
Sample records for direct enzyme-linked immunosorbent

  1. Direct Competitive Enzyme-Linked Immunosorbent Assay (ELISA).

    Kohl, Thomas O; Ascoli, Carl A


    The competitive enzyme-linked immunosorbent assay (ELISA) (cELISA; also called an inhibition ELISA) is designed so that purified antigen competes with antigen in the test sample for binding to an antibody that has been immobilized in microtiter plate wells. The same concept works if the immobilized molecule is antigen and the competing molecules are purified labeled antibody versus antibody in a test sample. Direct cELISAs incorporate labeled antigen or antibody, whereas indirect assay configurations use reporter-labeled secondary antibodies. The cELISA is very useful for determining the concentration of small-molecule antigens in complex sample mixtures. In the direct cELISA, antigen-specific capture antibody is adsorbed onto the microtiter plate before incubation with either known standards or unknown test samples. Enzyme-linked antigen (i.e., labeled antigen) is also added, which can bind to the capture antibody only when the antibody's binding site is not occupied by either the antigen standard or antigen in the test samples. Unbound labeled and unlabeled antigens are washed away and substrate is added. The amount of antigen in the standard or the test sample determines the amount of reporter-labeled antigen bound to antibody, yielding a signal that is inversely proportional to antigen concentration within the sample. Thus, the higher the antigen concentration in the test sample, the less labeled antigen is bound to the capture antibody, and hence the weaker is the resultant signal. © 2017 Cold Spring Harbor Laboratory Press.

  2. A Direct, Competitive Enzyme-Linked Immunosorbent Assay (ELISA) as a Quantitative Technique for Small Molecules

    Powers, Jennifer L.; Rippe, Karen Duda; Imarhia, Kelly; Swift, Aileen; Scholten, Melanie; Islam, Naina


    ELISA (enzyme-linked immunosorbent assay) is a widely used technique with applications in disease diagnosis, detection of contaminated foods, and screening for drugs of abuse or environmental contaminants. However, published protocols with a focus on quantitative detection of small molecules designed for teaching laboratories are limited. A…

  3. Direct immunofluorescence and enzyme-linked immunosorbent assays for evaluating chlorinated hydrocarbon degrading bacteria

    Brigmon, R.L.; Franck, M.M.; Brey, J.; Fliermans, C.B. [Westinghouse Savannah River, Aiken, SC (United States). Environmental Biotechnology Section; Scott, D.; Lanclos, K. [Medical Coll. of Georgia, Augusta, GA (United States)


    Immunological procedures were developed to enumerate chlorinated hydrocarbon degrading bacteria. Polyclonal antibodies (Pabs) were produced by immunizing New Zealand white rabbits against 18 contaminant-degrading bacteria. These included methanotrophic and chlorobenzene (CB) degrading species. An enzyme-linked immunosorbent assay (ELISA) was used to test for specificity and sensitivity of the Pabs. Direct fluorescent antibodies (DFAs) were developed with these Pabs against select methanotrophic bacteria isolated from a trichloroethylene (TCE) contaminated landfill at the Savannah River Site (SRS) and cultures from the American Type Culture Collection (ATCC). Analysis of cross reactivity testing data showed some of the Pabs to be group specific while others were species specific. The threshold of sensitivity for the ELISA is 105 bacteria cells/ml. The DFA can detect as few as one bacterium per ml after concentration. Results from the DFA and ELISA techniques for enumeration of methanotrophic bacteria in groundwater were higher but not significantly different (P < 0.05) compared to indirect microbiological techniques such as MPN. These methods provide useful information on in situ community structure and function for bioremediation applications within 1--4 hours of sampling.

  4. Direct microculture enzyme-linked immunosorbent assay for studying neural cells: oligodendrocytes.

    Gard, A L; Warrington, A E; Pfeiffer, S E


    Oligodendrocyte development has been studied in a standardized primary microculture system initiated from day 20-21 fetal rat brain using a solid-phase enzyme-linked immunosorbent assay (ELISA) carried out directly on fixed cells (direct microculture ELISA). A highly reproducible dissociation procedure is described that allows careful control of the number of cells seeded per culture. At a seeding density of 1 x 10(5) cells/culture, up to 250 oligodendrocyte-generating microcultures consisting of 10-12% oligodendrocytes can be prepared from a single fetal rat brain, thereby permitting the simultaneous assay of multiple developmental parameters in sibling cultures. The validity of this method for quantifying myelinogenesis was established by comparing the results obtained by direct microculture ELISA with immunocytochemical counting of cells in parallel cultures. As few as 200 oligodendrocytes could be detected using a biotinylated anti-Ig and an avidin-urease conjugate detection system; CNP immunoreactivity measured by ELISA was linearly proportional to the number of immunolabeled cells between 6 and 34 days in culture; the developmental time courses of 2',3'-cyclic nucleotide 3'-phosphohydrolase (CNP) and myelin basic protein (MBP) expression determined by the two methods were very similar. Finally, cell suspensions were seeded at increasing dilution to determine the number of cells required to generate cultures that tested positive for oligodendrocytes by ELISA. As few as 9,000 cells were sufficient, predicting a minimum of 8,000 oligoprogenitors per 20-21 day fetal rat brain. The application of direct microculture ELISA for studying oligodendrocyte population size and myelinogenesis is discussed.

  5. Thermometric enzyme linked immunosorbent assay: TELISA.

    Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K


    A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.

  6. Comparative analysis of enzyme-linked immunosorbent assay and direct microscopy for the diagnosis of Giardia intestinalis in fecal samples

    Shipra Singhal


    Full Text Available Context: Giardiasis is one of the most common nonviral infections causing diarrheal illness worldwide. In this prospective cross-sectional study, we evaluated the RIDASCREEN ® Giardia kit for detection of Giardia intestinalis in stool samples and compared the results with direct microscopy. Materials and methods: A total of 360 fecal samples were collected. They were then processed by wet film, iodine preparation and an enzyme-linked immunosorbent assay (ELISA kit to determine the presence of Giardia trophozoites and cysts. Statistical analysis was performed by sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy. Results and Conclusion: Of the 360 cases, 17.2% samples were positive for Giardia by direct microscopy and 23.6% were found to be positive by ELISA (sensitivity ~97%, but specificity was ~92% only. Because of less specificity, we need to perform ELISA in congruence with direct microscopy, etc. Further studies need to be performed on a larger sample size using other molecular tests in order to get more accurate estimations.

  7. Identification of phlebotomine sandfly bloodmeals from Baringo District, Kenya, by direct enzyme-linked immunosorbent assay (ELISA).

    Ngumbi, P M; Lawyer, P G; Johnson, R N; Kiilu, G; Asiago, C


    Direct enzyme-linked immunosorbent assay (ELISA) was used to identify the sources of bloodmeals in phlebotomine sandflies from Baringo District, Rift Valley Province, Kenya. Some bloodmeals had been stored for over 4 years before being analysed. Among 356 sandflies identified, 62.9% were Phlebotomus martini, 14.8% Sergentomyia antennatus, 10% S.schwetzi, 6% S.clydei, 1.9% S.adleri, 1.6% P.duboscqi, 1.4% S.africanus and 0.8% S.bedfordi. Out of 224 P.martini bloodmeals, host source was identified for 69. The order of host preference for P.martini was: goat 28.5%, rabbit 22.7%, human 8.9% and others 8.9%. Evidence of mixed feeding was shown by four species comprising sixteen specimens, twelve of which were P.martini. The most effective methods for trapping bloodfed P. martini were sticky paper traps in termite hills, followed by light-traps. Of the 224 P.martini trapped, 58.9% were collected with traps in termite hills, and 22.7% with light traps. Roles of the three most popular hosts for P.martini should be investigated to ascertain whether they act as reservoirs in the transmission of Leishmania donovani causing visceral leishmaniasis in Kenya.

  8. Enzyme-Linked Immunosorbent Assay (ELISA).

    Konstantinou, George N


    Food allergy is a public health concern especially after recognizing its constantly increased prevalence and severity. Despite careful reading of food ingredient statements, food allergic individuals may experience reactions caused by "hidden", "masked", or "contaminated" proteins that are known major allergens. Many techniques have been developed to detect even small traces of food allergens, for clinical or laboratory purposes. Enzyme-linked immunosorbent assay (ELISA) is one of the best validated and most routinely used immunoassay in allergy research, in allergy diagnosis in allergy-related quality control in various industries. Although as a technique it has been implemented for the last 45 years, the evolution in biochemistry allowed the development of ultrasensitive ELISA variations that are capable of measuring quantities in the scale of picograms, rendering ELISA attractive, robust, and very famous.

  9. A competitive enzyme linked immunosorbent assay for the ...

    A competitive enzyme linked immunosorbent assay for the determination of diminazene residues in animal tissues. ... After six washes with buffer, enzyme activity was determined by adding tetramethyl-benzidine and hydrogen peroxide as substrate. The assay detection limits for diminazene were 2.4 ng/g in muscle, 2.5 ...

  10. Polymerase chain reaction versus enzyme-linked immunosorbent ...

    Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.

  11. Desomorphine Screening Using Commercial Enzyme-Linked Immunosorbent Assays.

    Winborn, Jessica; Kerrigan, Sarah


    Desomorphine ("Krokodil") is a semi-synthetic opioid that has drawn attention as a recreational drug, particularly in Russia, neighboring former Soviet Republics, Eastern and Central Europe. It has no accepted medicinal uses and is currently a schedule I drug in the United States. In clandestine environments, desomorphine is synthesized from codeine using red phosphorous, hydroiodic acid and gasoline. Residual starting materials in illicit preparations have been associated with severe dermatological effects and extensive tissue necrosis. Desomorphine is not well studied, and there are limited reports concerning its pharmacology or detection in biological matrices. Immunoassays are widely relied upon for both antemortem and postmortem toxicology screening. Although desomorphine is an opioid of the phenanthrene-type, its ability to bind to conventional opioid antibodies has not been described. In this report we describe the cross-reactivity of desomorphine using six commercially available enzyme-linked immunosorbent assays (Immunalysis Opiates Direct ELISA, Immunalysis Oxycodone/Oxymorphone Direct ELISA, Randox Opiate ELISA, OraSure Technologies OTI Opiate Micro-plate EIA, Neogen Opiate Group ELISA and Neogen Oxycodone/Oxymorphone ELISA). Cross-reactivites were highly variable between assays, ranging from 77 to desomorphine than those directed towards oxycodone. The Immunalysis Opiates Direct ELISA produced the greatest cross-reactivity, although several of the assays evaluated produced cross-reactivity of a sufficient magnitude to be effective for desomorphine screening. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  12. Pistachio (Pistacia vera L.) Detection and Quantification Using a Murine Monoclonal Antibody-Based Direct Sandwich Enzyme-Linked Immunosorbent Assay.

    Liu, Changqi; Chhabra, Guneet S; Sathe, Shridhar K


    A commercially available direct sandwich enzyme-linked immunosorbent assay (ELISA) (BioFront Technologies, Tallahassee, FL, USA) using murine anti-pistachio monoclonal antibodies (mAbs) as capture and detection antibodies was evaluated. The assay was sensitive (limit of detection = 0.09 ± 0.02 ppm full fat pistachio, linear detection range = 0.5-36 ppm, 50% maximum signal concentration = 7.9 ± 0.7 ppm), reproducible (intra- and inter-assay variability pistachio seeds subjected to autoclaving (121 °C, 15 psi, 15, 30 min), blanching (100 °C, 5, 10 min), frying (191 °C, 1 min), microwaving (500, 1000 W, 3 min), and dry roasting (140 °C, 30 min; 168 °C, 12 min). No cross-reactivity was observed in 156 food matrices, each tested at 100,000 ppm, suggesting the ELISA to be pistachio specific. The pistachio recovery ranges for spiked (10 ppm) and incurred (10-50000 ppm) food matrices were 93.1-125.6% and 35.7-112.2%, respectively. The assay did not register any false-positive or -negative results among the tested commercial and laboratory prepared samples.

  13. Development of sensitive direct and indirect enzyme-linked immunosorbent assays (ELISAs) for monitoring bisphenol-A in canned foods and beverages.

    Lu, Yang; Peterson, Joshua Richard; Gooding, John Justin; Lee, Nanju Alice


    Enzyme-linked immunosorbent assays (ELISAs) are investigated in this work for the detection of bisphenol-A (BPA), a plastic monomer and a critical contaminant in food and environment. A series of polyclonal antibodies generated in vivo using BPA-butyrate-protein conjugate and BPA-valerate-protein conjugate were evaluated on direct and indirect competitive assay formats with five competing haptens (BPA-butyrate, BPA-valerate, BPA-crotonate, BPA-acetate, and BPA-2-valerate). Two indirect ELISAs and one direct ELISA exhibiting high sensitivity and specificity for BPA were developed. The 50 % inhibition of antibody binding (IC(50)) values were 0.78 ± 0.01-1.20 ± 0.26 μg L(-1), and the limits of detection as measured by the IC(20) values were 0.10 ± 0.03-0.20 ± 0.04 μg L(-1). The assays were highly specific to BPA, only displaying low cross-reactivity (3-8 % for the indirect assays and 26 % for the direct assay) for 4-cumylphenol (4-CP), at pH 7.2. The degree of cross-reaction of 4-CP was influenced by the antibody/hapten conjugate combination, assay conditions, and the assay format. The assays were optimized for the analysis of BPA in canned vegetables, bottled water and carbonated drinks. The limits of quantification for these three evaluated sample types, based on the spike and recovery data, were 0.5, 2.5, and 100 μg L(-1), respectively.

  14. Direct Human Papillomavirus E6 Whole-Cell Enzyme-Linked Immunosorbent Assay for Objective Measurement of E6 Oncoproteins in Cytology Samples

    Yang, Yi-Shan; Smith-McCune, Karen; Darragh, Teresa M.; Lai, Yvonne; Lin, Ju-Hwa; Chang, Ting-Chang; Guo, Hsiao-Yun; Kesler, Tiea; Carter, Alicia; Castle, Philip E.; Cheng, Shuling


    A novel, whole-cell enzyme-linked immunosorbent assay (ELISA) based on a non-type-specific anti-human papillomavirus (HPV) E6 antibody was tested on 182 residual cytological specimens. For samples with a designation of more severe than cervical intraepithelial neoplasia grade 3 (CIN3+), 83% tested positive for E6; in a subset with paired testing for E6 ELISA and HPV DNA, 72% tested E6 positive and 92% tested high-risk (HR)-HPV DNA positive (P = 0.2). Among the women with a less than CIN3 diag...

  15. rK39 enzyme-linked immunosorbent assay for diagnosis of Leishmania donovani infection

    Zijlstra, E. E.; Daifalla, N. S.; Kager, P. A.; Khalil, E. A.; El-Hassan, A. M.; Reed, S. G.; Ghalib, H. W.


    The rK39 enzyme-linked immunosorbent assay (ELISA) was compared with the direct agglutination test (DAT) for Leishmania donovani infection in the Sudan. rK39 ELISA proved more sensitive than DAT in diagnosis of kala-azar (93 and 80%, respectively); both tests may remain positive up to 24 months

  16. Enzyme-linked immunosorbent assays for Z-DNA.

    Thomas, M J; Strobl, J S


    Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e....

  17. Enzyme-linked immunosorbent assays for Z-DNA.

    Thomas, M J; Strobl, J S


    Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e.l.i.s.a. was conducted in 48-well culture dishes at 37 degrees C using a rabbit polyclonal antiserum developed against Br-poly(dG-dC).poly(dG-dC), an alkaline phosphatase-conjugated second antibody, and p-nitrophenol as the substrate. Under conditions where antibody concentrations were not limiting, alkaline phosphatase activity was linear for 2 h. Dot blot e.l.i.s.a. conditions are described which allow quantification of Z-DNA [Br-poly(dG-dC).poly(dG-dC)] within the range 5-250 ng. Dot blot and transblot horseradish peroxidase e.l.i.s.a. are described that detect Z-DNA within supercoiled plasmid DNAs immobilized on diazophenylthioether (DPT) paper. In the transblot e.l.i.s.a., plasmid pUC8 derivatives containing 16, 24, or 32 residues of Z-DNA were electrophoresed in agarose gels and electrophoretically transferred to DPT paper. Z-DNA-antibody complexes were detected by the horseradish peroxidase-catalysed conversion of 4-chloro-1-naphthol to a coloured product that was covalently bound to the DPT paper. Z-DNA antibody reactivity was specific for supercoiled Z-DNA containing plasmids after removal of the antibodies cross-reactive with B-DNA by absorption onto native DNA-cellulose. The transblot e.l.i.s.a. was sensitive enough to detect 16 base pairs of alternating G-C residues in 100 ng of pUC8 DNA.

  18. Development of an enzyme-linked immunosorbent assay method to detect mustard protein in mustard seed oil

    Koppelman, S.J.; Vlooswijk, R.; Bottger, G.; Duijn, G. van; Schaft, P. van der; Dekker, J.; Bemgen, H. van


    An enzyme-linked immunosorbent assay for the detection of mustard protein was developed. The assay is based on a polyclonal antiserum directed against a mixture of mustard proteins raised in rabbits. The assay has a detection limit of 1.5 ppm (milligrams per kilogram) and is suitable for the

  19. Development of an Enzyme Linked Immunosorbent Assay to Detect Chicken Parvovirus Specific Antibodies

    Here we report the development and application of an enzyme linked immunosorbent assay to detect parvovirus-specific antibodies in chicken sera. We used an approach previously described for other parvoviruses to clone and express viral structural proteins in insect cells from recombinant baculovirus...

  20. Application of an improved enzyme-linked immunosorbent assay method for serological diagnosis of canine leishmaniasis

    Santarém, Nuno; Silvestre, Ricardo; Cardoso, Luís; Schallig, Henk; Reed, Steven G.; Cordeiro-da-Silva, Anabela


    Accurate diagnosis of canine leishmaniasis (CanL) is essential toward a more efficient control of this zoonosis, but it remains problematic due to the high incidence of asymptomatic infections. In this study, we present data on the development of enzyme-linked immunosorbent assay (ELISA)-based


    An inhibition enzyme-linked immunosorbent assay (ELISA) was used to determine polychlorinated biphenyls (PCBs) in house dust and soil. Soil and house dust samples were analyzed for PCB by both gas chromatography/electron capture detection (GC/ECD) and ELISA methods. A correlati...

  2. Rapid enzyme-linked immunosorbent assay (ELISA) for Aspergillus fumigatus antibodies.

    Richardson, M D; Stubbins, J M; Warnock, D W


    A rapid enzyme-linked immunosorbent assay (ELISA) where component incubation periods were shortened to one hour, was compared with agar gel double diffusion (AGDD) and a standard ELISA procedure for detecting antibodies to Aspergillus fumigatus in 28 asthmatic patients with suspected allergic aspergillosis. Using two A fumigatus antigens the rapid ELISA compared well with AGDD and the standard ELISA method. Eleven sera that reacted with both antigens in AGDD were all positive against antigen ...

  3. Assessing protein oxidation by inorganic nanoparticles with enzyme-linked immunosorbent assay (ELISA).

    Sun, Wenjie; Luna-Velasco, Antonia; Sierra-Alvarez, Reyes; Field, Jim A


    Growth in the nanotechnology industry is leading to increased production of engineered nanoparticles (NPs). This has given rise to concerns about the potential adverse and toxic effects to biological system and the environment. An important mechanism of NP toxicity is oxidative stress caused by the formation of reactive oxygen species (ROS) or via direct oxidation of biomolecules. In this study, a protein oxidation assay was developed as an indicator of biomolecule oxidation by NPs. The oxidation of the protein, bovine serum albumin (BSA) was evaluated with an enzyme-linked immunosorbent assay (ELISA) to measure the protein carbonyl derivatives formed from protein oxidation. The results showed that some NPs such as Cu(0), CuO, Mn(2)O(3), and Fe(0) caused oxidation of BSA; whereas, many of the other NPs tested were not reactive or very slowly reactive with BSA. The mechanisms involved in the oxidation of BSA protein by the reactive NPs could be attributed to the combined effects of ROS-dependent and direct protein oxidation mechanisms. The ELISA assay is a promising method for the assessment of protein oxidation by NPs, which can provide insights on NP toxicity mechanisms. Copyright © 2012 Wiley Periodicals, Inc.

  4. Magnetic nanoparticle based purification and enzyme-linked immunosorbent assay using monoclonal antibody against enrofloxacin

    Kim, Nam-Gun; Kim, Myeong-Ae; Park, Young-Il; Jung, Tae-Sung; Son, Seong-Wan; So, ByungJae


    Monoclonal anti-enrofloxacin antibody was prepared for a direct competitive enzyme-linked immunosorbent assay (ELISA) and purification system using monoclonal antibody (mAb) coupled magnetic nanoparticles (MNPs). The IC50 values of the developed mAb for enrofloxacin (ENR), ciprofloxacin, difloxacin, sarafloxacin, pefloxacin, and norfloxacin were 5.0, 8.3, 9.7, 21.7, 36.0, and 63.7 ng/mL, respectively. The lowest detectable level of ENR was 0.7 ng/mL in the prepared ELISA system. To validate the developed ELISA in the food matrix, known amounts of ENR were spiked in meat and egg samples at 10, 20 and 30 ng/mL. Recoveries for ENR ranged from 72.9 to 113.16% with a coefficient of variation (CV) of 2.42 to 10.11%. The applicability of the mAb-MNP system was verified by testing the recoveries for ENR residue in three different matrices. Recoveries for ENR ranged from 75.16 to 86.36%, while the CV ranged from 5.08 to 11.53%. Overall, ENR-specific monoclonal antibody was prepared and developed for use in competitive to ELISAs for the detection of ENR in animal meat samples. Furthermore, we suggest that a purification system for ENR using mAb-coupled MNPs could be useful for determination of ENR residue in food. PMID:26040610

  5. Detection of antibodies to the extractable nuclear antigens by enzyme linked immunosorbent assay

    Aziz, Khalil A.; Fzizal, Abul A.


    Anti-extractable nuclear antigen (ENA) antibodies are a group of autoantibodies that are directed against various components of the cell nucleus. Antibodies to these antigens are closely associated with connective tissue disease. Early diagnosis of these diseases can prove very difficult and therefore clinicians rely on the use of anti-ENA antibody testing for the exclusion. Old methods of testing are time consuming and require great skills. For these reasons clinical immunology laboratories are switching to testing for anti-ENA antibodies by enzyme linked immunosorbent assay (ELISA). The latter assays are more sensitive and require little skills. In the present study we have investigated a number of different ELISA preparations. The study was conducted at Birmingham Heartlands Hospital during the period 2003. We tested a number of ENA-positive and negative samples using 3 different commercial ELISA preparations and compared the results with traditional CCIE-assay. The present study revealed that some ELISA preparations can be more sensitive than CCIE method. Laboratories still using later method should switch to ELISA. However it is important that laboratories evaluate a long range of different ELISA preparations before selecting the most optimal one. In addition it is recommended that laboratories then audit results in order to determine true significance of such results. Finally until the true significance of ELISA generated results is known, positive ENA-results should be interpreted in conjunction with the clinical picture and this would require close liaison in between the clinical immunology laboratory and clinicians

  6. Development of an enzyme-linked immunosorbent assay for the detection of dicamba.

    Clegg, B S; Stephenson, G R; Hall, J C


    A competitive indirect enzyme-linked immunosorbent assay (CI-ELISA) was developed to quantitate the herbicide dicamba (3,6-dichloro-2-methoxybenzoic acid) in water. The CI-ELISA has a detection limit of 2.3 microg L(-1) and a linear working range of 10--10000 microg L(-1) with an IC(50) value of 195 microg L(-1). The dicamba polyclonal antisera did not cross-react with a number of other herbicides tested but did cross-react with a dicamba metabolite, 5-hydroxydicamba, and structurally related chlorobenzoic acids. The assay was used to estimate quantitatively dicamba concentrations in water samples. Water samples were analyzed directly, and no sample preparation was required. To improve detection limits, a C(18) (reversed phase) column concentration step was devised prior to analysis, and the detection limits were increased by at least by 10-fold. After the sample preconcentration, the detection limit, IC(50), and linear working range were 0.23, 19.5, and 5-200 microg L(-1), respectively. The CI-ELISA estimations in water correlated well with those from gas chromatography-mass spectrometry (GC-MS) analysis (r(2) = 0.9991). This assay contributes to reducing laboratory costs associated with the conventional GC-MS residue analysis techniques for the quantitation of dicamba in water.

  7. Bluetongue virus: comparative evaluation of enzyme-linked immunosorbent assay, immunodiffusion, and serum neutralization for detection of viral antibodies.

    Poli, G; Stott, J; Liu, Y S; Manning, J S


    Comparative studies on the detection of bovine serum immunoglobulin G antibodies to bluetongue virus with an enzyme-linked immunosorbent assay, an immunodiffusion method, and a serum neutralization assay demonstrated complete concordance between the enzyme-linked immunosorbent assay and the serum neutralization assay results. However, the immunodiffusion method failed to detect bluetongue virus antibody in a substantial number of sera found to possess bluetongue virus immunoglobulin G with th...

  8. The use of subcutaneous fat tissue for amyloid typing by enzyme-linked immunosorbent assay

    Olsen, K E; Sletten, K; Westermark, Per


    for typing the most common systemic amyloidoses of AL, AA, and transthyretin types by enzyme-linked immunosorbent assay (ELISA), using abdominal wall subcutaneous fat biopsy specimens. The method was tested on 21 abdominal fat biopsy specimens that were sent to the laboratory. Of these, 15 contained amyloid......The amyloidoses are biochemically heterogeneous diseases with pathophysiologic deposits of various proteins. The clinical course, prognosis, and therapy are different for each type of amyloidosis and, therefore, a type-specific diagnosis is demanded as early as possible. We describe a method...

  9. A murine monoclonal antibody based enzyme-linked immunosorbent assay for almond (Prunus dulcis L.) detection.

    Su, Mengna; Venkatachalam, Mahesh; Liu, Changqi; Zhang, Ying; Roux, Kenneth H; Sathe, Shridhar K


    A sandwich enzyme-linked immunosorbent assay (ELISA) using anti-almond soluble protein rabbit polyclonal antibodies as capture antibodies and murine monoclonal antibody 4C10 as the detection antibodies was developed. The assay is specific and sensitive (3-200 ng almond protein/mL) for almond detection. The standardized assay is accurate (assay variability assay did not register any cross-reactivity with the tested food matrices, suggesting the assay to be almond amandin specific. The assay could detect the presence of declared almond in the tested matched commercial samples. Further, the assay reliably detected the presence of almonds in the laboratory prepared food samples spiked with almond flour.

  10. Review on enzyme-linked immunosorbent assays for sulfonamide residues in edible animal products.

    Zhang, Hongyan; Wang, Shuo


    The current status of enzyme-linked immunosorbent assays (ELISAs) for sulfonamides in edible animal products is reviewed. The attention was focused on the design and synthesis of haptens, conjugation to carrier protein, production of antibody, application of homologous and heterologous systems, as well as the molecular modeling of the haptens and sulfonamides. Researches have shown that sulfonamides seem to be particularly resistant to attempts to produce broad specificity antibodies. By summarizing the available research on sulfonamide ELISAs, it is hoped that it can be considered as a basis for further investigation aimed at developing the most efficient approaches for detection.

  11. Enzyme-linked immunosorbent assay (ELISA) for the anthropogenic marker isolithocholic acid in water.

    Baldofski, Stefanie; Hoffmann, Holger; Lehmann, Andreas; Breitfeld, Stefan; Garbe, Leif-Alexander; Schneider, Rudolf J


    Bile acids are promising chemical markers to assess the pollution of water samples with fecal material. This study describes the optimization and validation of a direct competitive enzyme-linked immunosorbent assay for the bile acid isolithocholic acid (ILA). The quantification range of the optimized assay was between 0.09 and 15 μg/L. The assay was applied to environmental water samples. Most studies until now were focused on bile acid fractions in the particulate phase of water samples. In order to avoid tedious sample preparation, we undertook to evaluate the dynamics and significance of ILA levels in the aqueous phase. Very low concentrations in tap and surface water samples made a pre-concentration step necessary for this matrix as well as for wastewater treatment plant (WWTP) effluent. Mean recoveries for spiked water samples were between 97% and 109% for tap water and WWTP influent samples and between 102% and 136% for WWTP effluent samples. 90th percentiles of intra-plate and inter-plate coefficients of variation were below 10% for influents and below 20% for effluents and surface water. ILA concentrations were quantified in the range of 33-72 μg/L in influent, 21-49 ng/L in effluent and 18-48 ng/L in surface water samples. During wastewater treatment the ILA levels were reduced by more than 99%. ILA concentrations of influents determined by ELISA and LC-MS/MS were in good agreement. However, findings in LC-ELISA experiments suggest that the true ILA levels in concentrated samples are lower due to interfering effects of matrix compounds and/or cross-reactants. Yet, the ELISA will be a valuable tool for the performance check and comparison of WWTPs and the localization of fecal matter input into surface waters. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Biotin/avidin sandwich enzyme-linked immunosorbent assay for Culicidae mosquito blood meal identification

    A. M. Marassá


    Full Text Available The knowledge of mosquitoes Culicidae host feeding patterns is basic to understand the roles of different species and to indicate their importance in the epidemiology of arthropod-borne diseases. A laboratory assay was developed aiming at standardizing the biotin-avidin sandwich enzyme-linked immunosorbent assay, which was unprecedented for mosquito blood meal identification. The enzyme-linked immunosorbent assay (ELISA activity was evaluated by the detection of titers on each sample of the 28 blood-fed Culex quinquefasciatus. In light of the high sensitivity that the technique permits, by means of small quantities of specific antibodies commercially provided and phosphatase substrate which reinforces additional dilutions, human and rat blood meals were readily identified in all laboratory-raised Culex quinquefasciatus tested. The assay was effective to detect human blood meal dilutions up to 1:4,096, which enables the technique to be applied in field studies. Additionally, the present results indicate a significant difference between the detection patterns recorded from human blood meal which corroborate the results of host feeding patterns.

  13. An enzyme-linked immunosorbent assay for bromodeoxyuridine incorporation using fixed microcultures

    Muir, D.; Varon, S.; Manthorpe, M.


    We report a quantitative method by which a single microculture can be examined for cell morphology; cell number; DNA synthesis; and expression of cell antigens. This method first involves measuring by enzyme-linked immunosorbent assay (ELISA) the total bromodeoxyuridine (BrdU) incorporation into DNA by monolayer microcultures. The BrdU-ELISA measurement was followed by simultaneous immunostaining for BrdU-positive nuclei and for a cytoplasmic antigen. The method was applied to the measurement of mitogen-induced proliferation of rat sciatic nerve Schwann cell and cerebral astroglia microcultures. The ELISA measurement of BrdU incorporation compares favorably with measurements of tritiated thymidine incorporation and offers the additional advantages that the same microculture can subsequently be examined for cell number, for cell morphology, and for the percentage of cells having BrdU-labeled nuclei and other antigens

  14. An enzyme-linked immunosorbent assay for bromodeoxyuridine incorporation using fixed microcultures

    Muir, D.; Varon, S.; Manthorpe, M. (Univ. of California, San Diego, La Jolla (USA))


    We report a quantitative method by which a single microculture can be examined for cell morphology; cell number; DNA synthesis; and expression of cell antigens. This method first involves measuring by enzyme-linked immunosorbent assay (ELISA) the total bromodeoxyuridine (BrdU) incorporation into DNA by monolayer microcultures. The BrdU-ELISA measurement was followed by simultaneous immunostaining for BrdU-positive nuclei and for a cytoplasmic antigen. The method was applied to the measurement of mitogen-induced proliferation of rat sciatic nerve Schwann cell and cerebral astroglia microcultures. The ELISA measurement of BrdU incorporation compares favorably with measurements of tritiated thymidine incorporation and offers the additional advantages that the same microculture can subsequently be examined for cell number, for cell morphology, and for the percentage of cells having BrdU-labeled nuclei and other antigens.

  15. Monoclonal antibodies against human angiotensinogen, their characterization and use in an angiotensinogen enzyme linked immunosorbent assay.

    Rubin, I; Lykkegaard, S; Olsen, A A; Selmer, J; Ballegaard, M


    Monoclonal antibodies were produced against human angiotensinogen. An enzyme linked immunosorbent assay (ELISA) was developed using a high affinity monoclonal antibody as catching antibody and a polyclonal rabbit anti human angiotensinogen antibody as detecting antibody in a "sandwich" ELISA. Linear range of the ELISA was 15-450 pmol/l of human angiotensinogen. Intra- and inter- assay variation coefficients were in the range of 2% to 8%. A correlation coefficient, r = 0.97, (n = 20), with values obtained by radioimmunoassay. This correlation coefficient, obtained by using both normal and pregnant sera, confirmed that the ELISA fulfill the requirements for clinical useful assay. Characterization of the antibodies were performed with respect to affinity constant and epitopes.

  16. Evaluation of an enzyme-linked immunosorbent assay for determination of porcine haptoglobin

    Petersen, H. H.; Nielsen, J. P.; Jensen, A.L.


    An enzyme-linked immunosorbent assay for quantification of haptoglobin in porcine serum was evaluated. Tbe detection limit when expressed as the estimated concentration of a blank sample was 0.0003 mg/ml. The precision of the assay was acceptable with intra-assay coefficients of variation below 4...... % and inter-assay coefficient of variation below 5 % for serum concentrations ranging from 1.0 mg/ml and above. For samples with a concentration below 0.8 mg/ml, the inter-assay coefficient of variation was above 10 %. The assay maintained linearity under dilution. Recovery was proportional. Haemolysis.......2. The maximum allowable analytical imprecision was 2.6 % and the maximum analytical inaccuracy was 9.9 %. The number of samples required to determine, the true haptoglobin value in an individual pig when accounting for the day-to-day fluctuation was 5. In conclusion, the haptoglobin assay was found...

  17. Determination of PCBs in fish using enzyme-linked immunosorbent assay (ELISA)

    Lasrado, J.A.; Santerre, C.R.; Zajicek, J.L.; Stahl, J.R.; Tillitt, D.E.; Deardorff, D.


    Polychlorinated biphenyls (PCBs) were determined in fish tissue using an enzyme-linked immunosorbent assay (ELISA). Standard curves for Aroclor 1248, 1254, and 1260 in catfish tissue were developed with ranges from 0.05 to 0.5 ppm and 0.5 to 5.0 ppm. Wild fish were initially analyzed using gas chromatography/electron-capture detection (GC/ECD) and those having residues within the standard curve ranges were analyzed with ELISA. Results obtained using ELISA and GC/ECD were not significantly different (p < 0.05) from 0.05 to 0.5 ppm. From 0.5 to 5.0 ppm, the standard curve for Aroclor 1254 was the best predictor of total PCB in wild fish samples.

  18. Validation of a KHV antibody enzyme-linked immunosorbent assay (ELISA).

    Bergmann, S M; Wang, Q; Zeng, W; Li, Y; Wang, Y; Matras, M; Reichert, M; Fichtner, D; Lenk, M; Morin, T; Olesen, N J; Skall, H F; Lee, P-Y; Zheng, S; Monaghan, S; Reiche, S; Fuchs, W; Kotler, M; Way, K; Bräuer, G; Böttcher, K; Kappe, A; Kielpinska, J


    Koi herpesvirus (KHV) causes KHV disease (KHVD). The virus is highly contagious in carp or koi and can induce a high mortality. Latency and, in some cases, a lack of signs presents a challenge for virus detection. Appropriate immunological detection methods for anti-KHV antibodies have not yet been fully validated for KHV. Therefore, it was developed and validated an enzyme-linked immunosorbent assay (ELISA) to detect KHV antibodies. The assay was optimized with respect to plates, buffers, antigens and assay conditions. It demonstrated high diagnostic and analytical sensitivity and specificity and was particularly useful at the pond or farm levels. Considering the scale of the carp and koi industry worldwide, this assay represents an important practical tool for the indirect detection of KHV, also in the absence of clinical signs. © 2017 John Wiley & Sons Ltd.

  19. Development and validation of an enzyme-linked immunosorbent assay for the quantification of trastuzumab in human serum and plasma

    Damen, Carola W. N.; de Groot, Els R.; Heij, Marianne; Boss, David S.; Schellens, Jan H. M.; Rosing, Hilde; Beijnen, Jos H.; Aarden, Lucien A.


    Trastuzumab, a humanized monoclonal antibody, is used for the treatment of breast cancer patients who overexpress the HER2 receptor. To optimize therapy, pharmacokinetic studies are necessary. The aim of this study was to develop an enzyme-linked immunosorbent assay (ELISA) for trastuzumab to

  20. Development of an enzyme-linked immunosorbent assay for the detection of ciguatoxin in fish tissue using chicken immunoglobulin Y.

    Empey Campora, Cara; Hokama, Yoshitsugi; Yabusaki, Kenichi; Isobe, Minoru


    A sandwich enzyme-linked immunosorbent assay was developed to detect ciguatoxin (CTX) in fish tissue. The assay utilizes two antibodies, chicken immunoglobulin Y specific to the ABCD domain of CTX and a mouse monoclonal immunoglobulin G-horseradish peroxidase conjugate specific to the JKLM domain of CTX. The sensitivity, working range, cross reactivity, accuracy, precision, and reproducibility were examined.

  1. A sensitive monoclonal antibody-based enzyme-linked immunosorbent assay for chlorpyrifos residue determination in Chinese agricultural smaples

    A monoclonal antibody-based competitive antibody-coated enzyme-linked immunosorbent assay (ELISA) was developed and optimized for determining chlorpyrifos residue in agricultural products. The IC50 and IC10 of this ELISA were 3.3 ng/mL and 0.1 ng/mL respectively. The average recoveries recovery rate...

  2. Comparative study of the enzyme linked immunosorbent assay (ELISA) and two radioimmunoassays (RIA'S) for in-sulin

    Klimes, I; Jurcovicova, J; Palkovic, M [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Endokrinologie


    The results of the quality control tests for enzyme linked immunosorbent assay (ELISA) were compared with the results of two different radioimmunoassays (RIA'S) for insulin. Using the manufacturer's procedure for the ELISA kit we found that the analytical variables such as assay sensitivity, recovery study and the 50% binding intercept were in good agreement with those obtained with the RIA method.

  3. Immunoglobulin G1 enzyme-linked Immunosorbent assay for diagnosis of Johne's disease in red deer (Cervus elaphus)

    Griffin, J.F.T.; Spittle, E.; Rodgers, C.R.; Liggett, S.; Cooper, M.; Bakker, D.; Bannantine, J.P.


    This study was designed to develop a customized enzyme-linked immunosorbent assay (ELISA) for the serodiagnosis of Johne's disease (JD) in farmed deer. Two antigens were selected on the basis of their superior diagnostic readouts: denatured purified protein derivative (PPDj) and undenatured


    Abstract describes the development of an enzyme-linked immunosorbent assay (ELISA) method for monitoring 2,4-dichlorophenoxyacetic acid (2,4-D exposures). The ELISA is compared with a gas chromatograhy/mass spectrometry procedure. ELISA method development steps and comparative ...

  5. Immunological Tools: Engaging Students in the Use and Analysis of Flow Cytometry and Enzyme-linked Immunosorbent Assay (ELISA)

    Ott, Laura E.; Carson, Susan


    Flow cytometry and enzyme-linked immunosorbent assay (ELISA) are commonly used techniques associated with clinical and research applications within the immunology and medical fields. The use of these techniques is becoming increasingly valuable in many life science and engineering disciplines as well. Herein, we report the development and…

  6. Use of enzyme-linked immunosorbent assay and dipstick assay for detection of Strongyloides stercoralis infection in humans

    van Doorn, H. Rogier; Koelewijn, Rob; Hofwegen, Henk; Gilis, Henk; Wetsteyn, Jose C. F. M.; Wismans, Pieter J.; Sarfati, Claudine; Vervoort, Tony; van Gool, Tom


    A homemade enzyme-linked immunosorbent assay (ELISA) (Academic Medical Center ELISA [AMC-ELISA]) and a dipstick assay for the detection of anti-Strongyloides stercoralis antibodies in serum were developed and evaluated together with two commercially available ELISAs (IVD-ELISA [IVD Research, Inc.

  7. Sandwich-dot enzyme-linked immunosorbent assay for the detection of canine distemper virus

    Li, Zhi; Zhang, Yanlong; Wang, Huiguo; Jin, Jinhua; Li, Wenzhe


    A sandwich-dot enzyme-linked immunosorbent assay (dot ELISA) was developed for the detection of canine distemper virus (CDV). In 56 dogs suspected to have CD the rates of detection of CDV antigen in samples of blood lymphocytes and palpebral conjunctiva by dot ELISA and ELISA were, respectively, 91% (49/54) and 81% (44/54) for the lymphocyte samples and 88% (28/32) and 75% (24/32) for the conjunctival samples. The CDV detection limits were 10 ng/50 μL for dot ELISA and 40 ng/50 μL for ELISA. The reliability of dot ELISA relative to electron microscopy was 96% with 22 samples: all 21 samples in which CDV particles were observed by electron microscopy yielded positive results with dot ELISA; the single sample in which particles were not observed yielded false-positive results with dot ELISA. The results indicate that the dot ELISA developed can serve as a reliable rapid diagnostic test in suspected cases of CD and also be useful for epidemiologic surveillance of the disease. PMID:24124274

  8. Single-dilution enzyme-linked immunosorbent assay for quantification of antigen-specific salmonid antibody

    Alcorn, S.W.; Pascho, R.J.


    An enzyme-linked immunosorbent assay (ELISA) was developed on the basis of testing a single dilution of serum to quantify the level of antibody to the p57 protein of Renibaclerium salmoninarum in sockeye salmon (Oncorhynchus nerka). The levels of antibody were interpolated from a standard curve constructed by relating the optical densities (OD) produced by several dilutions of a high-titer rainbow trout (O. mykiss) antiserum to the p57 protein. The ELISA OD values produced by as many as 36 test sera on each microplate were compared with the standard curve to calculate the antigen-specific antibody activity. Repeated measurements of 36 samples on 3 microplates on each of 6 assay dates indicated that the mean intraassay coefficient of variation (CV) was 6.68% (range, 0-23%) and the mean interassay CV was 8.29% (range, 4-16%). The antibody levels determined for the serum sample from 24 sockeye salmon vaccinated with a recombinant p57 protein generally were correlated with the levels determined by endpoint titration (r2 = 0.936) and with results from another ELISA that was based on extrapolation of antibody levels from a standard curve (r2 = 0.956). The single-dilution antibody ELISA described here increases the number of samples that can be tested on each microplate compared with immunoassays based on analysis of several dilutions of each test serum. It includes controls for interassay standardization and can be used to test fish weighing <3 g.

  9. Enzyme-linked immunosorbent assays for detection of equine antibodies specific to Sarcocystis neurona surface antigens.

    Hoane, Jessica S; Morrow, Jennifer K; Saville, William J; Dubey, J P; Granstrom, David E; Howe, Daniel K


    Sarcocystis neurona is the primary causative agent of equine protozoal myeloencephalitis (EPM), a common neurologic disease of horses in the Americas. We have developed a set of enzyme-linked immunosorbent assays (ELISAs) based on the four major surface antigens of S. neurona (SnSAGs) to analyze the equine antibody response to S. neurona. The SnSAG ELISAs were optimized and standardized with a sample set of 36 equine sera that had been characterized by Western blotting against total S. neurona parasite antigen, the current gold standard for S. neurona serology. The recombinant SnSAG2 (rSnSAG2) ELISA showed the highest sensitivity and specificity at 95.5% and 92.9%, respectively. In contrast, only 68.2% sensitivity and 71.4% specificity were achieved with the rSnSAG1 ELISA, indicating that this antigen may not be a reliable serological marker for analyzing antibodies against S. neurona in horses. Importantly, the ELISA antigens did not show cross-reactivity with antisera to Sarcocystis fayeri or Neospora hughesi, two other equine parasites. The accuracy and reliability exhibited by the SnSAG ELISAs suggest that these assays will be valuable tools for examining the equine immune response against S. neurona infection, which may help in understanding the pathobiology of this accidental parasite-host interaction. Moreover, with modification and further investigation, the SnSAG ELISAs have potential for use as immunodiagnostic tests to aid in the identification of horses affected by EPM.

  10. Enzyme-Linked Immunosorbent Assays for Detection of Equine Antibodies Specific to Sarcocystis neurona Surface Antigens†

    Hoane, Jessica S.; Morrow, Jennifer K.; Saville, William J.; Dubey, J. P.; Granstrom, David E.; Howe, Daniel K.


    Sarcocystis neurona is the primary causative agent of equine protozoal myeloencephalitis (EPM), a common neurologic disease of horses in the Americas. We have developed a set of enzyme-linked immunosorbent assays (ELISAs) based on the four major surface antigens of S. neurona (SnSAGs) to analyze the equine antibody response to S. neurona. The SnSAG ELISAs were optimized and standardized with a sample set of 36 equine sera that had been characterized by Western blotting against total S. neurona parasite antigen, the current gold standard for S. neurona serology. The recombinant SnSAG2 (rSnSAG2) ELISA showed the highest sensitivity and specificity at 95.5% and 92.9%, respectively. In contrast, only 68.2% sensitivity and 71.4% specificity were achieved with the rSnSAG1 ELISA, indicating that this antigen may not be a reliable serological marker for analyzing antibodies against S. neurona in horses. Importantly, the ELISA antigens did not show cross-reactivity with antisera to Sarcocystis fayeri or Neospora hughesi, two other equine parasites. The accuracy and reliability exhibited by the SnSAG ELISAs suggest that these assays will be valuable tools for examining the equine immune response against S. neurona infection, which may help in understanding the pathobiology of this accidental parasite-host interaction. Moreover, with modification and further investigation, the SnSAG ELISAs have potential for use as immunodiagnostic tests to aid in the identification of horses affected by EPM. PMID:16148170

  11. Enzyme-linked immunosorbent assay and radioimmunoassay of serum pepsinogen A

    Pals, Gerard; Meuwissen, S.G.M.; Frants, R.R.; Kostense, P.J.; Eriksson, A.W.; Raesaenen, Vesa


    The determination of serum pepsinogen A (=pepsinogen I) levels is of clinical importance in the study of duodenal ulcer, atrophic gastritis and gastric cancer. In the present study two different quantitative immunological techniques for serum pepsinogen A were compared: a radioimmunoassay (RIA) (Helsinki) and an enzyme-linked immunosorbent assay (ELISA) (Amsterdam). Serum samples of 177 subjects with various gastric diseases were tested in a double blind study. The correlation was excellent (r=0.954 in the range 0-760 μg/l and r=0.971 in the range 0-100 μg/l). The functional relationship between ELISA (x) and RIA (y), determined by weighted model II regression, was y=1.12x-0.54. Initially the use of goat anti-PGA in the ELISA resulted in falsely high values in about 10% of the individuals. This was caused by circulating antibodies cross-reacting with goat IgG. This artefact was eliminated by pre-incubation of all samples with non-immune goat serum. (author)

  12. Enzyme-linked immunosorbent assay for ultratrace determination of antibiotics in aqueous samples.

    Kumar, Kuldip; Thompson, Anita; Singh, Ashok K; Chander, Yogesh; Gupta, Satish C


    Two commercially available enzyme-linked immunosorbent assay (ELISA) kits that are commonly used for tylosin or tetracycline residues in meat and milk were adapted for ultratrace analysis of these antibiotics in surface and ground waters. These two antibiotics are commonly fed to swine, turkeys, and cattle at subtherapeutic doses for growth promotion purposes. Both ELISA techniques were found to be highly sensitive and selective for the respective antibiotics with detection limits of 0.10 and 0.05 microg L(-1) for tylosin and tetracycline, respectively. The recovery of both tylosin and tetracycline from spiked samples of lake waters, runoff samples, soil saturation extracts, and nanopure water was close to 100%. Tetracycline ELISA was highly specific for tetracycline and chlortetracycline but not for other forms of tetracycline (oxytetracycline, demeclocycline, and doxycycline). Analysis of a few liquid swine manure samples by liquid chromatography-mass spectrometry (LC-MS) showed lower concentrations for chlortetracycline as compared with concentrations obtained using ELISA. However, the concentrations of tylosin from ELISA were comparable with that of LC-MS. The lower concentrations of chlortetracycline obtained by LC-MS in manure samples indicate the presence of other similar or transformed compounds that were detected by ELISA but not determined by LC-MS. These results indicate that both ELISA kits can be useful tools for low-cost screening of tylosin, tetracycline, and chlortetracycline in environmental waters. Furthermore, both ELISA procedures are rapid, portable, and easily adaptable for testing of multiple samples simultaneously.

  13. Antibody screening by enzyme-linked immunosorbent assay using pooled soluble HLA in renal transplant candidates.

    Zaer, F; Metz, S; Scornik, J C


    The enzyme-linked immunosorbent assay (ELISA) using HLA class I molecules purified from pooled platelets has the potential to detect HLA antibodies with increased efficiency without sacrificing sensitivity or specificity. This test, which was originally developed in our institution, has been independently validated by recent studies and is now commercially available. We now present evidence of its usefulness as a routine HLA antibody screening test for renal transplant patients. A total of 515 patients were tested monthly by ELISA (13.9 tests/patient) and by antiglobulin-enhanced panel reactivity (6.3 tests/patient). In patients found to be unsensitized, the incidence of false-positive results was less for ELISA than for the panel studies. In patients who were highly sensitized, both tests performed equally well, whereas discordant results were registered mainly in cases of mild sensitization. Because 66% of our patients were not sensitized, the ELISA was effective in reducing the number of more involved tests aimed at characterizing the antibodies. These results provide a foundation to use the pooled platelet HLA ELISA on a routine basis for HLA antibody screening.

  14. Enzyme-linked immunosorbent assay and radioimmunoassay of serum pepsinogen A

    Pals, G; Meuwissen, S G.M.; Frants, R R; Kostense, P J; Eriksson, A W; Raesaenen, V


    The determination of serum pepsinogen A (=pepsinogen I) levels is of clinical importance in the study of duodenal ulcer, atrophic gastritis and gastric cancer. In the present study two different quantitative immunological techniques for serum pepsinogen A were compared: a radioimmunoassay (RIA) (Helsinki) and an enzyme-linked immunosorbent assay (ELISA) (Amsterdam). Serum samples of 177 subjects with various gastric diseases were tested in a double blind study. The correlation was excellent (r=0.954 in the range 0-760 and r=0.971 in the range 0-100 The functional relationship between ELISA (x) and RIA (y), determined by weighted model II regression, was y=1.12x-0.54. Initially the use of goat anti-PGA in the ELISA resulted in falsely high values in about 10% of the individuals. This was caused by circulating antibodies cross-reacting with goat IgG. This artefact was eliminated by pre-incubation of all samples with non-immune goat serum.

  15. Evaluation of electrochemiluminescene immunoassay and enzyme-linked immunosorbent assay for serum HBsAb detection

    Ma Caiyun; Jiang Li; Ge Gaoxia; Zhang Xiaojie


    Electrochemiluminescene immunoassay (ECLIA) and enzyme-linked immunosorbent (ELISA) were used to detect the different concentrations of serum HBsAb, in order to compare the results of ECLIA and ELISA. The result showed that intra-assay coefficient of variation of ECLIA was about 0.95% for high value, 1.13% for mean values and 2.63% for low value, while that of ELISA was about 5.76%, 12.8% and 15.9%, respectively. The interassay coefficient of ECLIA was about 4.03% for high values, 4.93% for mean values and 7.34% for low values, while that of ELISA was about 10.1%, 19.6% and 25.2%, respectively. The analytical sensitivity of ECLIA was about 4.0IU/L, while that of ELISA is about 19.0IU/L. Only in 3 samples, the results measured by ECLIA and ELISA were different (ECLIA: positive; ELISA: negative) among 165 samples. It is concluded that the met hod of ECLIA is more efficient than ELISA for detection of HBsAb in serum. (authors)

  16. A sensitive enzyme-linked immunosorbent assay for the determination of fish protein in processed foods.

    Shibahara, Yusuke; Uesaka, Yoshihiko; Wang, Jun; Yamada, Shoichi; Shiomi, Kazuo


    Fish is one of the most common causes of food allergy and its major allergen is parvalbumin, a 12 kDa muscular protein. In this study, a sandwich enzyme-linked immunosorbent assay (ELISA) for the determination of fish protein in processed foods was developed using a polyclonal antibody raised against Pacific mackerel parvalbumin. The developed sandwich ELISA showed 22.6-99.0% reactivity (based on the reactivity to Pacific mackerel parvalbumin) to parvalbumins from various species of fish. The limits of detection and quantitation were estimated to be 0.23 and 0.70 μg protein per g of food, respectively. When the sandwich ELISA was subjected to inter-laboratory validation, spiked fish protein was recovered from five model processed foods in the range of 69.4-84.8% and the repeatability and reproducibility relative standard deviations were satisfactorily low (≤ 10.5%). Thus, the sandwich ELISA was judged to be a useful tool to determine fish protein in processed foods. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Detection of copper ions using microcantilever immunosensors and enzyme-linked immunosorbent assay

    Zhao Hongwei [College of Agronomy and Biotechnology, China Agricultural University, Beijing 100193 (China); Xue Changguo [Key Laboratory of Mechanical Behavior and Design of Material of Chinese Academy of Sciences, University of Science and Technology of China, Hefei 230027 (China); Nan Tiegui; Tan Guiyu; Li Zhaohu [College of Agronomy and Biotechnology, China Agricultural University, Beijing 100193 (China); Li, Qing X. [Department of Molecular Biosciences and Bioengineering, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); Zhang Qingchuan, E-mail: [Key Laboratory of Mechanical Behavior and Design of Material of Chinese Academy of Sciences, University of Science and Technology of China, Hefei 230027 (China); Wang Baomin, E-mail: [College of Agronomy and Biotechnology, China Agricultural University, Beijing 100193 (China)


    A sensitive and specific monoclonal antibody (designated as mAb6A9) recognizing a Cu(II)-ethylenediamine-N,N,N',N'-tetraacetic acid (EDTA) complex but not metal-free EDTA was obtained by using an 1-(4-aminobenzyl)-EDTA-Cu(II) complex covalently coupled to a carrier protein as an immunogen to immunize the Balb/c mice. A mAb6A9-modified microcantilever sensor (MCS) was developed. A bending response was found to occur at or below 1 ng mL{sup -1} of Cu(II)-EDTA complex. An indirect competitive enzyme-linked immunosorbent assay (icELISA) was developed with mAb6A9. The icELISA had a half maximum inhibition concentration and working range of approximately 1.8 and 0.2-17 ng mL{sup -1}, respectively. The icELISA showed cross-reactivity of 18.8%, 1.1% and less than 1% with bivalent cobalt, mercury and other metals, respectively. The icELISA and functionalized MCSs were utilized to analyze the content of copper in spiked tap water samples. The assay conditions were optimized. The results of icELISA and MCS correlated well with those obtained by graphite furnace atomic absorption spectrometry.

  18. Biotin-Streptavidin Competition Mediates Sensitive Detection of Biomolecules in Enzyme Linked Immunosorbent Assay.

    Lakshmipriya, Thangavel; Gopinath, Subash C B; Tang, Thean-Hock


    Enzyme Linked Immunosorbent Assay (ELISA) is the gold standard assay for detecting and identifying biomolecules using antibodies as the probe. Improving ELISA is crucial for detecting disease-causing agents and facilitating diagnosis at the early stages of disease. Biotinylated antibody and streptavidin-conjugated horse radish peroxide (streptavidin-HRP) often are used with ELISA to enhance the detection of various kinds of targets. In the present study, we used a competition-based strategy in which we pre-mixed free biotin with streptavidin-HRP to generate high-performance system, as free biotin occupies some of the biotin binding sites on streptavidin, thereby providing more chances for streptavidin-HRP to bind with biotinylated antibody. ESAT-6, which is a protein secreted early during tuberculosis infection, was used as the model target. We found that 8 fM of free biotin mixed with streptavidin-HRP anchored the higher detection level of ESAT-6 by four-fold compared with detection without free biotin (only streptavidin-HRP), and the limit of detection of the new method was 250 pM. These results suggest that biotin-streptavidin competition can be used to improve the diagnosis of analytes in other types of sensors.

  19. Enzyme-linked immunosorbent assay for the quantitative/qualitative analysis of plant secondary metabolites.

    Sakamoto, Seiichi; Putalun, Waraporn; Vimolmangkang, Sornkanok; Phoolcharoen, Waranyoo; Shoyama, Yukihiro; Tanaka, Hiroyuki; Morimoto, Satoshi


    Immunoassays are antibody-based analytical methods for quantitative/qualitative analysis. Since the principle of immunoassays is based on specific antigen-antibody reaction, the assays have been utilized worldwide for diagnosis, pharmacokinetic studies by drug monitoring, and the quality control of commercially available products. Berson and Yalow were the first to develop an immunoassay, known as radioimmunoassay (RIA), for detecting endogenous plasma insulin [1], a development for which Yalow was awarded the Nobel Prize in Physiology or Medicine in 1977. Even today, after half a century, immunoassays are widely utilized with some modifications from the originally proposed system, e.g., radioisotopes have been replaced with enzymes because of safety concerns regarding the use of radioactivity, which is referred to as enzyme immunoassay/enzyme-linked immunosorbent assay (ELISA). In addition, progress has been made in ELISA with the recent advances in recombinant DNA technology, leading to increase in the range of antibodies, probes, and even systems. This review article describes ELISA and its applications for the detection of plant secondary metabolites.

  20. High sensitivity, high surface area Enzyme-linked Immunosorbent Assay (ELISA).

    Singh, Harpal; Morita, Takahiro; Suzuki, Yuma; Shimojima, Masayuki; Le Van, An; Sugamata, Masami; Yang, Ming


    Enzyme-linked immunosorbent assays (ELISA) are considered the gold standard in the demonstration of various immunological reactions with an application in the detection of infectious diseases such as during outbreaks or in patient care. This study aimed to produce an ELISA-based diagnostic with an increased sensitivity of detection compared to the standard 96-well method in the immunologic diagnosis of infectious diseases. A '3DStack' was developed using readily available, low cost fabrication technologies namely nanoimprinting and press stamping with an increased surface area of 4 to 6 times more compared to 96-well plates. This was achieved by stacking multiple nanoimprinted polymer sheets. The flow of analytes between the sheets was enhanced by rotating the 3DStack and confirmed by Finite-Element (FE) simulation. An Immunoglobulin G (IgG) ELISA for the detection of antibodies in human serum raised against Rubella virus was performed for validation. An improved sensitivity of up to 1.9 folds higher was observed using the 3DStack compared to the standard method. The increased surface area of the 3DStack developed using nanoimprinting and press stamping technologies, and the flow pattern between sheets generated by rotating the 3DStack were potential contributors to a more sensitive ELISA-based diagnostic device.

  1. Detection of tetracosactide in plasma by enzyme-linked immunosorbent assay (ELISA).

    Martin, Laurent; Chaabo, Ayman; Lasne, Françoise


    As a synthetic analogue of adrenocorticotropic hormone (ACTH), tetracosactide is prohibited in sport by the World Anti-Doping Agency (WADA). An enzyme-linked immunosorbent assay (ELISA) method is proposed for detection of this drug in plasma. Since its structure corresponds to the 24 N-terminal of the 39 amino acids of the natural endogenous peptide ACTH, tetracosactide can be detected with a commercial ELISA kit for ACTH that uses antibodies, the epitopes of which are located in the 1-24 part of ACTH. However, an essential condition for detection specificity is the preliminary total clearance of endogenous ACTH in the plasma samples. This is achieved by a preparative step based on cation-exchange chromatography before ELISA. The method is specific and sensitive (LOD: 30 pg/mL) and may be used as a screening analysis in anti-doping control. The pre-analytical conditions are shown to be of the upmost importance and recommendations for blood collection (EDTA tubes), sample transport (4 °C) and plasma sample storage (-20 °C) are presented. Copyright © 2014 John Wiley & Sons, Ltd.

  2. Development of enzyme-linked immunosorbent assay for detecting Ornithobacterium rhinotracheale (ORT infection in chicken

    Adin Priadi


    Full Text Available Ornithobacterium rhinotracheale (ORT has been recognized in chicken in Indonesia and incriminated as a possible additional causative agent in respiratory disease complex. An enzyme-linked immunosorbent assay (ELISA has been developed for the seroepidemiological study of ORT infection in chickens. Ten weeks old chickens are injected with 0.5 ml of killed O. rhinotracheale emulsified in Freund's complete adjuvant at a concentration of 109 CFU/ml. Hyperimmune sera and non-reactive control sera were used to standardized the ELISA for ORT infection. Optimum condition for the ORT ELISA was antigen dilution 1/800, serum dilution 1/100 and 1/4000 conjugate dilution. Optical density cut-off point was determined by using 31 serum samples from 2 broiler farms. Cut-off for negative serum was 0.27 (mean + 3 standard deviation. With these optima, 187 chicken sera from broiler, layer and broiler breeder farms were collected and screened. Seroconvertions were detected from broiler and layer farms in Magelang district, Central Java (Bojong I, Paremono, Bojong II, Keblukan and a broiler breeder farm in West Java. The seraconvertion were 0, 10, 94, 88 and 100 percents respectively. These figures show that the prevalence of O. rhinotracheale infection in chicken in layer and breeder farms were very high.

  3. Detection of Plasmodium Aldolase Using a Smartphone and Microfluidic Enzyme Linked Immunosorbent Assay

    Nikhil S. Gopal


    Full Text Available Background. Malaria control efforts are limited in rural areas. A low-cost system to monitor response without the use of electricity is needed. Plasmodium aldolase is a malaria biomarker measured using enzyme linked immunosorbent assay (ELISA techniques. A three-part system using ELISA was developed consisting of a microfluidic chip, hand crank centrifuge, and a smartphone. Methods. A circular microfluidic chip was fabricated using clear acrylic and a CO2 laser. A series of passive valves released reagents at precise times based upon centrifugal force. Color change was measured via smartphone camera using an application programmed in Java. The microchip was compared to a standard 96-well sandwich ELISA. Results. Results from standard ELISA were compared to microchip at varying concentrations (1–10 ng/mL. Over 15 different microfluidic patterns were tested, and a final prototype of the chip was created. The prototype microchip was compared to standard sandwich ELISA (n=20 using samples of recombinant aldolase. Color readings of standard ELISA and microfluidic microchip showed similar results. Conclusion. A low-cost microfluidic system could detect and follow therapeutic outcomes in rural areas and identify resistant strains.

  4. Detection of copper ions using microcantilever immunosensors and enzyme-linked immunosorbent assay

    Zhao Hongwei; Xue Changguo; Nan Tiegui; Tan Guiyu; Li Zhaohu; Li, Qing X.; Zhang Qingchuan; Wang Baomin


    A sensitive and specific monoclonal antibody (designated as mAb6A9) recognizing a Cu(II)-ethylenediamine-N,N,N',N'-tetraacetic acid (EDTA) complex but not metal-free EDTA was obtained by using an 1-(4-aminobenzyl)-EDTA-Cu(II) complex covalently coupled to a carrier protein as an immunogen to immunize the Balb/c mice. A mAb6A9-modified microcantilever sensor (MCS) was developed. A bending response was found to occur at or below 1 ng mL -1 of Cu(II)-EDTA complex. An indirect competitive enzyme-linked immunosorbent assay (icELISA) was developed with mAb6A9. The icELISA had a half maximum inhibition concentration and working range of approximately 1.8 and 0.2-17 ng mL -1 , respectively. The icELISA showed cross-reactivity of 18.8%, 1.1% and less than 1% with bivalent cobalt, mercury and other metals, respectively. The icELISA and functionalized MCSs were utilized to analyze the content of copper in spiked tap water samples. The assay conditions were optimized. The results of icELISA and MCS correlated well with those obtained by graphite furnace atomic absorption spectrometry.

  5. Reliability of soluble IL-2 receptor measurements obtained with enzyme-linked immunosorbent assay

    Akiyama, Mitoshi; Takaishi, Masatoshi; Murakami, Yoshie; Ueda, Ryuzo; Yamakido, Michio; Tsubokura, Tokuo.


    Using an enzyme-linked immunosorbent assay (ELISA), human soluble interleukin-2 receptors (IL-2R) were measured in the serum of patients with various autoimmune system diseases. To study the sensitivity and specificity of the assay, soluble IL-2Rs were measured in the culture supernatants and in the cell extracts of peripheral blood mononuclear cells activated with phytohemagglutinin (PHA), purified protein derivative of tuberculin, and allogeneic lymphocytes, as well as in the serum of patients with various collagen diseases. The results correlated well with reports from other laboratories. For example, when stimulated by PHA, the greatest amount of soluble IL-2Rs was produced at the fastest rate. In addition, soluble IL-2R levels in the serum of collagen disease patients were significantly higher than those in healthy persons, who themselves exhibited low levels of detectable soluble IL-2Rs. It is hoped that reliable ELISA measurements of soluble IL-2Rs in the serum of atomic bomb survivors will assist in the interpretation of data collected during the work described in RP 2-87, a study of autoimmunity and autoimmune diseases in the Adult Health Study. (author)

  6. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus



    Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

  7. Diagnostic value of enzyme linked immuno-sorbent assay for cytomegalovirus disease.

    Priya K


    Full Text Available BACKGROUND: Since interpretation of results of enzyme linked immuno-sorbent assay (ELISA for diagnosis of Cytomegalovirus (CMV infection in India is difficult, its diagnostic value required evaluation. AIMS: To evaluate the diagnostic value of ELISA against polymerase chain reaction (PCR in CMV disease. SETTINGS AND DESIGN: Results of ELISA test for CMV antibodies in CMV-DNA PCR positive and negative patients and normal healthy blood donors were analysed. METHODS AND MATERIAL: Anti-CMV antibodies were assayed by ELISA on the sera of 26 CMV PCR positive and 21 PCR negative patients and 35 normal healthy blood donors. STATISTICAL ANALYSIS: Chi square and Fischer exact test were used for statistical analysis. RESULTS: Anti-CMV antibodies (IgG or IgG and IgM were present in 20 (76.9% of 26 PCR positive and 13 (61.9% of 21 PCR negative patients. ELISA was negative in six (23.1% of 26 PCR positive patients. Of the 28 paediatric patients, ELISA was positive in 14 (73.7% of 19 PCR positive and three (33.3% of nine PCR negative patients showing a statistically significant difference (Chi square test, P value 0.038. Among the 19 patients having complications after organ transplant, ELISA showed anti-CMV antibodies in six (85.7% of seven PCR positive and 11 (91.7% of 12 PCR negative patients showing no significant difference. CMV-DNA was not detected in the buffy coat of 35 sero-positive blood donors. CONCLUSION: ELISA has no diagnostic value in the detection of CMV activation although it may help in the differential diagnosis of CMV infection in the paediatric age group.


    Michael J. Bangs


    Full Text Available Recent biotechnological breakthroughs have led to the development of various methods for detection and identification of human pathogens in their vectors. Monoclonal antibodies produced against malaria sporozoite antigens have permitted the development of several sensitive, species specific immunological tests (IFA, IRMA, ELIS A. One of these, a two-site enzyme-linked immunosorbent assay (ELIS A has been developed as a useful epidemiological tool in the identification of malaria-infected mosquitoes. This method employs highly species specific monoclonal antibodies that recognize the repetitive immunodominant epitope of the circumsporozoite (CS protein. Monoclonal antibodies have been developed for all four species of human malaria The key feature of the ELISA technique is the use of an enzyme indicator for an immunological reaction. The antigen capture or "sandwich" ELISA configuration uses the purified monoclonal both as the solid phase and, conjugated to enzyme, as a marker for the presence of CS protein in a mosquito homogenate incubated in the wells of a microtitration plate. This technology has shown advantages over other methods for epidemiological data collection. Mosquitoes can be caught, dried and stored until a time convenient for examination. The sporozoite rate by Plasmodium species can be identified easily, and when combined with the man-biting rate provides the sporozoite inoculation rate, an important entomologic estimate of the number of potential infective bites a person could expect over a given period of time. Presently, mosquitoes can be tested individually or pooled up to 20 anophe lines. The assay is sensitive enough to detect 1 infected mosquito per pool or as few as 25 sporozoites per 50 pi of mosquito extract. Basic principles and procedures are covered concerning solid substrate, adsorption to solid substrate, buffers and wash solutions, conjugates and enzyme substrates. The advantages and limitations of this technique

  9. Validation of 2 commercial Neospora caninum antibody enzyme linked immunosorbent assays

    Wu, John T.Y.; Dreger, Sally; Chow, Eva Y.W.; Bowlby, Evelyn E.


    Abstract This is a validation study of 2 commercially available enzyme linked immunosorbent assays (ELISA) for the detection of antibodies against Neospora caninum in bovine serum. The results of the reference sera (n = 30) and field sera from an infected beef herd (n = 150) were tested by both ELISAs and the results were compared statistically. When the immunoblotting results of the reference bovine sera were compared to the ELISA results, the same identity score (96.67%) and kappa values (K) (0.93) were obtained for both ELISAs. The sensitivity and specificity values for the IDEXX test were 100% and 93.33% respectively. For the Biovet test 93.33% and 100% were obtained. The corresponding positive (PV+) and negative predictive (PV−) values for the 2 assays were 93.75% and 100% (IDEXX), and 100% and 93.75% (Biovet). In the 2nd study, competitive inhibition ELISA (c-ELISA) results on bovine sera from an infected herd were compared to the 2 sets of ELISA results. The identity scores of the 2 ELISAs were 98% (IDEXX) and 97.33% (Biovet). The K values calculated were 0.96 (IDEXX) and 0.95 (Biovet). For the IDEXX test the sensitivity and specificity were 97.56% and 98.53%, whereas for the Biovet assay 95.12% and 100% were recorded, respectively. The corresponding PV+ and PV− values were 98.77% and 97.1% (IDEXX), and 100% and 94.44% (Biovet). Our validation results showed that the 2 ELISAs worked equally well and there was no statistically significant difference between the performance of the 2 tests. Both tests showed high reproducibility, repeatability and substantial agreement with results from 2 other laboratories. A quality assurance based on the requirement of the ISO/IEC 17025 standards has been adopted throughout this project for test validation procedures. PMID:12418782

  10. Diagnosis of Zika Virus Infection by Peptide Array and Enzyme-Linked Immunosorbent Assay

    Nischay Mishra


    Full Text Available Zika virus (ZIKV is implicated in fetal stillbirth, microcephaly, intracranial calcifications, and ocular anomalies following vertical transmission from infected mothers. In adults, infection may trigger autoimmune inflammatory polyneuropathy. Transmission most commonly follows the bite of infected Aedes mosquitoes but may also occur through sexual intercourse or receipt of blood products. Definitive diagnosis through detection of viral RNA is possible in serum or plasma within 10 days of disease onset, in whole blood within 3 weeks of onset, and in semen for up to 3 months. Serological diagnosis is nonetheless critical because few patients have access to molecular diagnostics during the acute phase of infection and infection may be associated with only mild or inapparent disease that does not prompt molecular testing. Serological diagnosis is confounded by cross-reactivity of immune sera with other flaviviruses endemic in the areas where ZIKV has recently emerged. Accordingly, we built a high-density microarray comprising nonredundant 12-mer peptides that tile, with one-residue overlap, the proteomes of Zika, dengue, yellow fever, West Nile, Ilheus, Oropouche, and chikungunya viruses. Serological analysis enabled discovery of a ZIKV NS2B 20-residue peptide that had high sensitivity (96.0% and specificity (95.9% versus natural infection with or vaccination against dengue, chikungunya, yellow fever, West Nile, tick-borne encephalitis, or Japanese encephalitis virus in a microarray assay and an enzyme-linked immunosorbent assay (ELISA of early-convalescent-phase sera (2 to 3 weeks after onset of symptomatic infection.

  11. Phytochrome quantitation in crude extracts of Avena by enzyme-linked immunosorbent assay with monoclonal antibodies

    Shimazaki, Y; Cordonnier, M M; Pratt, L H


    An enzyme-linked immunosorbent assay (ELISA), which uses both rabbit polyclonal and mouse monoclonal antibodies to phytochrome, has been adapted for quantitation of phytochrome in crude plant extracts. The assay has a detection limit of about 100 pg phytochrome and can be completed within 10 h. Quantitation of phytochrome in crude extracts of etiolated oat seedlings by ELISA gave values that agreed well with those obtained by spectrophotometric assay. When etiolated oat seedlings were irradiated continuously for 24 h, the amount of phytochrome detected by ELISA and by spectrophotometric assay decreased by more than 1000-fold and about 100-fold, respectively. This discrepancy indicates that phytochrome in light-treated plants may be antigenically distinct from that found in fully etiolated plants. When these light-grown oat seedlings were kept in darkness for 48 h, phytochrome content detected by ELISA increased by 50-fold in crude extracts of green oat shoots, but only about 12-fold in extracts of herbicide-treated oat shoots. Phytochrome reaccumulation in green oat shoots was initially more rapid in the more mature cells of the primary leaf tip than near the basal part of the shoot. The inhibitory effect of Norflurazon on phytochrome accumulation was much more evident near the leaf tip than the shoot base. A 5-min red irradiation of oat seedlings at the end of a 48-h dark period resulted in a subsequent, massive decrease in phytochrome content in crude extracts from both green and Norflurazon-bleached oat shoots. These observations eliminate the possibility that substantial accumulation of chromophore-free phytochrome was being detected and indicate that Norflurazon has a substantial effect on phytochrome accumulation during a prolonged dark period. 25 references, 9 figures, 3 tables.

  12. Assessment of Dextran Antigenicity of Intravenous Iron Preparations with Enzyme-Linked Immunosorbent Assay (ELISA).

    Neiser, Susann; Koskenkorva, Taija S; Schwarz, Katrin; Wilhelm, Maria; Burckhardt, Susanna


    Intravenous iron preparations are typically classified as non-dextran-based or dextran/dextran-based complexes. The carbohydrate shell for each of these preparations is unique and is key in determining the various physicochemical properties, the metabolic pathway, and the immunogenicity of the iron-carbohydrate complex. As intravenous dextran can cause severe, antibody-mediated dextran-induced anaphylactic reactions (DIAR), the purpose of this study was to explore the potential of various intravenous iron preparations, non-dextran-based or dextran/dextran-based, to induce these reactions. An IgG-isotype mouse monoclonal anti-dextran antibody (5E7H3) and an enzyme-linked immunosorbent assay (ELISA) were developed to investigate the dextran antigenicity of low molecular weight iron dextran, ferumoxytol, iron isomaltoside 1000, ferric gluconate, iron sucrose and ferric carboxymaltose, as well as isomaltoside 1000, the isolated carbohydrate component of iron isomaltoside 1000. Low molecular weight iron dextran, as well as dextran-based ferumoxytol and iron isomaltoside 1000, reacted with 5E7H3, whereas ferric carboxymaltose, iron sucrose, sodium ferric gluconate, and isolated isomaltoside 1000 did not. Consistent results were obtained with reverse single radial immunodiffusion assay. The results strongly support the hypothesis that, while the carbohydrate alone (isomaltoside 1000) does not form immune complexes with anti-dextran antibodies, iron isomaltoside 1000 complex reacts with anti-dextran antibodies by forming multivalent immune complexes. Moreover, non-dextran based preparations, such as iron sucrose and ferric carboxymaltose, do not react with anti-dextran antibodies. This assay allows to assess the theoretical possibility of a substance to induce antibody-mediated DIARs. Nevertheless, as this is only one possible mechanism that may cause a hypersensitivity reaction, a broader set of assays will be required to get an understanding of the mechanisms that may

  13. Serum biotin in Japanese children: Enzyme-linked immunosorbent assay measurement.

    Wakabayashi, Kenji; Kodama, Hiroko; Ogawa, Eishin; Sato, Yasuhiro; Motoyama, Kahoko; Suzuki, Mitsuyoshi


    Biotin deficiency has been reported in Japanese infants fed special formulas for medical reasons, including those with milk allergy and congenital metabolic diseases, because these formulas contain little biotin. Serum biotin measurement is useful for diagnosing biotin deficiency. We applied a simple and rapid method to analyze serum biotin, and established normal ranges for children and adults. Serum biotin in 188 healthy Japanese children aged 0-4 years and in 25 healthy adults was analyzed using a Biotin ELISA Kit (immundiagnostik). The effects of various conditions on the measurement of serum biotin were also examined. Median biotin in children aged 0-4 years was 10.4 ng/dL (IQR, 7.9-13.4 ng/dL), and that in adults was 12.9 ng/dL (IQR, 10.8-15.8 ng/dL). Normal range was 4.7-22.0 ng/dL in children and 8.4-20.5 ng/dL in adults (calculated using two-sided 95%CI). Measurements obtained with this method were not affected by frozen storage, freeze-thaw, or hemolysis, indicating that serum biotin can be analyzed accurately under these conditions, with a possible application to plasma samples. Serum biotin was significantly lower in children than in adults, with the normal range being 4.7-22.0 ng/dL in children and 8.4-20.5 ng/dL in adults. This simple and accurate enzyme-linked immunosorbent assay method is useful for diagnosing biotin deficiency. © 2016 The Authors. Pediatrics International published by John Wiley & Sons Australia, Ltd on behalf of Japan Pediatric Society.

  14. Development of Two Antibody Detection Enzyme-Linked Immunosorbent Assays for Serodiagnosis of Human Chronic Fascioliasis

    Cabán-Hernández, Kimberly; Gaudier, José F.; Ruiz-Jiménez, Caleb


    Coprological examination based on egg detection in stool samples is currently used as the gold standard for the diagnosis of human fascioliasis. However, this method is not effective during the acute phase of the disease and has poor sensitivity during the chronic phase. Serodiagnosis has become an excellent alternative to coprological examination in efforts to combat the effects of fascioliasis on human and animal health. Two novel recombinant Fasciola hepatica proteins, i.e., a ferritin (FhFtn-1) and a tegument-associated protein (FhTP16.5), were used as antigens to develop in-house enzyme-linked immunosorbent assay (ELISA) methods. The assays were optimized and validated using 152 serum samples from humans with a known infection status, including healthy subjects, patients with chronic fascioliasis, and patients with other parasitic diseases. The FhFtn-1 ELISA was shown to be 96.6% sensitive and 95.7% specific; the respective parameters for the FhTP16.5 ELISA were 91.4% and 92.4%. The performances of the FhFtn-1 and FhTP16.5 ELISAs were compared with that of an available commercial test (the DRG test) using a subset of serum samples. Our in-house tests were slightly more sensitive than the DRG test in detecting antibodies against F. hepatica, but the differences were not statistically significant. In conclusion, the present study provides evidence for the potential of the FhFtn-1 and FhTP16.5 ELISAs as diagnostic tools for human fascioliasis, as might be implemented in conjunction with standard assays for large-scale screenings in areas where the disease is endemic and for the detection of occasional cases in clinical laboratories. PMID:24353000

  15. Development of two antibody detection enzyme-linked immunosorbent assays for serodiagnosis of human chronic fascioliasis.

    Cabán-Hernández, Kimberly; Gaudier, José F; Ruiz-Jiménez, Caleb; Espino, Ana M


    Coprological examination based on egg detection in stool samples is currently used as the gold standard for the diagnosis of human fascioliasis. However, this method is not effective during the acute phase of the disease and has poor sensitivity during the chronic phase. Serodiagnosis has become an excellent alternative to coprological examination in efforts to combat the effects of fascioliasis on human and animal health. Two novel recombinant Fasciola hepatica proteins, i.e., a ferritin (FhFtn-1) and a tegument-associated protein (FhTP16.5), were used as antigens to develop in-house enzyme-linked immunosorbent assay (ELISA) methods. The assays were optimized and validated using 152 serum samples from humans with a known infection status, including healthy subjects, patients with chronic fascioliasis, and patients with other parasitic diseases. The FhFtn-1 ELISA was shown to be 96.6% sensitive and 95.7% specific; the respective parameters for the FhTP16.5 ELISA were 91.4% and 92.4%. The performances of the FhFtn-1 and FhTP16.5 ELISAs were compared with that of an available commercial test (the DRG test) using a subset of serum samples. Our in-house tests were slightly more sensitive than the DRG test in detecting antibodies against F. hepatica, but the differences were not statistically significant. In conclusion, the present study provides evidence for the potential of the FhFtn-1 and FhTP16.5 ELISAs as diagnostic tools for human fascioliasis, as might be implemented in conjunction with standard assays for large-scale screenings in areas where the disease is endemic and for the detection of occasional cases in clinical laboratories.

  16. Two new automated, compared with two enzyme-linked immunosorbent, antimüllerian hormone assays.

    Nelson, Scott M; Pastuszek, Ewa; Kloss, Grzegorz; Malinowska, Iwona; Liss, Joanna; Lukaszuk, Aron; Plociennik, Lukasz; Lukaszuk, Krzysztof


    To compare new automated antimüllerian hormone (AMH) assay performance characteristics from the new automated Elecsys AMH (Roche; Elecsys) and Access AMH (Beckman Coulter; Access) assays with the existing AMH Gen II ELISA (enzyme-linked immunosorbent assay; Gen II; Beckman Coulter) and AMH ELISA (Ansh Labs) assays. Prospective assay evaluation. University-affiliated clinical chemistry laboratory. Patients referred for serum AMH measurement (n = 83) before start of in vitro fertilization cycle between September 2014 and October 2014. None. Serum AMH concentration. Intra-assay coefficients of variation were low; Ansh ≤ 9.0%; Gen II ≤ 5.8%; Access ≤ 10.7%; and Elecsys ≤ 2.8%. The Passing-Bablok regression equations (pmol/L) were y (Access) = 0.128 + (0.781 × Gen II); and y (Access) = 0.302 + (0.742 x Ansh). For y (Elecys) = 0.087 + (0.729 x Gen II) and y (Elecys) = 0.253 + (0.688 x Ansh Labs). For y (Elecys) = 0.943 - (0.037 × Access). For all the assays, AMH exhibited a moderate positive correlation with AFC (r = 0.62-0.64); number of cumulus oocyte complexes (r = 0.60-0.64); and metaphase II oocytes (r = 0.48-0.50). Accuracy of pregnancy prediction, as determined by area under the receiver operating characteristic curve, was uniformly low for all assays (0.62-0.63). The novel automated assays exhibit strong concordance in calibration, but derived values are substantially lower than those obtained from pre-existing assays, with assay-specific interpretation required for routine clinical use. These results highlight the need for an international standard of measurement of AMH. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  17. Optimized enzyme-linked immunosorbent assay for detecting cytomegalovirus infections during clinical trials of recombinant vaccines.

    Pagnon, Anke; Piras, Fabienne; Gimenez-Fourage, Sophie; Dubayle, Joseline; Arnaud-Barbe, Nadège; Hessler, Catherine; Caillet, Catherine


    In clinical trials of cytomegalovirus (CMV) glycoprotein B (gB) vaccines, CMV infection is detected by first depleting serum of anti-gB antibodies and then measuring anti-CMV antibodies with a commercially available enzyme-linked immunosorbent assay (ELISA) kit, with confirmation of positive findings by immunoblot. Identification of CMV immunoantigens for the development of an ELISA that detects specifically CMV infection in clinical samples from individuals immunized with gB vaccines. Sensitivity and specificity of ELISAs using antigenic regions of CMV proteins UL83/pp65, UL99/pp28, UL44/pp52, UL80a/pp38, UL57, and UL32/pp150 were measured. An IgG ELISA using a UL32/pp150 [862-1048] capture peptide was the most specific (93.7%) and sensitive (96.4%) for detecting CMV-specific antibodies in sera. The ELISA successfully detected CMV-specific antibodies in 22 of 22 sera of subjects who had been vaccinated with a gB vaccine but who had later been infected with CMV. The ELISA was linear over a wide range of CMV concentrations (57-16,814 ELISA units/mL) and was reproducible as indicated by a 5% intra-day and 7% inter-day coefficients of variation. The signal was specifically competed by UL32/pp150 [862-1048] peptide but not by CMV-gB or herpes simplex virus 2 glycoprotein D. Lipid and hemoglobin matrix did not interfere with the assay. The UL32/pp150 [862-1048] IgG ELISA can be used for the sensitive and specific detection of CMV infection in gB-vaccinated individuals. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Enzyme linked immunosorbent assay for detecting antibody to Trichomonas vaginalis: use of whole cells and aqueous extract as antigen.

    Alderete, J F


    An enzyme linked immunosorbent assay (ELISA) for detecting antibody to antigenic Trichomonas vaginalis macromolecules has been identified using whole cells or an aqueous protein extract as antigen. The test was developed under optimum conditions using serum samples from experimental animals. The sensitivity of the ELISA was equal to or greater than that obtained by radioimmunoprecipitation and electrophoresis-fluorography techniques. The ELISA was capable of assessing antibody responses durin...

  19. Differentiation of ruminal bacterial species by enzyme-linked immunosorbent assay using egg yolk antibodies from immunized chicken hens.

    Ricke, S C; Schaefer, D M; Cook, M E; Kang, K H


    Cross-reactivity among four species of ruminal bacteria was examined by using egg yolk antibodies from immunized Leghorn laying hens and an enzyme-linked-immunosorbent assay. The effects of the four species on the hens were compared on various days postimmunization. Hens injected with the same bacterial species had similar apparent antibody levels over the entire postimmunization period, but only Bacteroides ruminicola B1(4) and Selenomonas ruminantium D antigens elicited early increases in a...

  20. Identification of a Vesicular-Arbuscular Mycorrhizal Fungus by Using Monoclonal Antibodies in an Enzyme-Linked Immunosorbent Assay †

    Wright, Sara F.; Morton, Joseph B.; Sworobuk, Janis E.


    Spore morphology is currently used to identify species of vesicular-arbuscular mycorrhizal fungi. We report the first use of a highly specific immunological method for identification of a vesicular-arbuscular mycorrhizal fungus. Two monoclonal antibodies were produced against Glomus occultum. Monoclonal antibodies reacted strongly with both spores and hyphae in an indirect enzyme-linked immunosorbent assay. All other mycorrhizal (29 species) and nonmycorrhizal (5 species) fungi tested were no...

  1. Immunodiagnosis of Human Fascioliasis by an Enzyme-Linked Immunosorbent Assay (ELISA) and a Micro-ELISA

    Carnevale, Silvana; Rodríguez, Mónica I.; Santillán, Graciela; Labbé, Jorge H.; Cabrera, Marta G.; Bellegarde, Enrique J.; Velásquez, Jorge N.; Trgovcic, Jorge E.; Guarnera, Eduardo A.


    Enzyme-linked immunosorbent assay (ELISA) and micro-ELISA were evaluated for their ability to detect anti-Fasciola hepatica antibodies in humans by using excretory-secretory antigen. The sensitivity of each method was 100%, but the specificity was 100% for ELISA and 97% for micro-ELISA. The micro-ELISA could be used as a screening assay and ELISA could be used as a confirmatory method for the serodiagnosis of human fascioliasis.

  2. Development of an enzyme-linked immunosorbent assay for residue analysis of the insecticide emamectin benzoate in agricultural products.

    Kondo, Mika; Yamashita, Hiroshi; Uchigashima, Mikiko; Kono, Takeshi; Takemoto, Toshihide; Fujita, Masahiro; Saka, Machiko; Iwasa, Seiji; Ito, Shigekazu; Miyake, Shiro


    A direct competitive enzyme-linked immunosorbent assay (dc-ELISA) for the analysis of emamectin residues in agricultural products was developed using a prepared mouse monoclonal antibody. The working range was 0.3-3.0 ng/mL, and the 50% inhibition concentration (IC(50)) was 1.0 ng/mL. The assay was sufficiently sensitive for analysis of the maximum residue limits in agricultural products in Japan (>0.1 microg/g). Emamectin residues contain the following metabolites: the 4''-epi-amino analogue, the 4''-epi-(N-formyl)amino analogue, the 4''-epi-(N-formyl-N-methyl)amino analogue, and the 8,9-Z isomer. The dc-ELISA reacted with these compounds at ratios of 113, 55, 38, and 9.1% of the IC(50) value of emamectin benzoate. Seven kinds of vegetables were spiked with emamectin benzoate at concentrations of 15-300 ng/g, and the recoveries were 91-117% in the dc-ELISA. The dc-ELISA results agreed reasonably well with results obtained by liquid chromatography-tandem mass spectrometry (LC-MS/MS) using spiked samples and actual (incurred) samples. The results indicate that the dc-ELISA was useful for the analysis of emamectin benzoate residues in agricultural products.

  3. Enzyme linked immunosorbent assay for detecting antibody to Trichomonas vaginalis: use of whole cells and aqueous extract as antigen.

    Alderete, J F


    An enzyme linked immunosorbent assay (ELISA) for detecting antibody to antigenic Trichomonas vaginalis macromolecules has been identified using whole cells or an aqueous protein extract as antigen. The test was developed under optimum conditions using serum samples from experimental animals. The sensitivity of the ELISA was equal to or greater than that obtained by radioimmunoprecipitation and electrophoresis-fluorography techniques. The ELISA was capable of assessing antibody responses during the development of lesions in animals inoculated subcutaneously and it reproducibly measured the individual classes immunoglobulins directed at T vaginalis. The colorimetric assay was also suitable for showing cross reactivity between trichomonal species as well as between different strains of T vaginalis. Conditions established for monitoring antibody to trichomanads in immunised rabbits or infected mice were equally effective for human materials, such as serum or vaginal washes. Serum from experimental animals or infected people showed high concentrations of IgG, IgA, and IgM antibody to trichomonads. Only antibodies of the IgG and IgA class were detected in vaginal washes from women with acute trichomoniasis. No IgE antibody to trichomonads was found under a variety of conditions in serum samples from patients or experimental animals.

  4. Parameters for measurement of oxidative stress in diabetes mellitus: applicability of enzyme-linked immunosorbent assay for clinical evaluation.

    Noiri, Eisei; Tsukahara, Hirokazu


    Investigations of the mechanisms involved in the onset and progression of diabetes have recently confronted the role of reactive oxygen species (ROS) and oxidative stress. Prolonged exposure to hyperglycemic conditions induces nonenzymatic glycation of protein via the so-called Maillard reaction, resulting in Schiff-base products and Amadori products that engender ROS production. These processes initiate and exacerbate micro- and macrovascular complications in diabetes. Increased oxidative stress is induced by excessive ROS production and inadequate antioxidant defenses. Recently, oxidative stress status markers have been associated directly with the severity and prognosis of diabetes. To examine oxidative stress, reliable and high-throughput methods are needed to examine large numbers of clinical samples. The emerging availability of enzyme-linked immunosorbent assay (ELISA) for oxidative stress status markers allows its application to assessment of various pathophysiologic conditions, including diabetes. This review outlines the recent achievements of ELISA application for clinical studies elucidating oxidative stress. It introduces the potential applicability of ELISA for investigating oxidative stress in diabetes.

  5. Detection of Francisella tularensis-Specific Antibodies in Patients with Tularemia by a Novel Competitive Enzyme-Linked Immunosorbent Assay

    Sharma, Neekun; Hotta, Akitoyo; Yamamoto, Yoshie; Fujita, Osamu; Uda, Akihiko; Morikawa, Shigeru; Yamada, Akio


    A novel competitive enzyme-linked immunosorbent assay (cELISA) was developed and evaluated for detection of antibodies against Francisella tularensis in humans. The assay is based on the ability of serum antibodies to inhibit the binding of monoclonal antibodies (MAbs) directed against F. tularensis lipopolysaccharide antigens. The assay was evaluated using serum samples of tularemia patients, inactivated F. tularensis-immunized rabbits, and F. tularensis-infected mice. Antibodies against F. tularensis were successfully detected in serum samples of tularemia patients as well as the immunized and infected animals. The cELISA method was compared to indirect ELISA (iELISA) and the commonly used microagglutination test (MA) using serum samples of 19 tularemia patients and 50 healthy individuals. The sensitivity and specificity of cELISA were 93.9 and 96.1%, respectively, in comparison to the iELISA. MA was less sensitive than cELISA with a sensitivity and specificity of only 81.8 and 98.0%, respectively. A high degree of correlation (R2 = 0.8226) was observed between cELISA and iELISA results. The novel cELISA developed in this study appears to be highly sensitive and specific for serodiagnosis of human tularemia. The potential of the MAb-based cELISA to be used in both human and animal samples emphasizes its usefulness for serological survey of tularemia among multiple animal species. PMID:23114700

  6. Environmental Technology Verification Report for Abraxis Ecologenia® 17β-Estradiol (E2) Microplate Enzyme-Linked Immunosorbent Assay (ELISA) Test Kits

    This verification test was conducted according to procedures specifiedin the Test/QA Planfor Verification of Enzyme-Linked Immunosorbent Assay (ELISA) Test Kis for the Quantitative Determination of Endocrine Disrupting Compounds (EDCs) in Aqueous Phase Samples. Deviations to the...

  7. Enzyme-linked immunosorbent assay for total sennosides using anti-sennside A and anti-sennoside B monoclonal antibodies.

    Morinaga, Osamu; Uto, Takuhiro; Sakamoto, Seiichi; Tanaka, Hiroyuki; Shoyama, Yukihiro


    Total sennosides concentration is a very important factor when rhubarb and senna will be used as crude drugs. However, one-step analytical technique for total sennosides has not been reported except HPLC. An enzyme-linked immunosorbent assay (ELISA) for total sennosides concentration by using the combination of anti-sennoside A (SA) and anti-sennoside B (SB) monoclonal antibodies (MAbs) in a single assay has been investigated. Total sennosides concentration in rhubarb and senna samples determined by newly developed assay system showed good agreement with those analyzed by ELISA using anti-SA MAb and anti-SB MAb, respectively.

  8. Serodiagnosis of cutaneous leishmaniasis: assessment of an enzyme-linked immunosorbent assay using a peptide sequence from gene B protein

    Jensen, A T; Gaafar, A; Ismail, A


    An enzyme-linked immunosorbent assay (ELISA) using a 28 amino acid sequence of the repetitive element of gene B protein (GBP) from Leishmania major was developed for serodiagnosis of cutaneous leishmaniasis (CL). The assay was compared to ELISAs using crude amastigote and promastigote antigens from...... samples from healthy Sudanese individuals living in an area endemic for malaria but free of leish-maniasis were negative in all the assays. Significantly higher levels of antibodies were found in the patients who had suffered from the disease for more than eight weeks than in patients with a shorter...

  9. Evaluation of immunofluorescence microscopy and enzyme-linked immunosorbent assay in detection of Cryptosporidium and Giardia infections in asymptomatic dogs

    Rimhanen-Finne, R.; Enemark, Heidi L.; Kolehmainen, J.


    The performance of immunofluorescence microscopy (IF) and enzyme-linked immunosorbent assay (ELISA) in canine feces was evaluated. IF and Cryptosporidium ELISA detected 10(5) oocysts/g, while the detection limit for Giardia ELISA was 10(4) cysts/g. The Cryptosporidium ELISA showed 94% specificity...... zoonotic character of Cryptosporidium and Giardia infections in 150 asymptomatic Finnish dogs from the Helsinki area were studied. The overall proportion of dogs positive for Cryptosporidium was 5% (7/150) and that for Giardia 5% (8/150). In dogs...

  10. Thermometric enzyme linked immunosorbent assay in continuous flow system: optimization and evaluation using human serum albumin as a model system.

    Borrebaeck, C; Börjeson, J; Mattiasson, B


    Thermometric enzyme-linked immunosorbent assay (TELISA) is described. After the procedure of optimization, human serum albumin was assayed using anti-human serum albumin bound to Sepharose CL 4-B in the enzyme thermistor unit and catalase as label on the free antigen. The model system was used for assays down to 10(-13)M and the preparation of immobilized antibodies was used repeatedly up to 100 times. Comparative studies of the TELISA technique with bromocresol green, immunoturbidimetric and rocket immunoelectrophoretic methods were carried out and showed that TELISA could be used as an alternative method.

  11. Quantification of methanogenic biomass by enzyme-linked immunosorbent assay and by analysis of specific methanogenic cofactors

    Gorris, L G.M.; Kemp, H A; Archer, D B


    The reliability and accuracy with which enzyme-linked immunosorbent assay (ELISA) and an assay of methanogenic cofactors detect and quantify methanogenic species were investigated. Both assays required standardization with laboratory cultures of methanogenic bacteria and were applied to mixtures of pure cultures and samples from anaerobic digesters. ELISA was shown to be a simple method for detecting and quantifying individual methanogenic species. The range of species which can be assayed is limited by the range of antisera available but, potentially, ELISA can be applied to all methanogens. Although the cofactor assay is not species-specific it can distinguish hydrogenotrophic and acetotrophic methanogens and is quantitative.

  12. Micro-enzyme-linked immunosorbent assay (ELISA) and radioimmunosorbent technique (RIST) for the detection of immunity to clinical tetanus

    Layton, G T [Royal Infirmary, Manchester (UK)


    Enzyme-linked immunosorbent assay (ELISA), and radioimmunosorbent assay (RIST) techniques for the detection of tetanus toxin antibodies are described. Both methods proved to be highly sensitive, and allowed the measurement of 5 x 10/sup -3/ units/ml tetanus antitoxin in human serum or plasma, sensitivity and reproducibility comparing well with other techniques previously described, and being superior to haemagglutination and latex agglutination tests. Results of the two methods correlated well, and reflected the immunization histories obtained. Micro ELISA and micro RIST would seem to be suitable for the detection of immunity, or non-immunity to clinical tetanus.

  13. A micro-enzyme-linked immunosorbent assay (ELISA) and radioimmunosorbent technique (RIST) for the detection of immunity to clinical tetanus

    Layton, G.T.


    Enzyme-linked immunosorbent assay (ELISA), and radioimmunosorbent assay (RIST) techniques for the detection of tetanus toxin antibodies are described. Both methods proved to be highly sensitive, and allowed the measurement of 5 x 10 -3 units/ml tetanus antitoxin in human serum or plasma, sensitivity and reproducibility comparing well with other techniques previously described, and being superior to haemagglutination and latex agglutination tests. Results of the two methods correlated well, and reflected the immunization histories obtained. Micro ELISA and micro RIST would seem to be suitable for the detection of immunity, or non-immunity to clinical tetanus. (author)

  14. Evaluation of a covalent mix-enzyme linked immunosorbent assay for screening of Salmonella antibodies in pig serum

    Chow, E.Y.W.; Wu, J.T.Y.; Jauho, E.S.


    In this study, a commercial Salmonella covalent mix-enzyme linked immunosorbent assay (ELISA) for serological detection of Salmonella infection in swine was evaluated by comparing it with the conventional fecal culture method and inter-laboratory proficiency testing, using a panel of sera tested.......9% tested negative. The interlaboratory comparison study found a kappa value of 0.9 between our laboratory (using an automated system) and the manufacturer laboratory (using the manual method). Comparison of ELISA results from all 5 participating laboratories showed very good to excellent agreement, between...

  15. Enzyme-linked immunosorbent assay characterization of Basal variation and heritability of systemic microfibrillar-associated protein 4

    Sækmose, Susanne Gjørup; Schlosser, Anders; Holst, René


    Microfibrillar-associated protein 4 (MFAP4) is a systemic biomarker that is significantly elevated in samples from patients suffering from hepatic cirrhosis. The protein is generally localized to elastic fibers and other connective tissue fibers in the extracellular matrix (ECM), and variation...... in systemic MFAP4 (sMFAP4) has the potential to reflect diverse diseases with increased ECM turnover. Here, we aimed to validate an enzyme-linked immunosorbent assay (ELISA) for the measurement of sMFAP4 with an emphasis on the robustness of the assay. Moreover, we aimed to determine confounders influencing...

  16. Comparison of four functionalization methods of gold nanoparticles for enhancing the enzyme-linked immunosorbent assay (ELISA

    Paula Ciaurriz


    Full Text Available The enzyme-linked immunosorbent assay (ELISA technique is based on the specific recognition ability of the molecular structure of an antigen (epitope by an antibody and is likely the most important diagnostic technique used today in bioscience. With this methodology, it is possible to diagnose illness, allergies, alimentary fraud, and even to detect small molecules such as toxins, pesticides, heavy metals, etc. For this reason, any procedures that improve the detection limit, sensitivity or reduce the analysis time could have an important impact in several fields. In this respect, many methods have been developed for improving the technique, ranging from fluorescence substrates to methods for increasing the number of enzyme molecules involved in the detection such as the biotin–streptavidin method. In this context, nanotechnology has offered a significant number of proposed solutions, mainly based on the functionalization of nanoparticles from gold to carbon which could be used as antibody carriers as well as reporter enzymes like peroxidase. However, few works have focused on the study of best practices for nanoparticle functionalization for ELISA enhancement. In this work, we use 20 nm gold nanoparticles (AuNPs as a vehicle for secondary antibodies and peroxidase (HRP. The design of experiments technique (DOE and four different methods for biomolecule loading were compared using a rabbit IgG/goat anti-rabbit IgG ELISA model (adsorption, directional, covalent and a combination thereof. As a result, AuNP probes prepared by direct adsorption were the most effective method. AuNPs probes were then used to detect gliadin, one of the main components of wheat gluten, the protein composite that causes celiac disease. With this optimized approach, our data showed a sensitivity increase of at least five times and a lower detection limit with respect to a standard ELISA of at least three times. Additionally, the assay time was remarkably decreased.

  17. Methodology for determination of plasma cortisol in fish using Competitive Enzyme-Linked Immunosorbent Assay (ELISA)

    Velasco-Santamaría, Yohana M.; Cruz-Casallas, Pablo E.


    Objective. To determine plasma cortisol procedure in fish using competitive enzymelinked immunosorbent assay (ELISA). Materials and methods. Two plasma samples of juveniles rainbow trout Oncorhynchus mykiss were analized by using ELISA human kit for cortisol assay. For standard curve calibration...

  18. Diagnosis of selected tropical diseases (Shistosomiasis and Malaria) using the enzyme-linked immunosorbent assays

    Chembe, E.


    Immunological reactions are commonly used in diagnostic procedures on the basis of their high levels of specificity and sensitivity. Antibodies or antigens labelled with various markers have been found to be particularly useful for assays of logical substances. The applications of Enzyme-Linked Immunoabsorbent Assays (ELISA) to research on various tropical and non-tropical diseases is now well established. The procedure depends on the labelling of one of the reactants with enzymes which can be detected accurately by an appropriate substrate. The detection mechanism depends on the labelling of one of the reactants in such a way that their their reactivity is not impaired or affected. In the present study, ELISA was applied to sera from kampumbu area of Isoka district in the Northern province of Zambia. The objective of this presentation is to show the relative positivity rate for antigen and antibody and the endemicity of schistosomiasis and malaria as assessed by classical parasitological procedures. (author)

  19. Evaluation of a commercially available enzyme-linked immunosorbent assay for the diagnosis of canine sarcoptic mange.

    Curtis, C F


    This study was designed to assess the accuracy of a commercial enzyme-linked immunosorbent assay for the diagnosis of canine scabies. Serum samples from 37 dogs were examined blind; 12 had sarcoptic mange confirmed by the identification of mites in skin scrapings, 12 were atopic (with positive intradermal reactions to one or more aeroallergens, including Dermatophagoides farinae), and 13 were healthy dogs with no history of skin disease. Optical density values of more than 0.16 were considered positive, 0.145 to 0.16 were considered questionable and less than 0.145 were considered negative. Ten of the 12 dogs with scabies were positive, all 12 atopic dogs were negative, and 11 of the 13 healthy dogs were negative and two were questionable.

  20. Evaluation of an enzyme-linked immunosorbent assay (ELISA) for the serological diagnosis of sarcoptic mange in dogs.

    Lower, K S; Medleau, L M; Hnilica, K; Bigler, B


    Canine scabies is a challenging disease to diagnose because sarcoptic mites are hard to find on skin scrapings. The purpose of this study was to evaluate a serologic enzyme-linked immunosorbent assay (ELISA) as an aid in the diagnosis of canine scabies. In addition, serum samples were obtained post treatment to determine the duration and persistence of circulating scabies antibodies after resolution of natural infection. Nineteen dogs diagnosed with sarcoptic mange and 38 control dogs were tested. Sixteen scabies-infested dogs showed positive pretreatment ELISA results (84.2% sensitivity). Thirty-four control dogs showed negative ELISA results (89.5% specificity). In the 11 scabies dogs from which multiple post treatment serum samples were obtained, detectable antibodies were not present 1 month after treatment in four cases, but were present for 1-4.5 months post treatment in seven dogs. Our results suggest that this scabies ELISA test is useful in the diagnosis of canine scabies.

  1. An improved enzyme-linked immunosorbent assay for whole-cell determination of methanogens in samples from anaerobic reactors

    Sørensen, A.H.; Ahring, B.K.


    An enzyme-linked immunosorbent assay was developed for the detection of whole cells of methanogens in samples from anaerobic continuously stirred tank digesters treating slurries of solid waste. The assay was found to allow for quantitative analysis of the most important groups of methanogens......-quality microtiter plates and the addition of dilute hydrochloric acid to the samples. In an experiment on different digester samples, the test demonstrated a unique pattern of different methanogenic strains present in each sample. The limited preparatory work required for the assay and the simple assay design make...... in samples from anaerobic digesters in a reproducible manner. Polyclonal antisera against eight strains of methanogens were employed in the test, The specificities of the antisera were increased by adsorption with cross-reacting cells. The reproducibility of the assay depended on the use of high...

  2. Seroprevalence of Japanese encephalitis virus using competitive enzyme linked immunosorbent assay (C-ELISA in pigs in East Sumba, Indonesia

    Annytha Detha


    Full Text Available Japanese Encephalitis (JE, a vector-borne zoonotic viral disease, is mostly prevalent in Asian countries. The objective of this study was to investigate the occurence of JE virus (JEV among pigs in East Sumba, Indonesia. Blood samples (n=52 were randomly collected from 52 apparantly healthy pigs where pig population was high in East Sumba. The samples were subjected for seroprevalence study for the presence of antibodies against JEV using competitive enzyme linked immunosorbent assay (C-ELISA. Results showed that 53% (n=28/52 blood samples from the pigs contained antibodies against JEV. This finding is suggestive that the JEV is circulating among pig population in East Sumba, Indonesia. The data may help in designing control strategies of the JEV in the East Sumba, Indonesia.

  3. An enzyme-linked immunosorbent assay (ELISA) for quantification of mouse surfactant protein D (SP-D)

    Hansen, Soren; Schmidt, Vivi; Steffensen, Maria Abildgaard


    characterized and validated for use in sandwich enzyme-linked immunosorbent assay (ELISA). Based on two of these, we established an ELISA that allows for measurements of mouse SP-D in various body fluids. The final ELISA was optimized and calibrated with a standard of purified recombinant mouse SP-D, which......Surfactant protein D (SP-D) is a pattern recognition molecule of the collectin family of C-type lectins. It is found in the airways and at mucosal surfaces. SP-D is part of the innate immune system where it neutralizes and leads to elimination of microorganisms. It regulates the functions of other...... innate immune cells, such as macrophages and neutrophils. It also modulates the adaptive immune response by interacting with antigen-presenting cells and T cells. Monoclonal anti-mouse-SP-D antibodies were raised from SP-D deficient mice using recombinant SP-D as antigen. Ten monoclonal antibodies were...

  4. Immunodiagnosis of fascioliasis using sandwich enzyme-linked immunosorbent assay for detection of Fasciola gigantica paramyosin antigen

    Abou-Elhakam, Hany Mohamed Adel; Bauomy, Ibraheem Rabia; El Deeb, Somaya Osman; El Amir, Azza Mohamed


    Background: Many immunological techniques have been developed over years using the different Fasciola antigens for diagnosis of parasitic infection and to replace the parasitological techniques, which are time consuming and usually lack sensitivity and reproducibility. Materials and Methods: In this study, Fasciola gigantica paramyosin (Pmy) antigen was early detected in cattle sera using sandwich enzyme-linked immunosorbent assay (ELISA), to evaluate the Pmy antigen performance in diagnosis. This work was conducted on 135 cattle blood samples, which were classified according to parasitological investigation into, healthy control (30), fascioliasis (75), and other parasites (30) groups. Results: The sensitivity of Sandwich ELISA was 97.33%, and the specificity was 95%, in comparison with parasitological examination, which recorded 66.66% sensitivity and 100% specificity, respectively. Conclusions: It was clear that the native F. gigantica Pmy is considered as a powerful antigen in early immunodiagnosis of fascioliasis, using a highly sensitive and specific sandwich ELISA technique. PMID:23961441

  5. Definition of purified enzyme-linked immunosorbent assay antigens from the culture filtrate protein of Mycobacterium bovis by proteomic analysis.

    Cho, Yun Sang; Lee, Sang-Eun; Ko, Young Joon; Cho, Donghee; Lee, Hyang Shim; Hwang, Inyeong; Nam, Hyangmi; Heo, Eunjung; Kim, Jong Man; Jung, Sukchan


    Enzyme-linked immunosorbent assay (ELISA) has been developed as the ancillary diagnosis of bovine tuberculosis at ante-mortem to overcome the disadvantages of intradermal skin test. In this study, the antigenic proteins were purified, applied to bTB ELISA, and identified through proteomic analysis. Culture filtrate protein of Mycobacterium bovis was fractionated by MonoQ column chromatography, and examined the antigenicity by immunoblotting. The antigenic 20 kDa protein was in-gel digested and identified the antigenome by LTQ mass spectrometer and peptide match fingerprinting, which were MPB64, MPB70, MPB83, Fas, Smc, Nrp, RpoC, Transposase, LeuA, and MtbE. The 20 kDa protein exhibited the highest antigenicity to bTB positive cattle in ELISA and would be useful for bTB serological diagnosis.

  6. Identification of a vesicular-arbuscular mycorrhizal fungus by using monoclonal antibodies in an enzyme-linked immunosorbent assay.

    Wright, S F; Morton, J B; Sworobuk, J E


    Spore morphology is currently used to identify species of vesicular-arbuscular mycorrhizal fungi. We report the first use of a highly specific immunological method for identification of a vesicular-arbuscular mycorrhizal fungus. Two monoclonal antibodies were produced against Glomus occultum. Monoclonal antibodies reacted strongly with both spores and hyphae in an indirect enzyme-linked immunosorbent assay. All other mycorrhizal (29 species) and nonmycorrhizal (5 species) fungi tested were nonreactive with the monoclonal antibodies. A single spore of G. occultum was detectable in the presence of high numbers of spores of other vesicular-arbuscular mycorrhizal fungi. Variation in the reaction of G. occultum isolates from West Virginia, Florida, and Colombia suggests that monoclonal antibodies may differentiate strains.

  7. Sandwich enzyme-linked immunosorbent assay (ELISA) for measuring the concentration of, and detection of antibodies to, Aujeszky's disease virus.

    Kardi, V; Szegletes, E; Perényi, T; Pergel, I; Smal, Z


    A double antibody sandwich enzyme-linked immunosorbent assay (ELISA) was developed for measuring Aujeszky's disease virus (ADV) antigen concentration and an inhibition technique based on the former was developed for detection of antibodies to ADV. The results were checked by determining the cytopathic and serum neutralization titres. The correlation was satisfactory in both cases, with correlation coefficients above 0.8. When measuring ADV antigen concentration, the lower limit of detection was 10(3) TCID 50/0.2 ml. The sensitivity of ELISA in detecting antibodies to ADV was found to be superior to that of the serum neutralization test and, thus, enabled the testing of rabbit and guinea-pig sera.

  8. Evaluation of Two Commercial Enzyme-Linked Immunosorbent Assay Kits for the Detection of Human Circulating Metrnl.

    Zheng, Si-Li; Li, Zhi-Yong; Zhang, Zheng; Wang, Dong-Sheng; Xu, Jian; Miao, Chao-Yu


    Metrnl is a newly discovered secreted protein with neurotrophic activity and metabolic effect, while in earlier studies its circulating level in human was not explored. We evaluated two commercial enzyme-linked immunosorbent assay kits (DY7867-05, R&D Systems and SK00478-02, Aviscera Bioscience) for the detection of human circulating Metrnl. The DY7867-05 kit showed superiority over the SK00478-02 kit since it generated better curve fitting degree, smaller variation among tests, higher inter-assay reproducibility and better specificity, and could effectively detect human Metrnl in six types of blood samples. Subsequent analysis was performed using the DY7867-05 kit. Sample storage conditions were investigated. No gender difference in circulating Metrnl levels was found, while people with newly diagnosed type 2 diabetes mellitus (T2DM) had significantly lower Metrnl levels compared to the healthy controls.

  9. An enzyme-linked immunosorbent assay (ELISA) for quantification of human collectin 11 (CL-11, CL-K1)

    Selman, L; Henriksen, M L; Brandt, J


    -associated serine protease 1 (MASP-1) and/or MASP-3 in circulation. Mutation in the CL-11 gene was recently associated with the developmental syndrome 3MC. In the present study, we established and thoroughly validated a sandwich enzyme-linked immunosorbent assay (ELISA) based on two different monoclonal antibodies....... The assay is highly sensitive, specific and shows excellent quantitative characteristics such as reproducibility, dilution linearity and recovery (97.7-104%). The working range is 0.15-34 ng/ml. The CL-11 concentration in two CL-11-deficient individuals affected by the 3MC syndrome was determined...... and thawing to a certain extent did not influence the ELISA. This ELISA offers a convenient and reliable method for studying CL-11 levels in relation to a variety of human diseases and syndromes....

  10. Enzyme-linked immunosorbent assays for insulin-like growth factor-I using six-histidine tag fused proteins

    Huang Yong; Shi Ruina; Zhong Xuefei; Wang Dan; Zhao Meiping; Li Yuanzong


    The fusion proteins of insulin-like growth factor-I (IGF-I) and six-histidine tag (IGF-I-6H, 6H-IGF-I-6H) were cloned, expressed, purified and renatured, with their immunoreaction properties and biological activities intact. The binding kinetics between these fusion proteins and anti-IGF-I antibody or anti-6H antibody were studied using surface plasmon resonance (SPR). Two enzyme-linked immunosorbent assay (ELISA) modes, which proved feasible in the measurement of human serum samples, were used to detect IGF-I with the help of the six-histidine tagged proteins. Furthermore, combining the production technique of the six-histidine tagged fusion protein with the competitive sandwich ELISA mode, using an enzyme labeled anti-6H antibody as a tracer, can be a universal immunochemical method to quantitate other polypeptides or proteins

  11. Detection of antibodies to Actinobacillus pleuropneumoniae serotype 12 in pig serum using a blocking enzyme-linked immunosorbent assay

    Andresen, Lars Ole; Klausen, Joan; Barfod, Kristen


    and from herds declared free of infection with Ap. The Ap serotype 12 blocking ELISA showed a herd sensitivity of 0.77 (95% confidence interval, 0.62-0.88) and a herd specificity of 1.00 (0.95-1.00) with a cut-off value at 40% relative absorbance or 60% inhibition. The assay may be used advantageously......The objective was to develop a blocking enzyme-linked immunosorbent assay (ELISA) for detection of antibodies to Actinobacillus pleuropneumoniae (Ap) serotype 12 in pig serum. Lipopolysaccharide (LPS) from Ap serotype 12 was purified and used as antigen in the assay. Antibodies to the LPS antigen...... in samples of pig serum were detected by inhibition of the binding of polyclonal rabbit antibodies raised against Ap serotype 12. The assay was evaluated against sera from experimentally infected pigs, from pig herds naturally infected with Ap and from herds declared free of Ap serotypc 12 infection...

  12. Influenza A plasma and serum virus antibody detection comparison in dogs using blocking enzyme-linked immunosorbent assay

    H. T. Lin


    Full Text Available Background and Aim: The influenza A virus (IAV is an important zoonotic pathogen with infections also reported in dogs. IAV infections can be detected through the presence of antibodies using the enzyme-linked immunosorbent assay (ELISA. Serum is the only standard sample source; however, there is no information on the availability of other sample sources for IAV antibody detection in dogs. Compared with serum, plasma is more widely employed in most animal hospitals. The object of this study is to investigate whether plasma collected in ethylenediaminetetraacetic acid (EDTA tubes (EDTA plasma or heparin tubes (heparin plasma could be used in the ELISA protocol instead of serum for IAV antibody detection in dogs. Materials and Methods: Totally, 82 matched EDTA plasma and serum sample pairs and 79 matched heparin plasma and serum sample pairs were employed using blocking enzyme-linked immunosorbent assay (bELISA. The agreement and correlation between the plasma (EDTA or heparin plasma and serum were assessed using the agreement index kappa (kD calculation and Pearson correlation coefficient, respectively. Results: The agreement index kD of EDTA plasma and serum was 1.0, and that of heparin plasma and serum was 0.85. The Pearson correlation coefficient of EDTA plasma and serum was 0.87 (p<0.01, and that of heparin plasma and serum was 0.82 (p<0.01. Conclusion: The results proved that plasma, especially EDTA plasma, could be substituted for serum in the bELISA test. This might greatly expand the clinical applicability of IAV antibody detection in dogs.

  13. Dot enzyme-linked immunosorbent assay (ELISA) for the detection of Toxocara infection using a rat model.

    Paller, Vachel Gay V; Besana, Cyrelle M; Valdez, Isabel Kristine M


    Toxocariasis is a zoonotic disease usually caused by dog and cat roundworms, Toxocara canis and T. cati. Detection and diagnosis is difficult in paratenic and accidental hosts, including humans, as they cannot be detected through conventional methods such as fecal examination. Diagnosis therefore relies on immunological methods and molecular methods such as enzyme-linked immunosorbent assay (ELISA) and Western Blot, which are both time-consuming and requires sophisticated equipment. In the Philippines, only a few studies are available on Toxocara seroprevalence. Therefore, there is a need to adapt methods for serodiagnosis of Toxocara infection in humans for the Philippine setting. A dot enzyme linked immunosorbent assay (dot-ELISA) was standardized using T. canis excretory-secretory antigens. Test sera were collected from laboratory rats (Sprague-Dawley strain) experimentally infected with embryonated eggs of T. canis and Ascaris suum as well as rice field rats naturally infected with Taenia taeniaeformis and Nippostrongylus sp. Optimum conditions used were 20 µg/ml antigen concentration and 1:10 serum dilution. The sensitivity, specificity, positive, and negative predictive values were 90% (95% CI 55.5-99.7%), 100% (95% CI 69.2-100.0%), 100% (95% CI 66.4-100%), and 90.9% (95% CI 58.7-99.8%), respectively. Dot-ELISA has the potential to be developed as a cheaper, simpler, and more practical method for detection of anti- Toxocara antibodies on accidental hosts. This is a preliminary study conducted on experimental animals before optimization and standardization for human serum samples.

  14. Evaluation of guppy (Poecilia reticulata Peters) immunization against Tetrahymena sp. by enzyme-linked immunosorbent assay (ELISA).

    Sharon, Galit; Nath, Pulak R; Isakov, Noah; Zilberg, Dina


    Analysis of the effectiveness of guppy (Poecilia reticulata Peters) immunization based on measurements of antibody (Ab) titers suffers from a shortage of reagents that can detect guppy antibodies (Abs). To overcome this problem, we immunized mice with different preparations of guppy immunoglobulins (Igs) and used the mouse antisera to develop a quantitative enzyme-linked immunosorbent assay (ELISA). The most efficient immunogen for mouse immunization was guppy Igs adsorbed on protein A/G beads. Antisera from mice boosted with this immunoglobulin (Ig) preparation were highly specific and contained high Ab titers. They immunoreacted in a Western blot with Ig heavy and light chains from guppy serum, and Ig heavy chain from guppy whole-body homogenate. The mouse anti-guppy Ig was applied in an ELISA aimed at comparing the efficiency of different routes of guppy immunization against Tetrahymena: (i) anal intubation with sonicated Tetrahymena (40,000 Tetrahymena/fish in a total volume of 10 μL) mixed with domperidon, deoxycholic acid and free amino acids (valine, leucine, isoleucine, phenylalanine and tryptophan), or (ii) intraperitoneal (i.p.) injection of sonicated Tetrahymena in complete Freund's adjuvant (15,000 Tetrahymena/fish in total a volume of 20 μL). Negative control fish were anally intubated with the intubation mixture without Tetrahymena, or untreated. ELISA measurement of anti-Tetrahymena Ab titer revealed a significantly higher level of Abs in i.p.-immunized guppies, compared to the anally intubated and control fish. In addition, the efficiency of immunization was tested by monitoring guppy mortality following (i) i.p. challenge with Tetrahymena (900 Tetrahymena/fish) or (ii) cold stress followed by immersion in water containing 10,000 Tetrahymena/mL. Fish mortality on day 14 post-Tetrahymena infection by i.p. injection exceeded 50% in the control and anally intubated fish, compared to 31% in i.p.-immunized fish. Immunization did not protect from

  15. Quantitation of the receptor for urokinase plasminogen activator by enzyme-linked immunosorbent assay

    Rønne, E; Behrendt, N; Ploug, M


    variant of uPAR, suPAR, has been constructed by recombinant technique and the protein content of a purified suPAR standard preparation was determined by amino acid composition analysis. The sensitivity of the assay (0.6 ng uPAR/ml) is strong enough to measure uPAR in extracts of cultured cells and cancer......Binding of the urokinase plasminogen activator (uPA) to a specific cell surface receptor (uPAR) plays a crucial role in proteolysis during tissue remodelling and cancer invasion. An immunosorbent assay for the quantitation of uPAR has now been developed. This assay is based on two monoclonal...... antibodies recognizing the non-ligand binding part of this receptor, and it detects both free and occupied uPAR, in contrast to ligand-binding assays used previously. In a variant of the assay, the occupied fraction of uPAR is selectively detected with a uPA antibody. To be used as a standard, a soluble...

  16. Relation between enzyme-linked immunosorbent assay and radioimmunoassay for detection of antibodies to the capsular polysaccharide of Haemophilus influenzae type b

    Kristensen, K.; Weis Bentzon, M.


    The measurement of antibodies to the capsular polysaccharide (PRP) of Haemophilus influenzae type b (Hib) is important because vaccines inducing such antibodies are now available. We developed and evaluated an enzyme-linked immunosorbent assay (ELISA) for detection of these antibodies based on direct coating of the plates with tyraminated PRP. The assay fulfilled the requirements for parallel line assays; it was sensitive, specific, and reproducible with a coefficient of variation between days of 19%. Results from the ELISA were compared with results from radioimmunoassay and a correlation coefficient of 0.93 was found. Results obtained by the two methods were proportional and the relation was indepenedent of the antibody level. The relation between them was also unaffected by the contribution of different antibody isotypes, indicating that these were measured to the same extent by both methods. ELISA employing direct coating of the plates with tyraminated PRP represents a useful alternative for detection of antibodies when studying immunogenicity of Hib vaccines. (au)

  17. Evaluation of the radioimmunoassay, indirect enzyme linked immunosorbent assay, and dot blot assay for the identification of Xanthomonas campestris pv. phaseoli

    Malin, E; Belden, E L; Roth, D


    A radioimmunoassay (RIA), an indirect competitive enzyme-linked immunosorbent assay (ELISA), and a dot-blot modification of the ELISA were evaluated for detection and identification of Xanthomonas campestris pv. phaseoli (X. c. pv. phaseoli). RIA and the dot blot tests were specific for X. c. pv. phaseoli; however, significant cross reactions occurred in the indirect competitive ELISA when using anti-X. c. pv. phaseoli antiserum against other closely related bacteria. The sensitivity level of all procedures for X. c. pv. phaseoli was approximately l0/sup 5/ colony forming unitsmL. All procedures were unsatisfactory in reliably detecting low levels of X. c. pv. phaseoli directly from extracts of bean seed. However when used in conjunction with ilution plating the dot blot assay and the RIA would be useful in specifically identifying X. c. pv. phaseoli. The relative merits of these tests for identification of X. c. pv. phaseoli are discussed.

  18. The use of enzyme-linked immunosorbent assay systems for the serology and antigen detection in parvovirus, coronavirus and rotavirus infections in dogs in The Netherlands.

    G.F. Rimmelzwaan (Guus); J. Groen (Jan); H.F. Egberink (Herman); G.H.A. Borst (Gerrit); F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)


    textabstractComplex trapping blocking (CTB) enzyme-linked immunosorbent assays (ELISAs) and indirect ELISAs for the detection of antibodies to canine parvovirus (CPV), canine coronavirus (CCV) and rotavirus in sera of dogs were established. Double antibody sandwich ELISAs for the detection of CPV-,

  19. Serodiagnosis of Leishmania donovani infections: assessment of enzyme-linked immunosorbent assays using recombinant L. donovani gene B protein (GBP) and a peptide sequence of L. donovani GBP

    Jensen, A T; Gasim, S; Moller, T


    The repetitive sequence of Leishmania major gene B protein (GBP) has previously been shown to be a useful tool in the diagnosis of cutaneous leishmaniasis (CL). Here, we have assessed enzyme-linked immunosorbent assays (ELISAs) using recombinant L. donovani GBP (rGBP) and a peptide sequence of L...... for malaria but free of leishmaniasis was negative in both assays....

  20. Evaluation of enzyme-linked immunosorbent assays based on monoclonal antibodies for the serology and antigen detection in canine parvovirus infections.

    G.F. Rimmelzwaan (Guus); N. Juntti; B. Klingeborn; J. Groen (Jan); F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)


    textabstractAn enzyme-linked immunosorbent assay (ELISA) system was developed for the detection of canine parvovirus (CPV) or CPV antigen in dog faeces and two other ELISA systems were developed for the detection of CPV-specific antibodies in dog sera. The ELISA's were based on the use of

  1. Onderzoek naar toepasbaarheid van Enzyme-Linked Immunosorbent Assay (ELISA) voor het bepalen van aflatoxinen in voedings- en voedermiddelen 1e interimrapport: Orientatie en taakstelling

    Egmond; H.P. van; Paulsch; W.E.; Sizoo; E.A.


    Immunochemische methoden van onderzoek voor het bepalen van mycotoxinen komen langzamerhand in de belangstelling te staan, vooral Enzyme-Linked Immunosorbent Assay (ELISA). Om een beeld te krijgen van de praktische en wetenschappelijke karakteristieken van ELISA's in het

  2. Challenges for bovine viral diarrhoea virus antibody detection in bulk milk by antibody enzyme-linked immunosorbent assays due to changes in milk production levels

    Foddai, Alessandro; Enøe, Claes; Stockmarr, Anders


    Background: Bovine viral diarrhoea (BVD) is considered eradicated from Denmark. Currently, very few (if any) Danish cattle herds could be infected with BVD virus (BVDV). The Danish antibody blocking enzyme-linked immunosorbent assay (ELISA) has been successfully used during the Danish BVD eradica...


    An enzyme-linked immunosorbent assay (ELISA) method was developed to quantitatively measure 2,4-dichlorophenoyacetic acid (2,4-D) in human urine. Samples were diluted (1:5) with phosphate-buffered saline, 0.05% Tween 20, with 0.02% sodium azide, and analyzed by a 96-microwekk pl...

  4. Comparison of an enzyme linked immunosorbent assay (ELISA) and a radioallergosorbent test (RAST) for detection of IgE antibodies to Brugia malayi

    Wahyuni, Sitti; van Ree, Ronald; Mangali, Andarias; Supali, Taniawati; Yazdanbakhsh, Maria; Sartono, Erliyani


    The enzyme linked immunosorbent assay (ELISA) for specific IgE antibodies to Brugia malayi was compared with the radioallergosorbent test (RAST) for use in immunoepidemiological studies of lymphatic filariasis. Sera used were from individuals (aged 5-82 years) living in an area endemic for lymphatic

  5. Development and validation of an indirect Enzyme-linked Immunosorbent Assay for the detection of antibodies against Schmallenberg virus in blood samples from ruminants

    Heijden, van der H.M.J.F.; Bouwstra, R.J.; Mars, M.H.; Poel, van der W.H.M.; Wellenberg, G.J.; Maanen, van C.


    To detect Schmallenberg virus (SBV) infections in ruminants and to perform SBV epidemiological studies a cost-effective serological test is required. For these purposes an indirect whole virus Enzyme-linked Immunosorbent Assay (ELISA) for detection of SBV specific antibodies in ruminant blood

  6. Development of a Multianalyte Enzyme-Linked Immunosorbent Assay for Permethrin and Aroclors and Its Implementation for Analysis of Soil/Sediment and House Dust ExtractsExtracts

    Development of a multianalyte enzyme-linked immunosorbent assay (ELISA) for detection of permethrin and aroclors 1248 or 1254, and implementation of the assay for analysis of soil/sediment samples are described. The feasibility of using the multianalyte ELISA to monitor aroclors ...

  7. Evaluation of a commercial competitive enzyme-linked immunosorbent assay for detection of avian influenza virus subtype H5 antibodies in zoo birds

    Jensen, Trine Hammer; Andersen, Jannie Holmegaard; Hjulsager, Charlotte Kristiane


    The hemagglutination inhibition (HI) test is the current gold standard for detecting antibodies to avian influenza virus (AIV). Enzyme-linked immunosorbent assays (ELISAs) have been explored for use in poultry and certain wild bird species because of high efficiency and lower cost. This study com...

  8. Low sensitivity of type VII collagen enzyme-linked immunosorbent assay in epidermolysis bullosa acquisita : serration pattern analysis on skin biopsy is required for diagnosis

    Terra, J. B.; Jonkman, M. F.; Diercks, G. F. H.; Pas, H. H.

    BackgroundThe type VII collagen (coll VII) enzyme-linked immunosorbent assay (ELISA) has been reported to have high sensitivity (>93%) and specificity (>96%) for diagnosing epidermolysis bullosa acquisita (EBA) in patients who are seropositive on indirect immunofluorescence on salt-split skin (SSS).



    In order to assess the diagnostic usefulness of the A60 (ANDA Biologicals, Strassbourg, France) sero-diagnostic enzyme-linked immunosorbent assay (ELISA) kit for tuberculosis in Africa, sera of 53 pulmonary smear-positive tuberculosis (TB) patients, 30 apparently healthy control subjects and 6 AIDS

  10. Enzyme-Linked Immunosorbent Assay To Differentiate the Antibody Responses of Animals Infected with Brucella Species from Those of Animals Infected with Yersinia enterocolitica O9

    Erdenebaatar, Janchivdorj; Bayarsaikhan, Balgan; Watarai, Masahisa; Makino, Sou-ichi; Shirahata, Toshikazu


    Enzyme-linked immunosorbent assays using antigens extracted from Brucella abortus with n-lauroylsarcosine differentiated natural Brucella-infected animals from Brucella-vaccinated or Yersinia enterocolitica O9-infected animals. A field trial in Mongolia showed cattle, sheep, goat, reindeer, camel, and human sera without infection could be distinguished from Brucella-infected animals by conventional serological tests.

  11. Development and validation of an enzyme-linked immunosorbent assay for antibodies against Mycobacterium bovis in european wild boar

    Gortázar Christian


    Full Text Available Abstract Background Bovine tuberculosis (bTB remains a significant problem in some parts of Spain largely because of contacts between cattle and wildlife reservoirs in extensive grazing systems. European Wild boar (Sus scrofa is one of the species involved in the transmission of the disease to other species. Fast and simple detection methods would be critical for assessing infection prevalence, study the mechanisms of pathogen transmission and monitoring the effects of TB control measures. Results An enzyme-linked immunosorbent assay (ELISA to detect antibodies against Mycobacterium bovis in wild boar serum was developed and validated on 185 sera from TB positive and negative wild boar. Based on antigen inoculation of captive animals as well as tuberculosis compatible lesions, culture results and molecular analysis of hunted individuals, animals were allocated into two groups: tuberculosis positive group and tuberculosis negative group. After optimization of the positive to negative ratio using different combinations of serum dilutions and conjugate concentrations, the test yielded a sensitivity of 72.60% and a specificity of 96.43% for the best cut-off. Conclusion Although some negative group animals showed an ELISA positive reaction (

  12. Evaluation of an enzyme linked immunosorbent assay kit for the detection of Babesia bovis antibodies in cattle in Argentina

    Echaide, S; Echaide, I E; Mangold, A J; Lugaresi, C I; Guglielmone, A A [Estacion Experimental Agropecuaria, Instituto Nacional de Tecnologia Agropecuaria, Rafaela, Santa Fe (Argentina); Gaido, A B [Estacion Experimental Agropecuaria Salta, Salta (Argentina)


    An enzyme linked immunosorbent assay (ELISA) for the detection of antibodies to Babesia bovis was evaluated by using sera of 874 cattle carrying B. bovis antibodies, 700 sera of uninfected cattle, and 357 sera from calves from 16 herds subjected to different B. bovis inoculation rates. The seropositive/ seronegative cut-off point set as double the mean percent positivity of negative cattle sera (= 16%). The sensitivity of the ELISA (four trials) ranged from 97.1% to 100% and the specificity (three trials) varied from 92.0% to 97.0%. The agreement between ELISA and immunofluorescent antibody test was {>=} 90.0% in 18 of 23 evaluations and it ranged from 86.0% to 88.0% in the remainder. The correlation coefficient between percentage of sera positive to ELISA and IFA test in 16 herds was 0.9958 (P<0.001). The ELISA has the advantages of a high sensitivity, objectivity and capacity to test large number of samples in short period of time and could replace the IFA test specially for epidemiological studies. (author) 11 refs, 1 fig., 2 tabs

  13. Use of hydrophilic extra-viral domain of canine distemper virus H protein for enzyme-linked immunosorbent assay development.

    Cho, Ki-hyun; Kim, Jeongmi; Yoo, Hyun-ah; Kim, Dae-hee; Park, Seung-yong; Song, Chang-seon; Choi, In-soo; Lee, Joong-bok


    Simple methods for measuring the levels of serum antibody against canine distemper virus (CDV) would assist in the effective vaccination of dogs. To develop an enzyme-linked immunosorbent assay (ELISA) specific for CDV, we expressed hydrophilic extra-viral domain (HEVD) protein of the A75/17-CDV H gene in a pET 28a plasmid-based Escherichia (E.) coli vector system. Expression was confirmed by dot and Western blotting. We proposed that detection of E. coli-expressed H protein might be conformation- dependent because intensities of the reactions observed with these two methods varied. The H gene HEVD protein was further purified and used as an antigen for an ELISA. Samples from dogs with undetectable to high anti-CDV antibody titers were analyzed using this HEVD-specific ELISA and a commercial CDV antibody detection kit (ImmunoComb). Levels of HEVD antigenicity measured with the assays and immunochromatography correlated. These data indicated that the HEDV protein may be used as antigen to develop techniques for detecting antibodies against CDV.

  14. Novel indirect enzyme-linked immunosorbent assay (ELISA) method to detect Total E. coli in water environment

    Wang Na; He Miao; Shi Hanchang


    In order to establish ELISA (enzyme-linked immunosorbent assay) method to detect Total E. coli in water environment, E. coli multi-characters antigens in water environment were prepared according to the characters of kinds of E. coli serotypes, including antigen of whole cell, antigen of disrupted whole cell, somatic antigen, flagellar antigen and fimbrial antigen. Total E. coli polyclonal antibodies were obtained from the New Zealand rabbits immunized with these five antigens, respectively. Antibodies generated in this research are with high titers and good purity, can conjugate with antigens, specifically, stably and strongly. Indirect ELISA shows the titers of antibody of whole cell and antibody of disrupted whole cell are both over 1 x 10 5 . The cross-reactivity of the antibody is from 12 to 30% which indicate the specificity of the antibody against Total E. coli. Based on these antibodies, we established indirect ELISA method to detect Total E. coli in water environment. The matrix effects were studied and the results show that there is no significant influence by all the factors. The ELISA result shows that the detection limitation could be 10 4 CFU (colony forming units) L -1 . The indirect ELISA method developed in this study is well suited for Total E. coli analysis in real water samples as a rapid screen method

  15. Identification of Proteinaceous Binders in Ancient Tripitaka by the Use of an Enzyme-linked Immunosorbent Assay.

    Liu, Yi; Li, Yi; Chang, Runxing; Zheng, Hailing; Li, Menglu; Hu, Zhiwen; Zhou, Yang; Wang, Bing


    Proteinaceous materials, such as ovabumin and collagen, were commonly used as binding media, and as adhesives and protective coatings. However, the identification of ancient proteinaceous binders is a great challenge for archaeologists, due to their limited sample size, complex combinations of various ingredients and reduced availability of the binder during the process of protein degradation. In this paper, an enzyme-linked immunosorbent assay (ELISA) provides to be a particularly promising method for the detection of proteinaceous binding materials in ancient relics. The present work focused on the specific identification of proteins in archaeological binders, which was brushed on the Tripitaka. Two samples, the adhesion area (S1) and the ink area (S2), were tested by ELISA. The results showed that both S1 and S2 reacted positively when treated with an anti-collagen-I antibody. It proved the existence of proteinaceous binders in Ancient Tripitaka, and the percentage of collagen in S1 and S2 was 61.44 and 15.4%, respectively. Compared with other conventional techniques, ELISA has advantages of high specificity, sensitivity, rapidity and low cost, making it especially suitable for the protein detection in the archaeological field.

  16. Comparison of agar gel immunodiffusion test, enzyme-linked immunosorbent assay and PCR in diagnostics of enzootic bovine leukosis

    Malovrh Tadej


    Full Text Available Bovine leukaemia virus (BLV is a retrovirus that induces a chronic infection in cattle. Once infected, cattle remain virus carriers for life and start to show an antibody response within a few weeks after infection. Eradication and control of the disease are based on early diagnostics and segregation of the carriers. The choice of a diagnostic method depends on the eradication programme, money resources and characteristics of the herd to be analysed. The agar gel immunodiffusion (AGID test has been the serological test of choice for routine diagnosis of serum samples. Nevertheless, in more recent years, the enzyme-linked immunosorbent assay (ELISA has replaced the AGID for large scale testing. For this purpose, commercially available BLV-ELISA kits were compared to the AGID and to the polymerase chain reaction (PCR method performed with two sets of primers, amplifying env region. The ELISA kit based on the p24 core protein was found to be less specific and served as a screening test. The ELISA kit based on the envelope glycoprotein (gpSI served as a verification test and gave a good correlation with the AGID test and PCR method. However, ELISA showed a higher sensitivity than AGID. The p24 based ELiSA was useful for screening a large number of samples, whereas gp51 based ELISA, AGID and PCR were more important for detecting the antibody response against the individual BLV-proteins and therefore for verification of the infection with BLV.

  17. Evaluation of a competitive enzyme-linked immunosorbent assay for measurements of soluble HLA-G protein

    Rasmussen, M; Dahl, M; Buus, S


    . We report a novel method, a competitive immunoassay, for measuring HLA-G5/sHLA-G1 in biological fluids. The sHLA-G immunoassay is based upon a competitive enzyme-linked immunosorbent assay (ELISA) principle. It includes a recombinant sHLA-G1 protein in complex with β2-microglobulin and a peptide...... as a standard, biotinylated recombinant sHLA-G1 as an indicator, and the MEM-G/9 anti-HLA-G monoclonal antibody (mAb) as the capture antibody. The specificity and sensitivity of the assay were evaluated. Testing with different recombinant HLA class I proteins and different anti-HLA class I mAbs showed....../ml. An intra-assay coefficient of variation (CV) of 15.5% at 88 ng/ml and an inter-assay CV of 23.1% at 39 ng/ml were determined. An assay based on the competitive sHLA-G ELISA may be important for measurements of sHLA-G proteins in several conditions: assisted reproduction, organ transplantation, cancer...

  18. An enzyme-linked immunosorbent assay and a gold-nanoparticle based immuno chromatographic test for amatoxins using recombinant antibody

    He, Kuo; Zhao, Ruiping; Wang, Lixia; Feng, Tingting; Wei, Dong; Zhang, Xiuyuan


    The authors describe two kinds of rapid assays for the determination of amatoxins in mushrooms. The first is an enzyme-linked immunosorbent assay (ELISA) using horseradish peroxidase. The second is a rapid immuno chromatographic assay that uses colloidal gold as a red label (CG-ICA). Both are based on the use of a well-characterized recombinant single chain variable fragment antibody (named scFv-A4). The half-maximum inhibition concentrations (IC50) of α-amanitin, β-amanitin and γ-amanitin are 78, 85 and 90 ng⋅mL"-"1, and the limits of detection (LODs; for IC15) are 1.9, 2.1 and 2.8 ng⋅mL"-"1. The method was applied to the determination of amanitins in mushrooms, and the LODs for α-amanitin, β-amanitin and γ-amanitin in mushroom samples were found to be 4.9, 6.4 and 8.3 ng⋅mL"-"1. The visual minimum detection limits of the optimized CGIA are 4 and 6 ng⋅mL"-"1 for mushroom samples. The test can be performed within 10 min. The results of the analysis of spiked samples showed that the CG-IA can rapidly and semi-quantitatively quantify amatoxins in mushroom samples on site and at low costs. (author)

  19. Validation of 2 commercially available enzyme-linked immunosorbent assays for adiponectin determination in canine serum samples.

    Tvarijonaviciute, Asta; Martínez-Subiela, Silvia; Ceron, José J


    The aim of this study was to validate 2 commercially available enzyme-linked immunosorbent assays (ELISAs) for adiponectin in dogs, 1 canine-specific and 1 originally designed for measurements in humans. Intra-assay and interassay precision was evaluated by multiple measurements in canine serum samples, and assay accuracy was indirectly determined by linearity under dilution. Interference caused by hemolysis and lipemia was also studied. Both assays were subsequently used for measuring adiponectin concentrations in clinically healthy dogs and those with different grades of obesity. The intra-assay and inter-assay precision was less than 7.5% and 13.5% in serum samples with low and high adiponectin concentrations, respectively. Lipemia and hemolysis did not affect the results of any of the assays. Both assays were able to differentiate lean dogs from those that were overweight or obese on the basis of the measured adiponectin concentrations. From these results it can be concluded that canine adiponectin concentrations can be measured reliably by means of the 2 ELISAs evaluated in this study.


    Trindade, Mirta; Nording, Malin; Nichkova, Mikaela; Spinnel, Erik; Haglund, Peter; Last, Michael S.; Gee, Shirley; Hammock, Bruce; Last, Jerold A.; González-Sapienza, Gualberto; Brena, Beatriz M.


    Uncontrolled combustion due to garbage recycling is a widespread activity among slum dwellers in distressed economy countries and has been indicated as a major source of dioxin contamination. However, because of the high cost and complexity of gas chromatography/high-resolution mass spectrometry (GC-HRMS) analysis, the magnitude of the problem remains largely unknown. The present study describes a first approach toward the use of a dioxin antibody-based enzyme-linked immunosorbent assay (ELISA) as the basis for a sustainable, simple, and low-cost monitoring program to assess the toxicological impact of uncontrolled combustion in slums. A panel of 16 samples was analyzed by GC-HRMS and ELISA on split extracts. Close to 20% of the analyzed samples showed dioxin concentrations up to almost twice the guidance level for residential soil in several countries, pointing out the need for performing a large-scale monitoring program. Despite the potential for variations in dioxin congener distribution due to the mixed nature of the incinerated material, there was a good correlation between the toxic equivalents as determined by GC-HRMS and ELISA. Furthermore, an interlaboratory ELISA validation showed that the capacity to perform the dioxin ELISA was successfully transferred between laboratories. It was concluded that the ELISA method performed very well as a screening tool to prioritize samples for instrumental analysis, which allows cutting down costs significantly. PMID:18522475

  1. Detection of thyroid stimulating hormone receptor antibodies (TRAb) by radioreceptor assay (RRA) and enzyme-linked immunosorbent assay (ELISA)

    Dumrongpisutikul, S.; Tuchinda, S.


    Thyroid stimulating hormone receptor antibodies (TRAb) were determined in 100 patients using radioreceptor assay (RRA) and enzyme-linked immunosorbent assay (ELISA). The sensitivity of RRA and ELISA were found to be 70.6% and 88.2% respectively (n=51). The specificity of both assays were 100% (n=16). With RRA as the standard test the sensitivity and specificity of ELISA were 75.8% and 86.8%. In the untreated hyperthyroid the RRA result which expressed as % specific 125 I-TSH inhibition was 33.6% (n=51), decline to 26.9% in the treated hyperthyroid (n=33) and 14.1% in the euthyroid (n=16). The mean 0.D 492nm of TRAb-ELISA were 0.861 in untreated hyperthyroid, 0.437 in treated hyperthyroid and 0.135 in euthyroid Phi coefficient analysis show that the RRA was 60.4% correlated to hyperthyroidism where as TRAb-ELISA was 80.1%

  2. Field assessment of the enzyme linked immunosorbent assay for foot-and-mouth disease virus diagnosis and typing

    Smitsaart, E.; Fondevila, N.; Compaired, D.; Maradei, E.; Fernandez, E.


    The objective of the present study was to evaluate the enzyme linked immunosorbent assay (ELISA) in comparison with the complement fixation test (CFT) for the diagnosis and typing of foot-and-mouth disease (FMD) virus (FMDV). Diagnostic material was epithelium from either suspected cases of FMD or from animals experimentally infected with FMDV. Epithelial suspensions and supernatant fluids from cell culture passage were assayed by CFT and ELISA. The superiority of the ELISA over the CFT was demonstrated: 1) the detection rate was 23% higher than that of CFT on original (epithelial) suspensions (OS) submissions of all sample (positive and negative) and 30% higher on supernatant fluids from cell culture passage, 2) the detection rate of ELISA on OS of confirmed positive samples was 28% higher than that of CFT, 3) no significant differences were observed in the detection and typing rates between the PANAFTOSA and FAO/IAEA ELISA kits (P<0.05) and 4) the sensitivity of the ELISA was 16 to 85 times higher than that of CFT when serial dilutions of sample homogenates were examined. (author)

  3. Development of enzyme linked immunosorbent assay (ELISA) for the detection of root-knot nematode Meloidogyne incognita.

    Kapur-Ghai, J; Kaur, M; Goel, P


    Root-knot nematodes (Meloidogyne incognita) are obligate, sedentary plant endoparasites that are extremely polyphagous in nature and cause severe economic losses in agriculture. Hence, it is essential to control the parasite at an early stage. For any control strategy to be effective, an early and accurate diagnosis is of paramount importance. Immunoassays have the inherent advantages of sensitivity and specificity; have the potential to identify and quantify these plant-parasitic nematodes. Hence, in the present studies, enzyme-linked immunosorbent assay (ELISA) has been developed for the detection of M.incognita antigens. First an indirect ELISA was developed for detection and titration of anti-M.incognita antibodies. Results indicated as high as 320 K titre of the antisera. Finally competitive inhibition ELISA was developed employing these anti-M.incognita antibodies for detection of M.incognita antigens. Sensitivity of ELISA was 10 fg. Competitive inhibition ELISA developed in the present studies has the potential of being used as an easy, rapid, specific and sensitive diagnostic tool for the detection of M.incognita infection.

  4. Improved quantification of a commercial enzyme-linked immunosorbent assay kit for measuring anti-MDA5 antibody.

    Gono, Takahisa; Okazaki, Yuka; Murakami, Akihiro; Kuwana, Masataka


    To compare the quantitative performance for measuring anti-MDA5 antibody titer of two enzyme-linked immunosorbent assay (ELISA) systems: an in-house ELISA and the commercial MESACUP TM anti-MDA5 test. Anti-MDA5 antibody titer was measured in sera from 70 patients with dermatomyositis using an in-house ELISA and the MESACUP TM anti-MDA5 test side-by-side. For the commercial ELISA kit, serum samples diluted 1:101 were used according to the manufacturer's protocol, but serial dilutions of sera were also examined to identify the optimal serum dilution for quantification. The anti-MDA5 antibody titers measured by the in-house and commercial ELISAs were positively correlated with each other (r = 0.53, p = .0001), but the antibody titer measured by the commercial ELISA was less sensitive to change after medical treatment, and 37 (80%) of 46 anti-MDA5-positive sera had antibody titer exceeding the quantification range specified by the manufacturer (≥150 index). Experiments using diluted serum samples revealed that diluting the sera 1:5050 improved the quantitative performance of the MESACUP TM anti-MDA5 test, including a better correlation with the in-house ELISA results and an increased sensitivity to change. We improved the ability of the commercial ELISA kit to quantify anti-MDA5 antibody titer by altering its protocol.

  5. Sensitive radioimmunoassay and enzyme-linked immunosorbent assay for the simultaneous determination of chloroquine and its metabolites in biological fluids

    Escande, C.; Chevalier, P.; Verdier, F.; Bourdon, R.


    Two new methods for the simultaneous determination of chloroquine and its two main metabolites (monodesethylchloroquine and bisdesethylchloroquine) in biological samples, radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA), are described. Antiserum is produced in rabbits immunized with N-(2-carboxyethyl)desethylchloroquine:protein conjugate. Besides chloroquine, this antiserum recognizes with good affinity the two main metabolites, monodesethylchloroquine and bisdesethylchloroquine (70 and 40% of crossreaction, respectively). Amodiaquine cross reacts by 4.5%; cross reactions with monodesethylamodiaquine, bisdesethylamodiaquine, and other antimalarial drugs are less than 1%. No extraction step or sample preparation is required for either system. Sensitivity limits are, respectively, 0.70 nM (3 pg of chloroquine sulfate measured in 10 microL of plasma sample) for RIA, and 10 nM (22 pg of chloroquine sulfate measured in 5 microL of plasma sample) for ELISA. The interassay coefficients of variation are, respectively, less than 10 and less than 16% for RIA and ELISA in the range 14-410 nM (6-180 ng/mL). The results of both methods are well correlated (r = 0.97) and correlate with spectrophotometry (r = 0.98) and HPLC results (r = 0.93). Because of their high sensitivity, both methods can be used in the case of chloroquine poisoning and in the control of malaria prophylaxis and treatment

  6. Validation of an improved enzyme-linked immunosorbent assay for the diagnosis of trypanosomal antibodies in Ghanaian cattle

    Doku, C.K.; Seidu, I.B.M.


    The validation of an enzyme-linked immunosorbent assay (Ab-ELISA) for the detection of antibodies to pathogenic trypanosomes in cattle is described. Two hundred known negative sera obtained from the tsetse-free zone of Dori (Burkina Faso) were analyzed using microtitre plates pre-coated with crude antigen lysates of Trypanosoma congolense and T. vivax. A pre-test optimization was carried out and a percent positivity (PP) of 50% was chosen (specificity: >82%) for assaying field sera. A total of 440 serum samples collected from cattle in areas of known and unknown disease prevalence were assayed. For all animals the packed red cell volume (PCV) was determined and the buffy coat technique (BCT) and blood smears were examined to detect trypanosomes at the species level. A comparison of the BCT and Ab-ELISA results showed there was a much higher prevalence of antibodies to both species than the parasite prevalence as shown by the BCT (10 fold). The rate of agreement between BCT-positive and Ab-ELISA-positive samples for both species was low (<10%). No conclusion could be drawn from this finding because of the low number of known BCT positive cases that were identified. There was a better, albeit highly variable, agreement between BCT-negative and Ab-ELISA-negative samples (30-70%). Proposals for further improvement of the Ab-ELISA and prospects for the use of the assay in the monitoring of trypanosomosis control in Ghana are discussed. (author)

  7. Commercial Milk Enzyme-Linked Immunosorbent Assay (ELISA) Kit Reactivities to Purified Milk Proteins and Milk-Derived Ingredients.

    Ivens, Katherine O; Baumert, Joseph L; Taylor, Steve L


    Numerous commercial enzyme-linked immunosorbent assay (ELISA) kits exist to quantitatively detect bovine milk residues in foods. Milk contains many proteins that can serve as ELISA targets including caseins (α-, β-, or κ-casein) and whey proteins (α-lactalbumin or β-lactoglobulin). Nine commercially-available milk ELISA kits were selected to compare the specificity and sensitivity with 5 purified milk proteins and 3 milk-derived ingredients. All of the milk kits were capable of quantifying nonfat dry milk (NFDM), but did not necessarily detect all individual protein fractions. While milk-derived ingredients were detected by the kits, their quantitation may be inaccurate due to the use of different calibrators, reference materials, and antibodies in kit development. The establishment of a standard reference material for the calibration of milk ELISA kits is increasingly important. The appropriate selection and understanding of milk ELISA kits for food analysis is critical to accurate quantification of milk residues and informed risk management decisions. © 2016 Institute of Food Technologists®

  8. Comparison of enzyme-linked immunosorbent assay and rapid chemiluminescent analyser in the detection of myeloperoxidase and proteinase 3 autoantibodies.

    Pucar, Phillippa A; Hawkins, Carolyn A; Randall, Katrina L; Li, Candice; McNaughton, Euan; Cook, Matthew C


    Antibodies to myeloperoxidase (MPO) and proteinase 3 (PR3) are vital in the diagnosis and management of ANCA-associated vasculitis. A chemiluminescent immunoassay (CLIA; Quanta Flash) provides MPO and PR3 antibody results in 30 minutes, which is much faster than enzyme-linked immunosorbent assay (ELISA). We compared the performance of ELISA (Orgentec) and CLIA (Quanta Flash) for MPO and PR3 antibody quantitation on 303 samples, comprising 196 consecutive samples received in a single diagnostic laboratory over a 3 month period, and 107 samples collected from 42 known vasculitis patients over a 40 month period. We observed a correlation between both methods using spearman correlation coefficients (MPO, r s  = 0.63, p assays) and disease relapse (correlation for both MPO and PR3 antibody quantitation r s  = 0.84, p = 0.03 and r s  = 0.78, p ELISA for measurement of MPO and PR3 antibodies. Copyright © 2017. Published by Elsevier B.V.

  9. Evaluation of an enzyme linked immunosorbent assay kit for the detection of Babesia bovis antibodies in cattle in Argentina

    Echaide, S.; Echaide, I.E.; Mangold, A.J.; Lugaresi, C.I.; Guglielmone, A.A.; Gaido, A.B.


    An enzyme linked immunosorbent assay (ELISA) for the detection of antibodies to Babesia bovis was evaluated by using sera of 874 cattle carrying B. bovis antibodies, 700 sera of uninfected cattle, and 357 sera from calves from 16 herds subjected to different B. bovis inoculation rates. The seropositive/ seronegative cut-off point set as double the mean percent positivity of negative cattle sera (= 16%). The sensitivity of the ELISA (four trials) ranged from 97.1% to 100% and the specificity (three trials) varied from 92.0% to 97.0%. The agreement between ELISA and immunofluorescent antibody test was ≥ 90.0% in 18 of 23 evaluations and it ranged from 86.0% to 88.0% in the remainder. The correlation coefficient between percentage of sera positive to ELISA and IFA test in 16 herds was 0.9958 (P<0.001). The ELISA has the advantages of a high sensitivity, objectivity and capacity to test large number of samples in short period of time and could replace the IFA test specially for epidemiological studies. (author)

  10. Detection by radioimmunoassay and enzyme-linked immunosorbent assay of coronavirus antibodies in bovine serum and lacteal secretions.

    Rodak, L; Babiuk, L A; Acres, S D


    The sensitivity of a radioimmunoassay (RIA), an enzyme-linked immunosorbent assay (ELISA), and a serum neutralization assay (SN) for detecting antibodies to bovine coronavirus in serum and colostrum were compared. Although there proved to be a good correlation among all three assays (r = 0.915 and 0.964 for RIA with SN and ELISA, respectively), RIA and ELISA proved to be at least 10 times more sensitive than neutralization tests. By using these techniques, it was possible to detect a time-dependent decrease in antibody levels in bovine colostrum after parturition. Using ELISA, we demonstrated that 12 of 12 herds in Saskatchewan, and 109 of 110 animals tested, and antibody to bovine coronavirus. There was no elevated antibody response in serum or lacteal secretions of cows vaccinated once or twice with a commercially available modified live rota-coronavirus vaccine. In addition to being more sensitive than SN, ELISA and RIA proved to have other advantages for measuring antibody levels to bovine coronavirus and therefore warrant wider use as tools in diagnostic virology.

  11. Dual-color plasmonic enzyme-linked immunosorbent assay based on enzyme-mediated etching of Au nanoparticles

    Guo, Longhua; Xu, Shaohua; Ma, Xiaoming; Qiu, Bin; Lin, Zhenyu; Chen, Guonan


    Colorimetric enzyme-linked immunosorbent assay utilizing 3‧-3-5‧-5-tetramethylbenzidine(TMB) as the chromogenic substrate has been widely used in the hospital for the detection of all kinds of disease biomarkers. Herein, we demonstrate a strategy to change this single-color display into dual-color responses to improve the accuracy of visual inspection. Our investigation firstly reveals that oxidation state of 3‧-3-5‧-5-tetramethylbenzidine (TMB2+) can quantitatively etch gold nanoparticles. Therefore, the incorporation of gold nanoparticles into a commercial TMB-based ELISA kit could generate dual-color responses: the solution color varied gradually from wine red (absorption peak located at ~530 nm) to colorless, and then from colorless to yellow (absorption peak located at ~450 nm) with the increase amount of targets. These dual-color responses effectively improved the sensitivity as well as the accuracy of visual inspection. For example, the proposed dual-color plasmonic ELISA is demonstrated for the detection of prostate-specific antigen (PSA) in human serum with a visual limit of detection (LOD) as low as 0.0093 ng/mL.

  12. An enzyme-linked immunosorbent assay for the quantification of serum platelet-bindable IgG.

    Howe, S E; Lynch, D M; Lynch, J M


    An enzyme-linked immunosorbent assay (ELISA) using F(ab')2 peroxidase-labeled antihuman immunoglobulin and o-phenylenediamine dihydrochloride (OPD) as a substrate was developed to measure serum platelet bindable IgG (S-PBIgG). The assay was made quantitative by standardizing the number of normal "target" platelets bound to microtiter plate wells, and by incorporating quantitated IgG standards with each microtiter plate tested to prepare a standard calibration curve. By this method, S-PBIgG for normal individuals was 3.4 +/- 1.6 fg per platelet (mean +/- 1 SD; n = 40). Increased S-PBIgG levels were detected in 36 of 40 patients with clinical autoimmune thrombocytopenia (ATP), ranging from 7.0 to 85 fg per platelet. Normal S-PBIgG levels were found in 34 of 40 patients with nonimmune thrombocytopenia. This method showed a sensitivity of 90 percent, specificity of 85 percent, and in the sample population studied, a positive predictive value of 0.86 and a negative predictive value of 0.90. This assay is highly reproducible (coefficient of variation was 6.8%) and appears useful in the evaluation of patients with suspected immune-mediated thrombocytopenia.

  13. The development of an enzyme-linked immunosorbent assay for Trypanosoma vivax antibodies and its use in epidemiological surveys

    Claudio R Madruga


    Full Text Available There are data indicating that the distribution of Trypanosoma vivax in the Brazilian territory is expanding with potential to reach other areas, where the vectors are present. The detection of anti-trypanosomal antibodies in serum provides important information of the trypanosomal status in cattle herds. For this reason, an enzyme-linked immunosorbent assay (Tv-ELISA-Ab with crude antigen from one Brazilian isolate of T. vivax was developed and evaluated. The sensitivity and specificity were respectively 97.6 and 96.9%. In the evaluation of cross-reactions, three calves inoculated with T. evansi trypimastigotes blood forms showed optical densities (OD under the cut-off during the whole experimental period, except one at 45 days post-inoculation. With relation to Babesia bovis, B. bigemina, and Anaplasma marginale, which are endemic hemoparasites in the studied area, the cross-reactions were shown to be 5.7, 5.3, and 1.1%, respectively. The first serological survey of Pantanal and state of Pará showed that T. vivax is widespread, although regions within both areas had significantly different prevalences. Therefore, this Tv-ELISA-Ab may be a more appropriate test for epidemiological studies in developing countries because the diagnostic laboratories in most countries may be able to perform an ELISA, which is not true for polymerase chain reaction.

  14. Evaluation of three enzyme-linked immunosorbent assays for sarcoptic mange diagnosis and assessment in the Iberian ibex, Capra pyrenaica.

    Ráez-Bravo, Arián; Granados, José Enrique; Serrano, Emmanuel; Dellamaria, Debora; Casais, Rosa; Rossi, Luca; Puigdemont, Anna; Cano-Manuel, Francisco Javier; Fandos, Paulino; Pérez, Jesús María; Espinosa, José; Soriguer, Ramón Casimiro; Citterio, Carlo; López-Olvera, Jorge Ramón


    Sarcoptic mange is a contagious skin disease caused by the mite Sarcoptes scabiei, affecting different mammalian species worldwide including the Iberian ibex (Capra pyrenaica), in which mortalities over 90 % of the population have been reported. No efficient diagnostic methods are available for this disease, particularly when there are low mite numbers and mild or no clinical signs. In this study, three enzyme-linked immunosorbent assays (ELISA) developed for dog (ELISA A), Cantabrian chamois (Rupicapra pyrenaica parva) (ELISA B) and Alpine chamois (Rupicapra rupicapra) (ELISA C), were evaluated to detect specific antibodies (IgG) to sarcoptic mange in Iberian ibex sera. Serum samples from 131 Iberian ibexes (86 healthy and 45 scabietic) were collected from 2005 to 2012 in the Sierra Nevada Natural and National Parks (southern Spain). Based on visual inspection, ibexes were classified into one of three categories, namely healthy (without scabietic compatible lesions), mildly affected (skin lesions over less than 50 % of the body surface) and severely affected (skin lesions over more than 50 % of the body surface). The optimal cut-off point, specificity, sensitivity and the area under the curve (AUC) were calculated, and the agreement between tests was determined. Moreover, differences in the optical density (OD) related to scabies severity have been evaluated for the best test. ELISA C showed better performance than the two other tests, reaching higher values of sensitivity (93.0 %) and specificity (93.5 %) against the visual estimation of the percentage of affected skin, chosen as the gold standard. Significantly higher concentrations of specific antibodies were observed with this test in the mildly and severely infested ibexes than in healthy ones. Our results revealed that ELISA C was an optimal test to diagnose sarcoptic mange in the Iberian ibex. Further studies characterizing immune response during the course of the disease, including spontaneous or drug

  15. The diagnostic significance of enzyme linked immuno-sorbent assay for herpes simplex, varicella zoster and cytomegalovirus retinitis.

    Madhavan Hajib


    Full Text Available Purpose: To evaluate the diagnostic usefulness of enzyme linked immuno-sorbent assay (ELISA in single serum samples to associate herpes simplex virus (HSV, varicella zoster virus (VZV or cytomegalovirus (CMV with viral retinitis as against polymerase chain reaction (PCR on intraocular specimens. It was also designed to study the seroprevalence in normal healthy individuals, and the genomic prevalence of HSV, VZV and CMV in patients without an active viral inflammatory process. Methods: PCR for the detection of HSV, VZV and CMV genomes was done on 33 and 90 intraocular fluids from viral retinal patients and non-viral controls respectively. ELISA was done on 30 and 100 serum samples from viral retinitis patients and normal healthy controls respectively. Results: PCR did not detect HSV, VZV and CMV genomes except one, in which VZV-DNA was detected. ELISA showed prevalence rates of 28%, 83% and 90% for antibodies against HSV, VZV and CMV respectively in the normal population. In the 30 viral retinitis patients, PCR detected HSV-DNA in 2 (6.7%, VZV-DNA in 7 (23.3% and CMV-DNA in 6 (20.0% patients, while ELISA detected antibodies against HSV, VZV and CMV in 13 (43.3%, 24 (80.0% and 23 (76.7% patients respectively. ELISA was of value in indirect diagnosis only in 6 (20.0% as compared to 15 (50.0% of 30 patients by PCR, this difference was statistically significant (McNemar test, P value = 0.005. Conclusion: Serology by ELISA is no longer a useful diagnostic tool to associate HSV, VZV and CMV viruses with viral retinitis.

  16. Postabsorptive hyperglucagonemia in patients with type 2 diabetes mellitus analyzed with a novel enzyme-linked immunosorbent assay.

    Matsuo, Toshihiro; Miyagawa, Jun-Ichiro; Kusunoki, Yoshiki; Miuchi, Masayuki; Ikawa, Takashi; Akagami, Takafumi; Tokuda, Masaru; Katsuno, Tomoyuki; Kushida, Akira; Inagaki, Takashi; Namba, Mitsuyoshi


    The aims of the present study were to investigate the performance of a novel sandwich enzyme-linked immunosorbent assay (ELISA) for measuring glucagon (1-29) with monoclonal antibodies against both the C- and N-terminal regions of glucagon (1-29), and to analyze the differences in plasma levels and responses of glucagon (1-29) to oral glucose loading in normal glucose tolerance (NGT) subjects and patients with type 2 diabetes mellitus. The cross-reactivity against proglucagon fragments using the ELISA kit and two types of conventional radioimmunoassay (RIA) kits was evaluated. A 75-g oral glucose tolerance test was carried out with NGT subjects and patients with type 2 diabetes mellitus, and the glucagon (1-29) concentration was measured using three types of kit. The ELISA kit clearly had the lowest cross-reactivity against miniglucagon (19-29) and glicentin (1-61). The oral glucose tolerance test was carried out with 30 NGT and 17 patients with type 2 diabetes mellitus. The glucagon (1-29) levels measured by the ELISA kit after glucose loading were significantly higher at all time-points in the type 2 diabetes mellitus group than in the NGT group. However, the glucagon (1-29) levels measured by one RIA kit were significantly higher in the NGT group, and those measured with the other RIA kit were approximately the same among the groups. The novel sandwich ELISA accurately determines plasma glucagon (1-29) concentrations with much less cross-reactivity against other proglucagon fragments than conventional RIA kits.

  17. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis

    Santiago-Felipe, S.; Tortajada-Genaro, L.A.; Puchades, R.; Maquieira, A., E-mail:


    Graphical abstract: -- Highlights: •Recombinase polymerase amplification is a powerful DNA method operating at 40 °C. •The combination RPA–ELISA gives excellent performances for high-throughput analysis. •Screening of food safety threats has been done using standard laboratory equipment. •Allergens, GMOs, bacteria, and fungi have been successfully determined. -- Abstract: Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR–ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA–ELISA combination is proposed for amplification at a low, constant temperature (40 °C) in a short time (40 min), for the hybridisation of labelled products to specific 5′-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA–ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA–ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings.

  18. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis

    Santiago-Felipe, S.; Tortajada-Genaro, L.A.; Puchades, R.; Maquieira, A.


    Graphical abstract: -- Highlights: •Recombinase polymerase amplification is a powerful DNA method operating at 40 °C. •The combination RPA–ELISA gives excellent performances for high-throughput analysis. •Screening of food safety threats has been done using standard laboratory equipment. •Allergens, GMOs, bacteria, and fungi have been successfully determined. -- Abstract: Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR–ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA–ELISA combination is proposed for amplification at a low, constant temperature (40 °C) in a short time (40 min), for the hybridisation of labelled products to specific 5′-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA–ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA–ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings

  19. Clinical Value of Specific Immunoglobulin E Detection by Enzyme-Linked Immunosorbent Assay in Cases of Acquired and Congenital Toxoplasmosis

    Foudrinier, F.; Villena, I.; Jaussaud, R.; Aubert, D.; Chemla, C.; Martinot, F.; Pinon, J. M.


    The clinical value of immunoenzymatic (enzyme-linked immunosorbent assay) detection of anti-Toxoplasma immunoglobulin E (IgE) was assessed by studying 2,036 sera from 792 subjects, comprising seronegative controls and subjects with acute, active, reactivated, or congenital toxoplasmosis. Included were nonimmunized adults; pregnant women with recently acquired infection (acute toxoplasmosis); immunocompetent subjects with recently acquired severe infection (active toxoplasmosis) expressed as fever, adenopathies, splenomegaly, pneumonia, meningitis, or disseminated infection; subjects—some of them immunocompromised—whose previously moderate IgG antibody levels rose, suggesting a reactivation of quiescent toxoplasmosis; and infants born to seroconverted mothers and evaluated for diagnosis of congenital infection and therapeutic management. Specific IgE antibodies were never detected in seronegative subjects. They were present in 85.7% of asymptomatic seroconverters and in 100% of seroconverters with overt toxoplasmosis, following two different kinetics: in the former, the specific IgE titer generally presented a brief peak 2 to 3 months postinfection and then fell rapidly, whereas specific IgE persisted at a very high titer for several months in the latter. IgE emerged concomitantly with the increase in IgG during toxoplasmic reactivation. For neonatal diagnosis of congenital toxoplasmosis, IgE was less informative than IgM and IgA (sensitivities, 59.5, 64.3, and 76.2%, respectively) and had a specificity of 91.9%. Nevertheless, simultaneous measurement of the three isotypes at birth improved the diagnostic yield to 81% relative to the combination of IgA and IgM. Emergence of specific IgE during postnatal treatment for congenital toxoplasmosis is a sign of poor adherence or inadequate dosing. PMID:12682160

  20. The Diagnosis of Human Fascioliasis by Enzyme-Linked Immunosorbent Assay (ELISA) Using Recombinant Cathepsin L Protease

    Gonzales Santana, Bibiana; Vasquez Camargo, Fabio; Parkinson, Michael


    Background Fascioliasis is a worldwide parasitic disease of domestic animals caused by helminths of the genus Fasciola. In many parts of the world, particularly in poor rural areas where animal disease is endemic, the parasite also infects humans. Adult parasites reside in the bile ducts of the host and therefore diagnosis of human fascioliasis is usually achieved by coprological examinations that search for parasite eggs that are carried into the intestine with the bile juices. However, these methods are insensitive due to the fact that eggs are released sporadically and may be missed in low-level infections, and fasciola eggs may be misclassified as other parasites, leading to problems with specificity. Furthermore, acute clinical symptoms as a result of parasites migrating to the bile ducts appear before the parasite matures and begins egg laying. A human immune response to Fasciola antigens occurs early in infection. Therefore, an immunological method such as ELISA may be a more reliable, easy and cheap means to diagnose human fascioliasis than coprological analysis. Methodology/Principal findings Using a panel of serum from Fasciola hepatica-infected patients and from uninfected controls we have optimized an enzyme-linked immunosorbent assay (ELISA) which employs a recombinant form of the major F. hepatica cathepsin L1 as the antigen for the diagnosis of human fascioliasis. We examined the ability of the ELISA test to discern fascioliasis from various other helminth and non-helminth parasitic diseases. Conclusions/Significance A sensitive and specific fascioliasis ELISA test has been developed. This test is rapid and easy to use and can discriminate fasciola-infected individuals from patients harbouring other parasites with at least 99.9% sensitivity and 99.9% specificity. This test will be a useful standardized method not only for testing individual samples but also in mass screening programs to assess the extent of human fascioliasis in regions where this

  1. The diagnosis of human fascioliasis by enzyme-linked immunosorbent assay (ELISA) using recombinant cathepsin L protease.

    Gonzales Santana, Bibiana; Dalton, John P; Vasquez Camargo, Fabio; Parkinson, Michael; Ndao, Momar


    Fascioliasis is a worldwide parasitic disease of domestic animals caused by helminths of the genus Fasciola. In many parts of the world, particularly in poor rural areas where animal disease is endemic, the parasite also infects humans. Adult parasites reside in the bile ducts of the host and therefore diagnosis of human fascioliasis is usually achieved by coprological examinations that search for parasite eggs that are carried into the intestine with the bile juices. However, these methods are insensitive due to the fact that eggs are released sporadically and may be missed in low-level infections, and fasciola eggs may be misclassified as other parasites, leading to problems with specificity. Furthermore, acute clinical symptoms as a result of parasites migrating to the bile ducts appear before the parasite matures and begins egg laying. A human immune response to Fasciola antigens occurs early in infection. Therefore, an immunological method such as ELISA may be a more reliable, easy and cheap means to diagnose human fascioliasis than coprological analysis. Using a panel of serum from Fasciola hepatica-infected patients and from uninfected controls we have optimized an enzyme-linked immunosorbent assay (ELISA) which employs a recombinant form of the major F. hepatica cathepsin L1 as the antigen for the diagnosis of human fascioliasis. We examined the ability of the ELISA test to discern fascioliasis from various other helminth and non-helminth parasitic diseases. A sensitive and specific fascioliasis ELISA test has been developed. This test is rapid and easy to use and can discriminate fasciola-infected individuals from patients harbouring other parasites with at least 99.9% sensitivity and 99.9% specificity. This test will be a useful standardized method not only for testing individual samples but also in mass screening programs to assess the extent of human fascioliasis in regions where this zoonosis is suspected.

  2. Development of monoclonal antibodies to pre-haptoglobin 2 and their use in an enzyme-linked immunosorbent assay (ELISA).

    Flanagan, J J; Arjomandi, A; Delanoy, M L; Du Paty, E; Galea, P; Laune, D; Rieunier, F; Walker, R P; Binder, S R


    Haptoglobins (HPs) are alpha 2-globulin proteins that bind free hemoglobin in plasma to prevent oxidative damage. HPs are produced as preproteins that are proteolytically cleaved in the ER into alpha and beta chains prior to forming mature, functional tetramers. Two alleles exist in humans (HP1 and HP2), therefore three genotypes are present in the population, i.e., HP1-1, HP2-1, and HP2-2. A biochemical role for nascent haptoglobin 2 (pre-haptoglobin 2 or pre-HP2) as the only known modulator of intestinal permeability has been established. In addition, elevated levels of serum pre-HP2 have been detected in multiple conditions including celiac disease and type I diabetes, which are believed to result in part through dysregulation of the intestinal barrier. In this study, we report the development of a monoclonal antibody that is specific for pre-HP2 with a binding affinity in the nanomolar range. Additional antibodies with specificities for preHP but not mature haptoglobin were also characterized. A sandwich enzyme-linked immunosorbent assay (ELISA) was established and validated. The ELISA showed high specificity for pre-HP2 even in the presence of excess pre-HP1 or mature haptoglobins, and has excellent linearity and inter- and intra-assay reproducibility with a working range from 3.1ng/mL to 200ng/mL. Testing of sera from 76 healthy patients revealed a non-Gaussian distribution of pre-HP2 levels with a mean concentration of 221.2ng/mL (95% CI: 106.5-335.9ng/mL) and a median value of 23.9ng/mL. Compared to current approaches, this ELISA offers a validated, monoclonal-based method with high sensitivity and specificity for measuring pre-HP2 in human serum. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. An enzyme-linked immunosorbent assay (ELISA) for quantification of human collectin 11 (CL-11, CL-K1)

    Selman, L.; Henriksen, M.L.; Brandt, J.; Palarasah, Y.; Waters, A.; Beales, P.L.; Holmskov, U.; Jørgensen, T.J.D.; Nielsen, C.; Skjodt, K.; Hansen, S.


    Collectin 11 (CL-11), also referred to as collectin kidney 1 (CL-K1), is a pattern recognition molecule that belongs to the collectin group of proteins involved in innate immunity. It interacts with glycoconjugates on pathogen surfaces and has been found in complex with mannose-binding lectin-associated serine protease 1 (MASP-1) and/or MASP-3 in circulation. Mutation in the CL-11 gene was recently associated with the developmental syndrome 3MC. In the present study, we established and thoroughly validated a sandwich enzyme-linked immunosorbent assay (ELISA) based on two different monoclonal antibodies. The assay is highly sensitive, specific and shows excellent quantitative characteristics such as reproducibility, dilution linearity and recovery (97.7–104%). The working range is 0.15–34 ng/ml. The CL-11 concentration in two CL-11-deficient individuals affected by the 3MC syndrome was determined to be below 2.1 ng/ml. We measured the mean serum CL-11 concentration to 284 ng/ml in 100 Danish blood donors, with a 95% confidence interval of 269–299 ng/ml. There was no significant difference in the CL-11 concentration measured in matched serum and plasma samples. Storage of samples and repeated freezing and thawing to a certain extent did not influence the ELISA. This ELISA offers a convenient and reliable method for studying CL-11 levels in relation to a variety of human diseases and syndromes. PMID:22301270

  4. Evaluation of an egg yolk enzyme-linked immunosorbent assay antibody test and its use to assess the prevalence of Mycoplasma gallisepticum infection in laying hens in Italy

    Marco Tamba


    Full Text Available The prevalence of Mycoplasma gallisepticum infection in commercial layers was established by the presence of antibodies in eggs. Saline-extracted yolks were used with a commercial enzyme-linked immunosorbent assay kit. For the prevalence study, yolks from 30 eggs were obtained from each of 66 flocks coming from 36 layer farms. The prevalence of egg antibodies to Mycoplasma gallisepticum was 33.3% in single-age farms and 77.8% in multi-age farms. In 27 flocks, antibody titers were compared with results obtained from blood samples taken in the same flock and in the same period and analyzed with the same kit. This study has confirmed that egg yolk enzyme-linked immunosorbent assay antibody test is a suitable and practical approach for assessing the flock prevalence of Mycoplasma gallisepticum infection in layer hens.

  5. Detection of Candida albicans Sap2 in cancer patient serum samples by an indirect competitive enzyme-linked immunosorbent assay for the diagnosis of candidiasis

    Yicun Wang; Xiang Gao; J U Zhi gang; Jingyuan Liu; Shuai Dong; Li Wang


    Background: The secreted aspartyl proteinases 2 (Sap2) of Candida albicans (C. albicans) is a potential marker of candididasis. It is a virulence factor associated with adherence and tissue invasion. Aim: In order to detect Sap2 in clinical sera, we developed an indirect competitive enzyme-linked immunosorbent assay (ELISA). Materials and Methods: Polyclonal antibodies were produced for Sap2 by injecting Sap2 into a New Zealand White inbred rabbit. They could be used at a dilution exceeding 1...

  6. Novel fluorescent probe for highly sensitive bioassay using sequential enzyme-linked immunosorbent assay-capillary isoelectric focusing (ELISA-cIEF).

    Henares, Terence G; Uenoyama, Yuta; Nogawa, Yuto; Ikegami, Ken; Citterio, Daniel; Suzuki, Koji; Funano, Shun-ichi; Sueyoshi, Kenji; Endo, Tatsuro; Hisamoto, Hideaki


    This paper presents a novel rhodamine diphosphate molecule that allows highly sensitive detection of proteins by employing sequential enzyme-linked immunosorbent assay and capillary isoelectric focusing (ELISA-cIEF). Seven-fold improvement in the immunoassay sensitivity and a 1-2 order of magnitude lower detection limit has been demonstrated by taking advantage of the combination of the enzyme-based signal amplification of ELISA and the concentration of enzyme reaction products by cIEF.

  7. Using an enzyme linked immunosorbent assay (ELISA) and a protein phosphatase inhibition assay (PPIA) for the detection of microcystins and nodularins.

    Carmichael, W W; An, J


    Cyanotoxins produced by cyanobacteria (blue-green algae) include potent neurotoxins and hepatotoxins. The hepatotoxins include cyclic peptide microcystins and nodularins plus the alkaloid cylindrospermopsins. Among the cyanotoxins the microcystins have proven to be the most widespread, and are most often implicated in animal and human poisonings. This paper presents a practical guide to two widely used methods for detecting and quantifying microcystins and nodularins in environmental samples-the enzyme linked immunosorbant assay (ELISA) and the protein phosphatase inhibition assay (PPIA).

  8. Multicountry Prospective Clinical Evaluation of Two Enzyme-Linked Immunosorbent Assays and Two Rapid Diagnostic Tests for Diagnosing Dengue Fever

    Dauner, Allison L.; Valks, Andrea; Forshey, Brett M.; Long, Kanya C.; Thaisomboonsuk, Butsaya; Sierra, Gloria; Picos, Victor; Talmage, Sara; Morrison, Amy C.; Halsey, Eric S.; Comach, Guillermo; Yasuda, Chadwick; Loeffelholz, Michael; Jarman, Richard G.; Fernandez, Stefan; An, Ung Sam; Kochel, Tadeusz J.; Jasper, Louis E.; Wu, Shuenn-Jue L.


    We evaluated four dengue diagnostic devices from Alere, including the SD Bioline Dengue Duo (nonstructural [NS] 1 Ag and IgG/IgM), the Panbio Dengue Duo Cassette (IgM/IgG) rapid diagnostic tests (RDTs), and the Panbio dengue IgM and IgG capture enzyme-linked immunosorbent assays (ELISAs) in a prospective, controlled, multicenter study in Peru, Venezuela, Cambodia, and the United States, using samples from 1,021 febrile individuals. Archived, well-characterized samples from an additional 135 febrile individuals from Thailand were also used. Reference testing was performed on all samples using an algorithm involving virus isolation, in-house IgM and IgG capture ELISAs, and plaque reduction neutralization tests (PRNT) to determine the infection status of the individual. The primary endpoints were the clinical sensitivities and specificities of these devices. The SD Bioline Dengue Duo had an overall sensitivity of 87.3% (95% confidence interval [CI], 84.1 to 90.2%) and specificity of 86.8% (95% CI, 83.9 to 89.3%) during the first 14 days post-symptom onset (p.s.o.). The Panbio Dengue Duo Cassette demonstrated a sensitivity of 92.1% (87.8 to 95.2%) and specificity of 62.2% (54.5 to 69.5%) during days 4 to 14 p.s.o. The Panbio IgM capture ELISA had a sensitivity of 87.6% (82.7 to 91.4%) and specificity of 88.1% (82.2 to 92.6%) during days 4 to 14 p.s.o. Finally, the Panbio IgG capture ELISA had a sensitivity of 69.6% (62.1 to 76.4%) and a specificity of 88.4% (82.6 to 92.8%) during days 4 to 14 p.s.o. for identification of secondary dengue infections. This multicountry prospective study resulted in reliable real-world performance data that will facilitate data-driven laboratory test choices for managing patient care during dengue outbreaks. PMID:25588659

  9. High seroprevalence of Mycoplasma pneumoniae IgM in acute Q fever by enzyme-linked immunosorbent assay (ELISA.

    Chung-Hsu Lai

    Full Text Available Q fever is serologically cross-reactive with other intracellular microorganisms. However, studies of the serological status of Mycoplasma pneumoniae and Chlamydophila pneumoniae during Q fever are rare. We conducted a retrospective serological study of M. pneumoniae and C. pneumoniae by enzyme-linked immunosorbent assay (ELISA, a method widely used in clinical practice, in 102 cases of acute Q fever, 39 cases of scrub typhus, and 14 cases of murine typhus. The seropositive (57.8%, 7.7%, and 0%, p<0.001 and seroconversion rates (50.6%, 8.8%, and 0%, p<0.001 of M. pneumoniae IgM, but not M. pneumoniae IgG and C. pneumoniae IgG/IgM, in acute Q fever were significantly higher than in scrub typhus and murine typhus. Another ELISA kit also revealed a high seropositivity (49.5% and seroconversion rate (33.3% of M. pneumoniae IgM in acute Q fever. The temporal and age distributions of patients with positive M. pneumoniae IgM were not typical of M. pneumoniae pneumonia. Comparing acute Q fever patients who were positive for M. pneumoniae IgM (59 cases with those who were negative (43 cases, the demographic characteristics and underlying diseases were not different. In addition, the clinical manifestations associated with atypical pneumonia, including headache (71.2% vs. 81.4%, p=0.255, sore throat (8.5% vs. 16.3%, p=0.351, cough (35.6% vs. 23.3%, p=0.199, and chest x-ray suggesting pneumonia (19.3% vs. 9.5%, p=0.258, were unchanged between the two groups. Clinicians should be aware of the high seroprevalence of M. pneumoniae IgM in acute Q fever, particularly with ELISA kits, which can lead to misdiagnosis, overestimations of the prevalence of M. pneumoniae pneumonia, and underestimations of the true prevalence of Q fever pneumonia.

  10. Evaluation of a competitive enzyme-linked immunosorbent assay for measurements of soluble HLA-G protein.

    Rasmussen, M; Dahl, M; Buus, S; Djurisic, S; Ohlsson, J; Hviid, T V F


    The human leukocyte antigen (HLA) class Ib molecule, HLA-G, has gained increased attention because of its assumed important role in immune regulation. The HLA-G protein exists in several soluble isoforms. Most important are the actively secreted HLA-G5 full-length isoform generated by alternative splicing retaining intron 4 with a premature stop codon, and the cleavage of full-length membrane-bound HLA-G1 from the cell surface, so-called soluble HLA-G1 (sHLA-G1). A specific and sensitive immunoassay for measurements of soluble HLA-G is mandatory for conceivable routine testing and research projects. We report a novel method, a competitive immunoassay, for measuring HLA-G5/sHLA-G1 in biological fluids. The sHLA-G immunoassay is based upon a competitive enzyme-linked immunosorbent assay (ELISA) principle. It includes a recombinant sHLA-G1 protein in complex with β2-microglobulin and a peptide as a standard, biotinylated recombinant sHLA-G1 as an indicator, and the MEM-G/9 anti-HLA-G monoclonal antibody (mAb) as the capture antibody. The specificity and sensitivity of the assay were evaluated. Testing with different recombinant HLA class I proteins and different anti-HLA class I mAbs showed that the sHLA-G immunoassay was highly specific. Optimal combinations of competitor sHLA-G1 and capture mAb concentrations were determined. Two versions of the assay were tested. One with a relatively wide dynamic range from 3.1 to 100.0 ng/ml, and another more sensitive version ranging from 1.6 to 12.5 ng/ml. An intra-assay coefficient of variation (CV) of 15.5% at 88 ng/ml and an inter-assay CV of 23.1% at 39 ng/ml were determined. An assay based on the competitive sHLA-G ELISA may be important for measurements of sHLA-G proteins in several conditions: assisted reproduction, organ transplantation, cancer, and certain pregnancy complications, both in research studies and possibly in the future also for clinical routine use. © 2014 John Wiley & Sons A/S. Published by John Wiley

  11. Enzyme-linked immunosorbent assay characterization of basal variation and heritability of systemic microfibrillar-associated protein 4.

    Susanne Gjørup Sækmose

    Full Text Available BACKGROUND: Microfibrillar-associated protein 4 (MFAP4 is a systemic biomarker that is significantly elevated in samples from patients suffering from hepatic cirrhosis. The protein is generally localized to elastic fibers and other connective tissue fibers in the extracellular matrix (ECM, and variation in systemic MFAP4 (sMFAP4 has the potential to reflect diverse diseases with increased ECM turnover. Here, we aimed to validate an enzyme-linked immunosorbent assay (ELISA for the measurement of sMFAP4 with an emphasis on the robustness of the assay. Moreover, we aimed to determine confounders influencing the basal sMFAP4 variability and the genetic contribution to the basal variation. METHODS: The sandwich ELISA was based on two monoclonal anti-MFAP4 antibodies and was optimized and calibrated with a standard of recombinant MFAP4. The importance of pre-analytical sample handling was evaluated regarding sample tube type, time, and temperature conditions. The mean value structure and variance structure was determined in a twin cohort including 1,417 Danish twins (age 18-67 years by mixed-effect linear regression modeling. RESULTS: The practical working range of the sandwich ELISA was estimated to be 4-75 U/ml. The maximum intra- and inter-assay variation was estimated to be 8.7% and 6.6%, respectively. Sample handling and processing appeared to influence MFAP4 measurements only marginally. The average concentration of sMFAP4 in the serum was 18.9 ± 8.4 (SD U/ml in the twin cohort (95% CI: 18.5-19.4, median sMFAP4 17.3 U/ml. The mean structure model was demonstrated to include waist-hip ratio, age, and cigarette smoking status in interactions with gender. A relatively low heritability of h(2 = 0.24 was found after applying a model including additive genetic factors and shared and non-shared environmental factors. CONCLUSIONS: The described ELISA provides robust measures of the liver fibrosis marker sMFAP4. The low heritability and the relatively

  12. Rapid Determination of Ractopamine Residues in Edible Animal Products by Enzyme-Linked Immunosorbent Assay: Development and Investigation of Matrix Effects

    Yan Zhang


    Full Text Available To determine ractopamine residues in animal food products (chicken muscle, pettitoes, pig muscle, and pig liver, we established a rapid direct competitive enzyme-linked immunosorbent assay (ELISA using a polyclonal antibody generated from ractopamine-linker-BSA. The antibody showed high sensitivity and specificity in phosphate buffer, with an IC50 of 0.6 ng/mL, and the limit of detection was 0.04 ng/mL. The matrix effect of the samples was easily eliminated by one-step extraction with PBS, without any organic solution or clean-up procedure such as SPE or liquid-liquid extraction, making it a much more simple and rapid method than previously reported ones. The detection limit in blank samples was 0.2 μg/kg. To validate this new RAC (ractopamine hydrochloride ELISA, a RAC-free pig liver sample spiked at three different concentrations was prepared and analyzed by HPLC and ELISA. The results showed a good correlation between the data of ELISA and HPLC (R2>0.95, which proves that the established ELISA is accurate enough to quantify the residue of RAC in the animal derived foods.

  13. Rapid determination of ractopamine residues in edible animal products by enzyme-linked immunosorbent assay: development and investigation of matrix effects.

    Zhang, Yan; Wang, Fengxia; Fang, Li; Wang, Shuo; Fang, Guozhen


    To determine ractopamine residues in animal food products (chicken muscle, pettitoes, pig muscle, and pig liver), we established a rapid direct competitive enzyme-linked immunosorbent assay (ELISA) using a polyclonal antibody generated from ractopamine-linker-BSA. The antibody showed high sensitivity and specificity in phosphate buffer, with an IC(50) of 0.6 ng/mL, and the limit of detection was 0.04 ng/mL. The matrix effect of the samples was easily eliminated by one-step extraction with PBS, without any organic solution or clean-up procedure such as SPE or liquid-liquid extraction, making it a much more simple and rapid method than previously reported ones. The detection limit in blank samples was 0.2 mug/kg. To validate this new RAC (ractopamine hydrochloride) ELISA, a RAC-free pig liver sample spiked at three different concentrations was prepared and analyzed by HPLC and ELISA. The results showed a good correlation between the data of ELISA and HPLC (R(2) > 0.95), which proves that the established ELISA is accurate enough to quantify the residue of RAC in the animal derived foods.

  14. Detection of Human Epididymis Protein 4 (HE4) in Human Serum Samples Using a Specific Monoclonal Antibody-Based Sandwich Enzyme-Linked Immunosorbent Assay (ELISA).

    Zhou, Lijun; Lv, Zhiqiang; Shao, Jing; Xu, Ying; Luo, Xiaohong; Zhang, Yuming; Hu, Yang; Zhang, Wenji; Luo, Shuhong; Fang, Jianmin; Wang, Ying; Duan, Chaohui; Huang, Ruopan


    The human epididymis protein 4 (HE4) may have high specificity in the detection of malignant diseases, making the development of an immunoassay for HE4 essential. In our study, a fusion gene was constructed encoded with the HE4 protein. This protein was then produced in the bacterial cells (Escherichia coli) and used to immunize mice in order to eventually generate hybridomas specific to HE4. The hybridoma supernatants were then screened, and four positive anti-HE4 cell lines were selected. These cell lines produce monoclonal antibodies against HE4 epitopes, as demonstrated in the Western blot as well as by direct enzyme-linked immunosorbent assay (ELISA). Using the developed antibodies, we successfully identified several good antibody pairs from the hybridomas, which allowed for the development of a sandwich ELISA to measure HE4 levels. By using the HE4 ELISA, we measured HE4 levels of 60 clinical human serum samples. Compared with the Food and Drug Administration (FDA) approved kit (Roche), our results showed a strong positive correlation to those of the FDA-approved kit. In summary, highly sensitive antibody pairs were screened against HE4, and a sandwich ELISA was developed as an accurate analytical tool for the detection of HE4 in human serum, which could be especially valuable for diagnosing ovarian carcinomas. © 2015 Wiley Periodicals, Inc.

  15. A simple, specific high-throughput enzyme-linked immunosorbent assay (ELISA) for quantitative determination of melatonin in cell culture medium.

    Li, Ye; Cassone, Vincent M


    A simple, specific, high-throughput enzyme-linked immunosorbent assay (ELISA) for quantitative determination of melatonin was developed for directly measuring melatonin in cell culture medium with 10% FBS. This assay adopts a commercial monoclonal melatonin antibody and melatonin-HRP conjugate, so it can be applied in multiple labs rapidly with low cost compared with commercial RIA and ELISA kits. In addition, the procedure is much simpler with only four steps: 1) sample/conjugate incubation, 2) plate washing, 3) TMB color reaction and 4) reading of results. The standards of the assay cover a wide working range from 100 pg/mL to 10 ng/mL. The sensitivity was 68 pg/mL in cell culture medium with 10% FBS and 26 pg/mL in PBS with as little as 25 μL sample volume. The recovery of melatonin from cell culture medium was 101.0%. The principal cross-reacting compound was 5-methoxytryptophol (0.1%). The variation coefficients of the assay, within and between runs, ranged between 6.68% and 15.76% in cell culture medium. The mean linearity of a series diluted cell culture medium sample was 105% (CV=5%), ranging between 98% and 111%, y=5.5263x+0.0646, R(2)=0.99. The assay enables small research and teaching labs to reliably measure this important neurohormone. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Comparison of Laboratory-Developed and Commercial Monoclonal Antibody-Based Sandwich Enzyme-Linked Immunosorbent Assays for Almond (Prunus dulcis) Detection and Quantification.

    Liu, Changqi; Chhabra, Guneet S; Zhao, Jing; Zaffran, Valerie D; Gupta, Sahil; Roux, Kenneth H; Gradziel, Thomas M; Sathe, Shridhar K


    A commercially available monoclonal antibody (mAb)-based direct sandwich enzyme-linked immunosorbent assay (ELISA) kit (BioFront Technologies, Tallahassee, Fla., U.S.A.) was compared with an in-house developed mAb 4C10-based ELISA for almond detection. The assays were comparable in sensitivity (limit of detection almond, limit of quantification almond), specificity (no cross-reactivity with 156 tested foods at a concentration of 100000 ppm whole sample), and reproducibility (intra- and interassay variability almond seeds subjected to autoclaving, blanching, frying, microwaving, and dry roasting. The almond recovery ranges for spiked food matrices were 84.3% to 124.6% for 4C10 ELISA and 81.2% to 127.4% for MonoTrace ELISA. The almond recovery ranges for commercial and laboratory prepared foods with declared/known almond amount were 30.9% to 161.2% for 4C10 ELISA and 38.1% to 207.6% for MonoTrace ELISA. Neither assay registered any false-positive or negative results among the tested commercial and laboratory prepared samples. Ability to detect and quantify trace amounts of almonds is important for improving safety of almond sensitive consumers. Two monoclonal antibody-based ELISAs were compared for almond detection. The information is useful to food industry, regulatory agencies, scientific community, and almond consumers. © 2017 Institute of Food Technologists®.

  17. Semiquantitative determination of ergot alkaloids in seed, straw, and digesta samples using a competitive enzyme-linked immunosorbent assay.

    Schnitzius, J M; Hill, N S; Thompson, C S; Craig, A M


    Ergot alkaloids present in endophyte-infected (E+) tall fescue cause fescue toxicosis and other toxic effects in livestock that consume infected plant tissue, leading to significant financial losses in livestock production each year. The predominant method currently in use for quantifying ergot alkaloid content in plant tissue is through high-performance liquid chromatography (HPLC), which quantifies the amount of ergovaline, one of many ergot alkaloids in E+ plant tissue. The enzyme-linked immunosorbent assay (ELISA) method used in this study detects quantities of nonspecific ergot alkaloids and therefore accounts for greater amounts of the total ergot alkaloid content in E+ tissue than does HPLC. The ELISA can also be used to more expediently analyze a larger number of forage samples without sophisticated and costly analytical equipment and therefore could be more desirable in a diagnostic setting. The purpose of this study was to evaluate the between-day and within-run variability of the ELISA and to determine the binding efficiency of 6 ergot alkaloids to the 15F3.E5 antibody used in the competitive ELISA to ascertain its feasibility as a quick analysis tool for ergot alkaloids. Straw samples had an average coefficient of variation (CV) for concentration of 10.2% within runs and 18.4% between runs, and the seed samples had an average CV for concentration of 13.3% within runs and 24.5% between runs. The grass tissue-based lysergic acid standard curve calculated from the ELISA had an average r2 of 0.99, with a CV of 2.1%. Ergocryptine, ergocristine, ergocornine, and ergotamine tartrate did not bind strongly to the 15F3.E5 antibody because of the presence of large side groups on these molecules, which block their binding to the antibody, whereas ergonovine and ergonovine maleate were bound much more efficiently because of their structural similarity to lysergic acid. Clarified rumen fluid was tested as an additional matrix for use in the ergot alkaloid competitive

  18. Generation of monoclonal antibodies against peptidylarginine deiminase 2 (PAD2) and development of a PAD2-specific enzyme-linked immunosorbent assay

    Damgaard, Dres; Palarasah, Yaseelan; Skjødt, Karsten


    The enzyme peptidylarginine deiminase 2 (PAD2) has been associated with inflammatory diseases, such as rheumatoid arthritis and neurodegenerative diseases including multiple sclerosis. To investigate the association of various diseases with extracellular PAD2, we raised monoclonal antibodies (m......Abs) against rabbit PAD2 and evaluated their cross-reactivity with human PAD2 by indirect enzyme-linked immunosorbent assay (ELISA), western blotting and immunohistological staining of inflamed synovial tissue. Moreover, we established a sandwich ELISA detecting human PAD2, based on two different monoclonal...... diseases....

  19. Quantitation of pulmonary surfactant protein SP-B in the absence or presence of phospholipids by enzyme-linked immunosorbent assay

    Oviedo, J M; Valiño, F; Plasencia, I


    We have developed an enzyme-linked immunosorbent assay (ELISA) that uses polyclonal or monoclonal anti-surfactant protein SP-B antibodies to quantitate purified SP-B in chloroform/methanol and in chloroform/methanol extracts of whole pulmonary surfactant at nanogram levels. This method has been...... used to explore the effect of the presence of different phospholipids on the immunoreactivity of SP-B. Both polyclonal and monoclonal antibodies produced reproducible ELISA calibration curves for methanolic SP-B solutions with protein concentrations in the range of 20-1000 ng/mL. At these protein...

  20. Detection of Antibodies to U.S. Isolates of Avian Pneumovirus by a Recombinant Nucleocapsid Protein-Based Sandwich Enzyme-Linked Immunosorbent Assay

    Gulati, Baldev R.; Munir, Shirin; Patnayak, Devi P.; Goyal, Sagar M.; Kapur, Vivek


    The nucleocapsid (N) protein of subgroup C (United States-specific) avian pneumovirus (APV/US) was expressed in Escherichia coli, and antibodies to the recombinant N protein were shown to specifically recognize the ≈47-kDa N protein of APV/US by Western immunoblot analysis. The recombinant APV/US N protein was used in a sandwich-capture enzyme-linked immunosorbent assay (ELISA), and the resulting assay was found to be more sensitive and specific than the routine indirect ELISA for the detecti...

  1. Quantification of urinary 5-hydroxyindoleacetic acid by in-house nitrosonaphthol reaction compared with nitrosonaphthol micro column chromatography and enzyme-linked immunosorbent assay

    Joyce Matie Kinoshita da Silva


    Full Text Available The aim of this study was to compare the colorimetric "kit" and enzyme-linked immunosorbent assay (ELISA methods to quantify urinary 5-hydroxyindoleacetic acid through the Goldenberg's technique, exploring the potential of replacing it. 24-hour urine samples were tested by Goldenberg's assay and compared with kits. The agreement was almost perfect for the comparison of Goldenberg's assay with both colorimetric kit, and with ELISA kit, considering ≤ 7.5 mg/24h normal cutoff value. Therefore, both "kits" would be good alternatives to Goldenberg's technique due to practicality and agreement between values.

  2. Comparison of electron microscopy, enzyme-linked immunosorbent assay, solid-phase radioimmunoassay, and indirect immunofluorescence for detection of human rotavirus antigen in faeces

    Birch, C J; Lehmann, N I; Hawker, A J; Marshall, J A; Gust, I D [Fairfield Hospital for Communicable Diseases, Victoria (Australia). Virology Dept.


    Four techniques were compared for their practicability, speed, and sensitivity for the detection of human rotavirus. Radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) were found to be the most sensitive means of identifying rotavirus and, once processed, up to 40 specimens could be examined daily. Electron microscopy, although less sensitive than these techniques, had the advantage of being able to detect other viral agents present in faecal extracts. Indirect immunofluorescence failed to detect rotavirus as often as the other three methods. In laboratories where routine examination of faecal specimens from patients with gastroenteritis is required, ELISA and RIA are useful alternatives to electron microscopy.

  3. Comparison of enzyme-linked immunosorbent assay, radioimmunoassay, complement fixation, anticomplement immunofluorescence and passive haemaglutination techniques for detecting cytomegalovirus IgG antibody

    Booth, J C; Hannington, G; Bakir, T M.F.; Stern, H; Kangro, H; Griffiths, P D; Heath, R B [Saint George' s Hospital Medical School, London (UK); Saint Bartholomew' s Hospital, London (UK))


    The radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) techniques were found to be comparable in sensitivity and specificity for detecting cytomegalovirus IgG antibody, and 10 to 100 times more sensitive than complement-fixation (CF), anticomplement immunofluorescence (ACIF) and passive haemagglutination (PHA). In screening tests for antibody, the frequency of false-positive and -negative results was 0.6% for RIA and ELISA, 1.5% for CF, 1.6% for ACIF and 3.6% for PHA. PHA was the least satisfactory test, largely because of technical problems.

  4. Detection of H5 Avian Influenza Viruses by Antigen-Capture Enzyme-Linked Immunosorbent Assay Using H5-Specific Monoclonal Antibody▿

    He, Qigai; Velumani, Sumathy; Du, Qingyun; Lim, Chee Wee; Ng, Fook Kheong; Donis, Ruben; Kwang, Jimmy


    The unprecedented spread of highly pathogenic avian influenza virus subtype H5N1 in Asia and Europe is threatening animals and public health systems. Effective diagnosis and control management are needed to control the disease. To this end, we developed a panel of monoclonal antibodies (MAbs) against the H5N1 avian influenza virus (AIV) and implemented an antigen-capture enzyme-linked immunosorbent assay (AC-ELISA) to detect the H5 viral antigen. Mice immunized with denatured hemagglutinin (H...

  5. Comparison of electron microscopy, enzyme-linked immunosorbent assay, solid-phase radioimmunoassay, and indirect immunofluorescence for detection of human rotavirus antigen in faeces

    Birch, C.J.; Lehmann, N.I.; Hawker, A.J.; Marshall, J.A.; Gust, I.D.


    Four techniques were compared for their practicability, speed, and sensitivity for the detection of human rotavirus. Radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) were found to be the most sensitive means of identifying rotavirus and, once processed, up to 40 specimens could be examined daily. Electron microscopy, although less sensitive than these techniques, had the advantage of being able to detect other viral agents present in faecal extracts. Indirect immunofluorescence failed to detect rotavirus as often as the other three methods. In laboratories where routine examination of faecal specimens from patients with gastroenteritis is required, ELISA and RIA are useful alternatives to electron microscopy. (author)

  6. Development of an enzyme-linked immunosorbent assay for seven sulfonamide residues and investigation of matrix effects from different food samples.

    Zhang, Hongyan; Wang, Lei; Zhang, Yan; Fang, Guozhen; Zheng, Wenjie; Wang, Shuo


    Direct competitive enzyme-linked immunosorbent assays (ELISA) were developed to detect a broad range of sulfonamides in various matrices. Screening for this class of antibiotics in pig muscle, chicken muscle, fish, and egg extracts was accomplished by simple, rapid extraction methods carried out with only phosphate-buffered saline (PBS) buffer. Twenty milliliters of extract solution was added to 4 g of sample to extract the sulfonamide residues, and sample extracts diluted with assay buffer were directly analyzed by ELISA; matrix effects could be avoided with 1:5 dilution of pig muscle, chicken muscle, and egg extracts with PBS and 1:5 dilution of fish extract with 1% bovine serum albumin (BSA)-PBS. For liver sample, the extraction method was a little more complicated; 2 g of sample was added to 20 mL of ethanol, mixed, and then centrifuged. The solvent of 10 mL of the upper liquid was removed, and the residues were dissolved in 10 mL of PBS and then filtered; the filtrate was diluted two-fold with 0.5% BSA-PBS for ELISA. These common methods were able to detect seven sulfonamide residues such as sulfisozole, sulfathiazole, sufameter, sulfamethoxypyridazine, sulfapyridine, sulfamethizole, and sulfachlorpyridazine in pig muscle, liver, chicken muscle, egg, and fish. The assay's detection limits for these compounds were less than 100 microg kg-1. Various extraction methods were tested, and the average recovery (n=3) of 100 microg kg-1 for the matrices was found to range from 77.3 to 123.7%.

  7. Management of bacterial kidney disease in Chinook Salmon hatcheries based on broodstock testing by enzyme-linked immunosorbent assay: A multiyear study

    Munson, A. Douglas; Elliott, Diane G.; Johnson, Keith


    From the mid-1980s through the early 1990s, outbreaks of bacterial kidney disease (BKD) caused by Renibacterium salmoninarum continued in Chinook salmon Oncorhynchus tshawytscha in Idaho Department of Fish and Game (IDFG) hatcheries despite the use of three control methods: (1) injection of returning adult fish with erythromycin to reduce prespawning BKD mortality and limit vertical transmission of R. salmoninarum, (2) topical disinfection of green eggs with iodophor, and (3) prophylactic treatments of juvenile fish with erythromycin-medicated feed. In addition, programs to manage BKD through measurement of R. salmoninarum antigen levels in kidney tissues from spawning female Chinook salmon by an enzyme-linked immunosorbent assay (ELISA) were tested over 13–15 brood years at three IDFG hatcheries. The ELISA results were used for either (1) segregated rearing of progeny from females with high ELISA optical density (OD) values (usually ≥0.25), which are indicative of high R. salmoninarum antigen levels, or (2) culling of eggs from females with high ELISA OD values. The ELISA-based culling program had the most profound positive effects on the study populations. Mortality of juvenile fish during rearing was significantly lower at each hatchery for brood years derived from culling compared with brood years for which culling was not practiced. The prevalence of R. salmoninarum in juvenile fish, as evidenced by detection of the bacterium in kidney smears by the direct fluorescent antibody test, also decreased significantly at each hatchery. In addition, the proportions of returning adult females with kidney ELISA OD values of 0.25 or more decreased 56–85% for fish reared in brood years during which culling was practiced, whereas the proportions of ELISA-negative adults increased 55–58%. This management strategy may allow IDFG Chinook salmon hatcheries to reduce or eliminate prophylactic erythromycin-medicated feed treatments. We recommend using ELISA


    . Sukenda


    Full Text Available ABSTRACTAn indirect enzyme-linked immunosorbent assay (ELISA was used to detect serum antibody in ayu, Plecoglossus altivelis, immunized against Pseudomonasplecoglossicida by immersion vaccination.  First, the procedure of the ELISA was optimized and the sensitivity was checked.  Secondly, the formalin-killed cells (FKC of P. plecoglossicida was administered to ayu by immersion vaccination.  Two weeks after vaccination, fish were divided into two groups, one group was given booster.  The level of specific antibody production of both boostered and vaccinated only fish were statistically higher than unvaccinated control fish at the time of each blood collection.  However, the differences between the boostered and vaccinated only fish were not statistically significant.Keywords :  immunization, Pseudomonas plecoglossicida, ayu, ELISA ABSTRAKIndirect enzyme-linked immunosorbent assay (ELISA digunakan untuk mendeteksi antibodi pada ayu, Plecoglossus altivelis, yang diimunisasi dengan cara perendaman untuk melawan infeksi Pseudomonas plecoglossicida.  Pertama, prosedur ELISA dioptimasikan dan sensitivitas dari metode ini juga diperiksa.  Kemudian, bakteri Plecoglossus altivelis yang sudah dimatikan dengan formalin diberikan ke ikan ayu dengan vaksinasi perendaman.  Dua minggu setelah vaksinasi, ikan dibagi menjadi dua kelompok, satu kelompok diberi vaksinasi kedua.  Produksi antibodi spesifik dari ikan-ikan yang divaksinasi satu kali dengan vaksinasi dua kaii secara statistik lebih tinggi dibandingkan dengan control.  Akan tetapi, tidak ada perbedaan produksi antibodi antara ikan yarig divaksanisi satu kali dengan divaksinasi dua kali.Kata kunci :  imunisasi, Pseudomonasplecoglossicida, ayu, ELISA

  9. Development of a biomimetic enzyme-linked immunosorbent assay based on molecularly imprinted polymers on paper for the detection of carbaryl.

    Zhang, Can; Cui, Hanyu; Han, Yufeng; Yu, Fangfang; Shi, Xiaoman


    A biomimetic enzyme-linked immunosorbent assay (BELISA) which was based on molecularly imprinted polymers on paper (MIPs-paper) with specific recognition was developed. As a detector, the surface of paper was modified with γ-MAPS by hydrolytic action and anchored the MIP layer on γ-MAPS modified-paper by copolymerization to construct the artificial antibody Through a series of experimentation and verification, we successful got the MIPs-paper and established BELISA for the detection of carbaryl. The development of MIPs-paper based on BELISA was applied to detect carbaryl in real samples and validated by an enzyme-linked immunosorbent assay (ELISA) based on anti-carbaryl biological antibody. The results of these two methods (BELISA and ELISA) were well correlated (R 2 =0.944). The established method of MIPs-paper BELISA exhibits the advantages of low cost, higher stability and being re-generable, which can be applied as a convenient tool for the fast and efficient detection of carbaryl. Copyright © 2017. Published by Elsevier Ltd.

  10. Development and evaluation of a Sarcocystis neurona-specific IgM capture enzyme-linked immunosorbent assay.

    Murphy, J E; Marsh, A E; Reed, S M; Meadows, C; Bolten, K; Saville, W J A


    Equine protozoal myeloencephalitis (EPM) is a serious neurologic disease of horses caused primarily by the protozoal parasite Sarcocystis neurona. Currently available antemortem diagnostic testing has low specificity. The hypothesis of this study was that serum and cerebrospinal fluid (CSF) of horses experimentally challenged with S neurona would have an increased S neurona-specific IgM (Sn-IgM) concentration after infection, as determined by an IgM capture enzyme linked immunoassay (ELISA). The ELISA was based on the S neurona low molecular weight protein SNUCD-1 antigen and the monoclonal antibody 2G5 labeled with horseradish peroxidase. The test was evaluated using serum and CSF from 12 horses experimentally infected with 1.5 million S neurona sporocysts and 16 horses experimentally infected with varying doses (100 to 100,000) of S neurona sporocysts, for which results of histopathologic examination of the central nervous system were available. For horses challenged with 1.5 million sporocysts, there was a significant increase in serum Sn-IgM concentrations compared with values before infection at weeks 2-6 after inoculation (P neurona, there were significant increases in serum Sn-IgM concentration at various points in time after inoculation, depending on the challenge dose (P < .01). In addition, there was a significant increase between the CSF Sn-IgM concentrations before and after inoculation (P < .0001). These results support further evaluation of the assay as a diagnostic test during the acute phase of EPM.

  11. Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

    Wischhusen, Jennifer; Padilla, Frederic


    Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  12. Comparison of Bovine coronavirus-specific and Bovine respiratory syncytial virus-specific antibodies in serum versus milk samples detected by enzyme-linked immunosorbent assay.

    Ohlson, Anna; Blanco-Penedo, Isabel; Fall, Nils


    Bovine coronavirus (BCV; Betacoronavirus 1) and Bovine respiratory syncytial virus (BRSV) are significant causes of enteric and respiratory disease in beef and dairy cattle throughout the world. Indirect enzyme-linked immunosorbent assays are widely used to detect serum antibodies for herd monitoring and prevalence studies. In dairy herds, milk is more readily collected than serum. Hence, in order to investigate the test agreement between serum and milk, both serum and milk samples from 105 cows in 27 dairy herds were analyzed in parallel for presence of immunoglobulin G antibodies to BCV and BRSV. The Bland-Altman analyses of data demonstrated good agreement between serum and milk antibody titers for both viruses. The results indicate milk samples are sufficient for surveillance of antibodies to BCV and BRSV.

  13. Detection of Candida albicans Sap2 in cancer patient serum samples by an indirect competitive enzyme-linked immunosorbent assay for the diagnosis of candidiasis

    Yicun Wang


    Full Text Available Background: The secreted aspartyl proteinases 2 (Sap2 of Candida albicans (C. albicans is a potential marker of candididasis. It is a virulence factor associated with adherence and tissue invasion. Aim: In order to detect Sap2 in clinical sera, we developed an indirect competitive enzyme-linked immunosorbent assay (ELISA. Materials and Methods: Polyclonal antibodies were produced for Sap2 by injecting Sap2 into a New Zealand White inbred rabbit. They could be used at a dilution exceeding 1:1200 in an indirect ELISA, and detected Sap2 concentration up to 1 ng/mL. Results: Of the 286 cancer serum samples tested, 16.8% were found as candidiasis. The test was simple and economical to perform and had a level of sensitivity for detection of low-titer positive sera; thus, it may be proven to be of value in epidemiological studies on candidiasis.

  14. Detection of Candida albicans Sap2 in cancer patient serum samples by an indirect competitive enzyme-linked immunosorbent assay for the diagnosis of candidiasis.

    Wang, Yicun; Gao, Xiang; Zhi Gang, J U; Liu, Jingyuan; Dong, Shuai; Wang, Li


    The secreted aspartyl proteinases 2 (Sap2) of Candida albicans (C. albicans) is a potential marker of candididasis. It is a virulence factor associated with adherence and tissue invasion. In order to detect Sap2 in clinical sera, we developed an indirect competitive enzyme-linked immunosorbent assay (ELISA). Polyclonal antibodies were produced for Sap2 by injecting Sap2 into a New Zealand White inbred rabbit. They could be used at a dilution exceeding 1:1200 in an indirect ELISA, and detected Sap2 concentration up to 1 ng/mL. Of the 286 cancer serum samples tested, 16.8% were found as candidiasis. The test was simple and economical to perform and had a level of sensitivity for detection of low-titer positive sera; thus, it may be proven to be of value in epidemiological studies on candidiasis.

  15. Seroprevalence study of Equine rhinitis B virus (ERBV) in Australian weanling horses using serotype-specific ERBV enzyme-linked immunosorbent assays.

    Horsington, Jacquelyn; Hartley, Carol A; Gilkerson, James R


    Respiratory infections are a major burden in the performance horse industry. Equine rhinitis B virus (ERBV) has been isolated from horses displaying clinical respiratory disease, and ERBV-neutralizing antibodies have been detected in 50-80% of horses in reported surveys. Current ERBV isolation and detection methods may underestimate the number of ERBV-positive animals and do not identify multiple serotype infections. The aim of the current study was to develop a serotyping ERBV antibody-detection enzyme-linked immunosorbent assay (ELISA) and examine the seroprevalence of ERBV in a group of Australian weanling horses. ELISAs with high sensitivity and specificity were developed. The seroprevalence of ERBV in the weanling horses was high (74-86%); ERBV-3 antibodies were most prevalent (58-62%) and ERBV-2 antibodies were least prevalent (10-16%). Many horses were seropositive to 2 or more serotypes. All 3 serotypes of ERBV were detected, and concurrent positivity to multiple serotypes was common.

  16. An enzyme-linked immunosorbent assay for monoester-type aconitic alkaloids and its application in the pharmacokinetic study of benzoylhypaconine in rats.

    Liu, Can-Can; Xu, Yun-Hui; Yuan, Shuai; Xu, Yu; Hua, Mo-Li


    A new enzyme-linked immunosorbent assay (ELISA) method for quantitative determination of monoester-type aconitic alkaloids was developed. The antibodies derived from the immunogen of benzoylmesaconine (BM) could be electively affined to benzoylaconitine-type alkaloids with an ester bond (14-benzoyl-), especially to benzoylhypaconine (BH, 140.02% of cross-reactivity). The effective working range of BH was 1 ng/ml to 5 μg/ml; the lower limit of detection and the quantification were 0.35 and 0.97 ng/ml, respectively. The values of CV for intra-day and inter-day assays and recovery ratios were in acceptable ranges. The results of stability experiments were also satisfactory. This validated method was employed for pharmacokinetic study of BH in rats and the bioavailability orally administered was estimated to be 16.3%.

  17. Development and evaluation of a blocking enzyme-linked immunosorbent assay and virus neutralization assay to detect antibodies to viral hemorrhagic septicemia virus

    Wilson, Anna; Goldberg, Tony; Marcquenski, Susan; Olson, Wendy; Goetz, Frederick; Hershberger, Paul; Hart, Lucas M.; Toohey-Kurth, Kathy


    Viral hemorrhagic septicemia virus (VHSV) is a target of surveillance by many state and federal agencies in the United States. Currently, the detection of VHSV relies on virus isolation, which is lethal to fish and indicates only the current infection status. A serological method is required to ascertain prior exposure. Here, we report two serologic tests for VHSV that are nonlethal, rapid, and species independent, a virus neutralization (VN) assay and a blocking enzyme-linked immunosorbent assay (ELISA). The results show that the VN assay had a specificity of 100% and sensitivity of 42.9%; the anti-nucleocapsid-blocking ELISA detected nonneutralizing VHSV antibodies at a specificity of 88.2% and a sensitivity of 96.4%. The VN assay and ELISA are valuable tools for assessing exposure to VHSV.

  18. Development and Validation of an Enzyme-Linked Immunosorbent Assay for the Detection of Binding Anti-Drug Antibodies against Interferon Beta

    Ingenhoven, Kathleen; Kramer, Daniel; Jensen, Poul Erik Hyldgaard


    to be 26 ng/mL using commercially available polyclonal rabbit antihuman IFN-β in human sera as the positive control. CONCLUSION: An ultrasensitive ELISA for IFN-β-binding ADA testing has been validated. This will form the basis to assess anti-biopharmaceutical immunization toward IFN-β with regards to its......OBJECTIVE: To develop and validate a method for the detection of binding anti-drug antibodies (ADAs) against interferon beta (IFN-β) in human serum as part of a European initiative (ABIRISK) aimed at the prediction and analysis of clinical relevance of anti-biopharmaceutical immunization...... to minimize the risk. METHOD: A two-tiered bridging enzyme-linked immunosorbent assay (ELISA) format was selected and validated according to current recommendations. Screening assay: ADA in serum samples form complexes with immobilized IFN-β and biotinylated IFN-β, which are then detected using HRP labeled...

  19. Enzyme-linked immunosorbent serum assay specific for the 7S domain of Collagen Type IV (P4NP 7S)

    Leeming, Diana J; Nielsen, Mette J; Dai, Yueqin


    Aim:  The present study describes the ability of a newly developed N-terminal pro-peptides of type IV collagen 7S domain (P4NP 7S) competitive enzyme-linked immunosorbent assay (ELISA) for describing liver fibrosis. The assay applies a monoclonal antibody specific for a PIVNP 7S epitope 100...... were significantly elevated in rat with liver fibrosis as seen by histology (CCL4: 283% elevated in the highest quartile of total hepatic collagen compared with controls, P = 0.001; BDL: 183% elevated at week 4 compared with sham, P type IV collagen...... expression in BDL rats (r = 0.49, P serum assay specific for P4NP 7S was highly related to liver fibrosis...

  20. Development of a monoclonal antibody-based, congener-specific and solvent-tolerable direct enzyme-linked immunosorbgent assay for the detection of 2,2',4,4'-tetrabromodiphenyl ether in environmental samples

    A sensitive direct enzyme-linked immunosorbent assay (ELISA) for the detection of 2,2',4,4'-tetrabromodiphenyl ether (BDE-47) in environmental samples was developed. A hapten mimicking the whole structure of BDE-47 was synthesized by introducing a butyric acid spacer to 5-hydroxy-BDE-47 and coupled ...

  1. Detection of Giardia duodenalis antigen in human fecal eluates by enzyme-linked immunosorbent assay using polyclonal antibodies

    Sofía Duque-Beltrán


    Full Text Available The present study developed and standardized an enzime-linked immunosorbent assay (ELISA to detect Giardia antigen in feces using rabbit polyclonal antibodies. Giardia cysts were purified from human fecal samples by sucrose and percoll gradients. Gerbils (Meriones unguiculatus were infected to obtain trophozoites. Rabbits were inoculated with either cyst or trophozoite antigens of 14 Colombian Giardia isolates to develop antibodies against the respective stages. The IgG anti-Giardia were purified by sequential caprylic acid and ammonium sulfate precipitation. A portion of these polyclonal antibodies was linked to alkaline phosphatase (conjugate. One hundred and ninety six samples of human feces, from different patients, were tested by parasitologic diagnosis: 69 were positive for Giardia cysts, 56 had no Giardia parasites, and 71 revealed parasites other than Giardia. The optimal concentration of polyclonal antibodies for antigen capture was 40 µg/ml and the optimal conjugate dilution was 1:100. The absorbance cut-off value was 0.24. The parameters of the ELISA test for Giardia antigen detection were: sensitivity, 100% (95% CI: 93.4-100%; specificity, 95% (95% CI: 88.6-97.6%; positive predictive value, 91% (95% CI: 81.4-95.9%; and negative predictive value, 100% (95% CI: 96.1-100%. This ELISA will improve the diagnosis of Giardia infections in Colombia and will be useful in following patients after treatment.

  2. Glypican-3 level assessed by the enzyme-linked immunosorbent assay is inferior to alpha-fetoprotein level for hepatocellular carcinoma diagnosis.

    Jeon, Yejoo; Jang, Eun Sun; Choi, Yun Suk; Kim, Jin-Wook; Jeong, Sook-Hyang


    Glypican-3 (GPC3) protein is highly expressed in hepatocellular carcinoma (HCC) tissue. It has been suggested as a diagnostic biomarker, but its inconsistent performance means that it requires further assessment. We therefore investigated the diagnostic value of the plasma GPC3 level compared to the alpha-fetoprotein (AFP) level as a diagnostic biomarker of HCC. We enrolled 157 consecutive patients with newly diagnosed HCC and 156 patients with liver cirrhosis (LC) as the control group. GPC3 plasma levels were measured using two commercially available enzyme-linked immunosorbent assays (ELISAs, named as Assay 1 and 2), and AFP levels were measured using an enzyme-linked chemiluminescent immunoassay. The diagnostic accuracy was analyzed using the receiver operating characteristics (ROC) curve. Plasma GPC3 levels in HCC patients were very low (0-3.09 ng/mL) in Assay 1, while only 3 of the 157 patients (1.9%) showed detectable GPC3 levels in Assay 2. The median GPC3 level was not significantly elevated in the HCC group (0.80 ng/mL) compared with the LC group (0.60 ng/mL). The area under the ROC curve (AUC) for GPC3 was 0.559 in Assay 1. In contrast, the median AFP level was significantly higher in HCC (27.72 ng/mL) than in LC (4.74 ng/mL), with an AUC of 0.729. The plasma level of GPC3 is a poor diagnostic marker for HCC, being far inferior to AFP. The development of a consistent detection system for the blood level of GPC3 is warranted.

  3. The Effect of Different Methods of Fermentation on the Detection of Milk Protein Residues in Retail Cheese by Enzyme-Linked Immunosorbent Assay (ELISA).

    Ivens, Katherine O; Baumert, Joseph L; Hutkins, Robert L; Taylor, Steve L


    Milk and milk products are among the most important allergenic food ingredients, both in the United States and throughout the world; cheeses are among the most important of these milk products. Milk contains several major antigenic proteins, each with differing susceptibilities to proteolytic enzymes. The extent of proteolysis in cheese varies as a result of conditions during manufacture and ripening. Proteolysis has the potential to degrade antigenic and allergenic epitopes that are important for residue detection and elicitation of allergic reactions. Commercial enzyme-linked immunosorbent assays (ELISAs) are not currently validated for use in detecting residues in hydrolyzed or fermented food products. Eighteen retail cheeses produced using 5 different styles of fermentation were investigated for detectable milk protein residues with 4 commercial ELISA kits. Mozzarella, Swiss, Blue, Limburger, and Brie cheeses were assessed. The Neogen Veratox® Casein and Neogen Veratox® Total Milk kits were capable of detecting milk residues in most cheeses evaluated, including blue-veined cheeses that exhibit extensive proteolysis. The other 2 ELISA kits evaluated, r-Biopharm® Fast Casein and ELISA Systems™ Casein, can detect milk residues in cheeses other than blue-veined varieties. ELISA results cannot be quantitatively compared among kits. The quantitative reliability of ELISA results in detection of cheese residues is questionable, but some methods are sufficiently robust to use as a semi-quantitative indication of proper allergen control for the validation of cleaning programs in industry settings. Many commercially available enzyme-linked immunosorbent assays (ELISAs) are not validated for detection of allergenic residues in fermented or hydrolyzed products. This research seeks to determine if commercial milk ELISAs can detect milk residues in varieties of cheese that have undergone different styles of fermentation and different degrees of proteolysis. Only certain

  4. A novel marker for assessment of liver matrix remodeling: An enzyme-linked immunosorbent assay (ELISA) detecting a MMP generated type I collagen neo-epitope (C1M)

    Leeming, Diana Julie; He, Y.; Veidal, S. S.


    A competitive enzyme-linked immunosorbent assay (ELISA) for detection of a type I collagen fragment generated by matrix metalloproteinases (MMP) -2, -9 and -13, was developed (CO1-764 or C1M). The biomarker was evaluated in two preclinical rat models of liver fibrosis: bile duct ligation (BDL) an...

  5. Enzyme-linked immunosorbent assay using a virus type-specific peptide based on a subdomain of envelope protein e(rns) for serologic diagnosis of pestivirus infections in swine

    Langedijk, J.P.; Middel, W.G.; Meloen, R.H.; Kramps, J.A.; Smit, de J.A.


    Peptides deduced from the C-terminal end (residues 191 to 227) of pestivirus envelope protein Erns were used to develop enzyme-linked immunosorbent assays (ELISAs) to measure specifically antibodies against different types of pestiviruses. The choice of the peptide was based on the modular structure

  6. Cross-validation of commercial enzyme-linked immunosorbent assay and radioimmunoassay for porcine C-peptide concentration measurements in non-human primate serum.

    Gresch, Sarah C; Mutch, Lucas A; Janecek, Jody L; Hegstad-Davies, Rebecca L; Graham, Melanie L


    C-peptide concentration is widely used as a marker of insulin secretion and is especially relevant in evaluating islet graft function following transplantation, because its measurement is not confounded by the presence of exogenous insulin. To address the shortage of human islet donors, the use of porcine islets has been proposed as a possible solution and the stringent pig-to-non-human primate (NHP) model is often the most relevant for pre-clinical evaluation of the potential for diabetes reversal resulting from an islet xenograft. The Millipore radioimmunoassay (RIA) was exclusively used to measure porcine C-peptide (PCP) until 2013 when the assay was discontinued and subsequently a commercially available enzyme-linked immunosorbent assay (ELISA) from Mercodia has been widely adopted. Both assays have been used in pre-clinical trials evaluating the therapeutic potential of xenograft products in reversing diabetes in the pig-to-NHP model, to interpret data in a comparable way it may be useful to perform a harmonization of C-peptide measurements. We performed a method comparison by determining the PCP concentration in 620 serum samples collected from 20 diabetic cynomolgus macaques transplanted with adult porcine islets. All analyses were performed according to manufacturer instructions. With both assays, we demonstrated an acceptable detection limit, precision, and recovery. Linearity of the ELISA met acceptance criteria at all concentrations tested while linearity of the RIA only met acceptance criteria at five of the eight concentrations tested. The RIA had a detection limit of 0.16 ng/mL, and recovery ranged from 82% to 96% and met linearity acceptance criteria at 0.35 ng/mL and from 0.78 to 2.33 ng/mL. The ELISA had a detection limit of 0.03 ng/mL, and recovery ranged from 81% to 115% and met linearity acceptance criteria from 0.08 to 0.85 ng/mL. Both assays had intra-assay precision assay precision ELISA demonstrated a significant correlation with RIA (R

  7. Cross-reactivity of antibodies with phenolic compounds in pistachios during quantification of ochratoxin A by commercial enzyme-linked immunosorbent assay kits.

    Lee, Hyun Jung; Meldrum, Alexander D; Rivera, Nicholas; Ryu, Dojin


    Ochratoxin A (OTA), a nephrotoxic mycotoxin, naturally occurs in wide range of agricultural commodities. Typical screening of OTA involves various enzyme-linked immunosorbent assay (ELISA) methods. Pistachio (Pistacia vera L.) is a rich source of phenolic compounds that may result in a false positive due to structural similarities to OTA. The present study investigated the cross-reactivity profiles of phenolic compounds using two commercial ELISA test kits. High-performance liquid chromatography was used to confirm the concentration of OTA in the pistachio samples and compared with the results obtained from ELISA. When the degree of interaction and 50 % inhibitory concentration of phenolic compounds were determined, the cross-reactivity showed a pattern similar to that observed with the commercial ELSIA kits, although quantitatively different. In addition, the degree of interaction increased with the increasing concentration of phenolic compounds. The ELISA value had stronger correlations with the content of total phenolic compound, gallic acid, and catechin (R(2) = 0.757, 0.732, and 0.729, respectively) compared with epicatechin (R(2) = 0.590). These results suggest that phenolic compounds in pistachio skins may cross-react with the OTA antibody and lead to a false positive or to an overestimation of OTA concentration in ELISA-based tests.

  8. Commercial enzyme-linked immunosorbent assay versuspolymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis

    Pedro Emmanuel Alvarenga Americano do Brasil


    Full Text Available Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA and polymerase chain reaction (PCR diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects.

  9. Removal of Lipid from Serum Increases Coherence between Brucellosis Rapid Agglutination Test and Enzyme-linked Immunosorbent Assay in Bears in Alaska, USA.

    Godfroid, Jacques; Beckmen, Kimberlee; Helena Nymo, Ingebjørg


    In cases of chronic Brucella spp. infection, results of the rose bengal plate test (RBPT) and indirect enzyme-linked immunosorbent assay (ELISA) should be coherent, as reported in controlled conditions in the literature. We compared RBPT and ELISA results in 58 Alaska grizzly bears ( Ursus arctos horribilis), eight Kodiak brown bears ( Ursus arctos middendorffi), and six Alaska Peninsula brown bears ( Ursus arctos gyas). Of the 72 bears tested, 42 (58%) were ELISA positive and 53 (73%) were RBPT positive. However, the coherence between the tests was only fair (K=0.37, SE=0.11), suggesting that either the serologic results were not compatible with Brucella spp. infection or that there was a technical problem with the tests. To address a potential technical problem, we performed a 30-min chloroform/centrifugation cleanup. Following cleanup, the ELISA identified 43 positives (59%) and the RBPT identified 47 (65%), and the coherence between the tests was much improved (K=0.80, SE=0.07). We recommend cleaning wildlife sera with a high lipid content before performing RBPT and performing RBPT and ELISA in parallel to assess coherence. Our results suggest that Alaskan brown bears have been exposed to Brucella spp.

  10. Enzyme-linked immunosorbent assay (ELISA) using a specific monoclonal antibody as a new tool to detect Sudan dyes and Para red

    Ju Chunmei; Tang Yong; Fan Huiying; Chen Jinding


    To set up an immunoassay-based method to detect Sudan dyes and Para red, we generated a monoclonal antibody (Mab) using a specially designed carboxyl derivative of Sudan I (CSD I) as the immunogen. CSD I was synthesized by azocoupling reaction using 2-naphthol and diazotised 4-aminobenzoic acid. The antibody was obtained from a hybridoma, which was derived from the fusion of the mouse myeloma SP2/0 cells and the splenocytes from the mice immunized with the CSD I-bovine serum albumin (BSA) conjugate. In addition, we showed that the Mab was highly specific for Sudan I, III and Para red. The limit of detection was approximately 0.01 ng mL -1 in phosphate-buffered saline (PBS) buffer and 0.5 ng g -1 in chilli tomato sauce. The recoveries of Sudan I, III and Para red for the chilli tomato sauce were from 84% to 99% and coefficients of variation were from 14.9% to 33.3%. Thus, the enzyme-linked immunosorbent assay (ELISA) method is a rapid and high throughput screening tool to detect Sudan dyes and Para red in food products

  11. Enzyme-linked immunosorbent assay (ELISA) using a specific monoclonal antibody as a new tool to detect Sudan dyes and Para red

    Ju Chunmei [College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642 (China); Tang Yong [Center of Antibody Engineering, Department of Bioengineering, Jinan University, Guangzhou 510632 (China); Fan Huiying [College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642 (China); Chen Jinding [College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642 (China)], E-mail:


    To set up an immunoassay-based method to detect Sudan dyes and Para red, we generated a monoclonal antibody (Mab) using a specially designed carboxyl derivative of Sudan I (CSD I) as the immunogen. CSD I was synthesized by azocoupling reaction using 2-naphthol and diazotised 4-aminobenzoic acid. The antibody was obtained from a hybridoma, which was derived from the fusion of the mouse myeloma SP2/0 cells and the splenocytes from the mice immunized with the CSD I-bovine serum albumin (BSA) conjugate. In addition, we showed that the Mab was highly specific for Sudan I, III and Para red. The limit of detection was approximately 0.01 ng mL{sup -1} in phosphate-buffered saline (PBS) buffer and 0.5 ng g{sup -1} in chilli tomato sauce. The recoveries of Sudan I, III and Para red for the chilli tomato sauce were from 84% to 99% and coefficients of variation were from 14.9% to 33.3%. Thus, the enzyme-linked immunosorbent assay (ELISA) method is a rapid and high throughput screening tool to detect Sudan dyes and Para red in food products.

  12. Establishment of the enzyme-linked immunosorbent assay system to detect the amino terminal secretory form of rat Erc/Mesothelin.

    Nakaishi, Masayuki; Kajino, Kazunori; Ikesue, Masahiro; Hagiwara, Yoshiaki; Kuwahara, Maki; Mitani, Hiroaki; Horikoshi-Sakuraba, Yuko; Segawa, Tatsuya; Kon, Shigeyuki; Maeda, Masahiro; Wang, Tegexibaiyin; Abe, Masaaki; Yokoyama, Masayoshi; Hino, Okio


    By representational difference analysis, we previously identified the rat Erc (Expressed in renal carcinoma) gene that was more abundantly expressed in the renal carcinoma tissues of Eker rats than in the rat normal kidney. In this study, we raised antibodies against the amino-terminal portion of the rat Erc, and demonstrated the existence of a approximately 30-kDa secretory form in the supernatant of cultured cells derived from rat renal carcinoma. The enzyme-linked immunosorbent assay (ELISA) system using these antibodies detected high concentrations of this form in the sera of Eker rats bearing renal carcinomas, and in the sera of rats transplanted with mesothelioma cells. Mesothelin, a human homolog of the rat Erc, was recently reported to be a serum marker of malignant mesothelioma. The prognosis of mesothelioma is poor and there is no effective treatment at present. There are several rat model systems of mesothelioma that may be promising tools in the development of an antimesothelioma treatment. We hope our ELISA to detect the soluble form of rat Erc/Mesothelin is useful in the rat model system to exploit the antimesothelioma therapy to be used in human cases.

  13. Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay.

    Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira


    For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. © The American Society of Tropical Medicine and Hygiene.

  14. Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay

    Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira


    For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. PMID:27044566

  15. Development and application of an indirect enzyme-linked immunosorbent assay using recombinant truncated Cap protein for the diagnosis of porcine circovirus-like virus P1.

    Wen, Li-bin; Wen, Shi-fu; He, Kong-wang


    Porcine circovirus-like virus P1 is a newly discovered virus. To date, there has been no specific serological assay for use in the diagnosis of P1 infection. Because P1 has high homology to porcine circovirus type 2 (PCV2) at the nucleotide level, the C-terminal portion of the capsid protein (amino acids 73-114), a discriminative antigen, was expressed in a prokaryotic expression system. The recombinant product (rctCap), composed of three identical repeated domains, was shown to be strongly immunoreactive to P1-specific serum. This assay was validated by comparison with an indirect immunofluorescence assay (IFA). The diagnostic sensitivity and specificity of the rctCap enzyme-linked immunosorbent assay (ELISA) developed in this study are 93.6% and 98.3%, respectively, compared with the results from IFAs on 450 sera samples from pigs. The indirect ELISA that we developed with rctCap, the recombinant capsid fragment containing the 217-342 nt repeat domain, was sensitive, specific, and suitable for the large-scale detection of P1 infections in swine.

  16. Determination of the folate content in cladodes of nopal (Opuntia ficus indica) by microbiological assay utilizing Lactobacillus casei (ATCC 7469) and enzyme-linked immunosorbent assay.

    Ortiz-Escobar, Tania Breshkovskaya; Valverde-González, Maria Elena; Paredes-López, Octavio


    Prickly pear cactus has been an important food source in Mexico since ancient times due to its economical and ecological benefits and potential nutraceutical value. Nevertheless, studies on the nutritional aspects and health benefits have been scarce. The purpose of this study was to assess, apparently for the first time, the folate contents of cladodes of nopal by a microbiological assay, using Lactobacillus casei (ATCC 7469) in extracts that were enzymatically treated to release the bound vitamin, employing single, dual, and trienzymatic procedures, and using the enzyme-linked immunosorbent assay (ELISA). We used Opuntia cladodes of different length sizes. The microbiological assay showed some differences among enzyme treatments and sizes of nopal; the trienzyme treatment (alpha-amylase-protease-conjugase) was more efficient in determining the folate content in nopal, giving 5.0 ng/g in the small size cladodes at 54 h of testing time, while ELISA showed no significant differences in the folate content among sizes of cladodes (5.5-5.62 ng/g at 0 min testing time). Both techniques may be used for the assessment of folate content in cladodes, but ELISA is more rapid and reliable.

  17. Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

    Shyamala G


    Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

  18. Comparison of a neutralization enzyme immunoassay and an enzyme-linked immunosorbent assay for evaluation of immune status of children vaccinated for mumps.

    Harmsen, T; Jongerius, M C; van der Zwan, C W; Plantinga, A D; Kraaijeveld, C A; Berbers, G A


    A 50% neutralization enzyme immunoassay (N50-EIA) was compared with an indirect enzyme-linked immunosorbent assay (ELISA) for determining mumps virus antibodies in three consecutive serum samples from 138 children vaccinated with a live mumps vaccine at the age (in years) of 1.5. By the N50-EIA, most (132 of 138) preserum samples did not show neutralizing activity. Eight to 12 weeks after vaccination, 17 of the children were still negative, but only 7 remained so after 2.5 years, resulting in a seroconversion rate of 125 of 132 (95%). Over the same period, the neutralization geometric mean titer rose from 3.6 to 9.9. By an indirect ELISA, 128 of 138 preserum samples were found negative. The early and late postvaccination sera of 8 children were ELISA negative, resulting in a seroconversion rate of 120 of 128 (94%). Only two children remained seronegative by both methods. Seven of the late postvaccination serum samples yielded noncorresponding results, reflecting 95% correlation between both methods. Due to cross-reactivity with parainfluenza viruses, the ELISA proved to be less specific, but on the other hand, it showed a greater sensitivity than the N50-EIA. PMID:1500523

  19. Comparison of Enzyme-Linked Immunosorbent Assay, Surface Plasmon Resonance and Biolayer Interferometry for Screening of Deoxynivalenol in Wheat and Wheat Dust

    Melanie Sanders


    Full Text Available A sample preparation method was developed for the screening of deoxynivalenol (DON in wheat and wheat dust. Extraction was carried out with water and was successful due to the polar character of DON. For detection, an enzyme-linked immunosorbent assay (ELISA was compared to the sensor-based techniques of surface plasmon resonance (SPR and biolayer interferometry (BLI in terms of sensitivity, affinity and matrix effect. The matrix effects from wheat and wheat dust using SPR were too high to further use this screenings method. The preferred ELISA and BLI methods were validated according to the criteria established in Commission Regulation 519/2014/EC and Commission Decision 2002/657/EC. A small survey was executed on 16 wheat lots and their corresponding dust samples using the validated ELISA method. A linear correlation (r = 0.889 was found for the DON concentration in dust versus the DON concentration in wheat (LOD wheat: 233 μg/kg, LOD wheat dust: 458 μg/kg.

  20. Application of 3D Printing Technology in Increasing the Diagnostic Performance of Enzyme-Linked Immunosorbent Assay (ELISA for Infectious Diseases

    Harpal Singh


    Full Text Available Enzyme-linked Immunosorbent Assay (ELISA-based diagnosis is the mainstay for measuring antibody response in infectious diseases and to support pathogen identification of potential use in infectious disease outbreaks and clinical care of individual patients. The development of laboratory diagnostics using readily available 3D printing technologies provides a timely opportunity for further expansion of this technology into immunodetection systems. Utilizing available 3D printing platforms, a ‘3D well’ was designed and developed to have an increased surface area compared to those of 96-well plates. The ease and rapidity of the development of the 3D well prototype provided an opportunity for its rapid validation through the diagnostic performance of ELISA in infectious disease without modifying current laboratory practices for ELISA. The improved sensitivity of the 3D well of up to 2.25-fold higher compared to the 96-well ELISA provides a potential for the expansion of this technology towards miniaturization and Lab-On-a-Chip platforms to reduce time, volume of reagents and samples needed for such assays in the laboratory diagnosis of infectious and other diseases including applications in other disciplines.

  1. Development of an enzyme-linked immunosorbent assay-based method for measuring galactosyltransferase activity using a synthetic glycopolymer acceptor substrate.

    Oubihi, M; Kitajima, K; Kobayashi, K; Adachi, T; Aoki, N; Matsuda, T


    A lectin-assisted enzyme-linked immunosorbent assay (ELISA)-based method using a synthetic glycopolymer as an acceptor substrate was developed for measuring beta 1,4-galactosyltransferase (GalT) activity. A polyacrylamide derivative having a beta-linked N-acetylglucosamine (GlcNAc beta) moiety on each monomeric unit was synthesized chemically and immobilized on a polystyrene microtiter plate as an acceptor substrate for GalT. After the plate was incubated with bovine GalT, the enzyme reaction product, beta-linked Gal residue on the polyacrylamide-bound GlcNAc residue, was detected by using Ricinus communis agglutinin 1 (RCA1), rabbit anti-RCA1 antibody, and a peroxidase-labeled anti-rabbit IgG. The lowest GalT concentration detectable by this method was about 0.5 mU/ml, which is comparable to those by the previously reported ELISA-based assays. The unique property of the glycopolymer, PAP(GlcNAc beta), of binding noncovalently but tightly to the polystyrene microtiter plate allowed the use of this acceptor substrate for the GalT activity measurement even in the presence of 1% Triton CF-54 and X-100. Our system was successfully applied to assess GalT activity in milk of various mammals.

  2. Development of cathepsin-L cysteine proteinase based Dot-enzyme-linked immunosorbent assay for the diagnosis of Fasciola gigantica infection in buffaloes.

    Varghese, Anju; Raina, O K; Nagar, Gaurav; Garg, Rajat; Banerjee, P S; Maharana, B R; Kollannur, Justin D


    Native cathepsin-L cysteine proteinase (28 kDa) was purified from the excretory secretory products of Fasciola gigantica and was used for sero-diagnosis of F. gigantica infection in buffaloes by Dot-enzyme-linked immunosorbent assay (Dot-ELISA). The test detected F. gigantica field infection in these animals with a sensitivity of ∼ 90%. No specific IgG antibody binding was displayed by sera obtained from 76 buffaloes considered to be Fasciola and other parasite-free by microscopic examination of faeces and necropsy examination of liver, rumen and intestine. Additionally, sera from 156 Fasciola-free buffaloes, yet infected with Gigantocotyle explanatum, Paramphistomum epiclitum, Gastrothylax spp., Strongyloides papillosus and hydatid cyst were all negative, indicating that F. gigantica cathepsin-L cysteine proteinase does not cross-react with these helminth parasites in natural infection of the host. The data indicated that cathepsin-L cysteine proteinase based Dot-ELISA reached ∼ 90% sensitivity and 100% specificity with relation to above parasites in the detection of bubaline fasciolosis. The present Dot-ELISA diagnostic assay is relevant to the field diagnosis of F. gigantica infection in buffaloes. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. An electric detection of immunoglobulin G in the enzyme-linked immunosorbent assay using an indium oxide nanoparticle ion-sensitive field-effect transistor

    Lee, Dongjin; Cui, Tianhong


    Semiconducting nanoparticle ion-sensitive field-effect transistors (ISFETs) are used to detect immunoglobulin G (IgG) in the conventional enzyme-linked immunosorbent assay (ELISA). Indium oxide and silica nanoparticles were layer-by-layer self-assembled with the oppositely charged polyelectrolyte as the electrochemical transducer and antibody immobilization site, respectively. The assay was conducted on a novel platform of indium oxide nanoparticle ISFETs, where the electric signals are generated in response to the concentration of target IgG using the labeled detecting antibody. The sandwiched ELISA structure catalyzed the conversion of the acidic substrate into neutral substance with the aid of horseradish peroxidase. The pH change in the substrate solution was detected by nanoparticle ISFETs. Normal rabbit IgG was used as a model antigen whose detection limit of 0.04 ng ml −1 was found. The facile electric detection in the conventional assay through the semiconducting nanoparticle ISFET has potential applications as a point-of-care detection or a sensing element in a lab-on-a-chip system

  4. Visual Detection of Canine Parvovirus Based on Loop-Mediated Isothermal Amplification Combined with Enzyme-Linked Immunosorbent Assay and with Lateral Flow Dipstick

    SUN, Yu-Ling; YEN, Chon-Ho; TU, Ching-Fu


    ABSTRACT Loop-mediated isothermal amplification (LAMP) combined with enzyme-linked immunosorbent assay (LAMP–ELISA) and with lateral flow dipstick (LAMP–LFD) are rapid, sensitive and specific methods for the visual detection of clinical pathogens. In this study, LAMP–ELISA and LAMP–LFD were developed for the visual detection of canine parvovirus (CPV). For LAMP, a set of four primers (biotin-labeled forward inner primers) was designed to specifically amplify a region of the VP2 gene of CPV. The optimum time and temperature for LAMP were 60 min and 65°C, respectively. The specific capture oligonucleotide probes, biotin-labeled CPV probe for LAMP–ELISA and fluorescein isothiocyanate-labeled CPV probe for LAMP–LFD were also designed for hybridization with LAMP amplicons on streptavidin-coated wells and LFD strips, respectively. For the comparison of detection sensitivity, conventional PCR and LAMP for CPV detection were also performed. The CPV detection limits by PCR, PCR–ELISA, LAMP, LAMP–ELISA and LAMP–LFD were 102, 102, 10−1, 10−1 and 10−1 TCID50/ml, respectively. In tests using artificially contaminated dog fecal samples, the samples with CPV inoculation levels of ≥1 TCID50/ml gave positive results by both LAMP–ELISA and LAMP–LFD. Our data indicated that both LAMP–ELISA and LAMP–LFD are promising as rapid, sensitive and specific methods for an efficient diagnosis of CPV infection. PMID:24334855

  5. Epitope-blocking enzyme-linked immunosorbent assay to differentiate west nile virus from Japanese encephalitis virus infections in equine sera.

    Kitai, Yoko; Shoda, Mizue; Kondo, Takashi; Konishi, Eiji


    West Nile virus (WNV) is now widely distributed worldwide, except in most areas of Asia where Japanese encephalitis virus (JEV) is distributed. Considering the movement and migration of reservoir birds, there is concern that WNV may be introduced in Asian countries. Although manuals and guidelines for serological tests have been created in Japan in preparedness for the introduction of WNV, differential diagnosis between WNV and JEV may be complicated by antigenic cross-reactivities between these flaviviruses. Here, we generated a monoclonal antibody specific for the nonstructural protein 1 (NS1) of WNV and established an epitope-blocking enzyme-linked immunosorbent assay that can differentiate WNV from JEV infections in horse sera. Under conditions well suited for our assay system, samples collected from 95 horses in Japan (regarded as negative for WNV antibodies), including those collected from horses naturally infected with JEV, showed a mean inhibition value of 8.2% and a standard deviation (SD) of 6.5%. However, inhibition values obtained with serum used as a positive control (obtained after 28 days from a horse experimentally infected with WNV) in nine separate experiments showed a mean of 54.4% and an SD of 7.1%. We tentatively determined 27.6% (mean + 3 x SD obtained with 95 negative samples) as the cutoff value to differentiate positive from negative samples. Under this criterion, two horses experimentally infected with WNV were diagnosed as positive at 12 and 14 days, respectively, after infection.

  6. Discerning Silk Produced by Bombyx mori from Those Produced by Wild Species Using an Enzyme-Linked Immunosorbent Assay Combined with Conventional Methods.

    You, Qiushi; Li, Qingqing; Zheng, Hailing; Hu, Zhiwen; Zhou, Yang; Wang, Bing


    Recently, much interest has been paid to the separation of silk produced by Bombyx mori from silk produced by other species and tracing the beginnings of silk cultivation from wild silk exploitation. In this paper, significant differences between silks from Bombyx mori and other species were found by microscopy and spectroscopy, such as morphology, secondary structure, and amino acid composition. For further accurate identification, a diagnostic antibody was designed by comparing the peptide sequences of silks produced by Bombyx mori and other species. The results of the noncompetitive indirect enzyme-linked immunosorbent assay (ELISA) indicated that the antibody that showed good sensitivity and high specificity can definitely discern silk produced by Bombyx mori from silk produced by wild species. Thus, the antibody-based immunoassay has the potential to be a powerful tool for tracing the beginnings of silk cultivation. In addition, combining the sensitive, specific, and convenient ELISA technology with other conventional methods can provide more in-depth and accurate information for species identification.

  7. Autoreactive lymphocytes in thyroid disorders. 2. Comparison of anti-thyroglobulin antibody production by plaque-forming cell, radio-immunological and enzyme-linked immunosorbent assays

    Petersen, J; Feldt-Rasmussen, U; Siersbaek-Nielsen, K; Hoeier-Madsen, M; Larsen, F; Husby, S


    Blood mononuclear cells (MNC) from 9 randomly selected patients with autoimmune thyroiditis were stimulated in vitro with pokeweed mitogen (PWM), a polyclonal B lymphocyte activator. The secretion of immunoglobulins (Ig) and anti-thyroglobulin antibodies (TgAb) was assayed by means of haemolytic plaque-forming cell (PFC) assays, radioimmune assay (RIA) and enzyme-linked immunosorbent assays (ELISA). Total Ig and TgAb production was maximal using MNC cultured at 1.0 x 10/sup 6//ml as estimated by PFC, RIA and ELISA. The Ig and TgAb production as measured by RIA and ELISA was 1.5 - 3 times higher after 12 days' culture compared to 6 days' culture. Ig and TgAb production measured by PFC-assays at day 6 correlated positively to the results obtained by RIA and ELISA at day 12. PWM-induced TgAb secretion correlated positively to TgAb titres in serum. As judged by PFC, TgAb production was found in 8/9 patients; about 5% (range 0 - 7.9%) of the total PWM-stimulated IgG-secreting cells were involved in TgAb secretion. TgAb production as measured by ELISA and RIA was found in 6/9 patients. By reference to an affinity-purified human TgAb preparation, the TgAb secretion was about 0.7% (range 0 - 21.3%) of the total PWM-induced IgG secretion.

  8. Development of sandwich enzyme-linked immunosorbent assay systems for plasma β-galactoside α2,6-sialyltransferase, a possible hepatic disease biomarker

    Futakawa, Satoshi; Kitazume, Shinobu; Oka, Ritsuko; Ogawa, Kazuko; Hagiwara, Yoshiaki; Kinoshita, Akinori; Miyashita, Kazuya; Hashimoto, Yasuhiro


    Previous reports, including our work, have shown that plasma β-galactoside α2,6-sialyltransferase (ST6Gal I) activity is significantly increased in particular hepatopathological situations, suggesting that it may represent a sensitive biomarker for diagnosing hepatic diseases. So far, activity of ST6Gal I have been measured by using radioactive tracer method in place of measuring amount of ST6Gal I. However, this method is tangled and cannot exclude other sialyltransferase activities. Thus, simple and specific methods for measuring plasma ST6Gal I had been unavailable. Here, we developed two kinds of sandwich enzyme-linked immunosorbent assay (ELISA) systems that specifically detect the soluble cleaved form of ST6Gal I in plasma. In one sandwich ELISA, we detected rat specific sequence, EFQMPK, which is N-terminus of soluble ST6Gal I. In the other sandwich ELISA, we detected internal common sequence among rat, mouse and human ST6Gal I in plasma (M2 ELISA). Using the M2 ELISA, we observed that elevation of plasma ST6Gal I was much faster than elevation of plasma aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in a carbon tetrachloride (CCl 4 )-induced mouse liver injury model. Our data suggest that these ELISA systems are very useful tools for measuring plasma ST6Gal I, which represents a potential biomarker for diagnosing hepatic diseases

  9. A Colorimetric Enzyme-Linked Immunosorbent Assay (ELISA) Detection Platform for a Point-of-Care Dengue Detection System on a Lab-on-Compact-Disc

    Thiha, Aung; Ibrahim, Fatimah


    The enzyme-linked Immunosorbent Assay (ELISA) is the gold standard clinical diagnostic tool for the detection and quantification of protein biomarkers. However, conventional ELISA tests have drawbacks in their requirement of time, expensive equipment and expertise for operation. Hence, for the purpose of rapid, high throughput screening and point-of-care diagnosis, researchers are miniaturizing sandwich ELISA procedures on Lab-on-a-Chip and Lab-on-Compact Disc (LOCD) platforms. This paper presents a novel integrated device to detect and interpret the ELISA test results on a LOCD platform. The system applies absorption spectrophotometry to measure the absorbance (optical density) of the sample using a monochromatic light source and optical sensor. The device performs automated analysis of the results and presents absorbance values and diagnostic test results via a graphical display or via Bluetooth to a smartphone platform which also acts as controller of the device. The efficacy of the device was evaluated by performing dengue antibody IgG ELISA on 64 hospitalized patients suspected of dengue. The results demonstrate high accuracy of the device, with 95% sensitivity and 100% specificity in detection when compared with gold standard commercial ELISA microplate readers. This sensor platform represents a significant step towards establishing ELISA as a rapid, inexpensive and automatic testing method for the purpose of point-of-care-testing (POCT) in resource-limited settings. PMID:25993517

  10. An Evaluation Study of Enzyme-Linked Immunosorbent Assay (ELISA) Using Recombinant Protein Pap31 for Detection of Antibody against Bartonella bacilliformis Infection among the Peruvian Population

    Angkasekwinai, Nasikarn; Atkins, Erin H.; Romero, Sofia; Grieco, John; Chao, Chien Chung; Ching, Wei Mei


    Reliable laboratory testing is of great importance to detect Bartonella bacilliformis infection. We evaluated the sensitivity and specificity of the enzyme-linked immunosorbent assay (ELISA) using recombinant protein Pap31 (rPap31) for the detection of antibodies against B. bacilliformis as compared with immunofluorescent assay (IFA). Of the 302 sera collected between 1997 and 2000 among an at-risk Peruvian population, 103 and 34 samples tested positive for IFA-immunoglobulin G (IgG) and IFA-IgM, respectively. By using Youden's index, the cutoff values of ELISA-IgG at 0.915 gave a sensitivity of 84.5% and specificity of 94%. The cutoff values of ELISA-IgM at 0.634 gave a sensitivity of 88.2% and specificity of 85.1%. Using latent class analysis, estimates of sensitivity and specificity of almost all the assays were slightly higher than those of a conventional method of calculation. The test is proved beneficial for discriminating between infected and non-infected individuals with the advantage of low-cost and high-throughput capability. PMID:24515944

  11. Application of 3D Printing Technology in Increasing the Diagnostic Performance of Enzyme-Linked Immunosorbent Assay (ELISA) for Infectious Diseases

    Singh, Harpal; Shimojima, Masayuki; Shiratori, Tomomi; An, Le Van; Sugamata, Masami; Yang, Ming


    Enzyme-linked Immunosorbent Assay (ELISA)-based diagnosis is the mainstay for measuring antibody response in infectious diseases and to support pathogen identification of potential use in infectious disease outbreaks and clinical care of individual patients. The development of laboratory diagnostics using readily available 3D printing technologies provides a timely opportunity for further expansion of this technology into immunodetection systems. Utilizing available 3D printing platforms, a ‘3D well’ was designed and developed to have an increased surface area compared to those of 96-well plates. The ease and rapidity of the development of the 3D well prototype provided an opportunity for its rapid validation through the diagnostic performance of ELISA in infectious disease without modifying current laboratory practices for ELISA. The improved sensitivity of the 3D well of up to 2.25-fold higher compared to the 96-well ELISA provides a potential for the expansion of this technology towards miniaturization and Lab-On-a-Chip platforms to reduce time, volume of reagents and samples needed for such assays in the laboratory diagnosis of infectious and other diseases including applications in other disciplines. PMID:26184194

  12. Analysis of Benzo[a]pyrene in Vegetable Oils Using Molecularly Imprinted Solid Phase Extraction (MISPE Coupled with Enzyme-Linked Immunosorbent Assay (ELISA

    Michael Pschenitza


    Full Text Available This paper describes the development of a molecularly imprinted polymer-based solid phase extraction (MISPE method coupled with enzyme-linked immunosorbent assay (ELISA for determination of the PAH benzo[a]pyrene (B[a]P in vegetable oils. Different molecularly imprinted polymers (MIPs were prepared using non-covalent 4-vinylpyridine/divinylbenzene co-polymerization at different ratios and dichloromethane as porogen. Imprinting was done with a template mixture of phenanthrene and pyrene yielding a broad-specific polymer for PAHs with a maximum binding capacity (Q of ~32 μg B[a]P per 50 mg of polymer. The vegetable oil/n-hexane mixture (1:1, (v/v was pre-extracted with acetonitrile, the solvent evaporated, the residue reconstituted in n-hexane and subjected to MISPE. The successive washing with n-hexane and isopropanol revealed most suitable to remove lipid matrix constituents. After elution of bound PAHs from MISPE column with dichloromethane, the solvent was evaporated, the residue reconstituted with dimethyl sulfoxide and diluted 100-fold with methanol/water (10:90, (v/v for analysis of B[a]P equivalents with an ELISA. The B[a]P recovery rates in spiked vegetable oil samples of different fatty acid composition were determined between 63% and 114%. The presence of multiple PAHs in the oil sample, because of MIP selectivity and cross-reactivity of the ELISA, could yield overestimated B[a]P values.

  13. Detection of Serum Thermolabile β-2 Macroglycoprotein (Hakata Antigen) by Enzyme-Linked Immunosorbent Assay Using Polysaccharide Produced by Aerococcus viridans

    Tsujimura, Mitsushi; Ishida, Chuzo; Sagara, Yasuko; Miyazaki, Takashi; Murakami, Koichi; Shiraki, Hiroshi; Okochi, Kazuo; Maeda, Yoshiaki


    Although a serum thermolabile β-2 macroglycoprotein (TMG) may play a role in host defense as a lectin, little is known of its related physiological functions, mainly due to a lack of appropriate methods for tracing the functions of TMG. We identified a polysaccharide from Aerococcus viridans, PSA, which reacts with TMG, and based on this finding, we developed an enzyme-linked immunosorbent assay to trace the functions of TMG. Using ethanol precipitation and DEAE-Sepharose and Sephacryl S-400 column chromatographies, we isolated PSA from cultured medium of A. viridans, and it exhibited specific binding against TMG in blood samples. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), the isolated PSA showed ladder bands that implied the existence of repeating units composed of d-glucose, N-acetyl-d-glucosamine, d-mannose, and d-xylose, as confirmed by gas chromatography-mass spectrometry. SDS-PAGE and immunochemical analysis, using rabbit anti-TMG antibody, showed that PSA specifically binds solely to intact serum TMG but not to TMG heated at 56°C for 30 min, a condition under which antigenicity is lost. TMG in serum samples bound to PSA in a dose-dependent manner, and this binding was clearly suppressed by addition of PSA. These observations indicate that PSA is a useful adsorbent to TMG and can be used to develop appropriate methods for tracing the functions of TMG. PMID:11238239

  14. Quantitative Analysis of Free 15-F2t-Isoprostane from Plasma of Obstructive Sleep Apnea Patients Using Enzyme Linked Immunosorbe

    Bertha Rusdi


    Full Text Available 15-F2t-isoprostane is a biomarker in assessment of oxidative stress status that due to its relatively low concentration in biological fluid and also has many isomers, the 15-F2t-isoprostane sample need to be extracted prior to the quantifying processes. Extraction techniques commonly used to extract 15-F2t-isoprostane are solid phase extraction (SPE and immunoaffinity extraction. Improvements to the SPE and immunoaffinity extraction techniques had been conducted, and the recovery results was then compared. The quantification of 15-F2t-isoprostane then was conducted using Enzyme Linked Immunosorbent Assay (ELISA method. Then followed by the examination of the plasma recovery results. Extraction technique which had the highest recovery then was used to quantify 15-F2t-isoprostane from plasma of Obstructive Sleep Apnea (OSA patients. Immunoaffinity extraction technique has a good recovery result. OSA patients have the tendency to have high 15-F2t-isoprostane concentrations in the plasma, therefore have a potential risk to get diseases related to the biological activities of 15-F2t-isoprostane, such as arteriosclerosis.

  15. Seroprevalence of Cryptosporidium parvum infection of dairy cows in three northern provinces of Thailand determined by enzyme-linked immunosorbent assay using recombinant antigen CpP23.

    Inpankaew, T; Jittapalapong, S; Phasuk, J; Pinyopanuwut, N; Chimnoi, W; Kengradomkit, C; Sunanta, C; Zhang, G; Aboge, G O; Nishikawa, Y; Igarashi, I; Xuan, X


    Cryptosporidium parvum is the most frequent parasitic agent that causes diarrhoea in AIDS patients in Thailand. Cryptosporidiosis outbreaks in humans may be attributed to contamination of their drinking water from infected dairy pastures. A 23-kDa glycoprotein of C. parvum (CpP23) is a sporozoite surface protein that is geographically conserved among C. parvum isolates. This glycoprotein is a potentially useful candidate antigen for the diagnosis of cryptosporidiosis by enzyme-linked immunosorbent assay. Therefore, we investigated the seroprevalence of C. parvum infection in dairy cows in northern Thailand using an ELISA based on recombinant CpP23 antigen. Sera were randomly collected from 642 dairy cows of 42 small-holder farmers, which had the top three highest number of the dairy cows' population in Northern Thailand, that included Chiang Mai, Chiang Rai and Lumpang provinces. The overall seroprevalence of the infection was 4.4%, and the seropositive rates for the three provinces were 3.3% in Chiang Mai, 5.1% in Chiang Rai and 3% in Lumpang. These results suggest that cattle could play a role in zoonotic cryptosporidiosis in Thailand.

  16. Evaluation of Enzyme-Linked Immunosorbent Assay for Diagnosis of Post-Kala-Azar Dermal Leishmaniasis with Crude or Recombinant k39 Antigen

    Salotra, P.; Sreenivas, G.; Nasim, A. A.; Subba Raju, B. V.; Ramesh, V.


    The diagnosis of post-kala-azar dermal leishmaniasis (PKDL), a dermatosis that provides the only known reservoir for the parasite Leishmania donovani in India, remains a problem. Timely recognition and treatment of PKDL would contribute significantly to the control of kala-azar. We evaluated here the potential of the enzyme-linked immunosorbent assay (ELISA) as a diagnostic tool for PKDL. Antigen prepared from promastigotes and axenic amastigotes with parasite isolates that were derived from skin lesions of a PKDL patient gave sensitivities of 86.36 and 92%, respectively, in the 88 PKDL cases examined. The specificity of the ELISA test was examined by testing groups of patients with other skin disorders (leprosy and vitiligo) or coendemic infections (malaria and tuberculosis), as well as healthy controls from areas where this disease is endemic or is not endemic. A false-positive reaction was obtained in 14 of 144 (9.8%) of the controls with the promastigote antigen and in 14 of 145 (9.7%) of the controls with the amastigote antigen. Evaluation of the serodiagnostic potential of recombinant k39 by ELISA revealed a higher sensitivity (94.5%) and specificity (93.7%) compared to the other two antigens used. The data demonstrate that ELISA with crude or recombinant antigen k39 provides a relatively simple and less-invasive test for the reliable diagnosis of PKDL. PMID:11874880

  17. Development and Validation of an Enzyme-Linked Immunosorbent Assay for the Detection of Binding Anti-Drug Antibodies against Interferon Beta

    Kathleen Ingenhoven


    Full Text Available ObjectiveTo develop and validate a method for the detection of binding anti-drug antibodies (ADAs against interferon beta (IFN-β in human serum as part of a European initiative (ABIRISK aimed at the prediction and analysis of clinical relevance of anti-biopharmaceutical immunization to minimize the risk.MethodA two-tiered bridging enzyme-linked immunosorbent assay (ELISA format was selected and validated according to current recommendations. Screening assay: ADA in serum samples form complexes with immobilized IFN-β and biotinylated IFN-β, which are then detected using HRP labeled Streptavidin and TMB substrate. Confirmation assay: Screen “putative positive” samples are tested in the presence of excess drug (preincubation of sera with 0.3 µg/mL of soluble IFN-β and percentage of inhibition is calculated.ResultsThe assay is precise, and the sensitivity of the assay was confirmed to be 26 ng/mL using commercially available polyclonal rabbit antihuman IFN-β in human sera as the positive control.ConclusionAn ultrasensitive ELISA for IFN-β-binding ADA testing has been validated. This will form the basis to assess anti-biopharmaceutical immunization toward IFN-β with regards to its clinical relevance and may allow for the development of predictive tools, key aims within the ABIRISK consortium.

  18. Application of commercial enzyme linked immunosorbent assays (ELISA for the detection of antibodies for foot-and-mouth disease virus in wild boar and red deer

    Terzić Svjetlana


    Full Text Available For detecting antibodies towards foot and mouth (FMD virus in sera collected from red deer hinds (Cervus elaphus and wild boars (Sus scrofa, three commercially available enzyme-linked immunosorbent assays (ELISA were used. Two ELISA kits (PrioCHECK FMDV NS and CHEKIT FMD-3ABC were used for the detection of antibodies towards non-structural proteins of FMD virus and one assay was based on the detection of antibodies for serotype O (PrioCHECK FMDV type O. All of the sera tested in our study were negative for antibodies against FMD virus. The aim of this study was to investigate the usefulness of commercially available ELISA kits given for marketing authorization in Croatia in testing the prevalence of FMD antibodies in wild boar and red deer populations. Since the producers of ELISA kits used in our study did not declare wild animals as a target species, we hypothesised that the same kits could be used for serological diagnosis of FMD in red deer and wild boars. Our study confirmed that the kits used are acceptable for detecting antibodies in both species tested, however, the investigation highlighted the problem of validating the kits due to the absence of available positive sera originating from red deer, as well as other susceptible species, especially artiodactyls.

  19. Development of a monoclonal antibody-based sandwich-type enzyme-linked immunosorbent assay (ELISA) for detection of abrin in food samples.

    Zhou, Yu; Tian, Xiang-Li; Li, Yan-Song; Pan, Feng-Guang; Zhang, Yuan-Yuan; Zhang, Jun-Hui; Wang, Xin-Rui; Ren, Hong-Lin; Lu, Shi-Ying; Li, Zhao-Hui; Liu, Zeng-Shan; Chen, Qi-Jun; Liu, Jing-Qiu


    Abrin is a plant toxin, which can be easily isolated from the seeds of Abrus precatorius. It may be used as a biological warfare agent. In order to detect abrin in food samples, a two-layer sandwich format enzyme-linked immunosorbent assay based on the monoclonal antibody (mAb) (as capture antibody) and rabbit polyclonal serum (as detecting antibody) was developed and applied for the determination of abrin in some food matrices. The linear range of the mAb was 1-100 μg L(-1) with a detection limit of 0.5 μg L(-1) for abrin in phosphate buffered saline (PBS). The recoveries of abrin from sausage, beer and milk samples ranged 97.5-98.6%, 95.8-98.4% and 94.8-9.6%, respectively, with a coefficient of variation (CV) of 3.7% or less. The newly developed sandwich ELISA using the mAb appears to be a reliable and useful method for detection of abrin in sausage, beer and milk. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Application of 3D Printing Technology in Increasing the Diagnostic Performance of Enzyme-Linked Immunosorbent Assay (ELISA) for Infectious Diseases.

    Singh, Harpal; Shimojima, Masayuki; Shiratori, Tomomi; An, Le Van; Sugamata, Masami; Yang, Ming


    Enzyme-linked Immunosorbent Assay (ELISA)-based diagnosis is the mainstay for measuring antibody response in infectious diseases and to support pathogen identification of potential use in infectious disease outbreaks and clinical care of individual patients. The development of laboratory diagnostics using readily available 3D printing technologies provides a timely opportunity for further expansion of this technology into immunodetection systems. Utilizing available 3D printing platforms, a '3D well' was designed and developed to have an increased surface area compared to those of 96-well plates. The ease and rapidity of the development of the 3D well prototype provided an opportunity for its rapid validation through the diagnostic performance of ELISA in infectious disease without modifying current laboratory practices for ELISA. The improved sensitivity of the 3D well of up to 2.25-fold higher compared to the 96-well ELISA provides a potential for the expansion of this technology towards miniaturization and Lab-On-a-Chip platforms to reduce time, volume of reagents and samples needed for such assays in the laboratory diagnosis of infectious and other diseases including applications in other disciplines.

  1. Diagnostic accuracy of enzyme-linked immunosorbent assay (ELISA) and immunoblot (IB) for the detection of antibodies against Neospora caninum in milk from dairy cows.

    Chatziprodromidou, I P; Apostolou, T


    The aim of the study was to estimate the sensitivity and specificity of enzyme-linked immunosorbent assay (ELISA) and immunoblot (IB) for detecting antibodies of Neospora caninum in dairy cows, in the absence of a gold standard. The study complies with STRADAS-paratuberculosis guidelines for reporting the accuracy of the test. We tried to apply Bayesian models that do not require conditional independence of the tests under evaluation, but as convergence problems appeared, we used Bayesian methodology, that does not assume conditional dependence of the tests. Informative prior probability distributions were constructed, based on scientific inputs regarding sensitivity and specificity of the IB test and the prevalence of disease in the studied populations. IB sensitivity and specificity were estimated to be 98.8% and 91.3%, respectively, while the respective estimates for ELISA were 60% and 96.7%. A sensitivity analysis, where modified prior probability distributions concerning IB diagnostic accuracy applied, showed a limited effect in posterior assessments. We concluded that ELISA can be used to screen the bulk milk and secondly, IB can be used whenever needed.

  2. Molecular detection of genotype II grass carp reovirus based on nucleic acid sequence-based amplification combined with enzyme-linked immunosorbent assay (NASBA-ELISA).

    Zeng, Weiwei; Yao, Wei; Wang, Yingying; Li, Yingying; Bermann, Sven M; Ren, Yan; Shi, Cunbin; Song, Xinjian; Huang, Qiwen; Zheng, Shuchen; Wang, Qing


    Grass carp reovirus (GCRV) is the causative agent of the grass carp hemorrhagic disease that has resulted in severe economic losses in the grass carp (Ctenopharyngodon idella) farming industry in China. Early diagnosis and vaccine administration are important priorities for GCRV control. In this study, a nucleic acid sequence-based amplification with enzyme-linked immunosorbent assay (NASBA-ELISA) was developed for to detect genotype II GCRV (GCRV- II). Primers specifically targeting viral RNA genome segment 6 were utilized for amplification in an isothermal digoxigenin-labeling NASBA process, resulting in DIG-labeled RNA amplicons. The amplicons were hybridized to specific biotinylated DNA probes and the products were detected colorimetrically using horseradish peroxidase and a microplate reader. The new method is able to detect GCRV at 14 copies/μL within 5h and had a diagnostic sensitivity and a specificity of 100% when GCRV-II and non-target virus were tested. This NASBA-ELISA was evaluated using a panel of clinical samples (n=103) to demonstrate that it is a rapid, effective and sensitive method for GCRV detection in grass carp aquaculture. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Validation of the World Health Organization Enzyme-Linked Immunosorbent Assay for the Quantitation of Immunoglobulin G Serotype-Specific Anti-Pneumococcal Antibodies in Human Serum.

    Lee, Hyunju; Lim, Soo Young; Kim, Kyung Hyo


    The World Health Organization (WHO) enzyme-linked immunosorbent assay (ELISA) guideline is currently accepted as the gold standard for the evaluation of immunoglobulin G (IgG) antibodies specific to pneumococcal capsular polysaccharide. We conducted validation of the WHO ELISA for 7 pneumococcal serotypes (4, 6B, 9V, 14, 18C, 19F, and 23F) by evaluating its specificity, precision (reproducibility and intermediate precision), accuracy, spiking recovery test, lower limit of quantification (LLOQ), and stability at the Ewha Center for Vaccine Evaluation and Study, Seoul, Korea. We found that the specificity, reproducibility, and intermediate precision were within acceptance ranges (reproducibility, coefficient of variability [CV] ≤ 15%; intermediate precision, CV ≤ 20%) for all serotypes. Comparisons between the provisional assignments of calibration sera and the results from this laboratory showed a high correlation > 94% for all 7 serotypes, supporting the accuracy of the ELISA. The spiking recovery test also fell within an acceptable range. The quantification limit, calculated using the LLOQ, for each of the serotypes was 0.05-0.093 μg/mL. The freeze-thaw stability and the short-term temperature stability were also within an acceptable range. In conclusion, we showed good performance using the standardized WHO ELISA for the evaluation of serotype-specific anti-pneumococcal IgG antibodies; the WHO ELISA can evaluate the immune response against pneumococcal vaccines with consistency and accuracy. © 2017 The Korean Academy of Medical Sciences.

  4. Enzyme-linked immunosorbent assay (ELISA) for the detection of use of the synthetic cannabinoid agonists UR-144 and XLR-11 in human urine.

    Mohr, Amanda L A; Ofsa, Bill; Keil, Alyssa Marie; Simon, John R; McMullin, Matthew; Logan, Barry K


    Ongoing changes in the synthetic cannabinoid drug market create the need for relevant targeted immunoassays for rapid screening of biological samples. We describe the validation and performance characteristics of an enzyme-linked immunosorbent assay designed to detect use of one of the most prevalent synthetic cannabinoids in urine, UR-144, by targeting its pentanoic acid metabolite. Fluorinated UR-144 (XLR-11) has been demonstrated to metabolize to this common product. The assay has significant cross-reactivity with UR-144-5-OH, UR-144-4-OH and XLR-11-4-OH metabolites, but assay's cutoff is 5 ng/mL relative to the pentanoic acid metabolite of UR-144, which is used as the calibrator. The method was validated with 90 positive and negative control urine samples for UR-144, XLR-11 and its metabolites tested versus liquid chromatography-tandem mass spectrometry. The accuracy, sensitivity and specificity were determined to be 100% for the assay at the specified cutoff. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  5. A Colorimetric Enzyme-Linked Immunosorbent Assay (ELISA) Detection Platform for a Point-of-Care Dengue Detection System on a Lab-on-Compact-Disc.

    Thiha, Aung; Ibrahim, Fatimah


    The enzyme-linked Immunosorbent Assay (ELISA) is the gold standard clinical diagnostic tool for the detection and quantification of protein biomarkers. However, conventional ELISA tests have drawbacks in their requirement of time, expensive equipment and expertise for operation. Hence, for the purpose of rapid, high throughput screening and point-of-care diagnosis, researchers are miniaturizing sandwich ELISA procedures on Lab-on-a-Chip and Lab-on-Compact Disc (LOCD) platforms. This paper presents a novel integrated device to detect and interpret the ELISA test results on a LOCD platform. The system applies absorption spectrophotometry to measure the absorbance (optical density) of the sample using a monochromatic light source and optical sensor. The device performs automated analysis of the results and presents absorbance values and diagnostic test results via a graphical display or via Bluetooth to a smartphone platform which also acts as controller of the device. The efficacy of the device was evaluated by performing dengue antibody IgG ELISA on 64 hospitalized patients suspected of dengue. The results demonstrate high accuracy of the device, with 95% sensitivity and 100% specificity in detection when compared with gold standard commercial ELISA microplate readers. This sensor platform represents a significant step towards establishing ELISA as a rapid, inexpensive and automatic testing method for the purpose of point-of-care-testing (POCT) in resource-limited settings.

  6. Iodoacetyl-functionalized pullulan: A supplemental enhancer for single-domain antibody-polyclonal antibody sandwich enzyme-linked immunosorbent assay for detection of survivin.

    Matsushita, Takahiko; Arai, Hidenao; Koyama, Tetsuo; Hatano, Ken; Nemoto, Naoto; Matsuoka, Koji


    Survivin, an inhibitor of the apoptosis protein family, is a potent tumor marker for diagnosis and prognosis. The enzyme-linked immunosorbent assay (ELISA) is one of the methods that has been used for detection of survivin. However, ELISA has several disadvantages caused by the use of conventional antibodies, and we have therefore been trying to develop a novel ELISA system using camelid single-domain antibodies (VHHs) as advantageous replacements. Here we report a supplemental approach to improve the VHH-polyclonal antibody sandwich ELISA for survivin detection. Iodoacetyl-functionalized pullulan was synthesized, and its thiol reactivity was characterized by a model reaction with l-cysteine. The thiophilic pullulan was applied to an immunoassay asan additive upon coating of standard assay plates with an anti-survivin VHH fusion protein with C-terminal cysteine. The results showed that the mole ratio of the additive to VHH had a significant effect on the consequent response. Mole ratios of 0.07, 0.7, and 7 led to 90% lower, 15% higher, and 69% lower responses, respectively, than the response of a positive control in which no additive was used. The background levels observed in any additive conditions were as low as that of a negative control lacking both VHH and the additive. These results indicate the applicability of the thiol-reactive pullulan as a response enhancer to VHH-based ELISA. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Increased sensitivity of 3D-Well enzyme-linked immunosorbent assay (ELISA) for infectious disease detection using 3D-printing fabrication technology.

    Singh, Harpal; Shimojima, Masayuki; Fukushi, Shuetsu; Le Van, An; Sugamata, Masami; Yang, Ming


    Enzyme-linked Immunosorbent Assay or ELISA -based diagnostics are considered the gold standard in the demonstration of various immunological reaction including in the measurement of antibody response to infectious diseases and to support pathogen identification with application potential in infectious disease outbreaks and individual patients' treatment and clinical care. The rapid prototyping of ELISA-based diagnostics using available 3D printing technologies provides an opportunity for a further exploration of this platform into immunodetection systems. In this study, a '3D-Well' was designed and fabricated using available 3D printing platforms to have an increased surface area of more than 4 times for protein-surface adsorption compared to those of 96-well plates. The ease and rapidity in designing-product development-feedback cycle offered through 3D printing platforms provided an opportunity for its rapid assessment, in which a chemical etching process was used to make the surface hydrophilic followed by validation through the diagnostic performance of ELISA for infectious disease without modifying current laboratory practices for ELISA. The higher sensitivity of the 3D-Well (3-folds higher) compared to the 96-well ELISA provides a potential for the expansion of this technology towards miniaturization platforms to reduce time, volume of reagents and samples needed for laboratory or field diagnosis of infectious diseases including applications in other disciplines.

  8. Development and Application of an Indirect Enzyme-Linked Immunosorbent Assay Using Recombinant Mag1 for Serodiagnosis of Toxoplasma gondii In Dogs.

    Zhuo, Xunhui; Sun, Hongchao; Zhang, Zhi; Luo, Jiaqing; Shan, Ying; Du, Aifang


    Serologic tests are widely accepted and applied as means to detect anti- Toxoplasma gondii immunoglobulin G antibodies. In this study, recombinant matrix antigen (rMAG1) was induced by isopropyl-β-d-thiogalactoside and purified by nickel-nitrilotriacetic acid purification system. We then developed and optimized an indirect enzyme-linked immunosorbent assay (ELISA) through checkerboard assays using serial dilutions of antigens and sera to assess the potential use of rMAG1 in serologic detection of T. gondii infection in dogs. Serum samples from 93 domestic dogs were analyzed by western blot and rMAG1-ELISA. The results were compared with those obtained from an ELISA with the soluble Toxoplasma lysate antigens (TLA). We found that although yielding an excellent agreement (96.7%) with western blot data (κ = 0.9659), rMAG1-ELISA produced higher sensitivity (93.9% vs. 87.8%) and specificity (98.3% vs. 96.7%) than TLA-ELISA. In addition, receiver operating characteristic analysis also revealed that rMAG1-ELISA is in more agreement with western blot (area under the curve [AUC] = 0.985) relative to TLA-ELISA (AUC = 0.955). These results indicated that the rMAG1-ELISA established in this study provides a promising and reliable tool for serologic detection of T. gondii infection in dogs.

  9. Expression of sheep pathogen Babesia sp. Xinjiang rhoptry-associated protein 1 and evaluation of its diagnostic potential by enzyme-linked immunosorbent assay.

    Niu, Qingli; Liu, Zhijie; Yang, Jifei; Yu, Peifa; Pan, Yuping; Zhai, Bintao; Luo, Jianxun; Guan, Guiquan; Yin, Hong


    Ovine babesiosis is one of the most important tick-borne haemoparasitic diseases of small ruminants. The ovine parasite Babesia sp. Xinjiang is widespread in China. In this study, recombinant full-length XJrRAP-1aα2 (rhoptry-associated protein 1aα2) and C-terminal XJrRAP-1aα2 CT of Babesia sp. Xinjiang were expressed and used to evaluate their diagnostic potential for Babesia sp. Xinjiang infections by indirect enzyme-linked immunosorbent assay (ELISA). Purified XJrRAP-1aα2 was tested for reactivity with sera from animals experimentally infected with Babesia sp. Xinjiang and other haemoparasites using Western blotting and ELISA. The results showed no cross-reactivities between XJrRAP-1aα2 CT and sera from animals infected by other pathogens. High level of antibodies against RAP-1a usually lasted 10 weeks post-infection (wpi). A total of 3690 serum samples from small ruminants in 23 provinces located in 59 different regions of China were tested by ELISA. The results indicated that the average positive rate was 30·43%, and the infections were found in all of the investigated provinces. This is the first report on the expression and potential use of a recombinant XJrRAP-1aα2 CT antigen for the development of serological assays for the diagnosis of ovine babesiosis, caused by Babesia sp. Xinjiang.

  10. Development of sandwich enzyme-linked immunosorbent assay systems for plasma {beta}-galactoside {alpha}2,6-sialyltransferase, a possible hepatic disease biomarker

    Futakawa, Satoshi [Department of Biochemistry, School of Medicine, Fukushima Medical University, 1 Hikarigaoka, Fukushima-shi, Fukushima 960-1295 (Japan); Kitazume, Shinobu [Disease Glycomics Laboratory, Institute of Physical and Chemical Research, RIKEN, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); CREST, Japan Science and Technology Agency, Kawaguchi-shi, Saitama 560-0082 (Japan); Oka, Ritsuko [CREST, Japan Science and Technology Agency, Kawaguchi-shi, Saitama 560-0082 (Japan); Glyco-chain Functions Laboratory, Institute of Physical and Chemical Research, RIKEN, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Ogawa, Kazuko [Disease Glycomics Laboratory, Institute of Physical and Chemical Research, RIKEN, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); CREST, Japan Science and Technology Agency, Kawaguchi-shi, Saitama 560-0082 (Japan); Hagiwara, Yoshiaki; Kinoshita, Akinori; Miyashita, Kazuya [Department of Biological Sciences, Immuno-Biological Laboratories Co. Ltd., 1091-1 Naka, Fujioka-shi, Gunma 375-0005 (Japan); Hashimoto, Yasuhiro [Department of Biochemistry, School of Medicine, Fukushima Medical University, 1 Hikarigaoka, Fukushima-shi, Fukushima 960-1295 (Japan); CREST, Japan Science and Technology Agency, Kawaguchi-shi, Saitama 560-0082 (Japan)], E-mail:


    Previous reports, including our work, have shown that plasma {beta}-galactoside {alpha}2,6-sialyltransferase (ST6Gal I) activity is significantly increased in particular hepatopathological situations, suggesting that it may represent a sensitive biomarker for diagnosing hepatic diseases. So far, activity of ST6Gal I have been measured by using radioactive tracer method in place of measuring amount of ST6Gal I. However, this method is tangled and cannot exclude other sialyltransferase activities. Thus, simple and specific methods for measuring plasma ST6Gal I had been unavailable. Here, we developed two kinds of sandwich enzyme-linked immunosorbent assay (ELISA) systems that specifically detect the soluble cleaved form of ST6Gal I in plasma. In one sandwich ELISA, we detected rat specific sequence, EFQMPK, which is N-terminus of soluble ST6Gal I. In the other sandwich ELISA, we detected internal common sequence among rat, mouse and human ST6Gal I in plasma (M2 ELISA). Using the M2 ELISA, we observed that elevation of plasma ST6Gal I was much faster than elevation of plasma aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in a carbon tetrachloride (CCl{sub 4})-induced mouse liver injury model. Our data suggest that these ELISA systems are very useful tools for measuring plasma ST6Gal I, which represents a potential biomarker for diagnosing hepatic diseases.

  11. Parvovirus B19 infections in state of Rio de Janeiro, Brasil: 526 sera analyzed by IgM-enzyme-linked immunosorbent assay and polymerase chain reaction

    MCL Mendonça


    Full Text Available In this study were analyzed 526 sera; the patients aged from two days to 65 years old presenting exanthema, which was the most frequent symptom observed, besides fever, adenomegaly, and arthralgia. These sera were negative by enzyme-linked immunosorbent assay (IgM-ELISA for either rubella (495, toxoplasma (41, cytomegalovirus (12, measles (40, dengue (56, and they were submitted to nested polymerase chain reaction (PCR for B19 DNA and commercial IgM-ELISA for B19. In 39 abortion cases, IgM or DNA were not detected, therefore they were not took into account for analysis. Specific DNA and IgM were detected respectively in 71 (14.5% and IgM in 62 (12.7% sera from 487 sera analyzed. IgM and DNA were simultaneously detected in 43 (8.8%, while agreement among the results by PCR and IgM-ELISA was observed in 440 (90.4%. The sera were collected from January 1999 to December 2000, most of them in 1999 (325, during winter and spring. The major number of clinical cases was observed in the age group from one to ten years old. IgM or DNA were detected in 23 from 51 municipal districts of the state of Rio de Janeiro, where the samples were collected.

  12. Development of a Nucleoprotein-Based Enzyme-Linked Immunosorbent Assay Using a Synthetic Peptide Antigen for Detection of Avian Metapneumovirus Antibodies in Turkey Sera

    Alvarez, Rene; Njenga, M. Kariuki; Scott, Melissa; Seal, Bruce S.


    Avian metapneumoviruses (aMPV) cause an upper respiratory tract disease with low mortality but high morbidity, primarily in commercial turkeys, that can be exacerbated by secondary infections. There are three types of aMPV, of which type C is found only in the United States. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. On the basis of the predicted antigenicity of consensus sequences, five aMPV-specific N peptides were synthesized for development of a peptide antigen enzyme-linked immunosorbent assay (aMPV N peptide-based ELISA) to detect aMPV-specific antibodies among turkeys. Sera from naturally and experimentally infected turkeys were used to demonstrate the presence of antibodies reactive to the chemically synthesized aMPV N peptides. Subsequently, aMPV N peptide 1, which had the sequence 10-DLSYKHAILKESQYTIKRDV-29, with variations at only three amino acids among aMPV serotypes, was evaluated as a universal aMPV ELISA antigen. Data obtained with the peptide-based ELISA correlated positively with total aMPV viral antigen-based ELISAs, and the peptide ELISA provided higher optical density readings. The results indicated that aMPV N peptide 1 can be used as a universal ELISA antigen to detect antibodies for all aMPV serotypes. PMID:15013970

  13. Field estimation of the flock-level diagnostic specificity of an enzyme-linked immunosorbent assay for Avian metapneumovirus antibodies in turkeys.

    Muñoz-Zanzi, Claudia; Trampel, Darrell; Hanson, Tim; Harrison, Kristen; Goyal, Sagar; Cortinas, Roberto; Lauer, Dale


    Routine serologic testing for Avian metapneumovirus (AMPV) infection of turkey flocks at slaughter is currently being used to monitor changes in the occurrence of AMPV infection in endemic areas and can also be used to detect the emergence of infection in currently unaffected areas. Because of the costs associated with false-positive results, particularly in areas that are free of AMPV infection, there is a need to obtain improved estimates of flock-level specificity (SP). The objective of this study was to estimate flock-level SP of a program to monitor AMPV infection in turkey flocks at processing using a standard enzyme-linked immunosorbent assay (ELISA). A study was carried out in which 37 AMPV-free flocks from 7 Midwest operations were followed serologically. Six percent, 3%, and 0.2% of total samples tested AMPV positive at 8 weeks, 12 weeks, and at processing, respectively. Overall, flock-level SP increased as the cutoff increased and as age increased. Flock-level SP at processing was 97%, if a cutoff of 1 was used (the flock was classified as positive if at least 1 sample tested positive), and 100%, if any other cutoff was used. Administration of antibiotics (P = 0.02) and vaccination for Bordetella avium (P = 0.08) were positively associated with the probability of (false) positive test results. These findings suggest possible cross-reactions with other infections and highlight the need to consider variable diagnostic performance depending on farm conditions.

  14. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid

    Pascho, Ronald J.; Chase, Dorothy M.; McKibben, Constance L.


    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 × 109cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 × 104cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

  15. Competitive Enzyme-Linked Immunosorbent Assay Based on a Rhoptry-Associated Protein 1 Epitope Specifically Identifies Babesia bovis-Infected Cattle

    Goff, Will L.; McElwain, Terry F.; Suarez, Carlos E.; Johnson, Wendell C.; Brown, Wendy C.; Norimine, Junzo; Knowles, Donald P.


    The competitive enzyme-linked immunosorbent assay (cELISA) format has proven to be an accurate, reliable, easily standardized, and high-throughput method for detecting hemoparasite infections. In the present study, a species-specific, broadly conserved, and tandemly repeated B-cell epitope within the C terminus of the rhoptry-associated protein 1 of the hemoparasite Babesia bovis was cloned and expressed as a histidine-tagged thioredoxin fusion peptide and used as antigen in a cELISA. The assay was optimized with defined negative and positive bovine sera, where positive sera inhibited the binding of the epitope-specific monoclonal antibody BABB75A4. The cELISA accurately differentiated animals with B. bovis-specific antibodies from uninfected animals and from animals with antibodies against other tick-borne hemoparasites (98.7% specificity). In addition, B. bovis-specific sera from Australia, Argentina, Bolivia, Puerto Rico, and Morocco inhibited the binding of BABB75A4, confirming conservation of the epitope. The assay first detected experimentally infected animals between 13 and 17 days postinfection, and with sera from naturally infected carrier cattle, was comparable to indirect immunofluorescence (98.3% concordance). The assay appears to have the characteristics necessary for an epidemiologic and disease surveillance tool. PMID:12522037

  16. Enzyme-Linked Immunosorbent Assay Using a Virus Type-Specific Peptide Based on a Subdomain of Envelope Protein Erns for Serologic Diagnosis of Pestivirus Infections in Swine

    Langedijk, J. P. M.; Middel, W. G. J.; Meloen, R. H.; Kramps, J. A.; de Smit, J. A.


    Peptides deduced from the C-terminal end (residues 191 to 227) of pestivirus envelope protein Erns were used to develop enzyme-linked immunosorbent assays (ELISAs) to measure specifically antibodies against different types of pestiviruses. The choice of the peptide was based on the modular structure of the Erns protein, and the peptide was selected for its probable independent folding and good exposure, which would make it a good candidate for an antigenic peptide to be used in a diagnostic test. A solid-phase peptide ELISA which was cross-reactive for several types of pestivirus antibodies and which can be used for the general detection of pestivirus antibodies was developed. To identify type-specific pestivirus antibodies, a liquid-phase peptide ELISA, with a labeled, specific classical swine fever virus (CSFV) peptide and an unlabeled bovine viral diarrhea virus peptide to block cross-reactivity, was developed. Specificity and sensitivity of the liquid-phase peptide ELISA for CSFV were 98 and 100%, respectively. Because the peptide is a fragment of the Erns protein, it can be used to differentiate between infected and vaccinated animals when a vaccine based on the E2 protein, which is another pestivirus envelope protein, is used. PMID:11230402

  17. Evaluation of a newly designed sandwich enzyme linked immunosorbent assay for the detection of hydatid antigen in serum, urine and cyst fluid for diagnosis of cystic echinococcosis.

    Chaya, Dr; Parija, Subhash Chandra


    Cystic echinococcosis (CE) is a zoonotic disease of humans with variable clinical manifestations. Imaging and immunological methods are currently the mainstay of diagnosis of this disease. Although the immunological tests for detection of anti-echinococcal antibodies have several disadvantages, they are widely being used. Antigen is far more superior than antibody detection test as they can provide a specific parasitic diagnosis. A sandwich enzyme linked immunosorbent assay (ELISA) was designed using antibodies to 24 kDa urinary hydatid antigen for the detection of hydatid antigens in urine, serum and cyst fluid specimens. The performance of this novel test was compared with that of other hydatid antibody detection ELISA and enzyme immune transfer blot (EITB) using radiological and surgical confirmation as the gold standard. The antigen detection ELISA showed 100% sensitivity and specificity when tested with cyst fluid. On testing urine and serum, the antigen detection ELISA was found to be more specific than antibody detection ELISA. EITB was found to be the most sensitive and specific test. ELISA using polyclonal antibodies against 24 kDa urinary hydatid protein was moderately sensitive to detect hydatid antigen in serum and urine. Hence polyclonal antibodies to 24 kDa urinary hydatid antigen can be used as an alternative source of antibody to detect hydatid antigen in serum, urine and cyst fluid. In the present study, EITB was found to be highly specific test for detection of hydatid antibodiesin serum. 24 kDa protein was found to be specific and of diagnostic value in CE.

  18. Enzyme-linked immunosorbent assay and polymerase chain reaction performance using Mexican and Guatemalan discrete typing unit I strains of Trypanosoma cruzi.

    Ballinas-Verdugo, Martha; Reyes, Pedro Antonio; Mejia-Dominguez, Ana; López, Ruth; Matta, Vivian; Monteón, Victor M


    Thirteen Trypanosoma cruzi isolates from different geographic regions of Mexico and Guatemala belonging to discrete typing unit (DTU) I and a reference CL-Brener (DTU VI) strain were used to perform enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR). A panel of 57 Mexican serum samples of patients with chronic chagasic cardiopathy and asymptomatic infected subjects (blood bank donors) were used in this study. DNA from the above 14 T. cruzi strains were extracted and analyzed by PCR using different sets of primers designed from minicircle and satellite T. cruzi DNA. The chronic chagasic cardiopathy serum samples were easily recognized with ELISA regardless of the source of antigenic extract used, even with the CL-Brener TcVI, but positive serum samples from blood bank donors in some cases were not recognized by some Mexican antigenic extracts. On the other hand, PCR showed an excellent performance despite the set of primers used, since all Mexican and Guatemalan T. cruzi strains were correctly amplified. In general terms, Mexican, Guatemalan, and CL-Brener T. cruzi strains are equally good sources of antigen when using the ELISA test to detect Mexican serum samples. However, there are some strains with poor performance. The DTU I strains are easily detected using either kinetoplast or satellite DNA target designed from DTU VI strains.

  19. Exploiting Nanobodies in the Detection and Quantification of Human Growth Hormone via Phage-Sandwich Enzyme-Linked Immunosorbent Assay

    Hossam Murad


    Full Text Available BackgroundMonitoring blood levels of human growth hormone (hGH in most children with short stature deficiencies is crucial for taking a decision of treatment with extended course of daily and expensive doses of recombinant hGH (rhGH or Somatropin®. Besides, misusing of rhGH by sportsmen is banned by the World Anti-Doping Agency and thus sensitive GH-detecting methods are highly welcome in this field. Nanobodies are the tiniest antigen-binding entity derived from camel heavy chain antibodies. They were successfully generated against numerous antigens including hormones.MethodsA fully nanobody-based sandwich ELISA method was developed in this work for direct measurement of GH in biological samples.ResultsTwo major characteristics of nanobody were exploited for this goal: the robust and stable structure of the nanobody (NbGH04 used to capture hGH from tested samples, and the great ability of tailoring, enabling the display of the anti-GH detector nanobody (NbGH07 on the tip of M13-phage. Such huge, stable, and easy-to-prepare phage-Nb was used in ELISA to provide an amplified signal. Previously, NbGH04 was retrieved on immobilized hGH by phage display from a wide “immune” cDNA library prepared from a hGH-immunized camel. Here, and in order to assure epitope heterogeneity, NbGH07 was isolated from the same library using NbGH04-captured hGH as bait. Interaction of both nanobodies with hGH was characterized and compared with different anti-GH nanobodies and antibodies. The sensitivity (~0.5 ng/ml and stability of the nanobody-base sandwich ELISA were assessed using rhGH before testing in the quantification of hGH in blood sera and cell culture supernatants.ConclusionIn regard to all advantages of nanobodies; stability, solubility, production affordability in Escherichia coli, and gene tailoring, nanobody-based phage sandwich ELISA developed here would provide a valuable method for hGH detection and quantification.

  20. Evaluation of Two Enzyme-Linked Immunosorbent Assay Kits for Chikungunya Virus IgM Using Samples from Deceased Organ and Tissue Donors

    Altrich, Michelle L.; Nowicki, Marek J.


    The identification of nearly 3,500 cases of chikungunya virus (CHIKV) infection in U.S. residents returning in 2014 and 2015 from areas in which it is endemic has raised concerns within the transplant community that, should recently infected individuals become organ and/or tissue donors, CHIKV would be transmitted to transplant recipients. Thus, tests designed to detect recent CHIKV infection among U.S. organ and tissue donors may become necessary in the future. Accordingly, we evaluated 2 enzyme-linked immunosorbent assays (ELISAs) for CHIKV IgM readily available in the United States using 1,000 deidentified serum or plasma specimens collected from donors between November 2014 and March 2015. The Euroimmun indirect ELISA identified 38 reactive specimens; however, all 38 were negative for CHIKV IgG and IgM in immunofluorescence assays (IFAs) conducted at a reference laboratory and, thus, were falsely reactive in the Euroimmun CHIKV IgM assay. The InBios IgM-capture ELISA identified 26 reactive samples, and one was still reactive (index ≥ 1.00) when retested using the InBios kit with a background subtraction modification to identify false reactivity. This reactive specimen was CHIKV IgM negative but IgG positive by IFAs at two reference laboratories; plaque reduction neutralization testing (PRNT) demonstrated CHIKV-specific reactivity. The IgG and PRNT findings strongly suggest that the InBios CHIKV IgM-reactive result represents true reactivity, even though the IgM IFA result was negative. If testing organ/tissue donors for CHIKV IgM becomes necessary, the limitations of the currently available CHIKV IgM ELISAs and options for their optimization must be understood to avoid organ/tissue wastage due to falsely reactive results. PMID:27535838

  1. Validation of an enzyme-linked immunosorbent assay for the quantification of citrullinated histone H3 as a marker for neutrophil extracellular traps in human plasma.

    Thålin, Charlotte; Daleskog, Maud; Göransson, Sophie Paues; Schatzberg, Daphne; Lasselin, Julie; Laska, Ann-Charlotte; Kallner, Anders; Helleday, Thomas; Wallén, Håkan; Demers, Mélanie


    There is an emerging interest in the diverse functions of neutrophil extracellular traps (NETs) in a variety of disease settings. However, data on circulating NETs rely largely upon surrogate NET markers such as cell-free DNA, nucleosomes, and NET-associated enzymes. Citrullination of histone H3 by peptidyl arginine deiminase 4 (PAD4) is central for NET formation, and citrullinated histone H3 (H3Cit) is considered a NET-specific biomarker. We therefore aimed to optimize and validate a new enzyme-linked immunosorbent assay (ELISA) to quantify the levels of H3Cit in human plasma. A standard curve made of in vitro PAD4-citrullinated histones H3 allows for the quantification of H3Cit in plasma using an anti-histone antibody as capture antibody and an anti-histone H3 citrulline antibody for detection. The assay was evaluated for linearity, stability, specificity, and precision on plasma samples obtained from a human model of inflammation before and after lipopolysaccharide injection. The results revealed linearity and high specificity demonstrated by the inability of detecting non-citrullinated histone H3. Coefficients of variation for intra- and inter-assay variability ranged from 2.1 to 5.1% and from 5.8 to 13.5%, respectively, allowing for a high precision. Furthermore, our results support an inflammatory induction of a systemic NET burden by showing, for the first time, clear intra-individual elevations of plasma H3Cit in a human model of lipopolysaccharide-induced inflammation. Taken together, our work demonstrates the development of a new method for the quantification of H3Cit by ELISA that can reliably be used for the detection of NETs in human plasma.

  2. Enzyme-linked immunosorbent assay gliadin assessment in processed food products available for persons with celiac disease: a feasibility study for developing a gluten-free food database.

    Agakidis, Charalampos; Karagiozoglou-Lampoudi, Thomais; Kalaitsidou, Marina; Papadopoulos, Theodoros; Savvidou, Afroditi; Daskalou, Efstratia; Dimitrios, Triantafyllou


    Inappropriate food labeling and unwillingness of food companies to officially register their own gluten-free products in the Greek National Food Intolerance Database (NFID) result in a limited range of processed food products available for persons with celiac disease (CDP). The objective of the study was to evaluate the feasibility of developing a gluten-free food product database based on the assessment of the gluten content in processed foods available for CDP. Gluten was assessed in 41 processed food products available for CDP. Group A consisted of 26 products for CDP included in the NFID, and group B contained 15 food products for CDP not registered in the NFID but listed in the safe lists of the local Celiac Association (CA). High-sensitivity ω-gliadin enzyme-linked immunosorbent assay (ELISA) was used for analysis. Gluten was lower than 20 ppm in 37 of 41 analyzed products (90.2%): in 24 of 26 (92.3%) products in group A and in 13 of 15 (86.7%) products in group B (P = .61). No significant difference was found between the 2 groups regarding gluten content. No product in either group contained gluten in excess of 100 ppm. Most of the analyzed products included in the Greek NFID or listed in the lists of the local CA, even those not officially labeled "gluten free," can be safely consumed by CDP. The use of commercially available ω-gliadin ELISA is able to identify those products that contain inappropriate levels of gluten, making feasible it to develop an integrated gluten-free processed food database.

  3. Diagnostic accuracy of the anti-glutamic acid decarboxylase antibody in type 1 diabetes mellitus: Comparison between radioimmunoassay and enzyme-linked immunosorbent assay.

    Murata, Takashi; Tsuzaki, Kokoro; Nirengi, Shinsuke; Watanabe, Tomokazu; Mizutani, Yukako; Okada, Hayami; Tsukamoto, Masami; Odori, Shinji; Nakagawachi, Reiko; Kawaguchi, Yaeko; Yoshioka, Fumi; Yamada, Kazunori; Shimatsu, Akira; Kotani, Kazuhiko; Satoh-Asahara, Noriko; Sakane, Naoki


    The distributer of the anti-glutamic acid decarboxylase antibody assay kit using radioimmunoassay (RIA) recently announced its discontinuation, and proposed an alternative kit using enzyme-linked immunosorbent assay (ELISA). The aim of the present study was to investigate the diagnostic values of the anti-glutamic acid decarboxylase antibody by RIA and ELISA among type 1 diabetes mellitus patients and control participants. A total of 79 type 1 diabetes mellitus patients and 79 age-matched controls were enrolled and assessed using RIA and ELISA. Sensitivity, specificity, positive predictive values and negative predictive values were calculated for cut-off values (RIA = 1.5 U/mL and ELISA = 5.0 U/mL, respectively). Kappa coefficients were used to test for agreements between the RIA and ELISA methods regarding the diagnosis of type 1 diabetes mellitus. The sensitivity, specificity, positive predictive values, and negative predictive values for diagnosing type 1 diabetes mellitus were 57.0, 97.5, 95.7, and 69.4% by RIA, and 60.8, 100.0, 100.0 and 71.8% by ELISA, respectively. The diagnosis of type 1 diabetes mellitus using the RIA and ELISA methods showed substantial agreement with the kappa values of 0.74 for all participants, and of 0.64 for the acute type; however, there was moderate agreement with the kappa value of 0.56 for the slowly progressive type. The present study suggests that both anti-glutamic acid decarboxylase antibody by RIA and ELISA was useful for diagnosing type 1 diabetes mellitus. However, in the slowly progressive type, the degree of agreement of these two kits was poorer compared with those in all participants or in the acute type. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

  4. Use of Heavy Water (D2O in Developing Thermostable Recombinant p26 Protein Based Enzyme-Linked Immunosorbent Assay for Serodiagnosis of Equine Infectious Anemia Virus Infection

    Harisankar Singha


    Full Text Available Thermostabilizing effect of heavy water (D2O or deuterium oxide has been demonstrated previously on several enzymes and vaccines like oral poliovirus vaccine and influenza virus vaccine. In view of the above observations, effect of heavy water on in situ thermostabilization of recombinant p26 protein on enzyme-linked immunosorbent assay (ELISA for serodiagnosis of equine infectious anemia virus (EIAV infection was investigated in the present study. The carbonate-bicarbonate coating buffer was prepared in 60% and 80% D2O for coating the p26 protein in 96-well ELISA plate and thermal stability was examined at 4°C, 37°C, 42°C, and 45°C over a storage time from 2 weeks to 10 months. A set of positive serum (n=12 consisting of strong, medium, and weak titer strength (4 samples in each category and negative serum (n=30 were assessed in ELISA during the study period. At each time point, ELISA results were compared with fresh plate to assess thermal protective effect of D2O. Gradual increase in the stabilizing effect of 80% D2O at elevated temperature (37°C < 42°C < 45°C was observed. The 80% D2O provides the thermal protection to rp26 protein in ELISA plate up to 2 months of incubation at 45°C. The findings of the present study have the future implication of adopting cost effective strategies for generating more heat tolerable ELISA reagents with extended shelf life.

  5. Milk progesterone enzyme-linked immunosorbent assay as a tool to investigate ovarian cyclicity of water buffaloes in relation to body condition score and milk production

    Banu Turgish A


    Full Text Available Abstract Background Application of assisted reproductive technologies in buffaloes is limited to some extent by farmers’ inability to detect oestrus because of its poor expression. The present study aimed at investigating reliability of a milk progesterone enzyme-linked immunosorbent assay (ELISA to assess the ovarian cyclicity during post partum, oestrus and post-breeding periods in water buffaloes. Methods Progesterone concentrations were measured by an ELISA in milk of 23 postpartum buffaloes in relation to oestrus, pregnancy, body condition score (BCS and milk production. Two milk samples were taken at 10 days intervals, every month starting from day 30 and continued to day 150 post partum. BCS and milk production were recorded during sample collection. Milk samples from bred buffaloes were collected at Day 0 (day of breeding, Days 10–12 and Days 22–24. Defatted milk was preserved at −80°C until analysis. Pregnancy was confirmed by palpation per rectum on Days 70–90. Results Seventeen buffaloes had 47 ovulatory cycles, one to four in each, 13 were detected in oestrus once (28 % oestrus detection rate. Progesterone concentration ≥1 ng/ml in one of the two 10-day-interval milk samples reflected ovulation and corpus luteum formation. The intervals between calving to first luteal activity and to first detected oestrus varied from 41 to 123 days (n = 17 and 83 to 135 (n = 13 days, respectively. Eight buffaloes were bred in the course of the study and seven were found pregnant. These buffaloes had a progesterone profile of low (P P  Conclusions Milk progesterone ELISA is a reliable tool for monitoring ovarian cyclicity and good BCS may be an indicator of resuming cyclicity in water buffalo.

  6. Milk progesterone enzyme-linked immunosorbent assay as a tool to investigate ovarian cyclicity of water buffaloes in relation to body condition score and milk production.

    Banu, Turgish A; Shamsuddin, Mohammed; Bhattacharjee, Jayonta; Islam, Mohammad F; Khan, Saiful I; Ahmed, Jalal U


    Application of assisted reproductive technologies in buffaloes is limited to some extent by farmers' inability to detect oestrus because of its poor expression. The present study aimed at investigating reliability of a milk progesterone enzyme-linked immunosorbent assay (ELISA) to assess the ovarian cyclicity during post partum, oestrus and post-breeding periods in water buffaloes. Progesterone concentrations were measured by an ELISA in milk of 23 postpartum buffaloes in relation to oestrus, pregnancy, body condition score (BCS) and milk production. Two milk samples were taken at 10 days intervals, every month starting from day 30 and continued to day 150 post partum. BCS and milk production were recorded during sample collection. Milk samples from bred buffaloes were collected at Day 0 (day of breeding), Days 10-12 and Days 22-24. Defatted milk was preserved at -80°C until analysis. Pregnancy was confirmed by palpation per rectum on Days 70-90. Seventeen buffaloes had 47 ovulatory cycles, one to four in each, 13 were detected in oestrus once (28 % oestrus detection rate). Progesterone concentration ≥1 ng/ml in one of the two 10-day-interval milk samples reflected ovulation and corpus luteum formation. The intervals between calving to first luteal activity and to first detected oestrus varied from 41 to 123 days (n = 17) and 83 to 135 (n = 13) days, respectively. Eight buffaloes were bred in the course of the study and seven were found pregnant. These buffaloes had a progesterone profile of low (progesterone ELISA is a reliable tool for monitoring ovarian cyclicity and good BCS may be an indicator of resuming cyclicity in water buffalo.

  7. A novel whole-bacterial enzyme linked-immunosorbant assay to quantify Chlamydia trachomatis specific antibodies reveals distinct differences between systemic and genital compartments.

    Hannah L Albritton

    Full Text Available Chlamydia trachomatis (CT is the leading sexually transmitted bacterial infection. The continued global burden of CT infection strongly predicates the need for a vaccine to supplement current chlamydial control programs. The correlates of protection against CT are currently unknown, but they must be carefully defined to guide vaccine design. The localized nature of chlamydial infection in columnar epithelial cells of the genital tract necessitates investigation of immunity at the site of infection. The purpose of this study was to develop a sensitive whole bacterial enzyme-linked immunosorbent assay (ELISA to quantify and compare CT-specific IgG and IgA in sera and genital secretions from CT-infected women. To achieve this, elementary bodies (EBs from two of the most common genital serovars (D and E were attached to poly-L-lysine-coated microtiter plates with glutaraldehyde. EB attachment and integrity were verified by the presence of outer membrane antigens and the absence of bacterial cytoplasmic antigens. EB-specific IgG and IgA standards were developed by pooling sera with high titers of CT-specific antibodies from infected women. Serum, endocervical and vaginal secretions, and endocervical cytobrush specimens from CT-infected women were used to quantify CT-specific IgG and IgA which were then normalized to total IgG and IgA, respectively. Analyses of paired serum and genital samples revealed significantly higher proportions of EB-specific antibodies in genital secretions compared to sera. Cervical and vaginal secretions and cytobrush specimens had similar proportions of EB-specific antibodies, suggesting any one of these genital sampling techniques could be used to quantify CT-specific antibodies when appropriate normalization methodologies are implemented. Overall, these results illustrate the need to investigate genital tract CT antibody responses, and our assay provides a useful quantitative tool to assess natural immunity in defined

  8. Smart Drug Delivery System-Inspired Enzyme-Linked Immunosorbent Assay Based on Fluorescence Resonance Energy Transfer and Allochroic Effect Induced Dual-Modal Colorimetric and Fluorescent Detection.

    Miao, Luyang; Zhu, Chengzhou; Jiao, Lei; Li, He; Du, Dan; Lin, Yuehe; Wei, Qin


    Numerous analytical techniques have been undertaken for the detection of protein biomarkers because of their extensive and significant applications in clinical diagnosis, whereas there are few strategies to develop dual-readout immunosensors to achieve more accurate results. To the best of our knowledge, inspired by smart drug delivery system (DDS), a novel pH-responsive modified enzyme-linked immunosorbent assay (ELISA) was innovatively developed for the first time, realizing dual-modal colorimetric and fluorescent detection of cardiac troponin I (cTnI). Curcumin (CUR) was elaborately selected as a reporter molecule, which played the same role of drugs in DDS based on the following considerations: (1) CUR can be used as a kind of pH indicator by the inherited allochroic effect induced by basic pH value; (2) the fluorescence of CUR can be quenched by certain nanocarriers as the acceptor because of the occurrence of fluorescence resonance energy transfer (FRET), while recovered by the stimuli of basic pH value, which can produce "signal-on" fluorescence detection. Three-dimensional MoS 2 nanoflowers (3D-MoS 2 NFs) were employed in immobilizing CUR to constitute a nanoprobe for the determination of cTnI by virtue of good biocompatibility, high absorption capacity, and fluorescence quench efficiency toward CUR. The proposed DDS-inspired ELISA offered dual-modal colorimetric and fluorescent detection of cTnI, thereby meeting the reliable and precise analysis requirements. We believe that the developed dual-readout ELISA will create a new avenue and bring innovative inspirations for biological detections.

  9. Development and evaluation of an avian influenza, neuraminidase subtype 1, indirect enzyme-linked immunosorbent assay for poultry using the differentiation of infected from vaccinated animals control strategy.

    Liu, Y; Mundt, E; Mundt, A; Sylte, M; Suarez, D L; Swayne, D E; García, M


    An indirect enzyme-linked immunosorbent assay (ELISA) was developed using baculovirus, purified, recombinant N1 protein from A/chicken/Indonesia/PA7/2003 (H5N1) virus. The N1-ELISA showed high selectivity for detection of N1 antibodies, with no cross-reactivity with other neuraminidase subtypes, and broad reactivity with sera to N1 subtype isolates from North American and Eurasian lineages. Sensitivity of the N1-ELISA to detect N1 antibodies in turkey sera, collected 3 wk after H1N1 vaccination, was comparable to detection of avian influenza antibodies by the commercial, indirect ELISAs ProFLOK AIV Plus ELISA Kit (Synbiotics, Kansas City, MO) and Avian Influenza Virus Antibody Test Kit (IDEXX, Westbrook, ME). However, 6 wk after vaccination, the Synbiotics ELISA kit performed better than the N1-ELISA and the IDEXX ELISA kit. An evaluation was made of the ability of the N1-ELISA to discriminate vaccinated chickens from subsequently challenged chickens. Two experiments were conducted, chickens were vaccinated with inactivated H5N2 and H5N9 viruses and challenged with highly pathogenic H5N1 virus, and chickens were vaccinated with recombinant poxvirus vaccine encoding H7 and challenged with highly pathogenic H7N1 virus. Serum samples were collected at 14 days postchallenge and tested by hemagglutination inhibition (HI), quantitative neuraminidase inhibition (NI), and N1-ELISA. At 2 days postchallenge, oropharyngeal swabs were collected for virus isolation (VI) to confirm infection. The N1-ELISA was in fair agreement with VI and HI results. Although the N1-ELISA showed a lower sensitivity than the NI assay, it was demonstrated that detection of N1 antibodies by ELISA was an effective and rapid assay to identify exposure to the challenge virus in vaccinated chickens. Therefore, N1-ELISA can facilitate a vaccination strategy with differentiation of infected from vaccinated animals using a neuraminidase heterologous approach.

  10. Diagnostic efficacy of monoclonal antibody based sandwich enzyme linked immunosorbent assay (ELISA for detection of Fasciola gigantica excretory/secretory antigens in both serum and stool

    Zoheiry Mona K


    Full Text Available Abstract Background This research was carried out to develop a reliable monoclonal antibody (MoAb-based sandwich enzyme linked immunosorbent assay (ELISA for the diagnosis of active Fasciola gigantica infection in both serum and stool for comparative purposes. Methods From a panel of MoAbs raised against F. gigantica excretory/secretory antigens (ES Ags, a pair (12B/11D/3F and 10A/9D/10G was chosen due to its high reactivity and strict specificity to F. gigantica antigen by indirect ELISA. Results The two MoAbs were of the IgG1 and IgG2a subclasses, respectively. Using SDS-PAGE and EITB, the selected MoAbs recognized 83, 64, 45 and 26 kDa bands of ES Ags. The lower detection limit of ELISA assay was 3 ng/ml. In stool, the sensitivity, specificity and diagnostic efficacy of ELISA was 96%, 98.2 and 97.1%; while in serum they were 94%, 94.6% and 94.3%, respectively. Moreover, a positive correlation was found between ova count in stool of F. gigantica infected patients and the OD readings of ELISA in both stool and serum samples (r = 0.730, p Conclusions These data showed that the use of MoAb-based sandwich ELISA for the detection of F. gigantica coproantigens in stool specimens was superior to serum samples; it provides a highly efficient, non-invasive technique for the diagnosis of active F. gigantica infection.

  11. Effects of thermal processing on the enzyme-linked immunosorbent assay (ELISA) detection of milk residues in a model food matrix.

    Downs, Melanie L; Taylor, Steve L


    Food products and ingredients are frequently tested for the presence of undeclared allergenic food residues (including milk) using commercial enzyme-linked immunosorbent assays (ELISAs). However, little is understood about the efficacy of these kits with thermally processed foods. This study evaluated the performance of three milk ELISA kits with a model food processed by several methods. A model food (pastry dough squares) was spiked with nonfat dry milk at several concentrations. The pastry squares were processed by boiling (100 °C for 2 min), baking (190 °C for 30 min), frying (190 °C for 2 min), and retorting (121 °C for 20 min with 17 psi overpressure). Samples were analyzed with three commercial ELISA kits: Neogen Veratox Total Milk, ELISA Systems β-lactoglobulin, and ELISA Systems casein. The detection of milk residues depended upon the type of processing applied to the food and the specific milk analyte targeted by the ELISA kit. Poor recoveries were obtained in all processed samples (2-10% of expected values) using the β-lactoglobulin kit. Better recoveries were obtained in boiled samples (44 and 59%, respectively) using the total milk and casein kits. However, these kits performed poorly with baked (9 and 21%) and fried (7 and 18%) samples. Moderate recoveries were observed in retorted samples (23 and 28%). The decreased detection in processed samples is likely due to protein modifications, including aggregation and Maillard reactions, which affect the solubility and immunoreactivity of the antigens detected by the ELISA methods. The observed decreases in ELISA detection of milk are dramatic enough to affect risk-assessment decisions. However, a lower detection of milk residues does not necessarily indicate decreased allergenicity. These ELISA kits are not acceptable for all applications, and users should understand the strengths and limitations of each method.

  12. Development of an indirect competitive enzyme-linked immunosorbent assay applied to the Botrytis cinerea quantification in tissues of postharvest fruits

    Raba Julio


    Full Text Available Abstract Background Botrytis cinerea is a phytopathogenic fungus responsible for the disease known as gray mold, which causes substantial losses of fruits at postharvest. This fungus is present often as latent infection and an apparently healthy fruit can deteriorate suddenly due to the development of this infection. For this reason, rapid and sensitive methods are necessary for its detection and quantification. This article describes the development of an indirect competitive enzyme-linked immunosorbent assay (ELISA for quantification of B. cinerea in apple (Red Delicious, table grape (pink Moscatel, and pear (William's tissues. Results The method was based in the competition for the binding site of monoclonal antibodies between B. cinerea antigens present in fruit tissues and B. cinerea purified antigens immobilized by a crosslinking agent onto the surface of the microtiter plates. The method was validated considering parameters such as selectivity, linearity, precision, accuracy and sensibility. The calculated detection limit was 0.97 μg mL-1 B. cinerea antigens. The immobilized antigen was perfectly stable for at least 4 months assuring the reproducibility of the assay. The fungus was detected and quantified in any of the fruits tested when the rot was not visible yet. Results were compared with a DNA quantification method and these studies showed good correlation. Conclusions The developed method allowed detects the presence of B. cinerea in asymptomatic fruits and provides the advantages of low cost, easy operation, and short analysis time determination for its possible application in the phytosanitary programs of the fruit industry worldwide.

  13. A novel sandwich enzyme-linked immunosorbent assay with covalently bound monoclonal antibody and gold probe for sensitive and rapid detection of bovine β-lactoglobulin.

    He, Shengfa; Li, Xin; Wu, Yong; Wu, Shandong; Wu, Zhihua; Yang, Anshu; Tong, Ping; Yuan, Juanli; Gao, Jinyan; Chen, Hongbing


    Bovine milk is a recognized allergenic food source with β-lactoglobulin (BLG) as its major allergen. Reliable detection of BLG epitopes can, therefore, be a useful marker for the presence of milk in processed food products, and for potential allergenicity. At the present, enzyme-linked immunosorbent assays (ELISA) for the detection of BLG are time-consuming and generally not specific to BLG IgE epitopes. In this study, the 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide-activated anti-BLG IgE epitope monoclonal antibody (mAb 1G9) was covalently bound onto the KOH-treated microtiter plate surface. Using this mAb-bound plate in sandwich combination with biotinylated anti-BLG polyclonal antibody-labeled gold nanoparticles, a linear dynamic range between 31.25 and 64 × 10 3  ng mL -1 with a limit of detection for BLG of 0.49 ng mL -1 was obtained, which is 32 times wider and 16 times more sensitive than conventional sandwich ELISA (sELISA). Total recovery of BLG in spiked food samples was found, without matrix effects. Also in partially hydrolyzed infant formulas, the allergenic BLG residues were detected quantitatively. Compared with conventional and commercial BLG detection sELISAs, our sELISA is reliable, highly BLG epitope-specific, user-friendly, and time-saving and allows accurate detection of potentially allergenic residues in different types of processed foods. This improved sELISA protocol can be easily extended to detect other well-identified and characterized food allergens. Graphical abstract IgE epitope mAb-bound plate in sandwich combination with gold probe for sensitive and rapid detection of bovine β-lactoglobulin and its potentially allergenic residues.

  14. Synergistic Use of Gold Nanoparticles (AuNPs) and “Capillary Enzyme-Linked Immunosorbent Assay (ELISA)” for High Sensitivity and Fast Assays

    Kim, Wan-Joong; Cho, Hyo Young; Jeong, Bongjin; Byun, Sangwon; Huh, JaeDoo; Kim, Young Jun


    Using gold nanoparticles (AuNPs) on “capillary enzyme-linked immunosorbent assay (ELISA)”, we produced highly sensitive and rapid assays, which are the major attributes for point-of-care applications. First, in order to understand the size effect of AuNPs, AuNPs of varying diameters (5 nm, 10 nm, 15 nm, 20 nm, 30 nm, and 50 nm) conjugated with Horseradish Peroxidase (HRP)-labeled anti-C reactive protein (antiCRP) (AuNP•antiCRP-HRP) were used for well-plate ELISA. AuNP of 10 nm produced the largest optical density, enabling detection of 0.1 ng/mL of CRP with only 30 s of incubation, in contrast to 10 ng/mL for the ELISA run in the absence of AuNP. Then, AuNP of 10 nm conjugated with antiCRP-HRP (AuNP•antiCRP-HRP) was used for “capillary ELISA” to detect as low as 0.1 ng/mL of CRP. Also, kinetic study on both 96-well plates and in a capillary tube using antiCRP-HRP or AuNP•antiCRP-HRP showed a synergistic effect between AuNP and the capillary system, in which the fastest assay was observed from the “AuNP capillary ELISA”, with its maximum absorbance reaching 2.5 min, while the slowest was the typical well-plate ELISA with its maximum absorbance reaching in 13.5 min. PMID:29278402

  15. Indirect enzyme-linked immunosorbent assay method based on Streptococcus agalactiae rSip-Pgk-FbsA fusion protein for detection of bovine mastitis.

    Bu, Ri-E; Wang, Jin-Liang; Wu, Jin-Hua; Xilin, Gao-Wa; Chen, Jin-Long; Wang, Hua


    The aim of this study was to establish a rapid and accurate method for the detection of the Streptococcus agalactiae antibody (SA-Ab) to determine the presence of the bovine mastitis (BM)-causative pathogen. The multi-subunit fusion protein rSip-Pgk-FbsA was prokaryotically expressed and purified. The triple activities of the membrane surface-associated proteins Sip, phosphoglycerate kinase (Pgk), and fibronectin (FbsA) were used as the diagnostic antigens to establish an indirect enzyme-linked immunosorbent assay (ELISA) method for the detection of SA-Ab in BM. The optimal antigen coating concentration was 2 μg/mL, the optimal serum dilution was 1:160, and the optimal dilution of the enzyme-labeled secondary antibody was 1:6000. The sensitivity, specificity, and repeatability tests showed that the method established in this study had no cross-reaction with antibodies to Streptococcus pyogenes, Escherichia coli, Staphylococcus aureus, and Staphylococcus epidermidis in the sera. The results of the sensitivity test showed that a positive result could be obtained even if the serum dilution reached 1:12,800, indicating the high sensitivity and good repeatability of the method. The positive coincidence rate of this method was 98.6%, which is higher than that of previous tests established with the Sip or Pgk mono-antigen fusion protein, respectively, demonstrating the relatively higher sensitivity of this newly established method. The detection rate for 389 clinical samples was 46.53%. The indirect ELISA method established in this study could provide a more accurate and reliable serological method for the rapid detection of S. agalactiae in cases of BM.

  16. Development of an enzyme-linked immunosorbent assay for detection of CDCP1 shed from the cell surface and present in colorectal cancer serum specimens.

    Chen, Yang; Harrington, Brittney S; Lau, Kevin C N; Burke, Lez J; He, Yaowu; Iconomou, Mary; Palmer, James S; Meade, Brian; Lumley, John W; Hooper, John D


    CUB domain containing protein 1 (CDCP1) is a transmembrane protein involved in progression of several cancers. When located on the plasma membrane, full-length 135kDa CDCP1 can undergo proteolysis mediated by serine proteases that cleave after two adjacent amino acids (arginine 368 and lysine 369). This releases from the cell surface two 65kDa fragments, collectively termed ShE-CDCP1, that differ by one carboxyl terminal residue. To evaluate the function of CDCP1 and its potential utility as a cancer biomarker, in this study we developed an enzyme-linked immunosorbent assay (ELISA) to reliably and easily measure the concentration of ShE-CDCP1 in biological samples. Using a reference standard we demonstrate that the developed ELISA has a working range of 0.68-26.5ng/ml, and the limit of detection is 0.25ng/ml. It displays high intra-assay (repeatability) and high inter-assay (reproducibility) precision with all coefficients of variation ≤7%. The ELISA also displays high accuracy detecting ShE-CDCP1 levels at ≥94.8% of actual concentration using quality control samples. We employed the ELISA to measure the concentration of ShE-CDCP1 in human serum samples with our results suggesting that levels are significantly higher in serum of colorectal cancer patients compared with serum from individuals with benign conditions (pELISA is a suitable method to quantify ShE-CDCP1 concentration in human serum. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Diagnostic specificity of the African swine fever virus antibody detection enzyme-linked immunosorbent assay in feral and domestic pigs in the United States.

    Bergeron, H C; Glas, P S; Schumann, K R


    African swine fever (ASF) is a highly contagious haemorrhagic disease of pigs that has the potential to cause mortality nearing 100% in naïve animals. While an outbreak of ASF in the United States' pig population (domestic and feral) has never been reported, an introduction of the disease has the potential to cause devastation to the pork industry and food security. During the recovery phase of an outbreak, an antibody detection diagnostic assay would be required to prove freedom of disease within the previously infected zone and eventually nationwide. Animals surviving an ASF infection would be considered carriers and could be identified through the persistence of ASF viral antibodies. These antibodies would demonstrate exposure to the disease and not vaccination, as there is no ASF vaccine available. A well-established commercial enzyme-linked immunosorbent assay (ELISA) detects antibodies against ASF virus (ASFV), but the diagnostic specificity of the assay had not been determined using serum samples from the pig population of the United States. This study describes an evaluation of the World Organization for Animal Health (OIE)-recommended Ingezim PPA COMPAC ELISA using a comprehensive cohort (n = 1791) of samples collected in the United States. The diagnostic specificity of the assay was determined to be 99.4% (95% confidence interval (CI): [98.9, 99.7]). The result of this study fills a gap in understanding the performance of the Ingezim PPA COMPAC ELISA in the ASF naïve pig population of the United States. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  18. Impact of grey zone sample testing by enzyme-linked immunosorbent assay in enhancing blood safety: Experience at a tertiary care hospital in North India.

    Solanki, Archana; Singh, Abhay; Chaudhary, Rajendra


    Enzyme-linked immunosorbent assay (ELISA) used for screening blood donors for transfusion transmitted infections (TTIs) can sometimes fail to detect blood donors who are recently infected or possessing the low strength of pathogen. Estimation of a grey zone in ELISA testing and repeat testing of grey zone samples can further help in reducing the risks of TTI in countries where nucleic acid amplification testing for TTIs is not feasible. Grey zone samples with optical density (OD) lying between cut-off OD and 10% below the cut-off OD (cut-off OD × 0.9) were identified during routine ELISA testing. On performing repeat ELISA testing on grey zone samples in duplicate, the samples showing both OD value below grey zone were marked nonreactive, and samples showing one or both OD value in the grey zone were marked indeterminate. The samples on repeat testing showing one or both OD above cut-off value were marked positive. About 119 samples (77 for hepatitis B virus [HBV], 23 for human immunodeficiency virus [HIV], and 19 for hepatitis C virus [HCV]) were found to be in grey zone. On repeat testing of these samples in duplicate, 70 (58.8%) samples (45 for HBV, 12 for HIV, and 13 for HCV) were found to be reactive. Six (5%) samples (four for HBV, one for HIV, and one for HCV) were found to be indeterminate. Seventy donors initially screened negative, were found out to be potentially infectious on repeat grey zone testing. Thus, estimation of grey zone samples with repeat testing can further enhance the safety of blood transfusion.

  19. Development of an Indirect Competitive Enzyme-Linked Immunosorbent Assay for Glycocholic Acid Based on Chicken Single-Chain Variable Fragment Antibodies.

    Cui, Xiping; Vasylieva, Natalia; Wu, Panpan; Barnych, Bogdan; Yang, Jun; Shen, Ding; He, Qiyi; Gee, Shirley J; Zhao, Suqing; Hammock, Bruce D


    Glycocholic acid (GCA) is an important metabolite of bile acids, whose urine levels are expected to be a specific diagnostic biomarker for hepatocellular carcinoma (HCC). A high-throughput immunoassay for determination of GCA would be of significant advantage and useful for primary diagnosis, surveillance, and early detection of HCC. Single-chain variable fragment (scFv) antibodies have several desirable characteristics and are an attractive alternative to traditional antibodies for the immunoassay. Because chicken antibodies possess single heavy and light variable functional domains, they are an ideal framework for simplified generation of recombinant antibodies for GCA detection. However, chicken scFvs have rarely been used to detect GCA. In this study, a scFv library was generated from chickens immunized with a GCA hapten coupled to bovine serum albumin (BSA), and anti-GCA scFvs were isolated by a phage-displayed method. Compared to the homologous coating antigen, use of a heterologous coating antigen resulted in about an 85-fold improvement in sensitivity of the immunoassay. This assay, under optimized conditions, had a linear range of 0.02-0.18 μg/mL, with an IC 50 of 0.06 μg/mL. The assay showed negligible cross-reactivity with various related bile acids, except for taurocholic acid. The detection of GCA from spiked human urine samples ranged from 86.7% to 123.3%. These results, combined with the advantages of scFv antibodies, indicated that a chicken scFv-based enzyme-linked immunosorbent assay is a suitable method for high-throughput screening of GCA in human urine.


    Nina Difla Muflikhah


    Full Text Available Toxoplasmosis is an infectious disease caused by Toxoplasma gondii, an intracellular protozoan parasite that live inside the cells of the reticulo endothelial and parenchymal cells of human and animals (mammals and birds. Some cases of toxoplasmosis usually have no symptoms, but in any cases caused severe symptoms, such as hydrocephalus, microcephalus, intracranial calcification, retinal damage, brain abscess, mental retardation, lymphadenopathy, and others. Its severe symptoms usually showed a long time after first exposure, except symptoms showed by congenital transmission caused by infected mother. Early diagnosis is important to prevent the illness but methods for toxoplasmosis screening are still too expensive for developing country. Enzyme-linked immunosorbent assay (ELISA allow the testing of a large number samples within short time frame and based on antibody or antigen detection. This study aimed to know the sensitivity and specificity of recombinat protein GRA1 as antigen using ELISA methods. We tested the sensitivity and spesificity of GRA1 protein as antigen in ELISA methods to diagnose toxoplasmosis and compared with ELISA Kit Commercial. Reliable laboratory testing is important to detect Toxoplasma gondii infection, and focused to improving the low cost and easy-to-use diagnostic instrument. Seventy sera collected and tested using both indirect ELISA, commercial ELISA kit and GRA1 protein coated as antigen. Fourty eight and fifty one samples showed positive IgG antibody result of ELISA-GRA1 and ELISA kit. Negative sample tested by ELISA-GRA1 was 22 samples and 19 sample tested by ELISA Kit. The sensitivity and specificity of GRA1-based on ELISA were 100% and 86.36%, positive prediction value (ppv was 94.11%. These data indicate that the recombinant protein GRA1 is a highly immunogenic protein in human toxoplasmosis and become a promising marker for the screening of toxoplasmosis.

  1. Differentiation of foot-and-mouth disease virus-infected from vaccinated pigs by enzyme-linked immunosorbent assay using nonstructural protein 3AB as the antigen and application to an eradication program

    Chung, Wen Bin; Sørensen, Karl Johan; Liao, Pei Chih


    Baculovirus-expressed foot-and-mouth disease virus (FMDV) nonstructural protein 3AB was used as the antigen in an enzyme-linked immunosorbent assay. This assay allowed the differentiation of vaccinated from infected pigs. Serial studies were performed using sera collected from pigs in the field...... in Taiwan showed that the positive reactors steadily decreased over time in both finishers and sows, indicating that the pig population risk of infection by FMDV has decreased....

  2. Standardization of micro-enzyme-linked immunosorbent assay (ELISA) and Western blot for detection of Trypanosoma cruzi antibodies using extracts from Mexican strains as antigens.

    Sánchez, B; Monteón, V; Reyes, P A; Espinoza, B


    This report describes two assays for the detection of anti-Trypanosoma cruzi antibodies using Mexican strains of the parasite and the concordance with two assays previously evaluated at the Instituto Nacional de Cardiología Ignacio Chávez in Mexico City. Micro-enzyme-linked immunosorbent assay (ELISA) and Western blot were used for the detection of T. cruzi antibodies with a total extract of epimastigote from Ninoa and Queretaro, which are Mexican strains of T. cruzi. To standardize these methods, a total of 246 serum samples was used. In addition, sera from six confirmed Mexican chronic individuals in the asymptomatic phase were also used for comparison with the Argentinean antigen. ELISA was 100% specific in that no false positive results were found with sera of both healthy individuals and non-Chagasic cardiopaths. Sera from individuals infected with Leishmania sp. showed approximately 16% of cross-reaction with ELISA. The test showed a positive predictive value of 90% and a negative predictive value of 100%. Western blot was also a highly sensitive test for detecting chronic Chagasic symptomatic patients from Mexico because no false negative results were obtained. Furthermore, it was possible to use Western blot to detect seven immunodominant antigens of approximately 30, 32, 40, 42, 65, 70, and 83 kDa. Concordance with two previous standardized tests at the Instituto Nacional de Cardiología showed a Kappa index of 0.96, indicating high concordance between the results obtained at these two laboratories. Finally, ELISA using Ninoa antigen extract was more sensitive than ELISA with an Argentinean extract, which failed to detect individuals in the chronic asymptomatic phase (undetermined phase) of infection. This study indicates that ELISA and Western blot using Ninoa and/or Queretaro extracts of T. cruzi as antigens are useful tools in the detection of individuals who have been exposed to T. cruzi both in the undetermined/asymptomatic and symptomatic phases

  3. Development and application of triple antibody sandwich enzyme-linked immunosorbent assays for begomovirus detection using monoclonal antibodies against Tomato yellow leaf curl Thailand virus.

    Seepiban, Channarong; Charoenvilaisiri, Saengsoon; Warin, Nuchnard; Bhunchoth, Anjana; Phironrit, Namthip; Phuangrat, Bencharong; Chatchawankanphanich, Orawan; Attathom, Supat; Gajanandana, Oraprapai


    Tomato yellow leaf curl Thailand virus, TYLCTHV, is a begomovirus that causes severe losses of tomato crops in Thailand as well as several countries in Southeast and East Asia. The development of monoclonal antibodies (MAbs) and serological methods for detecting TYLCTHV is essential for epidemiological studies and screening for virus-resistant cultivars. The recombinant coat protein (CP) of TYLCTHV was expressed in Escherichia coli and used to generate MAbs against TYLCTHV through hybridoma technology. The MAbs were characterized and optimized to develop triple antibody sandwich enzyme-linked immunosorbent assays (TAS-ELISAs) for begomovirus detection. The efficiency of TAS-ELISAs for begomovirus detection was evaluated with tomato, pepper, eggplant, okra and cucurbit plants collected from several provinces in Thailand. Molecular identification of begomoviruses in these samples was also performed through PCR and DNA sequence analysis of the CP gene. Two MAbs (M1 and D2) were generated and used to develop TAS-ELISAs for begomovirus detection. The results of begomovirus detection in 147 field samples indicated that MAb M1 reacted with 2 begomovirus species, TYLCTHV and Tobacco leaf curl Yunnan virus (TbLCYnV), whereas MAb D2 reacted with 4 begomovirus species, TYLCTHV, TbLCYnV, Tomato leaf curl New Delhi virus (ToLCNDV) and Squash leaf curl China virus (SLCCNV). Phylogenetic analyses of CP amino acid sequences from these begomoviruses revealed that the CP sequences of begomoviruses recognized by the narrow-spectrum MAb M1 were highly conserved, sharing 93% identity with each other but only 72-81% identity with MAb M1-negative begomoviruses. The CP sequences of begomoviruses recognized by the broad-spectrum MAb D2 demonstrated a wider range of amino acid sequence identity, sharing 78-96% identity with each other and 72-91% identity with those that were not detected by MAb D2. TAS-ELISAs using the narrow-specificity MAb M1 proved highly efficient for the detection of

  4. A New Enzyme-Linked Immunosorbent Assay for a Total Anti-T Lymphocyte Globulin Determination: Development, Analytical Validation, and Clinical Applications.

    Montagna, Michela; La Nasa, Giorgio; Bernardo, Maria E; Piras, Eugenia; Avanzini, Maria A; Regazzi, Mario; Locatelli, Franco


    Anti-T lymphocyte globulin (ATLG) modulates the alloreactivity of T lymphocytes, reducing the risk of immunological posttransplant complications, in particular rejection and graft-versus-host disease, after allogeneic hematopoietic stem cell transplantation (HSCT). We developed and validated a new enzyme-linked immunosorbent assay (ELISA) method to measure serum levels of total ATLG and evaluate the pharmacokinetics (PK) of the drug in children with β-Thalassemia, receiving allogeneic HSCT. Diluted serum samples were incubated with Goat-anti-Rabbit IgG antibody coated on a microtiter plate and then, with Goat-anti-Human IgG labeled with horseradish peroxidase. After incubation and washings, substrate solution was added and absorbance was read at 492 nm. ATLG concentrations in samples were determined by interpolation from a standard curve (range: 200-0.095 ng/mL), prepared by diluting a known amount of ATLG in phosphate-buffered saline (PBS). Low, medium, and high-quality control concentrations were 1.56, 6.25, and 25 ng/mL, respectively. This method was developed and validated within the acceptance criteria in compliance with the Guidelines for a biological method validation: the sensitivity of the method was 0.095 ng/mL. We analyzed serum samples from 14 children with β-Thalassemia who received ATLG (Grafalon) at a dose of 10 mg/kg administered as intravenous (IV) infusion on days -5, -4, and -3 before HSCT (day 0). Blood sampling for PK evaluation was performed on days -5, -4, and -3 before and after drug infusion; and then from day -2 to +56. The median total ATLG levels pre-IVand post-IV were 0 and 118 mcg/mL on day -5; 85.9 and 199.2 mcg/mL on day -4; 153 and 270.9 mcg/mL on day -3, respectively. The median PK values of CL was 0.0029 (range: 0.0028-0.0057) L·kg·d, Vd was 0.088 (range: 0.025-0.448) L/kg and t1/2 was 20.2 (range: 5.8-50.2) days. These data suggest that given the marked interindividual variability of total ATLG disposition, the development of

  5. Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

    Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A


    We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

  6. Occurrence and Distribution of Pesticides in the St. Lucie River Watershed, South-Central Florida, 2000-01, Based on Enzyme-Linked Immunosorbent Assay (ELISA) Screening

    Lietz, A.C.


    The St. Lucie River watershed is a valuable estuarine ecosystem and resource in south-central Florida. The watershed has undergone extensive changes over the last century because of anthropogenic activities. These activities have resulted in a complex urban and agricultural drainage network that facilitates the transport of contaminants, including pesticides, to the primary canals and then to the estuary. Historical data indicate that aquatic life criteria for selected pesticides have been exceeded. To address this concern, a reconnaissance was conducted to assess the occurrence and distribution of selected pesticides within the St. Lucie River watershed. Numerous water samples were collected from 37 sites among various land-use categories (urban/built-up, citrus, cropland/pastureland, and inte-grated). Samples were collected at inflow points to primary canals (C-23, C-24, and C-44) and at control structures along these canals from October 2000 to September 2001. Samples were screened for four pesticide classes (triazines, chloroacetanilides, chlorophenoxy compounds, and organophosphates) by using Enzyme-Linked Immunosorbent Assay (ELISA) screening. A temporal distribution of pesticides within the watershed was made based on samples collected at the integrated sites during different rainfall events between October 2000 and September 2001. Triazines were detected in 32 percent of the samples collected at the integrated sites. Chloroacetanilides were detected in 60 percent of the samples collected at the integrated sites, with most detections occurring at one site. Chlorophenoxy compounds were detected in 17 percent of the samples collected at the integrated sites. Organophosphates were detected in only one sample. A spatial distribution and range of concentration of pesticides at the 37 sampling sites in the watershed were determined among land-use categories. Triazine concentrations ranged from highest to lowest in the citrus, urban/built-up, and integrated areas

  7. Comparative study on collagen-binding enzyme-linked immunosorbent assay and ristocetin cofactor activity assays for detection of functional activity of von Willebrand factor.

    Turecek, Peter L; Siekmann, Jürgen; Schwarz, Hans Peter


    For more than two decades, the ristocetin cofactor (RCo) assay, which measures the von Willebrand factor (vWF)-mediated agglutination of platelets in the presence of the antibiotic ristocetin, has been the most common method for measuring the functional activity of vWF. There is, however, general agreement among clinical analysts that this method has major practical disadvantages in performance and reproducibility. Today, collagen-binding assays (CBA) based on the enzyme-linked immunosorbent assay (ELISA) technique that measure the interaction of vWF and collagen are an alternative analytic procedure based on a more physiological function than that of the RCo procedure. We used both assay systems in a comparative study to assess the functional activity of vWF in plasma as well as in therapeutic preparations. We measured RCo activities of plasma from healthy donors and patients with different types of von Willebrand disease (vWD) and of vWF as a drug substance in factor (F) VIII/vWF concentrates using both the aggregometric and the macroscopic methods. In addition, we measured collagen-binding activity (vWF:CB) using a recently developed commercially available CBA system. To investigate the relation between the structure and the functional activity of vWF, we isolated vWF species with different numbers of multimers from FVIII/vWF concentrates by affinity chromatography on immobilized heparin. The vWF:RCo and vWF:CB of the different fractions were measured, and the multimeric structure of vWF was analyzed by sodium dodecyl sulfate (SDS) agarose gel electrophoresis. (vWF:CB and vWF:RCo are part of the nomenclature proposed by the International Society on Thrombosis and Hemostasis Scientific and Standardization Committee [ISTH SSC] subcommittee on von Willebrand factor, in Maastricht, Germany, June 16, 2000.) Measurement of functional vWF activity by CBA can be carried out with substantially higher interassay reproducibility than can measurement of RCo. Both assay

  8. Evaluation of an enzyme-linked immunosorbent assay for serological surveillance of infection with Actinobacillus pleuropneumoniae serotype 5 in pig herds

    Klausen, Joan; Andresen, Lars Ole; Barfod, Kristen


    An indirect enzyme-linked immunoassay for serological surveillance of infection of pigs with Actinobacillus pleuropneumoniae (Ap) serotype 5 was developed. The antigen used was prepared from Ap serotype 5b strain L20. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis...

  9. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard


    Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  10. Development of a simple gel permeation clean-up procedure coupled to a rapid disequilibrium enzyme-linked immunosorbent assay (ELISA) for the detection of Sudan I dye in spices and sauces.

    Oplatowska, Michalina; Stevenson, Paul J; Schulz, Claudia; Hartig, Lutz; Elliott, Christopher T


    Sudan dyes have been found to be added to chilli and chilli products for illegal colour enhancement purposes. Due to the possible carcinogenic effect, they are not authorized to be used in food in the European Union or the USA. However, over the last few years, many products imported from Asian and African countries have been reported via the Rapid Alert System for Food and Feed in the European Union to be contaminated with these dyes. In order to provide fast screening method for the detection of Sudan I (SI), which is the most widely abused member of Sudan dyes family, a unique (20 min without sample preparation) direct disequilibrium enzyme-linked immunosorbent assay (ELISA) was developed. The assay was based on polyclonal antibodies highly specific to SI. A novel, simple gel permeation chromatography clean-up method was developed to purify extracts from matrices containing high amounts of fat and natural pigments, without the need for a large dilution of the sample. The assay was validated according to the Commission Decision 2002/657/EC criteria. The detection capability was determined to be 15 ng g(-1) in sauces and 50 ng g(-1) in spices. The recoveries found ranged from 81% to 116% and inter- and intra-assay coefficients of variation from 6% to 20%. The assay was used to screen a range of products (85 samples) collected from different retail sources within and outside the European Union. Three samples were found to contain high amounts (1,649, 722 and 1,461 ng g(-1)) of SI by ELISA. These results were confirmed by liquid chromatography-tandem mass spectrometry method. The innovative procedure allows for the fast, sensitive and high throughput screening of different foodstuffs for the presence of the illegal colorant SI.

  11. Comparison of two enzyme-linked immunosorbent assays and one rapid immunoblot assay for detection of herpes simplex virus type 2-specific antibodies in serum

    Groen, J; Van Dijk, G; Niesters, H G; Van Der Meijden, W I; Osterhaus, A D

    The sensitivities and specificities of three immunoassays for the detection of herpes simplex virus type 2 (HSV-2)-specific immunoglobulin G antibodies in serum, including the one-strip rapid immunoblot assay (RIBA; Chiron Corporation) and two indirect enzyme immunosorbent assays (EIA; Gull

  12. Measurement of Platelet-derived Microparticle Levels in the Chronic Phase of Cerebral Infarction Using an Enzyme-linked Immunosorbent Assay

    Shirafuji, Toshihiko; Hamaguchi, Hirotoshi; Kanda, Fumio


    Assessment of platelet function is a critical component of the treatment andsecondary prevention of cerebral infarction, and measurement of platelet-derivedmicroparticle (PDMP) levels using flow cytometry may be a good indicator of plateletfunction. However, the flow cytometric analysis is not feasible in a variety of clinicalsituations. The goal of the present study was to measure PDMP levels using anenzyme-linked immunosorbent assay (ELISA) in chronic cerebral infarction patientsand to dete...

  13. Synthesis of an oxytetracyline-tolidin-BSA immunogen and antibodies production of anti-oxytetracyline developed for oxytetracyline residue detection with enzyme-linked immunosorbent assays technique

    Widiastuti R


    Full Text Available An oxytetracycline-tolidin-bovine serum albumin (OTC-tolidin-BSA-conjugate was synthezed as immunogen for producing specific antibodies in immunized rabbits that would be used as reagent for development of OTC residue detection with enzym-linked immunoassays technique. The immunogen was prepared through diazotization tolidin and subsequently reacted with OTC. The red purple immunogen of OTC-tolidin-BSA absorbed at wave lengths of 277 nm and 488 nm under UV screening absorbances and confirmation with the high performance liquid chromatography (HPLC showed the absence of peak at retention time of 3.46 minutes. Characaterized result with SDS-PAGE showed the molecular weight of the OTC-tolidin-BSA at 69.79 kDA. Subsequently, the immunogen was immunized into New Zealand rabbits in order to produce the polyclonal antibodies. The antibodies were purified using a protein A sepharose column. The OD optimum responses of 0.92 to 1.20 were obtained from the second fractionation at dilution of 1/1000 by titrating the antibodies and OTC-tolidin-BSA coating antigen at concentration of 10 µg/mL on several bleeding times.

  14. Evaluation of a Commercial Sandwich Enzyme-Linked Immunosorbent Assay for the Quantification of Beta-Casomorphin 7 in Yogurt Using Solid-Phase Extraction Coupled to Liquid Chromatography-Tandem Mass Spectrometry as the "Gold Standard" Method.

    Nguyen, Duc Doan; Busetti, Francesco; Johnson, Stuart Keith; Solah, Vicky Ann


    This study investigated beta-casomorphin 7 (BCM7) in yogurt by means of LC-tandem MS (MS/MS) and enzyme-linked immunosorbent assay (ELISA) and use LC-MS/MS as the "gold standard" method to evaluate the applicability of a commercial ELISA. The level of BCM7 in milk obtained from ELISA analysis was much lower than that obtained by LC-MS/MS analysis and trended to increase during fermentation and storage of yogurt. Meanwhile, the results obtained from LC-MS/MS showed that BCM7 degraded during stages of yogurt processing, and its degradation may have been caused by X-prolyl dipeptidyl aminopeptidase activity. As a result, the commercial sandwich ELISA kit was not suitable for the quantification of BCM7 in fermented dairy milk.

  15. Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen

    BANNAI, Hiroshi; NEMOTO, Manabu; TSUJIMURA, Koji; YAMANAKA, Takashi; MAEDA, Ken; KONDO, Takashi


    To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA. PMID:26424485

  16. Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen.

    Bannai, Hiroshi; Nemoto, Manabu; Tsujimura, Koji; Yamanaka, Takashi; Maeda, Ken; Kondo, Takashi


    To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA.

  17. Application of the Ceditest FMDV type O and FMDV-NS enzyme-linked immunosorbent assays for detection of antibodies against Foot-and-mouth disease virus in selected livestock and wildlife species in Uganda

    Ayebazibwe, Chrisostom; Mwiine, Frank Norbert; Balinda, Sheila Nina


    Diagnosis and control of Foot-and-mouth disease virus (FMDV) requires rapid and sensitive diagnostic tests. Two antibody enzyme-linked immunosorbent assay (ELISA) kits, Ceditest FMDV-NS for the detection of antibodies against the nonstructural proteins of all FMDV serotypes and Ceditest FMDV type O......, and selected samples were tested not only in serotype-specific ELISAs for antibodies against primarily FMDV serotype O, but also against other serotypes. The FMDV-NS assay detected far more positive samples (93%) than the FMDV type O assay (30%) in buffalo (P ... the South African Territories (SAT) serotypes, while the seroprevalence was generally comparable in cattle with antibodies against serotype O elicited by infection and/or vaccination. However, some districts had higher seroprevalence using the FMDV type O assay indicating vaccination without infection...

  18. Evaluation of a broad-ranging and convenient enzyme-linked immunosorbent assay using the lysate of infected cells with five serotypes of Orientia tsutsugamushi, a causative agent of scrub typhus.

    Ogawa, Motohiko; Satoh, Masaaki; Saijo, Masayuki; Ando, Shuji


    Scrub typhus is a mite-borne rickettsiosis caused by infection of Orientia tsutsugamushi, which is endemic to several Asia-Pacific Rim countries, including Japan. Although micro-indirect immunofluorescent assay (micro-IFA) is the standard method for the serological diagnosis of scrub typhus, enzyme-linked immunosorbent assay (ELISA) is considered to be more objective, by providing digitized results as opposed to being subject to the judgment of the evaluator as in micro-IFA. Therefore, the aim of this study was to develop a broad-ranging ELISA using the five major prevalent serotypes of O. tsutsugamushi in Japan as the antigens. Furthermore, in contrast to previous studies that used purified microorganisms via ultracentrifugation, we directly used the infected cells, and evaluated the diagnostic accuracy of this simplified method to that of micro-IFA. Evaluation of paired patient sera against the five serotypes showed that the accuracy of ELISA relative to micro-IFA was 87.4 and 79.5% for immunoglobulin (Ig)M and IgG assays, respectively, at the optimized cut-off value. Further evaluation of patient sera against the expected serotype of the infecting strain showed that the accuracy of ELISA compared to micro-IFA increased to 100 and 97.4% in the IgM and IgG assays, respectively. This suggests that use of the five prevalent serotypes contributed to the increase of the accuracy of ELISA. When applying the criteria of serological diagnosis for paired sera samples to ELISA, all 19 patients were diagnosed as positive; a ≥4-fold elevation of the antibody titer was observed in 15 of 19 patients that were positive, and very high antibody titers were observed in both paired sera samples of the remaining four patients. In addition, all samples of healthy subjects and patients with other types of rickettsiosis were diagnosed as negative using these criteria. Our results suggest the excellent performance of the new broad-ranging and convenient ELISA, which appears to be

  19. Evaluation of two Taenia solium cysticercal antigenic preparations (vesicular fluid and a glycoprotein fraction with affinity for lentil lectin for the immunodiagnosis of neurocysticercosis by enzyme-linked immunosorbent assay (ELISA

    Lisandra Akemi Suzuki


    Full Text Available OBJECTIVE: To evaluate the performance of two antigenic preparations (vesicular fluid - VF and a glycoprotein fraction, LLa-Gp fraction, purified from a whole parasite extract by lentil lectin affinity chromatography from Taenia solium cysticerci for the immunodiagnosis of neurocysticercosis. METHOD: Fifty-six cerebrospinal fluid (CSF samples (22 from patients with neurocysticercosis and 34 from patients with other neurological disorders and 57 serum samples (22 from patients with neurocysticercosis, 18 from patients with other infections and 17 from presumably healthy persons were assayed for anticysticercal IgG antibodies with an enzyme-linked immunosorbent assay (ELISA. RESULTS: The VF ELISA showed 100% sensitivity and specificity in CSF and serum samples, whereas the sensitivity and specificity of the LLa-Gp ELISA were, respectively, 90.9% and 97.1%, with the CSF samples and 95.5% and 100% with serum samples. There was no significant difference in the sensitivity and specificity of the two antigenic preparations used to screen CSF and serum samples. CONCLUSION: Considering the complexity and high cost of obtaining the LLa-Gp fraction, VF could be more suitable for screening specific antibodies by ELISA in CSF and serum samples from patients with neurocysticercosis.

  20. Comparison of immunofluorescence and enzyme-linked immunosorbent assay and immunoglobulin G avidity techniques for screening of anti: Toxoplasma antibodies among single serum sample pregnant women in Tabriz, Iran

    Mehrangiz Rajaii


    Full Text Available Background: Congenital toxoplasmosis is that pregnant women acquire the infection during gestation; diagnosis of the acute infection during pregnancy is a complex subject of maternal toxoplasmosis. Thus, the presence of immunoglobulin G (IgG and/or IgM Toxoplasma antibodies in a single serum sample drawn during gestation cannot be used to define whether the infection was recently acquired or chronic. Materials and Methods: At this cross-sectional descriptive study, sera of 391 pregnant women examined and compared. They were in an age range of 21-35 years, referred by gynecologists and infectious disease specialists, during March 2012-April 2013. They have referred, 215 (54.98%, 102 (26%, 74 (18.92% in the first, second and third trimesters of gestation, respectively. For each of them, a questionnaire was completed and serum samples were prepared in an equal condition, examined according to the procedures of indirect immunofluorescence (IIF, enzyme-linked immunosorbent assay (ELISA and IgG Avidity techniques. Results: We have found 111 (28.38% seronegative and 280 (71.61% seropositive cases by IIF and 124 (31.70% seronegative, 267 (68.28% seropositive cases by ELISA. The IgG avidity test confirmed 45 (69.23% and 7 (10.76% doubtful cases of IgM test in IIF and ELISA techniques. Conclusions: This study highlights how to manage pregnant women with toxoplasmosis, especially in a single serum sample condition.

  1. Preparation of anti-Sudan red monoclonal antibody and development of an indirect competitive enzyme-linked immunosorbent assay for detection of Sudan red in chilli jam and chilli oil.

    Xu, Jing; Zhang, Yuanyang; Yi, Jian; Meng, Meng; Wan, Yuping; Feng, Caiwei; Wang, Shanliang; Lu, Xiao; Xi, Rimo


    Sudan dyes are banned to be used in food additives because of the carcinogenicity of their metabolites. A rapid and sensitive indirect competitive enzyme-linked immunosorbent assay (ELISA) was developed to detect the residues of Sudan dyes. Novel immunogen and coating antigen were synthesized via glutaraldehyde linking. The hapten-bovine serum albumin (BSA) was applied as immunogen and the hapten-ovalbumin (OVA) was served as coating antigen. The monoclonal antibody obtained showed high sensitivity to Sudan I with an IC(50) value of 1.7 μg L(-1) in buffer and was suitable to detect the residues of Sudan red in food products. The specificity of the assay was studied by measuring cross-reactivity of the antibody with the structurally related compounds of Sudan II (red (120%). Chilli jam and chilli oil samples spiked with Sudan dyes were analyzed by the method. The detection limit (LOD) of the ELISA method applied in chilli jam and chilli oil was 9.0 μg L(-1) and 19.6 μg L(-1), respectively. The recovery rates of Sudan-I in chilli oil and chilli jam were in the range of 80%-110% with coefficients of variation <25%. The intra-assay variation and inter-assay variation in buffer were both <9%.

  2. Influence of the incubation temperature and the batch components on the sensitivity of an enzyme-linked immunosorbent assay to detect Aujeszky's disease virus glycoprotein E (gE).

    Cay, A B; Van der Stede, Y


    Although licensed batches of an enzyme-linked immunosorbent assay (ELISA) for Aujeszky's disease virus (ADV) were used, and the assays were performed within an ISO/IEC 17025 accredited quality control system, certain routine runs of the ADV ELISA were not validated using the quality system criteria, even when all technical parameters were controlled. Incubation at different temperatures and batch composition were identified as parameters that could result in non-validated assays/runs. Therefore, the effect of incubation temperature and batch composition on the analytical sensitivity of the ELISA was investigated. The World Organisation for Animal Health (OIE) standard reference serum ADV1 was diluted 1:8 and tested in 94 different glycoprotein E ELISA runs performed with different batches and different incubation temperatures. The incubation temperature and batch components had a significant influence on the qualitative result for the OIE standard reference serum. An incubation temperature of at least 22 degrees C was recommended, based on the results of this analysis. Which of the batch components caused these differences in sensitivity was not investigated further.

  3. Specific and sensitive enzyme-linked immunosorbent assays for analysis of residual allergenic food proteins in commercial bottled wine fined with egg white, milk, and nongrape-derived tannins.

    Rolland, Jennifer M; Apostolou, Effie; de Leon, Maria P; Stockley, Creina S; O'Hehir, Robyn E


    Regulations introduced by the Food Standards Australia New Zealand in December 2002 require all wine and wine product labels in Australia to identify the presence of a processing aid, additive or other ingredient, which is known to be a potential allergen. The objective of this study was to establish sensitive assays to detect and measure allergenic proteins from commonly used processing aids in final bottled wine. Sensitive and specific enzyme-linked immunosorbent assays (ELISA) were developed and established for the proteins casein, ovalbumin, and peanut. Lower limits of detection of these proteins were 8, 1, and 8 ng/mL, respectively. A panel of 153 commercially available bottled Australian wines were tested by these ELISA, and except for two red wines known to contain added whole eggs, residuals of these food allergens were not detected in any wine. These findings are consistent with a lack of residual potentially allergenic egg-, milk-, or nut-derived processing aids in final bottled wine produced in Australia according to good manufacturing practice at a concentration that could cause an adverse reaction in egg, milk, or peanut/tree-nut allergic adult consumers.

  4. Evaluation of Chicken IgY Generated Against Canine Parvovirus Viral-Like Particles and Development of Enzyme-Linked Immunosorbent Assay and Immunochromatographic Assay for Canine Parvovirus Detection.

    He, Jinxin; Wang, Yuan; Sun, Shiqi; Zhang, Xiaoying


    Immunoglobulin Y (IgY) antibodies were generated against canine parvovirus virus-like particles (CPV-VLPs) antigen using chickens. Anti-CPV-VLPs-IgY was extracted from hen egg yolk and used for developing enzyme-linked immunosorbent assay (ELISA) and immunochromatographic assay (ICA) for the detection of CPV in dog feces. The cutoff negative values for anti-CPV-VLPs-IgY were determined using negative fecal samples (already confirmed by polymerase chain reaction [PCR]). In both ELISA and ICA, there was no cross-reaction with other diarrheal pathogens. Thirty-four fecal samples were collected from dogs with diarrhea, of which 26.47% were confirmed as CPV-positive samples by PCR, while 29.41% and 32.35% of the samples were found to be positive by ELISA and ICA, respectively. The developed ELISA and ICA exhibited 97.06% and 94.12% conformity with PCR. Higher sensitivity and specificity were observed for IgY-based ELISA and ICA. Thus, they could be suitable for routine use in the diagnosis of CPV in dogs.

  5. Levels of house dust mite-specific serum immunoglobulin E (IgE) in different cat populations using a monoclonal based anti-IgE enzyme-linked immunosorbent assay.

    Bexley, Jennifer; Hogg, Janice E; Hammerberg, Bruce; Halliwell, Richard E W


    Levels of serum immunoglobulin E (IgE) specific for the house dust mites (HDMs) Dermatophagoides farinae (DF) and Dermatophagoides pteronyssinus (DP) in 58 cats with clinical signs suggestive of atopic dermatitis (allergic dermatitis cats), 52 cats with no history of allergic or immunological disease (nonallergic cats) and 26 specific pathogen-free (SPF) cats were measured using a monoclonal anti-IgE enzyme-linked immunosorbent assay. Reactivity to both native and reduced HDM allergens was compared. SPF cats had significantly lower levels of HDM-specific serum IgE than cats with allergic dermatitis and nonallergic cats. The difference in levels of HDM-specific IgE in the serum of cats with allergic dermatitis and nonallergic cats was significant for native DF allergen, but not for native DP allergen or reduced HDM allergens. The results suggest that DF in its native form may be a significant allergen in cats with allergic dermatitis. The clinical relevance of these reactions, however, remains to be proven.

  6. Development of an indirect enzyme-linked immunosorbent assay (ELISA) to differentiate antibodies against wild-type porcine reproductive and respiratory syndrome from the vaccine strain TJM-F92 based on a recombinant Nsp2 protein.

    Wang, X X; Wang, F X; Li, Z G; Wen, Y J; Wang, X; Song, N; Wu, H


    An accurate ELISA method to differentiate pigs infected with wild-type porcine reproductive and respiratory syndrome (PRRSV) strains from vaccinated ones would help to monitor PRRSV vaccination compliance. The recombinant protein GST-d120aa derived from the continuous deletion of 120 amino acids in the non-structural protein 2 region of the modified-live vaccine strain TJM-F92 was used to develop an indirect enzyme-linked immunosorbent assay (d120-ELISA) for differentiating serum antibodies against TJM-F92 from other PRRSV strains. At the optimized cut-off value which was calculated at an S/P of 0.25, it yielded a sensitivity of 90.7% and a specificity of 95.1%. Cross-reactivity tests suggested that the d120-ELISA was PRRSV-specific. Coefficient of variations of the repeatability tests ranged between 1.41-17.02%. The results suggest that the d120-ELISA is suitable for differentiating animals infected with wild-type strains from those immunized with MLV TJM-F92. Copyright © 2017. Published by Elsevier B.V.

  7. Development of enzyme-linked immunosorbent assay (ELISA) for glutathione S-transferase (GST-S) protein in the intertidal copepod Tigriopus japonicus and its application for environmental monitoring.

    Rhee, Jae-Sung; Kim, Bo-Mi; Jeong, Chang-Bum; Leung, Kenneth Mei Yee; Park, Gyung Soo; Lee, Jae-Seong


    To utilize the GST-S protein as a useful biomarker for environmental contamination, we developed a polyclonal antibody-based enzyme-linked immunosorbent assay (ELISA) in the intertidal copepod Tigriopus japonicus. Two polyclonal antibodies, TJ-GST-S1 and TJ-GST-S2, were raised against two TJ-GST-S synthetic peptides. Also a recombinant TJ-GST-S protein was purified as a standard for ELISA development. Each polyclonal antibody was tested by Western blot analysis and indirect ELISA. Of two polyclonal antibodies, TJ-GST-S2 ELISA was further employed due to its wide range of detection and the limit of specificity compared to those of TJ-GST-S1 ELISA system. After exposure to 4 metals (Ag, As, Cd, and Cu) to T. japonicus, the amount of TJ-GST-S protein was significantly elevated in a concentration-dependent manner. Also, TJ-GST-S protein was upregulated at relative high concentrations of B[α]P, PCB, and TBT. In this paper, we suggest that T. japonicas ELISA for TJ-GST-S2 is useful as a potential indicator system for marine contaminants. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Expression of Leptin and Visfatin in Gingival Tissues of Chronic Periodontitis With and Without Type 2 Diabetes Mellitus: A Study Using Enzyme-Linked Immunosorbent Assay and Real-Time Polymerase Chain Reaction.

    Ghallab, Noha A; Amr, Eman M; Shaker, Olfat G


    The aim of this study is to investigate the protein and gene expression of leptin and visfatin in gingival tissue from patients with chronic periodontitis (CP), patients with CP and type 2 diabetes mellitus (T2DM), and healthy individuals. The study includes 50 individuals: 10 healthy individuals, 20 patients with CP, and 20 patients with CP and T2DM. Plaque index, gingival index, probing depth, and clinical attachment loss were measured, and gingival biopsies were obtained. Leptin and visfatin protein expression in gingival tissues was determined using enzyme-linked immunosorbent assay, and messenger RNA (mRNA) expression was measured via real-time polymerase chain reaction. The highest leptin mRNA and protein expression was observed in the control group and was significantly (P ≤0.05) different from the CP and CP+T2DM groups. Gingival tissues from patients with CP and T2DM had a significant increase in visfatin and a decrease in leptin gene and protein expression (P <0.05) compared with both controls and patients with CP. Expression of leptin and visfatin in the gingival tissues suggests a possible role for these adipokines in the pathogenesis of CP and T2DM.

  9. Impacts of Extraction Methods in the Rapid Determination of Atrazine Residues in Foods using Supercritical Fluid Chromatography and Enzyme-Linked Immunosorbent Assay: Microwave Solvent vs. Supercritical Fluid Extractions

    Mohamed H. El-Saeid


    Full Text Available It is an accepted fact that many food products that we eat today have the possibility of being contaminated by various chemicals used from planting to processing. These chemicals have been shown to cause illnesses for which some concerned government agencies have instituted regulatory mechanisms to minimize the risks and the effects on humans. It is for these concerns that reliable and accurate rapid determination techniques are needed to effect proper regulatory standards for the protection of people's nutritional health. This paper, therefore, reports the comparative evaluation of the extraction methods in the determination of atrazine (commonly used in agricultural as a herbicide residues in foods using supercritical fluid chromatography (SFC and enzyme-linked immunosorbent assay (ELISA techniques. Supercritical fluid extraction (SFE and microwave solvent extraction (MSE methods were used to test samples of frozen vegetables, fruit juice, and jam from local food markets in Houston. Results showed a high recovery percentage of atrazine residues using supercritical fluid coupled with ELISA and SFC than with MSE. Comparatively, however, atrazine was detected 90.9 and 54.5% using SFC and ELISA techniques, respectively. ELISA technique was, however, less time consuming, lower in cost, and more sensitive with low detection limit of atrazine residues than SFC technique.

  10. An Enzyme-Linked Immunosorbent Spot Assay Measuring Borrelia burgdorferi B31-Specific Interferon Gamma-Secreting T Cells Cannot Discriminate Active Lyme Neuroborreliosis from Past Lyme Borreliosis: a Prospective Study in the Netherlands.

    van Gorkom, T; Sankatsing, S U C; Voet, W; Ismail, D M; Muilwijk, R H; Salomons, M; Vlaminckx, B J M; Bossink, A W J; Notermans, D W; Bouwman, J J M; Kremer, K; Thijsen, S F T


    Two-tier serology testing is most frequently used for the diagnosis of Lyme borreliosis (LB); however, a positive result is no proof of active disease. To establish a diagnosis of active LB, better diagnostics are needed. Tests investigating the cellular immune system are available, but studies evaluating the utility of these tests on well-defined patient populations are lacking. Therefore, we investigated the utility of an enzyme-linked immunosorbent spot (ELISpot) assay to diagnose active Lyme neuroborreliosis. Peripheral blood mononuclear cells (PBMCs) of various study groups were stimulated by using Borrelia burgdorferi strain B31 and various recombinant antigens, and subsequently, the number of Borrelia -specific interferon gamma (IFN-γ)-secreting T cells was measured. We included 33 active and 37 treated Lyme neuroborreliosis patients, 28 healthy individuals treated for an early manifestation of LB in the past, and 145 untreated healthy individuals. The median numbers of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs did not differ between active Lyme neuroborreliosis patients (6.0; interquartile range [IQR], 0.5 to 14.0), treated Lyme neuroborreliosis patients (4.5; IQR, 2.0 to 18.6), and treated healthy individuals (7.4; IQR, 2.3 to 14.9) ( P = 1.000); however, the median number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs among untreated healthy individuals was lower (2.0; IQR, 0.5 to 3.9) ( P ≤ 0.016). We conclude that the Borrelia ELISpot assay, measuring the number of B. burgdorferi B31-specific IFN-γ-secreting T cells/2.5 × 10 5 PBMCs, correlates with exposure to the Borrelia bacterium but cannot be used for the diagnosis of active Lyme neuroborreliosis. Copyright © 2018 van Gorkom et al.

  11. Improved methods for urinary atrazine mercapturate analysis-Assessment of an enzyme-linked immunosorbent assay (ELISA) and a novel liquid chromatography-mass spectrometry (LC-MS) method utilizing online solid phase extraction (SPE)

    Koivunen, Marja E.; Dettmer, Katja; Vermeulen, Roel; Bakke, Berit; Gee, Shirley J.; Hammock, Bruce D.


    Elimination of interfering substances in urine by solid phase extraction (SPE) prior to analysis resulted in 10-fold improvement in the sensitivity of atrazine mercapturate (AM) enzyme-linked immunosorbent assay (ELISA) compared to previous reports. Of the two tested SPE systems, Oasis[reg] HLB and MCX, the mixed-mode MCX gave good recoveries (82%) of AM in spiked samples measured by ELISA, whereas the reverse-phase HLB phase was not compatible with the immunochemical method. At relatively high concentrations of urinary AM (>20 ng mL -1 ), sample dilution was effective enough for the elimination of interfering substances. The new liquid chromatography-mass spectrometry (LC-MS) method developed for AM utilizes online-SPE with Oasis[reg] HLB, column switching and a stable-isotope internal standard. The limit of quantification (0.05 ng mL -1 ) indicates improved sensitivity compared with most previously published LC-MS methods for AM. Validation of all three methods, LC-MS, ELISA + SPE and ELISA + dilution with spiked urine samples showed good correlation between the known and measured concentrations with R 2 values of 0.996, 0.957 and 0.961, respectively. When a set (n = 70 plus 12 blind duplicates) of urine samples from farmers exposed to atrazine was analyzed, there was a good agreement (R 2 = 0.917) between the log normalized data obtained by ELISA + SPE and LC-MS. High correlation among the data obtained by the two tested methods and the LC-MS method by the Center of Disease Control and Prevention (CDC), together with low variability among the blind duplicates, suggests that both methods reported here would be suitable for the analysis of urinary AM as a biomarker for human exposure of atrazine

  12. Identification of high-affinity anti-IL-1 α autoantibodies in normal human serum as an interfering substance in a sensitive enzyme-linked immunosorbent assay for IL-1 α

    Mae, N.; Liberato, D.J.; Chizzonite, R.; Satoh, H.


    A highly reproducible, sensitive, and specific sandwich enzyme-linked immunosorbent assay (ELISA) for recombinant human IL-1 α (rhIL-1 alpha) has been developed. Results from this ELISA have demonstrated that the concentration of rhIL-1 α added to normal human serum (NHS) decreased by 16.3% after 3 h and 24.9% after 6 h at room temperature. Molecular exclusion column chromatography with Sephacryl S-300 HR revealed that 125I-labeled IL-1 α added to normal human serum rapidly formed higher molecular weight complexes without indication of proteolytic degradation. The observed reduction in immunoreactivity was correlated with this protein complex formation and accounted for the apparent instability of rhIL-1 α in NHS. Immunoblot analysis indicated that the molecular weight of the binding protein was 150-160K, and the IL-1 α binding activity was removed and recovered from NHS by Protein-G affinity chromatography; indicating that the binding protein was IL-1 α-specific IgG. The binding of 125I-labeled IL-1 α to the serum binding proteins could be inhibited by unlabeled IL-1 alpha (IC50 = 7.4 x 10(-11) M) but not by unlabeled IL-1 β. Kinetic analysis with 125I-labeled IL-1 alpha revealed that the average binding affinity of these IL-1 α-specific IgGs was 4.7 x 10(10) M-1. These results suggest that these autoantibodies may interfere with the detection of IL-1 α in human serum by various assay systems and also could be a regulator of circulating IL-1 α

  13. Erysipelothrix rhusiopathiae and Mycoplasma hyopneumoniae: the sensitivities of enzyme-linked immunosorbent assays for detecting vaccinated sows of unknown disease status using serum and colostrum, and the correlation of the results for sow serum, colostrum, and piglet serum.

    Jenvey, Caitlin J; Reichel, Michael P; Cockcroft, Peter D


    Due to relatively high concentrations of immunoglobulins, colostrum has the potential to improve the sensitivity of diagnostic tests for diseases in pigs when compared with serum. It is possible that colostrum could improve the sensitivity of the antibody enzyme-linked immunosorbent assay (ELISA) compared with serum. Colostrum is also essential for piglets, providing protection against infections in the first few weeks and months of life. The sensitivity of 2 commercially available ELISAs, one for the detection of Erysipelothrix rhusiopathiae and the second for Mycoplasma hyopneumoniae antibodies, when used with sow colostrum in comparison with serum was investigated. The correlation of maternal E. rhusiopathiae- and M. hyopneumoniae-specific antibody levels with specific-antibody serum levels in the piglet was also determined. The sensitivity was defined as the proportion of vaccinated sows that were correctly identified as vaccinated at a given cutoff point. The true disease status of the sows with regard to the 2 infections was unknown. Blood and colostrum samples were collected from 20 sows, 10 primiparous and 10 multiparous, and blood samples were also collected from the piglets of each sow, 48-72 hr post-farrowing. The sensitivities of both ELISAs were significantly improved when using colostrum compared with serum. Sow serum and colostrum optical density (OD) values were significantly correlated. The mean sow OD values for serum for E. rhusiopathiae and M. hyopneumoniae and colostrum for E. rhusiopathiae were significantly correlated with piglet serum OD levels. If the improved sensitivity of colostrum can be demonstrated in infected animals, this will increase the ability of the test to identify infected animals using both individual and pooled colostrum. Testing serum and/or colostrum using ELISA can be useful predictors of piglet disease-specific OD values. © 2015 The Author(s).

  14. A comparison of titers of anti-Brucella antibodies of naturally infected and healthy vaccinated cattle by standard tube agglutination test, microtiter plate agglutination test, indirect hemagglutination assay, and indirect enzyme-linked immunosorbent assay

    Anju Mohan


    Full Text Available Aim: We determined the antibody response in cattle naturally infected with brucellosis and normal healthy adult cattle vaccinated during calf hood with strain 19. Materials and Methods: The antibody titers were measured by standard tube agglutination test (STAT, microtiter plate agglutination test (MAT, indirect hemagglutination assay (IHA, and indirect enzyme-linked immunosorbent assay (iELISA as per standard protocols. Results: The mean STAT titers were 1.963±0.345 in infected cattle and 1.200±0.155 in healthy vaccinated cattle. The difference was extremely significant (p<0.0001. The mean MAT titers were 2.244±0.727 in infected cattle and 1.200±0.155 in healthy vaccinated cattle. The difference was very significant (p<0.005. The mean IHA titers in infected cattle were 2.284±0.574, and those in healthy vaccinated cattle were 1.200±0.155. The difference was extremely significant (p=0.0002. However, the difference in mean iELISA titers of infected cattle (1.3678±0.014 and healthy vaccinated cattle (1.367±0.014 was non-significant. The infected animals showed very high titers of agglutinating antibodies compared to the vaccinated animals. However, it cannot be ascertained whether these antibodies are due to vaccine or response to infection. Since the infected animals had been vaccinated earlier, the current infection may suggest that vaccination was unable to induce protective levels of antibody. The heightened antibody response after infection may also indicate a secondary immune response to the antigens common to the vaccine strain and wild Brucella organisms. Conclusion: The brucellosis infected animals showed very high titers of agglutinating antibodies compared to the vaccinated animals.

  15. Enhanced immunoassay for porcine circovirus type 2 antibody using enzyme-loaded and quantum dots-embedded shell–core silica nanospheres based on enzyme-linked immunosorbent assay

    Wu, Long; Li, Xuepu; Shao, Kang; Ye, Shiyi; Liu, Chen; Zhang, Chenjun; Han, Heyou


    Boosting the detection sensitivity of enzyme-linked immunosorbent assay (ELISA) is significant to the early clinical diagnosis of various diseases. Here, we developed a versatile immunosensor using silica nanospheres as carriers for sensitive detection of porcine circovirus type 2 (PCV2) antibody. With HRP enzyme covalently immobilized on the silica nanospheres and CdSe nanocrystals embedded inside, these signal probes were successfully utilized in the sensitive detection of PCV2 antibody by ELISA, fluorometry and square-wave voltammetry (SWV). To further demonstrate the performance of the immunosensor, Human IgG (HIgG) was used as a model analyte. Since more HRP and CdSe QDs were loaded, 5-, 200- and 400-fold enhancements in amplified ELISA, fluorometry and voltammetry responses for HIgG could be achieved compared to conventional ELISA. The respective detection limits of theses methods for HIgG were 3.9, 0.1 and 0.05 ng mL −1 with a RSD below 5% for amplified ELISA, fluorescence and SWV measurements. Additionally, a 100-fold improvement was obtained in the detection sensitivity for PCV2 antibody immunoassay. The versatile immunosensor exhibits good sensitivity, stability and reproducibility, suggesting its potential applications in clinical diagnostics. - Highlights: • A versatile ELISA-based immunoassay for PCV2 antibody was developed. • Enzyme and CdSe QDs modified SiO 2 particles were used to improve sensitivity. • The simultaneous three ELISA-based techniques enhanced the detection reliability. • The biosensors strategy could provide a new avenue to ELISA-based sensors

  16. Validation of high throughput screening of human sera for detection of anti-PA IgG by Enzyme-Linked Immunosorbent Assay (ELISA) as an emergency response to an anthrax incident

    Semenova, Vera A.; Steward-Clark, Evelene; Maniatis, Panagiotis; Epperson, Monica; Sabnis, Amit; Schiffer, Jarad


    To improve surge testing capability for a response to a release of Bacillus anthracis, the CDC anti-Protective Antigen (PA) IgG Enzyme-Linked Immunosorbent Assay (ELISA) was re-designed into a high throughput screening format. The following assay performance parameters were evaluated: goodness of fit (measured as the mean reference standard r2), accuracy (measured as percent error), precision (measured as coefficient of variance (CV)), lower limit of detection (LLOD), lower limit of quantification (LLOQ), dilutional linearity, diagnostic sensitivity (DSN) and diagnostic specificity (DSP). The paired sets of data for each sample were evaluated by Concordance Correlation Coefficient (CCC) analysis. The goodness of fit was 0.999; percent error between the expected and observed concentration for each sample ranged from −4.6% to 14.4%. The coefficient of variance ranged from 9.0% to 21.2%. The assay LLOQ was 2.6 μg/mL. The regression analysis results for dilutional linearity data were r2 = 0.952, slope = 1.02 and intercept = −0.03. CCC between assays was 0.974 for the median concentration of serum samples. The accuracy and precision components of CCC were 0.997 and 0.977, respectively. This high throughput screening assay is precise, accurate, sensitive and specific. Anti-PA IgG concentrations determined using two different assays proved high levels of agreement. The method will improve surge testing capability 18-fold from 4 to 72 sera per assay plate. PMID:27814939

  17. Development of a highly sensitive and specific enzyme-linked immunosorbent assay (ELISA) for the detection of phenylethanolamine A in tissue and feed samples and confirmed by liquid chromatography tandem mass spectrometry (LC-MS/MS).

    Cao, Biyun; He, Guangzhao; Yang, Hong; Chang, Huafang; Li, Shuqun; Deng, Anping


    Phenylethanolamine A (PA) is a new emerged β-adrenergic agonist illegally used as feed additives for growth promotion. In this study, a highly sensitive and specific indirect competitive enzyme-linked immunosorbent assay (ELISA) for the detection of PA in tissue and feed samples was developed and confirmed by liquid chromatography tandem mass spectrometry (LC-MS/MS). By reduction of nitryl group to amino group, the PA derivative was synthesized and coupled to carrier proteins with diazobenzidine method. The antisera obtained from four immunized rabbits were characterized in terms of sensitivity and specificity. All antisera displayed high sensitivity with IC50 values lower than 0.48 ng mL(-1). The most sensitive ELISA was established with IC50 and limit of detection (LOD) values of 0.049 ng mL(-1) and 0.003 ng mL(-1), respectively. The cross-reactivity (CR) values of the antisera with three frequently used β-adrenergic agonists (clenbuterol, salbutamol and ractopamine) were lesser than 0.39%; there was no CR of the antisera with other six compounds including two structurally related substances (isoproterenol, phenylephrine). To investigate the accuracy and precision of the assay, swine kidney, liver, meat and feed samples were fortified with PA at different content and analyzed by ELISA. Acceptable recovery rates of 92.2-113.7% and intra-assay coefficients of variation of 3.8-10.9% (n=3) were achieved. Seven spiked samples were simultaneously analyzed by ELISA and LC-MS/MS. There was a high correlation coefficient of 0.9956 (n=7) between the two methods. The proposed ELISA proven to be a feasible quantitative/screening method for PA analysis in tissue and feed samples with the properties of high sensitivity and specificity, high sample throughput and low expensive. © 2013 Elsevier B.V. All rights reserved.

  18. Validation of high throughput screening of human sera for detection of anti-PA IgG by Enzyme-Linked Immunosorbent Assay (ELISA) as an emergency response to an anthrax incident.

    Semenova, Vera A; Steward-Clark, Evelene; Maniatis, Panagiotis; Epperson, Monica; Sabnis, Amit; Schiffer, Jarad


    To improve surge testing capability for a response to a release of Bacillus anthracis, the CDC anti-Protective Antigen (PA) IgG Enzyme-Linked Immunosorbent Assay (ELISA) was re-designed into a high throughput screening format. The following assay performance parameters were evaluated: goodness of fit (measured as the mean reference standard r 2 ), accuracy (measured as percent error), precision (measured as coefficient of variance (CV)), lower limit of detection (LLOD), lower limit of quantification (LLOQ), dilutional linearity, diagnostic sensitivity (DSN) and diagnostic specificity (DSP). The paired sets of data for each sample were evaluated by Concordance Correlation Coefficient (CCC) analysis. The goodness of fit was 0.999; percent error between the expected and observed concentration for each sample ranged from -4.6% to 14.4%. The coefficient of variance ranged from 9.0% to 21.2%. The assay LLOQ was 2.6 μg/mL. The regression analysis results for dilutional linearity data were r 2  = 0.952, slope = 1.02 and intercept = -0.03. CCC between assays was 0.974 for the median concentration of serum samples. The accuracy and precision components of CCC were 0.997 and 0.977, respectively. This high throughput screening assay is precise, accurate, sensitive and specific. Anti-PA IgG concentrations determined using two different assays proved high levels of agreement. The method will improve surge testing capability 18-fold from 4 to 72 sera per assay plate. Published by Elsevier Ltd.

  19. Enhanced immunoassay for porcine circovirus type 2 antibody using enzyme-loaded and quantum dots-embedded shell–core silica nanospheres based on enzyme-linked immunosorbent assay

    Wu, Long; Li, Xuepu; Shao, Kang; Ye, Shiyi; Liu, Chen; Zhang, Chenjun; Han, Heyou, E-mail:


    Boosting the detection sensitivity of enzyme-linked immunosorbent assay (ELISA) is significant to the early clinical diagnosis of various diseases. Here, we developed a versatile immunosensor using silica nanospheres as carriers for sensitive detection of porcine circovirus type 2 (PCV2) antibody. With HRP enzyme covalently immobilized on the silica nanospheres and CdSe nanocrystals embedded inside, these signal probes were successfully utilized in the sensitive detection of PCV2 antibody by ELISA, fluorometry and square-wave voltammetry (SWV). To further demonstrate the performance of the immunosensor, Human IgG (HIgG) was used as a model analyte. Since more HRP and CdSe QDs were loaded, 5-, 200- and 400-fold enhancements in amplified ELISA, fluorometry and voltammetry responses for HIgG could be achieved compared to conventional ELISA. The respective detection limits of theses methods for HIgG were 3.9, 0.1 and 0.05 ng mL{sup −1} with a RSD below 5% for amplified ELISA, fluorescence and SWV measurements. Additionally, a 100-fold improvement was obtained in the detection sensitivity for PCV2 antibody immunoassay. The versatile immunosensor exhibits good sensitivity, stability and reproducibility, suggesting its potential applications in clinical diagnostics. - Highlights: • A versatile ELISA-based immunoassay for PCV2 antibody was developed. • Enzyme and CdSe QDs modified SiO{sub 2} particles were used to improve sensitivity. • The simultaneous three ELISA-based techniques enhanced the detection reliability. • The biosensors strategy could provide a new avenue to ELISA-based sensors.

  20. Relationship between presence of cows with milk positive for Mycobacterium avium subsp. paratuberculosis-specific antibody by enzyme-linked immunosorbent assay and viable M. avium subsp. paratuberculosis in dust in cattle barns.

    Eisenberg, Susanne W F; Chuchaisangrat, Ruj; Nielen, Mirjam; Koets, Ad P


    Paratuberculosis, or Johne's disease, in cattle is caused by Mycobacterium avium subsp. paratuberculosis, which has recently been suspected to be transmitted through dust. This longitudinal study on eight commercial M. avium subsp. paratuberculosis-positive dairy farms studied the relationship between the number of cows with M. avium subsp. paratuberculosis antibody-positive milk and the presence of viable M. avium subsp. paratuberculosis in settled-dust samples, including their temporal relationship. Milk and dust samples were collected in parallel monthly for 2 years. M. avium subsp. paratuberculosis antibodies in milk were measured by enzyme-linked immunosorbent assay (ELISA) and used as a proxy for M. avium subsp. paratuberculosis shedding. Settled-dust samples were collected by using electrostatic dust collectors (EDCs) at six locations in housing for dairy cattle and young stock. The presence of viable M. avium subsp. paratuberculosis was identified by liquid culture and PCR. The results showed a positive relationship (odds ratio [OR], 1.2) between the number of cows with ELISA-positive milk and the odds of having positive EDCs in the same airspace as the adult dairy cattle. Moreover, the total number of lactating cows also showed an OR slightly above 1. This relationship remained the same for settled-dust samples collected up to 2 months before or after the time of milk sampling. The results suggest that removal of adult cows with milk positive for M. avium subsp. paratuberculosis-specific antibody by ELISA might result in a decrease in the presence of viable M. avium subsp. paratuberculosis in dust and therefore in the environment. However, this decrease is likely delayed by several weeks at least. In addition, the data support the notion that M. avium subsp. paratuberculosis exposure of young stock is reduced by separate housing.

  1. Quantum dot-linked immunosorbent assay (QLISA) using orientation-directed antibodies.

    Suzuki, Miho; Udaka, Hikari; Fukuda, Takeshi


    An approach similar to the enzyme-linked immunosorbent assay (ELISA), with the advantage of saving time and effort but exhibiting high performance, was developed using orientation-directed half-part antibodies immobilized on CdSe/ZnS quantum dots. ELISA is a widely accepted assay used to detect the presence of a target substance. However, it takes time to quantify the target with specificity and sensitivity owing to signal amplification. In this study, CdSe/ZnS quantum dots are introduced as bright and photobleaching-tolerant fluorescent materials. Since hydrophilic surface coating of quantum dots rendered biocompatibility and functional groups for chemical reactions, the quantum dots were modified with half-sized antibodies after partial reduction. The half-sized antibody could be bound to a quantum dot through a unique thiol site to properly display the recognition domain for the core process of ELISA, which is an antigen-antibody interaction. The reducing conditions were investigated to generate efficient conjugates of quantum dots and half-sized antibodies. This was applied to IL-6 detection, as the quantification of IL-6 is significant owing to its close relationships with various biomedical phenomena that cause different diseases. An ELISA-like assay with CdSe/ZnS quantum dot institution (QLISA; Quantum dot-linked immunosorbent assay) was developed to detect 0.05ng/mL IL-6, which makes it sufficiently sensitive as an immunosorbent assay. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Direct Agglutination Test and Enzyme Linked Immunosorbent Assay with Urine Samples for the Diagnosis of Visceral Leishma-niasis

    Sarkari B


    Full Text Available Background: Visceral leishmaniasis (VL or Kala azar is an infectious disease caused by various species of Leishmania parasites. The aim of this study was to detect and compare the presence of anti-Leishmania antibodies in the urine of vis-ceral leishmaniasis patients using ELISA and DAT methods."nMethods: A total of 30 urine samples were collected from VL patients referred to Shiraz (southeast of Iran hospitals. Moreover 31 urine samples were collected from healthy individuals and patients with other diseases such as malaria, brucellosis, hydatidosis and cutaneous leishmaniasis. Collected samples were examined to detect anti-Leishmania antibod-ies in urine, using ELISA and DAT."nResults: Anti-Leishmania antibody was detected in urine of 18 out of 30 (60% VL patients by DAT while ELISA detected anti-Leishmania antibodies in urine of 28 out of 30 (93.3% of VL cases. Sensitivity and specificity of urine-based DAT was 60% and 83.9%, respectively while sensitivity and specificity of urine-based ELISA were 93.3% and 93.5%, corre-spondingly. "nConclusion: Urine-based DAT and ELISA have a reasonable specificity and sensitivity in diagnosis of VL. Accordingly, urine-based ELISA might be a suitable alternative for serum based assays for diagnosis of VL.

  3. Determination of histamine in Iranian cheese using enzyme-linked ...


    enzyme-linked immunosorbent assay (ELISA) method. Mojtaba ... Histamine is a simple chemical substance created during processing of the amine acid histidine. Histamine is also an .... Institute of environment Health and Forensic. Sciences ...

  4. Development and application of an enzyme-linked immunosorbent assay for specific detection of mangiferin content in various cultivars of Mangifera indica leaves using anti-mangiferin polyclonal antibody.

    Yusakul, Gorawit; Kitirattrakarn, Wongsathorn; Tanwanichkul, Narunat; Tanaka, Hiroyuki; Putalun, Waraporn


    An enzyme-linked immunosorbent assay (ELISA) was developed for determining mangiferin content in plant samples using a polyclonal antibody (PAb) against mangiferin. The developed ELISA showed a full measurement range from 0.12 to 31.25 μg/mL mangiferin with a relative standard deviation (RSD) less than 6% for both intra- and interassay precision levels. The accuracy was determined by a percent recovery experiment at three concentration levels and it showed 97.8%-103.7% recovery in Mangifera indica leaf samples. The developed ELISA exhibited a high correlation value (R² = 0.992) with the standard high-performance liquid chromatography (HPLC) method in various mangiferin-containing plant samples. Our results suggest that the validated ELISA methodology using a PAb against mangiferin can be applied to determine mangiferin content with high specificity, rapidity and simplicity in various mangiferin-containing plant samples. The mangiferin content in the mature leaves of fifty M. indica cultivars were determined using the developed ELISA. The mangiferin contents ranged from 1.94 ± 0.13% to 13.79 ± 0.84% dry wt. The Thawai cultivar leaves contained the highest level of mangiferin (13.79 ± 0.84% dry wt), but it is a rare cultivar. The Namdokmai, which is more commonly cultivated in Thailand, contain 12.41 ± 0.60% dry wt mangiferin; therefore, this cultivar leaf was recommended as the source of raw material for the pharmaceutical, nutraceutical and cosmetic product industries. Currently, natural heath products are accepted worldwide for healthcare. Mangiferin-containing plants and products exhibit health benefits against oxidative stress-related diseases, such as cardiovascular diseases, cancer, dyslipidemia and diabetes. We have developed an ELISA with high specificity, rapidity and simplicity for the quality control of mangiferin-derived product production. Moreover, we found that the Namdokmai leaf, a Thai M. indica cultivar, was recommended as the source of raw

  5. Comparison of a novel chemiluminescence enzyme immunoassay (CLEIA) with enzyme-linked immunosorbent assay (ELISA) for the determination of MPO-ANCA in patients with ANCA-associated vasculitis.

    Hirose, Orie; Itabashi, Mitsuyo; Takei, Takashi; Nitta, Kosaku


    Myeloperoxidase (MPO) anti-neutrophil cytoplasmic antibody (ANCA) represents the serological hallmark of ANCA-associated vasculitis (AAV). We evaluated the analytical and diagnostic accuracy of chemiluminescence enzyme immunoassay (CLEIA) versus enzyme-linked immunosorbent assay (ELISA) for the detection of MPO-ANCA. A total of 242 sera obtained from 51 patients with AAV and 103 patients without AAV were tested for MPO-ANCA by ELISA (NephroScholor MPOANC II) and CLEIA (the STACIA MEBLux test). Disease activity in the patients with AAV was determined based on the Birmingham Vasculitis Activity Score. We analyzed the correlations between the MPO-ANCA titers determined by the CLEIA and those determined by the ELISA, and also between the MPO-ANCA titers and the disease activity. The MPO-ANCA titers determined by the CLEIA (x) were strongly correlated with those determined by the ELISA (y). The correlation could be expressed by the following equation in this study: y = 1.8x + 7.7 (r = 0.96; p ELISA yielded positive test results in 57 of the 242 sera (23.6%). The CLEIA yielded false-positive test results in 4 of the 120 sera obtained from the non-AAV patients (3.3%), whereas the ELISA yielded a false-positive result in only 1 of the 120 sera obtained from the non-AAV patients (0.8%). The sensitivity and specificity of the CLEIA for the diagnosis of AAV were 100% and 96.7%, respectively, while those of the ELISA were 94.3% and 99.2%, respectively. The sensitivity and specificity of the CLEIA for the prediction of active disease were 100% and 64.4%, respectively, while those of the ELISA were 94.3% and 73.6%, respectively. The false positivity rate of the CLEIA for MPO-ANCA tended to be high as compared with that of the ELISA. Also, according to the correlation coefficient between the results of the CLEIA and the ELISA calculated in this study, it is necessary to pay attention to the differences in the sensitivity and specificity between CLEIA and ELISA.

  6. Radioimmunoassay and enzyme-linked immunoassay of antibodies directed against lymphadenopathy-associated virus (LAV) proteins larger than the core protein (P24)

    Neurath, A.R.; Strick, N.; Lee, Y.S.; Nilsen, T.; Baker, L.; Sproul, P.; Rubinstein, P.; Taylor, P.; Stevens, C.E.; Gold, J.W.M.


    Molecular exclusion chromatography of crude LAV antigen preparations allows separation of most of P24 from larger proteins of LAV (PL). PL and 125 I- or beta-lactamase-labeled anti-LAV were used as reagents for radioimmunoassay (RIA) - or enzyme-linked immunoassay (ELISA) - inhibition tests to detect antibodies directed predominantly against PL (anti-PL). Among 257 individuals belonging to groups at high risk of developing AIDS, 117 (45.5%) were positive for anti-PL and 108 (42%) for anti-P24, respectively. The 2 individuals among 600 random blood donors found to be anti-P24-positive in the preceding study also had anti-PL in their serum. Sera from 500 additional blood donors were screened for anti-PL and 1 of these was positive. The implication of these findings for screening of blood donors is discussed. (Auth.)

  7. Radioimmunoassay and enzyme-linked immunoassay of antibodies directed against lymphadenopathy-associated virus (LAV) proteins larger than the core protein (P24)

    Neurath, A R; Strick, N; Lee, Y S; Nilsen, T; Baker, L; Sproul, P; Rubinstein, P; Taylor, P; Stevens, C E; Gold, J W.M.


    Molecular exclusion chromatography of crude LAV antigen preparations allows separation of most of P24 from larger proteins of LAV (PL). PL and /sup 125/I- or beta-lactamase-labeled anti-LAV were used as reagents for radioimmunoassay (RIA) - or enzyme-linked immunoassay (ELISA) - inhibition tests to detect antibodies directed predominantly against PL (anti-PL). Among 257 individuals belonging to groups at high risk of developing AIDS, 117 (45.5%) were positive for anti-PL and 108 (42%) for anti-P24, respectively. The 2 individuals among 600 random blood donors found to be anti-P24-positive in the preceding study also had anti-PL in their serum. Sera from 500 additional blood donors were screened for anti-PL and 1 of these was positive. The implication of these findings for screening of blood donors is discussed. 17 refs.; 2 figs.; 1 table.

  8. False-Positive Results in a Recombinant Severe Acute Respiratory Syndrome-Associated Coronavirus (SARS-CoV) Nucleocapsid Enzyme-Linked Immunosorbent Assay Due to HCoV-OC43 and HCoV-229E Rectified by Western Blotting with Recombinant SARS-CoV Spike Polypeptide

    Woo, Patrick C. Y.; Lau, Susanna K. P.; Wong, Beatrice H. L.; Chan, Kwok-Hung; Hui, Wai-Ting; Kwan, Grace S. W.; Peiris, J. S. Malik; Couch, Robert B.; Yuen, Kwok-Yung


    Using paired serum samples obtained from patients with illness associated with increases in anti-human coronavirus OC43 (HCoV-OC43) or anti-HCoV-229E antibodies, we examined the possibility of false-positive results detected in a recombinant severe acute respiratory syndrome (SARS)-associated coronavirus (SARS-CoV) nucleocapsid protein immunoglobulin G enzyme-linked immunosorbent assay (ELISA). Three of the 21 and 1 of the 7 convalescent-phase serum samples from persons with increases in anti...

  9. Comparison of agal gel precipitation test (AGPT) and enzyme linked ...

    The use of agar gel precipitation test (AGPT) and enzyme linked immunosorbent assay (ELISA) in assaying for the presence of infectious bursal disease (IBD) virus antibody in village chickens in Oyo State, Nigeria, was compared. Out of 400 sera subjected to ELISA, 360 (90%) samples where positive for IBD virus ...

  10. Laboratory diagnosis of amebiasis in a sample of students from southeastern Brazil and a comparison of microscopy with enzyme-linked immunosorbent assay for screening of infections with Entamoeba sp.

    Pereira, Valeriana Valadares; Conceição, Abiqueila da Silva; Maximiano, Leandro Henrique Silva; Belligoli, Leonardo de Queiroz Gomes; Silva, Eduardo Sergio da


    Epidemiological studies on amebiasis have been reassessed since Entamoeba histolytica and E. dispar were first recognized as distinct species. Because the morphological similarity of these species renders microscopic diagnosis unreliable, additional tools are required to discriminate between Entamoeba species. The objectives of our study were to compare microscopy with ELISA kit (IVD®) results, to diagnose E. histolytica infection, and to determine the prevalence of amebiasis in a sample of students from southeastern Brazil. In this study, diagnosis was based on microscopy due to its capacity for revealing potential cysts/trophozoites and on two commercial kits for antigen detection in stool samples. For 1,403 samples collected from students aged 6 to 14 years who were living in Divinópolis, Minas Gerais, Brazil, microscopy underestimated the number of individuals infected with E. histolytica/E. dispar (5.7% prevalence) compared with the ELISA kit (IVD®)-based diagnoses (15.7% for E. histolytica/E. dispar). A comparison of the ELISA (IVD®) and light microscopy results returned a 20% sensitivity, 97% specificity, low positive predictive value, and high negative predictive value for microscopy. An ELISA kit (TechLab®) that was specific for E. histolytica detected a 3.1% (43/1403) prevalence for E. histolytica infection. The ELISA kit (IVD®) can be used as an alternative screening tool. The high prevalence of E. histolytica infection detected in this study warrants the implementation of actions directed toward health promotion and preventive measures.

  11. Laboratory diagnosis of amebiasis in a sample of students from southeastern Brazil and a comparison of microscopy with enzyme-linked immunosorbent assay for screening of infections with Entamoeba sp.

    Valeriana Valadares Pereira


    Full Text Available Introduction: Epidemiological studies on amebiasis have been reassessed since Entamoeba histolytica and E. dispar were first recognized as distinct species. Because the morphological similarity of these species renders microscopic diagnosis unreliable, additional tools are required to discriminate between Entamoeba species. The objectives of our study were to compare microscopy with ELISA kit (IVD® results, to diagnose E. histolytica infection, and to determine the prevalence of amebiasis in a sample of students from southeastern Brazil. Methods: In this study, diagnosis was based on microscopy due to its capacity for revealing potential cysts/trophozoites and on two commercial kits for antigen detection in stool samples. Results: For 1,403 samples collected from students aged 6 to 14 years who were living in Divinópolis, Minas Gerais, Brazil, microscopy underestimated the number of individuals infected with E. histolytica/E. dispar (5.7% prevalence compared with the ELISA kit (IVD®-based diagnoses (15.7% for E. histolytica/E. dispar. A comparison of the ELISA (IVD® and light microscopy results returned a 20% sensitivity, 97% specificity, low positive predictive value, and high negative predictive value for microscopy. An ELISA kit (TechLab® that was specific for E. histolytica detected a 3.1% (43/1403 prevalence for E. histolytica infection. Conclusions: The ELISA kit (IVD® can be used as an alternative screening tool. The high prevalence of E. histolytica infection detected in this study warrants the implementation of actions directed toward health promotion and preventive measures.

  12. A survey of 17α-ethinylestradiol and mestranol residues in Hawkesbury River, Australia, using a highly specific enzyme-linked immunosorbent assay (ELISA) demonstrates the levels of potential biological significance.

    Uraipong, Chatchaporn; Allan, Robin D; Li, Chunhua; Kennedy, Ivan R; Wong, Victor; Lee, Nanju Alice


    This study reports on the potential status of 17α-ethinylestradiol (EE2) and mestranol (MeEE2) residues in aquatic environments in New South Wales (NSW), Australia, based on the analysis by a specific ELISA we developed. Polyclonal antibodies were raised against the EE2 hapten with a linker attached at the C3-position to direct the antibody binding towards the ring D of EE2/MeEE2. Using this approach, an ELISA highly specific to EE2 and MeEE2 was successfully developed, showing less than 3.1% cross-reactivity (% CR) with other major steroidal sex hormones and their derivatives. The assay performed with the limit of detection (LOD) of 0.04 ± 0.01µg/L for both EE2 and MeEE2, and the limit of quantitation (LOQ) of 0.05 ± 0.01ng/L when it was coupled with the SM2-Biobeads solid phase extraction. Prior to conducting the survey study, it was validated against the gas chromatography-mass spectrophotometry (GC-MS) method, which showed high correlation with R 2 of 0.934. Fresh surface water samples collected at different sites along Hawkesbury River in New South Wales (NSW) were analyzed for the EE2/ MeEE2 residues using the developed ELISA. The EE2/MeEE2 levels were found to range between 4.1 and 8.3ng/L in Emigrant Creek, NSW, where the primary activity was macadamia plantation, and higher levels between 15 and 29ng/L in South Creek, NSW, Greater Western Sydney at sites upstream and downstream of the municipal sewage treatment plants. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. (PCR) assays with enzyme-linked immunosorbent assay (ELISA)



    Jan 24, 2011 ... Visceral leishmaniasis (VL) is systemic zoonotic parasitic infection that is a health problem in some tropical and subtropical countries. The purpose of our study is to determine the seroprevalence of canine visceral leishmaniasis (CVL) in owned dogs of the Sarab area and to identify the species of.

  14. and Indigenous Indirect Enzyme-Linked Immunosorbent Assay

    Annapurna S. Agasthya


    Full Text Available Brucellosis is one of the most important reemerging zoonoses in many countries. Brucellosis is caused by Gram-negative coccobacillus belonging to genus Brucella. Human brucellosis often makes the diagnosis difficult. The symptoms and clinical signs most commonly reported are fever, fatigue, malaise, chills, sweats headaches, myalgia, arthralgia, and weight loss. Some cases have been presented with only joint pain, lower backache, and involuntary limb movement, burning feet, or ischemic heart attacks. The focus of this work was to develop a highly sensitive and specific indirect ELISA by using smooth lipopolysaccharide antigen of Brucella abortus 99 to detect anti-Brucella antibodies at Project Directorate on Animal Disease Monitoring and Surveillance. Serum samples collected from 652 individuals in whom fever was not the major symptom but the complaint was of joint pain, headache, lower backache, and so forth, were screened by Rose Bengal plate agglutination test (RBPT and standard tube agglutination test (STAT. Subsequent testing of sera by indigenous indirect ELISA detected 20 samples positive (3.6% seroprevalence, and indirect ELISA was found to be more sensitive than RBPT and STAT. The seroprevalence in South Karnataka was 2.14%, and in North Karnataka it was 0.92%.

  15. Comparisons of competitive enzyme-linked immunosorbent assay ...



    Jul 18, 2011 ... studies have shown that these genome seg-ments can vary in manner that reflects the geographical origin of the virus strains (Pritchard et al., 2004). Efficiency of PCR in diagnosis of BTV in several parts of the world, verified this technique as a rapid, reliable and sensitive diagnosis methods. The highly ...

  16. Comparisons of competitive enzyme-linked immunosorbent assay ...

    Bluetongue is a noncontagious, arthropod-borne viral disease of both domestic and wild ruminants. Bluetongue virus (BTV) is the type of species of the genus Orbivirus within the family Reoviridae. BTV is endemic in some areas with cattle and wild ruminants serving as reservoirs for the virus. Clinical symptoms are often ...

  17. Indirect Competitive Enzyme-Linked Immunosorbent Assay (ELISA).

    Kohl, Thomas O; Ascoli, Carl A


    The indirect competitive ELISA (indirect cELISA) pits plate-immobilized antigen against antigens in solution for binding to antigen-specific antibody. The antigens in solution are in the test sample and are first incubated with antigen-specific antibody. These antibody-antigen complexes are then added to microtiter plates whose wells have been coated with purified antigen. The wells are washed to remove unbound antigen-antibody complexes and free antigen. A reporter-labeled secondary antibody is then added followed by the addition of substrate. Substrate hydrolysis yields a signal that is inversely proportional to antigen concentration within the sample. This is because when antigen concentration is high in the test sample, most of the antibody is bound before adding the solution to the plate. Most of the antibody remains in solution (as complexes) and is thus washed away before the addition of the reporter-labeled secondary antibody and substrate. Thus, the higher the antigen concentration in the test sample, the weaker the resultant signal in the detection step. The indirect cELISA is often used for competitive detection and quantification of antibodies against viral diseases in biological samples. © 2017 Cold Spring Harbor Laboratory Press.

  18. Determinação da infecção por Entamoeba histolytica em residentes da área metropolitana de Belém, Pará, Brasil, utilizando ensaio imunoenzimático (ELISA para detecção de antígenos Determination of Entamoeba histolytica infection in patients from Greater Metropolitan Belém, Pará, Brazil, by enzyme-linked immunosorbent assay (ELISA for antigen detection

    Mônica Cristina de Moraes Silva


    Full Text Available O status epidemiológico da amebíase está sendo reavaliado desde que a Entamoeba histolytica (patogênica foi considerada espécie distinta de Entamoeba dispar (não patogênica. Em nosso estudo, realizamos pesquisa de antígenos de E. histolytica em amostras fecais de pacientes residentes na cidade de Belém, Pará, Brasil, utilizando ensaio imunoenzimático (E. histolytica Test, TechLab Inc., Blacksburg, Estados Unidos disponível comercialmente. Foram analisadas 845 amostras, com positividade em 248 (29,35%. A infecção por E. histolytica foi maior no grupo etário acima de 14 anos (30,36% que no grupo de 0-14 anos (28,28%, porém sem significância estatística (p The epidemiological status of amebiasis has been reevaluated since Entamoeba histolytica (pathogenic was considered a distinct species from Entamoeba dispar (non-pathogenic. We investigated E. histolytica antigens in stool samples from residents of Belém, Pará State, Brazil, with commercially available enzyme-linked immunosorbent assay (E. histolytica Test, TechLab Inc., Blacksburg, USA. A total of 845 samples were analyzed, of which 248 were positive (29.35%. E. histolytica infection was more frequent in the over-14-year age group (30.36% than in the 0-14-year group (28.28%, but the difference was not statistically significant (p < 0.05. Of all the samples, 334 were also submitted to parasitological methods (direct, Hoffman, and Faust et al.. There were discordant results between ELISA and parasitological methods in 83 samples (24.85%, with more positive results using ELISA. Our results thus suggest that intestinal amebiasis is an important public health problem in Greater Metropolitan Belém.

  19. An enzyme-linked immunosorbent assay for the detection of IgG antibodies against Babesia equi in horses Um ensaio imunoenzimático para a detecção de anticorpos IgG contra Babesia equi em eqüinos

    Cristiane Divan Baldani


    Full Text Available A crude antigenic preparation of Babesia equi was used to develop and establish the suitability of an enzyme-linked immunosorbent assay (ELISA for the detection of parasite carriers. Optimal dilutions of the antigen, using positive and negative reference sera, were determined by checkboard titrations. The specificity and sensitivity of the ELISA were 100 %. A total of 90 serum samples were taken from horses from the Northeast region of São Paulo State and examined for diagnosis of equine B. equi infection by ELISA. Approximately 75% (n=67 of all the horses tested were found serologically positive for B. equi. These results suggest that the ELISA described may prove to be an appropriate serological test for epidemiological studies on B. equi infections in the field and that equine piroplasmosis is a cause for serious concern in the State of São Paulo, Brazil.Um ensaio de imunoadsorção enzimática (ELISA baseado em antígeno bruto de Babesia equi foi desenvolvido para a detecção de portadores crônicos de babesiose eqüina. As diluições ótimas do antígeno e dos soros controles positivo e negativo foram determinadas através de titulação em bloco. A sensibilidade e especificidade do teste foram de 100%. O ELISA foi empregado em 90 soros de eqüinos da região Nordeste do Estado de São Paulo, de modo que aproximadamente 75% (n=67 dos eqüinos foram positivos para B. equi. Estes resultados sugerem que o ELISA descrito pode ser utilizado no diagnóstico sorológico de B. equi e que a piroplasmose eqüina é um problema sério no Estado de São Paulo, Brasil.

  20. Evaluation of enzyme-linked immunosorbent and alternative assays for detection of HIV antibodies using panels of Brasilian sera Avaliação de testes sorológicos para a detecção de anticorpos anti-HIV em painéis de soros de brasileiros

    Jairo Ivo-Dos-Santos


    Full Text Available Sera from 472 Brazilian subjects, confirmed to be either positive or negative for HIV antibodies and comprising the total clinical spectrum of HIV infection, were utilized in the evaluation of six commercially available enzyme-linked immunosorbent assays (ELISA, as well as of four alternative assays, namely indirect immunofluorescence (IIF, passive hemagglutination (PHA, dot blot and Karpas AIDS cell test. The sensitivities ranged from 100% (Abbott and Roche ELISA to 84.2% (PHA and the specificities ranged from 99.3% (IIF to 80.2% (PHA. The sensitivity and specificity of the PHA and the sensitivity of the Karpas cell test were significantly lower than those of the other tests. Although the IFF and dot blot had good sensitivities and specificities, the six ELISA were more attractive than those tests when other parameters such as ease of reading and duration of assay were considered.Os soros de 472 brasileiros, confirmados como sendo positivos ou negativos em relação à presença de anticorpos anti-HIV e compreendendo todo o espectro clínico da infecção, foram utilizados na avaliação de seis ensaios imunoenzimáticos comerciais (ELISA, bem como de quatro testes alternativos tais como imunofluorescência indireta (IFI, hemaglutinação passiva (HP, dot blot e Karpas AIDS cell test. As sensibilidades variaram de 100% (ELISA Abbott e Roche a 84,2% (HP e as especificidades variaram de 99,3% (IFI a 80,2% (HP. A sensibilidade e especificidade da HP e a sensibilidade do Karpas AIDS cell test foram significativamente menores que os outros ensaios. Embora a IFI e o dot blot tivessem apresentado uma boa sensibilidade e especificidade, os ensaios imunoenzimáticos (ELISA foram mais adequados para serem utilizados em triagem quando outros parâmetros tais como facilidade de leitura e interpretação dos resultados e duração dos ensaios foram considerados.

  1. Enzyme-linked immunospot: an alternative method for the detection of interferon gamma in Johne's disease

    Begg, Douglas J.; de Silva, Kumudika; Bosward, Katrina


    To date, the sensitivity of the interferon gamma (IFN-) enzyme-linked immunosorbent assay (ELISA) to detect Johne's disease (JD) has been poor, especially in the early stages of disease. To improve the sensitivity of IFN- detection in the early stages of infection, an alternate assay needs to be ...

  2. Clinical effectiveness and cost-effectiveness of use of therapeutic monitoring of tumour necrosis factor alpha (TNF-α) inhibitors [LISA-TRACKER® enzyme-linked immunosorbent assay (ELISA) kits, TNF-α-Blocker ELISA kits and Promonitor® ELISA kits] versus standard care in patients with Crohn's disease: systematic reviews and economic modelling.

    Freeman, Karoline; Connock, Martin; Auguste, Peter; Taylor-Phillips, Sian; Mistry, Hema; Shyangdan, Deepson; Court, Rachel; Arasaradnam, Ramesh; Sutcliffe, Paul; Clarke, Aileen


    Systematic reviews and economic modelling of clinical effectiveness and cost-effectiveness of therapeutic monitoring of tumour necrosis factor alpha (TNF-α) inhibitors [using LISA-TRACKER ® enzyme-linked immunosorbent assay (ELISA) kits (Theradiag, Marne La Vallee, France, or Alpha Laboratories, Heriot, UK), TNF-α-Blocker ELISA kits (Immundiagnostik AG, Bensheim, Germany) and Promonitor ® ELISA kits (Proteomika, Progenika Biopharma, Bizkaia, Spain)] versus standard care for Crohn's disease (CD). Multiple electronic databases were searched from inception to December 2014 in order to identify primary studies and meta-analyses. Patients with moderate to severe active CD treated with infliximab (IFX) (Remicade ® , Merck Sharp & Dohme Ltd, Kenilworth, NJ, USA) or adalimumab (ADA) (Humira ® , AbbVie Inc., North Chicago, IL, USA). Monitoring of serum anti-TNF-α (IFX or ADA) and/or of anti-drug antibody levels using test assays with a test-treatment algorithm. Standard care. Any patient-related outcome, test agreement and cost-effectiveness estimates. The quality assessments used recognised checklists (Quality Assessment of Diagnostic Accuracy Studies-2, Cochrane, Philips and Consolidated Health Economic Evaluation Reporting Standards). Evidence was synthesised using narrative review and meta-analysis. A Markov model was built in TreeAge Pro 2013 (TreeAge Software, Inc., Williamstown, MA, USA). The model had a 4-week cycle and a 10-year time horizon, adopted a NHS and Personal Social Services perspective and used a linked evidence approach. Costs were adjusted to 2013/14 prices and discounted at 3.5%. We included 68 out of 2434 and 4 out of 2466 studies for the clinical effectiveness and cost-effectiveness reviews, respectively. Twenty-three studies comparing test methods were identified. Evidence on test concordance was sparse and contradictory, offering scant data for a linked evidence approach. Three studies [two randomised controlled trials (RCTs) and one

  3. Enzyme-linked immunosorbent assay (ELISA for measles antibody: a comparison with haemagglutination inhibition, immunofluorescence and plaque neutralization tests Reação imunoenzimática (ELISA para detecção de anticorpos para o vírus do sarampo: comparação com reações de inibição da hema-glutinação, imunofluorescência indireta e neutralização de placas

    Vanda Akico Ueda Fick de Souza


    Full Text Available An enzyme-linked immunosorbent assay (ELISA for measles antibodies was compared with Plaque Neutralization (PRN, Haemagglutination inhibition (HI and Fluorescent antibody (IFA tests in 181 sera from vaccinated children and umbilical cord. Of 179 positive samples by the sensitive PRN, only two, with titers of 8, were negative by ELISA (copositivity of 98.9%. IFA and HI presented, respectively, copo-sitivities of 93.3% and 82.7%. The ELISA presented a high sensitivity as well as a good reproducibility and represents an alternative for the time consuming PRN for detection of low measles antibodies.A reação imunoenzimática (ELISA para determinação de anticorpos para o vírus do sarampo foi comparada com a reação de neutralização de placas (RNP, inibição da hemaglutinação (RIH e imunofluorescência indireta (RIF. Das 179 amostras positivas pela RNP, somente 2, com títulos iguais a 8, se apresentaram negativas por ELISA (copositividade de 98.9%. A RIF e RIH apresentaram, respectivamente, copositividade de 93.3 e 82.7%. ELISA apresentou sensibilidade equivalente à complexa RNP, boa reprodutibilidade e representa uma alternativa para a detecção de baixos títulos de anticorpos contra o sarampo.

  4. Avaliação do método imunoenzimático (ELISA para diagnóstico da infecção por Helicobacter pylori em crianças e adolescentes Evaluation of enzyme-linked immunosorbent assay for the diagnosis of Helicobacter pylori infection in children and adolescents

    Aurea Portorreal


    Full Text Available RACIONAL: A infecção por Helicobacter pylori é reconhecida como a causa mais freqüente de gastrite crônica em adultos e crianças. Seu diagnóstico é realizado com métodos invasivos em fragmentos de mucosa gástrica obtidos com pinça endoscópica e os não-invasivos. O método imunoenzimático constitui exame simples, rápido e de baixo custo, apresentando alta sensibilidade em pacientes adultos. OBJETIVO: Avaliou-se o método ELISA prospectivamente em 111 crianças e adolescentes. MATERIAL E MÉTODOS: Utilizou-se o kit "Cobas Core II" (Roche. Considerou-se Helicobacter pylori positivo quando o teste rápido da urease e a histologia resultaram ambos positivos ou quando a cultura foi positiva, e Helicobacter pylori negativo quando todos os testes foram negativos. RESULTADOS: A idade dos 111 pacientes variou de 3 meses a 16 anos, (mediana = 9a 5m; média = 8a 7m ± 4.0. Infecção por Helicobacter pylori foi diagnosticada em 47,7% (53/111. A sensibilidade da sorologia foi de 83,0% e 86,0% e a especificidade foi de 70,6% e 71,0%, utilizando o ponto de corte de 7 U/mL e 5 U/mL, respectivamente. Em pacientes maiores de 10 anos de idade, a sensibilidade foi de 90,6% e 96,8% e a especificidade 71,0% e 61,9%, com ponto de corte de 7 U/mL e 5 U/mL, respectivamente. Quando foi utilizada somente a cultura positiva como padrão ouro e ponto de corte em 5 U/mL, a sensibilidade foi de 93,3%. CONCLUSÃO: O método ELISA apresentou boa sensibilidade em crianças maiores de 10 anos, utilizando o ponto de corte de 5 U/mL, porém a especificidade foi menor.BACKGROUND: Helicobacter pylori infection is recognized as the most frequent cause of chronic gastritis in adults and children. The diagnosis is accomplished with invasive methods in fragments of endoscopic gastric biopsies and non-invasive methods. The enzyme-linked immunosorbent assay constitutes a simple, fast exam and of low cost with high sensibility in adult patients. AIM: The purpose of this study

  5. Study of cross-reactivity in serum samples from dogs positive for Leishmania sp., Babesia canis and Ehrlichia canis in enzyme-linked immunosorbent assay and indirect fluorescent antibody test Estudo da reatividade cruzada em amostras de soro de cães positivos para Leishmania sp., Babesia canis e Ehrlichia canis, pelo ensaio imunoenzimático indireto e pela reação de imunofluorescência indireta

    Trícia Maria F. de Sousa Oliveira


    Full Text Available To verify the presence of cross-reaction among leishmaniosis, ehrlichiosis and babesiosis in serological diagnostics used in human visceral leishmaniasis control programs, serum samples from leishmaniasis endemic and non-endemic areas were collected and tested by Indirect Fluorescent Antibody (IFAT and Enzyme-linked immunosorbent assay (ELISA. All serum samples from endemic areas were positive for Leishmania sp., by ELISA and IFAT, 51% positive for Babesia canis and 43% for Ehrlichia canis by IFAT. None of the serum samples from non-endemic areas were positive for Leishmania sp., by IFAT, but 67% were positive for B. canis and 78% for E. canis using the same test. When tested by ELISA for Leishmania sp., four samples from non-endemic area were positive. These dogs were then located and no clinical signs, parasites or antibody was detected in new tests for a six month period. Only one of these 4 samples was positive for B. canis by IFAT and ELISA and three for E. canis by IFAT. The results of the work suggest a co-infection in the endemic area and no serological cross-reaction among these parasites by IFAT and ELISA.Para verificar a existência de reação cruzada entre leishmaniose visceral, erliquiose e babesiose, nos testes sorológicos utilizados em programas de controle da leishmaniose visceral humana, amostras de soro canino provenientes de áreas endêmicas e não endêmicas para essa enfermidade, foram testadas pela Reação de Imunofluorescência (RIFI e Ensaio imunoenzimático (ELISA. Todos os soros provenientes de área endêmica foram positivos para Leishmania sp pelo ELISA e RIFI, 51% para Babesia canis e 43% para Ehrlichia canis pela RIFI. Pela RIFI, nenhum dos soros provenientes de área não endêmica foi positivo para Leishmania sp, sendo 67% positivos para B. canis e 78% para E. canis pelo mesmo teste. Quando testados pelo ELISA para Leishmania sp., quatro soros da área não endêmica foram positivos. Os cães foram localizados

  6. Direct Comparison of the Histidine-rich Protein-2 Enzyme-linked Immunosorbent Assay (HRP-2 ELISA) and Malaria SYBR Green I Fluorescence (MSF) Drug Sensitivity Tests in Plasmodium falciparum Reference Clones and Fresh ex vivo Field Isolates from Cambodia


    assessment of antimalarial activity in vitro by a semiautomated microdilution technique. Antimicrob Agents Chemother 1979, 16:710–718. 3. Noedl H, Attlmayr B...40:685–691. 32. Hawley SR, Bray PG, Mungthin M, Atkinson JD, O’Neill PM, Ward SA: Relationship between antimalarial drug activity , accumulation, and...success rate when testing DHA, AS, MQ, QN, CQ, and PPQ activities . A “successful” IC50 assay result for each P. falciparum clinical isolate was defined as

  7. Padronização de ensaio imunoenzimático para pesquisa de anticorpos das classes IgM e IgG anti-Toxoplasma gondii e comparação com a técnica de imunofluorescência indireta Standardization of enzyme-linked immunosorbent assay ELISA to detect anti-Toxoplasma gondii IgM and IgG antibodies, and comparison with the indirect immunofluorescence technique

    Cláudia Maria Antunes Uchôa


    Full Text Available A sorologia tem sido o método de escolha para o diagnóstico da toxoplasmose. Devido a isto, padronizamos um ensaio imunoenzimático (ELISA e comparamos seus resultados com a técnica de imunofluorescência indireta (IFI. A técnica padronizada apresentou na pesquisa de IgG sensibilidade (S de 96,7% e especificidade (E de 75%, com valor de predição de positividade (VPP de 83,3% e de negatividade (VPN de 94,7%, com uma concordância ajustada (K de 73,5%. A IFI apresentou S de 83,8%, E de 79,1% com VPP de 83,8 % e VPN de 79,1% com K de 63%. A concordância bruta entre os dois testes (ELISA/IFI foi de 88,3% para pesquisa de IgG e de 81,5% para pesquisa de IgM, sendo o K de 70,8% para IgG e de 1,3% para IgM, sendo o índice de correlação (r de 0,556 para IgG e de -0,023 para IgM. Podemos concluir que a ELISA-IgG padronizada é indicada nos processos de triagem sorológica, sendo a ELISA-IgM desaconselhada uma vez que apresentou baixos índices de concordância ajustada com a técnica de referência, sugerindo pouca confiabilidade dos resultados.Serology has been the most popular method to diagnose toxoplasmosis. Accordingly, this study standardizes an enzyme-linked immunosorbent assay (ELISA and compares its results with the IFI technique. In the IgG detection test, the standardized technique presented a sensibility (S of 96.77%, a specificity (SP of 75%, with a positive predictive value (PPV of 83.33%, a negative predictive value (NPV of 94.74%, and an adjusted concordance (K of 73.50%. The IFI exhibited 83.87% for S, 79.16% for SP, 83.81% for PPV, 79.16% for NPV, and 63% for K. The rough concordance between these two tests (ELISA/IFI was 88.35% for the IgG detection test and 81.55% for the IgM detection test. K was 70.82% and 1.31% for IgG and IgM, respectively, the correlation index (r being 0.556 for IgG and -0.023 for IgM. We can conclude that standardized ELISA-IgG is indicated in serologic selection processes, whereas the ELISA-IgM is

  8. An enzyme-linked immunosorbent assay for measuring GPIHBP1 levels in human plasma or serum

    Miyashita, Kazuya; Fukamachi, Isamu; Nagao, Manabu


    Background: Glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPIHBP1), a glycosylphosphatidylinositol (GPI)-anchored protein of capillary endothelial cells, transports lipoprotein lipase to the capillary lumen and is essential for the lipolytic processing of trigl...

  9. Probe colorimeter for quantitating enzyme-linked immunosorbent assays and other colorimetric assays performed with microplates.

    Ackerman, S B; Kelley, E A


    The performance of a fiberoptic probe colorimeter (model PC800; Brinkmann Instruments, Inc., Westbury, N.Y.) for quantitating enzymatic or colorimetric assays in 96-well microtiter plates was compared with the performances of a spectrophotometer (model 240; Gilford Instrument Laboratories, Inc., Oberlin, Ohio) and a commercially available enzyme immunoassay reader (model MR590; Dynatech Laboratories, Inc., Alexandria, Va.). Alkaline phosphatase-p-nitrophenyl phosphate in 3 M NaOH was used as the chromophore source. Six types of plates were evaluated for use with the probe colorimeter; they generated reproducibility values (100% coefficient of variation) ranging from 91 to 98% when one individual made 24 independent measurements on the same dilution of chromophore on each plate. Eleven individuals each performed 24 measurements with the colorimeter on either a visually light (absorbance of 0.10 at 420 nm) or a dark (absorbance of 0.80 at 420 nm) dilution of chromophore; reproducibilities averaged 87% for the light dilution and 97% for the dark dilution. When one individual measured the same chromophore sample at least 20 times in the colorimeter, in the spectrophotometer or in the enzyme immunoassay reader, reproducibility for each instrument was greater than 99%. Measurements of a dilution series of chromophore in a fixed volume indicated that the optical responses of each instrument were linear in a range of 0.05 to 1.10 absorbance units.

  10. Correlation between centromere protein-F autoantibodies and cancer analyzed by enzyme-linked immunosorbent assay

    Welner, Simon; Trier, Nicole Hartwig; Morten Frisch, Morten


    Centromere protein-F (CENP-F) is a large nuclear protein of 367 kDa, which is involved in multiple mitosis-related events such as proper assembly of the kinetochores, stabilization of heterochromatin, chromosome alignment and mitotic checkpoint signaling. Several studies have shown a correlation...




    Full Text Available The microplate method of e nzyme-l i nke d i rnmuno s o r be n t a s s ay (ELISA , usi ng alkaline phosphatase anti-human I gG conj ugate , was modified and appl ied in t he dete c t i on of the human b lood specimens among the blood samples prep a r ed fr om human and laborat or y anima l s i n t he form of small dr ied b loodst a i ns on f ilt e r paper . The modi f i e d ELISA t e chnique wa s compa red wit h t he agar double d i f f us ion me t hod of prec ipitin test ."nThe results of this primary study showed t ha t the ELISA i n compare to gel diffusi o n t e st is sensitive and specific. It is also enough repr oducible and practical t o be consider as a competent technique for i de nt i f i c ation o f human bloodstains in medicolegal laboratories .

  12. [Evaluation of the Performance of Two Kinds of Anti-TP Enzyme-Linked Immunosorbent Assay].

    Gao, Nan; Huang, Li-Qin; Wang, Rui; Jia, Jun-Jie; Wu, Shuo; Zhang, Jing; Ge, Hong-Wei


    To evaluate the accuracy and precision of 2 kinds of anti-treponema pallidum (anti-TP) ELISA reagents in our laboratory for detecting the anti-TP in voluntary blood donors, so as to provide the data support for use of ELISA reagents after introduction of chemiluminescene immunoassay (CLIA). The route detection of anti-TP was performed by using 2 kinds of ELISA reagents, then 546 responsive positive samples detected by anti-TP ELISA were collected, and the infections status of samples confirmed by treponema pallidum particle agglutination (TPPA) test was identified. The confirmed results of responsive samples detected by 2 kinds of anti-TP ELISA reagents were compared, the accuracy of 2 kinds of anti-TP ELISA reagents was analyzed by drawing ROC and comparing area under curve (AUC), and precision of 2 kinds of anti-TP ELISA reagents was compared by statistical analysis of quality control data from 7.1 2016 to 6.30 2017. There were no statistical difference in confirmed positive rate of responsive samples and weak positive samples between 2 kinds of anti-TP ELISA reagents. The responsive samples detected by 2 kinds of anti-TP ELISA reagents accounted for 85.53%(467/546) of all responsive samples, the positive rate confirmed by TPPA test was 82.87%. 44 responsive samples detected by anti-TP ELISA reagent A and 35 responsive samples detected by anti-TP ELISA reagent B were confirmed to be negative by TPPA test. Comparison of AUC showed that the accuracy of 2 kinds of anti-TP ELISA reagents was more high, the difference between 2 reagents was not statistically significant. The coefficient of variation (CV) of anti-TP ELISA reagent A and B was 14.98% and 18.04% respectively, which met the precision requirement of ELISA test. The accuracy and precision of 2 kinds of anti-TP ELISA reagents used in our laboratory are similar, and using any one of anti-TP ELISA reagents all can satisfy the requirements of blood screening.

  13. Evaluation of commercial a-amylase enzyme-linked immunosorbent assy (ELISA) test kits for wheat

    a-Amylase enzyme is associated with preharvest sprouting (PHS) and late-maturity a amylase (LMA) in wheat, and reduces wheat and flour quality. Various means have been developed to measure the presence of a-amylase, thereby predicting end-use quality; most are based on enzyme activity. An alternativ...

  14. Validation of a KHV antibody enzyme-linked immunosorbent assay (ELISA)

    Bergmann, S M; Wang, Q; Zeng, W


    Koi herpesvirus (KHV) causes KHV disease (KHVD). The virus is highly contagious in carp or koi and can induce a high mortality. Latency and, in some cases, a lack of signs presents a challenge for virus detection. Appropriate immunological detection methods for anti-KHV antibodies have not yet be...

  15. Recombinant Plasmodium falciparum glutamate rich protein; purification and use in enzyme-linked immunosorbent assay

    Dziegiel, Morten Hanefeld; Borre, M B; Jepsen, S


    New Guinea (MAD20) and Honduras (HB3) completely absorbed specific antibodies, indicating the presence of conserved epitopes produced by all isolates of P. falciparum. Recombinant GLURP489-1271 ELISA is sensitive and rapid, and therefore well-suited for sero-epidemiological studies, and for control...


    The dioxins comprise a family of compounds chemically referred to as polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs). The most toxic of these compounds is 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a known human carcinogen. Dioxins are formed ...

  17. Application of fluorescent antibody and enzyme-linked immunosorbent assays for TCE and PAH degrading bacteria

    Brigmon, R.L.; Franck, M.; Brey, J.; Scott, D.; Lanclos, K.; Fliermans, C.


    Historically, methods used to identify methanotrophic and polyaromatic hydrocarbon-degrading (PAH) bacteria in environmental samples have been inadequate because isolation and identification procedures are time-consuming and often fail to separate specific bacteria from other environmental microorganisms. Methanotrophic bacteria have been isolated and characterized from TCE-contaminated soils (Bowman et al. 1993; Fliermans et al., 1988). Fliermans et al., (1988) and others demonstrated that cultures enriched with methane and propane could cometabolically degrade a wide variety of chlorinated aliphatic hydrocarbons including ethylene; 1,2-cisdichloroethylene (c-DCE); 1,2-trans-dichloroethylene (t-DCE); vinyl chloride (VC); toluene; phenol and cresol. Characterization of select microorganisms in the natural setting is important for the evaluation of bioremediation potential and its effectiveness. This realization has necessitated techniques that are selective, sensitive and easily applicable to soils, sediments, and groundwater (Fliermans, et al., 1994). Additionally these techniques can identify and quantify microbial types in situ in real time

  18. Detection of eosinophil cationic protein (ECP) by an enzyme-linked immunosorbent assay

    Reimert, C M; Venge, P; Kharazmi, A


    Eosinophil cationic protein (ECP) is a highly basic and potent cytotoxic single-chain zinc-containing protein present in the granules of the eosinophilic granulocytes. ECP appears to be involved in defence against parasites and in the tissue damage seen in subjects with allergic and inflammatory...... disease. To investigate ECP release from in vitro activated human eosinophils and to study the involvement of eosinophils in health and disease, we have developed a sensitive and specific enzyme immunoassay. ECP was purified from normal human peripheral blood eosinophils and polyclonal antibodies to ECP...

  19. Evaluation of a novel enzyme-linked immunosorbent assay for serological diagnosis of porcine proliferative enteropathy

    Boesen, Henriette Toft; Jensen, Tim Kåre; Møller, Kristian


    was a specific and sensitive method for detecting specific antibodies, and may be a good alternative to the existing serological tests for L intracellularis. It may be usable for diagnosis of proliferative enteropathy and for determination of a herd's epidemiologic status....... experimentally infected pigs and 62 serum samples from naturally infected pigs the sensitivity of the ELISA was calculated to 98.0%. The specificity of the test was 99.3%, calculated on the basis of 273 serum samples collected in six herds free of L. intracellularis after medicated eradication. The novel ELISA...

  20. Development of direct competitive biomimetic immunosorbent assay based on quantum dot label for determination of trichlorfon residues in vegetables.

    Liu, Qiurui; Jiang, Mingdi; Ju, Zeliang; Qiao, Xuguang; Xu, Zhixiang


    A direct competitive biomimetic immunosorbent assay method based on molecularly imprinted polymer was developed for the determination of trichlorfon. A CdSe/ZnS quantum dot label was used as the marker. The hydrophilic imprinted film was synthesized directly on the surface of a 96-well plate, and characterized by Fourier-transform infrared spectroscopy and thermo-gravimetric analyses. The method exhibited high stability, selectivity, and sensitivity. Under optimal conditions, the limits of detection and sensitivity of the biomimetic immunosorbent assay method were 9.0 μg L -1 and 5.0 mg L -1 (0.1 mg kg -1 and 62.5 mg kg -1 for vegetable sample), respectively. Low cross-reactivity values of 19.2% and 15.6% were obtained for the structural analogues. Spinach and rape samples spiked with trichlorfon were extracted and determined by this method with recoveries ranging from 83.6% to 91.1%. The method was applied for the detection of trichlorfon residues in leek and cucumber samples, and results correlated well with those obtained using GC. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Enzymatic amplification of a flow-injected thermometric enzyme-linked immunoassay for human insulin.

    Mecklenburg, M; Lindbladh, C; Li, H; Mosbach, K; Danielsson, B


    A flow-injected thermometric enzyme linked immunoassay for human insulin which employs the lactate dehydrogenase/lactate oxidase (LDH/LOD) substrate recycling system for signal amplification is described. The system is composed of two columns, an immunosorbent column containing immobilized anti-insulin antibodies for sensing and a recycling column containing immobilized LDH/LOD/Catalase for detection. The effect of flow rates, conjugate concentrations, and chromatographic support material upon the sensitivity of the assay are investigated. The assay has a detection limit of 0.025 microgram/ml and a linear range from 0.05 to 2 micrograms/ml. This corresponds to a 10-fold increase in sensitivity over the unamplified system. A recombinant human insulin-proinsulin conjugate was also tested. The results show that enzymatic amplification can be employed to increase the sensitivity and reproducibility of flow injection assay-based biosensors. The implications of these results upon on-line analysis are discussed.

  2. Enzyme-linked, aptamer-based, competitive biolayer interferometry biosensor for palytoxin.

    Gao, Shunxiang; Zheng, Xin; Hu, Bo; Sun, Mingjuan; Wu, Jihong; Jiao, Binghua; Wang, Lianghua


    In this study, we coupled biolayer interferometry (BLI) with competitive binding assay through an enzyme-linked aptamer and developed a real-time, ultra-sensitive, rapid quantitative method for detection of the marine biotoxin palytoxin. Horseradish peroxidase-labeled aptamers were used as biorecognition receptors to competitively bind with palytoxin, which was immobilized on the biosensor surface. The palytoxin: horseradish peroxidase-aptamer complex was then submerged in a 3,3'-diaminobenzidine solution, which resulted in formation of a precipitated polymeric product directly on the biosensor surface and a large change in the optical thickness of the biosensor layer. This change could obviously shift the interference pattern and generate a response profile on the BLI biosensor. The biosensor showed a broad linear range for palytoxin (200-700pg/mL) with a low detection limit (0.04pg/mL). Moreover, the biosensor was applied to the detection of palytoxin in spiked extracts and showed a high degree of selectivity for palytoxin, good reproducibility, and stability. This enzyme-linked, aptamer-based, competitive BLI biosensor offers a promising method for rapid and sensitive detection of palytoxin and other analytes. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Enzyme-linked electrochemical DNA ligation assay using magnetic beads.

    Stejskalová, Eva; Horáková, Petra; Vacek, Jan; Bowater, Richard P; Fojta, Miroslav


    DNA ligases are essential enzymes in all cells and have been proposed as targets for novel antibiotics. Efficient DNA ligase activity assays are thus required for applications in biomedical research. Here we present an enzyme-linked electrochemical assay based on two terminally tagged probes forming a nicked junction upon hybridization with a template DNA. Nicked DNA bearing a 5' biotin tag is immobilized on the surface of streptavidin-coated magnetic beads, and ligated product is detected via a 3' digoxigenin tag recognized by monoclonal antibody-alkaline phosphatase conjugate. Enzymatic conversion of napht-1-yl phosphate to napht-1-ol enables sensitive detection of the voltammetric signal on a pyrolytic graphite electrode. The technique was tested under optimal conditions and various situations limiting or precluding the ligation reaction (such as DNA substrates lacking 5'-phosphate or containing a base mismatch at the nick junction, or application of incompatible cofactor), and utilized for the analysis of the nick-joining activity of a range of recombinant Escherichia coli DNA ligase constructs. The novel technique provides a fast, versatile, specific, and sensitive electrochemical assay of DNA ligase activity.

  4. Inaccuracy of Enzyme-Linked Immunosorbent Assay Using Soluble and Recombinant Antigens to Detect Asymptomatic Infection by Leishmania infantum

    Moreno, Elizabeth Castro; Gonçalves, Andréa Vieira; Chaves, Anderson Vieira; Melo, Maria Norma; Lambertucci, José Roberto; Andrade, Antero Silva Ribeiro; Negrão-Corrêa, Deborah; Antunes, Carlos Mauricio de Figueiredo; Carneiro, Mariângela


    Background One of the most important drawbacks in visceral leishmaniasis (VL) population studies is the difficulty of diagnosing asymptomatic carriers. The aim of this study, conducted in an urban area in the Southeast of Brazil, was to evaluate the performance of serology to identify asymptomatic VL infection in participants selected from a cohort with a two-year follow-up period. Methodology Blood samples were collected in 2001 from 136 cohort participants (97 positive and 39 negatives, PCR/hybridization carried out in 1999). They were clinically evaluated and none had progressed to disease from their asymptomatic state. As controls, blood samples from 22 control individuals and 8 patients with kala-azar were collected. Two molecular biology techniques (reference tests) were performed: PCR with Leishmania-generic primer followed by hybridization using L. infantum probe, and PCR with specific primer to L. donovani complex. Plasma samples were tested by ELISA using three different antigens: L. infantum and L. amazonensis crude antigens, and rK39 recombinant protein. Accuracy of the serological tests was evaluated using sensitivity, specificity, likelihood ratio and ROC curve. Findings The presence of Leishmania was confirmed, by molecular techniques, in all kala-azar patients and in 117 (86%) of the 136 cohort participants. Kala-azar patients showed high reactivity in ELISAs, whereas asymptomatic individuals presented low reactivity against the antigens tested. When compared to molecular techniques, the L. amazonensis and L. infantum antigens showed higher sensitivity (49.6% and 41.0%, respectively) than rK39 (26.5%); however, the specificity of rK39 was higher (73.7%) than L. amazonensis (52.6%) and L. infantum antigens (36.8%). Moreover, there was low agreement among the different antigens used (kappa<0.10). Conclusions Serological tests were inaccurate for diagnosing asymptomatic infections compared to molecular methods; this could lead to misclassification bias in population studies. Therefore, studies which have used serological assays to estimate prevalence, to evaluate intervention programs or to identify risk factors for Leishmania infection, may have had their results compromised. PMID:19841736

  5. Use of an indirect enzyme linked immunosorbent assay for the diagnosis and epidemiological studies of Brucella abortus in Chile

    Abalos, P.; Pinochet, L.; Ibarra, L.; Navia, F.


    It is well known that traditional brucellosis diagnostic tests have a lack of sensitivity and specificity depending on the area or country where they have been used. Seeking for better alternatives, we undertook an evaluation of an ELISA test for bovine brucellosis diagnosis, for its possible use in Chile. We collected 2 groups of sera from negative animals: one from an area free of S19 vaccination (n=491) and a second from vaccinated herds (n=349). These groups were used for determination of cut-offs and diagnostic specificity calculations. A positive group of sera was collected from animals (n=186) from infected herds which were all reactors in the Rose Bengal (RB) and Rivanol (RIV) tests; some were also bacteriological culture positive and positive to an immunodiffusion test. This group was used for sensitivity calculation. A final test group of 385 sera from herds with brucellosis, either negative or positive in the RB or RIV tests, were used for relative sensitivity and specificity calculations. The calculated cut-off values were 26% and 61% of Percentage Positivity (PP) for the free area and vaccinated negative groups, respectively. Real sensitivity was 100% and real specificity was 98.6% when a 26% cut-off was used. Using the 61% cut-off value, the relative sensitivity respect of the RB and RIV test were 95.7% and 100%, respectively. In addition, relative specificity with respect to the RB and RIV tests were 82.4% and 81.8%, respectively. (author)

  6. Development of an enzyme-linked immunosorbent assay for detection of IgM antibodies to Babesia bigemina in cattle

    Ruiz Patrícia M Gonçalves


    Full Text Available A crude antigenic preparation of Babesia bigemina was used to develop an ELISA for the detection of IgM antibodies. Optimal dilutions of the antigen, using positive and negative reference sera, were determined by checkerboard titrations. Negative sera from cattle imported from tick-free areas, serum samples collected from infected B. bigemina cattle were used to validate the test. The specificity was 94% and sensitivity of the Elisa 87.5%. Sera from 385 cattle deriving from areas free from tick-borne diseases, which were submitted to a preimmunization process, were screened by this technique. The Elisa detected seroconversion on the 14th day post-inoculation in animals either infested with Boophilus microplus ticks (infected with B. bigemina, or inoculated with B. bigemina infected blood. Antibody titers decreased after day 33; however, all animals remained positive until the end of the experiment (124 days. The ELISA described may prove to be an appropriate serological test for the detection of IgM antibodies against B. bigemina.

  7. An enzyme-linked immunosorbent assay for detection of avian influenza virus subtypes H5 and H7 antibodies

    Jensen, Trine Hammer; Ajjouri, Gitte; Handberg, Kurt


    subtypes H5 and H7. The ELISAs were evaluated with polyclonal chicken anti-AIV antibodies against AIV subtypes: H1N2, H5N2, H5N7, H7N1, H7N7, H9N9, H10N4 and H16N3. RESULTS: Both the H5 and H7 ELISA proved to have a high sensitivity and specificity and the ELISAs detected H5 and H7 antibodies earlier......BACKGROUND: Avian influenza virus (AIV) subtypes H5 and H7 attracts particular attention because of the risk of their potential pathogenicity in poultry. The haemagglutination inhibition (HI) test is widely used as subtype specific test for serological diagnostics despite the laborious nature...

  8. The use of enzyme-linked immunosorbent assay for detection of Mycoplasma hominis antibodies in infertile women serum samples

    Baczynska, Agata; Friis Svenstrup, Helle; Fedder, Jens


    BACKGROUND: Besides Chlamydiae trachomatis and Mycoplasma genitalium, Mycoplasma hominis may also cause infertility due to damage of the Fallopian tubes. Therefore serum samples from infertile women were analyzed for antibodies to M. hominis. METHODS: Sera from 304 infertile women were investigat...

  9. Evaluation of recombinant multi-epitope proteins for diagnosis of goat schistosomiasis by enzyme-linked immunosorbent assay.

    Lv, Chao; Hong, Yang; Fu, Zhiqiang; Lu, Ke; Cao, Xiaodan; Wang, Tao; Zhu, Chuangang; Li, Hao; Xu, Rui; Jia, Bingguang; Han, Qian; Dou, Xuefeng; Shen, Yuanxi; Zhang, Zuhang; Zai, Jinli; Feng, Jintao; Lin, Jiaojiao


    Schistosomiasis is a huge threat to human and animal health. Apart from bovines, goats play an important role in the transmission of schistosomiasis in some endemic areas of China. An accessible, quality-assured goat schistosomiasis diagnostic technique is needed. Recently, our laboratory identified two recombinant diagnostic antigens, SjPGM and SjRAD23 via an immuno-proteomic method. The application of these two recombinant antigens to develop a higher sensitivity and specificity technique for the sheep schistosomiasis diagnosis is urgently needed. Epitopes of SjPGM and SjRAD23 were predicted and three polypeptides, two from SjRAD23 and one from SjPGM, were selected. Recombinant plasmids containing two to three DNA sequences encoding predicted polypeptides or large hydrophilic region of Sj23 (LHD-Sj23) were constructed and expressed. Eight recombinant schistosome antigens including four multi-epitope proteins and four recombinant single-molecule antigens as well as SEA, were assessed by ELISA in 91 sera from schistosome-infected goats, 44 sera from non-infected goats, 37 sera from Orientobilharzia-infected goats, and 12 from Haemonchus contortus-infected goats. ELISA tests showed that three multi-epitope proteins had higher sensitivity than the four single-molecule antigens (rSjRAD23, rSjPGM, rBSjRAD23-1, rBSj23) and the multi-epitope protein rBSjPGM-BSjRAD23-1-BSj23 had the highest sensitivity (97.8 %, 89/91) and maintained good specificity (100 %, 44/44) as well as low cross-reactivity with haemonchosis (8.33 %, 3/12) and orientobilharziasis (13.51 %, 5/37) in the diagnosis of goat schistosomiasis. In contrast, when SEA was applied as a diagnosis antigen, it had 100 % (91/91) sensitivity, 75 % (33/44) specificity, 25 and 83.78 % cross-reactivity with haemonchosis (3/12) and orientobilharziasis (31/37), respectively. The application of recombinant multi-epitope proteins may increase the sensitivity of diagnosis technique and retain high specificity of single-molecule antigens for schistosomiasis, and the recombinant antigen rBSjPGM-BSjRAD23-1-BSj23 has the potential to be used as a diagnosis antigen for goat schistosomiasis.

  10. Development of an enzyme-linked-immunosorbent-assay technique for accurate identification of poorly preserved silks unearthed in ancient tombs.

    Zheng, Qin; Wu, Xiaofeng; Zheng, Hailing; Zhou, Yang


    We report the preparation of a specific fibroin antibody and its use for the identification of unearthed ancient silk relics. Based on the 12-amino-acid repeat sequence "GAGAGSGAGAGS", which is found in fibroin of the silkworm Bombyx mori, a specific antibody against fibroin was prepared in rabbits through peptide synthesis and carrier-protein coupling. This antibody was highly specific for fibroin found in silk. Using this antibody we have successfully identified four silk samples from different time periods. Our results reveal, for the first time, a method capable of detecting silk from a few milligrams of archaeological fabric that has been buried for thousands of years, confirming that the ancient practice of wearing silk products while praying for rebirth dated back to at least 400 BCE. This method also complements current approaches in silk detection, especially for the characterization of poorly preserved silks, promoting the investigation of silk origins and of ancient clothing cultures.

  11. Trypanosomosis surveillance on Zanzibar island, using the trypanosomal antigen detection ELISA (enzyme-linked immunosorbent assay) technique

    Mbwambo, H A [Animal Disease Research Inst. (ADRI), Dar-es-Salaam (Tanzania, United Republic of)


    The effectiveness of trypanosomosis control programs depends greatly on prior knowledge of basic data of the epidemiological situation of the disease, which in turns depends, among others, on the use of techniques that give a fairly quick and accurate diagnosis. An antigen-detection (Ag) ELISA was first introduced into Tanzania and validated at the Animal Disease Research Institute (ADRI) through the FAO/IAEA Research Contract (RC) No. 5030/NL. Incorporation of the Ag-ELISA technique into a FAO animal disease control project (1986-1993) on Unguja island, in 1992, revealed useful information of high trypanosomosis prevalence in an area previously declared free of the disease using just stained blood smears and buffy coat examinations. This triggered further efforts into more intensive surveys of the tsetse and trypanosomosis situation on Unguja island. The present study is a continuation of previous work in an effort to confirm the practical application of Ag-ELISA in trypanosomosis control operations. Results obtained from a known tsetse and trypanosomosis-free area, on Pemba island, showed a high specificity of the test for Trypanosoma congolense, T. vivax and T. brucei. A preliminary cut-off value of 10% (Percent Positivity = PP) was used. When the PP of 10 was used on sera of trypanosomosis-endemic areas (Mangapwani, Ndijani, Dunga and Kikungwi) on Unguja island, the results reflected the `real` trypanosomis situation in the affected area. This was most strongly felt in the Mangapwani area, where tsetse and trypanosomosis were considered under control by 1994 (no tsetse flies were caught and no samples were encountered positive by the buffy coat technique). However, it should be stressed that the buffy coat technique and the Ag-ELISA complement each other and should be used in conjunction. (author). 8 refs, 1 fig., 5 tabs.

  12. Standardization of the indirect enzyme-linked immunosorbent assay for detection of antibodies against Newcastle disease virus in chickens

    Della Porta, A.J.; Young, J.; Hansson, E.; Spencer, T.


    Newcastle disease is the major viral disease of poultry causing significant economic losses in most countries except Australia and New Zealand. Serological monitoring of poultry has traditionally been carried out using the haemagglutinin-inhibition (HI) test. More recently, ELISA has been used for the same purpose. This paper described the use of an indirect ELISA for assay of antibodies in chickens against Newcastle disease viruses and compares some of the parameters for this test. The sucrose density gradient purified, inactivated, antigen enabled performance of the test without the addition of any blocking agents other than the usual Tween 20. A range of plates was compared and the most suitable plate was found to be a polystyrene haemagglutination plate giving an excellent positive to negative ratio of 33.2, compared with some expensive ELISA plates which gave very low +ve/-ve ratios. Various incubation conditions for the steps in the ELISA were compared and incubation with shaking at room temperature (24 to 28 deg. C) gave adequate reactivity whilst simplifying incubation conditions and speeding up the test. The negative cut-off value was determined by testing 1632 HI negative specific pathogen free sera from birds of a wide age range. The reactivity of sera in the ELISA was standardized using a standard curve on every plate and converting the readings to ELISA units (EUs) in the range of 16 to 512 EUs. The EU values of these sera were not normally distributed and so the 95% cut-off was determined by ranking the values in descending order and retaining only the top 5% of the values as false positives. This resulted in a cut-off value of 33.6 EUs, with few of HI positive sera having values lower than this cut-off. The use of a standard curve on each plate is recommended in order to standardize the assay and to determine the ELISA units for the test sera. (author). 14 refs, 2 figs, 1 tab

  13. Application of enzyme linked immunosorbent assays for the diagnosis of bovine brucellosis in Rio Grande do Sul, Brazil

    Poester, F.P.; Ramos, E.T.; Thiesen, S.V.


    The results of an indirect ELISA (I-ELISA) and a competitive ELISA (C-ELISA) for detection of antibody to Brucella abortus in cattle were compared with those of conventional serological tests. The sensitivity of I-Elisa using 230 sera from infected animals was 98.6% and the specificity in 720 sera from brucellosis-free animals was 98.2%. The C-ELISA when tested in 94 positive sera and 91 negative sera was 100% sensitive and specific. The relative sensitivity and specificity of I-ELISA compared to C-ELISA in 582 sera from groups of animals vaccinated with S19 by different routes and doses was respectively 64% and 100%. When comparing five serological tests on sera from vaccinated animals, the specificity was 94% for C-ELISA, 93% for 2-mercaptoethanol (2ME), 88% for Rose Bengal Plate test (RBPT), 84% for Slow Tube Agglutination test (SAT) and 34% for I-ELISA. It can be concluded from this study that the RBPT gave less false positive results than the I-ELISA in vaccinated animals and the C-ELISA is a good confirmatory test with the advantage of distinguishing the antibody response due to vaccination from that resulting from infection with Brucella abortus. (author)

  14. Enzyme linked immunosorbent assay for the diagnosis of cerebral cysticercosis in Reunion island: comparison with computerized tomography scan

    Michault, A; Coubes, P; Laporte, J P; Bouillan-Linet, E; Leroy, D


    An immunoenzymologic (Elisa) serodiagnosis of cysticercosis is evaluated in 75 encephalic cysticercotic patients whose diagnosis of the disease and its progression is assessed by tomodensitometry. A Taenia solium antigen is used. Only Ig G are investigated. The sensibility of serodiagnosis is 85 % and specificity 87 % when there is a progression of the disease; no difference is noticed in the patients without any progression of the disease and in control normal subjects. This serodiagnosis of cysticercosis appears of value for the evaluation of the activity of the disease.

  15. Use of enzyme linked immunosorbent assay (ELISA) for the diagnosis of brucellosis in cattle in Yucatan, Mexico

    Dajer, A.; Gutierrez, E.; Zapata, D.


    Sera (247) from non-vaccinated brucellosis negative herds, 328 negative sera from Brucella abortus strain 19 vaccinated herds (brucellosis free), and 95 sera positive to the Rose Bengal test (RBT) and Complement Fixation test (CFT) from Brucella abortus-infected herds, were used to determine the relative sensitivity and specificity of a FAO/IAEA I-ELISA kit and the Rivanol Agglutination Test (RAT), using the CFT as a 'gold standard'. A threshold value for the I-ELISA was determined to be 37 PP using the mean plus 3 standard deviations of the negative sera from vaccinated animals. The I-ELISA showed a high relative sensitivity (100%) and a good relative specificity (92.5%), using the threshold determined for local conditions. The RAT gave a lower sensitivity value than the CFT (97.8%) and good specificity (99.3%). The I-ELISA could be used as a screening test under Yucatan conditions or as a confirmatory test in places where vaccination is not carried out. The RAT lacks sensitivity and is therefore not recommended for use in final stages of eradication programs but could be used in control programmes or early stages of eradication campaigns as a confirmatory test. (author)


    Hoorfar, Jeffrey; Wedderkopp, A.


    We investigated the ability of an antibody-specific, O antigen-based ELISA to document Salmonella typhimurium herd infections by screening of milk samples. Three cattle populations, 20 herds with no history of salmonellosis, 8 herds with history of S typhimurium epsiodes within the previous 7...... months, and 220 herds of unknown disease status, were tested. A herd was considered ELISA positive if at least 5% of the cows had OD values > 0.3. Among the 20 herds without history of salmonellosis, only 2 herds were ELISA positive, whereas all 8 herds with a known history of salmonellosis were ELISA...... positive (herd specificity, 0.9 and herd sensitivity, 1.0). A sig nificant correlation (P history of salmonellosis. It was concluded that ELISA testing of individual milk sam ples can be used for surveillance...

  17. Markers of human immunodeficiency virus infection in high-risk individuals seronegative by first generation enzyme-linked immunosorbent assay

    Pedersen, C; Lindhardt, B O; Lauritzen, E


    -linked immunoassay (ELISA). Seventy-four of the serum samples had been obtained from 40 sexual partners of HIV antibody positive individuals. Two of the samples were reactive for p24 in immunoblot, but no other markers of HIV infection were found. From 80 sexually active male homosexuals, 117 serum samples were...

  18. Evaluation of a Cordia-IC enzyme-linked immunosorbent assay kit for the detection of circulating immune complexes.

    Landoy, Z; West, T E; Vladutiu, A O; Fitzpatrick, J E


    A commercial kit (Cordia-IC) from Cordis Laboratory, Miami, Fla., was compared with the Raji cell radioimmunoassay for its ability to detect circulating immune complexes (CIC) in sera from 30 control subjects and 118 patients with infectious diseases. The 118 patients were categorized into the following groups: (i) 23 patients with bacterial endocarditis, (ii) 41 patients with bacteremia from an infected intravascular catheter or access device, and (iii) 54 patients with Staphylococcus aureus bacteremia related to a deep tissue infection. The Cordia-IC was comparable to the Raji cell radioimmunoassay in intraassay variability (4.0 versus 8.0%) and interassay reproducibility (8.7 versus 20.0%). Neither assay found CIC amounts above 12.5 micrograms equivalents (eq) of aggregated human gamma globulin (AHG) per ml in any of the 30 control individuals. In group 1, Cordia-IC detected 19 of 23 positives (mean, 73.6 micrograms eq of AHG per ml), whereas the Raji cell detected 16 of 23 positives (mean, 54.8 micrograms eq of AHG per ml). In group 2, Cordia-IC detected 19 of 41 positives (mean, 20.6 micrograms eq of AHG per ml), whereas the Raji cell detected 16 of 41 positives (mean, 15.1 micrograms eq of AHG per ml). In group 3, Cordia-IC found 38 of 54 positives (mean, 28.0 micrograms eq of AHG per ml), whereas the Raji cell found 32 of 54 positives (mean, 23.9 micrograms eq of AHG per ml). Statistically, these findings were not significantly different in any of the three patient groups (P> 0.15), and there was an overall good correlation between the results obtained by the two assays (r+0.64, PCordia-IC provided a suitable assay for the detection of CIC and might find application in routine clinical laboratories. PMID:3897269

  19. Trypanosomosis surveillance on Zanzibar island, using the trypanosomal antigen detection ELISA (enzyme-linked immunosorbent assay) technique

    Mbwambo, H.A.


    The effectiveness of trypanosomosis control programs depends greatly on prior knowledge of basic data of the epidemiological situation of the disease, which in turns depends, among others, on the use of techniques that give a fairly quick and accurate diagnosis. An antigen-detection (Ag) ELISA was first introduced into Tanzania and validated at the Animal Disease Research Institute (ADRI) through the FAO/IAEA Research Contract (RC) No. 5030/NL. Incorporation of the Ag-ELISA technique into a FAO animal disease control project (1986-1993) on Unguja island, in 1992, revealed useful information of high trypanosomosis prevalence in an area previously declared free of the disease using just stained blood smears and buffy coat examinations. This triggered further efforts into more intensive surveys of the tsetse and trypanosomosis situation on Unguja island. The present study is a continuation of previous work in an effort to confirm the practical application of Ag-ELISA in trypanosomosis control operations. Results obtained from a known tsetse and trypanosomosis-free area, on Pemba island, showed a high specificity of the test for Trypanosoma congolense, T. vivax and T. brucei. A preliminary cut-off value of 10% (Percent Positivity = PP) was used. When the PP of 10 was used on sera of trypanosomosis-endemic areas (Mangapwani, Ndijani, Dunga and Kikungwi) on Unguja island, the results reflected the 'real' trypanosomis situation in the affected area. This was most strongly felt in the Mangapwani area, where tsetse and trypanosomosis were considered under control by 1994 (no tsetse flies were caught and no samples were encountered positive by the buffy coat technique). However, it should be stressed that the buffy coat technique and the Ag-ELISA complement each other and should be used in conjunction. (author). 8 refs, 1 fig., 5 tabs


    Abstract describes a streamlined ELISA method developed to quantitatively measure 2,4-D in human urine samples. Method development steps and comparison with gas chromatography/mass spectrometry are presented. Results indicated that the ELISA method could be used as a high throu...

  1. Moderate reagent mixing on an orbital shaker reduces the incubation time of enzyme-linked immunosorbent assay.

    Kumar, Saroj; Ahirwar, Rajesh; Rehman, Ishita; Nahar, Pradip


    Rapid diagnostic tests can be developed using ELISA for detection of diseases in emergency conditions. Conventional ELISA takes 1-2 days, making it unsuitable for rapid diagnostics. Here, we report the effect of reagents mixing via shaking or vortexing on the assay timing of ELISA. A 48-min protocol of ELISA involving 12-min incubations with reagent mixing at 750 rpm for every step was optimized. Contrary to this, time-optimized control ELISA performed without mixing produced similar results in 8 h, leaving a time gain of 7 h using the developed protocol. Collectively, the findings suggest the development of ELISA-based rapid diagnostics. Copyright © 2017 Elsevier Inc. All rights reserved.


    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  3. Validation of an enzyme-linked immunosorbent assay (ELISA) for the measurement of canine S100A12.

    Heilmann, Romy M; Cranford, Shannon M; Ambrus, Andy; Grützner, Niels; Schellenberg, Stefan; Ruaux, Craig G; Suchodolski, Jan S; Steiner, Jörg M


    Canine S100 calcium-binding protein A12 (cS100A12) shows promise as biomarker of inflammation in dogs. A previously developed cS100A12-radioimmunoassay (RIA) requires radioactive tracers and is not sensitive enough for fecal cS100A12 concentrations in 79% of tested healthy dogs. An ELISA assay may be more sensitive than RIA and does not require radioactive tracers. The purpose of the study was to establish a sandwich ELISA for serum and fecal cS100A12, and to establish reference intervals (RI) for normal healthy canine serum and feces. Polyclonal rabbit anti-cS100A12 antibodies were generated and tested by Western blotting and immunohistochemistry. A sandwich ELISA was developed and validated, including accuracy and precision, and agreement with cS100A12-RIA. The RI, stability, and biologic variation in fecal cS100A12, and the effect of corticosteroids on serum cS100A12 were evaluated. Lower detection limits were 5 μg/L (serum) and 1 ng/g (fecal), respectively. Intra- and inter-assay coefficients of variation were ≤ 4.4% and ≤ 10.9%, respectively. Observed-to-expected ratios for linearity and spiking recovery were 98.2 ± 9.8% (mean ± SD) and 93.0 ± 6.1%, respectively. There was a significant bias between the ELISA and the RIA. The RI was 49-320 μg/L for serum and 2-484 ng/g for fecal cS100A12. Fecal cS100A12 was stable for 7 days at 23, 4, -20, and -80°C; biologic variation was negligible but variation within one fecal sample was significant. Corticosteroid treatment had no clinically significant effect on serum cS100A12 concentrations. The cS100A12-ELISA is a precise and accurate assay for serum and fecal cS100A12 in dogs. © 2016 American Society for Veterinary Clinical Pathology.

  4. Comparison of Metallothionein Detection by Using Brdicka Reaction and Enzyme-Linked Immunosorbent Assay Employing Chicken Yolk Antibodies

    Křížková, S.; Bláhová, P.; Nakielna, J.; Fabrik, I.; Adam, V.; Eckschlager, T.; Beklová, M.; Svobodová, Z.; Horák, Vratislav; Krížek, R.


    Roč. 21, č. 23 (2009), s. 2575-2583 ISSN 1040-0397 Institutional research plan: CEZ:AV0Z50450515 Keywords : Metallothionein * Differential pulse voltammetry * ELISA Subject RIV: CG - Electrochemistry Impact factor: 2.630, year: 2009

  5. Detection of Ganoderic Acid A in Ganoderma lingzhi by an Indirect Competitive Enzyme-Linked Immunosorbent Assay.

    Sakamoto, Seiichi; Kohno, Toshitaka; Shimizu, Kuniyoshi; Tanaka, Hiroyuki; Morimoto, Satoshi


    Ganoderma is a genus of medicinal mushroom traditionally used for treating various diseases. Ganoderic acid A is one of the major bioactive Ganoderma triterpenoids isolated from Ganoderma species. Herein, we produced a highly specific monoclonal antibody against ganoderic acid A (MAb 12 A) and developed an indirect competitive ELISA for the highly sensitive detection of ganoderic acid A in Ganoderma lingzhi, with a limit of detection of 6.10 ng/mL. Several validation analyses support the accuracy and reliability of the developed indirect competitive ELISA for use in the quality control of Ganoderma based on ganoderic acid A content. Furthermore, quantitative analysis of ganoderic acid A in G. lingzhi revealed that the pileus exhibits the highest ganoderic acid A content compared with the stipe and spore of the fruiting body; the best extraction efficiency was found when 50 % ethanol was used, which suggests the use of a strong liquor to completely harness the potential of Ganoderma triterpenoids in daily life. Georg Thieme Verlag KG Stuttgart · New York.

  6. Indirect solid-phase immunosorbent assay for detection of arenavirus antigens and antibodies

    Ivanov, A P; Rezapkin, G V; Dzagurova, T K; Tkachenko, E A [Institute of Poliomyelitis anU Viral Encephalities of the U.S.S.R. Academy of Medical Sciences, Moscow


    Indirect enzyme-linked immunosorbent assay (ELISA) and solid phase radioimmunoassay (SPRIA) using either enti-human or anti-mouse IgG labelled with horseradish peroxidase and /sup 125/I, respectively, were developed for the detection of Junin, Machupo, Tacaribe, Amapari, Tamiami, Lassa and LCM arenaviruses. Both methods allow high sensitivity detection of arenavirus antigens and antibodies.

  7. Design of indirect solid-phase immunosorbent methods for detecting arenavirus antigens and antibodies

    Ivanov, A P; Rezapkin, G V; Dzagurova, T K; Tkachenko, E A


    Specifications have been elaborated for formulating indirect solid-phase enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (SPRIA) methods that employ anti-human and anti-mice G class immunoglobulin (IgG), conjugated with horseradish peroxidase and /sup 125/I for detecting the arenaviruses Junin, Machupo, Tacaribe, Amalpari, Tamiami, Lassa, and LCM (lymphocytic choriomeningitis). These methods make it possible to identify with a high degree of sensitivity arenavirus antigens and antibodies in various kinds of material.

  8. Highly specific detection of genetic modification events using an enzyme-linked probe hybridization chip.

    Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L


    The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.

  9. A modified anthrax toxin-based enzyme-linked immunospot assay reveals robust T cell responses in symptomatic and asymptomatic Ebola virus exposed individuals.

    Herrera, Bobby Brooke; Hamel, Donald J; Oshun, Philip; Akinsola, Rolake; Akanmu, Alani S; Chang, Charlotte A; Eromon, Philomena; Folarin, Onikepe; Adeyemi, Kayode T; Happi, Christian T; Lu, Yichen; Ogunsola, Folasade; Kanki, Phyllis J


    Ebola virus (EBOV) caused more than 11,000 deaths during the 2013-2016 epidemic in West Africa without approved vaccines or immunotherapeutics. Despite its high lethality in some individuals, EBOV infection can produce little to no symptoms in others. A better understanding of the immune responses in individuals who experienced minimally symptomatic and asymptomatic infection could aid the development of more effective vaccines and antivirals against EBOV and related filoviruses. Between August and November 2017, blood samples were collected from 19 study participants in Lagos, Nigeria, including 3 Ebola virus disease (EVD) survivors, 10 individuals with documented close contact with symptomatic EVD patients, and 6 control healthcare workers for a cross-sectional serosurvey and T cell analysis. The Lagos samples, as well as archived serum collected from healthy individuals living in surrounding areas of the 1976 Democratic Republic of Congo (DRC) epidemic, were tested for EBOV IgG using commercial enzyme-linked immunosorbent assays (ELISAs) and Western blots. We detected antibodies in 3 out of 3 Lagos survivors and identified 2 seropositive individuals not known to have ever been infected. Of the DRC samples tested, we detected antibodies in 9 out of 71 (12.7%). To characterize the T cell responses in the Lagos samples, we developed an anthrax toxin-based enzyme-linked immunospot (ELISPOT) assay. The seropositive asymptomatic individuals had T cell responses against EBOV nucleoprotein, matrix protein, and glycoprotein 1 that were stronger in magnitude compared to the survivors. Our data provide further evidence of EBOV exposure in individuals without EVD-like illness and, for the first time, demonstrate that these individuals have T cell responses that are stronger in magnitude compared to severe cases. These findings suggest that T cell immunity may protect against severe EVD, which has important implications for vaccine development.

  10. Practical colorimeter for direct measurement of microplates in enzyme immunoassay systems.

    Clem, T R; Yolken, R H


    A colorimeter capable of measuring results of enzyme-linked immunosorbent assay (ELISA) reactions directly in the wells of a microtiter plate is described. This colorimeter proved to be as accurate as a conventional spectrophotometer in assessing ELISA reactions, but had the advantage of not requiring transfer of the specimen to a separate chamber. With this colorimeter, 96 specimens can be read in approximately 5 min. A practical colorimeter such as this can make the use of ELISA tests more feasible for many laboratories.

  11. A New Enzyme-linked Sorbent Assay (ELSA) to Quantify Syncytiotrophoblast Extracellular Vesicles in Biological Fluids.

    Göhner, Claudia; Weber, Maja; Tannetta, Dionne S; Groten, Tanja; Plösch, Torsten; Faas, Marijke M; Scherjon, Sicco A; Schleußner, Ekkehard; Markert, Udo R; Fitzgerald, Justine S


    The pregnancy-associated disease preeclampsia is related to the release of syncytiotrophoblast extracellular vesicles (STBEV) by the placenta. To improve functional research on STBEV, reliable and specific methods are needed to quantify them. However, only a few quantification methods are available and accepted, though imperfect. For this purpose, we aimed to provide an enzyme-linked sorbent assay (ELSA) to quantify STBEV in fluid samples based on their microvesicle characteristics and placental origin. Ex vivo placenta perfusion provided standards and samples for the STBEV quantification. STBEV were captured by binding of extracellular phosphatidylserine to immobilized annexin V. The membranous human placental alkaline phosphatase on the STBEV surface catalyzed a colorimetric detection reaction. The described ELSA is a rapid and simple method to quantify STBEV in diverse liquid samples, such as blood or perfusion suspension. The reliability of the ELSA was proven by comparison with nanoparticle tracking analysis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. [Enzyme-linked immunosorbent assay (ELISA) for detection of antibodies to Salmonella Typhi lipopolysaccharide O and capsular polysaccharide Vi antigens in persons from outbreak of typhoid fever].

    Rastawicki, Waldemar; Kałużewski, Stanisław


    The laboratory diagnosis of typhoid fever is dependent upon either isolation of S. Typhi from a clinical sample or the detection of raised titers of serum antibodies in the Widal test or the passive hemagglutination assay (PHA). In this study we evaluated the usefulness of ELISA for detection of antibodies to S. Typhi lipopolysaccharide O and capsular polysaccharide Vi antigens in the sera of persons from outbreak of typhoid fever. Fifteen serum samples from patients with laboratory confirmed typhoid fever and 140 sera from persons suspected for contact with typhoid fever patients from outbreak in 1974/75 in Poland were tested by ELISA. Additionally, as the control group, we tested 115 sera from blood donors for the presence of S. Typhi anti-LPS and anti-Vi antibodies. Anti-LPS and anti-Vi antibodies were detected in 80% and 53.3% of sera obtained from patients with laboratory confirmed typhoid fever, respectively. The high percentages of positive results in ELISA were also noted in the group of persons suspected for contact with typhoid fever patients (51.4% and 45%) but not in the group of blood donors (7.8% and 6.1%, respectively). The ELISA could be a useful tool for the serological diagnosis of typhoid fever in patients who have clinical symptoms but are culture negative, especially during massive outbreaks of typhoid fever.

  13. Detection of Entamoeba histolytica/dispar in stool specimens by using enzyme-linked immunosorbent assay in the population of Jeddah City, Saudi Arabia.

    Barnawi, Abdulaziz B M; Tonkal, Abulkader M; Fouad, Mahmoud A H; Al-Braiken, Faten A


    This study determined the prevalence of intestinal parasites, particularly pathogenic Entamoeba sp. (E. histolytica), in patients attending three hospitals in Jeddah City, King Abdulaziz University Hospital, King Abdulaziz Hospital and King Fahad Hospital for gastro-intestinal troubles. 186 stool specimens were examined microscopically for parasites and by ELISA kit (E. histolytica II) for true E. histolytica. 83 samples (44.6%) were positive by microscopy for at least one parasite. Of which, 23 (12.4%) showed two parasites and 15 (8.1%) three parasites. Eight different parasite species were identified. The most prevalent were E. histolytica/dispar (n = 26, 31.3%) and Giardia lamblia (n = 13, 15.7%). Others were Blastocytosis hominis (n = 12, 14.5%), Entamoeba coli (n = 11, 13.3%), Trichuris trichuria (n = 8, 9.6%), Endolymax nana (n = 6, 7.2%), Hymenolepes nana (n = 4, 4.8%) and Chilomastix mesnili (n = 3, 3.6%). Only five stool samples (19%) from those identified by microscopy to contain E. histolytica/dispar, were E. histolytica positive by E. histolytica II ELISA. For the first time to the authors' knowledge the true prevalence of E. histolytica in Saudi Arabia was 2.7%. E. histolytica II ELISA proved to be a highly useful technique to differentiate pathogenic E. histolytica from non pathogenic E. dispar.

  14. Accuracy of molecular diagnostics in pemphigus and bullous pemphigoid: comparison of commercial and modified mosaic indirect immunofluorescence tests as well as enzyme-linked immunosorbent assays.

    Gornowicz-Porowska, Justyna; Seraszek-Jaros, Agnieszka; Bowszyc-Dmochowska, Monika; Kaczmarek, Elżbieta; Pietkiewicz, Paweł; Bartkiewicz, Paweł; Dmochowski, Marian


    Pemphigus and bullous pemphigoid (BP) are identified by autoantibodies (abs) against desmoglein 1, 3 (DSG1/3) and BP180/BP230, respectively. A novel mosaic to indirect immunofluorescence (IIF) using purified BP180 recombinant proteins spotted on slide and transfected cells expressing BP230, DSG1, DSG3 is available. The commercial (IgG detection) and modified (IgG4 detection) mosaic for indirect immunofluorescence (IIFc - IIF commercial, IIFm - IIF modified) and IgG ELISAs were evaluated in pemphigus and bullous pemphigoid (BP) molecular diagnostics. To compare diagnostic accuracy of commercial (IgG detection) and modified (IgG4 detection) mosaic IIF assay and to examine the diagnostic value of ELISAs in relation to mosaic IIF in routine laboratory diagnostics of pemphigus and BP. Sera from 37 BP and 19 pemphigus patients were studied. Associations between tests were assessed using Fisher's exact test. There are associations between the positive/negative samples detected by IIFc with desmoglein1 (DSG1)/desmoglein3 (DSG3)/BP230 transfected cells and ELISAs and no association between anti-BP180 IgG detection by IIFc and ELISA. IIFm with DSG1 and DSG3 showed both 100% sensitivity and 100% and 78% specificity, respectively, and 100% and 83% positive predictive value in relation to IIFc. IIFm with BP230 had 87% specificity, 55% sensitivity, whereas IIFm with BP180 had a 100% sensitivity and 13% specificity in relation to IIFc. The IIFc with DSG1/DSG3/BP230 transfected cells, excluding BP180 spots, is an alternative method to ELISA in pemphigus/BP diagnostics. IgG4 antibodies, both pathogenically and diagnostically important, are inconsistently detectable with IIFm.

  15. Accuracy of molecular diagnostics in pemphigus and bullous pemphigoid: comparison of commercial and modified mosaic indirect immunofluorescence tests as well as enzyme-linked immunosorbent assays

    Justyna Gornowicz-Porowska


    Full Text Available Introduction : Pemphigus and bullous pemphigoid (BP are identified by autoantibodies (abs against desmoglein 1, 3 (DSG1/3 and BP180/BP230, respectively. A novel mosaic to indirect immunofluorescence (IIF using purified BP180 recombinant proteins spotted on slide and transfected cells expressing BP230, DSG1, DSG3 is available. The commercial (IgG detection and modified (IgG4 detection mosaic for indirect immunofluorescence (IIFc – IIF commercial, IIFm – IIF modified and IgG ELISAs were evaluated in pemphigus and bullous pemphigoid (BP molecular diagnostics. Aim : To compare diagnostic accuracy of commercial (IgG detection and modified (IgG4 detection mosaic IIF assay and to examine the diagnostic value of ELISAs in relation to mosaic IIF in routine laboratory diagnostics of pemphigus and BP. Material and methods : Sera from 37 BP and 19 pemphigus patients were studied. Associations between tests were assessed using Fisher’s exact test. Results: There are associations between the positive/negative samples detected by IIFc with desmoglein1 (DSG1/desmoglein3 (DSG3/BP230 transfected cells and ELISAs and no association between anti-BP180 IgG detection by IIFc and ELISA. IIFm with DSG1 and DSG3 showed both 100% sensitivity and 100% and 78% specificity, respectively, and 100% and 83% positive predictive value in relation to IIFc. IIFm with BP230 had 87% specificity, 55% sensitivity, whereas IIFm with BP180 had a 100% sensitivity and 13% specificity in relation to IIFc. Conclusions : The IIFc with DSG1/DSG3/BP230 transfected cells, excluding BP180 spots, is an alternative method to ELISA in pemphigus/BP diagnostics. IgG4 antibodies, both pathogenically and diagnostically important, are inconsistently detectable with IIFm.

  16. Development of an enzyme-linked immunosorbent assay for detection of chicken osteocalcin and its use in evaluation of perch effects on bone remodeling in caged White Leghorns.

    Jiang, S; Cheng, H W; Hester, P Y; Hou, J-F


    Osteocalcin (OC) is a sensitive biochemical marker for evaluating bone turnover in mammals. The role of avian OC is less clear because of the need for a chicken assay. Our objectives were to develop an assay using indirect competitive ELISA for detecting chicken serum OC and use the assay to examine the effects of perches on bone remodeling in caged hens. Anti-chicken OC polyclonal antibody was produced by immunization of rabbits with a recombinant OC from Escherichia coli. Chicken OC extracted from bone was used as a coated protein, and purified chicken OC was used for calibration. The limit of detection of the developed OC ELISA was 0.13 ng/mL. The intra- and interassay CV were housed in conventional cages with or without perches. Serum samples were collected from 71-wk-old White Leghorn hens subjected to 4 treatments. Treatment 1 was control chickens that never had access to perches during their life cycle. Treatment 2 chickens had perches during the pullet phase (0 to 16.9 wk of age), whereas treatment 3 chickens had perches only during the egg-laying phase of the life cycle (17 to 71 wk of age). Treatment 4 chickens always had access to perches (0 to 71 wk of age). Correlation between the 2 assays was 0.62 (P < 0.0001). Levels of serum OC using the developed chicken ELISA were higher than that detected using the Rat-Mid ELISA (P < 0.0001). Results from the chicken ELISA assay showed that hens with perch access had higher concentrations of serum OC than hens without perches during egg laying (P = 0.04). Pullet access to perches did not affect serum OC levels in 71-wk-old hens (P = 0.15). In conclusion, a chicken OC ELISA has been validated that is sensitive and accurate with adequate discriminatory power for measuring bone remodeling in chickens.

  17. Investigation of the induction of oxidative DNA damage by means of an enzyme-linked immunosorbent assay (ELISA) for thymine glycol containing DNA

    Pohlenz-Michel, C.


    The report explains an ELISA test system for the detection and quantification of toxic effects on genes, induced by mutagenic or carcinogenic chemicals introduced by way of reactive oxygen species. Sensitivity and reproducibility are defined, and the system's applicability to the detection of oxidative DNA damage as a result of the metabolism of chemicals in cellular systems is discussed. (TRV) [de

  18. Serodiagnosis of sporotrichosis infection in cats by enzyme-linked immunosorbent assay using a specific antigen, SsCBF, and crude exoantigens.

    Fernandes, Geisa Ferreira; Lopes-Bezerra, Leila Maria; Bernardes-Engemann, Andréa Reis; Schubach, Tânia Maria Pacheco; Dias, Maria Adelaide Galvão; Pereira, Sandro Antonio; de Camargo, Zoilo Pires


    The main objective of this study is to standardize an ELISA for the diagnosis of feline sporotrichosis. Sporothrix schenckii is the etiological agent of human and animal sporotrichosis. Cats may act as reservoirs for S. schenckii and can transmit the infection to humans by a bite or scratch. There are few methods for the serological diagnosis of fungal diseases in animals. In this paper, an ELISA test for the diagnosis of cat sporotrichosis is proposed, which detects S. schenckii-specific antibodies in feline sera. Two different kinds of antigens were used: "SsCBF", a specific molecule from S. schenckii that consists of a Con A-binding fraction derived from a peptido-rhamnomannan component of the cell wall, and a S. schenckii crude exoantigen preparation. The ELISA was developed, optimized, and evaluated using sera from 30 cats with proven sporotrichosis (by culture isolation); 22 sera from healthy feral cats from a zoonosis center were used as negative controls. SsCBF showed 90% sensitivity and 96% specificity in ELISA; while crude exoantigens demonstrated 96% sensitivity and 98% specificity. The ELISA assay described here would be a valuable screening tool for the detection of specific S. schenckii antibodies in cats with sporotrichosis. The assay is inexpensive, quick to perform, easy to interpret, and permits the diagnosis of feline sporotrichosis. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Indirect Enzyme-Linked Immunosorbent Assay for Detection of Immunoglobulin G Reactive with a Recombinant Protein Expressed from the Gene Encoding the 116-Kilodalton Protein of Mycoplasma pneumoniae

    Duffy, Michael F.; Whithear, Kevin G.; Noormohammadi, Amir H.; Markham, Philip F.; Catton, Michael; Leydon, Jennie; Browning, Glenn F.


    Serology remains the method of choice for laboratory diagnosis of Mycoplasma pneumoniae infection. Currently available serological tests employ complex cellular fractions of M. pneumoniae as antigen. To improve the specificity of M. pneumoniae diagnosis, a recombinant protein was assessed as a serodiagnostic reagent. A panel of recombinant proteins were expressed from a cloned M. pneumoniae gene that encodes a 116-kDa surface protein antigen. The recombinant proteins were assessed for reactiv...

  20. Evaluation of indirect TaSP enzyme-linked immunosorbent assay for diagnosis of tropical theileriosis in cattle (Bos indicus) and water buffaloes (Bubalus bubalis) in Egypt.

    Mohamed, Amr M; Abdel-Rady, Ahmed; Ahmed, Laila S; El-Hosary, Amira


    The aim of the present study was to evaluate the validity of Theileria annulata surface protein (TaSP)-ELISA, in comparison with traditional microscopic test, for the diagnosis of T. annulata infection among Egyptian baladi cattle (Bos taurus) and water buffaloes (Bubalus bubalis). Molecular confirmation of infection using T. annulata merozoite surface (Tams-1) target amplification by PCR was used as a gold standard. A total of 76 clinically suspected animals including 64 baladi cattle and 12 water buffaloes were investigated in the current study by the three methods. Based on the PCR-confirmed results, the evaluation study revealed higher sensitivity of TaSP-ELISA (72.9% and 75%) as compared to microscopic examination (58.3% and 50%) among cattle and buffaloes, respectively. On the other hand, the specificity of TaSP-ELISA in diagnosis of T. annulata infection was higher (87.5%) in baladi cattle as compared to water buffaloes (37.5%). In conclusion, TaSP-ELISA was shown to be suitable for the diagnosis of T. annulata infection in cattle under field conditions. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Novel sensitive monoclonal antibody based competitive enzyme-linked immunosorbent assay for the detection of raw and processed bovine beta-casein.

    Castillo, Daniela S; Cassola, Alejandro


    Cow milk protein allergy (CMPA) is the most common childhood food allergy, which can sometimes persist or can newly develop in adulthood with severe symptoms. CMPA's treatment is complete dietary avoidance of milk proteins. To achieve this task, patients have to be aware of milk proteins found as "hidden allergens" in food commodities. In regard to milk proteins, it has been reported that allergenicity of caseins remains unaffected upon heat treatment. For these reasons, we aimed to obtain monoclonal antibodies (mAbs) against native and denatured β-casein, one of the most abundant and antigenic caseins, in order to develop an indirect competitive ELISA (icELISA) to detect and quantify traces of this milk allergen in raw and processed foodstuffs. We developed two specific hybridoma clones, 1H3 and 6A12, which recognized β-casein in its denatured and native conformations by indirect ELISA (iELISA). Cross-reaction analysis by Western blot and iELISA indicated that these mAbs specifically recognized β-casein from bovine and goat milk extracts, while they did not cross-react with proteins present in other food matrixes. These highly specific mAbs enabled the development of sensitive, reliable and reproducible icELISAs to detect and quantify this milk protein allergen in food commodities. The extraction of β-casein from foodstuff was efficiently carried out at 60°C for 15 minutes, using an extraction buffer containing 1% SDS. The present study establishes a valid 1H3 based-icELISA, which allows the detection and quantification -0.29 ppm and 0.80 ppm, respectively- of small amounts of β-casein in raw and processed foods. Furthermore, we were able to detect milk contamination in incurred food samples with the same sensitivity as a commercial sandwich ELISA thus showing that this icELISA constitutes a reliable analytical method for control strategies in food industry and allergy prevention.

  2. Diagnostic performance of an indirect enzyme-linked immunosorbent assay (ELISA) to detect bovine leukemia virus antibodies in bulk-tank milk samples

    Nekouei, Omid; Durocher, Jean; Keefe, Greg


    This study assessed the diagnostic performance of a commercial ELISA for detecting bovine leukemia virus antibodies in bulk-tank milk samples from eastern Canada. Sensitivity and specificity of the test were estimated at 97.2% and 100%, respectively. The test was recommended as a cost-efficient tool for large-scale screening programs. PMID:27429469

  3. Performance of four different indirect enzyme-linked immunosorbent assays (ELISAs) to detect specific IgG, IgA, and IgM in Legionnaires' disease

    Bangsborg, Jette Marie; Shand, G H; Hansen, K


    Currently recommended methods in Legionnaires' disease serology are based upon crude whole-cell antigenic preparations. To investigate whether purified antigens would perform better in a given diagnostic test for antibodies against Legionella pneumophila, we compared the performance of three...

  4. The use of enzyme-linked immunosorbent assay (ELISA) for the diagnosis and monitoring of foot-and-mouth disease in the Philippines

    Verin, B.C.; Arvesu, R.M.


    The establishment and use of the indirect sandwich ELISA for the detection of foot-and-mouth disease (FMD) virus antigen sero-types O, A and C and the liquid phase blocking ELISA (LPB-ELISA) for antibody levels against similar FMD sero-types has been adopted for routine diagnosis at the FMD diagnostic laboratory, PAHC. A total of 552 epithelial samples and 4401 serum samples were tested starting 1995 to 1998. Out of 552, 84 (17.9%) were found negative and 468 (84.78%) diagnosed as positive for sero-types O and C (42% of the total positives). Within 4 years, 62 representative samples were sent to WRL for FMD for confirmation diagnosis. From 62 samples sent 54 (87%) were diagnosed as positive and 8 (12.9%) were negative. Serum samples received were either for diagnosis (71 samples), surveillance (3002 serum), post vaccination titre (1303 serum) and for the FAO/IAEA external quality assurance programme (25 samples) by the FAO/IAEA Co-ordinated Research Project on FMD. The assay has been a useful tool in the fast diagnosis and confirmation of FMD suspect cases and in the measurement of antibodies against FMDV in serum samples from all animals either vaccinated or infected. In the future, the assay will be use for potency testing of imported vaccines and for monitoring and surveillance purposes to show freedom from disease for the support documentation from OIE. (author)

  5. Performance and diagnostic usefulness of commercially available enzyme linked immunosorbent assay and rapid kits for detection of HIV, HBV and HCV in India.

    Maity, Susmita; Nandi, Srijita; Biswas, Subrata; Sadhukhan, Salil Kumar; Saha, Malay Kumar


    HIV, HBV and HCV pose a major public health problem throughout the world. Detection of infection markers for these agents is a major challenge for testing laboratories in a resource poor setting. As blood transfusion is an important activity saving millions of live every year, it also carries a risk of transfusion transmissible infections caused by these fatal blood borne pathogens if the quality of testing is compromised. Conventional ELISA is regarded as the mostly used screening technique but due to limitations like high cost, unavailability in many blood banks and testing sites, involvement of costly instruments, time taking nature and requirement of highly skilled personnel for interpretation, rapid tests are gaining more importance and warrants comparison of performance. A comparative study between these two techniques has been performed using commercially available diagnostic kits to assess their efficacy for detection of HIV, HBV and HCV infections. Rapid kits were more efficient in specificity with synthetic antigens along with high PPV than ELISA in most cases. Comparison between different ELISA kits revealed that Microlisa HIV and Hepalisa (J. Mitra & Co. Pvt. Ltd.); ERBA LISA HIV1 + 2, ERBA LISA Hepatitis B and ERBA LISA HCV (Transasia Bio-medicals Ltd.) gives uniform result with good performance in terms of sensitivity, specificity, PPV, NPV and efficiency, whereas, Microlisa HCV (J. Mitra & Co. Pvt. Ltd.), Microscreen HBsAg ELISA and INNOVA HCV (Span Diagnostics Ltd.) did not perform well. Rapid kits were also having high degree of sensitivity and specificity (100%) except in HIV Comb and HCV Comb (J. Mitra & Co. Pvt. Ltd.). The kit efficiency didn't vary significantly among different companies and lots in all the cases except for HCV ELISA showing statistically significant variation (p bank. For availability of quality commercial diagnostic assays, evaluation of kit may be helpful.

  6. Performance and diagnostic usefulness of commercially available enzyme linked immunosorbent assay and rapid kits for detection of HIV, HBV and HCV in India

    Maity Susmita


    Full Text Available Abstract Background HIV, HBV and HCV pose a major public health problem throughout the world. Detection of infection markers for these agents is a major challenge for testing laboratories in a resource poor setting. As blood transfusion is an important activity saving millions of live every year, it also carries a risk of transfusion transmissible infections caused by these fatal blood borne pathogens if the quality of testing is compromised. Conventional ELISA is regarded as the mostly used screening technique but due to limitations like high cost, unavailability in many blood banks and testing sites, involvement of costly instruments, time taking nature and requirement of highly skilled personnel for interpretation, rapid tests are gaining more importance and warrants comparison of performance. Results A comparative study between these two techniques has been performed using commercially available diagnostic kits to assess their efficacy for detection of HIV, HBV and HCV infections. Rapid kits were more efficient in specificity with synthetic antigens along with high PPV than ELISA in most cases. Comparison between different ELISA kits revealed that Microlisa HIV and Hepalisa (J. Mitra & Co. Pvt. Ltd.; ERBA LISA HIV1 + 2, ERBA LISA Hepatitis B and ERBA LISA HCV (Transasia Bio-medicals Ltd. gives uniform result with good performance in terms of sensitivity, specificity, PPV, NPV and efficiency, whereas, Microlisa HCV (J. Mitra & Co. Pvt. Ltd., Microscreen HBsAg ELISA and INNOVA HCV (Span Diagnostics Ltd. did not perform well. Rapid kits were also having high degree of sensitivity and specificity (100% except in HIV Comb and HCV Comb (J. Mitra & Co. Pvt. Ltd.. The kit efficiency didn’t vary significantly among different companies and lots in all the cases except for HCV ELISA showing statistically significant variation (p  Conclusions ELISA is a good screening assay for markers of HIV, HBV and HCV infections. Rapid tests are useful for further detection of false positive samples. ELISA seems the appropriate assay in blood bank. For availability of quality commercial diagnostic assays, evaluation of kit may be helpful.

  7. Efficacy of an enzyme-linked immunosorbent assay as a diagnostic tool for schistosomiasis mansoni in individuals with low worm burden

    Edward José de Oliveira


    Full Text Available IgM-ELISA is an immunoenzymatic method useful for detection of IgM antibodies against a fraction of Schistosoma mansoni adult worm antigen (AWA that is soluble in trichloroacetic acid (AWA-TCA. This method was applied to three groups of individuals with different clinical and epidemiological characteristics, and the results compared with those obtained by other diagnostic methods: immunofluorescence test for detection of IgM antibodies (IgM-IFT or IgG antibodies (IgG-IFT, ELISA for detection of IgG antibodies (IgG-ELISA, and two parasitological methods, Kato-Katz and miracidium hatching. The IgM-ELISA presented a sensitivity of 98%, when the parasitologic fecal examination was defined as reference diagnostic method, and a specificity of 98 and 97.3%, respectively for the group of clinically healthy individuals and other helminth carriers. A comparative analysis between the results of IgM-ELISA and those obtained by other serologic tests showed a good degree of agreement, with Kappa indices ranging from 0.95 to 0.98. The diagnostic efficacy of 97.8%, as determined with schistosomiasis patients with low parasitic burden, suggests the excellent performance of the IgM-ELISA and its usefulness for the diagnosis of schistosomiasis when applied in low endemic areas.

  8. Implementation of an Enzyme Linked Immunosorbent Assay for the Quantification of Allergenic Egg Residues in Red Wines Using Commercially Available Antibodies

    Koestel, Carole; Simonin, Céline; Belcher, Sandrine


    Abstract Since the early 2000s, labeling of potentially allergenic food components to protect people who suffer from food allergies is compulsory in numerous industrialized countries. In Europe, milk and egg components used during the winemaking process must be indicated on the label since July 1, 2012. Several ELISA procedures have been developed to detect allergenic residues in wines. However, the complexity of the wine matrix can inhibit the immunoenzymatic reaction. The aim of this study was to implement an ELISA assay for the detection of ovalbumin in red wines using commercially available antibodies. The specificity of the acquired antibodies and the absence of cross reactivity were assessed by immunoblotting and ELISA. An ELISA assay with a LOD of 14.2 μg/L and a LOQ of 56.4 μg/L of ovalbumin in aqueous solution was obtained. Differences in ELISA signals were observed when analyzing various fining agents, although reproducible conformation of the antigen could be reached for the comparison of ovalbumin and Ovicolle. The differences between samples in terms of pH could be leveled but the inhibition of the ELISA signal, positively correlated to the tannin content of the wines, could not be suppressed. Thus, standard curves of ovalbumin in several wines were obtained by relative quantification. The control steps and the difficulties encountered presented in this study should be considered by anybody working toward the development of ELISA assays for the detection of allergenic residues in complex food matrices. PMID:27356183

  9. Implementation of an Enzyme Linked Immunosorbent Assay for the Quantification of Allergenic Egg Residues in Red Wines Using Commercially Available Antibodies.

    Koestel, Carole; Simonin, Céline; Belcher, Sandrine; Rösti, Johannes


    Since the early 2000s, labeling of potentially allergenic food components to protect people who suffer from food allergies is compulsory in numerous industrialized countries. In Europe, milk and egg components used during the winemaking process must be indicated on the label since July 1, 2012. Several ELISA procedures have been developed to detect allergenic residues in wines. However, the complexity of the wine matrix can inhibit the immunoenzymatic reaction. The aim of this study was to implement an ELISA assay for the detection of ovalbumin in red wines using commercially available antibodies. The specificity of the acquired antibodies and the absence of cross reactivity were assessed by immunoblotting and ELISA. An ELISA assay with a LOD of 14.2 μg/L and a LOQ of 56.4 μg/L of ovalbumin in aqueous solution was obtained. Differences in ELISA signals were observed when analyzing various fining agents, although reproducible conformation of the antigen could be reached for the comparison of ovalbumin and Ovicolle. The differences between samples in terms of pH could be leveled but the inhibition of the ELISA signal, positively correlated to the tannin content of the wines, could not be suppressed. Thus, standard curves of ovalbumin in several wines were obtained by relative quantification. The control steps and the difficulties encountered presented in this study should be considered by anybody working toward the development of ELISA assays for the detection of allergenic residues in complex food matrices. © 2016 The Authors. Journal of Food Science published by Wiley Periodicals, Inc. on behalf of Institute of Food Technologists.

  10. Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

    Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael


    (1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

  11. Diagnosis of invasive candidiasis by enzyme-linked immunosorbent assay using the N-terminal fragment of Candida albicans hyphal wall protein 1

    Pontón José


    Full Text Available Abstract Background The diagnosis of invasive candidiasis is difficult because there are no specific clinical manifestations of the disease and colonization and infection are difficult to distinguish. In the last decade, much effort has been made to develop reliable tests for rapid diagnosis of invasive candidiasis, but none of them have found widespread clinical use. Results Antibodies against a recombinant N-terminal fragment of the Candida albicans germ tube-specific antigen hyphal wall protein 1 (Hwp1 generated in Escherichia coli were detected by both immunoblotting and ELISA tests in a group of 36 hematological or Intensive Care Unit patients with invasive candidiasis and in a group of 45 control patients at high risk for the mycosis who did not have clinical or microbiological data to document invasive candidiasis. Results were compared with an immunofluorescence test to detect antibodies to C. albicans germ tubes (CAGT. The sensitivity, specificity, positive and negative predictive values of a diagnostic test based on the detection of antibodies against the N-terminal fragment of Hwp1 by immunoblotting were 27.8 %, 95.6 %, 83.3 % and 62.3 %, respectively. Detection of antibodies to the N-terminal fragment of Hwp1 by ELISA increased the sensitivity (88.9 % and the negative predictive value (90.2 % but slightly decreased the specificity (82.6 % and positive predictive values (80 %. The kinetics of antibody response to the N-terminal fragment of Hwp1 by ELISA was very similar to that observed by detecting antibodies to CAGT. Conclusion An ELISA test to detect antibodies against a recombinant N-terminal fragment of the C. albicans germ tube cell wall antigen Hwp1 allows the diagnosis of invasive candidiasis with similar results to those obtained by detecting antibodies to CAGT but without the need of treating the sera to adsorb the antibodies against the cell wall surface of the blastospore.

  12. True positivity of anti-Hepatitis C Virus Enzyme-linked immunosorbent assay reactive blood donors: A prospective study done in western India

    Sunita Tulsiani


    Full Text Available Background: A significant number of safe donations are removed from the blood supply, because of the reactive anti-HCV screening test results. This study aimed to assess if the HCV (Hepatitis C Virus seropositive donors were confirmed positive or not. Materials and Methods: More than 68,000 blood donors′ samples were routinely screened and 140 samples were found to be anti-HCV ELISA reactive. These 140 samples were tested by NAT. The NAT negative samples were tested by RIBA. Analysis of samples reactive in single ELISA kit vs. two ELISA kits was done. Results: Out of 140 anti-HCV ELISA reactive samples, a total of 16 (11.43% were positive by NAT. The results of 124 RIBA showed 6 (4.84% positive, 92 (74.19% negative, and 26 (20.97% indeterminate results. None of the sample which was reactive in only single ELISA kit was positive by NAT or RIBA. Conclusion: Only a minority of blood donors with repeatedly reactive anti-HCV screening test is positive by confirmatory testing, but all these blood units are discarded as per existing legal provisions in India. Efforts should be made to retain these donors and also donor units.

  13. Environmental Technology Verification Report for Abraxis Ecologenia® Ethynylestradiol (EE2) Microplate Enzyme-Linked Immunosorbent Assay (ELISA) Test Kits

    The EPA's National Risk Management Research Laboratory (NRMRL) and its verification organization partner, Battelle, operate the Advanced Monitoring Systems (AMS) Center under ETV. The AMS Center recently evaluated the performance of the Abraxis Ecologenia Ethynylestradiol (EE2) ...

  14. Discordant results obtained on testing sera from immunocompromised patients for cytomegalovirus IgG by enzyme-linked immunosorbent assay and radioimmunoassay

    Booth, J C; El Mohandes, L; Tryhorn, Y S [London University (United Kingdom). St. George' s Hospital Medical School, Department of Medical Microbiology; Kangro, H O; Liu, K M [Saint Bartholomew' s Hospital, London (UK)


    The investigation of sera from immunocompromised patients for antibody to CMV by ELISA, RIA, immunofluorescence (IF) and complement-fixation (CF) revealed discrepancies that reflected differences in test specificity rather than sensitivity and suggested that for the long-term serological follow-up of such patients it would be advisable not to rely on only a single assay procedure. (author). 12 refs.; 8 figs.; 1 tab.

  15. Environmental Technology Verification Report for Abraxis 17β-Estradiol (E2) Magnetic Particle Enzyme-Linked Immunosorbent Assay (ELISA) Test Kits

    The EPA's National Risk Management Research Laboratory (NRMRL) and its verification organization partner, Battelle, operate the Advanced Monitoring Systems (AMS) Center under ETV. The AMS Center recently evaluated the performance of the Abraxis 17(beta)-estradiol (E2) magnetic p...

  16. Analysis of pirlimycin residues in beef muscle, milk and honey by a biotin-streptavidin-amplified enzyme-linked immunosorbent assay

    Food contamination caused by veterinary drug residues is a world-wide public health concern and requires continuous monitoring. In this paper, we describe a biotin–streptavidin-amplified ELISA (BA-ELISA) for detecting pirlimycin residues in beef, milk, and honey. The IC50 value of the BA-ELISA was...

  17. Determination of Dioxins in Soil Samples from industrial and burned forest sites in Syria Using an Enzyme Linked Immunosorbent Assay (ELIZA)

    Ghanem, I.; Orfi, M.; Abu-Alnaser, A.


    Sixty soil samples were collected from three industrial locations and burnt forest locution of Syria, namely, Banyas refinery and the Thermal Electricity Generation Station area (7 samples), Central factory area, Tartous (11 samples), AlFrunlok Forest, Lattakia (22 samples), Alwaer and Oil refinery area in Homs (20 samples) Dioxin presence in these samples was determined using a specific ELIZA Kit, Results indicate the absence of any detectable levels of Dioxins from any of the samples collected in Banyas refinery, Electricity Generation Station of Banyas, Central factory and the area of Hsain AlBaher, Mazrahat AlArous in Tartous. Likewise, all samples (22 samples) taken from AlFrunlok forest area were free of Dioxin contamination except the samples taken from the road to Nubu Issa, and Shahrura, where 8 samples (36.36%) and 6 samples (27.27%) contained concentration of Dioxin ranging between 5-15 and 15-25 PPT respectively. Results showed the presence of Dioxins in samples collected at AlWa-er area, Homs (17 sample) at high concentration in comparison with samples collected in other areas. Three of those samples (17.6%) and four samples (23.5%) contained Dioxins at levels ranging between 15-25 and 15-25 PPT respectively. (58.8%) of all samples (10 samples) collected in this area, contained Dioxins at levels exceeding the maximum level detectable by the ELIZA kit (i.e. 50 PPT). The results reported in the present study justify a follow up and detailed study in AlWa-er area. (author)

  18. Detection of Shiga toxin-producing Escherichia coli by sandwich enzyme-linked immunosorbent assay using chicken egg yolk IgY antibodies

    Yanil R Parma


    Full Text Available Enterohemorrhagic Escherichia coli (EHEC, a subset of Shiga toxin producing E. coli (STEC is associated with a spectrum of diseases that includes diarrhea, hemorrhagic colitis and a life-threatening hemolytic uremic syndrome (HUS. Regardless of serotype, Shiga toxins (Stx1 and/or Stx2 are uniformly expressed by all EHEC, and so exploitable targets for laboratory diagnosis of these pathogens. In this study, a sandwich ELISA for determination of Shiga toxin (Stx was developed using anti-Stx2 B subunit antibodies and its performance was compared with that of the Vero cell assay and a commercial immunoassay kit. Chicken IgY was used as capture antibody and a HRP-conjugated rabbit IgG as the detection antibody. The anti-Stx2B IgY was harvested from eggs laid by hens immunized with a recombinant protein fragment. Several parameters were tested in order to optimize the sandwich ELISA assay, including concentration of antibodies, type and concentration of blocking agent, and incubation temperatures. Supernatants from 42 STEC strains of different serotypes and stx variants, including stx2EDL933, stx2vha, stx2vhb, stx2g, stx1EDL933 and stx1d were tested. All Stx variants were detected by the sandwich ELISA, with a detection limit of 400 ng /ml Stx2. Twenty three strains negative for stx genes, including different bacteria species, showed no activity in Vero cell assay and produced negative results in ELISA, except for 2 strains. Our results show that anti-Stx2B IgY sandwich ELISA could be used in routine diagnosis as a rapid, specific and economic method for detection of Shiga toxin-producing E. coli.

  19. Detection of Shiga toxin-producing Escherichia coli by sandwich enzyme-linked immunosorbent assay using chicken egg yolk IgY antibodies

    Parma, Y. R.; Chacana, P. A.; Lucchesi, P. M. A.; Rogé, A.; Granobles Velandia, C. V.; Krüger, A.; Parma, A. E.; Fernández-Miyakawa, M. E.


    Enterohemorrhagic Escherichia coli (EHEC), a subset of Shiga toxin producing E. coli (STEC) is associated with a spectrum of diseases that includes diarrhea, hemorrhagic colitis and a life-threatening hemolytic-uremic syndrome (HUS). Regardless of serotype, Shiga toxins (Stx1 and/or Stx2) are uniformly expressed by all EHEC, and so exploitable targets for laboratory diagnosis of these pathogens. In this study, a sandwich ELISA for determination of Shiga toxin (Stx) was developed using anti-Stx2B subunit antibodies and its performance was compared with that of the Vero cell assay and a commercial immunoassay kit. Chicken IgY was used as capture antibody and a HRP-conjugated rabbit IgG as the detection antibody. The anti-Stx2B IgY was harvested from eggs laid by hens immunized with a recombinant protein fragment. Several parameters were tested in order to optimize the sandwich ELISA assay, including concentration of antibodies, type and concentration of blocking agent, and incubation temperatures. Supernatants from 42 STEC strains of different serotypes and stx variants, including stx2EDL933, stx2vha, stx2vhb, stx2g, stx1EDL933, and stx1d were tested. All Stx variants were detected by the sandwich ELISA, with a detection limit of 115 ng/ml Stx2. Twenty three strains negative for stx genes, including different bacteria species, showed no activity in Vero cell assay and produced negative results in ELISA, except for two strains. Our results show that anti-Stx2B IgY sandwich ELISA could be used in routine diagnosis as a rapid, specific and economic method for detection of Shiga toxin-producing E. coli. PMID:22919675

  20. Detection of Shiga toxin-producing Escherichia coli by sandwich enzyme-linked immunosorbent assay using chicken egg yolk IgY antibodies

    Parma, Y. R.; Chacana, P. A.; Lucchesi, P. M. A.; Rogé, A.; Granobles Velandia, C. V.; Krüger, A.; Parma, A. E.; Fernández-Miyakawa, M. E.


    Enterohemorrhagic Escherichia coli (EHEC), a subset of Shiga toxin producing E. coli (STEC) is associated with a spectrum of diseases that includes diarrhea, hemorrhagic colitis and a life-threatening hemolytic-uremic syndrome (HUS). Regardless of serotype, Shiga toxins (Stx1 and/or Stx2) are uniformly expressed by all EHEC, and so exploitable targets for laboratory diagnosis of these pathogens. In this study, a sandwich ELISA for determination of Shiga toxin (Stx) was developed using anti-St...

  1. Detection of Shiga toxin-producing Escherichia coli by sandwich enzyme-linked immunosorbent assay using chicken egg yolk IgY antibodies

    Yanil R Parma; Pablo A Chacana; Paula María Alejandra Lucchesi; Ariel eRoge; Claudia V Granobles Velandia; Alejandra eKrüger; Alejandra eKrüger; Alberto E. Parma; Mariano Enrique Fernandez Miyakawa


    Enterohemorrhagic Escherichia coli (EHEC), a subset of Shiga toxin producing E. coli (STEC) is associated with a spectrum of diseases that includes diarrhea, hemorrhagic colitis and a life-threatening hemolytic uremic syndrome (HUS). Regardless of serotype, Shiga toxins (Stx1 and/or Stx2) are uniformly expressed by all EHEC, and so exploitable targets for laboratory diagnosis of these pathogens. In this study, a sandwich ELISA for determination of Shiga toxin (Stx) was developed using anti-St...

  2. Seroprevalence of equine granulocytic anaplasmosis and lyme borreliosis in Canada as determined by a point-of-care enzyme-linked immunosorbent assay (ELISA).

    Schvartz, Gili; Epp, Tasha; Burgess, Hilary J; Chilton, Neil B; Pearl, David L; Lohmann, Katharina L


    Equine granulocytic anaplasmosis (EGA) and Lyme borreliosis (LB) are an emerging concern in Canada. We estimated the seroprevalence of EGA and equine LB by testing 376 convenience serum samples from 3 provinces using a point-of-care SNAP(®) 4Dx(®) ELISA (IDEXX Laboratories, Westbrook, Maine, USA), and investigated the agreement between the point-of-care ELISA and laboratory-based serologic tests. The estimated seroprevalence for EGA was 0.53% overall (0.49% in Saskatchewan, 0.71% in Manitoba), while the estimated seroprevalence for LB was 1.6% overall (0.49% in Saskatchewan, 2.86% in Manitoba). There was limited agreement between the point-of-care ELISA and an indirect fluorescent antibody test for EGA (kappa 0.1, PABAK 0.47) and an ELISA/Western blot combination for LB (kappa 0.23, PABAK 0.71). While the SNAP(®) 4Dx(®) ELISA yielded expected seroprevalence estimates, further evaluation of serologic tests for the purposes of disease exposure recognition may be needed.

  3. How-to-do-it: Immunological Assays for the Classroom 1. Enzyme Linked Immunosorbent Assay (ELISA): A Laboratory Tool for Demonstration of Antibody-Antigen Interaction.

    Russo, A. J.; And Others


    Background information, list of required materials, and procedures are provided for an immunological assay which has been modified for use as a classroom/laboratory demonstration of antigen-antibody reaction. The assay is designed for a two and one-half hour laboratory period but may be modified for one hour laboratories. (JN)

  4. Critical difference applied to exercise-induced salivary testosterone and cortisol using enzyme-linked immunosorbent assay (ELISA): distinguishing biological from statistical change.

    Hayes, Lawrence D; Sculthorpe, Nicholas; Young, John D; Baker, Julien S; Grace, Fergal M


    Due to its noninvasive, convenient, and practical nature, salivary testosterone (sal-T) and cortisol (sal-C) are frequently used in a clinical and applied setting. However, few studies report biological and analytical error and even fewer report the 'critical difference' which is the change required before a true biological difference can be claimed. It was hypothesized that (a) exercise would result in a statistically significant change in sal-C and sal-T and (b) the exercise-induced change would be within the critical difference for both salivary hormones. In study 1, we calculated the critical difference of sal-T and sal-C of 18 healthy adult males aged 23.2 ± 3.0 years every 60 min in a seated position over a 12-h period (08:00-20:00 hours [study 1]). As proof-of-concept, sal-C and sal-T was also obtained pre and at 5 and 60 min post a maximal exercise protocols in a separate group of 17 healthy males (aged 20.1 ± 2.8 years [study 2]). The critical difference of sal-T calculated as 90 %. For sal-C, the critical difference was 148 % (study 1). Maximal exercise was associated with a statistically significant (p < 0.05) changes in sal-T and sal-C. However, these changes were all within the critical difference range. Results from this investigation indicate that a large magnitude of change for sal-C and sal-T is required before a biologically significant mean change can be claimed. Studies utilizing sal-T and sal-C should appreciate the critical difference of these measures and assess the biological significance of any statistical changes.

  5. Selection of specific inhibitor peptides in enzyme-linked immunosorbent assay (ELISA) of cardiac troponin I using immuno-dominant epitopes as competitor.

    Rezaee, Majid Asiabanha; Rasaee, Mohammad Javad; Mohammadnejad, Javad


    Human cardiac troponin I (cTni) is the gold marker for early diagnosis of myocardial infarction. In this regard, four immune-dominant epitopes of cTni were predicted and their 3D structures were determined. Thereafter, the competitive performance of the peptides was monitored with the developed polyclonal antibody-based indirect competitive ELISA; a half-maximal inhibitory concentration (IC50) of 0.49 (µg/mL) and detection limit of 0.037 (µg/mL) were achieved for recombinant cTni. The competitive ELISA determined sensitivity levels of 0.306, 0.141, 0.960, and 0.155 (µg/mL), respectively, for each peptide as competitor. We indicated that two of the selected epitopes have significant sensitivity scales and inhibition ability.

  6. Enzyme-linked immunosorbent assay (ELISAs) for metalloproteinase derived type II collagen neoepitope, CIIM--increased serum CIIM in subjects with severe radiographic osteoarthritis

    Bay-Jensen, Anne-Christine; Liu, Qi; Byrjalsen, Inger


    OBJECTIVES: In joint degenerative diseases, the collagens are degraded by matrix metalloproteinases and protein fragments are released to serum as potential biomarkers. METHODS: A collagen type II specific neoepitope, CIIM, was identified (…RDGAAG(1053)) by mass spectrometry. Two ELISAs against...... the neoepitope were developed. CIIM was measured in cartilage explants in the presence or absence of protease inhibitors. CIIM was measured in OA synovial fluid (n=51) and serum (n=156). Knee OA was graded by standard Kellgren-Lawrence (KL) score. RESULTS: The ELISAs showed good technical performance; CV%,

  7. Evaluation of an indirect enzyme-linked immunosorbent assay (ELISA) for detection of antibodies to the Apx toxins of Actinobacillus pleuropneumoniae

    Nielsen, Ragnhild; van den Bosch, Johannes F.; Plambeck, Tamara


    The reference strains of the 12 serotypes of Actinobacillus pleuropneumoniae express one or two of three different RTX exotoxins designated Apr I, Apr II and Apr III. The toxins are important virulence factors. In the present study, ELISAs with purified Apr I, Apr II and Apr III, respectively...... of exotoxin is not revealed serologically in the ELISA test....

  8. Characteristics of enzyme-linked immunosorbent assay for detection of IgG antibodies specific to Сhlamydia trachomatis heat shock protein (HSP-60

    O. Yu. Galkin


    Full Text Available The goal of this work was to study sensitivity and specificity of the developed ELISA set for the identification of IgG antibodies against Chlamydia trachomatis HSP-60 (using biotinylated tyramine-based signal amplification system. The study was conducted using a panel of characterized sera, as well as two reference ELISA sets of similar purpose. According to the results of ELISA informative value parameters, the ELISA we have developed showed the highest specificity and sensitivity parameters (no false negative or false positive results were registered. In 4 out of 15 intralaboratory panel serum samples initially identified as negative, anti-HSP-60 IgG-antibodies test result in reference ELISA sets upon dilution changed from negative to positive. The nature of titration curves of false negative sera and commercial monoclonal antibodies А57-В9 against C. trachomatis HSP-60 after incubation for 24 h was indicative of the presence of anti-idiotypic antibodies in these samples. Upon sera dilution, idiotypic-anti-idiotypic complexes dissociated, which caused the change of test result. High informative value of the developed ELISA set for identification of IgG antibodies against C. trachomatis HSP-60 has been proven. Anti-idiotypic antibodies possessing C. trachomatis anti-HSP-60 activity and being one of the causes of false negative results of the relevant ELISA-based tests have been identified in blood sera of individuals infected with chlamydial genitourinary infection agents.

  9. Glycidyl methacrylate-co-N-vinyl-2-pyrrolidone coated polypropylene strips: Synthesis, characterization and standardization for dot-enzyme linked immunosorbent assay

    Tyagi, Charu; Tomar, Lomas [Centre for Biomedical Engineering, Indian Institute of Technology, Delhi 110016 (India); Singh, Harpal [Centre for Biomedical Engineering, Indian Institute of Technology, Delhi 110016 (India)], E-mail:


    Glycidyl methacrylate and N-vinyl-2-pyrrolidone (GMA-co-NVP) copolymers with various GMA:NVP ratios were synthesized by solution polymerization technique in toluene using 2,2'-azobisisobutyronitrile (AIBN) as free radical initiator and dip coated onto polypropylene strips. The copolymer composition in polymeric coatings was confirmed by proton NMR spectroscopy. Various techniques like FTIR, SEM and contact angle were used for surface characterization of the polymer coatings. These polymer coated strips were evaluated and standardized for their application in dot-ELISA in two steps. In first step, specificity, sensitivity and reproducibility of the assay on developed polymer coated strips was evaluated through a model system using rabbit anti-goat IgG, goat anti-rabbit IgG and goat anti-rabbit IgG HRP (horseradish peroxidase)-conjugate. Polymer coating with GMA-NVP mol% ratio of 78:22 was able to detect rabbit anti-goat IgG antibody at a concentration as low as 2 ng mL{sup -1} with 1% BSA as blocking agent using antispecies IgG peroxidase conjugate diluted 1500 times. In the second step, the sensitivity and specificity of the developed system was established with human blood and finally used to identify the source of mosquito blood meal which is an important parameter in epidemiological studies, particularly in determining the role of mosquito in malaria transmission. The time duration of standardized assay with developed polymer coated strips was cut down to one hour compared to the 3-4 h required in usual dot-ELISA.

  10. Development of an enzyme-linked immunosorbent assay (ELISA)-like fluorescence assay to investigate the interactions of glycosaminoglycans to cells

    Boucas, Rodrigo Ippolito [Disciplina de Biologia Molecular, Departamento de Bioquimica, Universidade Federal de Sao Paulo, SP (Brazil); Trindade, Edvaldo S. [Disciplina de Biologia Molecular, Departamento de Bioquimica, Universidade Federal de Sao Paulo, SP (Brazil); Departamento de Biologia Celular, Universidade Federal do Parana, Curitiba, Parana (Brazil); Tersariol, Ivarne L.S. [Disciplina de Biologia Molecular, Departamento de Bioquimica, Universidade Federal de Sao Paulo, SP (Brazil); Centro Interdisciplinar de Investigacao Bioquimica, Universidade de Mogi das Cruzes, Mogi das Cruzes, SP (Brazil); Dietrich, Carl P. [Disciplina de Biologia Molecular, Departamento de Bioquimica, Universidade Federal de Sao Paulo, SP (Brazil); Nader, Helena B. [Disciplina de Biologia Molecular, Departamento de Bioquimica, Universidade Federal de Sao Paulo, SP (Brazil)], E-mail:


    Sulfated glycosaminoglycans were labeled with biotin to study their interaction with cells in culture. Thus, heparin, heparan sulfate, chondroitin 4-sulfate, chondroitin 6-sulfate and dermatan sulfate were labeled using biotin-hydrazide, under different conditions. The structural characteristics of the biotinylated products were determined by chemical (molar ratios of hexosamine, uronic acid, sulfate and biotin) and enzymatic methods (susceptibility to degradation by chondroitinases and heparitinases). The binding of biotinylated glycosaminoglycans was investigated both in endothelial and smooth muscle cells in culture, using a novel time resolved fluorometric method based on interaction of europium-labeled streptavidin with the biotin covalently linked to the compounds. The interactions of glycosaminoglycans were saturable and number of binding sites could be obtained for each individual compound. The apparent dissociation constant varied among the different glycosaminoglycans and between the two cell lines. The interactions of the biotinylated glycosaminoglycans with the cells were also evaluated using confocal microscopy. We propose a convenient and reliable method for the preparation of biotinylated glycosaminoglycans, as well as a sensitive non-competitive fluorescence-based assay for studies of the interactions and binding of these compounds to cells in culture.

  11. Development of an enzyme-linked immunosorbent assay (ELISA)-like fluorescence assay to investigate the interactions of glycosaminoglycans to cells

    Boucas, Rodrigo Ippolito; Trindade, Edvaldo S.; Tersariol, Ivarne L.S.; Dietrich, Carl P.; Nader, Helena B.


    Sulfated glycosaminoglycans were labeled with biotin to study their interaction with cells in culture. Thus, heparin, heparan sulfate, chondroitin 4-sulfate, chondroitin 6-sulfate and dermatan sulfate were labeled using biotin-hydrazide, under different conditions. The structural characteristics of the biotinylated products were determined by chemical (molar ratios of hexosamine, uronic acid, sulfate and biotin) and enzymatic methods (susceptibility to degradation by chondroitinases and heparitinases). The binding of biotinylated glycosaminoglycans was investigated both in endothelial and smooth muscle cells in culture, using a novel time resolved fluorometric method based on interaction of europium-labeled streptavidin with the biotin covalently linked to the compounds. The interactions of glycosaminoglycans were saturable and number of binding sites could be obtained for each individual compound. The apparent dissociation constant varied among the different glycosaminoglycans and between the two cell lines. The interactions of the biotinylated glycosaminoglycans with the cells were also evaluated using confocal microscopy. We propose a convenient and reliable method for the preparation of biotinylated glycosaminoglycans, as well as a sensitive non-competitive fluorescence-based assay for studies of the interactions and binding of these compounds to cells in culture

  12. Eosinophil protein X/eosinophil derived neurotoxin (EPX/EDN). Detection by enzyme-linked immunosorbent assay and purification from normal human urine

    Reimert, C M; Minuva, U; Kharazmi, A


    Eosinophil protein X/eosinophil derived neurotoxin (EPX/EDN) is one of the cationic proteins found in the granules of the human eosinophilic granulocytes. EPX was purified from extracts of granules isolated from blood buffy coat cells of healthy donors. Polyclonal anti-EPX antibodies were...

  13. Comparison of IgM Capture Enzyme- Linked Immunosorbent Assay (ELISA) using Inhouse method and commercially available MRL kit for serological confirmation of dengue infection

    Hapugoda, D.M.; De Silva R, Nilanthi; Abeywickreme, W.; Gunasena, Sunethra; Prithimala, L.D.; Jayawardene, S.L.G.J.; Kumari, Thamara


    Laboratory diagnosis of dengue infection is important for the management of the patients. In this study igM capture ELISA using an inhouse method and commercially available kit (MRL diagnostics,USA) was compared to detect diagnostic capability of Inhouse IgM ELISA for provision of diagnostic facilities to the public at an affordable cost. Eighty acute and convalescent serum samples were collected from serologically confirmed dengue patients. Serological confirmation of patients were performed by Haemagglutination Inhibition (HI) assay, gold standard assay for dengue on paired serum samples. All collected acute and convalescent sera were tested by IgM ELISA using the inhouse method and MRL kit. Antigen and conjugate for the inhouse IgM method were prepared in the laboratory. A cocktail of four dengue antigens containing 25 Antigen ELISA units of each type was prepared and used as the assay antigen. Conjugate was prepared using a serum sample with high dengue Anti flavi IgG antibody titre conjugated with Horseradish peroxidase. A prospective study of both IgM ELISA assays were performed using 113 acute sera collected from dengue suspected cases. Overall results showed that 46% and 52% acute sera collected from dengue confirmed patients were positive by inhouse ELISA assay and MRL kits respectively. In the prospective study done using acute sera collected from dengue suspected patients showed that 44% and 52% were positive by inhouse ELISA assay and MRL kits. There was no significant difference in positivity between these two assays. (P=0.18). Inhouse IgM ELISA can be used for provision of laboratory diagnosis of dengue virus infection more than 5 days. The assay is 10 times less costly than using MRL kits as assay antigen and conjugate can be prepared easily in the laboratory


    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...


    Muflikhah, Nina Difla; Artama, Wayan Tunas


    Toxoplasmosis is an infectious disease caused by Toxoplasma gondii, an intracellular protozoan parasite that live inside the cells of the reticulo endothelial and parenchymal cells of human and animals (mammals and birds). Some cases of toxoplasmosis usually have no symptoms, but in any cases caused severe symptoms, such as hydrocephalus, microcephalus, intracranial calcification, retinal damage, brain abscess, mental retardation, lymphadenopathy, and others. Its severe symptoms usually showe...

  16. The immune monitoring of pediatric organ transplants : potential role of soluble CD30 plasma measurement and granzyme B enzyme-linked immunosorbent assay

    Truong, Quang Dinh


    Over the last half century, kidney and liver transplantation have been recognized as the treatment of choice for children with end-stage renal or liver failure. Greater understanding of the molecular mechanism of rejection and tolerance, as well as development of reliable assays that can measure accurately the status of the immune response, not only would help clinicians customize the prescription of immunosuppressive drugs in individual recipients, but also might contribute to optimization o...

  17. Comparison of a commercial ELISA and an immunoperoxidase monolayer assay to detect antibodies directed against porcine respiratory and reproductive syndrome virus

    Nodelijk, G.; Wensvoort, G.; Kroese, B.; Leengoed, van L.A.M.G.; Colijn, E.; Verheijden, J.H.M.


    A commercially available enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies against porcine respiratory and reproductive syndrome virus (PRRSV) was compared to an immunoperoxidase monolayer assay (IPMA). Serum samples used were collected from pigs experimentally infected with

  18. Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry.

    Bayraç, Ceren; Öktem, Hüseyin Avni


    To monitor the specificity of Staphylococcus aureus aptamer (SA-31) against its target cell, we used enzyme-linked aptamer assay. In the presence of target cell, horseradish peroxidase-conjugated streptavidin bound to biotin-labeled SA-31 showed specific binding to S  aureus among 3 different bacteria with limit of detection of 10 3 colony-forming unit per milliliter. The apparent K a was 1.39 μM -1  ± 0.3 μM -1 . The binding of SA-31 to membrane proteins extracted from cell surface was characterized using isothermal titration calorimetry, and the effect of changes in binding temperature and salt concentrations of binding buffer was evaluated based on thermodynamic parameters (K a , ΔH, and ΔG). Since binding of aptamer to its targets solely depends on its 3-dimensional structure under experimental conditions used in selection process, the change in temperature and ion concentration changed the affinity of SA-31 to its target on surface of bacteria. At 4°C, SA-31 did not show an affinity to its target with poor heat change upon injection of membrane fraction to aptamer solution. However, the apparent association constants of SA-31 slightly varied from K a  = 1.56 μM -1  ± 0.69 μM -1 at 25°C to K a  = 1.03 μM -1  ± 0.9 μM -1 at 37°C. At spontaneously occurring exothermic binding reactions, affinities of S aureus aptamer to its target were also 9.44 μM -1  ± 0.38 μM -1 at 50mM, 1.60 μM -1  ± 0.11 μM -1 at 137mM, and 3.28 μM -1  ± 0.46 μM -1 at 200 mM of salt concentration. In this study, it was demonstrated that enzyme-linked aptamer assay and isothermal titration calorimetry were useful tools for studying the fundamental binding mechanism between a DNA aptamer and its target on the outer surface of S aureus. Copyright © 2016 John Wiley & Sons, Ltd.

  19. Estimation of transfused red cell survival using an enzyme-linked antiglobulin test

    Kickler, T.S.; Smith, B.; Bell, W.; Drew, H.; Baldwin, M.; Ness, P.M.


    An enzyme-linked antiglobulin test (ELAT) method was developed to estimate survival of transfused red cells. This procedure is based on a principle analogous to that of the Ashby technique were antigenically distinct red cells are transfused and their survival studied. The authors compared the ELAT survival to the 51 Chromium method ( 51 Cr) in four patients. Three patients with hypoproliferative anemias showed T 1/2 by ELAT of 17.5, 18, and 17 days versus 18.5, 20, and 19 days by the 51 Cr method. A fourth patient with traumatic cardiac hemolysis had two studies performed. In this case, the ELAT showed a T 1/2 of 10 and 8.1 days while 51 Cr T 1/2 values were 11 and 10.5 days. The ELAT method for measuring red cell survival yielded data which agreed closely with the results of the 51 Cr method. Although 51 Cr is the accepted method for red cell survival, the ELAT method can be used to estimate transfused red cell survival

  20. Evaluation and comparison of radio-, fluorescence, and enzyme-linked immunoassays for serum thyroxine

    Kaplan, L.A.; Gau, N.; Fearn, J.; Steain, E.A.; Chen, I.W.; Maxon, H.; Volle, C.


    We have compared three analytical systems for the measurement of serum thyroxine: enzyme-linked immunoassay (EIA), fluorescent immunoassay (FIA) and a radioimmunoassay (RIA). These were evaluated with respect to their precision, accuracy, analytical sensitivity and sample throughput. The RIA is more sensitive than the EIA (10 μg/L vs. 35 μg/L). Both systems have excellent precision (X=86 μg/L, C.V.sub(RIA)=C.V.sub(EIA)=4.6 percent). Both the EIA and RIA demonstrate good accuracy with recovery of between 97-98 percent of added thyroxine. The FIA has an apparent sensitiviity between that of the RIA and EIA (25 μg/L), but a precision consistently lower than the other two systems (C.V. =7.4 percent, X=86 μg/L). Patients' results by RIA compared well with those from EIA (r=0.91,P 0.05). Although not fully automated, the EIA performed on the Abbott ABA-100 analyzer has a sample throughput equal to the automated RIA system (Micromedic, Concept 4)

  1. Evaluation of an enzyme-linked immunoelectrotransfer blot test for the confirmatory serodiagnosis of human toxocariasis

    William H Roldán


    Full Text Available To improve the serodiagnosis of human toxocariasis, a sensitive and specific enzyme-linked immunoelectrotransfer blot (EITB-IgG test was developed and evaluated using Toxocara canislarvae excretory-secretory antigens for detecting anti-Toxocara IgG antibodies. The EITB-IgG profile of toxocariasis was characterized by comparing 27 sera from patients with toxocariasis, 110 sera from healthy subjects and 186 sera from patients with other helminth diseases (ascariasis, ancylostomiasis, trichuriasis, enterobiasis, strongyloidiasis, hymenolepiasis, diphyllobothriasis, taeniasis, cysticercosis, hydatidosis and fascioliasis. Antigenic bands of 24, 28, 30, 35, 56, 117, 136 and 152 kDa were predominantly recognized in sera from all patients with toxocariasis. However, only bands of 24-35 kDa were highly specific for Toxocara infection (98.3%, whereas other antigenic bands observed displayed cross-reactivity. Additionally, when the results of the EITB-IgG test were compared to those of the ELISA-IgG test, a 100% concordance was observed for positive results in human toxocariasis cases. The concordance for negative results between the two tests for healthy subjects and patients with other helminth diseases were 96.3% and 53.7%, respectively, showing that the EITB-IgG test has a higher specificity than ELISA. In conclusion, the EITB-IgG test is a very useful tool to confirm the serological diagnosis of human toxocariasis.

  2. Design considerations of a hollow microneedle-optofluidic biosensing platform incorporating enzyme-linked assays

    Ranamukhaarachchi, Sahan A.; Padeste, Celestino; Häfeli, Urs O.; Stoeber, Boris; Cadarso, Victor J.


    A hollow metallic microneedle is integrated with microfluidics and photonic components to form a microneedle-optofluidic biosensor suitable for therapeutic drug monitoring (TDM) in biological fluids, like interstitial fluid, that can be collected in a painless and minimally-invasive manner. The microneedle inner lumen surface is bio-functionalized to trap and bind target analytes on-site in a sample volume as small as 0.6 nl, and houses an enzyme-linked assay on its 0.06 mm2 wall. The optofluidic components are designed to rapidly quantify target analytes present in the sample and collected in the microneedle using a simple and sensitive absorbance scheme. This contribution describes how the biosensor components were optimized to detect in vitro streptavidin-horseradish peroxidase (Sav-HRP) as a model analyte over a large detection range (0-7.21 µM) and a very low limit of detection (60.2 nM). This biosensor utilizes the lowest analyte volume reported for TDM with microneedle technology, and presents significant avenues to improve current TDM methods for patients, by potentially eliminating blood draws for several drug candidates.

  3. Quantification of patient specific assay interference in different formats of enzyme linked immunoassays for therapeutic monoclonal antibodies

    Grebenchtchikov, N.J.; Geurts-Moespot, A.; Heijmen, L.; Laarhoven, H.W.M. van; Herpen, C.M.L. van; Thijs, A.M.J.; Span, P.N.; Sweep, F.C.


    BackgroundThe use of therapeutic monoclonal antibodies for clinical purposes has significantly increased in recent years, and so has the need to monitor antibody concentrations. This may be achieved using the well-established enzyme linked immunoassay (ELISA) methods; however, these assays are

  4. Quantification of patient-specific assay interference in different formats of enzyme-linked immunoassays for therapeutic monoclonal antibodies

    Grebenchtchikov, Nicolai; Geurts-Moespot, Anneke J.; Heijmen, Linda; van Laarhoven, Hanneke W. M.; van Herpen, Carla M. L.; Thijs, Annemarie M. J.; Span, Paul N.; Sweep, Fred C. G. J.


    The use of therapeutic monoclonal antibodies for clinical purposes has significantly increased in recent years, and so has the need to monitor antibody concentrations. This may be achieved using the well-established enzyme linked immunoassay (ELISA) methods; however, these assays are subject to a

  5. Sources of variation in an enzyme-linked immunoassay of bluetongue virus in Culicoides variipennis (Diptera: Ceratopogonidae).

    Tabachnick, W J; Mecham, J O


    An enzyme-linked immunoassay for detecting bluetongue virus in infected Culicoides variipennis was evaluated using a nested analysis of variance to determine sources of experimental error in the procedure. The major source of variation was differences among individual insects (84% of the total variance). Storing insects at -70 degrees C for two months contributed to experimental variation in the ELISA reading (14% of the total variance) and should be avoided. Replicate assays of individual insects were shown to be unnecessary, since variation among replicate wells and plates was minor (2% of the total variance).

  6. Improvement of an enzyme immunosorbent assay for detecting antibodies against Dioctophyma renale.

    Pedrassani, Daniela; do Nascimento, Adjair Antonio; André, Marcos Rogério; Machado, Rosangela Zacarias


    An available enzyme-linked immunosorbent assay (ELISA) was studied for the detection of anti-Dioctophyma renale antibodies in the sera of dogs using, detection of parasite eggs in urine sediment as a reference test. ELISA uses a soluble antigenic preparation of esophagus of D. renale and the optimal dilutions of the antigen, serum and conjugate were determined by means of checker board titration, using positive (n=13) and negative (n=27) reference serum. The specificity and sensitivity of the ELISA were 93.8% and 92.3% respectively and the kappa index was good (0.76). These results suggest that ELISA described may prove to be an effective serological test for detecting dogs infected and exposed to this parasite mainly dogs that are not eliminating parasite eggs through their urine. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Development of a monoclonal-based enzyme-linked immunoassay for saxitoxin-induced protein.

    Smith, D S; Kitts, D D


    A monoclonal antibody was generated against saxitoxin-induced protein (SIP) from the small shore crab Hemigrapsus oregenesis. SIP was induced by saxitoxin injection and could be detected in the crude crab extracts with both polyclonal and monoclonal antibody preparations. On Western blots, the polyclonal serum reacted against several bands which were induced by saxitoxin in the crude extracts. These bands represented proteins related to SIP. The monoclonal (4G5), however, was specific for the 79,000 mol. wt subunit of SIP. A triple antibody sandwich ELISA was developed in which polyclonal anti-SIP IgG was used as a trapping layer and monoclonal 4G5 was used as the detection layer. This assay was shown to be more specific and more accurate than a direct bind assay which employed the polyclonal antiserum alone. Although the polyclonal serum was more sensitive than the monoclonal on Western blots, the triple antibody sandwich and direct bind ELISAs were of comparable sensitivity.

  8. Synthesis-based approach toward direct sandwich immunoassay for ciguatoxin CTX3C.

    Oguri, Hiroki; Hirama, Masahiro; Tsumuraya, Takeshi; Fujii, Ikuo; Maruyama, Megumi; Uehara, Hisatoshi; Nagumo, Yoko


    Ciguatoxins are the major causative toxins of ciguatera seafood poisoning. Limited availability of ciguatoxins has hampered the development of a reliable and specific immunoassay for detecting these toxins in contaminated fish. Monoclonal antibodies (mAbs) specific against both ends of ciguatoxin CTX3C were prepared by immunization of mice with protein conjugates of rationally designed synthetic haptens, 3 and 4, in place of the natural toxin. Haptenic groups that possess a surface area larger than 400 A(2) were required to produce mAbs that can bind strongly to CTX3C itself. A direct sandwich enzyme-linked immunosorbent assay (ELISA) using these mAbs was established to detect CTX3C at the ppb level with no cross-reactivity against other related marine toxins, including brevetoxin A, brevetoxin B, okadaic acid, or maitotoxin.

  9. enzyme-linked

    The precipitate was redissolved in 500 ml 0,05M tris-O, IM NaCI buffer, pH 8,0 ... Sheep were immunized by intramuscular injection at multiple sites with 50 J.. ..... Holubar K, \\X'ick G, eds.lmmunofluorescence und Refuted Swilling Techniques.

  10. [IFN-gamma enzyme-linked immunospot assay versus PPD tuberculin skin test in the diagnosis of tuberculous epididymitis].

    Huang, Hao; Yang, Xi-Fei; Deng, Qun-Yi; Li, Bing; Liu, Guo-Hui; Zhang, Jie-Yun; Yang, Da-Fei


    To explore the potential application of IFN-gamma enzyme-linked immunospot (ELISPOT) assay in the diagnosis of tuberculous epididymitis (TE) by comparing ELISPOT assay with the traditional purified protein derivative (PPD) tuberculin skin test. We examined 13 TE patients using an in-house ELISPOT kit, another 11 TE patients by PPD skin testing, and 57 healthy male volunteers by parallel test with both the methods. Twelve (92.3%) of the 13 TE cases were positive on ELISPOT assay, and 10 (90.9%) of the 11 TE cases positive on PPD skin test, with no statistically significant differences between the two groups (P > 0.05). Among the 57 healthy male volunteers, 8 (14.0%) were positive on ELISPOT, and 28 (49.1%) positive on PPD test, the latter significantly higher than the former (P PPD test in the examination of tuberculous epididymitis. As for specificity, ELISPOT assay seems better than PPD test in differentiating tuberculous epididymitis patients from healthy males.

  11. Antibody-based enzyme-linked lectin assay (ABELLA) for the sialylated recombinant human erythropoietin present in culture supernatant.

    Kim, Hyoung Jin; Lee, Seung Jae; Kim, Hong-Jin


    The terminal sialic acid of human erythropoietin (hEPO) is essential for in vivo activity. The current resorcinol and HPLC methods for analyzing alpha2,3-linked sialic acid require more than a microgram of purified rhEPO, and purification takes a great deal of time and labor. In this study, we assessed the use of an antibody-based enzyme-linked lectin assay (ABELLA) for analyzing non-purified recombinant hEPO (rhEPO). The major problem of this method was the high background due to terminal sialylation of components of the assay (antibody and bovine serum albumin) other than rhEPO. To solve this problem, we used a monoclonal antibody (Mab 287) to capture the rhEPO, and oxidized the bovine serum albumin used for blocking with meta-periodate. The sialic acid content of non-purified rhEPO measured by ABELLA was similar to that obtained by the resorcinol method on purified rhEPO. ABELLA has advantages such as adaptability and need for minimal amounts of rhEPO (40 ng/ml). Our observations suggest that ABELLA should reduce the time and labor needed to improve culture conditions so as to increase protein sialylation, and also facilitate the study of sialylation mechanisms.

  12. An enzyme-linked immuno-filtration assay used to compare infant and maternal antibody profiles in toxoplasmosis.

    Pinon, J M; Thoannes, H; Gruson, N


    Enzyme-linked immuno-filtration assay is carried out on a micropore membrane. This doubly analytical technique permits simultaneous study of antibody specificity by immunoprecipitation and characterisation of antibody isotypes by immuno-filtration with enzyme-labelled antibodies. Recognition of the same T. gondii antigenic constituent by IgG, IgA, IgM or IgE antibodies produces couplets (IgG-IgM; IgG-IgA) or triplets (IgG-IgM-IgA; IgG-IgM-IgE) which identify the functional fractions of the toxoplasmosis antigen. In acquired toxoplasmosis, the persistence of IgM antibody long after infestation puts in question the implication of recent infestation normally linked to detection of this isotype. For sera of comparable titres, comparison of immunological profiles by the method described demonstrates disparities in the composition of the specific antibody content as expressed in international units. Use of the same method to detect IgM antibodies or distinguish between transmitted maternal IgG and IgG antibodies synthesised by the foetus or neonate makes a diagnosis of congenital toxoplasmosis possible in 85% of cases during the first few days of life. With the method described the diagnosis may be made on average 5 months earlier than with classical techniques. In the course of surveillance for latent congenital toxoplasmosis, the appearance of IgM or IgE antibodies raises the possibility of complications (hydrocephalus, chorioretinitis). After cessation of treatment, a rise in IgG antibodies indicating persistence of infection is detected earlier by the present than by classical methods.

  13. Antibody Banding Patterns of the Enzyme-Linked Immunoelectrotransfer Blot and Brain Imaging Findings in Patients With Neurocysticercosis.

    Arroyo, Gianfranco; Rodriguez, Silvia; Lescano, Andres G; Alroy, Karen A; Bustos, Javier A; Santivañez, Saul; Gonzales, Isidro; Saavedra, Herbert; Pretell, E Javier; Gonzalez, Armando E; Gilman, Robert H; Tsang, Victor C W; Garcia, Hector H


    The enzyme-linked immunoelectrotransfer blot (EITB) assay is the reference serological test for neurocysticercosis (NCC). A positive result on EITB does not always correlate with the presence of active infections in the central nervous system (CNS), and patients with a single viable brain cyst may be EITB negative. Nonetheless, EITB antibody banding patterns appears to be related with the expression of 3 protein families of Taenia solium, and in turn with the characteristics of NCC in the CNS (type, stage, and burden of viable cysts). We evaluated EITB antibody banding patterns and brain imaging findings of 548 NCC cases. Similar banding patterns were grouped into homogeneous classes using latent class analysis. The association between classes and brain imaging findings was assessed. Four classes were identified. Class 1 (patients negative or only positive to the GP50 band, related to the protein family of the same name) was associated with nonviable or single viable parenchymal cysticerci; class 2 (patients positive to bands GP42-39 and GP24, related to the T24-42 protein family, with or without anti-GP50 antibodies) was associated with intraparenchymal viable and nonviable infections; classes 3 and 4 (positive to GP50, GP42-39, and GP24 but also responding to low molecular weight bands GP21, GP18, GP14, and GP13, related to the 8 kDa protein family) were associated with extraparenchymal and intraparenchymal multiple viable cysticerci. EITB antibody banding patterns correlate with brain imaging findings and complement imaging information for the diagnosis of NCC and for staging NCC patients. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail:

  14. Functional evaluation of carbohydrate-centred glycoclusters by enzyme-linked lectin assay: ligands for concanavalin A.

    Köhn, Maja; Benito, Juan M; Ortiz Mellet, Carmen; Lindhorst, Thisbe K; García Fernández, José M


    The affinities of the mannose-specific lectin concanavalin A (Con A) towards D-glucose-centred mannosyl clusters differing in the anomeric configuration of the monosaccharide core, nature of the bridging functional groups and valency, have been measured by a competitive enzyme-linked lectin assay. Pentavalent thioether-linked ligands (5 and 7) were prepared by radical addition of 2,3,4,6-tetra-O-acetyl-1-thio-alpha-D-mannopyranose to the corresponding penta-O-allyl-alpha- or -beta-D-glucopyranose, followed by deacetylation. The distinct reactivity of the anomeric position in the D-glucose scaffold was exploited in the preparation of a tetravalent cluster (10) that keeps a reactive aglyconic group for further manipulation, including incorporation of a reporter group or attachment to a solid support. Hydroboration of the double bonds in the penta-O-allyl-alpha-D-glucopyranose derivative and replacement of the hydroxy groups with amine moieties gave a suitable precursor for the preparation of pentavalent and 15-valent mannosides through the thiourea-bridging reaction (17 and 20, respectively). The diastereomeric 1-thiomannose-coated clusters 5 and 7 were demonstrated to be potent ligands for Con A, with IC(50) values for the inhibition of the Con A-yeast mannan association indicative of 6.4- and 5.5-fold increases in binding affinity (valency-corrected values), respectively, relative to the value for methyl alpha-D-mannopyranoside. The tetravalent cluster 10 exhibited a valency-corrected relative lectin-binding potency virtually identical to that of the homologous pentavalent mannoside 7. In sharp contrast, replacement of the 1-thiomannose wedges of 5 with alpha-D-mannopyranosylthioureido units (17) virtually abolished any multivalent or statistic effects, with a dramatic decrease of binding affinity. The 15-valent ligand 20, possessing classical O-glycosidic linkages, exhibited a twofold increase in lectin affinity relative to the penta-O-(thioglycoside) 5; it is

  15. A simplification of the enzyme-linked immunospot technique. Increased sensitivity for cells secreting IgG antibodies to Haemophilus influenzae type b capsular polysaccharide

    Barington, T; Sparholt, S; Juul, L


    A simplified enzyme-linked immunospot (ELISPOT) technique is described for the detection of cells secreting antibodies to tetanus toxoid (TT), diphtheria toxoid (DT) or Haemophilus influenzae type b capsular polysaccharide (PRP). By combining the cell suspension with the enzyme-linked secondary...... antibodies in one incubation, the second incubation and washing procedure could be omitted from the original technique. The simplified assay had the same sensitivity for anti-TT and anti-DT spot-forming cells as the ordinary ELISPOT assay. The IgG anti-PRP spots were, however, improved both in quality...... and in quantity (median: 40% more spots), while the detection of IgM and IgA anti-PRP spot-forming cells was the same in the two techniques. This simplified technique can probably also be used to save time in other antigen systems and should be considered when designing ELISPOT assays for the detection...

  16. Evaluation of a novel enzyme-linked immunosorbent assay for detection of antibodies against Salmonella, employing a stable coating of lipopolysaccharide-derived antigens covalently attached to polystyrene microwells

    Wiuff, C.; Jauho, E. S.; Stryhn, H.


    to microtiter polystyrene plates by ultraviolet irradiation. Both polysaccharide antigens could be coupled simultaneously to the same microtiter plate. The coated surface was used in indirect ELISA for the determination of serum antibodies from pigs infected with bacteria of the two Salmonella groups and from......Polysaccharides derived from Salmonella typhimurium lipopolysaccharide (LPS) representing the O-antigen factors 1, 4, 5, and 12 and the O-antigen factors 6 and 7 from Salmonella choleraesuis LPS were derivatized with the photoreactive compound anthraquinone and subsequently covalently coupled...

  17. The serologic response to Salmonella enteritidis and Salmonella typhimurium in experimentally infected chickens, followed by an indirect lipopolysaccharide enzyme-linked immunosorbent assay and bacteriologic examinations through a one-year period

    Skov, M.N.; Feld, Niels Christian; Carstensen, B.


    Three groups of 100 individually marked salmonella-free chickens were followed for a period of 53 wk. The chickens were infected as day olds by crop instillation of 101 colony-forming units: one group with Salmonella enteritidis and a second group with Salmonella typhimurium. A third group was kept...... in surveillance programs, in particular to detect flocks in early stages of infection before a measurable serologic response has been raised....

  18. One-year enzyme-linked immunosorbent assay follow-up of human interleukin for Da cells/leukemia inhibitory factor in blood and urine of 22 kidney transplant recipients.

    Morel, D; Taupin, J L; Combe, C; Potaux, L; Gualde, N; Moreau, J F


    The cytokine human interleukin for Da cells/leukemia inhibitory factor (HILDA/LIF) exerts multiple biological effects in vitro. In mice, high circulating levels of HILDA/LIF induce a wide range of pathophysiological events, some of them closely involved with immunological and inflammatory responses. Using a sandwich ELISA recognizing the natural human HILDA/LIF molecule with a threshold of 50 pg/ml in urine and 150 pg/ml in plasma, we monitored the urine and plasma HILDA/LIF levels of 22 patients in their first year after a kidney transplant. HILDA/LIF urine excretion is increased during acute rejection, and infections also trigger heavy HILDA/LIF plasma concentrations or urine excretion. In addition, this study raises the question of HILDA/LIF involvement in post-kidney-transplant phenomena such as hypercalcemia, osteoporosis, or the reversal of anemia.

  19. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay

    Roeder, Martin; Vieths, Stefan [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany); Holzhauser, Thomas, E-mail: [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany)


    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg{sup -1} almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg{sup -1}. We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg{sup -1} almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg{sup -1}. Further, between 100 and 100,000 mg kg{sup -1} spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n = 5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially quantitative almond detection. This PCR method detects almond at a level where severe allergic reactions should not be expected for the majority of the almond allergic individuals.

  20. Comparison of Measurements of Autoantibodies to Glutamic Acid Decarboxylase and Islet Antigen-2 in Whole Blood Eluates from Dried Blood Spots Using the RSR-Enzyme Linked Immunosorbent Assay Kits and In-House Radioimmunoassays

    Anders Persson


    Full Text Available To evaluate the performance of dried blood spots (DBSs with subsequent analyses of glutamic acid decarboxylase (GADA and islet antigen-2 (IA-2A with the RSR-ELISAs, we selected 80 children newly diagnosed with type 1 diabetes and 120 healthy women. DBSs from patients and controls were used for RSR-ELISAs while patients samples were analysed also with in-house RIAs. The RSR-ELISA-GADA performed well with a specificity of 100%, albeit sensitivity (46% was lower compared to in RIA (56%; P=.008. No prozone effect was observed after dilution of discrepant samples. RSR-ELISA-IA-2A achieved specificity of 69% and sensitivity was lower (59% compared with RIA (66%; P<.001. Negative or low positive patients and control samples in the RSR-ELISA-IA-2A increased after dilution. Eluates from DBS can readily be used to analyse GADA with the RSR-ELISA, even if low levels of autoantibodies were not detected. Some factor could disturb RSR-ELISA-IA-2A analyses.

  1. Serum antibodies from a subset of horses positive for babesia caballi by competitive enzyme-linked immunosorbent assay demonstrate a protein recognition pattern that is not consistent with infection

    Tick-borne pathogens that cause persistent infection are of major concern to the livestock industry because of transmission risk from persistently infected animals and the potential economic losses they pose. The recent re-emergence of Theileria equi in the U.S. prompted widespread national surveill...

  2. Development of a Chlamydia suis-specific antibody enzyme-linked immunosorbent assay based on the use of a B-cell epitope of the polymorphic membrane protein C.

    De Puysseleyr, K; Kieckens, E; De Puysseleyr, L; Van den Wyngaert, H; Ahmed, B; Van Lent, S; Creasy, H H; Myers, G S A; Vanrompay, D


    Chlamydia suis infections lead to economic loss in the pork industry. Chlamydia suis infections could be successfully treated with tetracyclines until the appearance of a tetracycline resistant phenotype, which was acquired via horizontal gene transfer of the tet(C) gene. Given the importance of C. suis as a swine pathogen and as a recently emerged tetracycline resistant pathogen with zoonotic potential, our aim was to develop a sensitive C. suis-specific antibody ELISA based on the polymorphic membrane proteins (Pmps). Chlamydia Pmps are important virulence factors and candidate antigens for serodiagnosis. We identified nine Pmps (PmpA to I) in C. suis strain MD56 using a recently developed Hidden-Markov model. PmpC was the most promising candidate for the development of a C. suis-specific antibody ELISA as the protein was absent in C. abortus, C. pecorum and C. psittaci which also infect pigs and as the protein contained C. suis-specific amino acid regions, absent in C. trachomatis PmpC. We identified an immunodominant B-cell epitope in C. suis PmpC using experimental porcine sera. The sensitivity and specificity of the PmpC ELISA was compared to the complement fixation test (CFT) and to a recombinant MOMP ELISA using experimental sera. The PmpC ELISA detected all positive control sera and was in contrast to CFT and the rMOMP ELISA 100% C. suis specific as positive control sera against other Chlamydia species did not react in the PmpC ELISA. The test was successfully validated using slaughterhouse sera and sera from clinically affected pigs. The PmpC ELISA could assist in diminishing the spread of C. suis infections in the pork industry. © 2018 Blackwell Verlag GmbH.

  3. Development and validation of an enzyme-linked immunosorbent assay for the quantification of a specific MMP-9 mediated degradation fragment of type III collagen--A novel biomarker of atherosclerotic plaque remodeling

    Barascuk, Natasha; Vassiliadis, Efstathios; Larsen, Lise


    Degradation of collagen in the arterial wall by matrix metalloproteinases is the hallmark of atherosclerosis. We have developed an ELISA for the quantification of type III collagen degradation mediated by MMP-9 in urine.......Degradation of collagen in the arterial wall by matrix metalloproteinases is the hallmark of atherosclerosis. We have developed an ELISA for the quantification of type III collagen degradation mediated by MMP-9 in urine....

  4. Validation of an enzyme-linked immunosorbent assay screening method and a liquid chromatography-tandem mass spectrometry confirmation method for the identification and quantification of ketamine and norketamine in urine samples from Malaysia.

    Harun, Norlida; Anderson, Robert A; Miller, Eleanor I


    An ELISA and a liquid chromatography-tandem mass spectrometry (LC-MS-MS) confirmation method were developed and validated for the identification and quantitation of ketamine and its major metabolite norketamine in urine samples. The Neogen ketamine microplate ELISA was optimized with respect to sample and enzyme conjugate volumes and the sample preincubation time before addition of the enzyme conjugate. The ELISA kit was validated to include an assessment of the dose-response curve, intra- and interday precision, limit of detection (LOD), and cross-reactivity. The sensitivity and specificity were calculated by comparison to the results from the validated LC-MS-MS confirmation method. An LC-MS-MS method was developed and validated with respect to LOD, lower limit of quantitation (LLOQ), linearity, recovery, intra- and interday precision, and matrix effects. The ELISA dose-response curve was a typical S-shaped binding curve, with a linear portion of the graph observed between 25 and 500 ng/mL for ketamine. The cross-reactivity of 200 ng/mL norketamine to ketamine was 2.1%, and no cross-reactivity was detected with 13 common drugs tested at 10,000 ng/mL. The ELISA LOD was calculated to be 5 ng/mL. Both intra- (n = 10) and interday (n = 50) precisions were below 5.0% at 25 ng/mL. The LOD for ketamine and norketamine was calculated statistically to be 0.6 ng/mL. The LLOQ values were also calculated statistically and were 1.9 ng/mL and 2.1 ng/mL for ketamine and norketamine, respectively. The test linearity was 0-1200 ng/mL with correlation coefficient (R(2)) > 0.99 for both analytes. Recoveries at 50, 500, and 1000 ng/mL range from 97.9% to 113.3%. Intra- (n = 5) and interday (n = 25) precisions between extracts for ketamine and norketamine were excellent (Royal Malaysian Police. Ketamine concentrations detected by LC-MS-MS ranged from 22 to 31,670 ng/mL, and norketamine concentrations ranged from 25 to 10,990 ng/mL. The concentrations of ketamine and norketamine detected in the samples are most ikely indicative of ketamine abuse.

  5. The Rapid Diagnosis of Leptospirosis: A Prospective Comparison of the Dot Enzyme-Linked Immunosorbent Assay and the Genus-Specific Microscopic Agglutination Test at Different Stages of Illness


    reference laboratories. Sim- ting" I liL of leptospiral antigen (770 ng of protein , Lowry pler techniques have been described, but information is...agitated for I win. tive, nonpathogenic antigen J41 - Leptospira b~fexa sero- and incubated for 30 min at room temperature (-.23 C). var Patoc I - to...authors have found that leptospiral test (0) by wetk of illness, expressed in percentage- of antilbodies detected by EI.IS4 appear early 161. There was

  6. Comparison of two 3ABC enzyme-linked immunosorbent assays for diagnosis of multiple-serotype foot-and-mouth disease in a cattle population in an area of endemicity

    Bronsvoort, B.M.D.; Sørensen, K.J.; Anderson, J.


    The development of a serological test for foot-and-mouth disease virus (FMDV) which is quick and easy to use, which can identify all seven serotypes, and which can differentiate vaccinated from convalescing or potential virus carriers would be a major advance in the epidemiological toolkit for FMDV....... The nonstructural polyprotein 3ABC has recently been proposed as such an antigen, and a number of diagnostic tests are being developed. This paper evaluates the performance of two FMDV tests for antibodies to nonstructural proteins in an unvaccinated cattle population from a region of Cameroon with endemic multiple...

  7. Comparison of in-house biotin-avidin tetanus IgG enzyme-linked-immunosorbent assay (ELISA) with gold standard in vivo mouse neutralization test for the detection of low level antibodies.

    Sonmez, Cemile; Coplu, Nilay; Gozalan, Aysegul; Akin, Lutfu; Esen, Berrin


    Detection of anti-tetanus antibody levels is necessary for both determination of the immune status of individuals and also for planning preventive measures. ELISA is the preferred test among in vitro tests however it can be affected by the cross reacting antibodies. A previously developed in-house ELISA test was found not reliable for the antibody levels ≤1.0IU/ml. A new method was developed to detect low antibody levels correctly. The aim of the present study was to compare the results of the newly developed in-house biotin-avidin tetanus IgG ELISA test with the in vivo mouse neutralization test, for the antibody levels ≤1.0IU/ml. A total of 54 serum samples with the antibody levels of three different levels, =0.01IU/ml, 0.01-0.1IU/ml, 0.1-1IU/ml, which were detected by in vivo mouse neutralization test were studied by the newly developed in-house biotin-avidin tetanus IgG ELISA test. Test was validated by using five different concentrations (0.01IU/ml, 0.06IU/ml, 0.2IU/ml, 0.5IU/ml, 1.0IU/ml). A statistically significant correlation (r 2 =0.9967 p=0,001) between in vivo mouse neutralization test and in-house biotin-avidin tetanus IgG ELISA test, was observed. For the tested concentrations intra-assay, inter-assay, accuracy, sensitivity, specificity and coefficients of variations were determined as ≤15%. In-house biotin-avidin tetanus IgG ELISA test can be an alternative method to in vivo mouse neutralization method for the detection of levels ≤1.0IU/ml. By using in-house biotin-avidin tetanus IgG ELISA test, individuals with non protective levels, will be reliably detected. Copyright © 2017. Published by Elsevier B.V.

  8. Assessment of the repeatability and border-plate effects of the B158/B60 enzyme-linked-immunosorbent assay for the detection of circulating antigens (Ag-ELISA) of Taenia saginata.

    Jansen, Famke; Dorny, Pierre; Berkvens, Dirk; Van Hul, Anke; Van den Broeck, Nick; Makay, Caroline; Praet, Nicolas; Gabriël, Sarah


    The monoclonal antibody-based circulating antigen detecting ELISA (B158/B60 Ag-ELISA) has been used elaborately in several studies for the diagnosis of human, bovine and porcine cysticercosis. Interpretation of test results requires a good knowledge of the test characteristics, including the repeatability and the effect of the borders of the ELISA plates. Repeatability was tested for 4 antigen-negative and 5 antigen-positive reference bovine serum samples by calculating the Percentage Coefficient of Variation (%CV) within and between plates, within and between runs, overall, for two batches of monoclonal antibodies and by 2 laboratory technicians. All CV values obtained were below 20% (except one: 24.45%), which indicates a good repeatability and a negligible technician error. The value of 24.45% for indicating the variability between batches of monoclonal antibodies for one positive sample is still acceptable for repeatability measures. Border effects were determined by calculating the %CV values between the inner and outer wells of one plate for 2 positive serum samples. Variability is a little more present in the outer wells but this effect is very small and no significant border effect was found. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman(®) real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay.

    Röder, Martin; Vieths, Stefan; Holzhauser, Thomas


    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg(-1) almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg(-1). We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman(®) probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg(-1) almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg(-1). Further, between 100 and 100,000 mg kg(-1) spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman(®) real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n=5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially quantitative almond detection. This PCR method detects almond at a level where severe allergic reactions should not be expected for the majority of the almond allergic individuals. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay

    Roeder, Martin; Vieths, Stefan; Holzhauser, Thomas


    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg -1 almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg -1 . We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg -1 almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg -1 . Further, between 100 and 100,000 mg kg -1 spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n = 5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially quantitative almond detection. This PCR method detects almond at a level where severe allergic reactions should not be expected for the majority of the almond allergic individuals.

  11. Use of recombinant nucleoproteins in enzyme-linked immunosorbent assays for detection of virus-specific immunoglobulin A (IgA) and IgG antibodies in influenza virus A- or B-infected patients

    J. Groen (Jan); D. van Alphen; E.C.J. Claas (Eric); R. de Groot (Ronald); G.F. Rimmelzwaan (Guus); J.T.M. Voeten; A.D.M.E. Osterhaus (Albert)


    textabstractThe nucleoprotein genes of influenza virus A/Netherlands/018/94 (H3N2) and influenza virus B/Harbin/7/94 were cloned into the bacterial expression vector pMalC to yield highly purified recombinant influenza virus A and B nucleoproteins. With these recombinant influenza

  12. Detection of single nucleotide polymorphisms in p53 mutation hotspots and expression of mutant p53 in human cell lines using an enzyme-linked electrochemical assay

    Horáková Brázdilová, Petra; Šimková, Eva; Vychodilová, Zdenka; Brázdová, Marie; Fojta, Miroslav


    Roč. 21, č. 15 (2009), s. 1723-1729 ISSN 1040-0397 R&D Projects: GA ČR(CZ) GA203/07/1195; GA AV ČR(CZ) IAA400040901; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : enzyme-linked electrochemical assay * SNP typing * p53 mutation Subject RIV: AQ - Safety, Health Protection, Human - Machine Impact factor: 2.630, year: 2009

  13. A new method for the production of a magnetic immunosorbent used in radioimmunoassay and immunoradiometric assay

    Toth, G.; Keszei, V.; Sarandi, I.


    A method has been developed enabling the direct coupling of first or second antibody to finely dispersed magnetite (Fe 3 O 4 ). The immunosorbent thus produced was applied in various radioimmunoassay systems (T3, T4, TSH, Cortisol) for the separation of bound and free antigens. The elimination of the need for 'precoating' the magnetic particles with a polymer as several advantages. One of them lies in the ease of one-step production of the immunosorbent and other is the high antibody/magnetic ratio. The influence of the concentration of the immunosorbent and detergent (TWEEN 20 or TRITON X-100) on the assay parameters (Bo, NSB, etc.) has been systematically investigated and the optimum concentration of the magnetizable particles and detergent has been determined. The reliability of magnetic separation has been validated by comparing it with the conventional PEG separation method. (author) 13 refs.; 17 figs.; 9 tabs

  14. An ultra-sensitive monoclonal antibody-based enzyme-linked immunosobent assay for dibutyl phthalate in human urinary

    Zhou, Lifang [Institute of Pharmacology, Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Science, Zhejiang University, Hangzhou 310058 (China); Lei, Yajing [Hangzhou EPIE Bio-detection Technology Limited, Hangzhou 310051 (China); Zhang, Dai; Ahmed, Shabbir [Institute of Pharmacology, Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Science, Zhejiang University, Hangzhou 310058 (China); Chen, Shuqing, E-mail: [Institute of Pharmacology, Toxicology and Biochemical Pharmaceutics, College of Pharmaceutical Science, Zhejiang University, Hangzhou 310058 (China)


    Dibutyl phthalate (DBP) has been extensively used as a plasticizer in many daily products, which is highly toxic to human, notably affecting the reproductive and developmental function. As the previous method is expensive, time-consuming, low sensitivity and just focused on the environment. Present study was aimed to establish an ultra-sensitive and simple method based on good quality monoclonal antibody, applying to evaluate excretion level of DBP in urine samples of Chinese population directly. A monoclonal antibody was generated and characterized after fusion of myeloma cells with spleen cells isolated from BALB/c mouse. The mouse was previously immunized using a specially designed amino derivative of DBP conjugated with bovine serum albumin (BSA) as immunogen. Cross-reactivity values of the monoclonal antibody against DBP, di-isobutyl phthalate (DIBP) were observed 100% and 1.25%, while for dimethyl phthalate (DMP), butyl benzyl phthalate (BBP) and didecyl phthalate (DDP) the values were < 0.06%. The standard curve was constructed at 0–50 ng mL{sup −1} and good linearity (R{sup 2} = 0.994) was achieved. The observed IC{sub 50} (7.34 ng mL{sup −1}) and LOD (0.06 ng mL{sup −1}) values was improved 1000-fold to polyclonal antibody and 5-fold to other monoclonal antibodies. A total 1246 urine samples were analyzed and the detection frequency of DBP was observed 72.87% by ic-ELISA. The 95th percentile and mean concentration of DBP were 12.07 and 3.00 ng mL{sup −1}. Acceptable recovery rates of DBP were 97.8–114.3% and coefficients variation 5.93–11.09%. The concentrations of DBP in females were found significantly higher (p < 0.05) than males. Similarly, the DBP in middle aged and low educated individuals was found higher (p < 0.001) than the others. Considering the adverse health effects, DBP internal exposure in the Chinese population should be reduced. The ic-ELISA method has been proved as a cost effective, specific, and highly sensitive screening

  15. An enzyme-linked immunoabsorbent assay for estimating red cell survival of transfused red cells-validation using CR-51 labeling

    Drew, H.; Kickler, T.; Smith, B.; LaFrance, N.


    The survival time of transfused red cells antigenically distinct from the recipient's red cells was determined using an indirect enzyme linked antiglobulin test. These results were then compared to those determined by Cr-51 labeling. Three patients with hypoproliferative anemias and one patient (2 studies) with traumatic hemolytic anemia caused by a prosthetic heart valve were studied. Survival times were performed by transfusing a 5cc aliquot of Cr-51 labeled cells along with the remaining unit. One hour post transfusion, a blood sample was drawn and used as the 100% value. Subsequent samples drawn over a 2-3 week period were then compared to the initial sample to determine percent survival for both methods. The ELISA method for measuring red cell survival in antigenically distinct cells is in close agreement with the Cr-51 method. Although CR-51 labeling is the accepted method for red cell survival determination the ELISA method can be used when radioisotopes are unavailable or contraindicated or when the decision to estimate red cell survival is made after transfusion

  16. Competitive-IgY- Enzyme Linked Immuno Sorbent Assay (CIgY-ELISA to detect the cytokinins in Gerbera jamesonii plantlets

    Cleiton Mateus Sousa


    Full Text Available A competitive hyper-immune yolk Immunoglobulin Y - Enzyme Linked Immune Sorbent Assay (CIgY-ELISA, was developed as an alternative method to detect zeatin and 2ip in plantlets of gerbera. The endogenous level of hormones in the plantlets in vitro of gerbera with one or six weeks after replication was determined with competitive IgY-ELISA set to detect between 1 and 100 pmoles of plant hormone for each 1.0 g tissue. The plantlets of six weeks presented sprouts and root, while the plantlets of one week presented only sprouts. The CIgY-ELISA was set with high independent variables values of sensitivity/specificity of 96/89 % for zeatin and 94/78 % for 2ip, with high values of reproducibility (up to 90 % for both the cytokinins. Zeatin content varied from 2.2 to 2.8 pmoles.g-1 and from 2.7 to 3.3 pmoles.g-1 on the plantlet with one and six weeks, respectively. The 2ip content did not vary and was detected near the detection limit in all the assays. It was concluded that the observed capabilities of CIgY-ELISA were putative and the competitive assay was a highly robust and stable method, which could be used for the studies on plant physiology for endogenous cytokinins.

  17. Quantitative analysis of the synthesis and secretion of type VII collagen in cultured human dermal fibroblasts with a sensitive sandwich enzyme-linked immunoassay.

    Amano, Satoshi; Ogura, Yuki; Akutsu, Nobuko; Nishiyama, Toshio


    Type VII collagen is the major component of anchoring fibrils in the epidermal basement membrane. Its expression has been analyzed by immunostaining or Northern blotting, but rarely at the protein level. In this study, we have quantitatively examined the effects of ascorbic acid and various cytokines/growth factors on the protein synthesis and secretion of type VII collagen by human dermal fibroblasts in culture, using a developed, highly sensitive sandwich enzyme-linked immunoassay with two kinds of specific monoclonal antibodies against the non-collagenous domain-1. Ascorbic acid and its derivative induced a twofold increase in type VII collagen synthesis, and markedly increased the secretion of type VII collagen into the medium when compared with the control culture. This effect was not influenced by the presence of transforming growth factor-beta1 (TGF-beta1). The synthesis of type VII collagen was elevated by TGF-beta1, platelet-derived growth factor, tumor necrosis factor-alpha, and interleukin-1beta, but not by TGF-alpha. Thus, our data indicate that the synthesis and secretion of type VII collagen in human dermal fibroblasts are regulated by ascorbate and the enhancement of type VII collagen gene expression by cytokines/growth factors is accompanied with elevated production of type VII collagen at the protein level.

  18. Porcine Cysticercosis: Possible Cross-Reactivity of Taenia hydatigena to GP50 Antigen in the Enzyme-Linked Immunoelectrotransfer Blot Assay.

    Muro, Claudio; Gomez-Puerta, Luis A; Flecker, Robert H; Gamboa, Ricardo; Barreto, Percy Vilchez; Dorny, Pierre; Tsang, Victor C W; Gilman, Robert H; Gonzalez, Armando E; Garcia, Hector H; O'Neal, Seth E; For The Cysticercosis Working Group In Peru


    The lentil lectin glycoprotein enzyme-linked immunoelectrotransfer blot (LLGP EITB, reported sensitivity 99% and specificity 100%) is used as a serologic marker of exposure to Taenia solium in pigs. However, only a limited number of parasites have been evaluated for cross reactivity. Pigs may host other related cestode infections, including Taenia hydatigena, which have not been formally evaluated for cross-reactions. We investigated a corral in Tumbes, Peru, a region where a cysticercosis elimination demonstration project was completed in 2012. In this corral, 14/19 (73.7%) 6-8-week-old piglets were reactive to GP50 on LLGP EITB, and all had circulating Taenia sp. antigens. From eight necropsied piglets; four were infected with T. hydatigena metacestodes whereas none had evidence of T. solium infection. Two resident dogs were subsequently confirmed to have T. hydatigena taeniasis. These results suggest GP50 cross-reactivity in T. hydatigena- infected pigs, although controlled experimental infection is needed to confirm this hypothesis.

  19. HPLC-DAD fingerprinting analysis, antioxidant activities of Tithonia diversifolia (Hemsl.) A. Gray leaves and its inhibition of key enzymes linked to Alzheimer's disease.

    Ojo, Oluwafemi Adeleke; Ojo, Adebola Busola; Ajiboye, Basiru Olaitan; Olaiya, Oluranti; Okesola, Mary Abiola; Boligon, Aline Augusti; de Campos, Marli Matiko Anraku; Oyinloye, Babatunji Emmanuel; Kappo, Abidemi Paul


    Tithonia diversifolia (Hemsl.) A. Gray leaves have long been used to manage neurodegenerative diseases without scientific basis. This study characterized the phenolic constituents, evaluated the antioxidant properties of phenolic extracts from T. diversifolia leaves used as traditional medicine in Africa and its inhibition of key enzymes linked to Alzheimer's disease. The extract was rich in phenolic acids (gallic acid, chlorogenic acid, caffeic acid and p -coumaric acid) and flavonoids (apigenin) and had 1,1-diphenyl-2-picryl-hydrazil radical scavenging abilities (IC 50  = 41.05 μg. mL -1 ), 2,2-Azino-bis3-ethylbenthiazoline-6sulphonic acid radical scavenging ability (IC 50  = 33.51 μg. mL -1 ), iron chelation (IC 50  = 38.50 μg. mL -1 ), reducing power (Fe 3+ - Fe 2+ ) (7.34 AAEmg/100 g), inhibited acetylcholinesterase (IC 50  = 39.27 μg mL -1 ) and butyrylcholinesterase (IC 50  = 35.01 μg mL -1 ) activities. These results reveal the leaf as a rich source of phenolic compounds with antioxidant and cholinesterase inhibitory activity.

  20. Proinflammatory mediators stimulate neutrophil-directed angiogenesis.

    McCourt, M


    BACKGROUND: Vascular endothelial growth factor (VEGF; vascular permeability factor) is one of the most potent proangiogenic cytokines, and it plays a central role in mediating the process of angiogenesis or new blood vessel formation. Neutrophils (PMNs) recently have been shown to produce VEGF. HYPOTHESIS: The acute inflammatory response is a potent stimulus for PMN-directed angiogenesis. METHODS: Neutrophils were isolated from healthy volunteers and stimulated with lipopolysaccharide (LPS), tumor necrosis factor alpha (TNF-alpha), interleukin 6 (IL-6), and anti-human Fas monoclonal antibody. Culture supernatants were assayed for VEGF using enzyme-linked immunosorbent assays. Culture supernatants from LPS- and TNF-alpha-stimulated PMNs were then added to human umbilical vein endothelial cells and human microvessel endothelial cells and assessed for endothelial cell proliferation using 5-bromodeoxyuridine labeling. Tubule formation was also assessed on MATRIGEL basement membrane matrix. Neutrophils were lysed to measure total VEGF release, and VEGF expression was detected using Western blot analysis. RESULTS: Lipopolysaccharide and TNF-alpha stimulation resulted in significantly increased release of PMN VEGF (532+\\/-49 and 484+\\/-80 pg\\/mL, respectively; for all, presented as mean +\\/- SEM) compared with control experiments (32+\\/-4 pg\\/mL). Interleukin 6 and Fas had no effect. Culture supernatants from LPS- and TNF-alpha-stimulated PMNs also resulted in significant increases (P<.005) in macrovascular and microvascular endothelial cell proliferation and tubule formation. Adding anti-human VEGF-neutralizing polyclonal antibody to stimulated PMN supernatant inhibited these effects. Total VEGF release following cell lysis and Western blot analysis suggests that the VEGF is released from an intracellular store. CONCLUSION: Activated human PMNs are directly angiogenic by releasing VEGF, and this has important implications for inflammation, capillary leak syndrome

  1. Real-time PCR and enzyme-linked fluorescent assay methods for detecting Shiga-toxin-producing Escherichia coli in mincemeat samples.

    Stefan, A; Scaramagli, S; Bergami, R; Mazzini, C; Barbanera, M; Perelle, S; Fach, P


    This work aimed to compare real-time polymerase chain reaction (PCR) with the commercially available enzyme-linked fluorescent assay (ELFA) VIDAS ECOLI O157 for detecting Escherichia coli O157 in mincemeat. In addition, a PCR-based survey on Shiga-toxin-producing E. coli (STEC) in mincemeat collected in Italy is presented. Real-time PCR assays targeting the stx genes and a specific STEC O157 sequence (SILO157, a small inserted locus of STEC O157) were tested for their sensitivity on spiked mincemeat samples. After overnight enrichment, the presence of STEC cells could be clearly determined in the 25 g samples containing 10 bacterial cells, while the addition of five bacteria provided equivocal PCR results with Ct values very close to or above the threshold of 40. The PCR tests proved to be more sensitive than the ELFA-VIDAS ECOLI O157, whose detection level started from 50 bacterial cells/25 g of mincemeat. The occurrence of STEC in 106 mincemeat (bovine, veal) samples collected from September to November 2004 at five different points of sale in Italy (one point of sale in Arezzo, Tuscany, central Italy, two in Mantova, Lombardy, Northern Italy, and two in Bologna, Emilia-Romagna, upper-central Italy) was less than 1%. Contamination by the main STEC O-serogroups representing a major public health concern, including O26, O91, O111, O145, and O157, was not detected. This survey indicates that STEC present in these samples are probably not associated with pathogenesis in humans.

  2. The morphological and molecular changes of brain cells exposed to direct current electric field stimulation.

    Pelletier, Simon J; Lagacé, Marie; St-Amour, Isabelle; Arsenault, Dany; Cisbani, Giulia; Chabrat, Audrey; Fecteau, Shirley; Lévesque, Martin; Cicchetti, Francesca


    The application of low-intensity direct current electric fields has been experimentally used in the clinic to treat a number of brain disorders, predominantly using transcranial direct current stimulation approaches. However, the cellular and molecular changes induced by such treatment remain largely unknown. Here, we tested various intensities of direct current electric fields (0, 25, 50, and 100V/m) in a well-controlled in vitro environment in order to investigate the responses of neurons, microglia, and astrocytes to this type of stimulation. This included morphological assessments of the cells, viability, as well as shape and fiber outgrowth relative to the orientation of the direct current electric field. We also undertook enzyme-linked immunosorbent assays and western immunoblotting to identify which molecular pathways were affected by direct current electric fields. In response to direct current electric field, neurons developed an elongated cell body shape with neurite outgrowth that was associated with a significant increase in growth associated protein-43. Fetal midbrain dopaminergic explants grown in a collagen gel matrix also showed a reorientation of their neurites towards the cathode. BV2 microglial cells adopted distinct morphological changes with an increase in cyclooxygenase-2 expression, but these were dependent on whether they had already been activated with lipopolysaccharide. Finally, astrocytes displayed elongated cell bodies with cellular filopodia that were oriented perpendicularly to the direct current electric field. We show that cells of the central nervous system can respond to direct current electric fields both in terms of their morphological shape and molecular expression of certain proteins, and this in turn can help us to begin understand the mechanisms underlying the clinical benefits of direct current electric field. © The Author 2015. Published by Oxford University Press on behalf of CINP.

  3. Phenolic constituents and modulatory effects of Raffia palm leaf (Raphia hookeri extract on carbohydrate hydrolyzing enzymes linked to type-2 diabetes

    Felix A. Dada


    Full Text Available This study sought to investigate the effects of Raffia palm (Raphia hookeri leaf extract on enzymes linked to type-2 diabetes mellitus (T2DM and pro-oxidant induced oxidative stress in rat pancreas. The extract was prepared and its α-amylase and α-glucosidase inhibitory effects were determined. Radical [2,2-diphenyl-1-picrylhydrazyl (DPPH] scavenging and Fe2+-chelating abilities, and inhibition of Fe2+-induced lipid peroxidation in rat pancreas homogenate were assessed. Furthermore, total phenol and flavonoid contents, reducing property, and high performance liquid chromatography diode array detector (HPLC-DAD fingerprint of the extract were also determined. Our results revealed that the extract inhibited α-amylase (IC50 = 110.4 μg/mL and α-glucosidase (IC50 = 99.96 μg/mL activities in concentration dependent manners which were lower to the effect of acarbose (amylase: IC50 = 18.30 μg/mL; glucosidase: IC50 = 20.31 μg/mL. The extract also scavenged DPPH radical, chelated Fe2+ and inhibited Fe2+-induced lipid peroxidation in rat pancreas all in concentration dependent manners with IC50 values of 402.9 μg/mL, 108.9 μg/mL and 367.0 μg/mL respectively. The total phenol and flavonoid contents were 39.73 mg GAE/g and 21.88 mg QAE/g respectively, while the reducing property was 25.62 mg AAE/g. The HPLC analysis revealed the presence of chlorogenic acid (4.17 mg/g and rutin (5.11 mg/g as the major phenolic compounds in the extract. Therefore, the ability of the extract to inhibit carbohydrate hydrolyzing enzymes and protect against pancreatic oxidative damage may be an important mechanisms supporting its antidiabetic properties and could make Raffia palm leaf useful in complementary/alternative therapy for management of T2DM. However, further studies such as in vivo should be carried out.

  4. Direct detection of cancer biomarkers in blood using a "place n play" modular polydimethylsiloxane pump.

    Zhang, Honglian; Li, Gang; Liao, Lingying; Mao, Hongju; Jin, Qinghui; Zhao, Jianlong


    Cancer biomarkers have significant potential as reliable tools for the early detection of the disease and for monitoring its recurrence. However, most current methods for biomarker detection have technical difficulties (such as sample preparation and specific detector requirements) which limit their application in point of care diagnostics. We developed an extremely simple, power-free microfluidic system for direct detection of cancer biomarkers in microliter volumes of whole blood. CEA and CYFRA21-1 were chosen as model cancer biomarkers. The system automatically extracted blood plasma from less than 3 μl of whole blood and performed a multiplex sample-to-answer assay (nano-ELISA (enzyme-linked immunosorbent assay) technique) without the use of external power or extra components. By taking advantage of the nano-ELISA technique, this microfluidic system detected CEA at a concentration of 50 pg/ml and CYFRA21-1 at a concentration of 60 pg/ml within 60 min. The combination of PnP polydimethylsiloxane (PDMS) pump and nano-ELISA technique in a single microchip system shows great promise for the detection of cancer biomarkers in a drop of blood.

  5. Evaluation of the enzyme-linked-immuno-electro-diffusion-assay (ELIEDA for the diagnosis of Schistosoma mansoni infection with low worm burden Avaliação da técnica de ELIEDA (enzyme-linked-immuno-electro-diffusion-assay para o diagnóstico da infecção pelo Schistosoma mansoni de baixa carga

    Grace Mary Leal-Bacelar


    Full Text Available An immunoprecipitation technique, ELIEDA (enzyme-linked-immuno-electro-diffusion assay, was evaluated for the diagnosis of Schistosoma mansoni infection with low worm burden. One hundred of serum samples from patients excreting less than 600 eggs per gram of feces (epg, with unrelated diseases and clinically healthy subjects were studied. In patients with egg counts higher than 200 epg, the sensitivities of IgM and IgG ELIEDA were 1.000 and 0.923, respectively, not differing from other Serologic techniques, such as indirect hemaglutination (IHAT, immunofluorescence (IFT tests and immuno-electrodiffusion assay (IEDA. However in patients with low egg counts (A técnica de imunoprecipitação ELIEDA (enzyme-linked-immuno-electro-diffusion-assay foi avaliada para fins diagnósticos da esquistossomose mansoni em pacientes com baixa carga parasitária. Amostras de soros de 50 pacientes com exame de fezes positivo para S. mansoni (carga parasitária < 600 ovos por grama de fezes = opg e 50 não esquistossomóticos (30 com outras afecções e 20 normais foram estudadas. Em pacientes com carga parasitária acima de 200 opg, a sensibilidade da técnica de ELIEDA, tanto para anticorpos IgG como IgM, respectivamente 1,000 e 0,923, não diferiu da observada para outras reações sorológicas, como a de hemaglutinação (RHA, imunofluorescênca (RIF e imunoeletrodifusão (IED. Entretanto, naqueles com baixa carga (< 100 opg, a ELIEDA-IgG mostrou resultados mais satisfatórios (0,821 que a ELIEDA-IgM (0,679, apresentando sensibilidade que não diferiu à da RIF-IgG (0,929; apesar de inferior à da RIF-IgM (0,964, a sensibilidade da ELIEDA-IgG foi superior à da RHA (0,607 e à da IED (0,536. Quanto à especificidade, esta foi comparável à dos demais testes estudados. Os dados indicam que a ELIEDA-IgG pode ser útil para diagnóstico da esquistossomose, mesmo em pacientes com pequena carga parasitária, com a vantagem de permitir estudos retrospectivos atrav

  6. Radioimmunoassay and enzyme-linked immunoassay of antibodies to the core protein (P24) of human T-lymphotropic virus (HTLV III). [Acquired immunodeficiency syndrome (AIDS)

    Neurath, A R; Strick, N; Sproul, P


    Human T-cell lymphotropic viruses designated HTLV III or LAV are considered to represent the causative agents of the acquired immunodeficiency syndrome (AIDS). Therefore a simple direct RIA or ELISA method for antibodies to distinct epitopes of HTLV III/LAV structural components would be of great value. The authors describe RIA and ELISA assays which obviate the need for purified virus or virus proteins, do not utilize infected cells and thus do not diminish the source for continuous production of viral antigens and are specific for a major core protein of HTLV III/LAV.

  7. El ensayo inmunoenzimatico en microgotas sobre nitrocelulosa (Dot-ELISA en el diagnostico de la enfermedad de Chagas: I. Estudio comparativo de dos preparaciones antigenicos de Trypanosoma cruzi The Dot-Enzyme linked immunosorbent assay (Dot-ELISA in the diagnosis of Chagas-disease: I. Comparative study of two antigenic preparations of Trypanosoma cruzi

    Rosa M. de Hubsch


    Full Text Available Se estudia el Ensayo Inmunoenzimático en Microgotas sobre Nitrocelulosa (Dot-ELISAcomparando dos preparados antigénicos de formas epimastigotas de cultivo de T. cruzi: 1 la fracción citoplasmática (antígeno citoplasmático y 2 el parásito total fijado previamente con formaldehido (antígeno integral. Se usaron sueros de: 95 pacientes chagásicos con serología convencional positiva, cardiopatía crónica y algunos con xenodiagnóstico positivo; 42 personas sanas y 32 con miocardipatía crónica con serología negativa y 74 pacientes con diferentes patologías incluyendo: sífilis, toxoplasmosis, lupus eritematoso diseminado, con factor reumatoide, leishmaniasis visceral, y leishmaniasis cutánea. Definidos los títulos diagnósticos (cut-off de 1:512 con antígeno citoplasmático y de 1: 128 con antígeno integral, la especificidad fue 96% para el primero y de 100% para el segundo; mientras que la sensibilidad fue de 100% para ambas. En el estudio comparativo con las pruebas serológicas convencionales examinando 147 sueros tomados de personas referidas al laboratório, Dot-ELISA con antígeno citoplasmático presentó índices deco-positividad de 1,0, co-negatividad de 0,989 y eficiencia 0,993. Dot-ELIS con antígeno integral dió 1,0, 0,979 y 0,986 respectivamente. De acuerdo con esta evaluación, la técnica Dot-ELISA con antígeno integral se presenta como una alternativa práctica para el diagnóstico serológico de la enfermedad de Chagas.Using the Dot-ELISA technique, two antigenic preparations of Trypanosoma cruzi epimastigote forms have been compared for the diagnosis of Chagas' disease: (1 The citoplasmic fraction (citoplasmic antigen and (2 whole fixed epimastigotes (integral antigen. There was been used sera from 95 chagasic patients with chronic cadiomyopathy, positive conventional serology and either positive or negative xenodiagnosis; 74 subjects with negative conventional serology, and either clinically normal or presenting cardiomyopathy; 74 patients with different diseases including siphilis,toxoplasmosis, leisjmaniasis or autoantibodies such as rheumatoid factor and antinuclear antibodies. By defining the diagnostic titers (cut Off: 1:512 for citoplasmatic antigen and 1:128 for the integral antigen, a sensitivity of 100% has been obtained with both antigenic preparations, being the specificity of 96% for the former and 100% for the latter when leishmaniasis sera were not included. A comparative study with conventional serology was carried out using 147 sera from a Laboratory of Chagas' diagnosis; Dot-ELISA with citoplasmic antigen showed co-positivity index of 1.0, co-negativity 0.989 and efficiency of 0.993, and Dot-ELISA with integral antigen 1.0, 0.979 and 0.986 respectively. According to this evaluation, Dot-ELISA using whole formalin fixed epimastigotes might be a practical alternative for the serological diagnosis of Chagas' disease.

  8. Mycothiol acetyltransferase (Rv0819) of Mycobacterium tuberculosis is a potential biomarker for direct diagnosis of tuberculosis using patient serum specimens.

    Zeitoun, H; Bahey-El-Din, M; Kassem, M A; Aboushleib, H M


    Mycobacterium tuberculosis infection constitutes a global threat that results in significant morbidity and mortality worldwide. Efficient and early diagnosis of tuberculosis (TB) is of paramount importance for successful treatment. The aim of the current study is to investigate the mycobacterial mycothiol acetyltransferase Rv0819 as a potential novel biomarker for the diagnosis of active TB infection. The gene encoding Rv0819 was cloned and successfully expressed in Escherichia coli. The recombinant Rv0819 was purified using metal affinity chromatography and was used to raise murine polyclonal antibodies against Rv0819. The raised antibodies were employed for direct detection of Rv0819 in patient serum samples using dot blot assay and competitive enzyme-linked immunosorbent assay (ELISA). Serum samples were obtained from 68 confirmed new TB patients and 35 healthy volunteers as negative controls. The dot blot assay showed sensitivity of 64·7% and specificity of 100%, whereas the competitive ELISA assay showed lower sensitivity (54·4%) and specificity (88·57%). The overall sensitivity of the combined results of the two tests was found to be 89·7%. Overall, the mycobacterial Rv0819 is a potential TB serum biomarker that can be exploited, in combination with other TB biomarkers, for efficient and reliable diagnosis of active TB infection. The early and accurate diagnosis of tuberculosis infection is of paramount importance for initiating treatment and avoiding clinical complications. Most current diagnostic tests have poor sensitivity and/or specificity and in many cases they are too expensive for routine diagnostic testing in resource-limited settings. In the current study, we examined a novel mycobacterial serum biomarker, namely mycothiol acetyltransferase Rv0819. The antigen was detectable in serum specimens of a significant number of tuberculosis patients. This article proves the importance of Rv0819 and paves the way towards its future use as a useful


    S. N. Depamede


    Full Text Available Clostridium botulinum neurotoxin (BoNTs is one of the causes of economic loss in the livestock industry. This economic loss would be as a direct result when animals poisoned by BoNTs or indirectly when the livestock products are contaminated by BoNTs, which end up with the products are banned by authority. Therefore a routine surveillance of BoNTs in the farm and in livestock product processing industry is urgently needed. One of the most relatively quick and accurate methods to perform a routine detection of the presence of BoNTs is enzyme-linkage immunosorbant assay (ELISA. In this article we describe the results of the development of ELISA, using polyclonal antibodies against BoNTs-B produced locally. Antibodies were generated from six Balb/c mice with standard immunological methods. Mice were immunized three times for a period of 8 weeks with a commercial type B Clostridium botulinum toxoid at a dose of 100 ng per mouse per injection. The resulting antibody was purified by a combination of ammonium sulfate precipitation 50% (w/v technique and a protein A column method. The results of this preliminary study indicated that the developed ELISA method capable of detecting type B Clostridium botulinum toxin up to 1.0 ng/ml.

  10. Carbon dots based immunosorbent assay for the determination of GFAP in human serum

    Ma, Yunsu; Xu, Guanhong; Wei, Fangdi; Cen, Yao; Song, Yueyue; Ma, Yujie; Xu, Xiaoman; Shi, Menglan; Sohail, Muhammad; Hu, Qin


    Glial fibrillary acidic protein (GFAP) is expressed in the central nervous system and the level of GFAP normally rises with brain injury and astroglial tumors. So, serum GFAP is used as a marker for diagnosing various types of brain damage and astroglial tumors. In this study, a new sensor based on carbon dots (CDs) linked with antibodies to specifically detect GFAP in human serum was developed. Anti-GFAP (Ab1) linked with protein A/G agarose resin (PA/G) as a capture antibody (PA/G-Ab1) and anti-GFAP (Ab2) labeled with CDs as a detection antibody (CDs-Ab2) were prepared firstly. Then the CD-linked antibody immunosorbent assay (CLAISA) method was constructed based on the sandwich conjunction reaction among PA/G-Ab1, GFAP, and CDs-Ab2. CLAISA, using the fluorescence of PA/G-Ab1-GFAP-Ab2-CDs as the direct signal, enabled the proposed immunosensor to detect GFAP sensitively with a linear range of 0.10-8.00 ng ml-1 and a detection limit of 25 pg ml-1. This method was applied to the determination of GFAP in human serum by the standard addition method, and the results showed high accuracy and precision. Considering the easy synthetic process and excellent performance of CLAISA, this method has great potential to be used to monitor GFAP in the clinic.

  11. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  12. Direct analysis of prostaglandin-E2 and -D2 produced in an inflammatory cell reaction and its application for activity screening and potency evaluation using turbulent flow chromatography liquid chromatography-high resolution mass spectrometry.

    Shin, Jeong-Sook; Peng, Lei; Kang, Kyungsu; Choi, Yongsoo


    Direct analysis of prostaglandin-E2 (PGE2) and -D2 (PGD2) produced from a RAW264.7 cell-based reaction was performed by liquid chromatography high-resolution mass spectrometry (LC-HRMS), which was online coupled with turbulent flow chromatography (TFC). The capability of this method to accurately measure PG levels in cell reaction medium containing cytokines or proteins as a reaction byproduct was cross-validated by two conventional methods. Two methods, including an LC-HRMS method after liquid-liquid extraction (LLE) of the sample and a commercial PGE2 enzyme-linked immunosorbent assay (ELISA), showed PGE2 and/or PGD2 levels almost similar to those obtained by TFC LC-HRMS over the reaction time after LPS stimulation. After the cross-validation, significant analytical throughputs, allowing simultaneous screening and potency evaluation of 80 natural products including 60 phytochemicals and 20 natural product extracts for the inhibition of the PGD2 produced in the cell-based inflammatory reaction, were achieved using the TFC LC-HRMS method developed. Among the 60 phytochemicals screened, licochalcone A and formononetin inhibited PGD2 production the most with IC50 values of 126 and 151nM, respectively. For a reference activity, indomethacin and diclofenac were used, measuring IC50 values of 0.64 and 0.21nM, respectively. This method also found a butanol extract of Akebia quinata Decne (AQ) stem as a promising natural product for PGD2 inhibition. Direct and accurate analysis of PGs in the inflammatory cell reaction using the TFC LC-HRMS method developed enables the high-throughput screening and potency evaluation of as many as 320 samples in less than 48h without changing a TFC column. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Prussian blue nanoparticles as a catalytic label in a sandwich nanozyme-linked immunosorbent assay

    Farka, Z.; Čunderlová, V.; Horáčková, V.; Pastucha, M.; Mikušová, Z.; Hlaváček, Antonín; Skládal, P.


    Roč. 90, č. 3 (2018), s. 2348-2354 ISSN 0003-2700 R&D Projects: GA MŠk(CZ) LM2015043; GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : catalytic nanoparticle * immunosorbent assays * nanoparticles Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 6.320, year: 2016

  14. Prussian blue nanoparticles as a catalytic label in a sandwich nanozyme-linked immunosorbent assay

    Farka, Z.; Čunderlová, V.; Horáčková, V.; Pastucha, M.; Mikušová, Z.; Hlaváček, Antonín; Skládal, P.


    Roč. 90, č. 3 (2018), s. 2348-2354 ISSN 0003-2700 R&D Projects: GA MŠk(CZ) LM2015043; GA ČR(CZ) GBP206/12/G014 Institutional support: RVO:68081715 Keywords : catalytic nanoparticle * immunosorbent assays * nanoparticles Subject RIV: CB - Analytical Chemistry , Separation OBOR OECD: Analytical chemistry Impact factor: 6.320, year: 2016

  15. The E. coli immunosorbent as used in serodiagnosis of Legionella infections studied by crossed immunoelectrophoresis

    Bangsborg, Jette Marie; Friis-Møller, A; Rechnitzer, C


    In this study we investigated an immunosorbent, E. coli blocking fluid (BF), proposed for use in the Legionella Indirect Fluorescent Antibody Test (IFA). With crossed immunoelectrophoresis (CIE) of clinically relevant Legionella species, only one heat-stable antigen (no. 1) cross...

  16. Anti-idiotypic antibodies directed against anti-HBs among the patients with chronic hepatitis B.

    Kobayashi, K; Suzuki, H; Ueno, Y; Nagatomi, R; Kanno, A; Otsuki, M; Toyota, T


    Anti-idiotypic antibodies (anti-Id) against anti-HBs were found in the sera of patients with chronic hepatitis type B. Anti-idiotypic antibodies were detected by an enzyme-linked immunosorbent assay using horseradish peroxidase conjugated mouse monoclonal anti-HBs. Ten of 72 HBsAg positive sera contained anti-Id (13.9%). The prevalence of anti-Id did not appear to correlate with HBeAg/anti-HBe system. However, HB virus specific DNA polymerase activity was significantly higher in anti-Id positive sera. In the sera obtained from the patients treated with predonisolone before, anti-Id positive rate was higher than that in the patients without a history of predonisolone therapy. These results suggest that anti-Id may be related to the immunoregulatory mechanism of HB virus replication.

  17. Development and validation of an epitope-blocking ELISA using an anti-haemagglutinin monoclonal antibody for specific detection of antibodies in sheep and goat sera directed against peste des petits ruminants virus.

    Bodjo, Sanne Charles; Baziki, Jean-de-Dieu; Nwankpa, Nick; Chitsungo, Ethel; Koffi, Yao Mathurin; Couacy-Hymann, Emmanuel; Diop, Mariame; Gizaw, Daniel; Tajelser, Idris Badri Adam; Lelenta, Mamadou; Diallo, Adama; Tounkara, Karim


    Peste des petits ruminants (PPR) is a contagious and economically important disease affecting production of small ruminants (i.e., sheep and goats). Taking into consideration the lessons learnt from the Global Rinderpest Eradication Programme (GREP), PPR is now targeted by the international veterinary community as the next animal disease to be eradicated. To support the African continental programme for the control of PPR, the Pan African Veterinary Vaccine Centre of the African Union (AU-PANVAC) is developing diagnostics tools. Here, we describe the development of a blocking enzyme-linked immunosorbent assay (bELISA) that allows testing of a large number of samples for specific detection of antibodies directed against PPR virus in sheep and goat sera. The PPR bELISA uses an anti-haemagglutinin (H) monoclonal antibody (MAb) as a competitor antibody, and tests results are interpreted using the percentage of inhibition (PI) of MAb binding generated by the serum sample. PI values below or equal to 18% (PI ≤ 18%) are negative, PI values greater than or equal to 25% (PI ≥ 25%) are positive, and PI values greater than 18% and below 25% are doubtful. The diagnostic specificity (DSp) and diagnostic sensitivity (DSe) were found to be 100% and 93.74%, respectively. The H-based PPR-bELISA showed good correlation with the virus neutralization test (VNT), the gold standard test, with a kappa value of 0.947. The H-based PPR-bELISA is more specific than the commercial kit ID Screen® PPR Competition (N-based PPR-cELISA) from IDvet (France), but the commercial kit is slightly more sensitive than the H-based PPR-bELISA. The validation process also indicated good repeatability and reproducibility of the H-based PPR-bELISA, making this new test a suitable tool for the surveillance and sero-monitoring of the vaccination campaign.

  18. An immunoassay for dibutyl phthalate based on direct hapten linkage to the polystyrene surface of microtiter plates.

    Chenxi Wei

    Full Text Available BACKGROUND: Dibutyl phthalate (DBP is predominantly used as a plasticizer inplastics to make them flexible. Extensive use of phthalates in both industrial processes and other consumer products has resulted in the ubiquitous presence of phthalates in the environment. In order to better determine the level of pollution in the environment and evaluate the potential adverse effects of exposure to DBP, immunoassay for DBP was developed. METHODOLOGY/PRINCIPAL FINDINGS: A monoclonal antibody specific to DBP was produced from a stable hybridoma cell line generated by lymphocyte hybridoma technique. An indirect competitive enzyme-linked immunosorbent assay (icELISA employing direct coating of hapten on polystyrene microtiter plates was established for the detection of DBP. Polystyrene surface was first oxidized by permanganate in dilute sulfuric acid to generate carboxyl groups. Then dibutyl 4-aminophthalate, which is an analogue of DBP, was covalently linked to the carboxyl groups of polystyrene surface with 1-ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride (EDC. Compared with conjugate coated format (IC(50=106 ng/mL, the direct hapten coated format (IC(50=14.6 ng/mL improved assay sensitivity after careful optimization of assay conditions. The average recovery of DBP from spiked water sample was 104.4% and the average coefficient of variation was 9.95%. Good agreement of the results obtained by the hapten coated icELISA and gas chromatography-mass spectrometry further confirmed the reliability and accuracy of the icELISA for the detection of DBP in certain plastic and cosmetic samples. CONCLUSIONS/SIGNIFICANCE: The stable and efficient hybridoma cell line obtained is an unlimited source of sensitive and specific antibody to DBP. The hapten coated format is proposed as generally applicable because the carboxyl groups on modified microtiter plate surface enables stable immobilization of aminated or hydroxylated hapten with EDC. The developed

  19. Efficiency of Direct Microscopy of Stool Samples Using an Antigen-Specific Adhesin Test for Entamoeba Histolytica

    Arzu İrvem


    easily misjudged using direct microscopy. Although microscopic examination of samples stained with Native-Lugol’s iodine is a cheap and simple method, the confusion of trophozoites with leukocytes may direct the clinician toward an incorrect pre-diagnosis. Because trichrome staining is difficult and time consuming, and results may vary depending on the technician, this method is not preferred in most laboratories. Therefore, an enzyme-linked immunosorbent assay method, which is a more advanced method than polymerase chain reaction, should be used to distinguish between E. histolytica and E. dispar in order to achieve an accurate diagnosis.

  20. Identification of a linear epitope recognized by a monoclonal antibody directed to the heterogeneous nucleoriboprotein A2

    Tronstrøm, Julie; Dragborg, Anette H.; Hansen, Paul Robert


    to as RA33. In the absence of citrulline antibodies, RA33 antibodies have been suggested to be associated with a milder disease course. In this study we screened the reactivity of a monoclonal antibody to RA33-derived peptides by modified enzyme-linked immunosorbent assays (ELISA). Terminally truncated......Rheumatoid arthritis (RA) is a chronic autoimmune disorder, characterized by progressive joint destruction and disability. Classical autoantibodies of RA are rheumatoid factors and citrulline antibodies. Patients positive for these autoantibodies are usually associated with a progressive disease...... course. A subgroup of RA patients does not express citrulline antibodies, instead are approximately 35% of these anti-citrulline-negative patients reported to express autoantibodies to the heterogeneous nucleoriboprotein A2, a ribonucleoprotein involved in RNA transport and processing also referred...