: 12.3 vs. 30.9 % p < 0.0001; IF: 15.9 vs. 24.1 %; p < 0.001). The IMRT technique and IF target volume delineation allow a significant dose escalation and an increase in TCP. IMRT results in an improved sparing of OARs as compared with 3D-CRT at equivalent dose levels. (orig.) [de

  16. Immunocytoadherence and sublethal irradiation

    Beaumariage, M.L.; Hiesche, K.; Revesz, L.; Haot, J.

    1975-01-01

    In sublethally irradiated CBA mice, the relative and absolute numbers of spontaneous rosette forming cells against sheep erythrocytes are markedly decreased in bone marrow. The decrease of the absolute number of spontaneous RFC is also important in the spleen in spite of an increase of the RFC relative number above the normal values between the 8th and 12th day after irradiation. The graft of normal bone marrow cells immediately after irradiation or the shielding of a medullary area during irradiation promotes the recovery of the immunocytoadherence capacity of the bone marrow cells but not of the spleen cells [fr

  17. Repair of DNA lesions induced by ultraviolet irradiation and aromatic amines in normal and repair-deficient human lymphoblastoid cell lines

    Stevnsner, Tinna; Frandsen, Henrik; Autrup, Herman

    1995-01-01

    (AAF) respectively. The cell line belonging to xeroderma pigmentosum complementation group C (XP-C) removed all three types of damage less efficiently than the normal cell line, but more efficiently than the cell line belonging to xeroderma pigmentosum complementation group D (XP-D). The cell line...

  18. Use of /sup 59/Fe uptake in estimating the marrow dose in normal and splenectomized rats exposed to 1000 kVp x irradiation

    Maillie, H D; Baxter, R C; Lisman, H [Rochester Univ., N.Y. (USA). School of Medicine and Dentistry

    1977-11-01

    The /sup 59/Fe uptake system was used to estimate the dose distribution throughout sham-operated and splenectomized rats exposed to whole-body 1000 kVp x irradiation. The marrow in the splenectomized animals was found to be slightly more radiosensitive. However, the difference between the two groups of rats was not significant. The dose distributions throughout the marrow of both groups were the same. It was concluded that splenectomy had no effect on the usefulness of this method. The method of measuring /sup 59/Fe uptake in this study used the uptake of radioiron at 6 hr post-injection and the deduction of the activity due to circulating iron. This resulted in a technique capable of measuring changes in iron uptake with midline-air-exposures of 25 R.

  19. Normal tissue tolerance to external beam radiation therapy: Rectum; Dose de tolerance a l'irradiation des tissus sains: le rectum

    Blanchard, P. [Departement de radiotherapie, institut Gustave-Roussy, 94 - Villejuif (France); Chapet, O. [Service d' oncologie-radiotherapie, centre hospitalier Lyon-Sud, 69 - Pierre-Benite (France)

    2010-07-15

    Radiation proctitis is among the most frequent radiation-induced toxicities. This is related to the high frequency of pelvic tumours and the key role of radiotherapy in the treatment of these tumours. Late rectal toxicity usually occurs within the first two years after the completion of a radiotherapy course. Rectal bleeding and a rectal syndrome are the main symptoms, and can be associated to fistulas or rectal ulcers. Clinical factors, such as diabetes mellitus, a severe acute radiation toxicity, small rectal volume or radiation hypersensitivity, are associated with late rectal toxicity. Dosimetric factors derived from the analysis of dose-volume histograms can also predict the occurrence of radiation proctitis, and help to adapt the prescribed dose and the ballistic of irradiation. (authors)

  20. Normal tissue tolerance to external beam radiation therapy: The stomach; Dose de tolerance a l'irradiation des tissus sains: l'estomac

    Oberdiac, P. [Service de radiotherapie, hopital de Bellevue, CHU de Saint-Etienne, 42 - Saint-Etienne (France); Mineur, L. [Unite d' oncologie digestive et radiotherapie, institut Sainte-Catherine, 84 - Avignon (France)

    2010-07-15

    In the following article, we will discuss general issues relating to acute and late gastric's radiation toxicities. The tolerance of the stomach to complete or partial organ irradiation is more un-appreciated than for most other organs. We consulted the Medline database via PubMed and used the key words gastric - radiotherapy - toxicity. Currently, 60 Gy or less is prescribed in gastric radiation therapy. Acute clinical toxicity symptoms are predominantly nausea and vomiting. Although there is a general agreement that the whole stomach tolerance is for doses of 40 to 45 Gy without unacceptable complication, it is well established that a stomach dose of 35 Gy increases the risk of ulcer complications. (authors)

  1. Development of intraepithelial T lymphocytes in the intestine of irradiated SCID mice by adult liver hematopoietic stem cells from normal mice

    Yamagiwa, Satoshi; Seki, Shuhji; Shirai, Katsuaki; Yoshida, Yuhei; Miyaji, Chikako; Watanabe, Hisami; Abo, Toru

    1999-01-01

    Background/Aims: We recently reported the adult mouse liver to contain c-kit + stem cells that can give rise to multilineage leukocytes. This study was designed to determine whether or not adult mouse liver stem cells can generate intraepithelial T cells in the intestine as well as to examine the possibility that adult liver c-kit + stem cells originate from the fetal liver. Methods: Adult liver mononuclear cells, bone marrow (BM) cells, liver c-kit + cells or bone BM c-kit + cells of BALB/c mice were i.v. transferred into 4 Gy irradiated CB17/-SCID mice. In other experiments, fetal liver cells from Ly5.1 C57BL/6 mice and T cell depleted adult BM cells from Ly5.2 C57BL/6 mice were simultaneously transferred into irradiated C57BL/6 SCID mice (Ly5.2). At 1 to 8 weeks after cell transfer, the SCID mice were examined. Results: Not only BM cells and BM c-kit + cells but also liver mononuclear cells and liver c-kit + cells reconstituted γδT cells, CD4 + CD8 + double-positive T cells and CDiα + β - T cells of intestinal intraepithelial lymphocytes of SCID mice. Injection of a mixture of fetal liver cells from Ly5.1 C57BL/6 mice and adult BM cells from Ly5.2 C57BL/6 mice into Ly5.2 C57BL/6 SCID mice induced both Ly5.1 and Ly5.2 T cells, while also generating c-kit + cells of both Ly5.1 and Ly5.2 origins in the liver. Conclusions: Adult mouse liver stem cells were able to generate intestinal intraepithelial T cells of the SCID mice, and it is thus suggested that some adult liver stem cells may indeed be derived from the fetal liver. (au)

  2. The Direct and Indirect Impact of Pharmaceutical Industry in Economic Expansion and Job Creation: Evidence from Bootstrapping and Normal Theory Methods

    Rizwan Raheem Ahmed

    2018-05-01

    Full Text Available The objective of this research article is to examine the role of Pakistan’s pharmaceutical industry in job creation opportunities, with the sacred intention to eradicate poverty, and expansion in economic activities. This research is quantitative in nature, and the data is directly gathered through closed-ended questionnaires from 300 respondents. Besides predictors’, four mediating variables have also been taken into consideration that contribute indirectly in job creation opportunities. Bootstrapping and Normal theory methods have been employed in order to examine the impact of predictors’ and mediating variables. The result of this research confirmed that pharmaceutical industry plays a vital role in job creation in Pakistan. It is further concluded that the pharmaceutical industry has a direct and significant impact in job creation by providing indigenous and direct job opportunities in sales, marketing, and other supporting departments for both skilled and unskilled workers. Pharmaceutical industry also provides indirect job opportunities through other industries, which are very much linked with this industry, such as: pharmaceutical distributors, dealers, retailers, wholesalers, hotel industry, and event management industry. It is also determined that pharmaceutical industry is acting like knowledge and skills imparting institutions. Therefore, skilled-based training and organizational learning are major mediating variables that transform unskilled people into human assets, which further trigger the future job prospects. Since pharmaceutical industry is one of the biggest industries in Pakistan, providing plenteous opportunities of new jobs with consistent growth. Thus, mediating variables such as motivation and interpersonal influence also preceded an active role in new job creation

  3. Granzyme B mediates both direct and indirect cleavage of extracellular matrix in skin after chronic low-dose ultraviolet light irradiation.

    Parkinson, Leigh G; Toro, Ana; Zhao, Hongyan; Brown, Keddie; Tebbutt, Scott J; Granville, David J

    2015-02-01

    Extracellular matrix (ECM) degradation is a hallmark of many chronic inflammatory diseases that can lead to a loss of function, aging, and disease progression. Ultraviolet light (UV) irradiation from the sun is widely considered as the major cause of visible human skin aging, causing increased inflammation and enhanced ECM degradation. Granzyme B (GzmB), a serine protease that is expressed by a variety of cells, accumulates in the extracellular milieu during chronic inflammation and cleaves a number of ECM proteins. We hypothesized that GzmB contributes to ECM degradation in the skin after UV irradiation through both direct cleavage of ECM proteins and indirectly through the induction of other proteinases. Wild-type and GzmB-knockout mice were repeatedly exposed to minimal erythemal doses of solar-simulated UV irradiation for 20 weeks. GzmB expression was significantly increased in wild-type treated skin compared to nonirradiated controls, colocalizing to keratinocytes and to an increased mast cell population. GzmB deficiency significantly protected against the formation of wrinkles and the loss of dermal collagen density, which was related to the cleavage of decorin, an abundant proteoglycan involved in collagen fibrillogenesis and integrity. GzmB also cleaved fibronectin, and GzmB-mediated fibronectin fragments increased the expression of collagen-degrading matrix metalloproteinase-1 (MMP-1) in fibroblasts. Collectively, these findings indicate a significant role for GzmB in ECM degradation that may have implications in many age-related chronic inflammatory diseases. © 2014 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  4. Preparation of PtRu/C and PtSn/C electrocatalysts using electron beam irradiation for direct and ethanol fuel cell

    Silva, Dionisio Furtunato da

    2009-01-01

    PtRu/C and PtSn/C electrocatalysts were prepared using electron beam irradiation. The metal ions were dissolved in water/2-propanol and water/ethylene glycol solutions and the carbon support was added. The resulting mixtures were irradiated under stirring. The effect of water/ethylene glycol and water/2-propanol (v/v) ratio, Pt:Ru and Pt:Sn atomic ratios, the irradiation time and dose rate were studied. The obtained materials were characterized by Energy dispersive analysis of X-rays (EDX), X-ray diffraction (XRD), cyclic voltammetry (CV) and Moessbauer spectroscopy. The electro-oxidation of methanol and ethanol were studied by cyclic voltammetry and chronoamperometry using the thin porous coating technique. The electrocatalysts were also tested on the Direct Methanol and Ethanol Fuel Cells. PtRu/C electrocatalysts prepared in water/ethylene glycol showed Pt:Ru atomic ratios different from the nominal ones. The results suggested that part of the Ru(III) ions were not reduced. The obtained materials showed the face-centered cubic (fcc) structure of Pt and Pt alloys with crystallite sizes of 2-3 nm. PtRu/C electrocatalysts prepared in water/2-propanol showed Pt:Ru atomic ratios similar to the nominal ones. The obtained materials also showed the fcc structure of platinum and platinum alloys with crystallite sizes of 3-4 nm. PtSn/C electrocatalysts prepared in water/ethylene glycol and water/2-propanol showed Pt:Sn atomic ratios similar to the nominal ones. The obtained materials showed the platinum (fcc) phase with crystallite sizes in the range of 2 - 4 nm and a SnO 2 (cassiterite) phase. The obtained PtRu/C and PtSn/C electrocatalysts showed similar or superior performance for methanol and ethanol electro-oxidation compared to commercial PtRu/C (E-TEK) and PtSn/C (BASF) electrocatalysts. (author)

  5. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  6. Normal tissue tolerance to external beam radiation therapy: Spinal cord; Tolerance a l'irradiation des tissus sains: moelle epiniere

    Habrand, J.L. [Departement de radiotherapie, institut Gustave-Roussy, 94 - Villejuif (France); Centre de protontherapie, institut Curie, 91 - Orsay (France); Drouet, F. [Departement de radiotherapie, centre Rene-Gauducheau, 44 - Nantes (France)

    2010-07-15

    Radiation myelopathy is one of the most dreadful complications of radiation therapy. Despite multiple animal experiments and human autopsic series, its pathogenesis remains largely unknown. In most instances, the classical aspect of myelomalacia combines glial and vascular injuries in various sequences. Recent studies point out the role of oligo-dendrocytes and their precursors, as well as of intercellular mediators (cytokines and stress molecules). The clinical presentation comprises a spectrum of non specific neurological symptoms whose evolution is sometimes regressive but more commonly progressive and life-threatening. Usually, it occurs following a latent period of six months to two years after irradiation of the cervical, thoracic or upper lumbar spine to a dose in excess of 50 Gy, conventionally fractionated. Nonetheless, these typical features can be altered by extrinsic factors, such as hypo fractionation/acceleration of the dose, multiple surgical procedures, chemotherapy especially mega therapy, or neurotoxic drugs. Conversely, hyperfractionated regimens that take into account protracted half-time repair of sublethal damages to the CNS, as well as sophisticated estimates of the dose to the cord and QA programs during the treatment course minimize such risks. (authors)

  7. Role of alkaline endonucleases in the release of soluble chromatin from thymus, spleen and liver nuclei of normal and irradiated mice

    Suciu, D.

    1979-01-01

    Thymus, spleen and liver nuclei released a large fraction of soluble chromatin in vitro when incubation was carried out in sucrose media containing low concentrations of CaCl 2 and/or MgCl 2 . A significant fraction of deoxyribopolynucleotides (DPN) was also extracted from nuclei. After 30 min of incubation at 37 0 C, the maximum release of soluble chromatin was observed near a pH of 8, which corresponds to the optimum pH of the alkaline endonuclease activity from thymus, spleen and liver. The soluble chromatin and DPN were precipitated by increasing the bivalent ion concentration of the medium. The protein/DNA ratio and the molecular weight of DNA suggest that the soluble chromatin and DPN represent nucleosome-like particles. The release of soluble chromatin in the first 4 hours of incubation was significantly increased if the nuclear fraction was isolated from the thymus and spleen of whole-body irradiated mice (1000 rad). This effect was absent in the liver nuclei. (author)

  8. Irradiation device

    Suzuki, Toshimitsu.

    1989-01-01

    In an irradiation device for irradiating radiation rays such as electron beams to pharmaceuticals, etc., since the distribution of scanned electron rays was not monitored, the electron beam intensity could be determined only indirectly and irradiation reliability was not satisfactory. In view of the above, a plurality of monitor wires emitting secondary electrons are disposed in the scanning direction near a beam take-out window of a scanning duct, signals from the monitor wires are inputted into a display device such as a cathode ray tube, as well as signals from the monitor wires at the central portion are inputted into counting rate meters to measure the radiation dose as well. Since secondary electrons are emitted when electron beams pass through the monitor wires and the intensity thereof is in proportion with the intensity of incident electron beams, the distribution of the radiation dose can be monitored by measuring the intensity of the emitted secondary electrons. Further, uneven irradiation, etc. can also be monitored to make the radiation of irradiation rays reliable. (N.H.)

  9. Use of Polymeric and Natural Materials for the Removal of Irradiated Direct and acid Dyes from Effluents

    Dessouki, A.M.; Abdel-Aal, S.E.; Gad, Y.H.

    2000-01-01

    Wastewater effluents from textile plants typically contain appreciable quantities of organic dyes that are resistant to degrade by ordinary treatment processes and constitute a highly visible form of pollution in the receiving waters. Carbon absorption as well as ionizing radiation are used as treatment processes. However, each method alone did not achieve the complete removal of these pollutants. A combined treatment is more effective. The two direct dyes(Direct orange S, Isma fast yellow Rl) were degraded by radiation 76% and 70% ,respectively. Also, the acid dye Sandolane Rubanole E-3 GSL (Acid red 37) was degraded almost to the same extent. Addition of O 2 or H 2 O-2 resulted in a remarkable enhancement in the degradation process. The effect of ph, gamma-dose and dye concentration was studied. Polymeric ion exchangers proved to be more effective in the removal process than clays. However, granular activated carbon (GAC) was the best adsorbent for the direct dyes. Clays proved to be very good adsorbents for two basic dyes than their weak adsorption behavior of the direct ones

  10. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2012-01-01

    that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface......DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption...... of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate...

  11. Industrial X-ray imaging based on scintillators and CMOS APS array: direct X-ray irradiation effects

    Kim, Kwang Hyun; Jeon, Sung Chae; Kim, Young Soo; Cho, Gyuseong

    2005-01-01

    To see the effects of the direct X-ray in a Lanex screen-coupled CMOS APS imager, we measured modulation transfer function (MTF), noise power spectrum (NPS), and detective quantum efficiency (DQE). These measurements were performed under the condition of non-destructive test (NDT). By increasing the cumulative exposure on the imager, the MTF was degraded, and also leading to the DQE degradation. Each parameter changed by the exposure is described in detail

  12. Effect of irradiation power and time on ultrasound assisted co-precipitation of nanostructured CuO–ZnO–Al2O3 over HZSM-5 used for direct conversion of syngas to DME as a green fuel

    Allahyari, Somaiyeh; Haghighi, Mohammad; Ebadi, Amanollah; Hosseinzadeh, Shahin

    2014-01-01

    Graphical abstract: Nanostructured CuO–ZnO–Al 2 O 3 /HZSM-5 catalyst has been prepared by an ultrasound-assisted co-precipitation hybrid method. Effect of power and irradiation time have been studied by changing the time (30–45–60 min) and power of sonication (50–100–150 W) during the synthesis which lead to different physiochemical properties of the catalyst. The XRD, FESEM, EDX, FTIR and BET analyses exhibited smaller particles with higher surface area and less population of particle aggregates at longer and highly irradiated catalysts. Study on the performance of investigated catalysts in direct synthesis of DME from syngas showed ultrasound-assisted co-precipitated synthesized catalysts have superior reactivity and stability compared with non-sonicated catalyst. Among sonicated catalysts, with increasing power and time of irradiation, the catalyst represents higher activity and DME selectivity. - Highlights: • Synthesis of CuO–ZnO–Al 2 O 3 /HZSM-5 by ultrasound assisted co-precipitation method. • Significant changes in morphology and surface area after ultrasound irradiations. • Smaller dispersed particle aggregates in longer and more intense irradiated catalysts. • Improvement in reactivity and stability of the longer and more intense ultrasound irradiated CZAZ catalyst. - Abstract: Nanostructured CuO–ZnO–Al 2 O 3 /HZSM-5 catalyst has been prepared by an ultrasound-assisted co-precipitation hybrid method. The effect of irradiation power and irradiation time have been studied by changing time (30, 45, 60 min) and power of the sonication (50, 100, 150 W) during the synthesis which led to different physiochemical properties of the nanocatalyst. The XRD, FESEM, EDX, FTIR and BET analyses exhibited smaller particles with higher surface area and less population of particle aggregates at longer and highly irradiated nanocatalysts. The nanocatalyst irradiated at 150 W for 60 min (the longest irradiation time and the most intense power

  13. Modified two-body potential approach to the peripheral direct capture astrophysical a+A->B+γ reaction and asymptotic normalization coefficients

    Igamov, S.B.; Yarmukhamedov, R.

    2007-01-01

    A modified two-body potential approach is proposed for determination of both the asymptotic normalization coefficient (ANC) (or the respective nuclear vertex constant (NVC)) for the A+a->B (for the virtual decay B->A+a) from an analysis of the experimental S-factor for the peripheral direct capture a+A->B+γ reaction and the astrophysical S-factor, S(E), at low experimentally inaccessible energy regions. The approach proposed involves two additional conditions which verify the peripheral character of the considered reaction and expresses S(E) in terms of the ANC. The connection between NVC (ANC) and the effective range parameters for Aa-scattering is derived. To test this approach we reanalyse the precise experimental astrophysical S-factors for t+α->Li7+γ reaction at energies E= Li7(g.s.), α+t->Li7(0.478 MeV) and of S(E) at E=<50 keV. These ANC values have been used for getting information about the ''indirect'' measured values of the effective range parameters and the p-wave phase shift for αt-scattering in the energy range of 100-bar E-bar 180 keV

  14. Normal inhibition of DNA synthesis following γ-irradiation of radiosensitive cell lines from patients with Down's syndrome and Alzheimer's disease

    Lavin, M.F.; Le poidevin, P.; Chen, P.C.; Bates, P.

    1989-01-01

    Inhibition of DNA synthesis was studied in γ-iradiated lymphoblastoid cells from patients with Alzheimer's disease and Down's syndrome. A normal biphasic pattern of inhibition was observed over a dose range of 0-4 krad of γ-rays in all of the cell lines 3 out of 4 Down's and all the Alzheimer's cell lines were shown to be hypersensitive to ionizing radiation based on induced chromosomal aberrations. Increased G2 phase delay, comparable to that occurring in ataxia-telangiectasia cells, was observed for some of the cell lines, after exposure to γ-rays. Contrary to other data in the literature these results demonstrate that radioresistand DNA synthesis is not an intrinsic feature of all disorders characterized by radiosensitivitey. (author).; 25 refs.; 2 figs.; 1 tab

  15. Identification of biomarkers of radioresponse and subsequent progression towards lung cancer in normal human bronchial epithelial cells after HZE particle irradiation

    Story, Michael; Ding, Liang-Hao; Park, Seongmi; Minna, John

    Using variants of a non-oncogenically immortalized human bronchial epithelial cell line HBEC3-KT, we have examined global gene expression patterns after low and high LET irradiation up to 24h post-IR. Using supervised analyses we have identified 427 genes whoes expression can be used to discriminate the cellular response to γ-vs Si or Fe particles even when the biological outcome, cell death, is equivalent. Furthermore, genetic background also determines gene expression response. When HBEC3-KT is compared to the HBEC3-KT cells line where mutant k-RAS is over-expressed and p53 has been knocked down, HBEC-3KTr53, principal component analysis clearly shows that the response of each cell resides in a different 3-D space, that is, basal gene expression patterns as well as the gene expression response are unique to each cell type. Using regression analysis to examine these 427 genes show clusters of genes whose temporal expression patterns are the same and which are unique to a given radiation type. Ultimately, this approach will allow for the interrogation of gene promoters to identify response elements that drive how cells respond to different radiation types. We are extending our examination to O particles and are now examining gene expression as a function of beam quality. We have made substantial progress in the determination of cellular transformation by HZE particles for these cell lines. (Transformation as defined by the ability to grow in soft agar.) For HBEC-3KT, the spontaneous transformation frequency is about 10- 7.ExposuretoeitherF eorSiparticlesinc KT r53celllinedidnotshowanyincreaseintransf ormationf requencyaf terdosesof upto1Gy, however, thesp 3KT.W ehavenowisolatedover160individualf ocithatf ormedinsof tagarf romcellculturesthatwereirradia termcultureandthenre-introducedintosof tagartoassurethattheabilitytogrowinsof tagarisclonal.T odatew 30 With these cell isolates in hand we will begin to determine tumorigenicity by subcutaneous injections in nude

  16. Effect of treatment in fractionated schedules with the combination of x-irradiation and six cytotoxic drugs on the RIF-1 tumor and normal mouse skin

    Lelieveld, P.; Scoles, M.A.; Brown, J.M.; Phil, D.; Kallman, R.F.

    1985-01-01

    RIF-1 tumors, implanted syngeneically in the gastrocnemius muscles of the right hind legs of C3H/Km mice, were treated either with X ray alone, drug alone, or drug and X ray combined. The drugs tested were bleomycin, BCNU, cis-diamminedichloro platinum, adriamycin, cyclophosphamide, and actinomycin-D. All drugs were administered either in the maximum tolerated dose or a dose that causes minimal tumor growth delay. Both drugs and X rays were administered either as a single dose or in five daily fractions. In addition to the single modality controls, seven different schedules of combined modalities were tested. Tumors were measured periodically after treatment in order that the day at which each tumor reached 4 times its initial cross-sectional area, i.e., its size at the time of treatment, could be determined. The effect of treatment on tumors was based upon excess growth delay (GD), i.e., T400% (treated)-T400% (untreated control). Treatment effects for the same combined modality schedules were also determined for normal skin, using the early skin reaction as an endpoint. Dose effect factors (DEF) were computed for all combined modality schedules and were based upon calculated radiation dose equivalents. We also calculated supra-additivity ratios, SR/sub I/ and SR/sub II/, therapeutic gain factors and adjusted therapeutic gain factors. The only drugs to produce significant supra-additivity with X rays were cis-Pt and cyclo

  17. 1H-MR spectroscopy and diffusion tensor imaging of normal-appearing temporal white matter in patients with nasopharyngeal carcinoma after irradiation: initial experience.

    Xiong, Wei Feng; Qiu, Shi Jun; Wang, Hong Zhuo; Lv, Xiao Fei

    2013-01-01

    To detect radiation-induced changes of temporal lobe normal-appearing white mater (NAWM) following radiation therapy (RT) for nasopharyngeal carcinoma (NPC). Seventy-five H(1)-MR spectroscopy and diffusion-tensor imaging (DTI) examinations were performed in 55 patients before and after receiving fractionated radiation therapy (total dose; 66-75GY). We divided the dataset into six groups, a pre-RT control group and five other groups based on time after completion of RT. N-acetylaspartic acid (NAA)/choline (Cho), NAA/creatine (Cr), Cho/Cr, mean diffusibility (MD), functional anisotropy (FA), radial diffusibility (λ(⊥)), and axial diffusibility (λ(||)) were calculated. NAA/Cho and NAA/Cr decreased and λ(⊥) increased significantly within 1 year after RT compared with pre-RT. After 1 year, NAA/Cho, NAA/Cr, and λ(⊥) were not significantly different from pre-RT. In all post-RT groups, FA decreased significantly. λ(||) decreased within 9 months after RT compared with pre-RT, but was not significantly different from pre-RT more than 9 months after RT. DTI and H(1)-MR spectroscopy can be used to detect early radiation-induced changes of temporal lobe NAWM following radiation therapy for NPC. Metabolic alterations and water diffusion characteristics of temporal lobe NAWM in patients with NPC after RT were dynamic and transient. Copyright © 2012 Wiley Periodicals, Inc.

  18. Combination of high-intensity focused ultrasound irradiation and hydroxyapatite nanoparticle injection to injure normal goat liver tissue in vivo without costal bone incision.

    Liu, L; Xiao, Z; Xiao, Y; Wang, Z; Li, F; Li, M; Peng, X

    2014-10-20

    The aims of this study were to evaluate the in vivo safety of intravenous nano-hydroxyapatite (nano-HA), to explore how nano-HA might influence the effects of high-intensity focused ultrasound (HIFU) on normal liver tissue, and to investigate whether intravenous nano-HA could enhance HIFU for hepatocellular carcinoma ablation in a goat model. The present study, for the first time, indicated that the delivery of abundant nano-HA into the body over short periods of time could be assembled by the hepatic reticuloendothelial system, subsequently leading to a rapid rise of ultrasound-induced overheating, and ultimately resulting in enlargement of the coagulation necrotic area for ablated hepatocellular carcinoma in goats both in vivo and ex vivo. On the other hand, therapeutic doses of nano-HA were much lower than the lethal dose, and consequently presented transient and mild abnormalities of hepatic enzymes and renal function during the first 24 h after nano-HA injection. These results suggested that the combined application of nano-HA and HIFU is potentially a more effective alternative option compared to surgery for hepatocellular carcinoma local ablation in a safe and feasible manner.

  19. Application of the radiochemical - and the direct gamma ray spectrometry method to the burnup determination of irradiated uranium oxide

    Cunha, I.I.L.

    1979-01-01

    The burn up of natural U 3 O 8 that occurs by the action of thermal neutrons was determined, using the radioisotopes 144 Ce, 137 Cs, 103 Ru, 106 Ru and 95 Zr as monitors. The determination of the burn up was made using both destructive and non-destructive methods. In the non-destructive method, the technique of direct gamma-ray spectrometry was used and the radioisotopes mentioned were simultaneously counted in a Ge-Li detector. In the radiochemical method the same radioisotopes were isolated one from the other and from all other fission products before counting. The solvent extraction technique was used for the radiochemical separation of uranium, cerium, cesium and ruthenium. To separate zirconium and niobium, adsorption in silica-gel was used. The extraction agent employed to isolate cesium was dipycrilamine and for the separation of the other radioisotopes Di-(2-Ethyl Hexyl) Phosphoric acid (HDEHP) was used. (Author) [pt

  20. Comparative human cellular radiosensitivity: I. The effect of SV40 transformation and immortalisation on the gamma-irradiation survival of skin derived fibroblasts from normal individuals and from ataxia-telangiectasia patients and heterozygotes.

    Arlett, C F; Green, M H; Priestley, A; Harcourt, S A; Mayne, L V

    1988-12-01

    We have compared cell killing following 60Co gamma irradiation in 22 primary human fibroblast strains, nine SV40-immortalized human fibroblast lines and seven SV40-transformed pre-crisis human fibroblast cultures. We have examined material from normal individuals, from ataxia-telangiectasia (A-T) patients and from A-T heterozygotes. We have confirmed the greater sensitivity of A-T derived cells to gamma radiation. The distinction between A-T and normal cells is maintained in cells immortalized by SV40 virus but the immortal cells are more gamma radiation resistant than the corresponding primary fibroblasts. Cells transformed by plasmids (pSV3gpt and pSV3neo) expressing SV40 T-antigen, both pre- and post-crisis, show this increased resistance, indicating that it is expression of SV40 T-antigen, rather than immortalization per se which is responsible for the change. We use D0, obtained from a straight line fit, and D, estimated from a multitarget curve, as parameters to compare radiosensitivity. We suggest that both have their advantages; D0 is perhaps more reproducible, but D is more realistic when comparing shouldered and non-shouldered data.

  1. Growth regulation in X-irradiated mouse skin

    Elgjo, K.; Devik, F.

    1978-01-01

    Extracts of hairless mouse skin were tested for their content of epidermal G 1 inhibitor and G 2 inhibitor at daily intervals after X-irradiation with 4 500 or 2 250 rad. After either dose the skin extracts lacked G 1 inhibitory activity on days 5 and 6 respectively after irradiation. This coincided with the time when the epidermal mitotic rate again became normal and started a period of over-shoot. The time interval of 5 to 6 days corresponds to the turnover time of the differentiating cells in hairless mouse back epidermis. The findings indicate that the proliferating cells in epidermis can respond to changes in local chalone concentration, even after X-irradiation at the tested doses, and that the irradiated epidermal cell population still retains some important properties inherent in a cybernetically regulated system. The local G 2 -inhibitory activity also varied after irradiation, but these variations could not be directly related to the corresponding mitotic rates. (author)

  2. Effects of whole-body and partial-body x irradiation upon epidermal mitotic activity during wound healing in mouse skin

    Kobayashi, K.

    1977-01-01

    Mitotic activity of normal (unwounded) and wounded skin was measured in the control (nonirradiated) and whole-body or partial-body x-irradiated mouse. Higher mitotic activity in the anterior than in the posterior region of the body was found in both the normal and the wounded skin of the control mouse. Whole-body irradiation (500 R) depressed completely the mitotic activity of normal skin 2 to 4 days after irradiation. In spite of this depression in mitotic activity, a surgical incision made 1 to 3 days after irradiation could induce a burst of proliferation after an inhibition of an initial mitosis increase. When the animals were partially irradiated with 500 R 3 days before wounding, it was shown that mitosis at 24 hr after wounding was inhibited markedly by the local effect of irradiation and that mitosis also could be inhibited diversely by the abscopal effect of irradiation. Because of a close similarity of sequential mitotic patterns between whole-body-irradiated and flapped-skin-only-irradiated groups (direct irradiation), the effect of irradiation upon mitosis was considered to be primarily local. Some discussions were made concerning the possible reasons which made a difference in mitotic patterns between the head-only-irradiated group, the irradiated group including the head and other parts of the body except for the skin flap

  3. IMRT and 3D conformal radiotherapy with or without elective nodal irradiation in locally advanced NSCLC. A direct comparison of PET-based treatment planning

    Fleckenstein, Jochen; Kremp, Katharina; Kremp, Stephanie; Palm, Jan; Ruebe, Christian [Saarland University Medical School, Department of Radiotherapy and Radiation Oncology, Homburg/Saar (Germany)

    2016-02-15

    The potential of intensity-modulated radiation therapy (IMRT) as opposed to three-dimensional conformal radiotherapy (3D-CRT) is analyzed for two different concepts of fluorodeoxyglucose positron emission tomography (FDG PET)-based target volume delineation in locally advanced non-small cell lung cancer (LA-NSCLC): involved-field radiotherapy (IF-RT) vs. elective nodal irradiation (ENI). Treatment planning was performed for 41 patients with LA-NSCLC, using four different planning approaches (3D-CRT-IF, 3D-CRT-ENI, IMRT-IF, IMRT-ENI). ENI included a boost irradiation after 50 Gy. For each plan, maximum dose escalation was calculated based on prespecified normal tissue constraints. The maximum prescription dose (PD), tumor control probability (TCP), conformal indices (CI), and normal tissue complication probabilities (NTCP) were analyzed. IMRT resulted in statistically significant higher prescription doses for both target volume concepts as compared with 3D-CRT (ENI: 68.4 vs. 60.9 Gy, p < 0.001; IF: 74.3 vs. 70.1 Gy, p < 0.03). With IMRT-IF, a PD of at least 66 Gy was achieved for 95 % of all plans. For IF as compared with ENI, there was a considerable theoretical increase in TCP (IMRT: 27.3 vs. 17.7 %, p < 0.00001; 3D-CRT: 20.2 vs. 9.9 %, p < 0.00001). The esophageal NTCP showed a particularly good sparing with IMRT vs. 3D-CRT (ENI: 12.3 vs. 30.9 % p < 0.0001; IF: 15.9 vs. 24.1 %; p < 0.001). The IMRT technique and IF target volume delineation allow a significant dose escalation and an increase in TCP. IMRT results in an improved sparing of OARs as compared with 3D-CRT at equivalent dose levels. (orig.) [German] Das Potenzial der intensitaetsmodulierten Strahlentherapie (IMRT) soll im Rahmen der FDG-PET basierten Bestrahlungsplanung des lokal fortgeschrittenen nichtkleinzelligen Bronchialkarzinoms (LA-NSCLC) fuer 2 Zielvolumenansaetze (Involved-Field-Bestrahlung, IF) sowie elektive Nodalbestrahlung (ENI) geprueft und mit der 3-D-konformalen Strahlentherapie (3-D

  4. Long-Term Effects of Repeated Prefrontal Cortex Transcranial Direct Current Stimulation (tDCS) on Food Craving in Normal and Overweight Young Adults.

    Ljubisavljevic, M; Maxood, K; Bjekic, J; Oommen, J; Nagelkerke, N

    The dorsolateral prefrontal cortex (DLPFC) plays an important role in the regulation of food intake. Several previous studies demonstrated that a single session of transcranial direct current stimulation (tDCS) of the DLPFC reduces food craving and caloric intake. We hypothesized that repeated tDCS of the right DLPFC cortex may exert long-term changes in food craving in young, healthy adults and that these changes may differ between normal and overweight subjects. Thirty healthy individuals who reported frequent food cravings without a prior history of eating disorders were initially recruited. Subjects were randomized into an ACTIVE group who received 5 days of real tDCS (20 minutes, anode right-cathode left montage, 2 mA with current density kept at 0.06 mA/cm2, 1 min ramp-up/ramp-down), and a SHAM group, who received one day of real tDCS, on the first day (same parameters), followed by 4 days of sham tDCS. Food craving intensity was examined by Food Craving Questionnaires State and Trait and Food Craving Inventory before, during, (5-days) and one month (30-days) after tDCS. Single session of tDCS significantly reduced the intensity of current food craving (FCQ-S). Five days of active tDCS significantly reduced habitual experiences of food craving (FCQ-T), when compared to baseline pre-stimulation levels. Furthermore, both current (FCQ-S) and habitual craving (FCQ-T) were significantly reduced 30 days after active tDCS, while sham tDCS, i.e. a single tDCS session did not have significant effects. Also, active tDCS significantly decreased craving for fast food and sweets, and to a lesser degree for fat, while it did not have significant effects on craving for carbohydrates (FCI). There were no significant differences between individual FCQ-T subscales (craving dimensions) after 5 or 30 days of either sham or active tDCS. Changes in craving were not significantly associated with the initial weight, or with weight changes 30 days after the stimulation in the

  5. Industrial irradiation

    Stirling, Andrew

    1995-01-01

    Production lines for rubber gloves would not appear to have much in common with particle physics laboratories, but they both use accelerators. Electron beam irradiation is often used in industry to improve the quality of manufactured goods or to reduce production cost. Products range from computer disks, shrink packaging, tyres, cables, and plastics to hot water pipes. Some products, such as medical goods, cosmetics and certain foodstuffs, are sterilized in this way. In electron beam irradiation, electrons penetrate materials creating showers of low energy electrons. After many collisions these electrons have the correct energy to create chemically active sites. They may either break molecular bonds or activate a site which promotes a new chemical linkage. This industrial irradiation can be exploited in three ways: breaking down a biological molecule usually renders it useless and kills the organism; breaking an organic molecule can change its toxicity or function; and crosslinking a polymer can strengthen it. In addition to traditional gamma irradiation using isotopes, industrial irradiation uses three accelerator configurations, each type defining an energy range, and consequently the electron penetration depth. For energies up to 750 kV, the accelerator consists of a DC potential applied to a simple wire anode and the electrons extracted through a slot in a coaxially mounted cylindrical cathode. In the 1-5 MeV range, the Cockcroft-Walton or Dynamitron( R ) accelerators are normally used. To achieve the high potentials in these DC accelerators, insulating SF6 gas and large dimension vessels separate the anode and cathode; proprietary techniques distinguish the various commercial models available. Above 5 MeV, the size of DC accelerators render them impractical, and more compact radiofrequency-driven linear accelerators are used. Irradiation electron beams are actually 'sprayed' over the product using a magnetic deflection system. Lower energy beams of

  6. Field-emission property of self-purification SiC/SiOx coaxial nanowires synthesized via direct microwave irradiation using iron-containing catalyst

    Zhou, Qing; Yu, Yongzhi; Huang, Shan; Meng, Jiang; Wang, Jigang

    2017-07-01

    SiC/SiOx coaxial nanowires were rapidly synthesized via direct microwave irradiation in low vacuum atmosphere. During the preparation process, only graphite, silicon, silicon dioxide powders were used as raw materials and iron-containing substance was employed as catalyst. Comprehensive characterizations were employed to investigate the microstructure of the products. The results showed that a great quantity of coaxial nanowires with uniform sizes and high aspect ratio had been successfully achieved. The coaxial nanowires consist of a silicon oxide (SiOx) shell and a β-phase silicon carbide (β-SiC) core that exhibited in special tube brush like. In additional, nearly all the products were achieved in the statement of pure SiC/SiOx coaxial nanowires without the existence of metallic catalyst, indicating that the self-removal of iron (Fe) catalyst should be occurred during the synthesis process. Photoluminescence (PL) spectral analysis result indicated that such novel SiC/SiOx coaxial nanowires exhibited significant blue-shift. Besides, the measurement results of field-emission (FE) demonstrated that the SiC/SiOx coaxial nanowires had ultralow turn-on field and threshold field with values of 0.2 and 2.1 V/μm, respectively. The hetero-junction structure formed between SiOx shell and SiC core, lots of emission sites, as well as clear tips of the nanowires were applied to explain the excellent FE properties.[Figure not available: see fulltext.

  7. Effect of spatial nonuniformity of heating on compression and burning of a thermonuclear target under direct multibeam irradiation by a megajoule laser pulse

    Bel’kov, S. A.; Bondarenko, S. V. [Russian Federal Nuclear Center, All-Russia Research Institute of Experimental Physics (Russian Federation); Vergunova, G. A. [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation); Garanin, S. G. [Russian Federal Nuclear Center, All-Russia Research Institute of Experimental Physics (Russian Federation); Gus’kov, S. Yu.; Demchenko, N. N.; Doskoch, I. Ya. [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation); Zmitrenko, N. V. [Russian Academy of Sciences, Keldysh Institute of Applied Mathematics (Russian Federation); Kuchugov, P. A., E-mail: pkuchugov@gmail.com; Rozanov, V. B.; Stepanov, R. V.; Yakhin, R. A. [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation)

    2017-02-15

    Direct-drive fusion targets are considered at present as an alternative to targets of indirect compression at a laser energy level of about 2 MJ. In this approach, the symmetry of compression and ignition of thermonuclear fuel play the major role. We report on the results of theoretical investigation of compression and burning of spherical direct-drive targets in the conditions of spatial nonuniformity of heating associated with a shift of the target from the beam center of focusing and possible laser radiation energy disbalance in the beams. The investigation involves numerous calculations based on a complex of 1D and 2D codes RAPID, SEND (for determining the target illumination and the dynamics of absorption), DIANA, and NUT (1D and multidimensional hydrodynamics of compression and burning of targets). The target under investigation had the form of a two-layer shell (ablator made of inertial material CH and DT ice) filled with DT gas. We have determined the range of admissible variation of compression and combustion parameters of the target depending on the variation of the spatial nonuniformity of its heating by a multibeam laser system. It has been shown that low-mode (long-wavelength) perturbations deteriorate the characteristics of the central region due to less effective conversion of the kinetic energy of the target shell into the internal energy of the center. Local initiation of burning is also observed in off-center regions of the target in the case of substantial asymmetry of irradiation. In this case, burning is not spread over the entire volume of the DT fuel as a rule, which considerably reduces the thermonuclear yield as compared to that in the case of spherical symmetry and central ignition.

  8. Clarifying Normalization

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  9. Reduction of FFA in jatropha curcas oil via sequential direct-ultrasonic irradiation and dosage of methanol/sulfuric acid catalyst mixture on esterification process

    Andrade-Tacca, Cesar Augusto; Chang, Chia-Chi; Chen, Yi-Hung; Ji, Dar-Ren; Wang, Yi-Yu; Yen, Yue-Quen; Chang, Ching-Yuan

    2014-01-01

    Highlights: • Ultrasonic irradiation (UI) can auto-induce temperature rise. • Esterification at higher temperature (T) by UI offers greater reduction of acid value. • Sequential UI and catalyst dosing enhance esterification conversion efficiency (η). • UR of jatropha oil at higher T results in less water content on ester as product. • A 99.35% of η is achievable via sequential UI and dosing of 5 mL per dose. - Abstract: Production of jatropha-ester (JO-ester) from jatropha oil (JO) under sequential direct-ultrasonic irradiation (UI) with auto-induced temperature rise followed by adding a mixture of methanol/sulfuric-acid catalyst (M/C) dose between high temperature intervals was studied. Comparisons with various doses of 5, 10, 16.6 and 25 mL at different temperature intervals of 108.9–120 °C, 100–120 °C, 85–120 °C and 75–120 °C respectively were performed. System parameters examined include: esterification times (t E ) for UI, settling time (t S ) after esterification and temperature (T). Properties of acid value (AV), iodine value (IV), kinematic viscosity (kV), density (ρ LO ) and water content (m w ) of JO and JO-ester product were measured. The esterification conversion efficiencies (η) were determined and assessed. An η of 99.35% was obtained at temperature interval of 108.9–120 °C with 5 mL per dose for 20 doses and t E of 167.39 min (denoted as Process U 120-5 ), which is slightly higher than η of 98.87% at temperature interval of 75–120 °C with 25 mL per dose for 4 doses and t E of 108.79 min (noted as Process U 120-25 ). The JO-ester obtained via sequential UI with adding doses of 5 mL possess AV of 0.24 mg KOH/g, IV of 124.77 g I 2 /100 g, kV of 9.89 mm 2 /s, ρ LO of 901.73 kg/m 3 and m w of 0.3 wt.% showing that sequential UI and dose at higher temperature interval can give higher reduction of AV compared with 36.56 mg KOH/g of original oil. The effects of t S and t E on AV are of minor and moderate importance

  10. Uniformity of the soft-x-ray emissions from gold foils irradiated by OMEGA laser beams determined by a two-mirror normal-incidence microscope with multilayer coatings

    Seely, John F.; Boehly, Thomas; Pien, Gregory; Bradley, David

    1998-01-01

    A two-mirror normal-incidence microscope with multilayer coatings was used to image the soft-x-ray emissions from planar foils irradiated by OMEGA laser beams. The bandpass of the multilayer coatings was centered at a wavelength of 48.3 Angstrom (257-eV energy) and was 0.5 Angstrom wide. Five overlapping OMEGA beams, without beam smoothing, were typically incident on the gold foils. The total energy was 1500 J, and the focused intensity was 6x10 13 Wcm -2 . The 5.8x magnified images were recorded by a gated framing camera at various times during the 3-ns laser pulse. A pinhole camera imaged the x-ray emission in the energy range of >2 keV. On a spatial scale of 10 μm, it was found that the soft-x-ray images at 257 eV were quite uniform and featureless. In contrast, the hard-x-ray images in the energy range of >2 kev were highly nonuniform with numerous features of size 150 μm. copyright 1998 Optical Society of America

  11. Mathematical model of normal tissue injury in telegammatherapy

    Belov, S.A.; Lyass, F.M.; Mamin, R.G.; Minakova, E.I.; Raevskaya, S.A.

    1983-01-01

    A model of normal tissue injury as a result of exposure to ionizing radiation is based on an assumption that the degree of tissue injury is determined by the degree of destruction by certain critical cells. The dependence of the number of lethal injuriies on a single dose is expressed by a trinomial - linear and quadratic parts and a constant, obtained as a result of the processing of experimental data. Quantitative correlations have been obtained for the skin and brain. They have been tested using clinical and experimental material. The results of the testing point out to the absence of time dependence on a single up to 6-week irradiation cources. Correlation with an irradiation field has been obtained for the skin. A conclusion has been made that the concept of isoefficacy of irradiation cources is conditional. Spatial-time fractionation is a promising direction in the development of radiation therapy

  12. Birkhoff normalization

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  13. In vitro co-culture experiments on prostate cancer and small intestine cells irradiated with carbon ions and x-rays

    Neubeck, C. von; Weyrather, W.-K.; Durante, M.

    2009-01-01

    Intensity modulated radiotherapy (IMRT) delivers the dose in many small irradiation fields of different beam direction to achieve a 3 dimensional tumour conformal dose overlapping with a maximum of normal tissue protection. In 2006 a study was started at GSI to treat prostate cancer patients with a boost irradiation of carbon ions in combination with an IMRT treatment administered at the Uniklinikum Heidelberg. The carbon ions are delivered in two opposing fields. So IMRT irradiation includes more normal tissue than carbon ion treatment but even here parts of the rectum and the bladder are in the irradiated field. This raises the question whether the irradiated tumor cells influence the normal cells (irradiated/ unirradiated) but also whether the normal irradiated cells influences normal tissue in a different way for carbon and photon irradiation. To study this problem, we established an in vitro co-culture model of prostate cancer and small intestine cells of the rat to simulate the patient treatment situation for analyzing tissue reaction exemplary. For characterization of the cells lines the parameters alpha and beta (linear quadratic model) for clonogenic survival were determined for x-rays and for carbon ions of different energies. For co-culture experiments unirradiated and irradiated cells were seeded together and the survival was analyzed

  14. Food irradiation

    Soothill, R.

    1987-01-01

    The issue of food irradiation has become important in Australia and overseas. This article discusses the results of the Australian Consumers' Association's (ACA) Inquiry into food irradiation, commissioned by the Federal Government. Issues discussed include: what is food irradiation; why irradiate food; how much food is consumer rights; and national regulations

  15. DNA-repair, cell killing and normal tissue damage

    Dahm-Daphi, J.; Dikomey, E.; Brammer, I.

    1998-01-01

    Background: Side effects of radiotherapy in normal tissue is determined by a variety of factors of which cellular and genetic contributions are described here. Material and methods: Review. Results: Normal tissue damage after irradiation is largely due to loss of cellular proliferative capacity. This can be due to mitotic cell death, apoptosis, or terminal differentiation. Dead or differentiated cells release cytokines which additionally modulate the tissue response. DNA damage, in particular non-reparable or misrepaired double-strand breaks are considered the basic lesion leading to G1-arrest and ultimately to cell inactivation. Conclusion: Evidence for genetic bases of normal tissue response, cell killing and DNA-repair capacity is presented. However, a direct link of all 3 endpoints has not yet been proved directly. (orig.) [de

  16. Food irradiation

    Lindqvist, H.

    1996-01-01

    This paper is a review of food irradiation and lists plants for food irradiation in the world. Possible applications for irradiation are discussed, and changes induced in food from radiation, nutritional as well as organoleptic, are reviewed. Possible toxicological risks with irradiated food and risks from alternative methods for treatment are also brought up. Ways to analyze weather food has been irradiated or not are presented. 8 refs

  17. Direct Determination of Molecular Weight Distribution of Calf-Thymus DNAs and Study of Their Fragmentation under Ultrasonic and Low-Energy IR Irradiations. A Charge Detection Mass Spectrometry Investigation.

    Halim, Mohammad A; Bertorelle, Franck; Doussineau, Tristan; Antoine, Rodolphe

    2018-06-09

    Calf-thymus (CT-DNA) is widely used as binding agent. The commercial samples are known to be "highly polymerized DNA" samples. CT-DNA is known to be fragile in particular upon ultrasonic wave irradiation. Degradation products might have dramatic consequence on its bio-sensing activity, and an accurate determination of the molecular weight distribution and stability of commercial samples is highly demanded. We investigated the sensitivity of charge detection mass spectrometry (CDMS), a single-molecule MS method, both with single-pass and ion trap CDMS ("Benner" trap) modes to the determination of the composition and stability (under multiphoton IR irradiation) of calf-thymus DNAs. We also investigated the changes of molecular weight distributions in the course of sonication by irradiating ultrasonic wave to CT-DNA. We report for the first time, the direct molecular weight (MW) distribution of DNA sodium salt from calf-thymus revealing two populations at high (~10 MDa) and low (~3 MDa) molecular weights. We evidence a transition between the high-MW to the low-MW distribution, confirming that the low-MW distribution results from degradation of CT-DNA. Finally, we report also IRMPD experiments carried out on trapped single-stranded linear DNAs from calf-thymus allowing to extract their activation energy for unimolecular dissociation. We show that single-pass CDMS is a direct, efficient and accurate MS-based approach to determine the composition of calf-thymus DNAs. Furthermore, ion trap CDMS allows us to evaluate the stability (both under multiphoton IR irradiation and in the course of sonication by irradiating ultrasonic wave) of calf-thymus DNAs. This article is protected by copyright. All rights reserved.

  18. Phototropism and Protein Phosphorylation in Higher Plants: Unilateral Blue Light Irradiation Generates a Directional Gradient of Protein Phosphorylation Across the Oat Coleoptile

    Salomon, M.; Zacherl, M.; Rüdiger, W.

    1997-01-01

    Blue light induces the phosphorylation of a 116 kDa oat protein found in plasma membrane preparations from coleoptile tips. We developed a very sensitive in vitro method that allowed us to determine the tissue distribution of protein phosphorylation after applying unilateral and bilateral blue light pulses in vivo. We found that following unilateral in vivo irradiation the degree in phosphorylation of the 116 kDa protein is significantly higher at the irradiated than at the shaded side of the coleoptile tip. This asymmetry can be considered as previously missing criterion that protein phosphorylation represents an early event within the transduction chain for phototropism. (author)

  19. Making nuclear 'normal'

    Haehlen, Peter; Elmiger, Bruno

    2000-01-01

    irrelevant for readers. The Swiss media's way of handling the contaminated irradiated fuel element transports and their politically delicate resumption in September 1999 after a 15 months ban confirmed the advantage of being treated as a normal industry, even in a peculiar situation, rather than being treated as a special case, even in routine conditions

  20. Food irradiation

    Gruenewald, T

    1985-01-01

    Food irradiation has become a matter of topical interest also in the Federal Republic of Germany following applications for exemptions concerning irradiation tests of spices. After risks to human health by irradiation doses up to a level sufficient for product pasteurization were excluded, irradiation now offers a method suitable primarily for the disinfestation of fruit and decontamination of frozen and dried food. Codex Alimentarius standards which refer also to supervision and dosimetry have been established; they should be adopted as national law. However, in the majority of cases where individual countries including EC member-countries so far permitted food irradiation, these standards were not yet used. Approved irradiation technique for industrial use is available. Several industrial food irradiation plants, partly working also on a contractual basis, are already in operation in various countries. Consumer response still is largely unknown; since irradiated food is labelled, consumption of irradiated food will be decided upon by consumers.

  1. Normalized modes at selected points without normalization

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  2. Network-directed cis-mediator analysis of normal prostate tissue expression profiles reveals downstream regulatory associations of prostate cancer susceptibility loci.

    Larson, Nicholas B; McDonnell, Shannon K; Fogarty, Zach; Larson, Melissa C; Cheville, John; Riska, Shaun; Baheti, Saurabh; Weber, Alexandra M; Nair, Asha A; Wang, Liang; O'Brien, Daniel; Davila, Jaime; Schaid, Daniel J; Thibodeau, Stephen N

    2017-10-17

    Large-scale genome-wide association studies have identified multiple single-nucleotide polymorphisms associated with risk of prostate cancer. Many of these genetic variants are presumed to be regulatory in nature; however, follow-up expression quantitative trait loci (eQTL) association studies have to-date been restricted largely to cis -acting associations due to study limitations. While trans -eQTL scans suffer from high testing dimensionality, recent evidence indicates most trans -eQTL associations are mediated by cis -regulated genes, such as transcription factors. Leveraging a data-driven gene co-expression network, we conducted a comprehensive cis -mediator analysis using RNA-Seq data from 471 normal prostate tissue samples to identify downstream regulatory associations of previously identified prostate cancer risk variants. We discovered multiple trans -eQTL associations that were significantly mediated by cis -regulated transcripts, four of which involved risk locus 17q12, proximal transcription factor HNF1B , and target trans -genes with known HNF response elements ( MIA2 , SRC , SEMA6A , KIF12 ). We additionally identified evidence of cis -acting down-regulation of MSMB via rs10993994 corresponding to reduced co-expression of NDRG1 . The majority of these cis -mediator relationships demonstrated trans -eQTL replicability in 87 prostate tissue samples from the Gene-Tissue Expression Project. These findings provide further biological context to known risk loci and outline new hypotheses for investigation into the etiology of prostate cancer.

  3. Neutron RBE for normal tissues

    Field, S.B.; Hornsey, S.

    1979-01-01

    RBE for various normal tissues is considered as a function of neutron dose per fraction. Results from a variety of centres are reviewed. It is shown that RBE is dependent on neutron energy and is tissue dependent, but is not specially high for the more critical tissues or for damage occurring late after irradiation. (author)

  4. Does TomoDirect 3DCRT represent a suitable option for post-operative whole breast irradiation? A hypothesis-generating pilot study

    Borca, Valeria Casanova; La Porta, Maria Rosa; Cante, Domenico; Sciacero, Piera; Girelli, Giuseppe; Ricardi, Umberto; Tofani, Santi; Franco, Pierfrancesco; Catuzzo, Paola; Migliaccio, Fernanda; Zenone, Flora; Aimonetto, Stefania; Peruzzo, Andrea; Pasquino, Massimo; Russo, Giuliana

    2012-01-01

    This study investigates the use of TomoDirect TM 3DCRT for whole breast adjuvant radiotherapy (AWBRT) that represents a very attractive treatment opportunity, mainly for radiotherapy departments without conventional Linacs and only equipped with helical tomotherapy units. Plans were created for 17 breast cancer patients using TomoDirect in 3DCRT and IMRT modality and field-in-field 3DCRT planning (FIF) and compared in terms of PTV coverage, overdosage, homogeneity, conformality and dose to OARs. The possibility to define patient-class solutions for TD-3DCRT employment was investigated, correlating OARs dose constraints to patient specific anatomic parameters. TD-3DCRT showed PTV coverage and homogeneity significantly higher than TD-IMRT and FIF. PTV conformality was significantly better for FIF, while no differences were found between TD-3DCRT and TD-IMRT. TD-3DCRT showed mean values of the OARs dosimetric endpoints significantly higher than TD-IMRT; with respect to FIF, TD-3DCRT showed values significantly higher for lung V 20Gy , mean heart dose and V 25Gy , while contralateral lung maximum dose and contralateral breast mean dose resulted significantly lower. The Central Lung Distance (CLD) and the maximal Heart Distance (HD) resulted as useful clinical tools to predict the opportunity to employ TD-3DCRT: positive correlations were found between CLD and both V 20Gy and mean lung dose and between HD and both V 25Gy and the mean heart dose. TD-3DCRT showed a significantly shorter mean beam-on time than TD-IMRT. The present study showed that TD-3DCRT and TD-IMRT are two feasible and dosimetrically acceptable treatment approach for AWBRT, with an optimal PTV coverage and adequate OARs sparing. Some concerns might be raised in terms of dose to organs at risks if TD-3DCRT is applied to a general population. A correct patients clusterization according to simple quantitative anatomic measures, would help to correctly allocate patients to the appropriate treatment

  5. Ultrasound assisted co-precipitation of nanostructured CuO-ZnO-Al2O3 over HZSM-5: effect of precursor and irradiation power on nanocatalyst properties and catalytic performance for direct syngas to DME.

    Allahyari, Somaiyeh; Haghighi, Mohammad; Ebadi, Amanollah; Hosseinzadeh, Shahin

    2014-03-01

    Nanostructured CuO-ZnO-Al2O3/HZSM-5 was synthesized from nitrate and acetate precursors using ultrasound assisted co-precipitation method under different irradiation powers. The CuO-ZnO-Al2O3/HZSM-5 nanocatalysts were characterized using XRD, FESEM, BET, FTIR and EDX Dot-mapping analyses. The results indicated precursor type and irradiation power have significant influences on phase structure, morphology, surface area and functional groups. It was observed that the acetate formulated CuO-ZnO-Al2O3/HZSM-5 nanocatalyst have smaller CuO crystals with better dispersion and stronger interaction between components in comparison to nitrate based nanocatalysts. Ultrasound assisted co-precipitation synthesis method resulted in nanocatalyst with more uniform morphology compared to conventional method and increasing irradiation power yields smaller particles with better dispersion and higher surface area. Additionally the crystallinity of CuO is lower at high irradiation powers leading to stronger interaction between metal oxides. The nanocatalysts performance were tested at 200-300 °C, 10-40 bar and space velocity of 18,000-36,000 cm(3)/g h with the inlet gas composition of H2/CO = 2/1 in a stainless steel autoclave reactor. The acetate based nanocatalysts irradiated with higher levels of power exhibited better reactivity in terms of CO conversion and DME yield. While there is an optimal temperature for CO conversion and DME yield in direct synthesis of DME, CO conversion and DME yield both increase with the pressure increase. Furthermore ultrasound assisted co-precipitation method yields more stable CuO-ZnO-Al2O3/HZSM-5 nanocatalyst while conventional precipitated nanocatalyst lost their activity ca. 18% and 58% in terms of CO conversion and DME yield respectively in 24 h time on stream test.

  6. Irradiation of foodstuffs

    Bugyaki, L.

    1977-01-01

    The author studies the criteria for the harmlessness of irradiation as a food-preservation process. The glucose and proteins of bacto-tryptone, irradiated at 5 Mrads, do not increase the Escherichia Coli C 600 lysogenous bacteriophages, compared to the induction produced by direct irradiation of the strain or to the exposition to nitrogenous yperite. The possible mutagenic effect is therefore different. Wheat flour freshly irradiated at 5 Mrads shows physico-chemical changes. When given to mice as 50% of their ration, it leads to a higher incidence of tumours and a greater number of meiotic chromosome alteration (besides some discreet physio-pathological changes in fertility and longevity). Immunoelectrophoresis in agar or agarose gel does not allow any detection of irradiation of meat, fish or eggs. A vertical electrophoresis in starch gel can lead to a differentiation between frozen or chilled meat and the one that is irradiated at 0.5 or 5 Mrads, but the same thing can't be said for fish or eggs. Lastly an irradiated mushroom shows every sign of freshness but, when planted in a suitable medium, its cuttings do not present any cell proliferation which could give a rapid and simple method of detecting the irradiation. (G.C.)

  7. Food irradiation

    Sato, Tomotaro; Aoki, Shohei

    1976-01-01

    Definition and significance of food irradiation were described. The details of its development and present state were also described. The effect of the irradiation on Irish potatoes, onions, wiener sausages, kamaboko (boiled fish-paste), and mandarin oranges was evaluated; and healthiness of food irradiation was discussed. Studies of the irradiation equipment for Irish potatoes in a large-sized container, and the silo-typed irradiation equipment for rice and wheat were mentioned. Shihoro RI center in Hokkaido which was put to practical use for the irradiation of Irish potatoes was introduced. The state of permission of food irradiation in foreign countries in 1975 was introduced. As a view of the food irradiation in the future, its utilization for the prevention of epidemics due to imported foods was mentioned. (Serizawa, K.)

  8. Gamma irradiator

    Simonet, G.

    1986-09-01

    Fiability of devices set around reactors depends on material resistance under irradiation noticeably joints, insulators, which belongs to composition of technical, safety or physical incasurement devices. The irradiated fuel elements, during their desactivation in a pool, are an interesting gamma irradiation device to simulate damages created in a nuclear environment. The existing facility at Osiris allows to generate an homogeneous rate dose in an important volume. The control of the element distances to irradiation box allows to control this dose rate [fr

  9. Food irradiation

    Anon.

    1985-01-01

    The article explains what radiation does to food to preserve it. Food irradiation is of economic importance to Canada because Atomic Energy of Canada Limited is the leading world supplier of industrial irradiators. Progress is being made towards changing regulations which have restricted the irradiation of food in the United States and Canada. Examples are given of applications in other countries. Opposition to food irradiation by antinuclear groups is addressed

  10. Food irradiation

    Beyers, M.

    1977-01-01

    The objectives of food irradiation are outlined. The interaction of irradiation with matter is then discussed with special reference to the major constituents of foods. The application of chemical analysis in the evaluation of the wholesomeness of irradiated foods is summarized [af

  11. : acquired resistance in mice by implantation of young irradiated worms into the portal system

    Paulo Marcos Z. Coelho

    1989-02-01

    Full Text Available In two distinct experiments, immature S. mansoni worms (LE strain, Belo Horizonte, Brazil, aged 20 days, obtained from the portal system of white outbred mice, were irradiated with 14 and 4 Krad, respectively. Afterwards, the worms were directly inoculated into the portal vein of normal mice. Inoculation was performed with 20 irradiated worms per animal. Fifty days after inoculation, the mice that received 4 and 14 Krad-irradiated worms and their respective controls were infected with S. mansoni cercariae (LE strain, by transcutaneous route. Twenty days after this challenge infection, the animals were sacrificed and perfused for mature irradiated (90-day-old and immature (20-day-old worm counts. Analysis of the results showed that statistically significant protection against cercariae occurred in both groups with irradiated worms.

  12. Plerocercoid growth factor (PGF), a human growth hormone (hGH) analogue produced by the tapeworm Spirometra mansonoides, has direct insulin-like action in adipose tissue of normal rats in vitro

    Salem, M.A.M.; Phares, C.K.

    1986-01-01

    The metabolic actions of GH can be divided into acute (insulin-like) and chronic (lipolytic/anti-insulin). The insulin-like actions of GH are most readily elicited in GH-deficient animals as GH induces resistance to its own insulin-like action. Like GH, PGF stimulates growth and cross-reacts with anti-hGH antibodies. Independent experiments were conducted comparing the direct actions of PGF to insulin or hGH in vitro. Insulin-like effects were determined by the ability of PGF, insulin or hGH to stimulate [U- 14 C]glucose metabolism in epidydimal fat pads from normal rats and by inhibition of epinephrine-stimulated lipolysis. Direct stimulation of lipolysis was used as anti-insulin activity. To determine if PGF competes for insulin or GH receptors, adipocytes (3 x 10 5 cells/ml) were incubated with either [ 125 I]insulin or [ 125 I]hGH +/- PGF, +/- insulin or +/- hGH. PGF stimulated glucose oxidation and 14 C-incorporation into lipids. Insulin, hGH and PGF inhibited lipolysis (33%, 29% and 34%, respectively). Adipose tissue was very sensitive to the lipolytic effect of hGH but PGF was neither lipolytic nor did it confer refractoriness to its insulin-like action. PGF bound to GH but not to insulin receptors. Therefore, PGF had direct insulin-like effects but did not stimulate lipolysis in tissue from normal rats in vitro

  13. Malware Normalization

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  14. Marrow transfusions into normal recipients

    Brecher, G.

    1983-01-01

    During the past several years we have explored the transfusion of bone marrow into normal nonirradiated mice. While transfused marrow proliferates readily in irradiated animals, only minimal proliferation takes place in nonirradiated recipients. It has generally been assumed that this was due to the lack of available proliferative sites in recipients with normal marrow. Last year we were able to report that the transfusion of 200 million bone marrow cells (about 2/3 of the total complement of marrow cells of a normal mouse) resulted in 20% to 25% of the recipient's marrow being replaced by donor marrow. Thus we can now study the behavior of animals that have been transfused (donor) and endogenous (recipient) marrow cells, although none of the tissues of either donor or recipient have been irradiated. With these animals we hope to investigate the nature of the peculiar phenomenon of serial exhaustion of marrow, also referred to as the limited self-replicability of stem cells

  15. Food irradiation

    Macklin, M.

    1987-01-01

    The Queensland Government has given its support the establishment of a food irradiation plant in Queensland. The decision to press ahead with a food irradiation plant is astonishing given that there are two independent inquiries being carried out into food irradiation - a Parliamentary Committee inquiry and an inquiry by the Australian Consumers Association, both of which have still to table their Reports. It is fair to assume from the Queensland Government's response to date, therefore, that the Government will proceed with its food irradiation proposals regardless of the outcomes of the various federal inquiries. The reasons for the Australian Democrats' opposition to food irradiation which are also those of concerned citizens are outlined

  16. Food irradiation

    Duchacek, V.

    1989-01-01

    The ranges of doses used for food irradiation and their effect on the processed foods are outlined. The wholesomeness of irradiated foods is discussed. The present food irradiation technology development in the world is described. A review of the irradiated foods permitted for public consumption, the purposes of food irradiaton, the doses used and a review of the commercial-scale food irradiators are tabulated. The history and the present state of food processing in Czechoslovakia are described. (author). 1 fig., 3 tabs., 13 refs

  17. Irradiated foods

    Darrington, Hugh

    1988-06-01

    This special edition of 'Food Manufacture' presents papers on the following aspects of the use of irradiation in the food industry:- 1) an outline view of current technology and its potential. 2) Safety and wholesomeness of irradiated and non-irradiated foods. 3) A review of the known effects of irradiation on packaging. 4) The problems of regulating the use of irradiation and consumer protection against abuse. 5) The detection problem - current procedures. 6) Description of the Gammaster BV plant in Holland. 7) World outline review. 8) Current and future commercial activities in Europe. (U.K.)

  18. Post irradiation test report of irradiated DUPIC simulated fuel

    Yang, Myung Seung; Jung, I. H.; Moon, J. S. and others

    2001-12-01

    The post-irradiation examination of irradiated DUPIC (Direct Use of Spent PWR Fuel in CANDU Reactors) simulated fuel in HANARO was performed at IMEF (Irradiated Material Examination Facility) in KAERI during 6 months from October 1999 to March 2000. The objectives of this post-irradiation test are i) the integrity of the capsule to be used for DUPIC fuel, ii) ensuring the irradiation requirements of DUPIC fuel at HANARO, iii) performance verification in-core behavior at HANARO of DUPIC simulated fuel, iv) establishing and improvement the data base for DUPIC fuel performance verification codes, and v) establishing the irradiation procedure in HANARO for DUPIC fuel. The post-irradiation examination performed are γ-scanning, profilometry, density, hardness, observation the microstructure and fission product distribution by optical microscope and electron probe microanalyser (EPMA)

  19. Post-irradiation diarrhea

    Meerwaldt, J.H.

    1984-01-01

    In radiotherapy of pelvic cancers, the X-ray dose to be delivered to the tumour is limited by the tolerance of healthy surrounding tissue. In recent years, a number of serious complications of irradiation of pelvic organs were encountered. Modern radiotherapy necessitates the acceptance of a calculated risk of complications in order to achieve a better cure rate. To calculate these risks, one has to know the radiation dose-effect relationship of normal tissues. Of the normal tissues most at risk when treating pelvic tumours only the bowel is studied. In the literature regarding post-irradiation bowel complications, severe and mild complications are often mixed. In the present investigation the author concentrated on the group of patients with relatively mild symptoms. He studied the incidence and course of post-irradiation diarrhea in 196 patients treated for carcinoma of the uterine cervix or endometrium. The aims of the present study were: 1) to determine the incidence, course and prognostic significance of post-irradiation diarrhea; 2) to assess the influence of radiotherapy factors; 3) to study the relation of bile acid metabolism to post-irradiation diarrhea; 4) to investigate whether local factors (reservoir function) were primarily responsible. (Auth.)

  20. Short-term solar irradiation forecasting based on Dynamic Harmonic Regression

    Trapero, Juan R.; Kourentzes, Nikolaos; Martin, A.

    2015-01-01

    Solar power generation is a crucial research area for countries that have high dependency on fossil energy sources and is gaining prominence with the current shift to renewable sources of energy. In order to integrate the electricity generated by solar energy into the grid, solar irradiation must be reasonably well forecasted, where deviations of the forecasted value from the actual measured value involve significant costs. The present paper proposes a univariate Dynamic Harmonic Regression model set up in a State Space framework for short-term (1–24 h) solar irradiation forecasting. Time series hourly aggregated as the Global Horizontal Irradiation and the Direct Normal Irradiation will be used to illustrate the proposed approach. This method provides a fast automatic identification and estimation procedure based on the frequency domain. Furthermore, the recursive algorithms applied offer adaptive predictions. The good forecasting performance is illustrated with solar irradiance measurements collected from ground-based weather stations located in Spain. The results show that the Dynamic Harmonic Regression achieves the lowest relative Root Mean Squared Error; about 30% and 47% for the Global and Direct irradiation components, respectively, for a forecast horizon of 24 h ahead. - Highlights: • Solar irradiation forecasts at short-term are required to operate solar power plants. • This paper assesses the Dynamic Harmonic Regression to forecast solar irradiation. • Models are evaluated using hourly GHI and DNI data collected in Spain. • The results show that forecasting accuracy is improved by using the model proposed

  1. Normal accidents

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  2. Effects of ion beam irradiation on semiconductor devices

    Nashiyama, Isamu; Hirao, Toshio; Itoh, Hisayoshi; Ohshima, Takeshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

    1997-03-01

    Energetic heavy-ion irradiation apparatus has been developed for single-event effects (SEE) testing. We have applied three irradiation methods such as a scattered-ion irradiation method, a recoiled-atom irradiation method, and a direct-beam irradiation method to perform SEE testing efficiently. (author)

  3. Behaviour of intestinal lactase after irradiation

    Becciolini, A; Cariaggi, P; Gori, A [Florence Univ. (Italy). Istituto di Radiologia

    1975-08-01

    The behavior of intestinal lactase has been studied in rats after irradiation. The significant increase of activity is not immediate, but slowly and progressively starting from 4 hrs after irradiation. The modifications of the activity are slow and gradual also during the reduction phase. This disaccharase does not show a return to normal values even after three weeks. We suggest the hypothesis that the increase could be due to a modification of the normal synthesis of enzymes caused by irradiation.

  4. Irradiating strand material

    Austin, J.R.; Brown, M.J.; Loan, L.D.

    1975-01-01

    Conductors covered with insulation which is to be irradiated are passed between two groups of coaxial sheaves mounted rotatably individually. Successive sections of the conductors are advanced past the window of one accelerator head, around the associated sheave or sheaves, and then past the window of another accelerator head. The accelerators face in substantially opposite directions and are staggered along the paths of the conductors to avoid any substantial overlap of the electron beams associated therewith. The windows extend vertically to encompass all the generally horizontal passes of the conductors as between the two groups of sheaves. Preferably, conductors are strung-up between the sheaves in a modified figure eight pattern. The pattern is a figure eight modified to intermittently include a pass between the sheaves which is parallel to a line joining the axes of the two groups of sheaves. This reverses the direction of travel of the conductors and optimizes the uniformity of exposure of the cross sectional area of the insulation of the conductors to irradiation. The use of a figure eight path for the conductors causes the successive sections of the conductor to turn about the longitudinal axes thereof as they are advanced around the sheaves. In this way the insulation is more uniformly irradiated. In a preferred embodiment, twisted conductor pairs may be irradiated. The twist accentuates the longitudinal turning of the conductor pair. The irradiation of twisted pairs achieves obvious manufacturing economies while avoiding the necessity of having to twist irradiation cross-linked conductors

  5. Irradiated cocoa beans

    Ashby, R.; Tesh, J.M.

    1982-11-01

    Groups of 40 male and 40 female CD rats were fed powdered rodent diet containing 25% (w/w) of either non-irradiated, irradiated or fumigated cocoa beans. The diets were supplemented with certain essential dietary constituents designed to satisfy normal nutritional requirements. An additional 40 male and 40 female rats received basal rodent diet alone (ground) and acted as an untreated control. After 70 days of treatment, 15 male and 15 female rats from each group were used to assess reproductive function of the F 0 animals and growth and development of the F 1 offspring up to weaning; the remaining animals were killed after 91 days of treatment. (orig.)

  6. Food preservation by irradiation

    Oztasiran, I.

    1984-01-01

    Irradiation is a physical process for treating food and as such it is comparable to other processing techniques such as heating or freezing foods for preservation. The energy level used in food irradiation is always below that producing radioactivity in the treated food, hence this aspect can be totally excluded in wholesomeness evaluations. Water is readily ionized and may be the primary source of ionization in foods with secondary effects on other molecules, possibly more a result of water ionization than of direct hits. In the presence of oxygen, highly reactive compounds may be produced, such as H, H 3 0+ and H 2 O 2 . Radiation at the energy flux levels used for food (<2 MeV) does not induce radioactivity. Food irradiation applications are already technically and economically feasible and that food so treated is suitable for consumption. Food irradiation techniques can play an important role for an improved preservation, storage and distribution of food products. (author)

  7. The ARBOR irradiation project

    Petersen, C. E-mail: claus.petersen@imf.fzk.de; Shamardin, V.; Fedoseev, A.; Shimansky, G.; Efimov, V.; Rensman, J

    2002-12-01

    The irradiation project 'ARBOR', for 'Associated Reactor Irradiation in BOR 60', includes 150 mini-tensile/low cycle fatigue specimens and 150 mini-Charpy (KLST) specimens of nine different RAFM steels. Specimens began irradiation on 22 November 2000 in an specially designed irradiation rig in BOR 60, in a fast neutron flux (>0.1 MeV) of 1.8x10{sup 15} n/cm{sup 2} s and with direct sodium cooling at a temperature less than 340 deg. C. Tensile, low cycle fatigue and Charpy specimens of the following materials are included: EUROFER 97, F82H mod., OPTIFER IVc, EUROFER 97 with different boron contents, ODS-EUROFER 97, as well as EUROFER 97 electron-beam welded and reference bulk material, from NRG, Petten.

  8. The ARBOR irradiation project

    Petersen, C.; Shamardin, V.; Fedoseev, A.; Shimansky, G.; Efimov, V.; Rensman, J.

    2002-01-01

    The irradiation project 'ARBOR', for 'Associated Reactor Irradiation in BOR 60', includes 150 mini-tensile/low cycle fatigue specimens and 150 mini-Charpy (KLST) specimens of nine different RAFM steels. Specimens began irradiation on 22 November 2000 in an specially designed irradiation rig in BOR 60, in a fast neutron flux (>0.1 MeV) of 1.8x10 15 n/cm 2 s and with direct sodium cooling at a temperature less than 340 deg. C. Tensile, low cycle fatigue and Charpy specimens of the following materials are included: EUROFER 97, F82H mod., OPTIFER IVc, EUROFER 97 with different boron contents, ODS-EUROFER 97, as well as EUROFER 97 electron-beam welded and reference bulk material, from NRG, Petten

  9. A prospective three-dimensional analysis about the impact of differences in the clinical target volume in prostate cancer irradiation on normal-tissue exposure. A potential for increasing the benefit/risk ratio

    Hille, A.; Toews, N.; Schmidberger, H.; Hess, C.F.

    2005-01-01

    Background and purpose: rectal toxicity following external-beam irradiation of prostate cancer correlates with the exposed percentage of rectal volume. Recently, it has been recommended to reduce the volume of the seminal vesicles that should be included in the clinical target volume (CTV). The purpose of this study was to quantitatively assess the impact of this CTV reduction on the expected rectal and bladder dose sparing. Patients and methods: 14 patients with localized prostate cancer undergoing external-beam radiotherapy were investigated. The prostate, the prostate + entire seminal vesicles, or the prostate + proximal seminal vesicles were delineated as CTV. Treatment plans were generated and compared concerning rectum and bladder dose-volume histograms (DVHs). Results: the exposure of rectum and bladder volume was significantly lower in case of irradiation of the prostate only compared to inclusion of the proximal or entire seminal vesicles into the CTV. The reduction of the CTV from prostate + entire seminal vesicles to prostate + proximal seminal vesicles led to a significant reduction of the rectal and bladder dose exposure. Conclusion: reduction of the CTV to the prostate only, or to the prostate + proximal seminal vesicles led to significant rectal and bladder dose sparing compared to irradiation of the prostate + entire seminal vesicles. In patients with a higher risk for seminal vesicles involvement, irradiation of the prostate + proximal seminal vesicles should be preferred. In case of a need for irradiation of the entire seminal vesicles, patients should be informed about a higher risk for chronic rectal toxicity and, possibly, for bladder complications. (orig.)

  10. Reconstructing Normality

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  11. Pursuing Normality

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  12. Foodstuff irradiation

    1982-01-01

    Report written on behalf of the Danish Food Institute summarizes national and international rules and developments within food irradiation technology, chemical changes in irradiated foodstuffs, microbiological and health-related aspects of irradiation and finally technological prospects of this conservation form. Food irradiatin has not been hitherto applied in Denmark. Radiation sources and secondary radiation doses in processed food are characterized. Chemical changes due to irradiation are compared to those due to p.ex. food heating. Toxicological and microbiological tests and their results give no unequivocal answer to the problem whether a foodstuff has been irradiated. The most likely application fields in Denmark are for low radiation dosis inhibition of germination, riping delay and insecticide. Medium dosis (1-10 kGy) can reduce bacteria number while high dosis (10-50 kGy) will enable total elimination of microorganisms and viruses. Food irradiation can be acceptable as technological possibility with reservation, that further studies follow. (EG)

  13. Direct Detection of Complex Organic Products in Ultraviolet (Lyα) and Electron-irradiated Astrophysical and Cometary Ice Analogs Using Two-step Laser Ablation and Ionization Mass Spectrometry

    Henderson, Bryana L.; Gudipati, Murthy S.

    2015-02-01

    As discovery of complex molecules and ions in our solar system and the interstellar medium has proliferated, several groups have turned to laboratory experiments in an effort to simulate and understand these chemical processes. So far only infrared (IR) and ultraviolet (UV) spectroscopy has been able to directly probe these reactions in ices in their native, low-temperature states. Here we report for the first time results using a complementary technique that harnesses two-step two-color laser ablation and ionization to measure mass spectra of energetically processed astrophysical and cometary ice analogs directly without warming the ices—a method for hands-off in situ ice analysis. Electron bombardment and UV irradiation of H2O, CH3OH, and NH3 ices at 5 K and 70 K led to complex irradiation products, including HCO, CH3CO, formamide, acetamide, methyl formate, and HCN. Many of these species, whose assignment was also strengthened by isotope labeling studies and correlate with IR-based spectroscopic studies of similar irradiated ices, are important ingredients for the building blocks of life. Some of them have been detected previously via astronomical observations in the interstellar medium and in cometary comae. Other species such as CH3CO (acetyl) are yet to be detected in astrophysical ices or interstellar medium. Our studies suggest that electron and UV photon processing of astrophysical ice analogs leads to extensive chemistry even in the coldest reaches of space, and lend support to the theory of comet-impact-induced delivery of complex organics to the inner solar system.

  14. Microstructural examination of irradiated zircaloy-2 pressure tube material

    Srivastava, D.; Tewari, R.; Dey, G.K.; Sah, D.N.; Banerjee, S.

    2005-01-01

    also seen in the irradiated samples. The refinement and alignment of the precipitates in a specific crystallographic direction were indicative of this fact. The hydride needles were also observed in the irradiated sample. However, their morphology had changed. They did not show any sharp interface as normally seen in the unirradiated samples. The oxidation behavior of these irradiated samples have been also studied. (author)

  15. Hemibody irradiation

    Schen, B.C.; Mella, O.; Dahl, O.

    1992-01-01

    In a large number of cancer patients, extensive skeletal metastases or myelomatosis induce vast suffering, such as intolerable pain and local complications of neoplastic bone destruction. Analgetic drugs frequently do not yield sufficient palliation. Irradiation of local fields often has to be repeated, because of tumour growth outside previously irradiated volumes. Wide field irradiation of the lower or upper half of the body causes significant relief of pain in most patients. Adequate pretreatment handling of patients, method of irradiation, and follow-up are of importance to reduce side effects, and are described as they are carried out at the Department of Oncology, Haukeland Hospital, Norway. 16 refs., 2 figs

  16. Effect of neutron irradiation on the dimension and the strength of carbon fiber/carbon composite derived from thermosetting resin precursor

    Yasuda, Eiichi; Tanabe, Yasuhiro; Kimura, Shiushichi; Maruyama, Tadashi; Iseki, Takayoshi; Yano, Toyohiko.

    1988-01-01

    Unidirectionally reinforced carbon fiber/carbon composite whose matrix was derived from thermosetting resin, was prepared. The heat-treatment temperature was 2800 deg C. The change in size and 4 point bending strength of the composite was measured after neutron irradiation (640 deg C, 6 x 10 24 n/m 2 , E > 1 MeV). Shrinkage in normal to the fiber direction was larger than that in fiber direction. Increase in strength and Young's modulus of the composite was observed after irradiation. Irradiated composite showed much higher deflection to fracture than unirradiated one. (author)

  17. Comparative study of thermoluminescence detection methods for irradiated spices

    Kawamura, Y.; Kojima, K.; Sugita, T.; Yamada, T.; Saito, Y.

    1995-01-01

    The thermoluminescence (TL) detection methods for irradiated spices were compared using spice samples obtained on the Japanese market, irradiated at doses of 1, 5, 10 and 30 kGy and stored for 1 year before analysis. The TL intensities of irradiated spices were stable for 1 year after irradiation. Measurement with whole samples failed to identify irradiated samples. Minerals were separated from spices in sodium tungstate saturated solution and/or sodium polytungstate solution. The TL intensity of minerals which had undergone irradiation was significantly increased for all samples. However, the ranges of TL intensity of irradiated and unirradiated samples overlapped. Clear discrimination has been obtained between the TL ratios of irradiated and unirradiated spices by using normalized measurement with reirradiation. The detection limit in terms of irradiation dose is 1 kGy even in a sample that has been irradiated 1 year prior to analysis. Normalization is the best technique currently available for thermoluminescence analysis to identify irradiated spices

  18. Normalization of satellite imagery

    Kim, Hongsuk H.; Elman, Gregory C.

    1990-01-01

    Sets of Thematic Mapper (TM) imagery taken over the Washington, DC metropolitan area during the months of November, March and May were converted into a form of ground reflectance imagery. This conversion was accomplished by adjusting the incident sunlight and view angles and by applying a pixel-by-pixel correction for atmospheric effects. Seasonal color changes of the area can be better observed when such normalization is applied to space imagery taken in time series. In normalized imagery, the grey scale depicts variations in surface reflectance and tonal signature of multi-band color imagery can be directly interpreted for quantitative information of the target.

  19. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  20. Comparative studies on the proliferation and differentiation of granulocytic progenitor cells CFU-C from the blood and bone marrow of dogs under normal conditions and after 80 R whole-body irradiation

    Faul, H.

    1984-01-01

    The study on hand was performed on dogs of both sexes and dealt with two complex issues: 1) the identity of the granulocytic progenitor cell CFU-C in the blood and bone marrow, and 2) possible verification of damage to stem cell store using the granulocytic progenitor cell CFU-C as an indicator for damage caused, in this case, by 80 rd whole body irradiation of dogs. A special culture technique was developed to study these issues, and was tested for its functionability. Examinations of the dogs with whole-body irradiation revealed the following results: a) Radiation damage to the stem cell store could be verified by the study object of CFU-C granulocytic progenitor cell of the bone marrow. A reduction of proliferative capacity linked with a change in the differentiation profiles for the different cell types in the suspension cultures was clearly verified. b) The suspension culture technique allows to verify damage by ionizing radiation both in the acute phase, i.c. two hours after irradiation, and in the late recovery phase. (orig./MG) [de

  1. The influence of dose fractionation and dose rate on normal tissue responses

    Barendsen, G.W.

    1982-01-01

    An analysis of responses of a variety of normal tissues in animals to fractionated irradiations has been made with the aim of developing a formalism for the prediction of tolerance doses as a function of the dose per fraction and the overall treatment time. An important feature of the formalism is that it is directly based on radiological insights and therefore provides a logical concept to account for the diversity of tissue responses. (Auth.)

  2. Food irradiation

    Mercader, J.P.; Emily Leong

    1985-01-01

    The paper discusses the need for effective and efficient technologies in improving the food handling system. It defines the basic premises for the development of food handling. The application of food irradiation technology is briefly discussed. The paper points out key considerations for the adoption of food irradiation technology in the ASEAN region (author)

  3. Food irradiation

    Matsuyama, Akira

    1990-01-01

    This paper reviews researches, commentaries, and conference and public records of food irradiation, published mainly during the period 1987-1989, focusing on the current conditions of food irradiation that may pose not only scientific or technologic problems but also political issues or consumerism. Approximately 50 kinds of food, although not enough to fill economic benefit, are now permitted for food irradiation in the world. Consumerism is pointed out as the major factor that precludes the feasibility of food irradiation in the world. In the United States, irradiation is feasible only for spices. Food irradiation has already been feasible in France, Hollands, Belgium, and the Soviet Union; has under consideration in the Great Britain, and has been rejected in the West Germany. Although the feasibility of food irradiation is projected to increase gradually in the future, commercial success or failure depends on the final selection of consumers. In this respect, the role of education and public information are stressed. Meat radicidation and recent progress in the method for detecting irradiated food are referred to. (N.K.) 128 refs

  4. Irradiation proctitis

    Minami, Akira

    1977-01-01

    Literatures on late rectal injuries are discussed, referring to two patients with uterine cervical cancer in whom irradiation proctitis occurred after telecobalt irradiation following uterine extirpation. To one patients, a total of 5000 rads was irradiated, dividing into 250 rads at one time, and after 3 months, irradiation with a total of 2000 rads, dividing into 200 rads at one time, was further given. In another one patient, two parallel opposing portal irradiation with a total of 6000 rads was given. About a year after the irradiation, rectal injuries and cystitis, accompanying with hemorrhage, were found in both of the patients. Rectal amputation and proctotoreusis were performed. Cystitis was treated by cystic irradiation in the urological department. Pathohistological studies of the rectal specimen revealed atrophic mucosa, and dilatation of the blood vessels and edema in the colonic submucosa. Incidence of this disease, term when the disease occurs, irradiation dose, type of the disease, treatment and prevention are described on the basis of the literatures. (Kanao, N.)

  5. Irradiation proctitis

    Minami, A [Osaka Kita Tsishin Hospital (Japan)

    1977-06-01

    Literatures on late rectal injuries are discussed, referring to two patients with uterine cervical cancer in whom irradiation proctitis occurred after telecobalt irradiation following uterine extirpation. To one patients, a total of 5000 rads was irradiated, dividing into 250 rads at one time, and after 3 months, irradiation with a total of 2000 rads, dividing into 200 rads at one time, was further given. In another one patient, two parallel opposing portal irradiation with a total of 6000 rads was given. About a year after the irradiation, rectal injuries and cystitis, accompanying with hemorrhage, were found in both of the patients. Rectal amputation and proctotoreusis were performed. Cystitis was treated by cystic irradiation in the urological department. Pathohistological studies of the rectal specimen revealed atrophic mucosa, and dilatation of the blood vessels and edema in the colonic submucosa. Incidence of this disease, term when the disease occurs, irradiation dose, type of the disease, treatment and prevention are described on the basis of the literatures.

  6. Irradiação global, direta e difusa, para a região de Cascavel, Estado do Paraná = Global, direct and diffuse irradiation in the region of Cascavel, Paraná State

    Patricia Aparecida de Oliveira Drechmer

    2006-01-01

    Full Text Available O presente trabalho apresenta um estudo sobre os níveis das irradiações global, direta e difusa incidentes na superfície terrestre, a irradiação incidente no topo da atmosfera e a insolação relativa mensal, para a cidade de Cascavel-PR. As componentes da radiação solar foram monitoradas entre janeiro de 2001 e fevereiro de 2003 na Estação Experimental Agrometeorológica da Unioeste, Cascavel, Estado do Paraná. Na medição da radiação global foi utilizado um piranômetro KIPP & ZONEN-CM3 e para medir a componente direta foiutilizado um pireliômetro EPPLEY-NIP acoplado a um rastreador solar. A radiação difusa foi calculada pela diferença entre as radiações global e direta. Os níveis médios mensais das irradiações global, direta e difusa, foram respectivamente, 51,8%, 31,7% e 20,17% dairradiação incidente no topo da atmosfera. O índice de insolação relativa apresentou valor máximo em agosto (61,43% e mínimo em fevereiro (34,35%, períodos caracterizados respectivamente por dias de céu limpo e nublados no hemisfério sul.This paper reports a study about the diffuse, direct and global radiation levels on surface of earth, the irradiation over the top of atmosphere and the monthly relative sunstroke in the city of Cascavel, State of Paraná, southern Brazil. The solar radiation components were monitored from January, 2001 to February, 2003 at Estação Experimental Agrometeorológica of Unioeste, Cascavel, Parana State. Global radiation was monitored by a pyranometer KIPP & ZONEN-CM3 and direct radiation was monitored by a pyrheliometer EPPLEY-NIP coupled to a solar tracer. The diffuse radiation wasmonitored through the difference between global and direct radiation. Monthly average levels of global, direct and diffuse irradiations were 51.8%, 31.7% and 20.17% of the irradiation in the top of atmosphere. The relative isolation index showed the maximum value in August (61.43% and the minimum in February (34.35%. These

  7. Spices, irradiation and detection methods

    Sjoeberg, A.M.; Manninen, M.

    1991-01-01

    This paper is about microbiological aspects of spices and microbiological methods to detect irradiated food. The proposed method is a combination of the Direct Epifluorescence Filter Technique (DEFT) and the Aerobic Plate Count (APC). The evidence for irradiation of spices is based on the demonstration of a higher DEFT count than the APC. The principle was first tested in our earlier investigation in the detection of irradiation of whole spices. The combined DEFT+APC procedure was found to give a fairly reliable indication of whether or not a whole spice sample had been irradiated. The results are given (8 figs, 22 refs)

  8. Food irradiation

    Kobayashi, Yasuhiko; Kikuchi, Masahiro

    2009-01-01

    Food irradiation can have a number of beneficial effects, including prevention of sprouting; control of insects, parasites, pathogenic and spoilage bacteria, moulds and yeasts; and sterilization, which enables commodities to be stored for long periods. It is most unlikely that all these potential applications will prove commercially acceptable; the extend to which such acceptance is eventually achieved will be determined by practical and economic considerations. A review of the available scientific literature indicates that food irradiation is a thoroughly tested food technology. Safety studies have so far shown no deleterious effects. Irradiation will help to ensure a safer and more plentiful food supply by extending shelf-life and by inactivating pests and pathogens. As long as requirement for good manufacturing practice are implemented, food irradiation is safe and effective. Possible risks of food irradiation are not basically different from those resulting from misuse of other processing methods, such as canning, freezing and pasteurization. (author)

  9. Irradiation damage

    Howe, L.M

    2000-07-01

    There is considerable interest in irradiation effects in intermetallic compounds from both the applied and fundamental aspects. Initially, this interest was associated mainly with nuclear reactor programs but it now extends to the fields of ion-beam modification of metals, behaviour of amorphous materials, ion-beam processing of electronic materials, and ion-beam simulations of various kinds. The field of irradiation damage in intermetallic compounds is rapidly expanding, and no attempt will be made in this chapter to cover all of the various aspects. Instead, attention will be focused on some specific areas and, hopefully, through these, some insight will be given into the physical processes involved, the present state of our knowledge, and the challenge of obtaining more comprehensive understanding in the future. The specific areas that will be covered are: point defects in intermetallic compounds; irradiation-enhanced ordering and irradiation-induced disordering of ordered alloys; irradiation-induced amorphization.

  10. Irradiation damage

    Howe, L.M.

    2000-01-01

    There is considerable interest in irradiation effects in intermetallic compounds from both the applied and fundamental aspects. Initially, this interest was associated mainly with nuclear reactor programs but it now extends to the fields of ion-beam modification of metals, behaviour of amorphous materials, ion-beam processing of electronic materials, and ion-beam simulations of various kinds. The field of irradiation damage in intermetallic compounds is rapidly expanding, and no attempt will be made in this chapter to cover all of the various aspects. Instead, attention will be focused on some specific areas and, hopefully, through these, some insight will be given into the physical processes involved, the present state of our knowledge, and the challenge of obtaining more comprehensive understanding in the future. The specific areas that will be covered are: point defects in intermetallic compounds; irradiation-enhanced ordering and irradiation-induced disordering of ordered alloys; irradiation-induced amorphization

  11. Anisotropic dislocation loop nucleation in ion-irradiated MgAl2O4

    Zinkle, S.J.

    1991-01-01

    Polycrystalline disks of stoichiometric magnesium aluminate spinel (MgAl 2 O 4 ) were irradiated with 2 MeV Al + ions at 650 degrees C and subsequently analyzed in cross-section using transmission electron microscopy (TEM). Interstitial dislocation loops were observed on 110 and 11 habit planes. The population of loops on both sets of habit planes was strongly dependent on their orientation with respect to the ion beam direction. The density of loops with habit plane normals nearly perpendicular to the ion beam direction much higher than loops with habit plane normals nearly parallel to the ion beam direction. On the other hand, the loop size was nearly independent of habit plane orientation. This anisotropic loop nucleation does not occur in ion-irradiated metals such as copper. An additional anomaly associated with ion-irradiated spinel is that the loops on 111 planes were partially unfaulted with a Burgers vector of b = a/4 . Previous neutron irradiation studies have never reported unfaulted loops in stoichiometric spinel. Possible cause of the unusual response of spinel to ion irradiation are discussed. 12 refs., 14 figs

  12. γ - irradiation induced effect on the optical parameters of Cu10 Se90 thin films

    Abu EL-Fadl, A.; Hafiz, M. M.; Aashour, A.S.; Wakaad, M.M.

    2007-01-01

    The optical constants of Cu 10 SE 90 Chalcogenide films successfully deposited by evaporation coating technique have been measured. The absorption coefficient (a) for the as-deposited or after being γ-irradiation at various doses have been computed in the spectral wavelength range 400-900 nm from the transmittance (T) and reflectance (R) measurements of normally-incident light. Both irradiated and as-prepared films showed direct transition. The direct optical band gaps of the films were found to decrease from 2.017 for as prepared to 1.941 eV for γ-irradiation at 190 kGy doses. The width of the tails of localized states E e were calculated and found to be increasing after γ-irradiation. The effects of the γ-irradiation on the refractive index n and extinction coefficient k were studied. Other optical parameters (ε I , ε 2 were calculated at different γ-irradiation doses the obtained values of both ε 1 and ε 2 were found to be incident light and γ-doses dependent. The effect of γ-irradiation on the high-frequency dielectric constant (ε ∞ ) and carrier concentration (N/m * ) is also studied. The change on the degree of disorder as will as the radiation-induced defect changes applied to explain the radiation effects on nature of optical properties Cu 10 SE 90 glasses

  13. Educative campaign about information on irradiated foods

    Luna C, P.C.

    1991-07-01

    The irradiation of foods is accepted by international agencies (FAO, OMS) like a healthy and effective technology at the moment the irradiated foods are marketed easily in many countries, however in other countries exist several factors that affect the practical application of this process. In this work is planned about an educational campaign about the irradiation process directed to the consumers. (Author)

  14. Study of a solid state micro-dosemeter based on a monolithic silicon telescope: Irradiations with low-energy neutrons and direct comparison with a cylindrical TEPC

    Agosteo, S.; Colautti, P.; Fanton, I.; Fazzi, A.; Introini, M. V.; Moro, D.; Pola, A.; Varoli, V.

    2011-01-01

    A silicon device based on the monolithic silicon telescope technology coupled to a tissue-equivalent converter was proposed and investigated for solid state microdosimetry. The detector is constituted by a DE stage about 2 μm in thickness geometrically segmented in a matrix of micrometric diodes and a residual-energy measurement stage E about 500 μm in thickness. Each thin diode has a cylindrical sensitive volume 9 μm in nominal diameter, similar to that of a cylindrical tissue-equivalent proportional counter (TEPC). The silicon device and a cylindrical TEPC were irradiated in the same experimental conditions with quasi-monoenergetic neutrons of energy between 0.64 and 2.3 MeV at the INFN-Legnaro National Laboratories (LNLINFN, Legnaro (Italy)). The aim was to study the capability of the silicon-based system of reproducing microdosimetric spectra similar to those measured by a reference micro-dosemeter. The TEPC was set in order to simulate a tissue site about 2 μm in diameter. The spectra of the energy imparted to the ΔE stage of the silicon telescope were corrected for tissue-equivalence through an optimized procedure that exploits the information from the residual energy measurement stage E. A geometrical correction based on parametric criteria for shape-equivalence was also applied. The agreement between the dose distributions of lineal energy and the corresponding mean values is satisfactory at each neutron energy considered. (authors)

  15. Interfractional Target Variations for Partial Breast Irradiation

    Ahunbay, Ergun E.; Robbins, Jared; Christian, Robert; Godley, Andrew; White, Julia; Li, X. Allen

    2012-01-01

    Purpose: In this work, we quantify the interfractional variations in the shape of the clinical target volume (CTV) by analyzing the daily CT data acquired during CT-guided partial breast irradiation (PBI) and compare the effectiveness of various repositioning alignment strategies considered to account for the variations. Methods and Materials: The daily CT data for 13 breast cancer patients treated with PBI in either prone (10 patients) or supine (3 patients) with daily kV CT guidance using CT on Rails (CTVision, Siemens, Malvern, PA) were analyzed. For approximately 25 points on the surface of the CTV, deformation vectors were calculated by means of deformable image registration and verified by visual inspection. These were used to calculate the distances along surface normals (DSN), which directly related to the required margin expansions for each point. The DSN values were determined for seven alignment methods based on volumetric imaging and also two-dimensional projections (portal imaging). Results: The margin expansion necessary to cover 99% of all points for all days was 2.7 mm when utilizing the alignment method based on deformation field data (the best alignment method). The center-of-mass based alignment yielded slightly worse results (a margin of 4.0 mm), and shifts obtained by operator placement (7.9 mm), two-dimensional-based methods (7.0–10.1 mm), and skin marks (13.9 mm) required even larger margin expansions. Target shrinkage was evident for most days by the negative values of DSN. Even with the best alignment, the range of DSN values could be as high as 7 mm, resulting in a large amount of normal tissue irradiation, unless adaptive replanning is employed. Conclusion: The appropriate alignment method is important to minimize the margin requirement to cover the significant interfractional target deformations observed during PBI. The amount of normal tissue unnecessarily irradiated is still not insignificant, and can be minimized if adaptive

  16. Food irradiation

    Hetherington, M.

    1989-01-01

    This popular-level article emphasizes that the ultimate health effects of irradiated food products are unknown. They may include vitamin loss, contamination of food by botulism bacteria, mutations in bacteria, increased production of aflatoxins, changes in food, carcinogenesis from unknown causes, presence of miscellaneous harmful chemicals, and the lack of a way of for a consumer to detect irradiated food. It is claimed that the nuclear industry is applying pressure on the Canadian government to relax labeling requirements on packages of irradiated food in order to find a market for its otherwise unnecessary products

  17. Food irradiation

    Luecher, O.

    1979-01-01

    Limitations of existing preserving methods and possibilities of improved food preservation by application of nuclear energy are explained. The latest state-of-the-art in irradiation technology in individual countries is described and corresponding recommendations of FAO, WHO and IAEA specialists are presented. The Sulzer irradiation equipment for potato sprout blocking is described, the same equipment being suitable also for the treatment of onions, garlic, rice, maize and other cereals. Systems with a higher power degree are needed for fodder preserving irradiation. (author)

  18. Inhibitor production by normal rat tracheal epithelial cells influences the frequency of spontaneous and X-ray-induced enhanced growth variants

    Terzaghi-Howe, M.

    1989-01-01

    A cell culture model was used to assay for the induction of cell populations with enhanced growth capacity in culture in irradiated normal rat tracheal epithelial cells (NTEC). Some growth conditions appear to favor the proliferation of both normal and carcinogen-exposed populations, while others appear to select for populations previously exposed to carcinogen. In the present report we focus on what growth conditions are critical for controlling the emergence of spontaneous and X-ray induced proliferating epithelial foci (PEF) and what factor(s) directly influences the relative frequency of PEF in irradiated and control NTEC cultures. (author)

  19. Food irradiation: Facts or fiction?

    Loaharanu, P.

    1990-01-01

    Food irradiation is at a political crossroad. In one direction, it is moving forward supported by overwhelming scientific evidence of its safety and benefits to economy and health. In the opposite direction, it threatens to be derailed by misleading claims about its safety and usefulness. Whether people will ultimately benefit from the use of irradiation to help fight serious food problems, or whether they will allow the technology to go to waste, will be determined by how successful people are in separating the facts from the fiction of food irradiation

  20. Direct Extraction of InP/GaAsSb/InP DHBT Equivalent-Circuit Elements From S-Parameters Measured at Cut-Off and Normal Bias Conditions

    Johansen, Tom Keinicke; Leblanc, Rémy; Poulain, Julien

    2016-01-01

    A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base-collector......A unique direct parameter extraction method for the small-signal equivalent-circuit model of InP/GaAsSb/InP double heterojunction bipolar transistors (DHBTs) is presented. $S$-parameters measured at cut-off bias are used, at first, to extract the distribution factor $X_{0}$ for the base......-collector capacitance at zero collector current and the collector-to-emitter overlap capacitance $C_{ceo}$ present in InP DHBT devices. Low-frequency $S$-parameters measured at normal bias conditions then allows the extraction of the external access resistances $R_{bx}$, $R_{e}$, and $R_{cx}$ as well as the intrinsic...

  1. Food irradiation

    Paganini, M.C.

    1991-06-01

    Food treatment by means of ionizing energy, or irradiation, is an innovative method for its preservation. In order to treat important volumes of food, it is necessary to have industrial irradiation installations. The effect of radiations on food is analyzed in the present special work and a calculus scheme for an Irradiation Plant is proposed, discussing different aspects related to its project and design: ionizing radiation sources, adequate civil work, security and auxiliary systems to the installations, dosimetric methods and financing evaluation methods of the project. Finally, the conceptual design and calculus of an irradiation industrial plant of tubercles is made, based on the actual needs of a specific agricultural zone of our country. (Author) [es

  2. Fruit irradiation

    Anon.

    1977-01-01

    Food spoilage is a common problem when marketing agricultural products. Promising results have already been obtained on a number of food irradiating applications. A process is described in this paper where irradiation of sub-tropical fruits, especially mangoes and papayas, combined with conventional heat treatment results in effective insect and fungal control, delays ripening and greatly improves the quality of fruit at both export and internal markets

  3. Tissue irradiator

    Hungate, F.P.; Riemath, W.F.; Bunnell, L.R.

    1975-01-01

    A tissue irradiator is provided for the in-vivo irradiation of body tissue. The irradiator comprises a radiation source material contained and completely encapsulated within vitreous carbon. An embodiment for use as an in-vivo blood irradiator comprises a cylindrical body having an axial bore therethrough. A radioisotope is contained within a first portion of vitreous carbon cylindrically surrounding the axial bore, and a containment portion of vitreous carbon surrounds the radioisotope containing portion, the two portions of vitreous carbon being integrally formed as a single unit. Connecting means are provided at each end of the cylindrical body to permit connections to blood-carrying vessels and to provide for passage of blood through the bore. In a preferred embodiment, the radioisotope is thulium-170 which is present in the irradiator in the form of thulium oxide. A method of producing the preferred blood irradiator is also provided, whereby nonradioactive thulium-169 is dispersed within a polyfurfuryl alcohol resin which is carbonized and fired to form the integral vitreous carbon body and the device is activated by neutron bombardment of the thulium-169 to produce the beta-emitting thulium-170

  4. Blood irradiation

    Chandy, Mammen

    1998-01-01

    Viable lymphocytes are present in blood and cellular blood components used for transfusion. If the patient who receives a blood transfusion is immunocompetent these lymphocytes are destroyed immediately. However if the patient is immunodefficient or immunosuppressed the transfused lymphocytes survive, recognize the recipient as foreign and react producing a devastating and most often fatal syndrome of transfusion graft versus host disease [T-GVHD]. Even immunocompetent individuals can develop T-GVHD if the donor is a first degree relative since like the Trojan horse the transfused lymphocytes escape detection by the recipient's immune system, multiply and attack recipient tissues. T-GVHD can be prevented by irradiating the blood and different centers use doses ranging from 1.5 to 4.5 Gy. All transfusions where the donor is a first degree relative and transfusions to neonates, immunosuppressed patients and bone marrow transplant recipients need to be irradiated. Commercial irradiators specifically designed for irradiation of blood and cellular blood components are available: however they are expensive. India needs to have blood irradiation facilities available in all large tertiary institutions where immunosuppressed patients are treated. The Atomic Energy Commission of India needs to develop a blood irradiator which meets international standards for use in tertiary medical institutions in the country. (author)

  5. Food irradiation

    Migdal, W.

    1995-01-01

    A worldwide standard on food irradiation was adopted in 1983 by codex Alimentarius Commission of the Joint Food Standard Programme of the Food and Agriculture Organization (FAO) of the United Nations and The World Health Organization (WHO). As a result, 41 countries have approved the use of irradiation for treating one or more food items and the number is increasing. Generally, irradiation is used to: food loses, food spoilage, disinfestation, safety and hygiene. The number of countries which use irradiation for processing food for commercial purposes has been increasing steadily from 19 in 1987 to 33 today. In the frames of the national programme on the application of irradiation for food preservation and hygienization an experimental plant for electron beam processing has been established in Inst. of Nuclear Chemistry and Technology. The plant is equipped with a small research accelerator Pilot (19 MeV, 1 kW) and industrial unit Electronika (10 MeV, 10 kW). On the basis of the research there were performed at different scientific institutions in Poland, health authorities have issued permissions for irradiation for; spices, garlic, onions, mushrooms, potatoes, dry mushrooms and vegetables. (author)

  6. Food irradiation

    1991-01-01

    Processing of food with low levels of radiation has the potential to contribute to reducing both spoilage of food during storage - a particular problem in developing countries - and the high incidence of food-borne disease currently seen in all countries. Approval has been granted for the treatment of more than 30 products with radiation in over 30 countries but, in general, governments have been slow to authorize the use of this new technique. One reason for this slowness is a lack of understanding of what food irradiation entails. This book aims to increase understanding by providing information on the process of food irradiation in simple, non-technical language. It describes the effects that irradiation has on food, and the plant and equipment that are necessary to carry it out safely. The legislation and control mechanisms required to ensure the safety of food irradiation facilities are also discussed. Education is seen as the key to gaining the confidence of the consumers in the safety of irradiated food, and to promoting understanding of the benefits that irradiation can provide. (orig.) With 4 figs., 1 tab [de

  7. Function of skeletal muscle tissue formed after myoblast transplantation into irradiated mouse muscles.

    Wernig, A; Zweyer, M; Irintchev, A

    2000-01-15

    1. Pretreatment of muscles with ionising radiation enhances tissue formation by transplanted myoblasts but little is known about the effects on muscle function. We implanted myoblasts from an expanded, male-donor-derived, culture (i28) into X-ray irradiated (16 Gy) or irradiated and damaged soleus muscles of female syngeneic mice (Balb/c). Three to 6 months later the isometric contractile properties of the muscles were studied in vitro, and donor nuclei were visualised in muscle sections with a Y chromosome-specific DNA probe. 2. Irradiated sham-injected muscles had smaller masses than untreated solei and produced less twitch and tetanic force (all by about 18 %). Injection of 106 myoblasts abolished these deficiencies and innervation appeared normal. 3. Cryodamage of irradiated solei produced muscle remnants with few (1-50) or no fibres. Additional myoblast implantation led to formation of large muscles (25 % above normal) containing numerous small-diameter fibres. Upon direct electrical stimulation, these muscles produced considerable twitch (53 % of normal) and tetanic forces (35 % of normal) but innervation was insufficient as indicated by weak nerve-evoked contractions and elevated ACh sensitivity. 4. In control experiments on irradiated muscles, reinnervation was found to be less complete after botulinum toxin paralysis than after nerve crush indicating that proliferative arrest of irradiated Schwann cells may account for the observed innervation deficits. 5. Irradiation appears to be an effective pretreatment for improving myoblast transplantation. The injected cells can even produce organised contractile tissue replacing whole muscle. However, impaired nerve regeneration limits the functional performance of the new muscle.

  8. Detection of Irradiated Korean Wheat Flour by Viscosity and Pulsed Photostimulated Luminescence (PPSL) Methods

    Yi, S.D.; Chang, K.S.; Oh, M.J.

    2005-01-01

    This study was carried out to establish methods for irradiation detection of irradiation in Korean wheat flour by pulsed photostimulated luminescence (PPSL) and viscometric methods. The photon counts of the irradiated Korean wheat flour measured by PPSL immediately after irradiation increased with increasing irradiation dose. The photon counts in the irradiated Korean wheat flour almost disappeared with lapse of time after storage in normal room conditions, but irradiation detection was still possible after 6 months in darkroom conditions

  9. Societal benefits of food irradiation

    Prakash, Anuradha

    2013-01-01

    Food irradiation has a direct impact on society by reducing the occurrence of food-borne illness, decreasing food spoilage and waste, and facilitating global trade. Food irradiation is approved in 40 countries around the world to decontaminate food of disease and spoilage causing microorganisms, sterilize insect pests, and inhibit sprouting. A recent estimate suggests that 500,000 metric of food is currently irradiated worldwide, primarily to decontaminate spices. Since its first use in the 1960s the use of irradiation for food has grown slowly, but it remains the major technology of choice for certain applications. The largest growth sector in recent years has been phytosanitary irradiation of fruit to disinfest fruit intended for international shipment. For many countries which have established strict quarantine standards, irradiation offers as an effective alternative to chemical fumigants some of which are being phased out due to their effects on the ozone layer. Insects can be sterilized at very low dose levels, thus quality of fruit can be maintained. Irradiation is also highly effective in destroying microbial pathogens such as Salmonella spp., E. coli, and Listeria, hence its application for treatment of spices, herbs, dried vegetables, frozen seafood, poultry, and meat and its contribution to reducing foodborne illnesses. Unfortunately the use of irradiation for improving food safety has been under-exploited. This presentation will provide details on the use, benefits, opportunities, and challenges of food irradiation. (author)

  10. Effects of therapeutic irradiation delivered in early childhood upon subsequent lung function

    Wohl, M.E.B.; Griscom, N.T.; Graggis, D.G.; Jaffe, N.

    1975-01-01

    To determine the long-term effects of therapeutic pulmonary irradiation and treatment with actinomycin D during a period of lung growth, 12 patients treated for Wilms' tumor metastatic to the lung and 8 patients treated for Wilms' tumor with no evidence of pulmonary metastases were studied 7 to 14 years after their initial tumor therapy. All patients had received irradiation to the tumor bed and treatment with actinomycin D. Group 1 had received a single course of bilateral pulmonary irradiation; group 2 had received additional pulmonary irradiation and/or thoracic surgery; group 3 had received no therapeutic irradiation directed primarily to the chest. Total lung capacity (TLC) averaged 71 percent of predicted value in group 1, 58 percent in group 2, and 94 percent in group 3. Diffusing capacity in groups 1 and 2 was reduced to the same extent as lung volume. Quasi-static pressure-volume relationships, studied in three of six patients in group 1, were within the normal range when lung volume was expressed as percentage of observed TLC. Airway resistance, evaluated by spirometry, maximum expiratory flow-volume curves, and resistance of the total respiratory system, was normal or reduced. The data support the hypothesis that therapeutic irradiation during a period of lung growth primarily affects the lung parenchyma and produces a decrease in subsequent size of both the lung and chest wall. No effect of actinomycin D alone upon the lung could be demonstrated

  11. Loss of Ia-bearing splenic adherent cells after whole body ultraviolet irradiation

    Letvin, N.L.; Nepom, J.T.; Greene, M.I.; Benacerraf, B.; Germain, R.N.

    1980-01-01

    Daily uv irradiation of mice results in a marked decrease in the antigen-presenting capability of SAC from these mice after 1 wk of uv exposure. To directly examine this cell population, we developed a technique for purifying SAC that involves passing mouse splenocytes through two cycles of glass adherence with an intervening incubation on rabbit anti-mouse Ig-coated dishes. SAC from externally uv irradiated mice prepared by this method, when pulsed with antigen, activate primed T cells to proliferate much less efficiently than SAC from normal mice. Both the proportion and absolute number of Ia-bearing cells in this purified SAC population from uv irradiated mice are considerably smaller than that seen in similarly prepared populations from normal mice. Previous adjuvant immunization was shown to override functional defects elicited by external uv irradiation. This demonstration of a uv irradiation induced selective loss of Ia bearing splenic adherent cells and the functional consequences of this loss provide further evidence for the importance of Ia-bearing accessory cells in antigen presentation of T dependent antigens, and provides insight into the origin of the immunologic defects induced by whole body uv irradiation

  12. Highly efficient direct Z-scheme WO3/CdS-diethylenetriamine photocatalyst and its enhanced photocatalytic H2 evolution under visible light irradiation

    Hu, Taiping; Li, Pengfei; Zhang, Jinfeng; Liang, Changhao; Dai, Kai

    2018-06-01

    Cadmium sulfide (CdS) has demonstrated great promise in artificial photocataytic hydrogen (H2) production. However, the serious photocorrosion hinders its effective interaction and real-life application. In this work, a typical direct Z-scheme WO3/CdS-diethylenetriamine (CdS-DETA) composite has been designed via facile in-situ solvothermal method, which exhibits excellent H2 production properties in visible light region. In this system, the inorganic-organic CdS-DETA nanobelts (NBs) possess enough active sites and large surface area for the encouraging nanojunction structure information. Furthermore, we also systematically calculated energy band structure and investigated charge transfer of the WO3/CdS-DETA by PL and photocurrent test, the results demonstrated that the suitable band gap matching between CdS-DETA and WO3 and high redox potential improve the separation of photogenerated holes and electrons, restraining intrinsic photocorrosion of CdS as well as improving the photocatalytic activity. 5%WO3/CdS-DETA presented the most outstanding H2 evolution rate (15522 μmol g-1 h-1), which is twice higher than that of pure CdS-DETA. WO3/CdS-DETA composites also presented high stability after three recycle H2 production experiment. Finally, direct Z-scheme photocatalytic mechanism is calculated.

  13. Testicular damage in rats fed on irradiated diets

    Kushwaha, A.K.S.; Hasan, S.S.

    1986-01-01

    Feeding effect of irradiated diets was studied on the pups born to mother fed either on irradiated normal diet or irradiated low protein diet. The study indicated that pups born to mother fed on the irradiated low protein diet had fewer spermatogonial cells in the testes than those given irradiated normal diet and unirradiated low protein diet. Similarly, pups maintained on the irradiated low protein diet showed marked decrease in alkaline phosphatase and cholesterol contents in the testes rather than in the pups fed irradiated normal as well as unirradiated low protein diets. The irradiated low protein diet fed pups showed increased depletion and vacuolization of adrenocortical and medullary cells. 13 refs., 15 figures. (author)

  14. Testicular damage in rats fed on irradiated diets

    Kushwaha, A K.S.; Hasan, S S

    1986-12-01

    Feeding effect of irradiated diets was studied on the pups born to mother fed either on irradiated normal diet or irradiated low protein diet. The study indicated that pups born to mother fed on the irradiated low protein diet had fewer spermatogonial cells in the testes than those given irradiated normal diet and unirradiated low protein diet. Similarly, pups maintained on the irradiated low protein diet showed marked decrease in alkaline phosphatase and cholesterol contents in the testes rather than in the pups fed irradiated normal as well as unirradiated low protein diets. The irradiated low protein diet fed pups showed increased depletion and vacuolization of adrenocortical and medullary cells. 13 refs., 15 figures.

  15. Intensity modulated radiotherapy and 3D conformal radiotherapy for whole breast irradiation: a comparative dosimetric study and introduction of a novel qualitative index for plan evaluation, the normal tissue index

    Yim, Jackie; Suttie, Clare; Bromley, Regina; Morgia, Marita; Lamoury, Gillian [Department of Radiation Oncology, Royal North Shore Hospital, St Leonards, New South Wales (Australia)

    2015-09-15

    We report on a retrospective dosimetric study, comparing 3D conformal radiotherapy (3DCRT) and hybrid intensity modulated radiotherapy (hIMRT). We evaluated plans based on their planning target volume coverage, dose homogeneity, dose to organs at risk (OARs) and exposure of normal tissue to radiation. The Homogeneity Index (HI) was used to assess the dose homogeneity in the target region, and we describe a new index, the normal tissue index (NTI), to assess the dose in the normal tissue inside the tangent treatment portal. Plans were generated for 25 early-stage breast cancer patients, using a hIMRT technique. These were compared with the 3DCRT plans of the treatment previously received by the patients. Plan quality was evaluated using the HI, NTI and dose to OARs. The hIMRT technique was significantly more homogenous than the 3DCRT technique, while maintaining target coverage. The hIMRT technique was also superior at minimising the amount of tissue receiving D{sub 105%} and above (P < 0.0001). The ipsilateral lung and contralateral breast maximum were significantly lower in the hIMRT plans (P < 0.05 and P < 0.005), but the 3DCRT technique achieved a lower mean heart dose in left-sided breast cancer patients (P < 0.05). Hybrid intensity modulated radiotherapy plans achieved improved dose homogeneity compared to the 3DCRT plans and superior outcome with regard to dose to normal tissues. We propose that the addition of both HI and NTI in evaluating the quality of intensity modulated radiotherapy (IMRT) breast plans provides clinically relevant comparators which more accurately reflect the new paradigm of treatment goals and outcomes in the era of breast IMRT.

  16. Intensity modulated radiotherapy and 3D conformal radiotherapy for whole breast irradiation: a comparative dosimetric study and introduction of a novel qualitative index for plan evaluation, the normal tissue index

    Yim, Jackie; Suttie, Clare; Bromley, Regina; Morgia, Marita; Lamoury, Gillian

    2015-01-01

    We report on a retrospective dosimetric study, comparing 3D conformal radiotherapy (3DCRT) and hybrid intensity modulated radiotherapy (hIMRT). We evaluated plans based on their planning target volume coverage, dose homogeneity, dose to organs at risk (OARs) and exposure of normal tissue to radiation. The Homogeneity Index (HI) was used to assess the dose homogeneity in the target region, and we describe a new index, the normal tissue index (NTI), to assess the dose in the normal tissue inside the tangent treatment portal. Plans were generated for 25 early-stage breast cancer patients, using a hIMRT technique. These were compared with the 3DCRT plans of the treatment previously received by the patients. Plan quality was evaluated using the HI, NTI and dose to OARs. The hIMRT technique was significantly more homogenous than the 3DCRT technique, while maintaining target coverage. The hIMRT technique was also superior at minimising the amount of tissue receiving D 105% and above (P < 0.0001). The ipsilateral lung and contralateral breast maximum were significantly lower in the hIMRT plans (P < 0.05 and P < 0.005), but the 3DCRT technique achieved a lower mean heart dose in left-sided breast cancer patients (P < 0.05). Hybrid intensity modulated radiotherapy plans achieved improved dose homogeneity compared to the 3DCRT plans and superior outcome with regard to dose to normal tissues. We propose that the addition of both HI and NTI in evaluating the quality of intensity modulated radiotherapy (IMRT) breast plans provides clinically relevant comparators which more accurately reflect the new paradigm of treatment goals and outcomes in the era of breast IMRT

  17. Effects of irradiation of skin flaps

    Sumi, Y.; Ueda, M.; Oka, T.; Torii, S.

    1984-01-01

    The reaction of skin flaps to irradiation and the optimum postoperative time for irradiation was studied in the rat. Flaps showed different reactions depending on the time of irradiation. There was a correlation between the radiosensitivity and the vascularity of the flap. Those flaps in the marginal hypovascular stage of revascularization showed reactions similar to normal skin. However, severe adverse reactions were observed in the marginal hypervascular stage

  18. Direct elution of sup(99m)Tc complexes from neutron irradiation produced 99Mo incorporated in a MoCl2-MoBr2 mixture

    Ganzerli Valentini, M.T.; Stella, R.; Genova, N.

    1987-01-01

    A novel type of sup(99m)Tc generator, enabling radiopharmaceutical preparation without reductant addition, was prepared and tested. Neutron activated product 99 Mo, in the form of dichloride cluster, was incorporated into inactive molybdenum dichloride-dibromide mixture (MCB) that was left to settle over an activated alumina layer. Direct elution with aqueous ligands such as salicylate or iminodiacetate derivatives in the pH range 6.5-7.5 yielded chemically stable sup(99m)Tc complexes accompanied by small amounts of secondary products (mostly sup(99m)TcO - 4 ). Pentavalent oxidation state in the salicylate complex and tervalent in the iminodiacetate (IDA) and in the N-(2,6-dimethylphenylcarbamoylmethyl) iminodiacetate (HIDA) complexes were assigned to the element after comparison with reference complexes. The anion exchange version of reverse-phase HPLC was used to resolve the eluted product mixture. (author)

  19. Microwave irradiation enhances kinetics of the biomimetic process of hydroxyapatite nanocomposites

    Guha, Avijit; Nayar, Suprabha; Thatoi, H N

    2010-01-01

    In situ synthesized hydroxyapatite-poly(vinyl) alcohol nanocomposite was subjected to microwave irradiation, post synthesis. Interestingly, the aging time of 1 week required for the normal biomimetic process was reduced to 1 h post microwave irradiation, as characterized by x-ray powder diffraction and transmission electron microscopy. The surface topography shows the tendency of tubules to cross-link with the help of microwave energy. The microwave energy seems to provide a directional pull to the polymer chains which could have led to an enhancement of the kinetics of phase formation. (communication)

  20. Irradiation environment and materials behavior

    Ishino, Shiori

    1992-01-01

    Irradiation environment is unique for materials used in a nuclear energy system. Material itself as well as irradiation and environmental conditions determine the material behaviour. In this review, general directions of research and development of materials in an irradiation environment together with the role of materials science are discussed first, and then recent materials problems are described for energy systems which are already existing (LWR), under development (FBR) and to be realized in the future (CTR). Topics selected are (1) irradiation embrittlement of pressure vessel steels for LWRs, (2) high fluence performance of cladding and wrapper materials for fuel subassemblies of FBRs and (3) high fluence irradiation effects in the first wall and blanket structural materials of a fusion reactor. Several common topics in those materials issues are selected and discussed. Suggestions are made on some elements of radiation effects which might be purposely utilized in the process of preparing innovative materials. (J.P.N.) 69 refs

  1. Food irradiation

    Beishon, J.

    1991-01-01

    Food irradiation has been the subject of concern and controversy for many years. The advantages of food irradiation include the reduction or elimination of dangerous bacterial organisms, the control of pests and insects which destroy certain foods, the extension of the shelf-life of many products, for example fruit, and its ability to treat products such as seafood which may be eaten raw. It can also replace existing methods of treatment which are believed to have hazardous side-effects. However, after examining the evidence produced by the proponents of food irradiation, the author questions whether it has any major contribution to make to the problems of foodborne diseases or world food shortages. More acceptable solutions, he suggests, may be found in educating food handlers to ensure that hygienic conditions prevail in the production, storage and serving of food. (author)

  2. Vinca irradiator

    Eymery, R.

    1976-10-01

    The development programme of the VINCA radiosterilisation centre involves plans for an irradiator capable of working in several ways. Discontinuous operation. The irradiator is loaded for a certain period then runs automatically until the moment of unloading. This method is suitable as long as the treatment capacity is relatively small. Continuous operation with permanent batch loading and unloading carried out either manually or automatically (by means of equipment to be installed later). Otherwise the design of the apparatus is highly conventional. The source is a vertical panel submersible in a pool. The conveyor is of the 'bucket' type, with 4 tiers to each bucket. The batches pass successively through all possible irradiation positions. Transfert into and out of the cell take place through a maze, which also provides access to the cell when the sources are in storage at the bottom of the pool [fr

  3. Detection methods of irradiated foodstuffs

    Ponta, C C; Cutrubinis, M; Georgescu, R [IRASM Center, Horia Hulubei National Institute for Physics and Nuclear Engineering, PO Box MG-6, RO-077125 Magurele-Bucharest (Romania); Mihai, R [Life and Environmental Physics Department, Horia Hulubei National Institute for Physics and Nuclear Engineering, PO Box MG-6, RO-077125 Magurele-Bucharest (Romania); Secu, M [National Institute of Materials Physics, Bucharest (Romania)

    2005-07-01

    Full text: Food irradiation has, in certain circumstances, an important role to play both in promoting food safety and in reducing food losses. The safety and availability of nutritious food are essential components of primary health care. WHO actively encourages the proper use of food irradiation in the fight against foodborne diseases and food losses. To this end, it collaborates closely with FAO and IAEA. Food irradiation can have a number of beneficial effects, including delay of ripening and prevention of sprouting; control of insects, parasites, helminths, pathogenic and spoilage bacteria, moulds and yeasts; and sterilization, which enables commodities to be stored unrefrigerated for long periods. The 1990s witnessed a significant advancement in food irradiation processing. As a result, progress has been made in commercialization of the technology, culminating in greater international trade in irradiated foods and the implementation of differing regulations relating to its use in many countries. Codex General Standard for Irradiated Foodstuffs and Recommended International Code of Practice for the Operation of Irradiation Facilities Used for the Treatment of Foods regulate food irradiation at international level. At European Union level there are in power Directive 1999/2/EC and Directive1999/3/EC. Every particular country has also its own regulations regarding food irradiation. In Romania, since 2002 the Norms Regarding Foodstuffs and Food Ingredients Treated by Ionizing Radiation are in power. These Norms are in fact the Romanian equivalent law of the European Directives 1999/2/EC and 1999/3/EC. The greater international trade in irradiated foods has led to the demand by consumers that irradiated food should be clearly labeled as such and that methods capable of differentiating between irradiated and nonirradiated products should be available. Thus a practical basis was sought to allow consumers to exercise a free choice as to which food they purchase. If a

  4. Cell and tissue kinetics of the subependymal layer in mouse brain following heavy charged particle irradiation

    Manley, N.B.

    1988-01-01

    The following studies investigate the cellular response and cell population kinetics of the subependymal layer in the mouse brain exposed to heavy charged particle irradiation. Partial brain irradiation with helium and neon ions was confined to one cortex of the brain. Both the irradiated and the unirradiated contralateral cortex showed similar disturbances of the cell and tissue kinetics in the subependymal layers. The irradiated hemisphere exhibited histological damage, whereas the unirradiated side appeared normal histologically. The decrease in the values of the labeling indices 1 week after charged particle irradiation was dose- and ion-dependent. Mitotic indices 1 week after 10 and 25 Gy helium and after 10 Gy neon were the same as those seen in the control mice. Analysis of cell kinetics 1 week after 10 Gy helium and 10 Gy neon irradiation suggests the presence of a progenitor subpopulation that is proliferating with a shorter cell cycle. Comparison of the responses to the different charged particle beams indicates that neon ions are more effective in producing direct cellular damage than the helium ions, but the surviving proliferating cells several divisions later continue to maintain active cell renewal. Based on the 1 week post-irradiation H 3 -TdR labeling indices, a rough estimate of the RBE for neon ions is at least 2.5 when compared to helium ions

  5. Irradiance gradients

    Ward, G.J.; Heckbert, P.S.; Technische Hogeschool Delft

    1992-04-01

    A new method for improving the accuracy of a diffuse interreflection calculation is introduced in a ray tracing context. The information from a hemispherical sampling of the luminous environment is interpreted in a new way to predict the change in irradiance as a function of position and surface orientation. The additional computation involved is modest and the benefit is substantial. An improved interpolation of irradiance resulting from the gradient calculation produces smoother, more accurate renderings. This result is achieved through better utilization of ray samples rather than additional samples or alternate sampling strategies. Thus, the technique is applicable to a variety of global illumination algorithms that use hemicubes or Monte Carlo sampling techniques

  6. Numerical simulation of physicochemical interactions between oxygen atom and phosphatidylcholine due to direct irradiation of atmospheric pressure nonequilibrium plasma to biological membrane with quantum mechanical molecular dynamics

    Uchida, Satoshi; Yoshida, Taketo; Tochikubo, Fumiyoshi

    2017-10-01

    Plasma medicine is one of the most attractive applications using atmospheric pressure nonequilibrium plasma. With respect to direct contact of the discharge plasma with a biological membrane, reactive oxygen species play an important role in induction of medical effects. However, complicated interactions between the plasma radicals and membrane have not been understood well. In the present work, we simulated elemental processes at the first stage of physicochemical interactions between oxygen atom and phosphatidylcholine using the quantum mechanical molecular dynamics code in a general software AMBER. The change in the above processes was classified according to the incident energy of oxygen atom. At an energy of 1 eV, the abstraction of a hydrogen atom and recombination to phosphatidylcholine were simultaneously occurred in chemical attachment of incident oxygen atom. The exothermal energy of the reaction was about 80% of estimated one based on the bond energies of ethane. An oxygen atom over 10 eV separated phosphatidylcholine partially. The behaviour became increasingly similar to physical sputtering. The reaction probability of oxygen atom was remarkably high in comparison with that of hydrogen peroxide. These results suggest that we can uniformly estimate various physicochemical dynamics of reactive oxygen species against membrane lipids.

  7. Thermoluminescence of irradiated foods

    Wagner, U.; Helle, N.; Boegl, K.W.; Schreiber, G.A.

    1993-01-01

    This report describes developments and applications of the thermoluminescence (TL) analysis of mineral contaminants in foods. Procedures are presented to obtain minerals from most different products such as pepper, mangos, shrimps and mussels. The effect of light exposure during the storage of foods on the TL intensity of minerals is examined and corresponding conclusions for routine control are drawn. It is also shown that the normalization of TL intensities - the essential step to identify irradiated samples - can not only be achieved by γ, X or β rays but also by UV radiation. The results allow the conclusion that a clear identification of any food which has been irradiated with more than 1 kGy is possible if enough minerals can be isolated. (orig.)

  8. 3D/4D architecture of chromosomal break point regions in the cell nucleus following irradiation of normal cells and tumor cells; 3D/4D Architektur von chromosomalen Bruchpunktregionen im Zellkern nach Bestrahlung von Normalzellen und Tumorzellen

    Hausmann, M.; Cremer, C.; Friedl, A.; Dollinger, G.; Loebrich, M.; Friedland, W.

    2015-01-15

    The development of an effective analytical methodology for a correct description of oncogenic chromosomal aberrations is the challenge of medical radiobiology with respect to preventive therapeutic methods. Scope of the project was a better understanding of the behavior of break point regions dependent on the genome loci, the chromatin folding, the involved repair proteins and the beam quality with respect to an improvement and an efficient prognosis of the health consequences following radiation exposure. New microscopic insights in the normal cell nucleus are supposed to allow a better understanding of the spatial interactions on a molecular scale.

  9. Control of food irradiation in Denmark

    Leth, T.

    1996-01-01

    In Denmark food irradiation is not allowed. However, with the consideration within EEC about directives regulating food irradiation and the development of methods for detection, it has been found necessary to ascertain that illegally irradiated foods are not found on the Danish market. Irradiation of spices is allowed in many countries even without being declared in the foods. It thus seemed logical to begin the control of food irradiation by screening a number of spices. This resulted in 1992 in the assessment of 105 samples and in 1993 of 48 samples. (author)

  10. Normal Pressure Hydrocephalus (NPH)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  11. Irradiated food - no nutritional value?

    Diehl, J.F.; Hasselmann, C.

    1991-01-01

    Attempts by the European Commission to regulate food irradiation in the European Community by a directive have been repeatedly turned down by the European Parliament. The basis of information for the Parliamentarians was a Committee Report, which stated that irradiated foods had no nutritional value. This conclusion is compared with the richly available results of experimental studies. The authors conclude that the European Parliament has been completely misinformed. (orig.) [de

  12. ion irradiation

    Swift heavy ions interact predominantly through inelastic scattering while traversing any polymer medium and produce excited/ionized atoms. Here samples of the polycarbonate Makrofol of approximate thickness 20 m, spin coated on GaAs substrate were irradiated with 50 MeV Li ion (+3 charge state). Build-in ...

  13. Response of irradiated diet fed rats to whole body X irradiation

    Hasan, S.S.; Kushwaha, A.K.S.

    1985-01-01

    The response to whole body X irradiation has been studied in the brain of rats fed both on a normal diet (consisting of equal parts of wheat and gram flour) and on a low protein irradiated diet (consisting of a part of normal diet and three parts of wheat). The activity of enzymes related to the glucose metabolism (glucose 6-phosphate dehydrogenase and fructose diphosphate aldolase) is reduced, while that of peroxidant enzymes (catalase and lipid peroxidase) increased in the brain of rats that received a diet poor in proteins and irradiated diets (normal or hypoproteic). DNA and RNA levels and protein content show a significant reduction in the brain of rats with hypoproteic and irradiated diets. The total body irradiation causes serious alterations in the brain in animals with a hypoproteic malnutritions due both to a low protein and an irradiated diet. The brain of rats fed on a low protein and irradiated diet exhibits after whole body irradiation damages more severe than those in rats fed on a normal irradiated diet

  14. Fish irradiation

    Kovacs, J.; Tengumnuay, C.; Juangbhanich, C.

    1970-01-01

    Chub-mackerel was chosen for the study because they are the most common fish in Thailand. Preliminary investigations were conducted to determine the maximum radiation dose of gamma-rays by organoleptic tests. The samples were subjected to radiation at various doses up to 4 Mrad. Many experiments were conducted using other kinds of fish. The results showed that 1 Mrad would be the maximum acceptable dose for fish. Later, the influence of the radiation dose from 0.1-1 Mrad was studied in order to find the optimum acceptable dose for preservation of fish without off-flavour. For this purpose, the Hedonic scale was used. It was found that 0.2 and 0.5 Mrad gave the best result on Chub mackerel. The determinations of optimum dose, organoleptic, microbiological and trimethylamine content changes were done. The results showed that Chub mackerel irradiated at 0.2, 0.5 and 1 Mrad stored at 3 0 C for 71 days were still acceptable, on the contrary the untreated samples were found unacceptable at 14 days. The trimethylamine increment was significantly higher in the untreated samples. At 15 days storage, trimethylamine in the non-irradiated Chub-mackerel was about 10 times higher than the irradiated ones. At 51 and 79 days storage, about 13 times higher in the control samples than the irradiated samples except 0.1 Mrad. Only 2 times higher was found for the 0.1 Mrad. The microbiological results showed that the irradiation above 0.2 Mrad gave favorable extension of shelf-life of fish

  15. Direct or photostimulated luminescence after X-Ray irradiation of divalent europium in alkaline earth compounds containing some halides; Luminescence directe ou photostimulee apres irradiation X de l'europium divalent dans des familles de composes alcalino-terreux comportant un halogene

    Merigou, C

    1990-10-15

    With a view for digitizing of radiological images, the luminescent properties of divalent europium in diverse halogen compounds involving strontium or barium have been studied. In halogen-rich compounds (MCl{sub 2}, M{sub 4}OCl{sub 6}, M{sub 5}SiO{sub 4}Cl{sub 6},... where M is Sr or Ba), the thermal extinction of the emission begins only above 300 K. High densities of coloured spots have been produced with X-ray irradiation. The combining of these 2 features has led to the obtention of high yields for argon laser stimulated luminescence in the case of Sr{sub 5}SiO{sub 4}Cl{sub 5}Br:Eu halogen silicate. Although these yields are high they stay below that of BaXF:Eu which is usually used in photon-stimulated screens.

  16. Chapter 2: Irradiators

    NONE

    2018-04-01

    The chapter 2 presents the subjects: 1) gamma irradiators which includes: Category-I gamma irradiators (self-contained); Category-II gamma irradiators (panoramic and dry storage); Category-III gamma irradiators (self-contained in water); Category-IV gamma irradiators (panoramic and wet storage); source rack for Category-IV gamma irradiators; product transport system for Category-IV gamma irradiators; radiation shield for gamma irradiators; 2) accelerators which includes: Category-I Accelerators (shielded irradiator); Category-II Accelerators (irradiator inside a shielded room); Irradiation application examples.

  17. Food irradiation: An update

    Morrison, Rosanna M.

    1984-01-01

    Recent regulatory and commercial activity regarding food irradiation is highlighted. The effects of irradiation, used to kill insects and microorganisms which cause food spoilage, are discussed. Special attention is given to the current regulatory status of food irradiation in the USA; proposed FDA regulation regarding the use of irradiation; pending irradiation legislation in the US Congress; and industrial applications of irradiation

  18. Irradiation distribution diagrams and their use for estimating collectable energy

    Ronnelid, M.; Karlsson, B.

    1997-01-01

    A method for summarising annual or seasonal solar irradiation data in irradiation distribution diagrams, including both direct and diffuse irradiation, is outlined. The practical use of irradiation distribution diagrams is discussed in the paper. Examples are given for the calculation of collectable irradiation on flat plate collectors or trough-like concentrators like the compound parabolic concentrator (CPC), and for the calculation of overhang geometries for windows to prevent overheating of buildings. (author)

  19. Studies on mating competition of irradiated melon flies

    Limohpasmanee, W.

    1994-01-01

    Mating competition is the key factor for fruit flies control by using sterile insect technique project. Mass rearing and irradiation can reduce the mating competition of fruit flies. This experiment has purpose to evaluate the mating competition of the irradiated melon fly. The results show that mating competition values of irradiated melon flies were 0.36 and 0.24 when they mated with normal and irradiated females. Both normal male and female can mate more frequency than irradiated flies. (Z=1.322, P<0.05; Z=1.851, P<0.05). The results show that quality of mass rearing and irradiated melon fly was lower than the normal flies. So that quality of irradiated fly must be improved and the number of released flies as less must be higher than natural flies 6 time

  20. Postoperative irradiation of glaucoma filtering surgery

    Mano, Tomiya; Manabe, Reizo; Masaki, Norie; Ohashi, Yuichi; Umemoto, Masayo; Kinoshita, Shigeru; Yamamoto, Ryo; Hirose, Naomi.

    1986-01-01

    To inhibit the subcojunctival scarring after glaucoma filtering surgery, Sr-90 beta-irradiation of 10 Gy in 1 fraction or 20 Gy in 2 fractions has been tried in 12 eyes. Usual trabeculectomy followed by beta-irradiation was performed on 6 eyes. Of these, 3/6 eyes were meintained in normal range of IOP after irradiation. Furthermore, combined surgery of trabeculectomy, tenectomy and episcleral resection followed by beta-irradiation were performed on 6 eyes. Of these, 5/6 eyes were maintained in normal range of IOP. No complications was observed during 3 to 8 months of followup periods after treatment. Filtering surgery combined with postoperative beta-irradiation seems to inhibit the proliferation of subcon-junctival fibroblast and to control IOP. (1 Gy = 100 rad). (author)

  1. Food irradiation

    Beerens, H [Lille-1 Univ., 59 - Villeneuve-d' Ascq (France); Saint-Lebe, L

    1979-01-01

    Various aspects of food treatment by cobalt 60 or caesium 137 gamma radiation are reviewed. One of the main applications of irradiation on foodstuffs lies in its ability to kill micro-organisms, lethal doses being all the lower as the organism concerned is more complex. The effect on parasites is also spectacular. Doses of 200 to 300 krad are recommended to destroy all parasites with no survival period and no resistance phenomenon has ever been observed. The action of gamma radiation on macromolecules was also investigated, the bactericide treatment giving rise to side effects by transformation of food components. Three examples were studied: starch, nucleic acids and a whole food, the egg. The organoleptic aspect of irradiation was examined for different treated foods, then the physical transformations of unpasteurized, heat-pasteurized and radio-pasteurized eggs were compared. The report ends with a brief analysis of the toxicity and conditions of application of the treatment.

  2. Irradiation device

    Ransohoff, J.A.

    1984-01-01

    Carriers, after being loaded with product to be irradiated, are transported by an input-output conveyor system into an irradiation chamber where they are received in a horizontal arrangement on racks which may support different sizes and numbers of carriers. The racks are moved by a chamber conveyor system in an endless rectangular path about a radiation source. Packers shift the carriers on the racks to maintain nearest proximity to the radiation source. The carriers are shifted in position on each rack during successive rack cycles to produce even radiation exposure. The carriers may be loaded singly onto successive racks during a first cycle of movement thereof about the source, with loading of additional carriers, and/or unloading of carriers, onto each rack occurring on subsequent rack cycles of movement

  3. Food irradiation

    Roberts, P.B.

    1997-01-01

    Food can be provided with extra beneficial properties by physical processing. These benefits include a reduced possibility of food poisoning, or an increased life of the food. We are familiar with pasteurisation of milk, drying of vegetables, and canning of fruit. These physical processes work because the food absorbs energy during treatment which brings about the changes needed. The energy absorbed in these examples is heat energy. Food irradiation is a less familiar process. It produces similar benefits to other processes and it can sometimes be applied with additional advantages over conventional processing. For example, because irradiation causes little heating, foods may look and taste more natural. Also, treatment can take place with the food in its final plastic wrappers, reducing the risk of re-contamination. (author). 1 ref., 4 figs., 1 tab

  4. Food irradiation

    Beerens, H.; Saint-Lebe, L.

    1979-01-01

    Various aspects of food treatment by cobalt 60 or caesium 137 gamma radiation are reviewed. One of the main applications of irradiation on foodstuffs lies in its ability to kill micro-organisms, lethal doses being all the lower as the organism concerned is more complex. The effect on parasites is also spectacular. Doses of 200 to 300 krad are recommended to destroy all parasites with no survival period and no resistance phenomenon has ever been observed. The action of gamma radiation on macromolecules was also investigated, the bactericide treatment giving rise to side effects by transformation of food components. Three examples were studied: starch, nucleic acids and a whole food, the egg. The organoleptic aspect of irradiation was examined for different treated foods, then the physical transformations of unpasteurized, heat-pasteurized and radio-pasteurized eggs were compared. The report ends with a brief analysis of the toxicity and conditions of application of the treatment [fr

  5. Endolymphatic irradiation

    Galvao, M.M.; Ianhez, L.E.; Sabbaga, E.

    1982-01-01

    The authors analysed the clinical evolution and the result of renal transplantation some years after irradiation in 24 patients (group I) who received endolymphatic 131 I as a pre-transplantation immunesuppresive measure. The control group (group II) consisted of 24 non-irradiated patients comparable to group I in age, sex, primary disease, type of donor and immunesuppressive therapy. Significant differences were observed between the two groups regarding such factors a incidence and reversibility of rejection crises in the first 60 post-transplantation days, loss of kidney due to rejection, and dosage of azathioprine. The authors conclude that this method, besides being harmless, has prolonged immunesuppressive action, its administration being advised for receptores of cadaver kidneys, mainly those who show positive cross-match against HLA antigens for painel. (Author) [pt

  6. Normalization: A Preprocessing Stage

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  7. Changes in ovaries of X-irradiated ewes

    Tokos, M.; Arendarcik, J.; Maracek, I.; Stanikova, A.; Balun, J.; Praslicka, M.

    1980-01-01

    The qualitative histological alterations of ovaries and caryometric changes in the corpora lutea (CL) were studied in the ewes of the Slovak Merino breed after irradiation with X-rays. The experiments were conducted on 12 ewes divided into three groups of four animals. The first group included the control ewes, the second, experimental group was exposed to X-rays applied directly to the ovaries after laparotomy at a rate of 64.4 mC per kg (250 R), and the ewes in the third group were locally irradiated in the hypothalamo-hypophysial region at a rate of 516.5 mC per kg (2000 R). On the 10th day following the irradiation, the animals were killed, ovarian excisions were taken from the carcasses and processed. Changes in the blood vessels of the ovaries of the ewes in the second group were revealed by qualitative microscopic analysis. Pronounced subintimal changes, reminding of foamy cells described in available literature as a consequence of radiation damage to the blood vessels, were observed in the arteries and veins of the marrow and porta of the ovaries. A pronounced alteration of follicular structures was induced by single local irradiation of the ovaries which, at the same time, stimulated CL production. The irradiation of the hypothalamo-hypophysial region resulted in a multiplication of normal tertiary follicles and in an increase of the total number of follicles. No other histological changes were observed in the tissues of ovaries after irradiation of the hypothalamo-hypophysial region

  8. Prenatal irradiation: radioinduced apoptosis in developing central nervous system

    Gisone, P.; Dubner, D.; Michelin, S.; Perez, M.R.; Barboza, M.

    1998-01-01

    Severe mental retardation (SMR) is the most significant effect of prenatal irradiation. The high radiosensitivity of developing brain is related with the chronology of morpho genetic phenomena regarding neuroblast proliferation, neuronal differentiation and migration, synaptogenesis and dendritic arborization. Programmed cell death (apoptosis) normally occurs during development in central nervous system (CNS). Apoptosis is a direct result of the expression of specific genes with a final common pathway leading to a characteristic DNA fragmentation pattern. A wide variety of situations and toxic agents have been reported to result in apoptotic death in developing CNS. The aim of this work was the characterization and quantification of apoptosis using an in vitro model of prenatal irradiation. Primary cell cultures from rat brain cortex of 17 days g.a. were irradiated with a gamma source, with doses between 0.2 Gy to 2 Gy. Apoptosis was evaluated 4 hours and 20 hours after irradiation by hematoxylin/eosin, fluorescent microscopy, flow cytometry and DNA electrophoresis. It was also evaluated the neuro protective effect of L-NAME, SOD and glutathion. A dose-dependent increase in apoptotic cell fraction was observed. A protector effect related with the presence of glutathion was observed. (author) [es

  9. Normalized cDNA libraries

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  10. Weighted optimization of irradiance for photodynamic therapy of port wine stains

    He, Linhuan; Zhou, Ya; Hu, Xiaoming

    2016-10-01

    Planning of irradiance distribution (PID) is one of the foremost factors for on-demand treatment of port wine stains (PWS) with photodynamic therapy (PDT). A weighted optimization method for PID was proposed according to the grading of PWS with a three dimensional digital illumination instrument. Firstly, the point clouds of lesions were filtered to remove the error or redundant points, the triangulation was carried out and the lesion was divided into small triangular patches. Secondly, the parameters such as area, normal vector and orthocenter for optimization of each triangular patch were calculated, and the weighted coefficients were determined by the erythema indexes and areas of patches. Then, the optimization initial point was calculated based on the normal vectors and orthocenters to optimize the light direction. In the end, the irradiation can be optimized according to cosine values of irradiance angles and weighted coefficients. Comparing the irradiance distribution before and after optimization, the proposed weighted optimization method can make the irradiance distribution match better with the characteristics of lesions, and has the potential to improve the therapeutic efficacy.

  11. Total body irradiation: current indications; L`irradiation corporelle totale: les indications actuelles

    Giraud, P.; Danhier, S.; Dubray, B.; Cosset, J.M. [Institut Curie, 75 - Paris (France)

    1998-05-01

    The choice of dose and fractionation for total body irradiation is made difficult by the large number of considerations to be taken into account. The outcome of bone marrow transplantation after total body irradiation can be understood in terms of tumor cell killing, engraftment, and normal tissue damage, each of these endpoints being influenced by irradiation-, disease-, transplant-, and patient- related factors. Interpretation of clinical data is further hampered by the overwhelming influence of logistic constraints, the small numbers of randomized studies, and the concomitant variations in total dose and fraction size or dose rate. So far, three cautious conclusions can be drawn in order to tentatively adapt the total body irradiation schedule to clinically-relevant situations. Firstly, the organs at risk for normal tissue damage (lung, liver, lens, kidney) are protected by delivering small doses per fraction at low dose rate. This suggests that, when toxicity is at stake (e.g. in children), fractionated irradiation should be preferred, provided that inter-fraction intervals are long enough. Secondly, fractionated irradiation should be avoided in case of T-cell depleted transplant, given the high risk of graft rejection in this setting. An alternative would be to increase total (or fractional) dose of fractionated total body irradiation, but this approach is likely to induce more normal tissue toxicity. Thirdly, clinical data have shown higher relapse rates in chronic myeloid leukemia after fractionated or low dose rate total body irradiation, suggesting that fractionated irradiation should not be recommended, unless total (or fractional) dose is increased. Total body irradiation-containing regimens, primarily cyclophosphamide / total body irradiation, are either equivalent to or better than the chemotherapy-only regimens, primarily busulfan / cyclophosphamide. Busulfan / cyclophosphamide certainly represents a reasonable alternative, especially in patients who

  12. Studies on Microbiological and Biological Methods for Detection of Irradiated Food

    Ibrahim, H.M.A.

    2013-01-01

    The main aim of this study is to evaluate a microbiological and biological methods used for the detection of irradiated foods in Egypt. The microbiological methods included were shift in microflora load and direct epifluroescent filter technique compared with aerobic plate count (DEFT/APC), while the biological method was DNA comet assay. The selected foods were black, strawberry, fresh-and frozen-de boned chicken. The samples of these foods were exposed to different doses of gamma radiation according to the purpose of irradiation for each food. The results indicated that the characteristics of microbial population of all irradiated samples have been changed. The very lower count of viable bacterial count (APC) and mold and yeasts counts in the samples than the reported normal count as well as the absence of Gram- negative bacteria and Enterobacteriaceae group from these samples could be used as an indication for radiation treatment of these foods. The large difference between microbial counts obtained by DEFT test and that obtained by APC test could also be used for screening radiation treatment of these foods. Photographic and image analysis of DNA comet assay showed that irradiation of these foods caused damage to the food cells DNA (fragmentation) at different levels according to the doses used and kind of foods. This DNA damage can be followed or described by DNA comet assay test. On the basis of comet assay, the discrimination between unirradiated and irradiated food samples was very possible. In general the results showed that DEFT/APC method had the potential to detect irradiated food samples either at zero time of storage or throughout the storage period post- irradiation. DNA comet assay as a rapid, simple and inexpensive screening test approved to be successful for detection of irradiated food samples under investigation. Determination of rough applied irradiation dose is possible if photographic analysis is combined with image analysis

  13. Detection of some irradiated foods

    NASR, E.H.A

    2009-01-01

    This study was performed to investigate the possibility of using two rapid methods namely Supercritical Fluid Extraction (SFE) and Direct Solvent Extraction (DSE) methods for extraction and isolation of 2-dodecylcyclobutanone (2-DCB) followed by detecting this chemical marker by Gas chromatography technique and used this marker for identification of irradiated some foods containing fat (beef meat, chicken, camembert cheese and avocado) post irradiation, during cold and frozen storage. Consequently, this investigation was designed to study the following main points:- 1- The possibility of applying SFE-GC and DSE-GC rapid methods for the detection of 2-DCB from irradiated food containing fat (beef meat, chicken, camembert cheese and avocado fruits) under investigation.2-Studies the effect of gamma irradiation doses on the concentration of 2-DCB chemical marker post irradiation and during frozen storage at -18 degree C of chicken and beef meats for 12 months.3-Studies the effect of gamma irradiation doses on the concentration of 2-DCB chemical marker post irradiation and during cold storage at 4±1 degree C of camembert cheese and avocado fruits for 20 days.

  14. Behavior of high Tc-superconductors and irradiated defects under reactor irradiation

    Atobe, Kozo; Honda, Makoto; Fukuoka, Noboru; Yoshida, Hiroyuki.

    1991-01-01

    It has been well known that the lattice defects of various types are introduced in ceramics without exception, and exert large effect to the function of these materials. Among oxides, the electronic materials positively using oxygen defect control have been already put in practical use. Also in the oxide high temperature superconductors which are Perovskite type composite oxides, the superconductive characteristics are affected largely by the concentration of the oxygen composing them. This is regarded as an important factor for causing superconductivity, related with the oxygen cavities arising at this time and the carriers bearing superconductivity. In this study, the irradiation effect with relatively low dose, the measurement under irradiation, the effect of irradiation temperature, and the effect of radiation quality were evaluated by the irradiation of YBCO, EBCO and LBCO. The experimental method, and the irradiation effect at low temperature and normal temperature, the effect of Co-60 gamma ray irradiation instead of reactor irradiation are reported. (K.I.)

  15. Nitric oxide-mediated bystander signal transduction induced by heavy-ion microbeam irradiation

    Tomita, Masanori; Matsumoto, Hideki; Funayama, Tomoo; Yokota, Yuichiro; Otsuka, Kensuke; Maeda, Munetoshi; Kobayashi, Yasuhiko

    2015-07-01

    In general, a radiation-induced bystander response is known to be a cellular response induced in non-irradiated cells after receiving bystander signaling factors released from directly irradiated cells within a cell population. Bystander responses induced by high-linear energy transfer (LET) heavy ions at low fluence are an important health problem for astronauts in space. Bystander responses are mediated via physical cell-cell contact, such as gap-junction intercellular communication (GJIC) and/or diffusive factors released into the medium in cell culture conditions. Nitric oxide (NO) is a well-known major initiator/mediator of intercellular signaling within culture medium during bystander responses. In this study, we investigated the NO-mediated bystander signal transduction induced by high-LET argon (Ar)-ion microbeam irradiation of normal human fibroblasts. Foci formation by DNA double-strand break repair proteins was induced in non-irradiated cells, which were co-cultured with those irradiated by high-LET Ar-ion microbeams in the same culture plate. Foci formation was suppressed significantly by pretreatment with an NO scavenger. Furthermore, NO-mediated reproductive cell death was also induced in bystander cells. Phosphorylation of NF-κB and Akt were induced during NO-mediated bystander signaling in the irradiated and bystander cells. However, the activation of these proteins depended on the incubation time after irradiation. The accumulation of cyclooxygenase-2 (COX-2), a downstream target of NO and NF-κB, was observed in the bystander cells 6 h after irradiation but not in the directly irradiated cells. Our findings suggest that Akt- and NF-κB-dependent signaling pathways involving COX-2 play important roles in NO-mediated high-LET heavy-ion-induced bystander responses. In addition, COX-2 may be used as a molecular marker of high-LET heavy-ion-induced bystander cells to distinguish them from directly irradiated cells, although this may depend on the time

  16. 3j Symbols: To Normalize or Not to Normalize?

    van Veenendaal, Michel

    2011-01-01

    The systematic use of alternative normalization constants for 3j symbols can lead to a more natural expression of quantities, such as vector products and spherical tensor operators. The redefined coupling constants directly equate tensor products to the inner and outer products without any additional square roots. The approach is extended to…

  17. Effect of high-intensity irradiation from dental photopolymerization on the isolated and superfused vertebrate retina.

    Rassaei, Mohammad; Thelen, Martin; Abumuaileq, Ramzi; Hescheler, Jürgen; Lüke, Matthias; Schneider, Toni

    2013-03-01

    Light or electromagnetic radiation may damage the neurosensory retina during irradiation of photopolymerizing resinous materials. Direct and indirect effects of irradiation emitted from polymerisation curing light may represent a severe risk factor for the eyes and the skin of the lamp operators, as well as for the patient's oral mucosa. Bovine superfused retinas were used to record their light-evoked electroretinogram (ERG) as ex vivo ERGs. Both the a- and the b-waves were used as indicators for retinal damage on the functional level. The isolated retinas were routinely superfused with a standard nutrient solution under normoglycemic conditions (5 mM D-glucose). The change in the a- and b-wave amplitude and implicit time, caused by low and high intensity irradiation, was calculated and followed over time. From the results, it can be deduced that the irradiation from LED high-power lamps affects severely the normal physiological function of the bovine retina. Irradiations of 1,200 lx irreversibly damaged the physiological response. In part, this may be reversible at lower intensities, but curing without using the appropriate filter will bleach the retinal rhodopsin to a large extent within 20 to 40 s of standard application times. Constant exposure to intense ambient irradiation affects phototransduction (a-wave) as well as transretinal signalling. The proper use of the UV- and blue-light filtering device is highly recommended, and may prevent acute and long lasting damage of the neurosensory retina.

  18. Depression of DNA synthesis rate following hyperthermia, gamma irradiation, cyclotron neutrons and mixed modalities

    Weber, H.J.; Muehlensiepen, H.; Porschen, W.; Feinendegen, L.E.; Dietzel, F.

    1978-01-01

    The incorporation of the thymidine analogue I-UdR is proportional to the activity of DNA synthesis. The maximum depression of 125-I-UdR incorporation occurs approximately 4 hours after all kinds of treatment. The increase which follow reflects cell processes like reoxygeneration, recovery, recycling and recruitment (although a direct relation is not yet demonstrable). The degree of depression 4 hours after treatment and the time required needs to reach control level is dependent on dose and radiation quaility but no such dependence could be clearly seen for the times of hyperthermia treatment we used. Neutron irradiation and the combination gamma irradiation + hyperthermia show a higher depression and a slower return to normal than gamma irradiation at the same dose. (orig.) [de

  19. Inductive capacity of irradiated dermal papillae

    Ibrahim, L.; Wright, E.A.

    1977-01-01

    It is stated that the importance of the dermal papilla for the maintenance and control of hair cycles in mammals has long been recognised, but there has been little direct evidence of its mode of functioning. Permanent removal of rat body hair has resulted from large doses of X-radiation and it was believed that this caused destruction of the dermal papilla, which in turn resulted in permanent epilation. A study is here reported on the effect of heavy doses of irradiation on the dermal papilla and epithelial elements of the hair follicles of mice and rats. It was found that the high doses that caused permanent epilation destroyed the epithelium but left the dermal papilla anatomically and functionally intact, so that even on transplantation it could induce a series of new hairs. The dose employed was 2500 R of X-radiation for mice or 5000 R for rats. Hairs after transplantation were shorter than normal and had a slower rate of growth; depending on the size of the transplanted dermal papilla. The hairs become shorter with successive cycles of irradiation. (U.K.)

  20. Normal forms in Poisson geometry

    Marcut, I.T.

    2013-01-01

    The structure of Poisson manifolds is highly nontrivial even locally. The first important result in this direction is Conn's linearization theorem around fixed points. One of the main results of this thesis (Theorem 2) is a normal form theorem in Poisson geometry, which is the Poisson-geometric

  1. Cesium glass irradiation sources

    Plodinec, M.J.

    1982-01-01

    The precipitation process for the decontamination of soluble SRP wastes produces a material whose radioactivity is dominated by 137 Cs. Potentially, this material could be vitrified to produce irradiation sources similar to the Hanford CsCl sources. In this report, process steps necessary for the production of cesium glass irradiation sources (CGS), and the nature of the sources produced, are examined. Three options are considered in detail: direct vitrification of precipitation process waste; direct vitrification of this waste after organic destruction; and vitrification of cesium separated from the precipitation process waste. Direct vitrification is compatible with DWPF equipment, but process rates may be limited by high levels of combustible materials in the off-gas. Organic destruction would allow more rapid processing. In both cases, the source produced has a dose rate of 2 x 10 4 rads/hr at the surface. Cesium separation produces a source with a dose rate of 4 x 10 5 at the surface, which is nearer that of the Hanford sources (2 x 10 6 rads/hr). Additional processing steps would be required, as well as R and D to demonstrate that DWPF equipment is compatible with this intensely radioactive material

  2. PV System Performance Evaluation by Clustering Production Data to Normal and Non-Normal Operation

    Tsafarakis, O.; Sinapis, K.; van Sark, W.G.J.H.M.

    2018-01-01

    The most common method for assessment of a photovoltaic (PV) system performance is by comparing its energy production to reference data (irradiance or neighboring PV system). Ideally, at normal operation, the compared sets of data tend to show a linear relationship. Deviations from this linearity

  3. China's move to food irradiation

    Wedekind, L.H.

    1986-01-01

    The Chinese officials outlined China's past and future directions at a recent international food irradiation seminar in Shanghai sponsored by the FAO and IAEA. The meeting was attended by about 170 participants from China and 22 other countries, primarily from the Asian and Pacific region. Three food irradiation plants currently are operating in the region and 14 more are planned over the next 5 years. It was reported that China continues to suffer high food losses, up to 30% for some commodities, primarily due to preservation and storage problems. In January 1986, the first of five regional irradiation facilities planned in China officially opened in Shanghai. The Shanghai irradiation centre plans to process up to 35,000 tons of vegetables a year, as well as some spices, fruits, and non-food products. The Ministry of Public Health has approved seven irradiated foods as safe human diets: rice, potatoes, onions, garlic, peanuts, mushrooms and pork sausages; approval for apples is expected shortly. The Chinese officials at the Shanghai meeting stressed their openness to foreign participation and cooperation in food irradiation's development

  4. Cost-benefit analysis of irradiation of vegetables and fruits at the Shanghai irradiation centre

    Xu Zhicheng; Sha Zhenyuan

    1993-01-01

    Differences between the developing and the developed countries in development and application of food irradiation are discussed, including the objectives of irradiation, scale, and the operation and control of facilities. These represent the chief problems of development of food irradiation in the developing countries. A proposal concerning the economic benefit of a gamma irradiation facility is discussed. In the light of many years' operating experience at the Shanghai Irradiation Centre, the operation cost per hour and coefficient of economic benefit are presented. These data can be used to estimate the economic benefit of gamma irradiated products at any time, and are useful for directing the daily operation of gamma irradiation facilities. From examples of cost-benefit analysis of irradiated garlic and apples it is shown that to improve the benefit of gamma irradiation facilities the annual hours of operation must be increased, so as to reduce the cost of operation. Food irradiated with a low dose provides more economic benefit than other irradiated products; the coefficients of economic benefit will increase as the irradiated processing throughput increases. Practical examples are given relating to garlic and apples, showing the economic benefit to wholesalers and retailers. (author). 4 refs, 3 figs, 7 tabs

  5. Development of irradiation rig in HTTR and dosimetry method. I-I type irradiation equipment

    Shibata, Taiju; Kikuchi, Takayuki [Japan Atomic Energy Research Inst., Oarai, Ibaraki (Japan). Oarai Research Establishment; Miyamoto, Satoshi; Ogura, Kazutomo [Japan Atomic Power Co., Tokyo (Japan)

    2002-12-01

    The High Temperature Engineering Test Reactor (HTTR) is a graphite-moderated, helium gas-cooled test reactor with a maximum power of 30 MW. The HTTR aims not only to establish and upgrade the technological basis for the HTGRs but also to perform the innovative basic research on high temperature engineering with high temperature irradiation fields. It is planned that the HTTR is used to perform various engineering tests such as the safety demonstration test, high temperature test operation and irradiation test with large irradiation fields at high temperatures. This paper describes the design of the I-I type irradiation equipment developed as the first irradiation rig for the HTTR and does the planned dosimetry method at the first irradiation test. It was developed to perform in-pile creep test on a stainless steel with large standard size specimens in the HTTR. It can give great loads on the specimens stably and can control the irradiation temperature precisely. The in-core creep properties on the specimens are measured by newly developed differential transformers and the irradiation condition in the core is monitored by thermocouples and self-powered neutron detectors (SPNDs), continuously. The irradiated neutron fluence is assessed by neutron fluence monitors of small metallic wires after the irradiation. The obtained data at the first irradiation test can strongly be contributed to upgrade the technological basis for the HTGRs, since it is the first direct measurement of the in-core irradiation environments of the HTTR. (author)

  6. Biology of food irradiation

    Murray, D.R.

    1990-01-01

    The author presents his arguments for food scientists and biologists that the hazards of food irradiation outweigh the benefits. The subject is discussed in the following sections: introduction (units, mutagenesis, seed viability), history of food irradiation, effects of irradiation on organoleptic qualities of staple foods, radiolytic products and selective destruction of nutrients, production of microbial toxins in stored irradiated foods and loss of quality in wheat, deleterious consequences of eating irradiated foods, misrepresentation of the facts about food irradiation. (author)

  7. A direct comparison of popular models of normal memory loss and Alzheimer's disease in samples of African Americans, Mexican Americans, and refugees and immigrants from the former Soviet Union.

    Schrauf, Robert W; Iris, Madelyn

    2011-04-01

    To understand how people differentiate normal memory loss from Alzheimer's disease (AD) by investigating cultural models of these conditions. Ethnographic interviews followed by a survey. Cultural consensus analysis was used to test for the presence of group models, derive the "culturally correct" set of beliefs, and compare models of normal memory loss and AD. Chicago, Illinois. One hundred eight individuals from local neighborhoods: African Americans, Mexican Americans, and refugees and immigrants from the former Soviet Union. Participants responded to yes-or-no questions about the nature and causes of normal memory loss and AD and provided information on ethnicity, age, sex, acculturation, and experience with AD. Groups held a common model of AD as a brain-based disease reflecting irreversible cognitive decline. Higher levels of acculturation predicted greater knowledge of AD. Russian speakers favored biological over psychological models of the disease. Groups also held a common model of normal memory loss, including the important belief that "normal" forgetting involves eventual recall of the forgotten material. Popular models of memory loss and AD confirm that patients and clinicians are speaking the same "language" in their discussions of memory loss and AD. Nevertheless, the presence of coherent models of memory loss and AD, and the unequal distribution of that knowledge across groups, suggests that clinicians should include wider circles of patients' families and friends in their consultations. These results frame knowledge as distributed across social groups rather than simply the possession of individual minds. © 2011, Copyright the Authors. Journal compilation © 2011, The American Geriatrics Society.

  8. Effect of Irradiation Maternal Diets on the Post-natal Development of Brain Rat Pups

    Hasan, S.S.

    2005-09-01

    Full text: Effect of Protein-calorie malnutrition was studied on the pups born to mothers receiving either irradiated normal diet (consisted equal parts of gram and wheat) or irradiation low protein diet (consisted one part of normal diet and three parts of heat). Level of DNA, RNA and protein content were found markedly reduced in the brain of irradiated low protein diet fed pups than in the pups fed on the irradiated normal diet. Glucose 6-phosphate dehydrogenase activity was found lower while catalase and lipid peroxidation activity were higher in the pups given irradiated low protein diet, compared whit the pups fed irradiated normal diet. On the whole both the irradiated low protein diet as well as irradiated normal diet fed pups showed higher index of biochemical changes than in the unirradiated low protein diet fed pups. Post-natal mortality was 60% in the pups given irradiated low protein diet, whereas the pups fed on the irradiated normal diet and unirradiated low protein diet did not show any death. The study given evidence that feeding of the irradiated low protein diet interferes more with the development of brain compared with the pups fed on irradiated normal diet

  9. Stem cell migration after irradiation

    Nothdurft, W.; Fliedner, T.M.

    1979-01-01

    The survival rate of irradiated rodents could be significantly improved by shielding only the small parts of hemopoietic tissues during the course of irradiation. The populations of circulating stem cells in adult organisms are considered to be of some importance for the homeostasis between the many sites of blood cell formation and for the necessary flexibility of hemopoietic response in the face of fluctuating demands. Pluripotent stem cells are migrating through peripheral blood as has been shown for several mammalian species. Under steady state conditions, the exchange of stem cells between the different sites of blood cell formation appears to be restricted. Their presence in blood and the fact that they are in balance with the extravascular stem cell pool may well be of significance for the surveilance of the integrity of local stem cell populations. Any decrease of stem cell population in blood below a critical size results in the rapid immigration of circulating stem cells in order to restore local stem cell pool size. Blood stem cells are involved in the regeneration after whole-body irradiation if the stem cell population in bone marrows is reduced to less than 10% of the normal state. In the animals subjected to partial-body irradiation, the circulating stem cells appear to be the only source for the repopulation of the heavily irradiated, aplastic sites of hemopoietic organs. (Yamashita, S.)

  10. Irradiation damage to the lung

    Fennessy, J.J.

    1987-01-01

    While some degree of injury to normal, non-tumor-bearing, intrathoracic structures always occurs following irradiation for cure or palliation of neoplastic disease, clinical expression of this injury is uncommon. However, under certain circumstances, clinical manifestations may be severe and life threatening. Acute radiographic manifestations of pulmonary injury usually appear either synchronous with or, more typically, seven to ten days after the onset of the clinical syndrome. The acute signs of edema and slight volume loss within the irradiated zone are nonspecific except for their temporal and spatial relationship to the irradiation of the patient. Resolution of the acute changes is followed by pulmonary cicatrization, which is almost always stable within one year after completion of therapy. Change in postirradiation scarring following stabilization of the reaction must always be assumed to be due to some other process. While the radiograph primarily reveals pulmonary injury, all tissues, including the heart and major vessels, are susceptible, and the radiologist must recognize that any change within the thorax of a patient who has undergone thoracic irradiation may be a complication of that treatment. Differentiation of irradiation injury from residual or recurrent tumor, drug reaction, or opportunistic infection may be difficult and at times impossible

  11. Effect of irradiation on the Porphyromonas gingivalis

    Lee, Chang Hee; Kim, Gyu Tae; Choi, Yong Suk; Hwang, Eui Hwan

    2008-01-01

    The aim of this study was to observe a direct effect of irradiation on the periodontopathic Porphyromonas gingivalis (P. gingivalis). P. gingivalis 2561 was exposed to irradiation with a single absorbed dose of 10, 20, 30, and 40 Gy. Changes in viability and antibiotic sensitivity, morphology, transcription, and protein profile of the bacterium after irradiation were examined by pour plating method, disc diffusion method, transmission electron microscopy, RT-PCR, and immunoblot, respectively. Viability of irradiated P. gingivalis drastically reduced as irradiation dose was increased. Irradiated P. gingivalis was found to have become more sensitive to antibiotics as radiation dose was increased. With observation under the transmission electron microscope, the number of morphologically abnormal cells was increased with increasing of irradiation dose. In RT-PCR, decrease in the expression of fim A and sod was observed in irradiated P. gingivalis. In immunoblot, change of profile in irradiated P. gingivalis was found in a number of proteins including 43-kDa fimbrillin. These results suggest that irradiation may affect the cell integrity of P. gingivalis, which is manifested by the change in cell morphology and antibiotic sensitivity, affecting viability of the bacterium.

  12. Effect of irradiation on the Porphyromonas gingivalis

    Lee, Chang Hee; Kim, Gyu Tae; Choi, Yong Suk; Hwang, Eui Hwan [School of Dentistry, Kyung Hee University, Seoul (Korea, Republic of)

    2008-03-15

    The aim of this study was to observe a direct effect of irradiation on the periodontopathic Porphyromonas gingivalis (P. gingivalis). P. gingivalis 2561 was exposed to irradiation with a single absorbed dose of 10, 20, 30, and 40 Gy. Changes in viability and antibiotic sensitivity, morphology, transcription, and protein profile of the bacterium after irradiation were examined by pour plating method, disc diffusion method, transmission electron microscopy, RT-PCR, and immunoblot, respectively. Viability of irradiated P. gingivalis drastically reduced as irradiation dose was increased. Irradiated P. gingivalis was found to have become more sensitive to antibiotics as radiation dose was increased. With observation under the transmission electron microscope, the number of morphologically abnormal cells was increased with increasing of irradiation dose. In RT-PCR, decrease in the expression of fim A and sod was observed in irradiated P. gingivalis. In immunoblot, change of profile in irradiated P. gingivalis was found in a number of proteins including 43-kDa fimbrillin. These results suggest that irradiation may affect the cell integrity of P. gingivalis, which is manifested by the change in cell morphology and antibiotic sensitivity, affecting viability of the bacterium.

  13. A study of morphogenesis of digital malformation on rat embryo by x-irradiation

    Kim, Jhai Dhuck; You, Dong Soo

    1981-01-01

    The author studied in the effects of x-irradiation to the development of digital malformation in gestation rats. The time-matings occurred between 6 p.m. and 8 a.m. and females with copulation plugs at 8 a.m. were isolated and properly marked for evidence of copulation. The lower abdomen of mothers were exposed to x-irradiation on the 11 1/2th day of gestation, the critical period developing digital malformation, respectively 100, 150, 200, 250, 300 and 350 rads. At 18 1/2th day of post-conception total 50 pregnant females were dissected and the incidence of digital malformations were obtained. Rat embryos on the 12, 13, 14, 15, 16th day of gestation irradiated by 250 rads were examined for morphogenesis of digital malformation. Digital radiating lines were examined in water and histologically by H-E stain. Supra vital stain samples by Nile-blue sulfate in 37 .deg. C normal saline were prepared for the observation of cell necrosis regions and morphogenesis of digits. The results obtained were as follows; 1. By x-irradiation on 11th day of gestation, digital malformations of Ectrodactylia, Syndactylia, Polydactylia and Hematodactylia were developed. Ectrodactylia showed the effective relationship to the amount of irradiation, however Syndactylia and Poydactylia did not. 2. By x-irradiation, cell necrosis of digital germ was appeared markedly, but in 48 hours after irradiation was depressed to the periphery of digital germ and in 72 hours after irradiation was disappeared. Digital radiating line showed marked state of malformation in 48 hours after irradiation and continued to show the same amount of physiological cell necrosis as the compared control group in 72 hours after irradiation. But in the Syndactylia, physiological cell necrosis was not able to be recognized. 3. Ectrodactylia induced by x-irradiation was considered as the direct result of cell necrosis of digital origin, however, Polydactylia and Syndactylia were considered as the result of some effect in

  14. Dose rate distribution for products irradiated in a semi-industrial irradiation plant. 1st stage

    Mangussi, J.

    2005-01-01

    The model of the bulk product absorbed dose rate distribution in a semi industrial irradiation plant is presented. In this plant the products are subject to a dynamic irradiation process: single-plaque, single-direction, four-passes. The additional two passes, also one on each side of the plaque, serve to minimize the lateral dose variation as well as the depth-dose non-uniformity. The first stage of this model takes only into account the direct absorbed dose rate; the model outputs are the depth-dose distribution and the lateral-dose distribution. The calculated absorbed dose in the bulk product and its uniformity-ratio after the dynamic irradiation process for different products is compared. The model results are in good agreement with the experimental measurements in a bulk of irradiated product; and the air absorbed dose rate in the irradiation chamber behind the product subject to the dynamic irradiation process. (author) [es

  15. Electron emission from laser irradiating target normal sheath acceleration (TNSA)

    Torrisi, L.; Cutroneo, Mariapompea

    2016-01-01

    Roč. 171, 9-10 (2016), s. 754-765 ISSN 1042-0150. [12th Workshop on European Collaboration for Higher Education and Research in Nuclear Engineering and Radiological Protection. Bologna, Catania, Milan, 30.05.2016-01.06.2016] R&D Projects: GA ČR(CZ) GBP108/12/G108; GA MŠk LM2015056 Institutional support: RVO:61389005 Keywords : electron emission from plasma * TNSA * TOF * SiC * plastic scintillator * Thomson parabola spectrometer Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.443, year: 2016

  16. Radiation doses to normal tissues during craniospinal irradiation ...

    Mohamed Farouk Mostafa

    2011-10-15

    Oct 15, 2011 ... not in the center of the brain as this shows lower doses to eyes and lenses. ª 2011 Alexandria .... dose plan function was used to check the dose coverage of the .... maximum dose received by the right and left lens were listed.

  17. Radiation doses to normal tissues during craniospinal irradiation ...

    Objective: This dosimetric study is aiming to report the results of the analysis of doses received by target volumes and organs outside the target volumes during the treatment of medulloblastoma patients. And also by comparing the doses reaching the eyes and the lens with the use of different shielding methods.

  18. Detection of irradiated foods by the DEFT/APC method

    Yuecel, P. K.; Koeseoglu, T.; Halkman, H. B. D.

    2009-01-01

    Irradiation technology is used to prevent the spoilage losses and to improve the hygienic quality of foods. Appropriate techniques for the detection of irradiated foods are needed to guarantee the proper consumer information and to facilitate the trade of irradiated foods. The characteristics of the microbial population of irradiated foods have been used for developing detection methods for irradiated foods. This microbiological method is based on the comparison of an aerobic plate count (APC) with a count obtained with the direct epifluorescent filter technique (DEFT) for the detection of irradiation of foodstuffs.

  19. Intestinal enzyme distribution after supralethal irradiation

    Becciolini, A; Gerber, G B; Buracchi, A; Deroo, J [Florence Univ. (Italy). Istituto di Radiologia; Centre d' Etude de l' Energie Nucleaire, Mol (Belgium). Dept. de Radiobiologie)

    1977-07-01

    The activity of some intestinal enzymes has been studied after 2 kR irradiation. Brush border enzymes, maltase and leucineaminopeptidase (LAP) show an increase 20 hours after irradiation, while after 72 hours their activities are reduced to very low levels. Lysosomal enzymes show a completely different behaviour: acid phosphatase activity increases only 72 hours after irradiation, whereas ..beta.. glucuronidase increases significantly after 20 hours and reaches values two or three times higher than controls after 72 hours. The histologic picture at the first interval after irradiation shows gross alterations in the crypt region, but the villi appear nearly normal. Seventy-two hours after irradiation the whole epithelium is affected and very numerous leukocytes are present in the stroma.

  20. Tube for irradiation equipment

    Goehrich, K.; Vogt, H.

    1979-01-01

    This patent describes a tube for irradiation equipment for limiting an emergent beam, with a baseplate, possessing a central aperture, intended for attaching to the equipment, as well as four carrier plates, each of which possesses a limiting edge and a sliding edge located at right angles thereto. The carrier plates are located parallel to the baseplate, the limiting edge of each carrier plate resting against the sliding edge of the adjacent carrier plate and each of the two mutually opposite pairs of carrier plates being displaceable, parallel to the direction of its sliding edges and symmetrically to the center of the transmission aperture, for the purpose of continuously varying the transmission aperture defined by the limiting edges, during which displacement each of the displaced carrier plates carries with it the carrier plate, resting against the limiting edge of the former plate, parallel to the direction of the limiting edge of the latter plate. 8 claims

  1. Effect of irradiation on the streptococcus mutans

    Ahn, Ki Dong; Kim, Gyu Tae; Choi, Yong Suk; Hwang, Eui Hwan

    2007-01-01

    To observe direct effect of irradiation on cariogenic Streptococcus mutans. S. mutans GS5 was exposed to irradiation with a single absorbed dose of 10, 20, 30, and 40 Gy. Viability and changes in antibiotic sensitivity, morphology, transcription of virulence factors, and protein profile of bacterium after irradiation were examined by pour plate, disc diffusion method, Transmission electron microscopy. RT-PCR, and SDS-PAGE, respectively. After irradiation with 10 and 20 Gy, viability of S. mutans was reduced. Further increase in irradiation dose, however, did not affect the viability of the remaining cells of S. mutans. Irradiated S. mutans was found to have become sensitive to antibiotics. In particular, the bacterium irradiated with 40 Gy increased its susceptibility to cefotaxime, penicillin, and tetracycline. Under the transmission electron microscope, number of morphologically abnormal cells was increased as the irradiation dose was increased. S. mutans irradiated with 10 Gy revealed a change in the cell wall and cell membrane. As irradiation dose was increased. a higher number of cells showed thickened cell wall and cell membrane and lysis, and appearance of ghost cells was noticeable. In RT-PCR, no difference was detected in expression of gtfB and spaP between cells with and without irradiation of 40 Gy. In SDS-PAGE, proteins with higher molecular masses were gradually diminished as irradiation dose was increased. These results suggest that irradiation affects the cell integrity of S. mutans, as observed by SDS-PAGE, and as manifested by the change in cell morphology, antibiotic sensitivity, and eventually viability of the bacterium

  2. Effect of irradiation on the streptococcus mutans

    Ahn, Ki Dong; Kim, Gyu Tae; Choi, Yong Suk; Hwang, Eui Hwan [Kyung Hee Univ., Seoul (Korea, Republic of)

    2007-03-15

    To observe direct effect of irradiation on cariogenic Streptococcus mutans. S. mutans GS5 was exposed to irradiation with a single absorbed dose of 10, 20, 30, and 40 Gy. Viability and changes in antibiotic sensitivity, morphology, transcription of virulence factors, and protein profile of bacterium after irradiation were examined by pour plate, disc diffusion method, Transmission electron microscopy. RT-PCR, and SDS-PAGE, respectively. After irradiation with 10 and 20 Gy, viability of S. mutans was reduced. Further increase in irradiation dose, however, did not affect the viability of the remaining cells of S. mutans. Irradiated S. mutans was found to have become sensitive to antibiotics. In particular, the bacterium irradiated with 40 Gy increased its susceptibility to cefotaxime, penicillin, and tetracycline. Under the transmission electron microscope, number of morphologically abnormal cells was increased as the irradiation dose was increased. S. mutans irradiated with 10 Gy revealed a change in the cell wall and cell membrane. As irradiation dose was increased. a higher number of cells showed thickened cell wall and cell membrane and lysis, and appearance of ghost cells was noticeable. In RT-PCR, no difference was detected in expression of gtfB and spaP between cells with and without irradiation of 40 Gy. In SDS-PAGE, proteins with higher molecular masses were gradually diminished as irradiation dose was increased. These results suggest that irradiation affects the cell integrity of S. mutans, as observed by SDS-PAGE, and as manifested by the change in cell morphology, antibiotic sensitivity, and eventually viability of the bacterium.

  3. Normal foot and ankle

    Weissman, S.D.

    1989-01-01

    The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

  4. Irradiation Facilities at CERN

    Gkotse, Blerina; Carbonez, Pierre; Danzeca, Salvatore; Fabich, Adrian; Garcia, Alia, Ruben; Glaser, Maurice; Gorine, Georgi; Jaekel, Martin, Richard; Mateu,Suau, Isidre; Pezzullo, Giuseppe; Pozzi, Fabio; Ravotti, Federico; Silari, Marco; Tali, Maris

    2017-01-01

    CERN provides unique irradiation facilities for applications in many scientific fields. This paper summarizes the facilities currently operating for proton, gamma, mixed-field and electron irradiations, including their main usage, characteristics and information about their operation. The new CERN irradiation facilities database is also presented. This includes not only CERN facilities but also irradiation facilities available worldwide.

  5. Survival and antigenic profile of irradiated malarial sporozoites in infected liver cells

    Suhrbier, A.; Winger, L.A.; Castellano, E.; Sinden, R.E.

    1990-01-01

    Exoerythrocytic (EE) stages of Plasmodium berghei derived from irradiated sporozoites were cultured in vitro in HepG2 cells. They synthesized several antigens, predominantly but not exclusively those expressed by normal early erythrocytic schizonts. After invasion, over half the intracellular sporozoites, both normal and irradiated, appeared to die. After 24 h, in marked contrast to the normal parasites, EE parasites derived from irradiated sporozoites continued to break open, shedding their antigens into the cytoplasm of the infected host cells. Increasing radiation dosage, which has previously been shown to reduce the ability of irradiated sporozoites to protect animals, correlated with reduced de novo antigen synthesis by EE parasites derived from irradiated sporozoites

  6. Perspective on food irradiation

    Newsome, R.L.

    1987-01-01

    A brief review summarizes current scientific information on the safety and efficacy of irradiation processing of foods. Attention is focused on: specifics of the irradiation process and its effectiveness in food preservation; the historical development of food irradiation technology in the US; the response of the Institute of Food Technologists to proposed FDA guidelines for food irradiation; the potential uses of irradiation in the US food industry; and the findings of the absence of toxins and of unaltered nutrient density (except possibly for fats) in irradiated foods. The misconceptions of consumers concerning perceived hazards associated with food irradiation, as related to consumer acceptance, also are addressed

  7. Endodontics and the irradiated patient

    Cox, F.L.

    1976-01-01

    With increasingly larger numbers of irradiated patients in our population, it seems likely that all dentists will eventually be called upon to manage the difficult problems that these patients present. Of utmost concern should be the patient's home care program and the avoidance of osteroradionecrosis. Endodontics and periodontics are the primary areas for preventing or eliminating the infection that threatens osteoradionecrosis. Endodontic treatment must be accomplished with the utmost care and maximum regard for the fragility of the periapical tissues. Pulpally involved teeth should never be left open in an irradiated patient, and extreme care must be taken with the between-visits seal. If one is called upon for preradiation evaluation, routine removal of all molar as well as other compromised teeth should be considered. Attention should be directed to the literature for further advances in the management of irradiated patients

  8. Hypopituitarism following pituitary irradiation for acromegaly

    Aloia, J.F.; Archambeau, J.O.

    1978-01-01

    Endocrine evaluation is reported in 8 acromegalic patients who received 5500 rad to the pituitary from a linear accelerator. There was a mean decrease in hGH levels of 72%. Plasma testosterone levels were low in 1 of the 6 male patients prior to pituitary irradiation and were below normal in all male patients on the final evaluation (3.1 +- 0.2 SD years postirradiation). Deficiency of TSH secretion developed in 2 patients following irradiation. This rather high incidence of postirradiation partial hypopituitarism was not anticipated and is thought to be related to radiation necrosis of the normal pituitary tissue which surrounds the adenoma.

  9. Botryllus schlosseri (Tunicata) whole colony irradiation: Do senescent zooid resorption and immunological resorption involve similar recognition events

    Rinkevich, B.; Weissman, I.L.

    1990-01-01

    The colonial tunicate Botryllus schlosseri undergoes cyclic blastogenesis where feeding zooids are senescened and resorbed and a new generation of zooids takes over the colony. When non-identical colonies come into direct contact, they either reject each other or fuse. Fusion is usually followed by the resorption of one of the partners in the chimera (immunological resorption). The striking morphological similarities between the two resorption phenomena suggest that both may involve tissue destruction following self-nonself recognition events. Here we attempt to modify these two events by whole colony gamma irradiation assays. Three sets of experiments were performed: (1) different doses of whole colony irradiation for determination of irradiation effects (110 colonies); (2) pairs of irradiated-nonirradiated isografts of clonal replicates for the potential of reconstruction of the irradiated partners (23 pairs); (3) chimeras of irradiated-nonirradiated partners for analysis of resorption hierarchy. Mortality increased with the irradiation dose. All colonies exposed to more than 5,000 rads died within 19 days, while no colony died below 2,000 rads. The average mortality periods, in days, for doses of 6,000-8,000, 5,000, and 2,500-4,000 rads were 14.4 +/- 3.1 (n = 24), 19.8 +/- 6.0 (n = 15), and 19.6 + 5.1 (n = 22), respectively. Younger colonies (3-6 months old) may survive radiation better than older ones (more than 13 months). Many morphological alterations were recorded in irradiated colonies: ampullar contraction and/or dilation, accumulation of pigment cells within ampullae, abnormal bleeding from blood vessels, sluggish blood circulation, necrotic zones, reduction in bud number, and irregularities in zooid and system structures. With doses of 3,000-4,000 rads and above, irradiation arrested the formation of new buds and interrupted normal takeover

  10. Comparison of local International Sensitivity Index calibration and 'Direct INR' methods in correction of locally reported International Normalized Ratios: an international study. On behalf of the European Action of Anticoagulation

    Poller, L; Keown, M; Ibrahim, S

    2007-01-01

    collaborative study at 77 centers has compared local INR correction using the two alternative methods recommended in the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis guidelines: local ISI calibration and 'Direct INR'. METHODS: Success of INR correction...

  11. Delayed expression of enhanced reactivation and decreased mutagenesis of UV-irradiated adenovirus in UV-irradiated ataxia telangiectasia fibroblasts

    Bennett, C.B.; Rainbow, A.J.

    1988-01-01

    In this study the authors examined UV-enhanced reactivation (UVER) and UV-enhanced mutagenesis (UVEM) of UV-irradiated adenovirus in AT fibroblasts. UVER factors for Ad V antigen expression were significantly less than normal in AT strains tested when infection occurred immediately after UV-irradiation of cells. However, UVER factors were >1 and similar to those found for normal strains when cells were infected 24 h after UV-irradiation, indicating delay in the expression of UVER for Ad V antigen in AT cells. UV-irradiation of both normal and AT cells 24 h prior to infection also resulted in a significant increase in progeny survival for UV-irradiated Ad. In normal cells, this progeny UVER was concomitant with a significant increase in the mutation frequency for UV-irradiated virus (increase in targeted mutagenesis) suggesting existence of an inducible error-prone DNA repair mode in normal human cells. In contrast, pre-UV-irradiation of AT cells resulted in a significant decrease in the mutation frequency for UV-irradiated virus. (author)

  12. Irradiation behaviors of coated fuel particles, (4)

    Fukuda, Kousaku; Kashimura, Satoru; Ogawa, Toru; Ikawa, Katsuichi; Iwamoto, Kazumi; Ishimoto, Kiyoshi

    1981-09-01

    Loose coated fuel particles prepared in confirmity to a preliminary design for the multi-purpose VHTR in fiscal 1972 - 1974 were irradiated by 73F - 12A capsule in JMTR. Main purpose for this irradiation experiment was to examine irradiation stability of the candidate TRISO coated fuel particles for the VHTR. Also the coated particles possessing low-density kernel (90%TD), highly anisotropic OLTI-PyC and ZrC coating layer were loaded with the candidate particles in this capsule. The coated particles were irradiated up to 1.5 x 10 21 n/cm 2 of fast neutron fluence (E > 0.18 MeV) and 3.2% FIMA of burnup. In the post irradiation examination it was observed that among three kinds of TRISO particles exposed to irradiation corresponding to the normal operating condition of the VHTR ones possessing poor characteristics of the coating layers did not show a good stability. The particles irradiated under abnormally high temperature condition (> 1800 0 C) revealed 6.7% of max. EOL failure fraction (95% confidence limit). Most of these particles were failed by the ameoba effect. Furthermore, among four kinds of the TRISO particles exposed to irradiation corresponding to the transient condition of the VHTR (--1500 0 C) the two showed a good stability, while the particles possessing highly anisotropic OLTI-PyC or poorly characteristic coating layers were not so good. (author)

  13. Nutritional aspects of food irradiation

    Murray, T.K.

    1981-01-01

    From the nutritional point of view the irradiation of fruits and vegetables presents few problems. It should be noted that irradiation-induced changes in the β-carotene content of papaya (not available to the Joint Expert Committee in 1976) have been demonstrated to be unimportant. The Joint Expert Committee also noted the need for more data on thiamine loss. These have been forthcoming and indicate that control of insects in rice is possible without serious loss of the vitamin. Experiments with other cereal crops were also positive in this regard. The most important evidence on the nutritional quality of irradiated beef and poultry was the demonstration that they contained no anti-thiamine properties. A point not to be overlooked is the rather serious loss of thiamine when mackerel is irradiated at doses exceeding 3 kGy. Recent evidence indicates that thiamine loss could be reduced by using a high dose rate application process. Though spices contribute little directly to the nutritional quality of the food supply they play an important indirect role. It is thus encouraging that they can be sterilized by irradiation without loss of aroma and taste and without significant loss of β-carotenes. Of future importance are the observations on single cell protein and protein-fat-carbohydrate mixtures. The reduction of net protein utilization in protein-fat mixtures may be the result of physical interaction of the components. (orig./AJ)

  14. Nutritional aspects of food irradiation

    Murray, T K

    1981-08-01

    From the nutritional point of view the irradiation of fruits and vegetables presents few problems. It should be noted that irradiation-induced changes in the ..beta..-carotene content of papaya (not available to the Joint Expert Committee in 1976) have been demonstrated to be unimportant. The Joint Expert Committee also noted the need for more data on thiamine loss. These have been forthcoming and indicate that control of insects in rice is possible without serious loss of the vitamin. Experiments with other cereal crops were also positive in this regard. The most important evidence on the nutritional quality of irradiated beef and poultry was the demonstration that they contained no anti-thiamine properties. A point not to be overlooked is the rather serious loss of thiamine when mackerel is irradiated at doses exceeding 3 kGy. Recent evidence indicates that thiamine loss could be reduced by using a high dose rate application process. Though spices contribute little directly to the nutritional quality of the food supply they play an important indirect role. It is thus encouraging that they can be sterilized by irradiation without loss of aroma and taste and without significant loss of ..beta..-carotenes. Of future importance are the observations on single cell protein and protein-fat-carbohydrate mixtures. The reduction of net protein utilization in protein-fat mixtures may be the result of physical interaction of the components.

  15. Effect of front and rear incident proton irradiation on silicon solar cells

    Anspaugh, Bruce; Kachare, Ram

    1987-01-01

    Four solar cell types of current manufacture were irradiated through the front and rear surfaces with protons in the energy range between 1 and 10 MeV. The solar cell parameters varied for this study were cell thickness and back surface field (BSF) vs. no BSF. Some cells were irradiated at normal incidence and an equal number were irradiated with simulated isotropic fluences. The solar cell electrical characteristics were measured under simulated AM0 illumination after each fluence. Using the normal incidence data, proton damage coefficients were computed for all four types of cells for both normal and omnidirectional radiation fields. These were found to compare well with the omnidirectional damage coefficients derived directly from the rear-incidence radiation data. Similarly, the rear-incidence omnidirectional radiation data were used to compute appropriate damage coefficients. A method for calculating the effect of a spectrum of energies is derived from these calculations. It is suitable for calculating the degradation of cells in space when they have minimal rear-surface shielding.

  16. Modification of genetic effect of gamma irradiation by electric current

    Grigor'eva, N.N.; Shakhbazov, V.G.

    1985-01-01

    The effect of direct electric current of different value and polarity on genetic sequences of γ-irradiation of Vicia faba seedlings has been studied. The previously found modifying effect of direct electric current is confirmed. The extent and character of this effect depend on the value and polarity of current as well as time between irradiation and electric effects. Current effect modes having no effect on irradiated seedlings protecting cells from injury and the modes aggravating radiation effect have been found. At certain modes the effects of direct electric current on irradiated seedlings changes in the rearrangement spectrum are observed, particularly the number of bridges is increased

  17. Computerized three-dimensional normal atlas

    Mano, Isamu; Suto, Yasuzo; Suzuki, Masataka; Iio, Masahiro.

    1990-01-01

    This paper presents our ongoing project in which normal human anatomy and its quantitative data are systematically arranged in a computer. The final product, the Computerized Three-Dimensional Normal Atlas, will be able to supply tomographic images in any direction, 3-D images, and coded information on organs, e.g., anatomical names, CT numbers, and T 1 and T 2 values. (author)

  18. Polar Direct Drive-Ignition at 1 MJ

    Skupsky, S.; Craxton, R.S.; Marshall, F.J.; Betti, R.; Collins, T.J.B.; Epstein, R.; Goncharov, V.N.; Igumenshchev, I.V.; Marozas, J.A.; McKenty, P.W.; Radha, P.B.; Kilkenny, J.D.; Meyerhofer, D.D.; Sangster, T.C.; McCrory, R.L.

    2006-01-01

    Target designs to achieve direct-drive ignition on the NIF using the x-ray-drive beam configuration are examined. This approach, known as polar direct drive (PDD), achieves the required irradiation uniformity by repointing some of the beams toward the target equator, and by increasing the laser intensity at the equator to compensate for the reduced laser coupling from oblique irradiation. Techniques to increase the equatorial intensity can include using phase plates that produce elliptical spot shapes, increasing the power in beams directed toward the equator, and using a ring offset from the equator to redirect rays toward the target normal. The requirements for beam pointing, power balance, single-beam smoothing, and inner-ice-surface roughness are examined. Designs with an incident laser energy of 1.0 MJ are presented. The simulations use the 2-D hydrocode DRACO with 3-D ray trace to model the laser irradiation and Monte Carlo alpha particle transport to model the thermonuclear burn

  19. ICRP and impairment of mental function following prenatal irradiation

    Mole, R.H.

    1992-01-01

    A brief account is given of mental retardation and intelligence testing in unirradiated human populations, without which it is not possible to judge the 1991 ICRP Recommendations relating to mental impairment. The dose-response used by ICRP (1991) for the reduction of IQ by irradiation in utero has no radiobiological basis because IQ values are derived from intelligence test scores by transforming the scale of measurement. It is also defective because it assumed that IQ is distributed normally whereas this is so only in normal school children, not in a population in general including retarded persons. There seems good evidence for a substantial threshold of dose for both reduction in IQ and increase in severe mental retardation (SMR). The four prenatally irradiated bomb survivors with SMR and intrauterine dose in the dose range 1-49 cGy were not intelligence tested, so the relation between SMR and IQ in that practically important dose range cannot be examined directly, SMR is a deterministic phenomenon, so is not expected to occur unless dose exceeds a threshold. The threshold doses for SMR based on linear dose-responses using ungrouped doses were 46 and 55 cGy DS86 intrauterine dose (Otake et al 1987). The threshold 50 cGy derived here for reduction in IQ is closely similar. Mild mental retardation has not been reported as a diagnosis in bombs survivors exposed in utero. (Author)

  20. The influence of urban area opacity on biologically active UV-B irradiance

    Chubarova, Nataly; Rozental', Victor

    2013-04-01

    The study of UV irradiance changes in urban area is an essential problem due to the significant effect of UV irradiance on human health which can be positive (vitamin D synthesis) and negative (erythema, skin cancer, eye damage). According to the results of several experiments within the Moscow megacity we studied the effects of urban area opacity on the different types of biologically active UV-B irradiance on the base of a specially developed mobile photometric complex snd additional measurements of the urban opacity by Nikon Fisheye Converter FC-E8. We analyzed both the level of erythemally-active irradiance and the UV eye damaging radiation using the broadband UVB-1 YES pyranometer calibrated against ultraviolet spectroradiometer Bentham DTM-300 of the Medical University of Innsbruck (courtesy of Dr. M.Blumthaler). In order to estimate the effects of the urban opacity the measurements were normalized on similar measurements at the Meteorological Observatory of Moscow State University with zero opacity. This ratio is defined as an urban radiative transmittance (URT). Different atmospheric conditions were considered. In cloudy conditions the effect of opacity on URT is much less than that in conditions when the sun disk is open from clouds. We revealed some spectral features in transmittance of biologically active UV-B irradiance which is characterized by higher URT variations in overcast cloudy conditions due to more intensive scattering and smaller direct solar radiation component. In the absence of cloudiness the effect of opacity was studied for open and screening solar disk conditions. We obtained much higher URT in UVB spectral region compared with that for total solar irradiance for screening solar disk conditions with a significant URT dependence on the opacity only in UVB spectral region. No URT dependence was obtained for total solar irradiance in these conditions. Some model calculations were fulfilled to match the experimental results.