WorldWideScience

Sample records for direct detection vis-a-vis

  1. Astrophysical limitations to the identification of dark matter: Indirect neutrino signals vis-a-vis direct detection recoil rates

    International Nuclear Information System (INIS)

    Serpico, Pasquale D.; Bertone, Gianfranco

    2010-01-01

    A convincing identification of dark matter (DM) particles can probably be achieved only through a combined analysis of different detections strategies, which provides an effective way of removing degeneracies in the parameter space of DM models. In practice, however, this program is made complicated by the fact that different strategies depend on different physical quantities, or on the same quantities but in a different way, making the treatment of systematic errors rather tricky. We discuss here the uncertainties on the recoil rate in direct-detection experiments and on the muon rate induced by neutrinos from dark matter annihilations in the Sun, and we show that, contrarily to the local DM density or overall cross section scale, irreducible astrophysical uncertainties affect the two rates in a different fashion, therefore limiting our ability to reconstruct the parameters of the dark matter particles. By varying within their respective errors astrophysical parameters such as the escape velocity and the velocity dispersion of dark matter particles, we show that the uncertainty on the relative strength of the neutrino and direct-detection signal is as large as a factor of 2 for typical values of the parameters, but can be even larger in some circumstances.

  2. Detecting changes in rainfall pattern and seasonality index vis-`a-vis ...

    Indian Academy of Sciences (India)

    index vis-`a-vis increasing water scarcity in Maharashtra ... in the district scale are identified by trend analysis of rainfall time series. ... for better disaster management and water resource ..... productivity and irrigation water supply in the con-.

  3. Migratory Trends in the Czech Republic: “Divergence or Convergence” vis-a-vis the Developed World?

    Directory of Open Access Journals (Sweden)

    Dušan Drbohlav

    2002-09-01

    Full Text Available The main goal of this paper is to analyse whether the geopolitical and socio-economic integration and “harmonisation” of the Czech Republic with Western Europe is accompanied by a divergence or convergence of the Czech migratory reality vis-a-vis the developed western world. When testing resemblance two kinds of measurements are used: 1 quantitative – (in terms of the numbers of international migrants, and 2 “qualitative” – a in terms of regularities linked with the migration itself and those that tackle mutual relationships among immigration, the socio-economic development of the destination country and subjective attitudes of the majority population towards minority groups: 3 hypotheses are tested in this regard; b in terms of migratory policies and practices. The results clearly show us that convergence rather than divergence is characteristic of the current migratory trends in the Czech Republic as compared to the developed world, mainly Western Europe.

  4. Codon usage vis-a-vis start and stop codon context analysis of three ...

    Indian Academy of Sciences (India)

    Prosenjit Paul

    2018-02-20

    Feb 20, 2018 ... Keywords. codon; dinucleotide; selection; mutation; genome. Introduction ..... influence of other factors, for example natural selection, is 91.7%, 99.5% ..... measure of directional synonymous codon usage bias, and its potential ...

  5. A Look at Technologies Vis-a-vis Information Handling Techniques.

    Science.gov (United States)

    Swanson, Rowena W.

    The paper examines several ideas for information handling implemented with new technologies that suggest directions for future development. These are grouped under the topic headings: Handling Large Data Banks, Providing Personalized Information Packages, Providing Information Specialist Services, and Expanding Man-Machine Interaction. Guides in…

  6. RESEARCH ARTICLE Codon usage vis-a-vis start and stop codon ...

    Indian Academy of Sciences (India)

    Prosen

    codon usage at start and stop site showed variation in codon selection in ..... pressure is 8.3%, 0.5% and 18.5% while the influence of other factors, for example natural ..... The codon Adaptation Index--a measure of directional synonymous.

  7. Technical Support to an Operating PWR vis-a-vis Safety Analysis

    International Nuclear Information System (INIS)

    Gul, Subhan; Khan, M.; Chughtai, M. Kamran

    2011-01-01

    Currently a PWR of 300 MWe capacity CHASNUPP-I is in operation since the year 2000. Technical support being provided includes in-core fuel management and corresponding safety analysis for the reshuffled core for the next cycle. Currently calculation and analysis were performed for Cycle 6 to achieve the safe and economical loading pattern. The technique used is designated as out in mode (modified). In this technique, most of the fresh fuel assemblies are not directly located at the periphery of the core, but near the boundary. This technique has the advantage that without using burnable absorber we can design a low leakage core with extended cycle and maximum batch averaged burnup. (author)

  8. EFFECTS OF AZADIRACHTIN ON CUTICULAR PROTEINS OF SPODOPTERA LITURA (LEPIDOPTERA: NOCTUIDAE) VIS-A-VIS THE MODES OF APPLICATION.

    Science.gov (United States)

    Yooboon, T; Pluempanupat, W; Koul, Opender; Bullangpoti, V

    2015-01-01

    Azadirachtin is a known botanical insecticide with multiple modes of action. Whether these effects have any relation with the modes of application, specifically during ecdysis process, has been the objective of the present study and accordingly the impairment, if any, among cuticular proteins of Spodoptera litura (Fab.) was determined. Azadirachtin was applied topically, via injection or oral administration. Azadirachtin administered via injection and topical applications severely impaired the ecdysis by 86.67 and 80.0%, respectively. However, this impairment via oral administration was significantly lower (73.33%). Using SDS-PAGE, the cuticular proteins were determined for treated insects under all the three modes of application. In all cases 6 protein bands (MW 9-34 kDa) were identified using markers as standard. In all treatments 3 induced proteins (MW. ~16, 20 and 23 kDa) and 1 reduced protein (~19 kDa) were observed. In case of the topical treatment a different induced protein of ~18 kDa was identified. The change in cuticular proteins, their possible role in ecdysis impairment vis-a-vis the mode of application of azadirachtin is being correlated. This will help in understanding the mode-of-action at cuticular level and also will allow developing a suitable application strategy under field conditions in insect pest management.

  9. Insects vis a vis radiations

    International Nuclear Information System (INIS)

    Srivastava, Meera

    2014-01-01

    Insects have turned out to be much more radiation resistant. For most insects a dose of about 500-700 Gy is required to kill them within a few weeks of exposure; although cockroaches require 900-1000 Gy. Killing insects in less than a few days requires much higher doses. These doses are for mature insects, the immature stages of some insects can be killed by doses as low as 40 Gy. Some insects can be sterilized at even lower doses, and this has application in insect control. Screw-worms, for example, can be sterilized with doses of 25-50 Gy. By contrast, doses as low as 3 Gy caused death of humans in Hiroshima and Nagasaki and doses of about 6 Gy caused death of fire fighters in the Chernobyl accident. It is not exactly certain what the basis is for the resistance of insects to ionizing radiation. It is not animal size by itself, nor lack of penetration. It is also not because of few dividing cells as these are more radiosensitive than non-dividing ones. The speculation that insects might have lower oxygen tensions, and the lack of oxygen is known to protect cells from radiation also does not work. Insect cells might have an enhanced capacity to repair radiation damage also could not be proven. The number of chromosomes influenced radio-sensitivity, and that insects had fewer chromosomes could be true. The radiation resistance is inherent to the cells, since cells derived from insects are also radiation resistant when grown in cell culture. For example, a dose of 60 Gy is required to produce a 80% kill of insect cells, while doses of 1-2 Gy are sufficient to generate this level of killing in mammalian cells. But, nevertheless, according to recent researches, radiation from Japan's leaking Fukushima nuclear plant has caused mutations in some butterflies. It is therefore clear that insects are resistant to ionizing radiation and that this resistance is an inherent property of their cells. But it is not clear exactly what the basis of this cellular resistance is, although the dominant theory is that it relates to the relatively small amount of DNA in insect cells. One of the difficulties is assessing possible mechanisms is that very little work on insect radiobiology is being carried out?

  10. Internet vis-a-vis marine biology

    Digital Repository Service at National Institute of Oceanography (India)

    Chavan, V.S.

    Internet is an amalgum of networks which reaches to more than 100 million people across the globe. The satellite-telecommunication based computer network web hosts information on every aspect of life. Marine biology related information too is being...

  11. A Comparative Analysis of the Impact of the IAEA Cooperation Instruments in the Field of Nuclear Safety to Deal with the Fukushima Daiichi Accident vis-a-vis the Chernobyl Accident

    International Nuclear Information System (INIS)

    Da Silva Simões, V.

    2016-01-01

    entrenched among nuclear power plant operators, governments and regulators.” This work intends to make a comparative analysis of the impact of the IAEA cooperation instruments in the field of nuclear safety to deal with the Fukushima Daiichi accident vis-a-vis the Chernobyl accident. (author)

  12. Macromolecules Vis-a-Vis the Traditions of Chemistry

    Science.gov (United States)

    Flory, Paul J.

    1973-01-01

    Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…

  13. Issues and prospects vis a vis Indian PV commercialization programme

    International Nuclear Information System (INIS)

    Deambi, Suneel

    1994-01-01

    Following a large scale demonstration of photovoltaic systems attending to the important requirements of lighting, water pumping, television and battery charging etc. in the remote surroundings of India, serious efforts are being made to promote the commercial use of these systems. A recently launched World Bank-supported project on PV market development has provided the much needed boost to the Indian PV programme. This paper tries to analyse the issues and prospects with respect to the National PV Commercialization Programme in view of the changing PV scenario in the country. (author)

  14. Mega-geomorphology: Mars vis a vis Earth

    Science.gov (United States)

    Sharp, R. P.

    1985-01-01

    The areas of chaotic terrain, the giant chasma of the Valles Marineris region, the complex linear and circular depressions of Labyrinthus Noctis on Mars all suggest the possibility of large scale collapse of parts of the martian crust within equatorial and sub equatorial latitudes. It seems generally accepted that the above features are fossil, being perhaps, more than a billion years old. It is possible that parts of Earth's crust experienced similar episodes of large scale collapse sometime early in the evolution of the planet.

  15. Relasi Antagonistik Barat-Timur: Orientalisme vis a vis Oksidentalisme

    Directory of Open Access Journals (Sweden)

    Moh. Fudholi

    2015-10-01

    Full Text Available Encounter of the East and the West due to such various interests as economic, political, scientific, cultural has been a major factor in the study of western scientists (Orientalists about the East that produces a variety of works in the fields of archeology, history, literature, environment, customs, and Islamic studies. Meanwhile, resistance against Orientalism in the form of Occidentalism, as initiated by Hasan Hanafî, seems to be closely related to ‘obsession’ and hopes of someone who frustrated and dissatisfied with the condition of the world he has dealt with as the project of civilization he offered seemed to be too theoretical to be applied into the form of well established science. This is a fact that, unlike Orientalism that has born from strength, power, and has been then smoothly formed, Occidentalism was created by the East that was defeated and suffered from weakness and at the same time merely has an obsession. In spite of the impression, apparently, what has been attempted in Occidentalism is dismantling the text, another interpretation, and building a new, more proportional context.

  16. Energy conservation opportunities: audit vis-a-vis mine productivity

    Energy Technology Data Exchange (ETDEWEB)

    Iyer, G.H.

    2009-07-01

    Mining operation, whether opencast or underground, with modern equipment is highly energy intensive, needing energy conservation and management to ensure efficiency, cost effectiveness, and overall productivity. Exhaustible primary energy resources such as coal, lignite, oil, and nuclear fuels are being mined out to meet our energy needs. An attempt has been made in this paper to highlight the energy conservation opportunities, energy audit, the relevant Energy Conservation Act 2001 and certain energy saving measures leading to higher productivity followed by a few case study examples. 3 refs.

  17. Influence of hydrogen on metals behavior. 1 - Mechanical behavior of Ti 6 pc Al 6 pc V 2 pc Sn titanium alloy versus hydrogen: influence of heat treatment and of oxygen content; Influence de l'hydrogene sur le comportement des metaux. 1 - comportement mecanique de l'alliage de titane T A6 V6 E2 vis-a-vis de l'hydrogene: influence du traitement thermique et de la teneur en oxygene

    Energy Technology Data Exchange (ETDEWEB)

    Schaller, Bernard

    1972-06-26

    The mechanical behavior of Ti 6 pc Al 6 pc V Sn alloy during dynamic testing has been investigated versus hydrogen and oxygen content. The hydrogen susceptibility depends only slightly on its microstructure, acicular or equi-axed: it depends much more on conditions of hydrogen contamination and on the thermal history afterward. When the alloy has been stabilized by annealing in {alpha} - {beta} and provided hydrogen absorption does not induce phase transformations, hydrogen sensitivity is relatively low: brittleness occurs suddenly but at a high concentration threshold (2000 ppm H), which coincides with hydrogen saturation of {beta} phase. When the alloy includes unstabilized phases, its response to hydrogen changes whether it has been finally annealed or not, in the 300 - 500 C temperature area, prone to {omega} phase formation. In the absence of such an annealing, a reduction in ductility only occurs at high concentrations (> 1500 ppm H). In the other and, after annealing at 400 C, alloy hardening and a ductility decrease start even at the lowest hydrogen amounts: then hydrogen susceptibility is very high. Low oxygen concentration (up to 2000 ppm) do not sensibly affect the good hydrogen tolerance of this alloy. Beyond 2500 ppm, oxygen, while improving tensile strength, yet severely decreases ductility. [French] Le comportement mecanique de l'alliage TA6-V6-E2 lors d'un essai dynamique a ete etudie en fonction de la teneur en hydrogene et en oxygene. La sensibilite vis-a-vis de l'hydrogene ne depend que tres faiblement de sa structure migrographique, aciculaire ou equiaxe; elle depend bien plus des conditions de contamination par l'hydrogene et de son histoire thermique apres contamination. Lorsque l'alliage a ete stabilise par un recuit dans le domaine biphase, et a condition que l'absorption d'hydrogene n'entraine pas de modification structurale, la sensibilite vis-a-vis de l'hydrogene est relativement faible: la fragilite apparait brutalement mais pour un

  18. Direct detection with dark mediators

    Energy Technology Data Exchange (ETDEWEB)

    Curtin, David; Surujon, Ze' ev [C. N. Yang Institute for Theoretical Physics, Stony Brook University, Stony Brook, NY 11794 (United States); Tsai, Yuhsin [Physics Department, University of California Davis, Davis, CA 95616 (United States)

    2014-11-10

    We introduce dark mediator Dark Matter (dmDM) where the dark and visible sectors are connected by at least one light mediator ϕ carrying the same dark charge that stabilizes DM. ϕ is coupled to the Standard Model via an operator q{sup ¯}qϕϕ{sup ⁎}/Λ, and to dark matter via a Yukawa coupling y{sub χ}χ{sup c¯}χϕ. Direct detection is realized as the 2→3 process χN→χ{sup ¯}Nϕ at tree-level for m{sub ϕ}≲10 keV and small Yukawa coupling, or alternatively as a loop-induced 2→2 process χN→χN. We explore the direct-detection consequences of this scenario and find that a heavy O(100 GeV) dmDM candidate fakes different O(10 GeV) standard WIMPs in different experiments. Large portions of the dmDM parameter space are detectable above the irreducible neutrino background and not yet excluded by any bounds. Interestingly, for the m{sub ϕ} range leading to novel direct detection phenomenology, dmDM is also a form of Self-Interacting Dark Matter (SIDM), which resolves inconsistencies between dwarf galaxy observations and numerical simulations.

  19. Plasma dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Clarke, J.D.; Foot, R., E-mail: j.clarke5@pgrad.unimelb.edu.au, E-mail: rfoot@unimelb.edu.au [ARC Centre of Excellence for Particle Physics at the Terascale, School of Physics, University of Melbourne, Victoria 3010 Australia (Australia)

    2016-01-01

    Dark matter in spiral galaxies like the Milky Way may take the form of a dark plasma. Hidden sector dark matter charged under an unbroken U(1)' gauge interaction provides a simple and well defined particle physics model realising this possibility. The assumed U(1)' neutrality of the Universe then implies (at least) two oppositely charged dark matter components with self-interactions mediated via a massless 'dark photon' (the U(1)' gauge boson). In addition to nuclear recoils such dark matter can give rise to keV electron recoils in direct detection experiments. In this context, the detailed physical properties of the dark matter plasma interacting with the Earth is required. This is a complex system, which is here modelled as a fluid governed by the magnetohydrodynamic equations. These equations are numerically solved for some illustrative examples, and implications for direct detection experiments discussed. In particular, the analysis presented here leaves open the intriguing possibility that the DAMA annual modulation signal is due primarily to electron recoils (or even a combination of electron recoils and nuclear recoils). The importance of diurnal modulation (in addition to annual modulation) as a means of probing this kind of dark matter is also emphasised.

  20. Direct Fast-Neutron Detection

    International Nuclear Information System (INIS)

    DC Stromswold; AJ Peurrung; RR Hansen; PL Reeder

    2000-01-01

    Direct fast-neutron detection is the detection of fast neutrons before they are moderated to thermal energy. We have investigated two approaches for using proton-recoil in plastic scintillators to detect fast neutrons and distinguish them from gamma-ray interactions. Both approaches use the difference in travel speed between neutrons and gamma rays as the basis for separating the types of events. In the first method, we examined the pulses generated during scattering in a plastic scintillator to see if they provide a means for distinguishing fast-neutron events from gamma-ray events. The slower speed of neutrons compared to gamma rays results in the production of broader pulses when neutrons scatter several times within a plastic scintillator. In contrast, gamma-ray interactions should produce narrow pulses, even if multiple scattering takes place, because the time between successive scattering is small. Experiments using a fast scintillator confirmed the presence of broader pulses from neutrons than from gamma rays. However, the difference in pulse widths between neutrons and gamma rays using the best commercially available scintillators was not sufficiently large to provide a practical means for distinguishing fast neutrons and gamma rays on a pulse-by-pulse basis. A faster scintillator is needed, and that scintillator might become available in the literature. Results of the pulse-width studies were presented in a previous report (peurrung et al. 1998), and they are only summarized here

  1. Vertical Foreign Direct Investment versus Outsourcing: A Welfare Comparison from the Perspective of a Host Country

    OpenAIRE

    Goswami, Arti Grover

    2011-01-01

    In the offshoring literature, there is a huge disconnect between the alternative modes of organizing offshore production and their relative welfare impact on a host country. We bridge this gap by comparing the welfare of a host country from vertical foreign direct investment (VFDI) vis-a-vis international outsourcing. Our model finds that the ability to maximize welfare in the alternative modes of organizing offshore production is contingent on the absorptive capacity of the host country. If ...

  2. Object Detection: Current and Future Directions

    Directory of Open Access Journals (Sweden)

    Rodrigo eVerschae

    2015-11-01

    Full Text Available Object detection is a key ability required by most computer and robot vision systems. The latest research on this area has been making great progress in many directions. In the current manuscript we give an overview of past research on object detection, outline the current main research directions, and discuss open problems and possible future directions.

  3. Soviet Language Policy vis-a-vis Minority Languages: The Road to Disintegration

    Science.gov (United States)

    Das, Alok Kumar

    2011-01-01

    The present linguistic situation in Russia, however much it may have been affected by political and economic considerations, is overwhelmingly the consequence of what people have made of their geographical conditions, their history and their long-standing language and ethnic contacts over many centuries. The present linguistic complexity of Russia…

  4. Russian Energy Policy vis-a-vis Europe: Natural Resources as a Means of Foreign Policy

    Science.gov (United States)

    2012-06-01

    Charter stipulates,58 Russia would have to give up its almost monopolistic control over the transit routes by making the energy market open, transparent...Russian monopolistic control over energy flow to Europe might be converted into a regional political dominance. Threatening the possibility of abrupt... monopolistic control over energy flow to Europe might be converted into a regional political dominance. Threatening the possibility of abrupt energy

  5. Changes of vegetation vis-a-vis Climate since last several thousand ...

    Indian Academy of Sciences (India)

    IPSITA

    ... since last several thousand years at North-East India ... of agricultural practices showed the presence of cereal and other cultural pollen taxa. Later, a more humid ... research in southeast Asia, and also to trace the migratory route of flora.

  6. Examining Deaf Students' Equitable Access to Science vis-a-vis Contemporary Pedagogical Practices

    Science.gov (United States)

    Ross, Annemarie D.

    As a Deaf individual, it is important to ensure the growth of the Deaf community as science-literate members of society. While many predecessors have contributed to the body of research in Deaf pedagogy, there is still much to be done in safeguarding Deaf learners' equitable access to science education. One area of concern is in narrowing the statistically significant gap in Climate Change knowledge between Deaf students' and Hearing students' at the Rochester Institute of Technology. It is within this topic that the writing-to-learn-science framework is practiced and Deaf students in the Laboratory Science Technology program at the National Technical Institute for the Deaf participate in a study to assess whether or not the use of writing-to-learn-science strategies help them become better scientists, writers and learners. In this study, the social constructivist framework (Vygotsky, 1987) is used to study the impact of the use of the Berland and Reiser (2009) argumentation framework, so that they write-to-learn-science through the steps of sense-making, articulation and persuasion.

  7. Codon usage vis-a-vis start and stop codon context analysis of three ...

    Indian Academy of Sciences (India)

    To understand the variation in genomic composition and its effect on codon usage, we performed the comparative analysis of codon usage and nucleotide usage in the genes of three dicots, Glycine max, Arabidopsis thaliana and Medicago truncatula. The dicot genes were found to be A/T rich and have predominantly ...

  8. Environmental challenge vis a vis opportunity: the case of water hyacinth.

    Science.gov (United States)

    Malik, Anushree

    2007-01-01

    Water hyacinth (Eichhornia crassipes) is a noxious weed that has attracted worldwide attention due to its fast spread and congested growth, which lead to serious problems in navigation, irrigation, and power generation. On the other hand, when looked from a resource angle, it appears to be a valuable resource with several unique properties. As a result, research activity concerning control (especially biological control) and utilization (especially wastewater treatment or phytoremediation) of water hyacinth has boomed up in the last few decades. Investigations on biogas/compost production from water hyacinth have also come up very well mainly from few research groups in India. This review presents a comprehensive view of the research related to water hyacinth with special emphasis on the recent investigations on water hyacinth control and utilization technologies conducted in the last 2-3 decades. Based on these significant research achievements, now it is desirable to identify a management strategy so that the excessive growth can be controlled and the plant can be used in beneficial ways. In the rural areas, water hyacinth could be used in an integrated manner for decentralized wastewater treatment systems coupled to biogas and compost production from the resulting biomass. There is a need to work out the techno-economic viability of such integrated model systems.

  9. Geospatial technology perspectives for mining vis-a-vis sustainable forest ecosystems

    Directory of Open Access Journals (Sweden)

    Goparaju Laxmi

    2017-06-01

    Full Text Available Forests, the backbone of biogeochemical cycles and life supporting systems, are under severe pressure due to varied anthropogenic activities. Mining activities are one among the major reasons for forest destruction questioning the survivability and sustainability of flora and fauna existing in that area. Thus, monitoring and managing the impact of mining activities on natural resources at regular intervals is necessary to check the status of their depleted conditions, and to take up restoration and conservative measurements. Geospatial technology provides means to identify the impact of different mining operations on forest ecosystems and helps in proposing initiatives for safeguarding the forest environment. In this context, the present study highlights the problems related to mining in forest ecosystems and elucidates how geospatial technology can be employed at various stages of mining activities to achieve a sustainable forest ecosystem. The study collates information from various sources and highlights the role of geospatial technology in mining industries and reclamation process.

  10. First evidence of denitrification vis-a-vis monsoon in the Arabian Sea since late Miocene

    Digital Repository Service at National Institute of Oceanography (India)

    Tripathi, S.; Tiwari, M.; Lee, J.; Khim, B.-K.; Pandey, D.K.; Clift, P.D.; Kulhanek, D.K.; Ando, S.; Bendle, J.A.P.; Aharonovich, S.; Griffith, E.M.; Gurumurthy, G.P.; Hahn, A.; Iwai, M.; Kumar, A.; Kumar, A.G.; Liddy, H.M.; Lu, H.; Lyle, M.W.; Mishra, R.; Radhakrishna, T.; Routledge, C.M.; Saraswat, R.; Saxena, R.; Scardia, G.; Sharma, G.K.; Singh, A.D.; Steinke, S.; Suzuki, K.; Tauxe, L.; Xu, Z.; Yu, Z.

    of Earth Sciences, University of Southern California, 3651 Trousdale Parkway Los Angeles CA 90089, USA. 15School of Geographical and Oceanographical Sciences, Nanjing University, 163 Xianlin Avenue, Nanjing 210023, China. 16College of Earth, Ocean...

  11. The Problem of Scientific Realism Vis-a-Vis the Probabilistic ...

    African Journals Online (AJOL)

    Scientific realism holds that the objects of scientific knowledge exist independently of the minds or activities of scientists and those scientific theories are true of that objective world. This is antithetical to the posits of quantum physics, a body of knowledge taken as the seal of the sciences because of its incredible feat, which ...

  12. Stability of extended scalar diquark stars vis-`a-vis soliton stars

    Indian Academy of Sciences (India)

    50.7 km) obtained for an extended scalar diquark star within the framework of ... ing its stability) within the framework of an effective φ 4-theory described [4,5] by the ..... an award of the Research Scientist Scheme by UGC, New Delhi during the ...

  13. Biomass status vis-a-vis bioenergy prospects and options for India

    International Nuclear Information System (INIS)

    Panigrahhi, M.R.; Overend, R.P.

    1997-01-01

    India has a large biomass energy potential if its underutilized resources are used in modernized biofuels and bioenergy conversion systems. India uses about half traditional and half commercial energy sources. However, with a fast-growing population, a relatively slow-growing economy, and few fossil energy resources, the need to use indigenous resources more efficiency is becoming more pressing. Currently, about 400 million tonnes of biomass (fuel wood, crop residues, and cattle dung) is burnt in millions of traditional cooking stoves, especially in the rural sector. The net energy loss could be as much as 5 EJ. Converting only a fraction of this biomass to biogas, a much cleaner and more efficient fuel, could meet the total cooking requirements of the rural sector. The remainder of the biomass could be converted for use as producer of gas and ethanol. Nearly 15 percent of about 0.6 million villages are unelectrified. Modular power generation using biomass-fueled producer gas-fired generators could meet the rural needs at less cost than grid extensions. Ethanol is already proven in Brazil and the U.S. as a gasoline substitute and extender that mitigates air pollution in urban areas. (author)

  14. Public-Private Partnerships: an International Development vis a vis Indonesia Experience

    Directory of Open Access Journals (Sweden)

    Rizal Yaya

    2014-08-01

    Full Text Available For more than two decades, Public Private Partnerships (PPP had developed worldwide as an instrument to procure public infrastructure where government funds are limited. This practice supports the covergent theory of the public and private sector. Indonesia experience with PPP follows most of what had been done by countries overseas with some deviations. The main reasons for going for PPP for Indonesia government is to fill the gap in finance and capability in procuring the infrastructure. Unofficial reason such as for off-balance sheet and ideological is not relevant. Up to now, the Government only allow investment in hard economic infrastructure. Instead of using pure private finance, Indonesia Government facilitates public funds either from Central Government or Local Governments to finance PPP projects. In most cases, this involvement is because of marginality of the project. This results in the condition where the Government still has dominant role in the existing PPP projects. Compared to the PPP framework in other countries like in the UK, Indonesia PPP lacks of attention on output specification and risk transfer. This may be because of lacking of experiences as well as due to high degree of Government involvement. Rigorous policy is needed in this area to ensure Government to achieve better value for money.

  15. The Achuar People of the Corrientes Basin: The State vis a vis its own Paradigm

    Directory of Open Access Journals (Sweden)

    Alberto Chirif

    2010-12-01

    Full Text Available The paper analyses the events leading to the 2006 uprising of theAchuar people of the Corrientes basin (Loreto, who have sufferedfour decades of contamination due to oil exploitation. It also examinesthe Peruvian State’s and the oil company´s attitudes throughoutthe protest and after signing an agreement aiming to stop contaminationand remedy environmental and social havoc. Materials usedinclude interviews conducted with different stake holders and a widerange of written records, such as political declarations, reports onlocal people´s health´s and remediation work, agreement documentsand letters exchanged between stake holders, as well as historicaland socio economic background information. Findings highlight thestrength of organized indigenous people´s claiming for their rights;the greater commitment to assuming responsibility shown by the oilcompany´s as compared to the Peruvian State; and the weakness ofa political discourse equating development with the extraction ofnatural resources. The main conclusion is that the Peruvian Statedoes not fulfill the paradigm set in the first article of the Constitution:that the defense of the human person and the respect of its dignityare its supreme aim.

  16. Personal vis-a-vis social responsibility for disparities in health status: An issue of justice.

    Science.gov (United States)

    Jha, Ayan; Dobe, Madhumita

    2016-01-01

    Health inequities are disparities which can be avoided through rational actions on the part of policymakers. Such inequalities are unnecessary and unjust and may exist between and within nations, societies, and population groups. Social determinants such as wealth, income, occupation, education, gender, and racial/ethnic groups are the principal drivers of this inequality since they determine the health risks and preventive behaviors, access to, and affordability of health care. Within this framework, there is a debate on assigning a personal responsibility factor over and above societal responsibility to issues of ill health. One school of philosophy argues that when individuals are worse-off than others for no fault of their own, it is unjust, as opposed to health disparities that arise due to avoidable personal choices such as smoking and drug addiction for which there should (can) be a personal responsibility. Opposing thoughts have pointed out that the relative socioeconomic position of an individual dictates how his/her life may progress from education to working conditions and aging, susceptibility to diseases and infirmity, and the consequences thereof. The existence of a social gradient in health outcomes across populations throughout the world is a testimony to this truth. It has been emphasized that assuming personal responsibility for health in public policy-making can only have a peripheral place. Instead, the concept of individual responsibility should be promoted as a positive concept of enabling people to gain control over the determinants of health through conscious, informed, and healthy choices.

  17. Shad Garbhakara Bhavas vis-a-vis congenital and genetic disorders.

    Science.gov (United States)

    Dhiman, Kamini; Kumar, Abhimanayu; Dhiman, K S

    2010-04-01

    Despite the advancements in diagnostic techniques and therapeutic interventions, medical science has failed to keep the incidence of congenital malformations under control. Ayurveda, the ancient Indian medical system has given due emphasis on this and postulated various measures to minimize the risks. These measures start well before conception. According to Ayurvedic principles, proper preparation of the parents is an essential prerequisite for a healthy progeny. Pre-conception care is a set of interventions that identifies biomedical behavioral and social risks to the health of the mother and the baby. It includes both-prevention and management, emphasizing health issues that require action before conception, very early in pregnancy, for maximal impact. For meeting the objective of healthy progeny, Ayurveda scholars felt the importance of six procreative factors (Shadgarbhkarabhavas) such as Matrija, Pitrija, Aatmaja, Rasaja, Satmyaja, and Sattvaja. The conglomeration of these procreative factors is must for healthy progeny. The physical, mental, social, and spiritual well-being of the person, proper nutrition of the mother during pregnancy, and practice of a wholesome regimen, play a prime role in achieving a healthy offspring, thus structuring a healthy family, society, and nation. Negligence toward any of these factors becomes a cause for unhealthy and defective child birth. The present literary / conceptual study, thus focuses mainly on interpreting these observations, on the basis of modern scientific knowledge.

  18. Trading Behavior of Foreign Vis a Vis Local Investors in The Indonesian Stock Market

    Directory of Open Access Journals (Sweden)

    Soemarso Slamet Rahardjo

    2015-04-01

    Full Text Available This paper studies the behavior of foreign, local investors and total market in a stock trading. The analysis is focused on their implementation of positive feedback strategy, the existence of mean reverting process and their sensitivity toward expected capital gain and losses. The result reveals that both of these two investors apply the positive feedback strategy, at a different degree. The investment horizon of the foreign investors is shorter than the local investors. There is a mean reverting pattern in the price volatilities. The convergence period for local investor is 2.4. The market needs 1.8 month. No convergence period for foreign investors. The local investors and total market are neutral toward expected gain and losses. The foreign investors are more sensitive to capital loss. Previous price and volume changes have a leverage effect to the current demand of foreign investors. The local investors are affected by changes in price only.

  19. Usable Security and E-Banking: ease of use vis-a-vis security

    Directory of Open Access Journals (Sweden)

    Morten Hertzum

    2004-05-01

    Full Text Available Electronic banking must be secure and easy to use. An evaluation of six Danish web-based electronic banking systems indicates that the systems have serious weaknesses with respect to ease of use. Our analysis of the weaknesses suggests that security requirements are among their causes and that the weaknesses may in turn cause decreased security. We view the conflict between ease of use and security in the context of usable security, a concept that is intended to match security principles and demands against user knowledge and motivation. Automation, instruction, and understanding can be identified as different approaches to usable security. Instruction is the main approach of the systems evaluated; automation relieves the user from involvement in security, as far as possible; and understanding goes beyond step-by-step instructions, to enable users to act competently and safely in situations that transcend preconceived instructions. We discuss the pros and cons of automation and understanding as alternative approaches to the design of web-based e-banking systems.

  20. Comparing Conventional Bank Credit Vis A Vis Shariah Bank Musharakah: Experimental Economic Approach

    Directory of Open Access Journals (Sweden)

    Muhamad Abduh

    2008-01-01

    Full Text Available Central Bank of Indonesia with dual banking system – i.e Shariah and Conventional Bank – keep on developing system that considered as an answer to generate the national economic growth. One of the banking activities that emphasized by the Central Bank of Indonesia is fund distribution through either conventional bank credit or shariah bank fi nancing. Having the Experimental Economic Approach based on Induced Value Theory and employing ANOVA, this paper found that shariah bank musharakah fi nancing system would come up with higher profi t opportunity compare to conventional credit system. One main reason is that musharakah fi nancing in shariah bank applies profi t and lost sharing (PLS scheme so that will not be a burden to the customer when he fi nd low profi t.Keywords: Credit Loan, Musharakah Financing, Induced Value Theory, Experimental Economic Approach, Analysis of Variance (ANOVA.

  1. Chemical characterization of meltwater from East Rathong glacier vis-a-vis Western Himalayan glaciers

    Digital Repository Service at National Institute of Oceanography (India)

    Sharma, B.M.; Tayal, S.; Chakraborty, P.; Bharat, G.K.

    of (Ca2+ + Mg2+) to the total cations and high value of [(Ca2+ + Mg2+)/(Na+ + K+)] ratio suggests that the major source of dissolved ions in the meltwater is carbonate weathering...

  2. [Agreement and asymmetry. Population and wages vis vis a vis the globalization of the economy].

    Science.gov (United States)

    Jusidman, C

    1991-01-01

    The free flow of labor and services across national borders will be 1 of the most difficult problems of future negotiations for integration of the markets of the US, Mexico, and Canada. The free flow of products and increasingly of capital have been accepted in general terms, and land and natural resources are entering the globalization process through external investment. In the trilateral free trade treaty between Mexico, the US, and Canada, the US is particularly interested in access to the service markets of Canada and Mexico. Mexico would like freer access to the other markets, and to protect its migrant workers. Canada needs foreign labor for its agricultural production. All 3 countries would potentially benefit from more flexible population movement. Mexico, Canada, and the US have very different structures, population dynamics, and labor markets. Mexico's population growth rate is the highest and its active population is increasing the most rapidly. Mexico must generate 1 million new jobs annually, the US requires 2.1 million, and Canada around 230,000. The 3 countries, with about 360 million inhabitants in 1991, must create 3.4 million new jobs annually. Because of differences in occupational and activity structures, levels of skill, salaries, productivity, and cultures of work in the 3 countries, it is clear that the new jobs correspond to different labor markets, making predictions about average salaries difficult. The 1990 average minimum wage in the US was about 10 times that of Mexico, while the average minimum in the manufacturing sector as about 7 times greater. The degree to which the trilateral treaty can contribute to reducing the differential is an important question. 3 possible scenarios suggest themselves. If current restrictions on mobility of workers are maintained, wage disparities will probably continue unless there is a very great foreign investment in activities throughout Mexico that require significant labor inputs. This would probably have a positive effect on unskilled wages. If Mexico does not open its service market, foreign companies would need to train and advance Mexican workers. A 2nd scenario assumes a general easing of restrictions for high-tech services while restrictions remain for unskilled workers. Unemployment among Mexican professionals and technicians in service industries might increase if they were unable to compete. The final scenario represents the longterm possibility of eliminating all restrictions on labor mobility between the 3 countries, which would result in improving the quality of life and working conditions of a large number of persons. Regardless of the outcome, Mexico faces the task of increasing the productivity of its labor force.

  3. Bromination vis-a-vis chlorination as a biocide feasibility study

    International Nuclear Information System (INIS)

    Upadhyay, S.K.; Nagaigh, N.; Mittal, S.

    2000-01-01

    Water is used extensively as a cooling medium in various heat transfer equipment's of a power industry such as condenser, heat exchangers and cooling towers. At elevated temperature, the breeding of microbiological growth can form slimes, underneath of this, accelerated corrosion can take place resulting into sudden and catastrophic failure of equipment's. The microbiological growth unchecked in the various systems especially in low velocity areas can lead to large growth of micro organisms such as algae which can even reduce the flow of the fluid thus affecting the efficiency of plant equipment's. Therefore, chlorination is a mandatory requirement in industrial cooling water to reduce biofouling in heat transfer equipment's. The chlorination in drinking water produces germicidal effect and thus reduces the bacterial counts. At NAPS the water quality is good and mild doses of chlorine (5 ppm) two times a day, as envisaged in design is noticed to be satisfactory. The chlorination of recirculating condenser cooling water presently is being done with the established doses for a fixed time twice a day. Some of the problems noticed with the chlorination process are : Corrosion of constructional material of chlorination plant and equipment's and pipelines causing large input of efforts on maintenance for keeping high availability of the chlorination plant. In addition to this, the leakages in the equipment could be a potential safety hazard. The effectiveness of chlorine is observed to be less in alkaline pH (above 9.0) as encountered at NAPS. This results is large quantities of chlorine injection for extended periods. The cost of chlorine and bleaching powder keeps fluctuating in the market as noticed in past few years. Many a times this results in scarcity of chlorine/bleaching powder causing interruption in biofouling control programme. Hence it was felt prudent to work on the alternative biocides which could be cost effective, non-polluting and nature and user friendly. This paper highlights the brief details on the feasibility studies carried out on bromination. (author)

  4. Rejuvenating direct modulation and direct detection for modern optical communications

    Science.gov (United States)

    Che, Di; Li, An; Chen, Xi; Hu, Qian; Shieh, William

    2018-02-01

    High-speed transoceanic optical fiber transmission using direct modulation (DM) and direct detection (DD) was one of the most stirring breakthroughs for telecommunication in 1990s, which drove the internet as a global phenomenon. However, the later evolution of optical coherent communications in 2000s gradually took over the long-haul applications, due to its superior optical spectral efficiency. Nowadays, DM-DD systems are dominant mainly in cost- and power-sensitive short-reach applications, because of its natural characteristics-the simplicity. This paper reviews the recent advances of DM-DD transceivers from both hardware and signal processing perspectives. It introduces a variety of modified DM and/or DD systems for 3 application scenarios: very-short-reach interconnect with little fiber channel impact; single or a few spans of fiber transmission up to several hundred km; and distance beyond the 2nd scenario. Besides the DM-DD and multi-dimension DM-DD with polarization diversity, this paper focuses on how to rejuvenate traditional DM and DD technologies in order to bridge the transmission application gap between DM-DD and coherent transceivers, using technologies such as dispersion compensation, signal field recovery from the intensity-only DD receiver, and complex direct modulation with coherent detection. More than 30 years since the birth, DM and DD still hold indispensable roles in modern optical communications.

  5. Wind measurement via direct detection lidar

    Science.gov (United States)

    Afek, I.; Sela, N.; Narkiss, N.; Shamai, G.; Tsadka, S.

    2013-10-01

    Wind sensing Lidar is considered a promising technology for high quality wind measurements required for various applications such as hub height wind resource assessment, power curve measurements and advanced, real time, forward looking turbine control. Until recently, the only available Lidar technology was based on coherent Doppler shift detection, whose market acceptance has been slow primarily due to its exuberant price. Direct detection Lidar technology provides an alternative to remote sensing of wind by incorporating high precision measurement, a robust design and an affordable price tag.

  6. Discriminating dark matter candidates using direct detection

    International Nuclear Information System (INIS)

    Belanger, G.; Nezri, E.; Pukhov, A.

    2009-01-01

    We examine the predictions for both the spin-dependent and spin-independent direct detection rates in a variety of new particle physics models with dark matter candidates. We show that a determination of both spin-independent and spin-dependent amplitudes on protons and neutrons can in principle discriminate different candidates of dark matter up to a few ambiguities. We emphasize the importance of making measurements with different spin-dependent sensitive detector materials and the need for significant improvement of the detector sensitivities. Scenarios where exchange of new colored particles contributes significantly to the elastic scattering cross sections are often the most difficult to identify, the LHC should give an indication whether such scenarios are relevant for direct detection.

  7. Directly detecting isospin-violating dark matter

    Science.gov (United States)

    Kelso, Chris; Kumar, Jason; Marfatia, Danny; Sandick, Pearl

    2018-03-01

    We consider the prospects for multiple dark matter direct detection experiments to determine if the interactions of a dark matter candidate are isospin-violating. We focus on theoretically well-motivated examples of isospin-violating dark matter (IVDM), including models in which dark matter interactions with nuclei are mediated by a dark photon, a Z , or a squark. We determine that the best prospects for distinguishing IVDM from the isospin-invariant scenario arise in the cases of dark photon-or Z -mediated interactions, and that the ideal experimental scenario would consist of large exposure xenon- and neon-based detectors. If such models just evade current direct detection limits, then one could distinguish such models from the standard isospin-invariant case with two detectors with of order 100 ton-year exposure.

  8. Directly detecting isospin-violating dark matter

    OpenAIRE

    Kelso, Chris; Kumar, Jason; Marfatia, Danny; Sandick, Pearl

    2018-01-01

    We consider the prospects for multiple dark matter direct detection experiments to determine if the interactions of a dark matter candidate are isospin-violating. We focus on theoretically well-motivated examples of isospin-violating dark matter (IVDM), including models in which dark matter interactions with nuclei are mediated by a dark photon, a Z, or a squark. We determine that the best prospects for distinguishing IVDM from the isospin-invariant scenario arise in the cases of dark photon–...

  9. Dark matter spin determination with directional direct detection experiments

    Science.gov (United States)

    Catena, Riccardo; Conrad, Jan; Döring, Christian; Ferella, Alfredo Davide; Krauss, Martin B.

    2018-01-01

    If dark matter has spin 0, only two WIMP-nucleon interaction operators can arise as leading operators from the nonrelativistic reduction of renormalizable single-mediator models for dark matter-quark interactions. Based on this crucial observation, we show that about 100 signal events at next generation directional detection experiments can be enough to enable a 2 σ rejection of the spin 0 dark matter hypothesis in favor of alternative hypotheses where the dark matter particle has spin 1 /2 or 1. In this context, directional sensitivity is crucial since anisotropy patterns in the sphere of nuclear recoil directions depend on the spin of the dark matter particle. For comparison, about 100 signal events are expected in a CF4 detector operating at a pressure of 30 torr with an exposure of approximately 26,000 cubic-meter-detector days for WIMPs of 100 GeV mass and a WIMP-fluorine scattering cross section of 0.25 pb. Comparable exposures require an array of cubic meter time projection chamber detectors.

  10. Direct detection of Leishmania from clinical samples.

    Science.gov (United States)

    Waitumbi, John N; Bast, Joshua; Nyakoe, Nancy; Magiri, Charles; Quintana, Miguel; Takhampunya, Ratree; Schuster, Anthony L; Van de Wyngaerde, Marshall T; McAvin, James C; Coleman, Russell E

    2017-01-01

    The ability to rapidly and accurately diagnose leishmaniasis is a military priority. Testing was conducted to evaluate diagnostic sensitivity and specificity of field-expedient Leishmania genus and visceral Leishmania specific dual-fluorogenic, hydrolysis probe (TaqMan), polymerase chain reaction assays previously established for use in vector surveillance. Blood samples of patients with confirmed visceral leishmaniasis and controls without the disease from Baringo District, Kenya, were tested. Leishmania genus assay sensitivity was 100% (14/14) and specificity was 84% (16/19). Visceral Leishmania assay sensitivity was 93% (13/14) and specificity 80% (4/5). Cutaneous leishmaniasis (CL) skin scrapes of patients from Honduras were also evaluated. Leishmania genus assay sensitivity was 100% (10/10). Visceral Leishmania assay specificity was 100% (10/10) from cutaneous leishmaniasis samples; no fluorescence above background was reported. These results show promise in a rapid, sensitive, and specific method for Leishmania direct detection from clinical samples.

  11. Coaxial direct-detection lidar-system

    DEFF Research Database (Denmark)

    2014-01-01

    The invention relates to a coaxial direct-detection LIDAR system for measuring velocity, temperature and/or particulate density. The system comprises a laser source for emitting a laser light beam having a lasing center frequency along an emission path. The system further comprises an optical....... Finally, the system comprises a detector system arranged to receive the return signal from the optical delivery system, the detector system comprising a narrowband optical filter and a detector, the narrowband optical filter having a filter center frequency of a pass-band, wherein the center lasing...... frequency and/or the center filter frequency may be scanned. The invention further relates to an aircraft airspeed measurement device, and a wind turbine airspeed measurement device comprising the LIDAR system....

  12. Direct fast neutron detection: A status report

    International Nuclear Information System (INIS)

    Peurrung, A.J.; Hansen, R.R.; Craig, R.A.; Hensley, W.K.; Hubbard, C.W.; Keller, P.E.; Reeder, P.L.; Sunberg, D.S.

    1997-12-01

    This report describes the status of efforts to develop direct fast-neutron detection via proton recoil within plastic scintillator. Since recording proton recoil events is of little practical use without a means to discriminate effectively against gamma-ray interactions, the present effort is concentrated on demonstrating a method that distinguishes between pulse types. The proposed method exploits the different pulse shapes that are to be expected primarily on the basis of the slower speed of the recoiling fission neutrons. Should this effort ultimately prove successful, the resulting novel technology will have the potential to significantly lower cost and increase capability for a number of critical neutron-detection applications. Considerable progress has been made toward a clear and compelling demonstration of this new technique. An exhaustive theoretical and numerical investigation of the method has been completed. The authors have been able to better understand the laboratory results and estimate the performance that could ultimately be achieved using the proposed technique. They have assessed the performance of a number of different algorithms for discriminating between neutron and gamma ray events. The results of this assessment will be critical when the construction of low-cost, field-portable neutron detectors becomes necessary. Finally, a laboratory effort to realize effective discrimination is well underway and has resulted in partial success

  13. EXTRAGALACTIC DARK MATTER AND DIRECT DETECTION EXPERIMENTS

    International Nuclear Information System (INIS)

    Baushev, A. N.

    2013-01-01

    Recent astronomical data strongly suggest that a significant part of the dark matter content of the Local Group and Virgo Supercluster is not incorporated into the galaxy halos and forms diffuse components of these galaxy clusters. A portion of the particles from these components may penetrate the Milky Way and make an extragalactic contribution to the total dark matter containment of our Galaxy. We find that the particles of the diffuse component of the Local Group are apt to contribute ∼12% to the total dark matter density near Earth. The particles of the extragalactic dark matter stand out because of their high speed (∼600 km s –1 ), i.e., they are much faster than the galactic dark matter. In addition, their speed distribution is very narrow (∼20 km s –1 ). The particles have an isotropic velocity distribution (perhaps, in contrast to the galactic dark matter). The extragalactic dark matter should provide a significant contribution to the direct detection signal. If the detector is sensitive only to the fast particles (v > 450 km s –1 ), then the signal may even dominate. The density of other possible types of the extragalactic dark matter (for instance, of the diffuse component of the Virgo Supercluster) should be relatively small and comparable with the average dark matter density of the universe. However, these particles can generate anomaly high-energy collisions in direct dark matter detectors.

  14. Direct progeny detection techniques and random epidemiology

    International Nuclear Information System (INIS)

    Mayya, Y.S.; Mishra, Rosaline; Sapra, B.K.

    2015-01-01

    Over the past 40 years, there has been considerable progress in the measurements methods and their application to the estimates of risks due to radon among general populations. The previous decade saw major development in this regard. It was the direct estimate of indoor radon risk from epidemiological studies in Europe and North America. These were important findings that demonstrated the presence of lung cancer risks at residential radon levels supplementing the generally used risks estimates at high exposures obtained from uranium miner's data. The residential radon epidemiological studies largely used radon concentration as a measure of exposure. The exposure to decay products, which are primarily the dose givers, are assumed to be proportional to the measured gas concentrations. Also, the presence of thoron was neglected in these studies. Although several corrections have appeared to these assessments, the question of variability of actual decay product exposures has largely remained unaddressed. In order to circumvent this limitation, passive techniques were developed to estimate the decay product concentrations directly using deposition monitors. These are based on detecting the alpha particles from decay products deposited on an absorber mounted LR-115 detectors. Known as Direct radon, and Thoron Progeny sensors (DRPS/DTPS), these have been further refined to separate fine fraction from the coarse fraction by wire-mesh capping techniques. Large number environmental calibration exercises and field data generation has been carried out on the progeny concentrations in Indian and some European environments. The development of progeny sensors offers a new tool for future epidemiology. Since in the Indian context, there exist no radon related epidemiological estimates of risk, it is time one conducts large scale studies to seek possible correlations between DRPS/DTPS data and lung cancer risks. While epidemiological studies in High background radiation areas

  15. Direct Detection of Soil-Bound Prions

    Science.gov (United States)

    Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro

    2007-01-01

    Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

  16. Direct detection of soil-bound prions.

    Directory of Open Access Journals (Sweden)

    Sacha Genovesi

    Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.

  17. Direct and indirect detection of supersymmetric dark matter; Detection directe et indirecte de matiere sombre supersymetrique

    Energy Technology Data Exchange (ETDEWEB)

    Mayet, F

    2001-09-01

    A substantial body of astrophysical evidence supports the existence of non-baryonic dark matter in the universe. One of the leading dark matter candidates is the neutralino predicted by the supersymmetric extensions of the standard model of particle physics. Different detectors have been designed for the detection, either indirect or direct, of the neutralino. Related to indirect detection, the present work has been performed in the context of the AMS experiment. A precursor version of the spectrometer was flown on the space shuttle Discovery in June 1998. The detector included an Aerogel Threshold Cherenkov counter (ATC) to identify antiprotons, whose spectrum may be used to infer a neutralino signal. The analysis of the ATC data is presented including an evaluation of the flight performance and a description of the optimization of the antiproton selection. An antiproton analysis is also reported. A phenomenological study allows us to investigate the discovery potential of this indirect method. This thesis also includes the development of a new detector (MACHe3) designed for direct neutralino search using a superfluid {sup 3}He bolometer operated at ultra low temperatures. The data analysis of the prototype cell is presented. A Monte Carlo simulation has been developed, in order to optimize the detector design for direct neutralino search. These results are compared with theoretical predictions of supersymmetric models, thus highlighting the discovery potential of this detector and its complementarity with existing devices. (author)

  18. Inverted dipole feature in directional detection of exothermic dark matter

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Gelmini, Graciela B.; Gondolo, Paolo

    2017-01-01

    Directional dark matter detection attempts to measure the direction of motion of nuclei recoiling after having interacted with dark matter particles in the halo of our Galaxy. Due to Earth's motion with respect to the Galaxy, the dark matter flux is concentrated around a preferential direction. An anisotropy in the recoil direction rate is expected as an unmistakable signature of dark matter. The average nuclear recoil direction is expected to coincide with the average direction of dark matter particles arriving to Earth. Here we point out that for a particular type of dark matter, inelastic exothermic dark matter, the mean recoil direction as well as a secondary feature, a ring of maximum recoil rate around the mean recoil direction, could instead be opposite to the average dark matter arrival direction. Thus, the detection of an average nuclear recoil direction opposite to the usually expected direction would constitute a spectacular experimental confirmation of this type of dark matter.

  19. Phenomenological introduction to direct dark matter detection

    International Nuclear Information System (INIS)

    Gondolo, P.

    1996-01-01

    The dark matter of our galactic halo may be constituted by elementary particles that interact weakly with with ordinary matter (WIMPs). In spite of the very low counting rates expected for these dark matter particle to scatter off nuclei in a laboratory detector, such direct WIMP searches are possible and are experimentally carried out at present. An introduction to the theoretical ingredients entering the counting rates predictions, together with a short discussion of the major theoretical uncertainties, is here presented. (author)

  20. Course 6. dark matter: direct detection

    International Nuclear Information System (INIS)

    Chardin, G.

    2000-01-01

    Determining the precise nature of dark matter is one of the main open questions of contemporary physics. The search for non-baryonic dark matter is strongly motivated by present data and 3 particle candidates: wimps (weakly interactive massive particles), axions and massive neutrinos are actively searched by several experiments (GENIUS, HDMS, CDMS, EDELWEISS, LLNL, CARRACK, SOLAX, DAMA,...). In this course the author reviews and summarizes the experimental situation and analyzes the main detection strategies developed to identify the dark matter candidates. (A.C.)

  1. Indirect detection of radiation sources through direct detection of radiolysis products

    Science.gov (United States)

    Farmer, Joseph C [Tracy, CA; Fischer, Larry E [Los Gatos, CA; Felter, Thomas E [Livermore, CA

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  2. Current status of direct dark matter detection experiments

    Science.gov (United States)

    Liu, Jianglai; Chen, Xun; Ji, Xiangdong

    2017-03-01

    Much like ordinary matter, dark matter might consist of elementary particles, and weakly interacting massive particles are one of the prime suspects. During the past decade, the sensitivity of experiments trying to directly detect them has improved by three to four orders of magnitude, but solid evidence for their existence is yet to come. We overview the recent progress in direct dark matter detection experiments and discuss future directions.

  3. Readout technologies for directional WIMP Dark Matter detection

    International Nuclear Information System (INIS)

    Battat, J.B.R.; Irastorza, I.G.; Aleksandrov, A.; Asada, T.; Baracchini, E.; Billard, J.; Bosson, G.; Bourrion, O.; Bouvier, J.; Buonaura, A.; Burdge, K.; Cebrián, S.

    2016-01-01

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  4. Direct 13C NMR Detection in HPLC Hyphenation Mode

    DEFF Research Database (Denmark)

    Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils

    2012-01-01

    Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments...... application of HPLC-SPE-NMR analysis using direct-detected (13)C NMR spectra. HPLC column loading, accumulative SPE trappings, and the effect of different elution solvents were evaluated and optimized. A column loading of approximately 600 mug of a prefractionated triterpenoid mixture, six trappings...

  5. Direct detection of the optical field beyond single polarization mode.

    Science.gov (United States)

    Che, Di; Sun, Chuanbowen; Shieh, William

    2018-02-05

    Direct detection is traditionally regarded as a detection method that recovers only the optical intensity. Compared with coherent detection, it owns a natural advantage-the simplicity-but lacks a crucial capability of field recovery that enables not only the multi-dimensional modulation, but also the digital compensation of the fiber impairments linear with the optical field. Full-field detection is crucial to increase the capacity-distance product of optical transmission systems. A variety of methods have been investigated to directly detect the optical field of the single polarization mode, which normally sends a carrier traveling with the signal for self-coherent detection. The crux, however, is that any optical transmission medium supports at least two propagating modes (e.g. single mode fiber supports two polarization modes), and until now there is no direct detection that can recover the complete set of optical fields beyond one polarization, due to the well-known carrier fading issue after mode demultiplexing induced by the random mode coupling. To avoid the fading, direct detection receivers should recover the signal in an intensity space isomorphic to the optical field without loss of any degrees of freedom, and a bridge should be built between the field and its isomorphic space for the multi-mode field recovery. Based on this thinking, we propose, for the first time, the direct detection of dual polarization modes by a novel receiver concept, the Stokes-space field receiver (SSFR) and its extension, the generalized SSFR for multiple spatial modes. The idea is verified by a dual-polarization field recovery of a polarization-multiplexed complex signal over an 80-km single mode fiber transmission. SSFR can be applied to a much wider range of fields beyond optical communications such as coherent sensing and imaging, where simple field recovery without an extra local laser is desired for enhanced system performance.

  6. Clinical and economic outcomes of Acinetobacter vis a vis non-Acinetobacter infections in an Indian teaching hospital

    Directory of Open Access Journals (Sweden)

    Priyendu Asim

    2016-01-01

    Full Text Available Context: Acinetobacter infections are a major nosocomial infection causing epidemics of infection in the Intensive Care Units (ICU. Aims: This study estimates the clinical and economic outcomes of Acinetobacter infections and compares them with those of non-Acinetobacter bacterial infections. Settings and Design: Prospective cross-sectional observational study carried out for 6 months in the medicine ICU of a tertiary care hospital. Materials and Methods: Patients were divided in two groups, one group with Acinetobacter infections and the other with non-Acinetobacter infections. The data was collected for infection, length of stay (LOS, mortality and cost along with patient demographics from the hospital records for analysis. Statistical Analysis Used: The data was analyzed using Statistical Package for the Social Sciences Version 15.0. The LOS and cost of treatment (COT for the two groups were compared using the nonparametric Mann–Whitney U-test. Results: A total of 220 patients were studied out of which 91 had Acinetobacter infections. The median LOS was 20 days in Group-A and 12 days in Group-B (P < 0.0001. The median COT was INR 125,862 in Group-A and INR 68,228 in the Group-B (P < 0.0001. Mortality in Group-A and Group-B was 32.97 and 32.56 (P = 0.949 respectively. Conclusion: The burden of Acinetobacter infections in ICUs is increasing with the increase in LOS and COT for the patients. The infection control team has to play a major role in reducing the rate of nosocomial infections.

  7. Global end-diastolic volume an emerging preload marker vis-a-vis other markers - Have we reached our goal?

    Directory of Open Access Journals (Sweden)

    P M Kapoor

    2016-01-01

    Full Text Available A reliable estimation of cardiac preload is helpful in the management of severe circulatory dysfunction. The estimation of cardiac preload has evolved from nuclear angiography, pulmonary artery catheterization to echocardiography, and transpulmonary thermodilution (TPTD. Global end-diastolic volume (GEDV is the combined end-diastolic volumes of all the four cardiac chambers. GEDV has been demonstrated to be a reliable preload marker in comparison with traditionally used pulmonary artery catheter-derived pressure preload parameters. Recently, a new TPTD system called EV1000™ has been developed and introduced into the expanding field of advanced hemodynamic monitoring. GEDV has emerged as a better preload marker than its previous conventional counterparts. The advantage of it being measured by minimum invasive methods such as PiCCO™ and newly developed EV1000™ system makes it a promising bedside advanced hemodynamic parameter.

  8. Reassessment of Business Courses in Foreign Languages: The European Union vis-a-vis Its Individual Members.

    Science.gov (United States)

    von Schmidt, Wolff

    The need for advanced (fourth-year) college business courses taught in foreign languages by foreign language teachers, and the design of such courses, are discussed. It is proposed that such courses be offered more often, generally in French, German, and Spanish and preferably over two semesters or three quarters, with a minimum of 3 contact hours…

  9. Spirituality vis-a-vis Islam as prerequisite to Arab American well being: the implications of Eurocentrism for mainstream psychology.

    Science.gov (United States)

    Hall, Ronald E; Breland-Noble, Alfiee

    2011-01-01

    Due to the historical preponderance of racial and/or intellectual homogeneity in the field of psychology, Eurocentrism set the "gold standard" for its method of intervention. As such, it might be argued that psychology remains a bastion of Eurocentric thought despite the globalization of knowledge and the influx of racially and ethnically diverse scientists into the research endeavor. At the same time and the significant increase in the immigrant Arab population, Arab Americans remain a less familiar component of society. Among the various Arab populations, spirituality through Islam is fundamental. Thus, psychologists would be remiss to exclude a critical aspect of Arab American life from intervention when it is essential to well-being.

  10. Assessing thermochromatography as a separation method for nuclear forensics. Current capability vis-a-vis forensic requirements

    International Nuclear Information System (INIS)

    Hanson, D.E.; Garrison, J.R.; Hall, H.L.

    2011-01-01

    Nuclear forensic science has become increasingly important for global nuclear security. However, many current laboratory analysis techniques are based on methods developed without the imperative for timely analysis that underlies the post-detonation forensics mission requirements. Current analysis of actinides, fission products, and fuel-specific materials requires time-consuming chemical separation coupled with nuclear counting or mass spectrometry. High-temperature gas-phase separations have been used in the past for the rapid separation of newly created elements/isotopes and as a basis for chemical classification of that element. We are assessing the utility of this method for rapid separation in the gas-phase to accelerate the separations of radioisotopes germane to post-detonation nuclear forensic investigations. The existing state of the art for thermo chromatographic separations, and its applicability to nuclear forensics, will be reviewed. (author)

  11. Special features of nuclear waste repository ventilation system VIS-A-VIS experiences at the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    Sethi, S.C.

    1991-01-01

    The paper presents an analysis and discussion of the underground ventilation system at the Waste Isolation Pilot Plant (WIPP). Particular emphasis is placed on specific repository-related requirements and the gradual evolution of engineering designs relative to the WIPP Project scope. The ventilation system for a nuclear waste facility similar to WIPP is designed to provide a suitable environment for personnel and equipment during normal activities. It is also designed to provide confinement and channeling of potential airborne radioactive material in the event of an accidental release. It is desirable to identify and design all parallel activities and the required process equipment prior to completion of the repository mine final design. Such factors as ventilation requirements, drift sizes, bulkhead sizes, and placement are dependent on these items. Mine creep closure properties must be factored into the mine and ventilation equipment design considerations. Effects of natural ventilation pressures deserve due consideration in the design. Mine ventilation requirements are dominated by the diesel equipment to be operated in the underground horizon. WIPP engineers have also found it extremely desirable to have automated real-time monitoring and control for the underground ventilation air. Final testing and balancing of the ventilation system is an extremely important startup requirement. 3 refs., 2 figs

  12. INAA of trace elements in Indian vegetarian diet and its adequacy vis-a-vis Recommended Dietary Allowances

    International Nuclear Information System (INIS)

    Singh, V.; Garg, A.N.

    1997-01-01

    There has been an increasing awareness concerning the adequacy of trace elements in diet as their deficiency or excess may cause abnormal changes in the biochemical processes. Typical Indian vegetarian diet and dietary components such as cereals, grains, pulses, vegetables and spices have been analysed for 19 elements (Br, Cl, Co, Cr, Cu, Fe, Hg, K, Mn, Mo, Na, P, Rb, Sb, Sc, Se, Sr, Th and Zn) by instrumental neutron activation analysis (INAA). Several Standard Reference Materials (SRMs) were analysed for quality assurance. Based on the elemental contents, the daily dietary intake has been calculated and the data compared with those from other countries, Recommended Dietary Allowances (RDAs) and permissible body burden. It has been observed that, although vegetarian, the Indian diet has an adequate content of essential trace elements compared to non-vegetarian oriental (Japan and Taiwan) and western (Germany, Denmark and USA) diets. (author)

  13. Heterozygosity and Fixation Index for ABO Gene in Barak Valley Populations vis-a-vis a Few Exotic Populations

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2011-03-01

    Full Text Available In a genetic study of 26 human populations including 2 major endogamous populations (Hindus and Muslims of Barak Valley in Assam and 24 exotic populations, observed heterozygosity (Ho, fixation index (F and Panmictic index (P for ABO gene were estimated from gene frequency data to reveal the extent of inbreeding that has taken place in each population during evolution. Observed heterozygosity, a measure of genetic variation, ranged from 0.3254 to 0.6086 in these populations. Expected Hardy-Weinberg heterozygosity of ABO gene was estimated as 0.6666 assuming the occurrence of all the three alleles in equal frequency. Fixation index was the highest in the population of Sudan (51.18% followed by Australia (48.51% and Iceland (38.28% indicating the occurrence of high inbreeding and the presence of more homozygosity in these populations during evolution. But the fixation index was the lowest in the population of South China (8.70% followed by Central Asia (11.82% and Russia (12.96%. It suggested the occurrence of low inbreeding and hence more outbreeding in these populations resulting in the existence of more heterozygosity (high genetic variation in these populations. Panmictic index, a measure of outbreeding, is the opposite of fixation index and it varied from 48.82 (Sudan to 91.30% (South China. The population showing the highest fixation index recorded the lowest panmictic index and vice-versa. In evolutionary context, outbreeding in human populations would be more desirable to reduce the incidence of genetic diseases caused by recessive genes and to enhance heterozygosity for those loci for better adaptation of future generations, possibly at the cost of gradually increasing genetic load in the population.

  14. Onset of local ordering in some copper-based alloys: critical solute concentration vis-a-vis various solutionhardening parameters

    Science.gov (United States)

    Butt, Muhammad Zakria; Noshi, Mozina; Bashir, Farooq

    2008-12-01

    The mode of planar distribution of solute atoms in Cu single crystals alloyed with 0.5 to 8.0 at.%Ge has been investigated via the temperature dependence of the critical resolved shear stress of these alloys. It is found that there exists a critical solute concentration c m ≈ 5 at.%Ge below which the distribution of solute atoms in the crystal is random, and above which some local ordering occurs. This together with such data available in the literature for Cu-Zn, Cu-Al and Cu-Mn alloys, i.e. c m ≈7 at. %Zn, 7 at.%Al and 1 at.%Mn, when examined as a function of the size-misfit factor δ = (1/ b)(d b/d c)of a given binary alloy system, shows that the value of c m strongly depends on δ; the smaller the magnitude of δ, the greater the value of c m and vice versa. Also, the value of c m is found to correlate well with the electron-to-atom ratio ( e/a)of the Cu-Zn, Cu-Al, Cu-Ge and Cu-Mn alloys with the solute concentration c = c m . However, no systematic correlation exists between the critical solute concentration c m for the onset of local ordering and the modulus-mismatch parameter η = (1/ G)(d G/d c).

  15. What Perspectives for Crisis Resolution? Which European Diplomacy vis-a-vis Iran's Nuclear Ambitions?

    International Nuclear Information System (INIS)

    Moscovici, Pierre

    2008-01-01

    The conduct of European diplomacy on the Iranian dossier raises many geopolitical issues. What are the strategic possibilities for the European Union? Its credibility is at stake and it must now demonstrate that its alternative approach is more efficient than American policy, which seeks to use the Iranian nuclear dispute as an element of struggle against the Iranian regime. However, the multiplicity of decision-making structures of the EU foreign policy make more complex its action and the implementation of its policies, that are articulated between diplomatic efforts and threats of sanctions. Where the United States has chosen containment, the EU chooses the commitment and sees the return to dialogue and stabilization possible

  16. Effects of gamma irradiation on chickpea seeds vis-a-vis total seed storage proteins, antioxidant activity and protein profiling.

    Science.gov (United States)

    Bhagyawant, S S; Gupta, N; Shrivastava, N

    2015-10-23

    The present work describes radiation—induced effects on seed composition vis—à—vis total seed proteins, antioxidant levels and protein profiling employing two dimensional gel electrophoresis (2D—GE) in kabuli and desi chickpea varities. Seeds were exposed to the radiation doses of 1,2,3,4 and 5 kGy. The total protein concentrations decreased and antioxidant levels were increased with increasing dose compared to control seed samples. Radiation induced effects were dose dependent to these seed parameters while it showed tolerance to 1 kGy dose. Increase in the dose was complimented with increase in antioxidant levels, like 5 kGy enhanced % scavenging activities in all the seed extracts. Precisely, the investigations reflected that the dose range from 2 to 5 kGy was effective for total seed storage proteins, as depicted quantitatively and qualitative 2D—GE means enhance antioxidant activities in vitro.

  17. Assembly of gamma radiation detection with directivity properties

    International Nuclear Information System (INIS)

    Stoica, M.; Talpalariu, C.

    2016-01-01

    An assembly of gamma radiation detection with directivity properties and small size enables the development of portable equipment or robots specialized in finding and signaling radioactively contaminated areas in case of nuclear incidents or decommissioning of nuclear installations. Directivity characteristic of the assembly of gamma radiation detection is very important when aiming to build an equipment for searching radioactively contaminated areas. In order to obtain a suitable directivity characteristics in terms of detection of gamma rays, it was necessary to construct a lead collimator with a cylindrical shape. The detector, preamplifier and amplifier pulse were placed inside the collimator and pulse discriminator circuit and power source were placed beside the collimator, all being disposed within the housing cylindrical experimental. A PIN photodiode type was used as a detector of gamma radiation. (authors)

  18. Can the Existence of Dark Energy be Directly Detected?

    Energy Technology Data Exchange (ETDEWEB)

    Perl, Martin L.; /SLAC /KIPAC, Menlo Park

    2011-11-23

    The majority of astronomers and physicists accept the reality of dark energy and also believe that it can only be studied indirectly through observation of the motions of stars and galaxies. In this paper I open the experimental question of whether it is possible to directly detect dark energy through the presence of dark energy density. Two thirds of this paper outlines the major aspects of dark energy density as now comprehended by the astronomical and physics community. The final third summarizes various proposals for direct detection of dark energy density or its possible effects. At this time I do not have a fruitful answer to the question: Can the Existence of Dark Energy Be Directly Detected?

  19. Optimized velocity distributions for direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Ibarra, Alejandro; Rappelt, Andreas, E-mail: ibarra@tum.de, E-mail: andreas.rappelt@tum.de [Physik-Department T30d, Technische Universität München, James-Franck-Straße, 85748 Garching (Germany)

    2017-08-01

    We present a method to calculate, without making assumptions about the local dark matter velocity distribution, the maximal and minimal number of signal events in a direct detection experiment given a set of constraints from other direct detection experiments and/or neutrino telescopes. The method also allows to determine the velocity distribution that optimizes the signal rates. We illustrate our method with three concrete applications: i) to derive a halo-independent upper limit on the cross section from a set of null results, ii) to confront in a halo-independent way a detection claim to a set of null results and iii) to assess, in a halo-independent manner, the prospects for detection in a future experiment given a set of current null results.

  20. Direct detection of antihydrogen atoms using a BGO crystal

    Energy Technology Data Exchange (ETDEWEB)

    Nagata, Y. [Department of Applied Physics, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei-shi, 184-8588 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Kuroda, N., E-mail: kuroda@phys.c.u-tokyo.ac.jp [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Ohtsuka, M. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Leali, M.; Lodi-Rizzini, E.; Mascagna, V. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Tajima, M.; Torii, H.A. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Zurlo, N. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Matsuda, Y. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Venturelli, L. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Yamazaki, Y. [Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan)

    2016-12-21

    The ASACUSA collaboration has developed a detector consisting of a large size BGO crystal to detect an atomic antihydrogen beam, and performed the direct detection of antihydrogen atoms. Energy spectra from antihydrogen annihilation on the BGO crystal are discussed in comparison to simulation results from the GEANT4 toolkit. Background mainly originating from cosmic rays were strongly suppressed by analyzing the energy deposited in the BGO and requiring a multiplicity of charged pions. Thus antihydrogen events were identified.

  1. Direct detection of neutralino dark matter in the NMSSM

    International Nuclear Information System (INIS)

    Cerdeno, David G

    2006-01-01

    The direct detection of neutralino dark matter is analysed in the Next-to-Minimal Supersymmetric Standard Model (NMSSM). Sizable values for the neutralino detection cross section, within the reach of dark matter detectors, are attainable, due to the exchange of very light Higgses, which have a significant singlet composition. The lightest neutralino exhibits a large singlino-Higgsino composition, and a mass in the range 50 ∼ χ -0 1 ∼< 100 GeV

  2. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    Science.gov (United States)

    2015-01-01

    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  3. Working Group Report: WIMP Dark Matter Direct Detection

    International Nuclear Information System (INIS)

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-01-01

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  4. Evading direct dark matter detection in Higgs portal models

    Energy Technology Data Exchange (ETDEWEB)

    Arcadi, Giorgio [Max Planck Institut für Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); Gross, Christian, E-mail: christian.gross@helsinki.fi [Department of Physics and Helsinki Institute of Physics, Gustaf Hällströmin katu 2, FI-00014 Helsinki (Finland); Lebedev, Oleg [Department of Physics and Helsinki Institute of Physics, Gustaf Hällströmin katu 2, FI-00014 Helsinki (Finland); Pokorski, Stefan [Institute of Theoretical Physics, University of Warsaw, Pasteura 5, PL-02-093 Warsaw (Poland); Toma, Takashi [Physik-Department T30d, Technische Universität München, James-Franck-Straße, D-85748 Garching (Germany)

    2017-06-10

    Many models of Higgs portal Dark Matter (DM) find themselves under pressure from increasingly tight direct detection constraints. In the framework of gauge field DM, we study how such bounds can be relaxed while retaining the thermal WIMP paradigm. When the hidden sector gauge symmetry is broken via the Higgs mechanism, the hidden sector generally contains unstable states which are lighter than dark matter. These states provide DM with an efficient annihilation channel. As a result, the DM relic abundance and the direct detection limits are controlled by different parameters, and the two can easily be reconciled. This simple setup realizes the idea of “secluded” dark matter naturally.

  5. Working Group Report: WIMP Dark Matter Direct Detection

    Energy Technology Data Exchange (ETDEWEB)

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-10-30

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  6. Light Magnetic Dark Matter in Direct Detection Searches

    DEFF Research Database (Denmark)

    Del Nobile, Eugenio; Kouvaris, Christoforos; Panci, Paolo

    2012-01-01

    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out...

  7. Direct detection of the inflationary gravitational-wave background

    International Nuclear Information System (INIS)

    Smith, Tristan L.; Kamionkowski, Marc; Cooray, Asantha

    2006-01-01

    Inflation generically predicts a stochastic background of gravitational waves over a broad range of frequencies, from those accessible with cosmic microwave background (CMB) measurements, to those accessible directly with gravitational-wave detectors, like NASA's Big-Bang Observer (BBO) or Japan's Deci-Hertz Interferometer Gravitational-wave Observer (DECIGO), both currently under study. Here we investigate the detectability of the inflationary gravitational-wave background at BBO/DECIGO frequencies. To do so, we survey a range of slow-roll inflationary models consistent with constraints from the CMB and large-scale structure (LSS). We go beyond the usual assumption of power-law power spectra, which may break down given the 16 orders of magnitude in frequency between the CMB and direct detection, and solve instead the inflationary dynamics for four classes of inflaton potentials. Direct detection is possible in a variety of inflationary models, although probably not in any in which the gravitational-wave signal does not appear in the CMB polarization. However, direct detection by BBO/DECIGO can help discriminate between inflationary models that have the same slow-roll parameters at CMB/LSS scales

  8. Development and deployment of the Collimated Directional Radiation Detection System

    Science.gov (United States)

    Guckes, Amber L.; Barzilov, Alexander

    2017-09-01

    The Collimated Directional Radiation Detection System (CDRDS) is capable of imaging radioactive sources in two dimensions (as a directional detector). The detection medium of the CDRDS is a single Cs2LiYCl6:Ce3+ scintillator cell enriched in 7Li (CLYC-7). The CLYC-7 is surrounded by a heterogeneous high-density polyethylene (HDPE) and lead (Pb) collimator. These materials make-up a coded aperture inlaid in the collimator. The collimator is rotated 360° by a stepper motor which enables time-encoded imaging of a radioactive source. The CDRDS is capable of spectroscopy and pulse shape discrimination (PSD) of photons and fast neutrons. The measurements of a radioactive source are carried out in discrete time steps that correlate to the angular rotation of the collimator. The measurement results are processed using a maximum likelihood expectation (MLEM) algorithm to create an image of the measured radiation. This collimator design allows for the directional detection of photons and fast neutrons simultaneously by utilizing only one CLYC-7 scintillator. Directional detection of thermal neutrons can also be performed by utilizing another suitable scintillator. Moreover, the CDRDS is portable, robust, and user friendly. This unit is capable of utilizing wireless data transfer for possible radiation mapping and network-centric applications. The CDRDS was tested by performing laboratory measurements with various gamma-ray and neutron sources.

  9. Sol-gel matrices for direct colorimetric detection of analytes

    Science.gov (United States)

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2000-01-01

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  10. Analysis of the theoretical bias in dark matter direct detection

    International Nuclear Information System (INIS)

    Catena, Riccardo

    2014-01-01

    Fitting the model ''A'' to dark matter direct detection data, when the model that underlies the data is ''B'', introduces a theoretical bias in the fit. We perform a quantitative study of the theoretical bias in dark matter direct detection, with a focus on assumptions regarding the dark matter interactions, and velocity distribution. We address this problem within the effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. We analyze 24 benchmark points in the parameter space of the theory, using frequentist and Bayesian statistical methods. First, we simulate the data of future direct detection experiments assuming a momentum/velocity dependent dark matter-nucleon interaction, and an anisotropic dark matter velocity distribution. Then, we fit a constant scattering cross section, and an isotropic Maxwell-Boltzmann velocity distribution to the simulated data, thereby introducing a bias in the analysis. The best fit values of the dark matter particle mass differ from their benchmark values up to 2 standard deviations. The best fit values of the dark matter-nucleon coupling constant differ from their benchmark values up to several standard deviations. We conclude that common assumptions in dark matter direct detection are a source of potentially significant bias

  11. Direct detection of dark matter bound to the Earth

    DEFF Research Database (Denmark)

    Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    We study the properties and direct detection prospects of an as of yet neglected population of dark matter (DM) particles moving in orbits gravitationally bound to the Earth. This DM population is expected to form via scattering by nuclei in the Earth's interior. We compute fluxes and nuclear...

  12. Dark matter directional detection in non-relativistic effective theories

    International Nuclear Information System (INIS)

    Catena, Riccardo

    2015-01-01

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF 4 , CS 2 and 3 He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments

  13. Directional detection of dark matter with two-dimensional targets

    Science.gov (United States)

    Hochberg, Yonit; Kahn, Yonatan; Lisanti, Mariangela; Tully, Christopher G.; Zurek, Kathryn M.

    2017-09-01

    We propose two-dimensional materials as targets for direct detection of dark matter. Using graphene as an example, we focus on the case where dark matter scattering deposits sufficient energy on a valence-band electron to eject it from the target. We show that the sensitivity of graphene to dark matter of MeV to GeV mass can be comparable, for similar exposure and background levels, to that of semiconductor targets such as silicon and germanium. Moreover, a two-dimensional target is an excellent directional detector, as the ejected electron retains information about the angular dependence of the incident dark matter particle. This proposal can be implemented by the PTOLEMY experiment, presenting for the first time an opportunity for directional detection of sub-GeV dark matter.

  14. Direct versus indirect detection of supersymmetric dark matter

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    This document gathers the slides that were presented during the workshop 'direct versus indirect detection of supersymmetric dark matter'(about 30 contributions). This workshop intended to bring together people from the particle theory community, astrophysicists and cosmologists, as well as experimentalists involved in the detection of dark matter. The aim is to generate a discussion about current and future strategies for detection of SUSY dark matter (with focus, but not exclusively, on neutralinos). Complementarities between accelerator, direct and indirect searches as well as a comparison between the uncertainties in direct and indirect searches of dark matter, are supposed to be discussed. Among the issues which will be addressed are: -) the crucial questions related to the structure of galaxies (local dark matter density, clumping, anomalous velocity distributions, etc.) ; -) the possibilities offered by the present and future experimental facilities for direct and indirect (photon, neutrino) searches; -) the potential for the discovery of SUSY at LHC and beyond; and -) the parameterization of the SUSY breaking models beyond the minimal versions.

  15. Direct versus indirect detection of supersymmetric dark matter

    International Nuclear Information System (INIS)

    2003-01-01

    This document gathers the slides that were presented during the workshop 'direct versus indirect detection of supersymmetric dark matter'(about 30 contributions). This workshop intended to bring together people from the particle theory community, astrophysicists and cosmologists, as well as experimentalists involved in the detection of dark matter. The aim is to generate a discussion about current and future strategies for detection of SUSY dark matter (with focus, but not exclusively, on neutralinos). Complementarities between accelerator, direct and indirect searches as well as a comparison between the uncertainties in direct and indirect searches of dark matter, are supposed to be discussed. Among the issues which will be addressed are: -) the crucial questions related to the structure of galaxies (local dark matter density, clumping, anomalous velocity distributions, etc.) ; -) the possibilities offered by the present and future experimental facilities for direct and indirect (photon, neutrino) searches; -) the potential for the discovery of SUSY at LHC and beyond; and -) the parameterization of the SUSY breaking models beyond the minimal versions

  16. The XENON project for dark matter direct detection at LNGS

    Science.gov (United States)

    Molinario, Andrea

    2017-12-01

    The XENON project at INFN Laboratori Nazionali del Gran Sasso, Italy, aims at dark matter direct detection with liquid xenon dual-phase time projection chambers. Latest results of XENON100 detector exclude various models of leptophilic dark matter. A search for low mass weakly interacting massive particles was also performed, lowering the energy threshold for detection to 0.7 keV for nuclear recoils. The multi-ton XENON1T detector is fully installed and operating. It is expected to reach a sensitivity a factor 100 better than XENON100 with a 2 ton·year exposure.

  17. Neutron stars at the dark matter direct detection frontier

    Science.gov (United States)

    Raj, Nirmal; Tanedo, Philip; Yu, Hai-Bo

    2018-02-01

    Neutron stars capture dark matter efficiently. The kinetic energy transferred during capture heats old neutron stars in the local galactic halo to temperatures detectable by upcoming infrared telescopes. We derive the sensitivity of this probe in the framework of effective operators. For dark matter heavier than a GeV, we find that neutron star heating can set limits on the effective operator cutoff that are orders of magnitude stronger than possible from terrestrial direct detection experiments in the case of spin-dependent and velocity-suppressed scattering.

  18. Exploring light mediators with low-threshold direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kahlhoefer, Felix [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); RWTH Aachen Univ. (Germany). Inst. for Theoretical Particle Physics and Cosmology; Kulkarni, Suchita [Oesterreichische Akademie der Wissenschaften, Vienna (Austria). Inst. fuer Hochenergiephysik; Wild, Sebastian [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2017-11-15

    We explore the potential of future cryogenic direct detection experiments to determine the properties of the mediator that communicates the interactions between dark matter and nuclei. Due to their low thresholds and large exposures, experiments like CRESST-III, SuperCDMS SNOLAB and EDELWEISS-III will have excellent capability to reconstruct mediator masses in the MeV range for a large class of models. Combining the information from several experiments further improves the parameter reconstruction, even when taking into account additional nuisance parameters related to background uncertainties and the dark matter velocity distribution. These observations may offer the intriguing possibility of studying dark matter self-interactions with direct detection experiments.

  19. Hunting electroweakinos at future hadron colliders and direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Cortona, Giovanni Grilli di [SISSA - International School for Advanced Studies,Via Bonomea 265, I-34136 Trieste (Italy); INFN - Sezione di Trieste,via Valerio 2, I-34127 Trieste (Italy)

    2015-05-07

    We analyse the mass reach for electroweakinos at future hadron colliders and their interplay with direct detection experiments. Motivated by the LHC data, we focus on split supersymmetry models with different electroweakino spectra. We find for example that a 100 TeV collider may explore Winos up to ∼7 TeV in low scale gauge mediation models or thermal Wino dark matter around 3 TeV in models of anomaly mediation with long-lived Winos. We show moreover how collider searches and direct detection experiments have the potential to cover large part of the parameter space even in scenarios where the lightest neutralino does not contribute to the whole dark matter relic density.

  20. Exploring light mediators with low-threshold direct detection experiments

    International Nuclear Information System (INIS)

    Kahlhoefer, Felix

    2017-11-01

    We explore the potential of future cryogenic direct detection experiments to determine the properties of the mediator that communicates the interactions between dark matter and nuclei. Due to their low thresholds and large exposures, experiments like CRESST-III, SuperCDMS SNOLAB and EDELWEISS-III will have excellent capability to reconstruct mediator masses in the MeV range for a large class of models. Combining the information from several experiments further improves the parameter reconstruction, even when taking into account additional nuisance parameters related to background uncertainties and the dark matter velocity distribution. These observations may offer the intriguing possibility of studying dark matter self-interactions with direct detection experiments.

  1. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  2. Inelastic Boosted Dark Matter at direct detection experiments

    OpenAIRE

    Giudice, Gian F.; Kim, Doojin; Park, Jong-Chul; Shin, Seodong

    2018-01-01

    We explore a novel class of multi-particle dark sectors, called Inelastic Boosted Dark Matter (iBDM). These models are constructed by combining properties of particles that scatter off matter by making transitions to heavier states (Inelastic Dark Matter) with properties of particles that are produced with a large Lorentz boost in annihilation processes in the galactic halo (Boosted Dark Matter). This combination leads to new signals that can be observed at ordinary direct detection experimen...

  3. Direct Detection of Oil; Case History From Iran

    International Nuclear Information System (INIS)

    Tabatabaee, S. H.

    2007-01-01

    Iran is one of the main petroleum producers and also one of the countries which experiences contemporary geophysical techniques in Middle East region. Main aim of this study is direct detection of oil hydrocarbons by a special geophysical technique. To accomplish that, FEM, TEM and IP integrated geophysical techniques were successfully applied to measure IP phase shift which might relate to existence of oil traps. Target penetration for this prospecting is about 6 kms

  4. Dark matter direct detection with non-Maxwellian velocity structure

    International Nuclear Information System (INIS)

    Kuhlen, Michael; Weiner, Neal; Diemand, Jürg; Moore, Ben; Potter, Doug; Stadel, Joachim; Madau, Piero; Zemp, Marcel

    2010-01-01

    The velocity distribution function of dark matter particles is expected to show significant departures from a Maxwell-Boltzmann distribution. This can have profound effects on the predicted dark matter - nucleon scattering rates in direct detection experiments, especially for dark matter models in which the scattering is sensitive to the high velocity tail of the distribution, such as inelastic dark matter (iDM) or light (few GeV) dark matter (LDM), and for experiments that require high energy recoil events, such as many directionally sensitive experiments. Here we determine the velocity distribution functions from two of the highest resolution numerical simulations of Galactic dark matter structure (Via Lactea II and GHALO), and study the effects for these scenarios. For directional detection, we find that the observed departures from Maxwell-Boltzmann increase the contrast of the signal and change the typical direction of incoming DM particles. For iDM, the expected signals at direct detection experiments are changed dramatically: the annual modulation can be enhanced by more than a factor two, and the relative rates of DAMA compared to CDMS can change by an order of magnitude, while those compared to CRESST can change by a factor of two. The spectrum of the signal can also change dramatically, with many features arising due to substructure. For LDM the spectral effects are smaller, but changes do arise that improve the compatibility with existing experiments. We find that the phase of the modulation can depend upon energy, which would help discriminate against background should it be found

  5. Directional genomic hybridization for chromosomal inversion discovery and detection.

    Science.gov (United States)

    Ray, F Andrew; Zimmerman, Erin; Robinson, Bruce; Cornforth, Michael N; Bedford, Joel S; Goodwin, Edwin H; Bailey, Susan M

    2013-04-01

    Chromosomal rearrangements are a source of structural variation within the genome that figure prominently in human disease, where the importance of translocations and deletions is well recognized. In principle, inversions-reversals in the orientation of DNA sequences within a chromosome-should have similar detrimental potential. However, the study of inversions has been hampered by traditional approaches used for their detection, which are not particularly robust. Even with significant advances in whole genome approaches, changes in the absolute orientation of DNA remain difficult to detect routinely. Consequently, our understanding of inversions is still surprisingly limited, as is our appreciation for their frequency and involvement in human disease. Here, we introduce the directional genomic hybridization methodology of chromatid painting-a whole new way of looking at structural features of the genome-that can be employed with high resolution on a cell-by-cell basis, and demonstrate its basic capabilities for genome-wide discovery and targeted detection of inversions. Bioinformatics enabled development of sequence- and strand-specific directional probe sets, which when coupled with single-stranded hybridization, greatly improved the resolution and ease of inversion detection. We highlight examples of the far-ranging applicability of this cytogenomics-based approach, which include confirmation of the alignment of the human genome database and evidence that individuals themselves share similar sequence directionality, as well as use in comparative and evolutionary studies for any species whose genome has been sequenced. In addition to applications related to basic mechanistic studies, the information obtainable with strand-specific hybridization strategies may ultimately enable novel gene discovery, thereby benefitting the diagnosis and treatment of a variety of human disease states and disorders including cancer, autism, and idiopathic infertility.

  6. Direct and indirect detection of dissipative dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Fan, JiJi; Katz, Andrey; Shelton, Jessie, E-mail: jijifan1982@gmail.com, E-mail: katz.andrey@gmail.com, E-mail: jshelton137@gmail.com [Department of Physics, Harvard University, Cambridge, MA 02138 (United States)

    2014-06-01

    We study the constraints from direct detection and solar capture on dark matter scenarios with a subdominant dissipative component. This dissipative dark matter component in general has both a symmetric and asymmetric relic abundance. Dissipative dynamics allow this subdominant dark matter component to cool, resulting in its partial or total collapse into a smaller volume inside the halo (e.g., a dark disk) as well as a reduced thermal velocity dispersion compared to that of normal cold dark matter. We first show that these features considerably relax the limits from direct detection experiments on the couplings between standard model (SM) particles and dissipative dark matter. On the other hand, indirect detection of the annihilation of the symmetric dissipative dark matter component inside the Sun sets stringent and robust constraints on the properties of the dissipative dark matter. In particular, IceCube observations force dissipative dark matter particles with mass above 50 GeV to either have a small coupling to the SM or a low local density in the solar system, or to have a nearly asymmetric relic abundance. Possible helioseismology signals associated with purely asymmetric dissipative dark matter are discussed, with no present constraints.

  7. Direct and indirect detection of dissipative dark matter

    International Nuclear Information System (INIS)

    Fan, JiJi; Katz, Andrey; Shelton, Jessie

    2014-01-01

    We study the constraints from direct detection and solar capture on dark matter scenarios with a subdominant dissipative component. This dissipative dark matter component in general has both a symmetric and asymmetric relic abundance. Dissipative dynamics allow this subdominant dark matter component to cool, resulting in its partial or total collapse into a smaller volume inside the halo (e.g., a dark disk) as well as a reduced thermal velocity dispersion compared to that of normal cold dark matter. We first show that these features considerably relax the limits from direct detection experiments on the couplings between standard model (SM) particles and dissipative dark matter. On the other hand, indirect detection of the annihilation of the symmetric dissipative dark matter component inside the Sun sets stringent and robust constraints on the properties of the dissipative dark matter. In particular, IceCube observations force dissipative dark matter particles with mass above 50 GeV to either have a small coupling to the SM or a low local density in the solar system, or to have a nearly asymmetric relic abundance. Possible helioseismology signals associated with purely asymmetric dissipative dark matter are discussed, with no present constraints

  8. Halo-Independent Direct Detection Analyses Without Mass Assumptions

    CERN Document Server

    Anderson, Adam J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the $m_\\chi-\\sigma_n$ plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the $v_{min}-\\tilde{g}$ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from $v_{min}$ to nuclear recoil momentum ($p_R$), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call $\\tilde{h}(p_R)$. The entire family of conventional halo-independent $\\tilde{g}(v_{min})$ plots for all DM masses are directly found from the single $\\tilde{h}(p_R)$ plot through a simple re...

  9. Collider, direct and indirect detection of supersymmetric dark matter

    International Nuclear Information System (INIS)

    Baer, Howard; Park, Eun-Kyung; Tata, Xerxes

    2009-01-01

    We present an overview of supersymmetry (SUSY) searches, both at collider experiments and via searches for dark matter (DM). We focus on three DM possibilities in the SUSY context: the thermally produced neutralino, a mixture of axion and axino, and the gravitino, and compare and contrast signals that may be expected at colliders, in direct detection (DD) experiments searching of DM relics left over from the Big Bang, and indirect detection (ID) experiments designed to detect the products of DM annihilations within the solar interior or galactic halo. Detection of DM particles using multiple strategies provides complementary information that may shed light on the new physics associated with the DM sector. In contrast to the minimal supergravity (mSUGRA) model where the measured cold DM relic density restricts us to special regions mostly on the edge of the m 0 -m 1/2 plane, the entire parameter plane becomes allowed if the universality assumption is relaxed in models with just one additional parameter. Then, thermally produced neutralinos with a well-tempered mix of wino, bino and higgsino components, or with a mass adjusted so that their annihilation in the early Universe is Higgs-resonance-enhanced, can be the DM. Well-tempered neutralinos typically yield heightened rates for DD and ID experiments compared with generic predictions from mSUGRA. If instead DM consists of axinos (possibly together with axions) or gravitinos, then there exists the possibility of detection of quasi-stable next-to-lightest SUSY particles at colliding beam experiments, with especially striking consequences if the next-lightest-supersymmetric-particle (NLSP) is charged, but no DD or ID detection. The exception for mixed axion/axino DM is that DD of axions may be possible.

  10. Direct detection of non-baryonic dark matter

    International Nuclear Information System (INIS)

    Nollez, G.

    2003-01-01

    Baryonic matter, which constitutes stars and galaxies, amounts to a few percents of the mass of the universe in agreement with the theory of the big-bang nucleosynthesis. Most of the matter in the universe (approximately 85%) is then non-baryonic and dark. One of the most favoured hypothesis is that this non-baryonic dark matter is constituted by a new type, still undiscovered, of elementary weakly interacting massive particles (wimps). These hypothetical particles would appear as thermal relics from the big-bang era during which they were created. A rich spectrum of new elementary particles is predicted by supersymmetry, the lightest of which is the neutralino. If the dark matter halo of our Milky-way is made of neutralinos, their detection in terrestrial detectors should be possible. Neutralinos are coupled to matter through the electroweak interaction, this implies that the detection rate is extraordinary low. About 10 experiments in the world are dedicated to the search after wimps. A first group of experiments (HDMS, IGEX, DAMA and Zeplin) use 'classical' detectors of nuclear physics, germanium semiconductor diodes or NaI scintillators. A second group (CDMS, Edelweiss) gathers cryogenic phonon ionisation experiments and a third group (CRESST, Rosebud) is based on cryogenic phonon-light experiments. Till now no wimps has been clearly detected, the direct detection story is obviously not concluded, most of the future experiments aim to reach a sensitivity of 10 -44 cm 2 . (A.C.)

  11. Congratulations on the direct detection of gravitational waves

    CERN Multimedia

    2016-01-01

    This week saw the announcement of an extraordinary physics result: the first direct detection of gravitational waves by the LIGO Scientific Collaboration, which includes the GEO team, and the Virgo Collaboration, using the twin Laser Interferometer Gravitational-wave Observatory (LIGO) detectors located in Livingston, Louisiana, and Hanford, Washington, USA.   Albert Einstein predicted gravitational waves in a paper published 100 years ago in 1916. They are a natural consequence of the theory of general relativity, which describes the workings of gravity and was published a few months earlier. Until now, they have remained elusive. Gravitational waves are tiny ripples in space-time produced by violent gravitational phenomena. Because the fractional change in the space-time geometry can be at the level of 10-21 or smaller, extremely sophisticated, high-sensitivity instruments are needed to detect them. Recently, the Advanced LIGO detector increased its sensitivity by alm...

  12. Prospects for the direct detection of the cosmic neutrino background

    International Nuclear Information System (INIS)

    Ringwald, Andreas

    2009-01-01

    The existence of a cosmic neutrino background - the analogue of the cosmic microwave background - is a fundamental prediction of standard big bang cosmology. Up to now, the observational evidence for its existence is rather indirect and rests entirely on cosmological observations of, e.g., the light elemental abundances, the anisotropies in the cosmic microwave background, and the large scale distribution of matter. Here, we review more direct, weak interaction based detection techniques for the cosmic neutrino background in the present epoch and in our local neighbourhood. We show that, with current technology, all proposals are still off by some orders of magnitude in sensitivity to lead to a guaranteed detection of the relic neutrinos. The most promising laboratory search, based on neutrino capture on beta decaying nuclei, may be done in future experiments designed to measure the neutrino mass through decay kinematics.

  13. Optical filtering in directly modulated/detected OOFDM systems.

    Science.gov (United States)

    Sánchez, C; Ortega, B; Wei, J L; Capmany, J

    2013-12-16

    This work presents a theoretical investigation on the performance of directly modulated/detected (DM/DD) optical orthogonal frequency division multiplexed (OOFDM) systems subject to optical filtering. The impact of both linear and nonlinear distortion effects are taken into account to calculate the effective signal-to-noise ratio of each subcarrier. These results are then employed to optimize the design parameters of two simple optical filtering structures: a Mach Zehnder interferometer and a uniform fiber Bragg grating, leading to a significant optical power budget improvement given by 3.3 and 3dB, respectively. These can be further increased to 5.5 and 4.2dB respectively when balanced detection configurations are employed. We find as well that this improvement is highly dependent on the clipping ratio.

  14. Prospects for the direct detection of the cosmic neutrino background

    International Nuclear Information System (INIS)

    Ringwald, Andreas

    2009-01-01

    The existence of a cosmic neutrino background - the analogue of the cosmic microwave background - is a fundamental prediction of standard big bang cosmology. Up to now, the observational evidence for its existence is rather indirect and rests entirely on cosmological observations of, e.g., the light elemental abundances, the anisotropies in the cosmic microwave background, and the large scale distribution of matter. Here, we review more direct, weak interaction based detection techniques for the cosmic neutrino background in the present epoch and in our local neighbourhood. We show that, with current technology, all proposals are still off by some orders of magnitude in sensitivity to lead to a guaranteed detection of the relic neutrinos. The most promising laboratory search, based on neutrino capture on beta decaying nuclei, may be done in future experiments designed to measure the neutrino mass through decay kinematics. (orig.)

  15. Theoretical antineutrino detection, direction and ranging at long distances

    Energy Technology Data Exchange (ETDEWEB)

    Jocher, Glenn R., E-mail: gjocher@integrity-apps.com [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Bondy, Daniel A., E-mail: dbondy@integrity-apps.com [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Dobbs, Brian M., E-mail: Brian.M.Dobbs.ctr@nga.mil [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Dye, Stephen T., E-mail: sdye@phys.hawaii.edu [College of Natural Sciences, Hawaii Pacific University, Kaneohe, HI 96744 (United States); Department of Physics and Astronomy, University of Hawaii, Honolulu, HI, 96822 (United States); Georges, James A., E-mail: James.A.Georges.ctr@nga.mil [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Learned, John G., E-mail: jgl@phys.hawaii.edu [Department of Physics and Astronomy, University of Hawaii, Honolulu, HI, 96822 (United States); Mulliss, Christopher L., E-mail: Christopher.L.Mulliss.ctr@nga.mil [Integrity Applications Incorporated, 15020 Conference Center Drive, Chantilly, VA, 20151 (United States); Usman, Shawn, E-mail: Shawn.Usman@nga.mil [InnoVision Basic and Applied Research Office, Sensor Geopositioning Center, National Geospatial-Intelligence Agency, 7500 GEOINT Dr., Springfield, VA, 22150 (United States)

    2013-06-20

    In this paper we introduce the concept of what we call “NUDAR” (NeUtrino Direction and Ranging), making the point that measurements of the observed energy and direction vectors can be employed to passively deduce the exact three-dimensional location and thermal power of geophysical and anthropogenic neutrino sources from even a single detector. Earlier studies have presented the challenges of long-range detection, dominated by the unavoidable inverse-square falloff in neutrinos, which force the use of kiloton scale detectors beyond a few kilometers. Earlier work has also presented the case for multiple detectors, and has reviewed the background challenges. We present the most precise background estimates to date, all handled in full three dimensions, as functions of depth and geographical location. For the present calculations, we consider a hypothetical 138 kiloton detector which can be transported to an ocean site and deployed to an operational depth. We present a Bayesian estimation framework to incorporate any a priori knowledge of the reactor that we are trying to detect, as well as the estimated uncertainty in the background and the oscillation parameters. Most importantly, we fully employ the knowledge of the reactor spectrum and the distance-dependent effects of neutrino oscillations on such spectra. The latter, in particular, makes possible determination of range from one location, given adequate signal statistics. Further, we explore the rich potential of improving detection with even modest improvements in individual neutrino direction determination. We conclude that a 300 MW{sub th} reactor can indeed be geolocated, and its operating power estimated with one or two detectors in the hundred kiloton class at ranges out to a few hundred kilometers. We note that such detectors would have natural and non-interfering utility for scientific studies of geo-neutrinos, neutrino oscillations, and astrophysical neutrinos. This motivates the development of cost

  16. On the direct detection of {sup 229m}Th

    Energy Technology Data Exchange (ETDEWEB)

    Wense, Lars von der

    2017-02-03

    The measurement of time has always been an important tool in science and society. Today's most precise time and frequency measurements are performed with optical atomic clocks. However, these clocks could potentially be outperformed by a ''nuclear clock'', which employs a nuclear transition instead of an atomic shell transition for time measurement. Among the 176 000 known nuclear excited states, there is only one nuclear state that would allow for the development of a nuclear clock using currently available technology. This is the isomeric first excited state of {sup 229}Th, denoted as {sup 229m}Th. Despite 40 years of past research, no direct decay detection of this nuclear state has so far been achieved. In this thesis, measurements are described that have led to the first direct detection of the ground-state decay of {sup 229m}Th. Two decay channels (radiative decay and internal conversion) are experimentally investigated. Only the investigation of the internal conversion decay channel has led to the successful observation of the first excited isomeric nuclear state of {sup 229}Th. Based on this direct detection, a new nuclear laser excitation scheme for {sup 229m}Th is proposed. This excitation scheme circumvents the general assumed requirement of a better knowledge of the isomeric energy value, thereby paving the way for nuclear laser spectroscopy of {sup 229m}Th. Many of the presented results have so far been unpublished. This includes results of the investigation of a potential radiative decay channel of {sup 229m}Th, a negative result in the search for an isomeric decay during extraction of {sup 229}Th{sup 1+}, investigation of the isomeric decay in thorium molecules and on an MgF{sub 2}-coated surface, as well as a first report of the isomeric half-life for neutral {sup 229}Th.

  17. Revisiting the direct detection of dark matter in simplified models

    OpenAIRE

    Li, Tong

    2018-01-01

    In this work we numerically re-examine the loop-induced WIMP-nucleon scattering cross section for the simplified dark matter models and the constraint set by the latest direct detection experiment. We consider a fermion, scalar or vector dark matter component from five simplified models with leptophobic spin-0 mediators coupled only to Standard Model quarks and dark matter particles. The tree-level WIMP-nucleon cross sections in these models are all momentum-suppressed. We calculate the non-s...

  18. Edge-detect interpolation for direct digital periapical images

    International Nuclear Information System (INIS)

    Song, Nam Kyu; Koh, Kwang Joon

    1998-01-01

    The purpose of this study was to aid in the use of the digital images by edge-detect interpolation for direct digital periapical images using edge-deted interpolation. This study was performed by image processing of 20 digital periapical images; pixel replication, linear non-interpolation, linear interpolation, and edge-sensitive interpolation. The obtained results were as follows ; 1. Pixel replication showed blocking artifact and serious image distortion. 2. Linear interpolation showed smoothing effect on the edge. 3. Edge-sensitive interpolation overcame the smoothing effect on the edge and showed better image.

  19. Detailed noise statistics for an optically preamplified direct detection receiver

    DEFF Research Database (Denmark)

    Danielsen, Søren Lykke; Mikkelsen, Benny; Durhuus, Terji

    1995-01-01

    We describe the exact statistics of an optically preamplified direct detection receiver by means of the moment generating function. The theory allows an arbitrary shaped electrical filter in the receiver circuit. The moment generating function (MGF) allows for a precise calculation of the error...... rate by using the inverse Fast Fourier transform (FFT). The exact results are compared with the usual Gaussian approximation (GA), the saddlepoint approximation (SAP) and the modified Chernoff bound (MCB). This comparison shows that the noise is not Gaussian distributed for all values of the optical...... and calculate the sensitivity degradation due to inter symbol interference (ISI)...

  20. Simultaneous mass detection for direct inlet mass spectrometry

    International Nuclear Information System (INIS)

    Gordon, R.L.

    1979-05-01

    The evolution of analytical techniques for application in trace analysis has led to interest in practical methods for real-time monitoring. Direct inlet mass spectrometry (DIMS) has been the subject of considerable activity in recent years. A DIMS instrument is described which consists of an inlet system designed to permit particles entrained in the inlet air stream to strike a hot, oxidized rhenium filament which serves as a surface ionization source. A mass analyzer and detection system then permits identification of the elemental composition of particulates which strike the filament

  1. Unstable gravitino dark matter prospects for indirect and direct detection

    International Nuclear Information System (INIS)

    Grefe, Michael

    2011-11-01

    We confront the signals expected from unstable gravitino dark matter with observations of indirect dark matter detection experiments in all possible cosmic-ray channels. For this purpose we calculate in detail the gravitino decay widths in theories with bilinear violation of R parity, particularly focusing on decay channels with three particles in the final state. Based on these calculations we predict the fluxes of gamma rays, charged cosmic rays and neutrinos expected from decays of gravitino dark matter. Although the predicted spectra could in principal explain the anomalies observed in the cosmic ray positron and electron fluxes as measured by PAMELA and Fermi LAT, we find that this possibility is ruled out by strong constraints from gamma-ray and antiproton observations. Therefore, we employ current data of indirect detection experiments to place strong constraints on the gravitino lifetime and the strength of R-parity violation. In addition, we discuss the prospects of forthcoming searches for a gravitino signal in the spectrum of cosmic-ray antideuterons, finding that they are in particular sensitive to rather low gravitino masses. Finally, we discuss in detail the prospects for detecting a neutrino signal from gravitino dark matter decays, finding that the sensitivity of neutrino telescopes like IceCube is competitive to observations in other cosmic ray channels, especially for rather heavy gravitinos. Moreover, we discuss the prospects for a direct detection of gravitino dark matter via R-parity violating inelastic scatterings off nucleons. We find that, although the scattering cross section is considerably enhanced compared to the case of elastic gravitino scattering, the expected signal is many orders of magnitude too small in order to hope for a detection in underground detectors. (orig.)

  2. Unstable gravitino dark matter prospects for indirect and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Grefe, Michael

    2011-11-15

    We confront the signals expected from unstable gravitino dark matter with observations of indirect dark matter detection experiments in all possible cosmic-ray channels. For this purpose we calculate in detail the gravitino decay widths in theories with bilinear violation of R parity, particularly focusing on decay channels with three particles in the final state. Based on these calculations we predict the fluxes of gamma rays, charged cosmic rays and neutrinos expected from decays of gravitino dark matter. Although the predicted spectra could in principal explain the anomalies observed in the cosmic ray positron and electron fluxes as measured by PAMELA and Fermi LAT, we find that this possibility is ruled out by strong constraints from gamma-ray and antiproton observations. Therefore, we employ current data of indirect detection experiments to place strong constraints on the gravitino lifetime and the strength of R-parity violation. In addition, we discuss the prospects of forthcoming searches for a gravitino signal in the spectrum of cosmic-ray antideuterons, finding that they are in particular sensitive to rather low gravitino masses. Finally, we discuss in detail the prospects for detecting a neutrino signal from gravitino dark matter decays, finding that the sensitivity of neutrino telescopes like IceCube is competitive to observations in other cosmic ray channels, especially for rather heavy gravitinos. Moreover, we discuss the prospects for a direct detection of gravitino dark matter via R-parity violating inelastic scatterings off nucleons. We find that, although the scattering cross section is considerably enhanced compared to the case of elastic gravitino scattering, the expected signal is many orders of magnitude too small in order to hope for a detection in underground detectors. (orig.)

  3. Dark matter and exotic neutrino interactions in direct detection searches

    Energy Technology Data Exchange (ETDEWEB)

    Bertuzzo, Enrico [Departamento de Física Matemática, Instituto de Física, Universidade de São Paulo,R. do Matão 1371, CEP. 05508-090, São Paulo (Brazil); Deppisch, Frank F. [Department of Physics and Astronomy, University College London,London WC1E 6BT (United Kingdom); Kulkarni, Suchita [Institut für Hochenergiephysik, Österreichische Akademie der Wissenschaften,Nikolsdorfer Gasse 18, 1050 Wien (Austria); Gonzalez, Yuber F. Perez; Funchal, Renata Zukanovich [Departamento de Física Matemática, Instituto de Física, Universidade de São Paulo,R. do Matão 1371, CEP. 05508-090, São Paulo (Brazil)

    2017-04-12

    We investigate the effect of new physics interacting with both Dark Matter (DM) and neutrinos at DM direct detection experiments. Working within a simplified model formalism, we consider vector and scalar mediators to determine the scattering of DM as well as the modified scattering of solar neutrinos off nuclei. Using existing data from LUX as well as the expected sensitivity of LUX-ZEPLIN and DARWIN, we set limits on the couplings of the mediators to quarks, neutrinos and DM. Given the current limits, we also assess the true DM discovery potential of direct detection experiments under the presence of exotic neutrino interactions. In the case of a vector mediator, we show that the DM discovery reach of future experiments is affected for DM masses m{sub χ}≲10 GeV or DM scattering cross sections σ{sub χ}≲10{sup −47} cm{sup 2}. On the other hand, a scalar mediator will not affect the discovery reach appreciably.

  4. Understanding WIMP-baryon interactions with direct detection: a roadmap

    International Nuclear Information System (INIS)

    Gluscevic, Vera; Peter, Annika H.G.

    2014-01-01

    We study prospects of dark-matter direct-detection searches for probing non-relativistic effective theory for WIMP-baryon scattering. We simulate a large set of noisy recoil-energy spectra for different scattering scenarios (beyond the standard momentum-independent contact interaction), for Generation 2 and futuristic experiments. We analyze these simulations and quantify the probability of successfully identifying the operator governing the scattering, if a WIMP signal is observed. We find that the success rate depends on a combination of factors: the WIMP mass, the mediator mass, the type of interaction, and the experimental energy window. For example, for a 20 GeV WIMP, Generation 2 is only likely to identify the right operator if the interaction is Coulomb-like, and is unlikely to do so in any other case. For a WIMP with a mass of 200 GeV or higher, success is almost guaranteed. We also find that, regardless of the scattering model and the WIMP parameters, a single Generation 2 experiment is unlikely to successfully discern the momentum dependence of the underlying operator on its own, but prospects improve drastically when experiments with different target materials and energy windows are analyzed jointly. Furthermore, we examine the quality of parameter estimation and degeneracies in the multi-dimensional parameter space of the effective theory. We find in particular that the resulting WIMP mass estimates can be severely biased if data are analyzed assuming the standard (momentum-independent) operator while the actual operator has momentum-dependence. Finally, we evaluate the ultimate reach of direct detection, finding that the prospects for successful operator selection prior to reaching the irreducible backgrounds are excellent, if the signal is just below the current limits, but slim if Generation 2 does not report WIMP detection

  5. Direct and dynamic detection of HIV-1 in living cells.

    Directory of Open Access Journals (Sweden)

    Jonas Helma

    Full Text Available In basic and applied HIV research, reliable detection of viral components is crucial to monitor progression of infection. While it is routine to detect structural viral proteins in vitro for diagnostic purposes, it previously remained impossible to directly and dynamically visualize HIV in living cells without genetic modification of the virus. Here, we describe a novel fluorescent biosensor to dynamically trace HIV-1 morphogenesis in living cells. We generated a camelid single domain antibody that specifically binds the HIV-1 capsid protein (CA at subnanomolar affinity and fused it to fluorescent proteins. The resulting fluorescent chromobody specifically recognizes the CA-harbouring HIV-1 Gag precursor protein in living cells and is applicable in various advanced light microscopy systems. Confocal live cell microscopy and super-resolution microscopy allowed detection and dynamic tracing of individual virion assemblies at the plasma membrane. The analysis of subcellular binding kinetics showed cytoplasmic antigen recognition and incorporation into virion assembly sites. Finally, we demonstrate the use of this new reporter in automated image analysis, providing a robust tool for cell-based HIV research.

  6. Development of a novel gamma probe for detecting radiation direction

    Science.gov (United States)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  7. Development of a novel gamma probe for detecting radiation direction

    International Nuclear Information System (INIS)

    Pani, R.; Pellegrini, R.; Cinti, M.N.; Longo, M.; Donnarumma, R.; Borrazzo, C.; D'Alessio, A.; Pergola, A.; Ridolfi, S.; Vincentis, G. De

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security

  8. Halo-independent direct detection analyses without mass assumptions

    International Nuclear Information System (INIS)

    Anderson, Adam J.; Fox, Patrick J.; Kahn, Yonatan; McCullough, Matthew

    2015-01-01

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the m χ −σ n plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the v min −g-tilde plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from v min to nuclear recoil momentum (p R ), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call h-til-tilde(p R ). The entire family of conventional halo-independent g-tilde(v min ) plots for all DM masses are directly found from the single h-tilde(p R ) plot through a simple rescaling of axes. By considering results in h-tilde(p R ) space, one can determine if two experiments are inconsistent for all masses and all physically possible halos, or for what range of dark matter masses the results are inconsistent for all halos, without the necessity of multiple g-tilde(v min ) plots for different DM masses. We conduct a sample analysis comparing the CDMS II Si events to the null results from LUX, XENON10, and SuperCDMS using our method and discuss how the results can be strengthened by imposing the physically reasonable requirement of a finite halo escape velocity

  9. Direct detection of glucuronide metabolites of lidocaine in sheep urine.

    Science.gov (United States)

    Doran, Gregory S; Smith, Alistair K; Rothwell, Jim T; Edwards, Scott H

    2018-02-15

    The anaesthetic lidocaine is metabolised quickly to produce a series of metabolites, including several hydroxylated metabolites, which are further metabolised by addition of a glucuronic acid moiety. Analysis of these glucuronide metabolites in urine is performed indirectly by cleaving the glucuronic acid group using β-glucuronidase. However, direct analysis of intact glucuronide conjugates is a more straightforward approach as it negates the need for long hydrolysis incubations, and minimises the oxidation of sensitive hydrolysis products, while also distinguishing between the two forms of hydroxylated metabolites. A method was developed to identify three intact glucuronides of lidocaine in sheep urine using LC-MS/MS, which was further confirmed by the synthesis of glucuronide derivatives of 3OH-MEGX and 4OH-LIDO. Direct analysis of urine allowed the detection of the glucuronide metabolites of hydroxylidocaine (OH-LIDO), hydroxyl-monoethylglycinexylidide (OH-MEGX), and hydroxy-2,6-xylidine (OH-XYL). Analysis of urine before and after β-glucuronidase digestion showed that the efficiency of hydrolysis of these glucuronide metabolites may be underestimated in some studies. Analysis of urine in the current study from three different sheep with similar glucuronide metabolite concentrations resulted in different hydrolysis efficiencies, which may have been a result of different levels of substrate binding by matrix components, preventing enzyme cleavage. The use of direct analysis of intact glucuronides has the benefit of being less influenced by these matrix effects, while also allowing analysis of unstable metabolites like 4OH-XYL, which rapidly oxidises after hydrolysis. Additionally, direct analysis is less expensive and less time consuming, while providing more information about the status of hydroxylated metabolites in urine. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  10. Ultrafast electron microscopy integrated with a direct electron detection camera

    Directory of Open Access Journals (Sweden)

    Young Min Lee

    2017-07-01

    Full Text Available In the past decade, we have witnessed the rapid growth of the field of ultrafast electron microscopy (UEM, which provides intuitive means to watch atomic and molecular motions of matter. Yet, because of the limited current of the pulsed electron beam resulting from space-charge effects, observations have been mainly made to periodic motions of the crystalline structure of hundreds of nanometers or higher by stroboscopic imaging at high repetition rates. Here, we develop an advanced UEM with robust capabilities for circumventing the present limitations by integrating a direct electron detection camera for the first time which allows for imaging at low repetition rates. This approach is expected to promote UEM to a more powerful platform to visualize molecular and collective motions and dissect fundamental physical, chemical, and materials phenomena in space and time.

  11. Ultrafast electron microscopy integrated with a direct electron detection camera.

    Science.gov (United States)

    Lee, Young Min; Kim, Young Jae; Kim, Ye-Jin; Kwon, Oh-Hoon

    2017-07-01

    In the past decade, we have witnessed the rapid growth of the field of ultrafast electron microscopy (UEM), which provides intuitive means to watch atomic and molecular motions of matter. Yet, because of the limited current of the pulsed electron beam resulting from space-charge effects, observations have been mainly made to periodic motions of the crystalline structure of hundreds of nanometers or higher by stroboscopic imaging at high repetition rates. Here, we develop an advanced UEM with robust capabilities for circumventing the present limitations by integrating a direct electron detection camera for the first time which allows for imaging at low repetition rates. This approach is expected to promote UEM to a more powerful platform to visualize molecular and collective motions and dissect fundamental physical, chemical, and materials phenomena in space and time.

  12. From quarks to nucleons in dark matter direct detection

    Science.gov (United States)

    Bishara, Fady; Brod, Joachim; Grinstein, Benjamin; Zupan, Jure

    2017-11-01

    We provide expressions for the nonperturbative matching of the effective field theory describing dark matter interactions with quarks and gluons to the effective theory of nonrelativistic dark matter interacting with nonrelativistic nucleons. We give expressions of leading and subleading order in chiral counting. In general, a single partonic operator matches onto several nonrelativistic operators already at leading order in chiral counting. Keeping only one operator at the time in the nonrelativistic effective theory thus does not properly describe the scattering in direct detection. The matching of the axial-axial partonic level operator, as well as the matching of the operators coupling DM to the QCD anomaly term, include naively momentum suppressed terms. However, these are still of leading chiral order due to pion poles and can be numerically important.

  13. Inelastic Boosted Dark Matter at direct detection experiments

    Science.gov (United States)

    Giudice, Gian F.; Kim, Doojin; Park, Jong-Chul; Shin, Seodong

    2018-05-01

    We explore a novel class of multi-particle dark sectors, called Inelastic Boosted Dark Matter (iBDM). These models are constructed by combining properties of particles that scatter off matter by making transitions to heavier states (Inelastic Dark Matter) with properties of particles that are produced with a large Lorentz boost in annihilation processes in the galactic halo (Boosted Dark Matter). This combination leads to new signals that can be observed at ordinary direct detection experiments, but require unconventional searches for energetic recoil electrons in coincidence with displaced multi-track events. Related experimental strategies can also be used to probe MeV-range boosted dark matter via their interactions with electrons inside the target material.

  14. ASSESSING ASTROPHYSICAL UNCERTAINTIES IN DIRECT DETECTION WITH GALAXY SIMULATIONS

    International Nuclear Information System (INIS)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M.; Governato, Fabio

    2016-01-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  15. ASSESSING ASTROPHYSICAL UNCERTAINTIES IN DIRECT DETECTION WITH GALAXY SIMULATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M. [Department of Physics and Astronomy, Rutgers University, Piscataway, NJ 08854 (United States); Governato, Fabio [Astronomy Department, University of Washington, Box 351580, Seattle, WA 98195-1580 (United States)

    2016-11-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  16. Direct and Indirect Dark Matter Detection in Gauge Theories

    Energy Technology Data Exchange (ETDEWEB)

    Queiroz, Farinaldo [Federal Univ. of Paraba (Brazil)

    2013-01-01

    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.

  17. Direct Detection of Polarized, Scattered Light from Exoplanets

    Science.gov (United States)

    Laughlin, Gregory

    We propose to radically advance the state of exoplanet characterization, which lags dramatically behind exoplanet discovery. We propose to directly detect scattered light from the atmospheres of close-in, highly eccentric, and extended/non-spherical exoplanets and thereby determine the following: orbital inclination (and therefore masses free of the M sin i mass ambiguity), geometric albedo, presence or lack of hazes and cloud layers, and scattering particle size and composition. Such measurements are crucial to the understanding of exoplanet atmospheres, because observations with NASA s Hubble, Spitzer, and Kepler space telescopes present the following questions: 1) Do exoplanets have highly reflective haze layers? 2) How does the upper atmospheric composition differ between exoplanets with and without thermal inversions? 3) What are the optical manifestations of the extreme heating of highly eccentric exoplanets? 4) Are the atmospheres of certain exoplanets truly escaping their Roche lobes? Using the POLISH2 polarimeter developed by the Postdoctoral Associate (Wiktorowicz) for the Lick 3-m telescope, we propose to monitor the linear polarization state of exoplanet host stars at the part per million level. POLISH2 consistently delivers nearly photon shot noise limited measurements with this precision. In addition, the simultaneous full-Stokes measurements of POLISH2 and the equatorial mount of the Lick 3-m telescope ensure that systematic effects are mitigated to the part per million level. Indeed, we find the accuracy of the POLISH2 polarimeter to be 0.1 parts per million. This instrument and telescope represent the highest precision polarimeter in the world for exoplanet research. We present potential detection of polarized, scattered light from the HD 189733b, Tau Boo b, and WASP-12b exoplanets. We propose to observe hot Jupiters on circular orbits, highly eccentric exoplanets, exoplanets with extended or non-spherical scattering surfaces, and 55 Cnc e, the

  18. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    Science.gov (United States)

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  19. NEW COMPLETENESS METHODS FOR ESTIMATING EXOPLANET DISCOVERIES BY DIRECT DETECTION

    International Nuclear Information System (INIS)

    Brown, Robert A.; Soummer, Remi

    2010-01-01

    We report on new methods for evaluating realistic observing programs that search stars for planets by direct imaging, where observations are selected from an optimized star list and stars can be observed multiple times. We show how these methods bring critical insight into the design of the mission and its instruments. These methods provide an estimate of the outcome of the observing program: the probability distribution of discoveries (detection and/or characterization) and an estimate of the occurrence rate of planets (η). We show that these parameters can be accurately estimated from a single mission simulation, without the need for a complete Monte Carlo mission simulation, and we prove the accuracy of this new approach. Our methods provide tools to define a mission for a particular science goal; for example, a mission can be defined by the expected number of discoveries and its confidence level. We detail how an optimized star list can be built and how successive observations can be selected. Our approach also provides other critical mission attributes, such as the number of stars expected to be searched and the probability of zero discoveries. Because these attributes depend strongly on the mission scale (telescope diameter, observing capabilities and constraints, mission lifetime, etc.), our methods are directly applicable to the design of such future missions and provide guidance to the mission and instrument design based on scientific performance. We illustrate our new methods with practical calculations and exploratory design reference missions for the James Webb Space Telescope (JWST) operating with a distant starshade to reduce scattered and diffracted starlight on the focal plane. We estimate that five habitable Earth-mass planets would be discovered and characterized with spectroscopy, with a probability of zero discoveries of 0.004, assuming a small fraction of JWST observing time (7%), η = 0.3, and 70 observing visits, limited by starshade fuel.

  20. First direct detection of solar pp neutrinos by Borexino

    Energy Technology Data Exchange (ETDEWEB)

    Maneschg, Werner [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Collaboration: Werner Maneschg on behalf of the Borexino collaboration

    2015-07-01

    According to the Standard Solar Model (SSM) the radiative energy of our Sun is produced by a series of nuclear reactions that convert hydrogen into helium. In 99% of cases these processes are supposed to start with a fusion of two protons and the emission of a positron and a low-energy neutrino. These so-called pp neutrinos vastly outnumber those emitted in other sub-reactions, but only the large volume organic liquid scintillator detector Borexino has recently succeeded to perform a spectroscopic and direct measurement of them. The present talk reviews the procedure adopted by the Borexino collaboration to detect pp neutrinos. The key requirements, i.e. unprecedented radiopurity levels at low energies and a precise spectral description of the main background arising from 14C decays, and their fulfillment are discussed. The measured pp neutrino flux is then compared with the predictions of the SSM including neutrino oscillation mechanisms, and with the solar luminosity constraint deduced from photospheric observations.

  1. Direct detection of light anapole and magnetic dipole DM

    International Nuclear Information System (INIS)

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng; Gondolo, Paolo

    2014-01-01

    We present comparisons of direct detection data for ''light WIMPs'' with an anapole moment interaction (ADM) and a magnetic dipole moment interaction (MDM), both assuming the Standard Halo Model (SHM) for the dark halo of our galaxy and in a halo-independent manner. In the SHM analysis we find that a combination of the 90% CL LUX and CDMSlite limits or the new 90% CL SuperCDMS limit by itself exclude the parameter space regions allowed by DAMA, CoGeNT and CDMS-II-Si data for both ADM and MDM. In our halo-independent analysis the new LUX bound excludes the same potential signal regions as the previous XENON100 bound. Much of the remaining signal regions is now excluded by SuperCDMS, while the CDMSlite limit is much above them. The situation is of strong tension between the positive and negative search results both for ADM and MDM. We also clarify the confusion in the literature about the ADM scattering cross section

  2. Direct detection of exothermic dark matter with light mediator

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Chao-Qiang [Chongqing University of Posts & Telecommunications,Chongqing, 400065 (China); Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Huang, Da; Lee, Chun-Hao [Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Wang, Qing [Department of Physics, Tsinghua University,Beijing, 100084 (China); Collaborative Innovation Center of Quantum Matter,Beijing, 100084 (China)

    2016-08-05

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  3. CMOS-based avalanche photodiodes for direct particle detection

    International Nuclear Information System (INIS)

    Stapels, Christopher J.; Squillante, Michael R.; Lawrence, William G.; Augustine, Frank L.; Christian, James F.

    2007-01-01

    Active Pixel Sensors (APSs) in complementary metal-oxide-semiconductor (CMOS) technology are augmenting Charge-Coupled Devices (CCDs) as imaging devices and cameras in some demanding optical imaging applications. Radiation Monitoring Devices are investigating the APS concept for nuclear detection applications and has successfully migrated avalanche photodiode (APD) pixel fabrication to a CMOS environment, creating pixel detectors that can be operated with internal gain as proportional detectors. Amplification of the signal within the diode allows identification of events previously hidden within the readout noise of the electronics. Such devices can be used to read out a scintillation crystal, as in SPECT or PET, and as direct-conversion particle detectors. The charge produced by an ionizing particle in the epitaxial layer is collected by an electric field within the diode in each pixel. The monolithic integration of the readout circuitry with the pixel sensors represents an improved design compared to the current hybrid-detector technology that requires wire or bump bonding. In this work, we investigate designs for CMOS APD detector elements and compare these to typical values for large area devices. We characterize the achievable detector gain and the gain uniformity over the active area. The excess noise in two different pixel structures is compared. The CMOS APD performance is demonstrated by measuring the energy spectra of X-rays from 55 Fe

  4. Direct single-molecule dynamic detection of chemical reactions.

    Science.gov (United States)

    Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng

    2018-02-01

    Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.

  5. The effective field theory of dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Fitzpatrick, A. Liam; Haxton, Wick; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2013-02-01

    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  6. Directional response of identifier Micro Detective ORTEC, N-type with 15% of detection efficiency

    International Nuclear Information System (INIS)

    Arbach, Mayara Nascimento; Karam, Rudnei M.; Cardoso, Domingos D.O.; Sant'anna, Viviane C.; Vellozo, Sergio de O.; Gomes, Renato G.; Amorim, Aneuri S. de; Oliveira, Luciano S.R.

    2016-01-01

    It was characterized the directional response of identifier Micro Detective ORTEC, N-type with 15% of detection efficiency by using sources of Cesium ("1"3"7Cs) with activity of 37,4 kBq and Cobalt ("6"0Co) with an activity of 41 kBq, manufactured on 04/17/2007. The work took place in distances (0,5m, 1,0m, 1,5m e 2,0m) and for the angles (0°, 45°, 60° e 90°), and the measure found in angle 0° of said evaluation was adopted as reference value; this same procedure was adopted for other distances evaluated in this work. The results achieved are provided in charts 1, 2 and 3. (author)

  7. Optical intensity modulation direct detection versus heterodyne detection: A high-SNR capacity comparison

    KAUST Repository

    Chaaban, Anas

    2016-09-15

    An optical wireless communications system which employs either intensity-modulation and direct-detection (IM-DD) or heterodyne detection (HD) is considered. IM-DD has lower complexity and cost than HD, but on the other hand, has lower capacity. It is therefore interesting to investigate the capacity gap between the two systems. The main focus of this paper is to investigate this gap at high SNR. Bounds on this gap are established for two cases: between IM-DD and HD, and between IM-DD and an HD-PAM which is an HD system employing pulse-amplitude modulation (PAM). While the gap between IM-DD and HD increases as the signal-to-noise ratio (SNR) increases, the gap between IM-DD and an HD-PAM is upper bounded by a constant at high SNR. © 2015 IEEE.

  8. Optical intensity modulation direct detection versus heterodyne detection: A high-SNR capacity comparison

    KAUST Repository

    Chaaban, Anas; Alouini, Mohamed-Slim

    2016-01-01

    An optical wireless communications system which employs either intensity-modulation and direct-detection (IM-DD) or heterodyne detection (HD) is considered. IM-DD has lower complexity and cost than HD, but on the other hand, has lower capacity. It is therefore interesting to investigate the capacity gap between the two systems. The main focus of this paper is to investigate this gap at high SNR. Bounds on this gap are established for two cases: between IM-DD and HD, and between IM-DD and an HD-PAM which is an HD system employing pulse-amplitude modulation (PAM). While the gap between IM-DD and HD increases as the signal-to-noise ratio (SNR) increases, the gap between IM-DD and an HD-PAM is upper bounded by a constant at high SNR. © 2015 IEEE.

  9. Stereo multiplexing for direct detected optical communication systems

    NARCIS (Netherlands)

    Gaete, O.; Coelho, L.D.; Spinnler, B.; Al Fiad, M.S.A.S.; Jansen, S.L.; Hanik, N.

    2009-01-01

    We propose a novel technique that allows simultaneous detection of two modulated optical sub-carriers. A proof-of-principle experiment is described and subsequently the performance at high data rates (111Gb/s) is assessed by simulations.

  10. Discovery potential for directional dark matter detection with nuclear emulsions

    Science.gov (United States)

    Guler, A. M.; NEWSdm Collaboration

    2017-06-01

    Direct Dark Matter searches are nowadays one of the most exciting research topics. Several Experimental efforts are concentrated on the development, construction, and operation of detectors looking for the scattering of target nuclei with Weakly Interactive Massive Particles (WIMPs). In this field a new frontier can be opened by directional detectors able to reconstruct the direction of the WIMP-recoiled nucleus thus allowing to extend dark matter searches beyond the neutrino floor. Exploiting directionality would also give a proof of the galactic origin of dark matter making it possible to have a clear and unambiguous signal to background separation. The angular distribution of WIPM-scattered nuclei is indeed expected to be peaked in the direction of the motion of the Solar System in the Galaxy, i.e. toward the Cygnus constellation, while the background distribution is expected to be isotropic. Current directional experiments are based on the use of gas TPC whose sensitivity is limited by the small achievable detector mass. In this paper we show the potentiality in terms of exclusion limit of a directional experiment based on the use of a solid target made by newly developed nuclear emulsions and read-out systems reaching sub-micrometric resolution.

  11. A Nonstationary Markov Model Detects Directional Evolution in Hymenopteran Morphology.

    Science.gov (United States)

    Klopfstein, Seraina; Vilhelmsen, Lars; Ronquist, Fredrik

    2015-11-01

    Directional evolution has played an important role in shaping the morphological, ecological, and molecular diversity of life. However, standard substitution models assume stationarity of the evolutionary process over the time scale examined, thus impeding the study of directionality. Here we explore a simple, nonstationary model of evolution for discrete data, which assumes that the state frequencies at the root differ from the equilibrium frequencies of the homogeneous evolutionary process along the rest of the tree (i.e., the process is nonstationary, nonreversible, but homogeneous). Within this framework, we develop a Bayesian approach for testing directional versus stationary evolution using a reversible-jump algorithm. Simulations show that when only data from extant taxa are available, the success in inferring directionality is strongly dependent on the evolutionary rate, the shape of the tree, the relative branch lengths, and the number of taxa. Given suitable evolutionary rates (0.1-0.5 expected substitutions between root and tips), accounting for directionality improves tree inference and often allows correct rooting of the tree without the use of an outgroup. As an empirical test, we apply our method to study directional evolution in hymenopteran morphology. We focus on three character systems: wing veins, muscles, and sclerites. We find strong support for a trend toward loss of wing veins and muscles, while stationarity cannot be ruled out for sclerites. Adding fossil and time information in a total-evidence dating approach, we show that accounting for directionality results in more precise estimates not only of the ancestral state at the root of the tree, but also of the divergence times. Our model relaxes the assumption of stationarity and reversibility by adding a minimum of additional parameters, and is thus well suited to studying the nature of the evolutionary process in data sets of limited size, such as morphology and ecology. © The Author

  12. Detection without deflection? A hypothesis for direct sensing of ...

    Indian Academy of Sciences (India)

    PRAKASH

    level, the pressure component of a sound signal is more readily detected ... gives rise to a slowly propagating travelling wave, a wave of displacement on the ..... partial pressure of gas dissolved in sea water stays constant at about the level ...... of Corti (Midwinter Meeting, Florida, Association for Research in Otolaryngology).

  13. Chasing a consistent picture for dark matter direct detection searches

    NARCIS (Netherlands)

    Arina, C.

    2012-01-01

    In this paper we assess the present status of dark matter direct searches by means of Bayesian statistics. We consider three particle physics models for spin-independent dark matter interaction with nuclei: elastic, inelastic and isospin violating scattering. We briefly present the state of the art

  14. Teleconnection Paths via Climate Network Direct Link Detection.

    Science.gov (United States)

    Zhou, Dong; Gozolchiani, Avi; Ashkenazy, Yosef; Havlin, Shlomo

    2015-12-31

    Teleconnections describe remote connections (typically thousands of kilometers) of the climate system. These are of great importance in climate dynamics as they reflect the transportation of energy and climate change on global scales (like the El Niño phenomenon). Yet, the path of influence propagation between such remote regions, and weighting associated with different paths, are only partially known. Here we propose a systematic climate network approach to find and quantify the optimal paths between remotely distant interacting locations. Specifically, we separate the correlations between two grid points into direct and indirect components, where the optimal path is found based on a minimal total cost function of the direct links. We demonstrate our method using near surface air temperature reanalysis data, on identifying cross-latitude teleconnections and their corresponding optimal paths. The proposed method may be used to quantify and improve our understanding regarding the emergence of climate patterns on global scales.

  15. The detection of transient directional couplings based on phase synchronization

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, T; Fell, J; Lehnertz, K, E-mail: twagner@uni-bonn.d [Department of Epileptology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany)

    2010-05-15

    We extend recent approaches based on the concept of phase synchronization to enable the time-resolved investigation of directional relationships between coupled dynamical systems from short and transient noisy time series. For our approach, we consider an observed ensemble of a sufficiently large number of time series as multiple realizations of a process. We derive an index that quantifies the direction of transient interactions and assess its statistical significance using surrogate techniques. Analysing time series from noisy and chaotic systems, we demonstrate numerically the applicability and limitations of our approach. Our findings from an exemplary application to event-related brain activities underline the importance of our method for improving knowledge about the mechanisms underlying memory formation in humans.

  16. The detection of transient directional couplings based on phase synchronization

    International Nuclear Information System (INIS)

    Wagner, T; Fell, J; Lehnertz, K

    2010-01-01

    We extend recent approaches based on the concept of phase synchronization to enable the time-resolved investigation of directional relationships between coupled dynamical systems from short and transient noisy time series. For our approach, we consider an observed ensemble of a sufficiently large number of time series as multiple realizations of a process. We derive an index that quantifies the direction of transient interactions and assess its statistical significance using surrogate techniques. Analysing time series from noisy and chaotic systems, we demonstrate numerically the applicability and limitations of our approach. Our findings from an exemplary application to event-related brain activities underline the importance of our method for improving knowledge about the mechanisms underlying memory formation in humans.

  17. Direct detection of a microlens in the Milky Way.

    Science.gov (United States)

    Alcock, C; Allsman, R A; Alves, D R; Axelrod, T S; Becker, A C; Bennett, D P; Cook, K H; Drake, A J; Freeman, K C; Geha, M; Griest, K; Keller, S C; Lehner, M J; Marshall, S L; Minniti, D; Nelson, C A; Peterson, B A; Popowski, P; Pratt, M R; Quinn, P J; Stubbs, C W; Sutherland, W; Tomaney, A B; Vandehei, T; Welch, D

    2001-12-06

    The nature of dark matter remains mysterious, with luminous material accounting for at most approximately 25 per cent of the baryons in the Universe. We accordingly undertook a survey looking for the microlensing of stars in the Large Magellanic Cloud (LMC) to determine the fraction of Galactic dark matter contained in massive compact halo objects (MACHOs). The presence of the dark matter would be revealed by gravitational lensing of the light from an LMC star as the foreground dark matter moves across the line of sight. The duration of the lensing event is the key observable parameter, but gives non-unique solutions when attempting to estimate the mass, distance and transverse velocity of the lens. The survey results to date indicate that between 8 and 50 per cent of the baryonic mass of the Galactic halo is in the form of MACHOs (ref. 3), but removing the degeneracy by identifying a lensing object would tighten the constraints on the mass in MACHOs. Here we report a direct image of a microlens, revealing it to be a nearby low-mass star in the disk of the Milky Way. This is consistent with the expected frequency of nearby stars acting as lenses, and demonstrates a direct determination of a lens mass from a microlensing event. Complete solutions such as this for halo microlensing events will probe directly the nature of the MACHOs.

  18. Detection of nucleic acid sequences by invader-directed cleavage

    Science.gov (United States)

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  19. Fast and direct detection of neuronal activation with diffusion MRI

    International Nuclear Information System (INIS)

    Le Bihan, D.; Urayama, S.; Aso, T.; Hanakawa, T.; Fukuyama, H.

    2006-01-01

    Over the last 30 years functional neuroimaging has emerged as a revolutionary path to study the brain and the mind. This has been possible because of significant advances mainly in two imaging modalities, namely Positron Emission Tomograph y (PET) and Magnetic Resonance Imaging (MRI). Amazingly, although those two modalities are based on radically different physical approaches (detection of 1 3 radioactivity for the first one and nuclear magnetization for the second), both allo w brain activation images to be obtained through measurements involving water molecules. So far, PET and MRI functional imaging have relied on the same principle that neuronal activation and blood flow are coupled through metabolism: Blood flow increases locally in activated brain regions. In the case of PET one uses H 2 O radioactive water which is produced by using a cyclotron and injected to the subject vasculature. In activated brain regions the increase in blood flow leads to a local increase in the tissue radioactive water content detected and localized by the PE T camera. With MRI the hydrogen nuclei of brain endogenous water molecules are magnetized by a strong external magnetic field. In activated regions the increase in blood flow results in an increase of blood oxygenation which induces a slight perturbation of the magnetization relaxation properties of the water molecules around blood vessels detected by the MRI scanner (so called 'BOLD' effect). I n both approaches water is, thus, merely an indirect means to look at changes in cerebral blood flow which accompany brain activation, and although PET and BOLD f MRI have been extremely successful for the functional neuroimaging community, present well known limitations. While the coupling between neuronal activation, metabolism and blood flow has been verified in most instances including BOLD f MRI, the degree and the mechanism of coupling remains largely debated (Magistratt, Pellerin, Mangia) and may fail in some pathological

  20. Direct detection of a single photon by humans

    Science.gov (United States)

    Tinsley, Jonathan N.; Molodtsov, Maxim I.; Prevedel, Robert; Wartmann, David; Espigulé-Pons, Jofre; Lauwers, Mattias; Vaziri, Alipasha

    2016-01-01

    Despite investigations for over 70 years, the absolute limits of human vision have remained unclear. Rod cells respond to individual photons, yet whether a single-photon incident on the eye can be perceived by a human subject has remained a fundamental open question. Here we report that humans can detect a single-photon incident on the cornea with a probability significantly above chance. This was achieved by implementing a combination of a psychophysics procedure with a quantum light source that can generate single-photon states of light. We further discover that the probability of reporting a single photon is modulated by the presence of an earlier photon, suggesting a priming process that temporarily enhances the effective gain of the visual system on the timescale of seconds. PMID:27434854

  1. Direct detection of radicals in intact soybean nodules

    DEFF Research Database (Denmark)

    Mathieu, C; Moreau, S; Frendo, P

    1998-01-01

    Electron paramagnetic resonance spectroscopy has been employed to examine the nature of the metal ions and radicals present in intact root nodules of soybean plants grown in the absence of nitrate. The spectra obtained from nodules of different ages using this non-invasive technique show dramatic...... differences, suggesting that there are both qualitative and quantitative changes in the metal ion and radical species present. A major component of the spectra obtained from young nodules is assigned to a complex (Lb-NO) of nitric oxide (NO.) with the heme protein leghemoglobin (Lb). This Lb-NO species, which...... has not been previously detected in intact root nodules of plants grown in the absence of nitrate, is thought to be formed by reaction of nitric oxide with iron(II) leghemoglobin. The nitric oxide may be generated from arginine via a nitric oxide synthase-like activity present in the nodules...

  2. A detecting device with compensated directional dependence of response

    International Nuclear Information System (INIS)

    Viererbl, L.

    1988-01-01

    A scintillation detector making up for the directional dependence of response was devised. The jacket of the scintillator consists of a hollow body whose internal diameter is sufficient for the scintillator to be inserted, and of a ring whose height is lower than one-half of the largest dimension of the scintillator. The ring is accommodated at that side of the scintillator face which is more distant from the cathode of the photomultiplier. More than 90% of the material of the ring is constituted by atoms with atomic number higher than 23, whereas more than 90% of the material of the hollow body is constituted by atoms with atomic number lower than 14. (P.A.). 2 figs

  3. Coherent radio-frequency detection for narrowband direct comb spectroscopy.

    Science.gov (United States)

    Anstie, James D; Perrella, Christopher; Light, Philip S; Luiten, Andre N

    2016-02-22

    We demonstrate a scheme for coherent narrowband direct optical frequency comb spectroscopy. An extended cavity diode laser is injection locked to a single mode of an optical frequency comb, frequency shifted, and used as a local oscillator to optically down-mix the interrogating comb on a fast photodetector. The high spectral coherence of the injection lock generates a microwave frequency comb at the output of the photodiode with very narrow features, enabling spectral information to be further down-mixed to RF frequencies, allowing optical transmittance and phase to be obtained using electronics commonly found in the lab. We demonstrate two methods for achieving this step: a serial mode-by-mode approach and a parallel dual-comb approach, with the Cs D1 transition at 894 nm as a test case.

  4. Theoretical interpretation of experimental data from direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Chung-Lin, Shan

    2007-10-15

    I derive expressions that allow to reconstruct the normalized one-dimensional velocity distribution function of halo WIMPs and to determine its moments from the recoil energy spectrum as well as from experimental data directly. The reconstruction of the velocity distribution function is further extended to take into account the annual modulation of the event rate. All these expressions are independent of the as yet unknown WIMP density near the Earth as well as of the WIMP-nucleus cross section. The only information about the nature of halo WIMPs which one needs is the WIMP mass. I also present a method for the determination of the WIMP mass by combining two (or more) experiments with different detector materials. This method is not only independent of the model of Galactic halo but also of that of WIMPs. (orig.)

  5. Theoretical interpretation of experimental data from direct dark matter detection

    International Nuclear Information System (INIS)

    Shan Chung-Lin

    2007-10-01

    I derive expressions that allow to reconstruct the normalized one-dimensional velocity distribution function of halo WIMPs and to determine its moments from the recoil energy spectrum as well as from experimental data directly. The reconstruction of the velocity distribution function is further extended to take into account the annual modulation of the event rate. All these expressions are independent of the as yet unknown WIMP density near the Earth as well as of the WIMP-nucleus cross section. The only information about the nature of halo WIMPs which one needs is the WIMP mass. I also present a method for the determination of the WIMP mass by combining two (or more) experiments with different detector materials. This method is not only independent of the model of Galactic halo but also of that of WIMPs. (orig.)

  6. Fast and direct detection of neuronal activation with diffusion MRI

    Energy Technology Data Exchange (ETDEWEB)

    Le Bihan, D. [Service Hospitalier Frederic Joliot (CEA/DSV/DRM), Lab. Anatomical and Functional Neuroimaging, 91 - Orsay (France); Urayama, S.; Aso, T.; Hanakawa, T.; Fukuyama, H. [Kyoto Univ. Graduate School of Medicine, Human Brain Research Center, Kyoto (Japan)

    2006-07-01

    Over the last 30 years functional neuroimaging has emerged as a revolutionary path to study the brain and the mind. This has been possible because of significant advances mainly in two imaging modalities, namely Positron Emission Tomograph y (PET) and Magnetic Resonance Imaging (MRI). Amazingly, although those two modalities are based on radically different physical approaches (detection of 1 3 radioactivity for the first one and nuclear magnetization for the second), both allo w brain activation images to be obtained through measurements involving water molecules. So far, PET and MRI functional imaging have relied on the same principle that neuronal activation and blood flow are coupled through metabolism: Blood flow increases locally in activated brain regions. In the case of PET one uses H{sub 2}O radioactive water which is produced by using a cyclotron and injected to the subject vasculature. In activated brain regions the increase in blood flow leads to a local increase in the tissue radioactive water content detected and localized by the PE T camera. With MRI the hydrogen nuclei of brain endogenous water molecules are magnetized by a strong external magnetic field. In activated regions the increase in blood flow results in an increase of blood oxygenation which induces a slight perturbation of the magnetization relaxation properties of the water molecules around blood vessels detected by the MRI scanner (so called 'BOLD' effect). I n both approaches water is, thus, merely an indirect means to look at changes in cerebral blood flow which accompany brain activation, and although PET and BOLD f MRI have been extremely successful for the functional neuroimaging community, present well known limitations. While the coupling between neuronal activation, metabolism and blood flow has been verified in most instances including BOLD f MRI, the degree and the mechanism of coupling remains largely debated (Magistratt, Pellerin, Mangia) and may fail in some

  7. Directionality and signal amplification in cryogenic dark matter detection

    International Nuclear Information System (INIS)

    More, T.

    1996-05-01

    A mounting body of evidence suggests that most of the mass in our universe is not contained in stars, but rather exists in some non- luminous form. The evidence comes independently from astronomical observation, cosmological theory, and particle physics. All of this missing mass is collectively referred to as dark matter. In this thesis we discuss two ways to improve the performance of dark matter detectors based on the measurement of ballistic phonons. First, we address the issue of signal identification through solitons. Secondly, we discuss a method for lowering the detection threshold and improving the energy sensitivity: amplifying phonons through the evaporation of helium atoms from a superfluid film coating the target and the adsorption of the evaporated atoms onto a helium-free substrate. A phonon amplifier would also be of use in many other applications in which a few phonons are to be measured at low temperatures. Factors contributing to the low amplifier gains achieved thus far are described and proposals for avoiding them are analyzed and discussed. 101 refs., 30 figs., 2 tabs

  8. Effects of tritiated water ingestion on mice: II. Damage at cellular vis-a-vis subcellular level monitored up to four generations

    International Nuclear Information System (INIS)

    Srivastava, P.N.; Sharan, R.N.; Pozzi, L.

    1983-01-01

    Damage at cellular level is measured using colony forming units in spleen (CFU-S) technique while that at subcellular level by DNA unwinding technique. The damage is monitored up to four generations in Swiss albino mice. The results show drastically reduced colony forming ability in mice bone marrow cells (BMC). On plotting survival fractions (percent of control) for BMC against generations of mice, the plateau is found around 50% survival. The role of DNA in colony forming ability of BMC is tested. The results indicate that, at least, initial impairment of colony ability is not DNA dependent but related to some other factor(s)

  9. Globalização vis-a-vis a história do nacionalismo na América Latina: o caso do Brasil

    Directory of Open Access Journals (Sweden)

    Céli Regina Jardim Pinto

    2012-12-01

    Full Text Available The article has as start point a central question: Is it possible to identify a reaction to the globalization of capitalism, in term of a globalized movement that involves an alternative to the system or to the north hegemony in relation to the south countries, many of them in conditions of complete miserably and deep social inequality? To examine this question the article is divided in to four small sections: 1.The Internationalism and nationalism; 2. The Nationalism in Brazil; 3. The global civil society; 4. A conclusion. This article concludes that we are far away from a global civil society able to propose a way of life that problematize the capitalist system and all forms of exploitation and class, gender and race dominations.

  10. EVOLUTION OF FIAT AUTOMÓVEIS S.AS STRATEGY VIS-A-VIS COMPETITIVE CHANGES IN THE BRAZILIAN AUTOMOBILE INDUSTRY ENVIRONMENT: A CASE STUDY

    OpenAIRE

    SERGIO MOLINA MICAELO

    2003-01-01

    A Fiat Automóveis S.A. se destacou na indústria automobilística nacional ao atingir, em 2001, a liderança do mercado de automóveis e comerciais leves. A análise desta trajetória avaliou a variação do ambiente competitivo e as estratégias seguidas em dois momentos relevantes determinados por questionário estruturado, que foram 1994 e 2001. A caracterização do ambiente da indústria e das estratégias usaram, respectivamente, o modelo das cinco forças e a tipologia...

  11. High power pulsed/microwave technologies for electron accelerators vis a vis 10MeV, 10kW electron LINAC for food irradiation at CAT

    International Nuclear Information System (INIS)

    Shrivastava, Purushottam; Mulchandani, J.; Mohania, P.; Baxy, D.; Wanmode, Y.; Hannurkar, P.R.

    2005-01-01

    Use of electron accelerators for irradiation of food items is gathering momentum in India. The various technologies for powering the electron LINAC were needed to be developed in the country due to embargo situations as well as reservations of the developers worldwide to share the information related to this development. Centre for Advanced Technology, CAT, Indore, is engaged in the development of particle accelerators for medical industrial and scientific applications. Amongst other electron accelerators developed in CAT, a 10MeV, 10kW LINAC for irradiation of food items has been commissioned and tested for full rated 10kW beam power. The high power pulsed microwave driver for the LINAC was designed, developed and commissioned with full indigenous efforts, and is right now operational at CAT. It consists of a 6MW, 25kW S-band pulsed klystron, 15MW peak power pulse modulator system for the klystron, microwave driver amplifier chain, stabilized generator, protection and control electronics, waveguide system to handle the high peak and average power, gun modulator electronics, grid electronics etc. The present paper highlights various technologies like the pulsed power systems and components, microwave circuits and systems etc. Also the performance results of the high power microwave driver for the 10MeV LINAC at CAT are discussed. Future strategies for developing the state of art technologies are highlighted. (author)

  12. Perception of Employers' in Transforming Technical and Vocational Education and Training vis-a-vis Emerging Technology Tools for Sustainable Workforce Development in Nigeria

    Directory of Open Access Journals (Sweden)

    Oladiran Stephen Olabiyi

    2018-04-01

    Full Text Available Economic competitiveness of a country depends to a large extent on the skills of its workforce. The skills and the competencies of the workforce, in turn, are dependent upon the quality of the country’s education and training. Education and training are undergoing continuous change, and this change poses more challenges to the 21st-century workforce, and to training institutions. Despite the importance of TVET in transforming economic development, of any nation, Nigeria still has different perspectives about the competency of its TVET graduates. Therefore, the paper aims at determining the perceptions of Organized Private Sector (OPS employers’ regarding the competency of TVET graduates and the role of emerging technology tools in transforming TVET for a sustainable workforce development. Using a descriptive survey research design and a sample of 80 OPS employers. A validated and piloted questionnaire based on a 5-point Likert scale used as the data collection instrument for the study. Data were analysed using descriptive and inferential statistics including means, standard deviation and ANOVA. Data analysis was facilitated using the Statistical Package for Social Sciences (SPSS. Findings revealed that employers were not satisfied with the competency level of TVET graduates as it is showed that they are not well prepared to enter the competitive workforce and to be self-reliant. Given the nature and complexity of the field of TVET for a sustainable workforce, it was recommended that the utilization of adequate planning and management of emerging technology tools and resources in teaching TVET programs could contribute enormously to the quality and sustainability of the Nigerian workforce.

  13. Dissociated reality vis-a-vis integrative planning of AYUSH in Maternal Health Program: A situational analysis in Jaleswar block of Balasore district of Odisha, India.

    Science.gov (United States)

    Dehury, Ranjit Kumar; Chatterjee, Suhita Chopra

    2016-01-01

    Mainstreaming of AYUSH and revitalization of local health traditions is one of the innovative components of the National Rural Health Mission (NRHM) in the state of Odisha, India. In this study, an attempt was made to assess the potential of collocating AYUSH to improve maternal health services in tribal dominated Jaleswar block of the Balasore district. In addition, the study aimed at unearthing the underlying challenges and constraints in mainstreaming AYUSH and linking it with the Maternal Health Program. Review of the policy documents and guidelines, both central and state government, was made to assess the implementation of AYUSH in Odisha. Primary data were collected through interviews with AYUSH doctors, district and block level health administrators, and tribal women. The study revealed the inadequacy of basic amenities, infrastructure, drugs, and consumables in the health centers for integrating AYUSH in the delivery of maternal health services. Analysis of the job chart and work pattern of AYUSH doctors showed underutilization of their specialized knowledge to treat patients. Lack of continued medical education, standard operating procedures for treatment and spatial marginalization made suboptimal utilization of AYUSH services. This is unfortunate given the fact that such regions are economically underdeveloped and already have a distinct orientation toward indigenous health systems. AYUSH, on account of its holistic approach and proven cost-effectiveness, could be a viable option for improving maternal health in the region. The study concluded that although there is huge scope for integrating AYUSH in Maternal Health Program under the ongoing NRHM, the full potential is yet to be exploited. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  14. Dissociated reality vis-a-vis integrative planning of AYUSH in Maternal Health Program: A situational analysis in Jaleswar block of Balasore district of Odisha, India

    OpenAIRE

    Dehury, Ranjit Kumar; Chatterjee, Suhita Chopra

    2016-01-01

    Mainstreaming of AYUSH and revitalization of local health traditions is one of the innovative components of the National Rural Health Mission (NRHM) in the state of Odisha, India. In this study, an attempt was made to assess the potential of collocating AYUSH to improve maternal health services in tribal dominated Jaleswar block of the Balasore district. In addition, the study aimed at unearthing the underlying challenges and constraints in mainstreaming AYUSH and linking it with the Maternal...

  15. Histological vis-a-vis biochemical assessment on the toxic level and antineoplastic efficacy of a synthetic drug Pt-ATP on experimental animal models.

    Science.gov (United States)

    Pal, Shipra; Sadhu, Arpita Sengupta; Patra, Swarup; Mukherjea, Kalyan K

    2008-11-12

    Cisplatin, a platinum based anticancer drug has played a vital role in the treatment of cancers by chemical agents, but in view of the serious toxicity including nephrotoxicity of cisplatin, various other platinum based drugs have been synthesized and screened to overcome its toxicity. A Pt-ATP compound was prepared in our laboratory hoping to have reduced or no toxicity along with the potentiality of reducing neoplasm growth. A Pt-ATP compound was prepared. It was first screened for its antineoplastic efficacy. Confirming that, subsequent experiments were carried on to test its toxicity on animals, viz. Albino Swiss mice. The animals were randomly divided into four sets--Set I: Erhlich Ascites Carcinoma (EAC) challenged mice; Set II: Normal mice; Set III: Drug treated mice, Set IVA Cisplatin (CDDP) treated mice, Set IV B EAC challenged Cisplatin treated mice. Set I was used to test antineoplasticity of the drug, Set II and Set III for studying drug toxicity and Set IV was treated with CDDP. Set II was used as a control. Animals were sacrificed after 5 days, 10 days 15 days and 20 days of drug administration on the 6th, 11th, 16th and 21st days respectively for Set I, II and III. Set IVA was sacrificed only on the 16th day and Set IV B on 6th and 11th days. For Set I only tumor cell count and packed cell volume (PCV) of tumor cells were recorded. For Set II and III, aspartate aminotransferase (AST), alanine aminotransferase (ALT) assays were done using serum while blood creatinine and creatine were assayed from blood filtrate. For cytotoxicity assessment liver, spleen and kidney tissues were collected and subjected to scanning electron microscopy (SEM) after extensive treatment. Set IV A was only studied for the biochemical parameters viz. aspartate aminotransferase (AST), alanine aminotransferase (ALT) assays were done using serum while blood creatinine and creatine were assayed from blood filtrate. Set IV B was studied for tumor cell count after treatment with CDDP for 10 days. Our comparative studies with normal and drug treated animals reveal that the drug does not affect the body weight of the drug treated animals significantly. The biochemical parameters like ALT and AST levels are also within normal limits which rules out hepatotoxicity. The detailed histological studies by SEM reveal that the hepatic, kidney and spleen tissues are not adversely affected by the drug. Comparison of biochemical parameters with the CDDP treated animals show that Pt-ATP is not at all toxic like the CDDP. The Kaplan-Meier analysis of the survival data of Set I has shown promising results with a significance of p < 0.0001. Set I results are promising and indicating antineoplastic efficacy of the synthesized drug with increased life span of the animals. Biochemical analysis, hematological and SEM studies revealed that the drug was neither nephrotoxic nor hepato-spleeno-toxic under the experimental set up.

  16. Valuation of Strength of Structural Steel Angle Sections, under IS Code: 800-1984--A Case Study with Equal vis-a-vis Unequal Angles

    OpenAIRE

    Manoj Kumar Varshaney

    2015-01-01

    International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computa...

  17. An insight into the complexation of trivalent americium vis-a-vis lanthanides with bis(1,2,4-triazinyl)bipyridine derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharyya, Arunasis; Mohapatra, Manoj; Mohapatra, Prasanta K. [Bhabha Atomic Research Centre, Trombay, Mumbai (India). Radiochemistry Div.; Gadly, Trilochan; Ghosh, Sunil K. [Bhabha Atomic Research Centre, Trombay, Mumbai (India). Bioorganic Div.; Manna, Debashree; Ghanty, Tapan K. [Bhabha Atomic Research Centre, Trombay, Mumbai (India). Theoretical Chemistry Section; Rawat, Neetika; Tomar, Bhupendra S. [Bhabha Atomic Research Centre, Trombay, Mumbai (India). Radioanalytical Chemistry Div.

    2017-01-26

    Complexation of Am{sup 3+} and Ln{sup 3+} (La{sup 3+}, Eu{sup 3+}, and Er{sup 3+}) with two bis(1,2,4-triazinyl)bipyridine (C{sub 2}BTBP, C{sub 5}BTBP) derivatives has been studied in acetonitrile medium with use of various experimental techniques such as electrospray ionization mass spectrometry (ESI-MS), time-resolved fluorescence spectroscopy (TRFS), UV/Vis spectrophotometry, and solution calorimetry. Metal-ligand stoichiometries and conditional stability constants of these complexes were determined. To the best of our knowledge, this is the first report on the complexation of Am{sup 3+} with any of the BTBP derivatives with use of UV/Vis spectrophotometric titration to determine the conditional stability constants. Density functional theory (DFT) calculations are carried out on the An{sup 3+} (U{sup 3+} and Am{sup 3+}) and Ln{sup 3+} (La{sup 3+}, Nd{sup 3+}, Eu{sup 3+}, Er{sup 3+}, and Lu{sup 3+}) complexes of BTBP in order to understand the difference between the bonding in actinide and lanthanide complexes. The results indicate a stronger covalent interaction in the An-N bonds as compared to the Ln-N bonds, which leads to an actinide selectivity of this class of ligands. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. Analysis of the determining factors in the attitude of an organ of information vis-a-vis the development of nuclear energy

    International Nuclear Information System (INIS)

    Fagnani, F.

    1978-09-01

    The report is devoted to the study of the role of the media, in France, confronted with the nuclear debate. It has been developed through two distinct and complementary approaches, which are illustrative of the possible attitudes towards the research on media impacts. The first approach deals with a systematic qualitative and quantitative review of the various French newspapers (national and regional). With the help of a sample of events running from January 68 to August 76, this study aims at a classification of the periodicals according to their behaviour towards the nuclear issues. It also tries to make assumptions on the role of the press in the public opinion regarding that matter. The second approach follows an inverse scope. By using the result of a survey on a representative sample of French adult population, regarding the nuclear debate, this study concentrates on the individuals as readers of different newspapers. On an other side, individuals are characterized according to their answers to a series of arguments about nuclear energy. In order to precise the impact of the press, this study puts into emphasis the degree of coherence between the general ideological position and the arguments on nuclear. It is proposed to interpret the discrepancies observed in terms of differential media impacts

  19. Visualization and co-occurrence of journals in the area of information science in vis-a-vis the Qualis/Capes system in Brazil

    Directory of Open Access Journals (Sweden)

    Adilson Luiz Pinto

    2016-05-01

    Full Text Available This paper aims at qualifying scientific journals that are part of the listing Qualis/Capes Brazil. The site of Capes only lists a few influential international titles. Included in this list are “Information Processing & Management, Organization Knowledge and Library” but several other important titles in Information Science are not covered. Our study describes 27 scientific worldwide journals, representing the world stage in Information Science, and which for some reason are not well respected in Brazil. The influence of these international journals (which are part of Web of Science is evidenced by measuring the power they have in the scientific field of Information Science as well as the power of major authors (Salton, Spink, Nicholas, Belkin, Saracevic, Dervin, Garfield and others. Citation index comparison with the other journals in the area and index of impact factor are also analyzed. The results highlight the importance of JASIST, Information Processing & Management, College Research Library, Journal of Documentation, ARIST, Journal Information Sciences, Information Retrieval and Library Trends, both in the matter of world representativeness and in the number of citations.

  20. Halo-independent direct detection of momentum-dependent dark matter

    DEFF Research Database (Denmark)

    Cherry, J. F.; Frandsen, M. T.; Shoemaker, I. M.

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given...... a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can...

  1. Minimizing Detection Probability Routing in Ad Hoc Networks Using Directional Antennas

    Directory of Open Access Journals (Sweden)

    Towsley Don

    2009-01-01

    Full Text Available In a hostile environment, it is important for a transmitter to make its wireless transmission invisible to adversaries because an adversary can detect the transmitter if the received power at its antennas is strong enough. This paper defines a detection probability model to compute the level of a transmitter being detected by a detection system at arbitrary location around the transmitter. Our study proves that the probability of detecting a directional antenna is much lower than that of detecting an omnidirectional antenna if both the directional and omnidirectional antennas provide the same Effective Isotropic Radiated Power (EIRP in the direction of the receiver. We propose a Minimizing Detection Probability (MinDP routing algorithm to find a secure routing path in ad hoc networks where nodes employ directional antennas to transmit data to decrease the probability of being detected by adversaries. Our study shows that the MinDP routing algorithm can reduce the total detection probability of deliveries from the source to the destination by over 74%.

  2. Evaluation of two methods for direct detection of Fusarium spp. in water.

    Science.gov (United States)

    Graça, Mariana G; van der Heijden, Inneke M; Perdigão, Lauro; Taira, Cleison; Costa, Silvia F; Levin, Anna S

    2016-04-01

    Fusarium is a waterborne fungus that causes severe infections especially in patients with prolonged neutropenia. Traditionally, the detection of Fusarium in water is done by culturing which is difficult and time consuming. A faster method is necessary to prevent exposure of susceptible patients to contaminated water. The objective of this study was to develop a molecular technique for direct detection of Fusarium in water. A direct DNA extraction method from water was developed and coupled to a genus-specific PCR, to detect 3 species of Fusarium (verticillioides, oxysporum and solani). The detection limits were 10 cells/L and 1 cell/L for the molecular and culture methods, respectively. To our knowledge, this is the first method developed to detect Fusarium directly from water. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Near-IR Direct Detection of Water Vapor in Tau Bootis b

    Science.gov (United States)

    2014-02-24

    unknown orbital inclination. Treating the τ Boo system as a high flux ratio double-lined spectroscopic binary permits the direct measurement of the...the atmosphere of a non-transiting hot Jupiter, τ Boo b. Key words: planets and satellites: atmospheres – techniques: spectroscopic 1. INTRODUCTION...sensitivity required for these detections. Despite the agreement between the two groups, the direct detection of exoplanets, especially τ Boo b, has

  4. The Diurnal Variation of the Wimp Detection Event Rates in Directional Experiments

    CERN Document Server

    Vergados, J D

    2009-01-01

    The recent WMAP data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Modern particle theories naturally provide viable cold dark matter candidates with masses in the GeV-TeV region. Supersymmetry provides the lightest supersymmetric particle (LSP), theories in extra dimensions supply the lightest Kaluza-Klein particle (LKP) etc. The nature of dark matter can only be unraveled only by its direct detection in the laboratory. All such candidates will be called WIMPs (Weakly Interacting Massive Particles). In any case the direct dark matter search, which amounts to detecting the recoiling nucleus, following its collision with WIMP, is central to particle physics and cosmology. In this work we briefly review the theoretical elements relevant to the direct dark matter detection experiments, paying particular attention to directional experiments. i.e experiments in which, not only the energy but the direction of the recoiling nucleus is ob...

  5. Direct Detection Phenomenology in Models Where the Products of Dark Matter Annihilation Interact with Nuclei

    DEFF Research Database (Denmark)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2015-01-01

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection...... to nuclei, the limit from annihilation to relativistic particles in the Sun can be stronger than that of conventional non-relativistic direct detection by more than three orders of magnitude for masses in a 2-7 GeV window.......We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection...... experiments is controlled by relativistic kinematics. This results in a distinctive recoil spectrum, a non-standard and or even absent annual modulation, and the ability to probe DM masses as low as a $\\sim$10 MeV. We use current LUX data to show that experimental sensitivity to thermal relic annihilation...

  6. Characterising dark matter searches at colliders and direct detection experiments: Vector mediators

    International Nuclear Information System (INIS)

    Buchmueller, Oliver; Dolan, Matthew J.; Malik, Sarah A.; McCabe, Christopher

    2015-01-01

    We introduce a Minimal Simplified Dark Matter (MSDM) framework to quantitatively characterise dark matter (DM) searches at the LHC. We study two MSDM models where the DM is a Dirac fermion which interacts with a vector and axial-vector mediator. The models are characterised by four parameters: m DM , M med, g DM and g q , the DM and mediator masses, and the mediator couplings to DM and quarks respectively. The MSDM models accurately capture the full event kinematics, and the dependence on all masses and couplings can be systematically studied. The interpretation of mono-jet searches in this framework can be used to establish an equal-footing comparison with direct detection experiments. For theories with a vector mediator, LHC mono-jet searches possess better sensitivity than direct detection searches for light DM masses (≲5 GeV). For axial-vector mediators, LHC and direct detection searches generally probe orthogonal directions in the parameter space. We explore the projected limits of these searches from the ultimate reach of the LHC and multi-ton xenon direct detection experiments, and find that the complementarity of the searches remains. In conclusion, we provide a comparison of limits in the MSDM and effective field theory (EFT) frameworks to highlight the deficiencies of the EFT framework, particularly when exploring the complementarity of mono-jet and direct detection searches

  7. Sensitivity study with respect to direction of ADI method during re-flooding in AHWR

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, M.; Mukhopadhyay, D. [Bhabha Atomic Research Centre, Mumbai (India). Reactor Safety Div.; Ghosh, A.K. [Bhabha Atomic Research Centre, Mumbai (India). Raja Ramanna Fellow; Kumar, R. [Indian Institute of Technology, Roorkee (India)

    2015-05-15

    The Advanced Heavy water Reactor (AHWR) is a natural circulation vertical pressure tube type boiling light water cooled and heavy water moderated reactor. As the AHWR fuel bundle quenching under accident condition is designed primarily with radial jets at several axial locations, bottom re-flooding still remain open as another option. Radial direction injection of emergency core cooling leads to rewetting of AHWR fuel cluster in circumferential direction. A 3D fuel pin model has been developed by using Finite Difference Method (FDM) of transient heat conduction equation. Alternating Direction Implicit technique of Finite Difference Method (FDM) has been used for discretisation of numerical equation in different time step at different direction. Sensitivity numerical study with respect to direction of ADI method has been carried out to optimize the time step during the transient as well as steady state and is found that it is insensitivity with direction of solution. Further, to assess influence of circumferential rewetting vis-a-vis axial rewetting. Both the analyses are carried out with same fluid temperature and heat transfer coefficients as boundary conditions. It has been found from the analyses that for radial jet, the circumferential conduction is significant and overall the fuel temperature falls in the quench plane with the initiation of quenching event. The paper discusses the sensitivity study with respect to direction of ADI solution and comparison of numerical results for circumferential and axial rewetting for single pin.

  8. Deciphering inflation with gravitational waves: Cosmic microwave background polarization vs direct detection with laser interferometers

    International Nuclear Information System (INIS)

    Smith, Tristan L.; Peiris, Hiranya V.; Cooray, Asantha

    2006-01-01

    A detection of the primordial gravitational wave background is considered to be the 'smoking-gun' evidence for inflation. While superhorizon waves are probed with cosmic microwave background (CMB) polarization, the relic background will be studied with laser interferometers. The long lever arm spanned by the two techniques improves constraints on the inflationary potential and validation of consistency relations expected under inflation. If gravitational waves with a tensor-to-scalar amplitude ratio greater than 0.01 are detected by the CMB, then a direct-detection experiment with a sensitivity consistent with current concept studies should be pursued vigorously. If no primordial tensors are detected by the CMB, a direct-detection experiment to understand the simplest form of inflation must have a sensitivity improved by two to 3 orders of magnitude over current plans

  9. A comparison of directed search target detection versus in-scene target detection in Worldview-2 datasets

    Science.gov (United States)

    Grossman, S.

    2015-05-01

    Since the events of September 11, 2001, the intelligence focus has moved from large order-of-battle targets to small targets of opportunity. Additionally, the business community has discovered the use of remotely sensed data to anticipate demand and derive data on their competition. This requires the finer spectral and spatial fidelity now available to recognize those targets. This work hypothesizes that directed searches using calibrated data perform at least as well as inscene manually intensive target detection searches. It uses calibrated Worldview-2 multispectral images with NEF generated signatures and standard detection algorithms to compare bespoke directed search capabilities against ENVI™ in-scene search capabilities. Multiple execution runs are performed at increasing thresholds to generate detection rates. These rates are plotted and statistically analyzed. While individual head-to-head comparison results vary, 88% of the directed searches performed at least as well as in-scene searches with 50% clearly outperforming in-scene methods. The results strongly support the premise that directed searches perform at least as well as comparable in-scene searches.

  10. Loop-induced dark matter direct detection signals from gamma-ray lines

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Haisch, Ulrich; Kahlhoefer, Felix

    2012-01-01

    Improved limits as well as tentative claims for dark matter annihilation into gamma-ray lines have been presented recently. We study the direct detection cross section induced from dark matter annihilation into two photons in a model-independent fashion, assuming no additional couplings between...... dark matter and nuclei. We find a striking non-standard recoil spectrum due to different destructively interfering contributions to the dark matter nucleus scattering cross section. While in the case of s-wave annihilation the current sensitivity of direct detection experiments is insufficient...... to compete with indirect detection searches, for p-wave annihilation the constraints from direct searches are comparable. This will allow to test dark matter scenarios with p-wave annihilation that predict a large di-photon annihilation cross section in the next generation of experiments....

  11. Effectiveness of direct and indirect radionuclide cystography in detecting vesicoureteral reflux

    International Nuclear Information System (INIS)

    Conway, J.J.; Kruglik, G.D.

    1976-01-01

    A modified of the direct radionuclide cystography technique to include filling, voiding, and postvoiding phases of the examination permitted a simulated comparison between direct and indirect radionuclide cystography. One hundred thirty-seven examples of reflux were documented with this technique. Of these, 96 instances of reflux (70 percent) were recorded during two or more phases and thus would have been detected by either technique. Twenty-nine examples (21 percent) were only detected during filling and thus would have been missed by the indirect radionuclide technique and by some roentgenographic techniques. Only 12 examples (9 percent) were detected during the voiding phase only. The modified direct method of radionuclide cystography, which continuously monitors the urinary tracts during filling, voiding, and postvoiding, is offered as the best current technique for assessing visicoureteral reflus

  12. Halo-independent direct detection of momentum-dependent dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Cherry, John F. [Theoretical Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Frandsen, Mads T.; Shoemaker, Ian M., E-mail: jcherry@lanl.gov, E-mail: frandsen@cp3-origins.net, E-mail: shoemaker@cp3-origins.net [CP3-Origins and the Danish Institute for Advanced Study, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark)

    2014-10-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be ∼< 10 MeV for DM in the 20-1000 GeV range in a halo-independent manner.

  13. Halo-independent direct detection of momentum-dependent dark matter

    International Nuclear Information System (INIS)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be ∼< 10 MeV for DM in the 20-1000 GeV range in a halo-independent manner

  14. Exploring the Cosmic Frontier, Task A - Direct Detection of Dark Matter, Task B - Experimental Particle Astrophysics

    International Nuclear Information System (INIS)

    Matthews, John A.J.; Gold, Michael S.

    2016-01-01

    This report summarizes the work of Task A and B for the period 2013-2016. For Task A the work is for direct detection of dark matter with the single-phase liquid argon experiment Mini-CLEAN. For Task B the work is for the search for new physics in the analysis of fluorescence events with the Auger experiment and for the search for the indirect detection of dark matter with the HAWC experiment.

  15. Exploring the Cosmic Frontier, Task A - Direct Detection of Dark Matter, Task B - Experimental Particle Astrophysics

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, John A.J. [Univ. of New Mexico, Albuquerque, NM (United States); Gold, Michael S. [Univ. of New Mexico, Albuquerque, NM (United States)

    2016-08-11

    This report summarizes the work of Task A and B for the period 2013-2016. For Task A the work is for direct detection of dark matter with the single-phase liquid argon experiment Mini-CLEAN. For Task B the work is for the search for new physics in the analysis of fluorescence events with the Auger experiment and for the search for the indirect detection of dark matter with the HAWC experiment.

  16. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    International Nuclear Information System (INIS)

    Garny, Mathias; Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan

    2012-01-01

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years

  17. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Garny, Mathias [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan [Technische Univ. Muenchen, Garching (Germany). Physik-Department

    2012-07-15

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  18. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Science.gov (United States)

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Gene doping detection: evaluation of approach for direct detection of gene transfer using erythropoietin as a model system.

    Science.gov (United States)

    Baoutina, A; Coldham, T; Bains, G S; Emslie, K R

    2010-08-01

    As clinical gene therapy has progressed toward realizing its potential, concern over misuse of the technology to enhance performance in athletes is growing. Although 'gene doping' is banned by the World Anti-Doping Agency, its detection remains a major challenge. In this study, we developed a methodology for direct detection of the transferred genetic material and evaluated its feasibility for gene doping detection in blood samples from athletes. Using erythropoietin (EPO) as a model gene and a simple in vitro system, we developed real-time PCR assays that target sequences within the transgene complementary DNA corresponding to exon/exon junctions. As these junctions are absent in the endogenous gene due to their interruption by introns, the approach allows detection of trace amounts of a transgene in a large background of the endogenous gene. Two developed assays and one commercial gene expression assay for EPO were validated. On the basis of ability of these assays to selectively amplify transgenic DNA and analysis of literature on testing of gene transfer in preclinical and clinical gene therapy, it is concluded that the developed approach would potentially be suitable to detect gene doping through gene transfer by analysis of small volumes of blood using regular out-of-competition testing.

  20. A performance comparison of direct- and indirect-detection flat-panel imagers

    International Nuclear Information System (INIS)

    Partridge, M.; Hesse, B.-M.; Mueller, L.

    2002-01-01

    A comparison of the performance of a direct- and an indirect-detection amorphous silicon flat-panel X-ray imager is presented for a 6 MV beam. Experimental measurements of the noise characteristics, image lag, spectral response, spatial resolution and quantum efficiency are described, compared and discussed. The two systems are comprised of 512x512 pixel, 400 μm pitch, arrays of a-Si:H p-i-n photodiodes and thin-film transistors. In the direct-detection system, X-rays interact to produce electron/hole pairs directly in the silicon photodiodes. For the indirect-detection system, a phosphor screen converts energy from the incident X-rays into visible light, which is then detected by the photodiodes. Both systems are shown to be quantum noise limited, with the total electronic noise in the detector 10-15 times smaller than the Poisson noise level in detected signal. The measured lag for both systems is 1.0±0.1% or less in the first frame with subsequent signals decaying exponentially with frame read-out, with a half-life of between 3.3 and 3.8 frames. Both systems are demonstrated to have a pronounced sensitivity to low-energy multiply scattered photons, although this is shown to be effectively filtered out using a 2 mm copper build-up plate. The direct-detection system, with the 2 mm Cu build-up, shows greater sensitivity to scattered radiation than the indirect system. The spatial resolutions of both systems were effectively equal with an f 50 of 0.25 mm -1 when pixels are binned 2x2, although a slight contribution from optical scattering in the phosphor screen is seen for the indirect-detection system. The quantum efficiency of the direct-detection system is a factor of 0.45 lower than that of the indirect-detection system. The application of these detectors to megavoltage CT is discussed, with the conclusion that the indirect-detection system is to be preferred

  1. Less-simplified models of dark matter for direct detection and the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, Arghya [Regional Centre for Accelerator-based Particle Physics, Harish-Chandra Research Institute,Allahabad - 211019 (India); Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J. [National Centre for Nuclear Research,Hoża 69, 00-681 Warsaw (Poland)

    2016-04-29

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators’ mass. We derive the strongest limits for combinations of vector + scalar, vector + “squark”, and “squark” + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  2. Direct biosensor immunoassays for the detection of nonmilk proteins in milk powder

    NARCIS (Netherlands)

    Haasnoot, W.; Olieman, K.; Cazemier, G.; Verheijen, R.

    2001-01-01

    The low prices of some nonmilk proteins make them attractive as potential adulterants in dairy products. An optical biosensor (BIACORE 3000) was used to develop a direct and combined biosensor immunoassay (BIA) for the simultaneous detection of soy, pea, and soluble wheat proteins in milk powders.

  3. 16-level differential phase shift keying (D16PSK) in direct detection optical communication systems

    DEFF Research Database (Denmark)

    Sambaraju, R.; Tokle, Torger; Jensen, J.B.

    2006-01-01

    Optical 16-level differential phase shift keying (D16PSK) carrying four bits for every symbol is proposed for direct detection optical communication systems. Transmitter and receiver schematics are presented, and the receiver sensitivity is discussed. We numerically investigate the impact...

  4. Less-simplified models of dark matter for direct detection and the LHC

    International Nuclear Information System (INIS)

    Choudhury, Arghya; Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J.

    2016-01-01

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators’ mass. We derive the strongest limits for combinations of vector + scalar, vector + “squark”, and “squark” + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  5. Less-simplified models of dark matter for direct detection and the LHC

    Science.gov (United States)

    Choudhury, Arghya; Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J.

    2016-04-01

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳ 10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators' mass. We derive the strongest limits for combinations of vector + scalar, vector + "squark", and "squark" + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  6. Interplay and Characterization of Dark Matter Searches at Colliders and in Direct Detection Experiments

    CERN Document Server

    Malik, Sarah A.; Araujo, Henrique; Belyaev, A.; Bœhm, Céline; Brooke, Jim; Buchmueller, Oliver; Davies, Gavin; De Roeck, Albert; de Vries, Kees; Dolan, Matthew J.; Ellis, John; Fairbairn, Malcolm; Flaecher, Henning; Gouskos, Loukas; Khoze, Valentin V.; Landsberg, Greg; Newbold, Dave; Papucci, Michele; Sumner, Timothy; Thomas, Marc; Worm, Steven

    2015-01-01

    In this White Paper we present and discuss a concrete proposal for the consistent interpretation of Dark Matter searches at colliders and in direct detection experiments. Based on a specific implementation of simplified models of vector and axial-vector mediator exchanges, this proposal demonstrates how the two search strategies can be compared on an equal footing.

  7. Signatures of Earth-scattering in the direct detection of Dark Matter

    DEFF Research Database (Denmark)

    Kavanagh, Bradley J.; Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation...

  8. Direct detection of dark matter in models with a light Z'

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Sarkar, Subir

    2011-01-01

    We discuss the direct detection signatures of dark matter interacting with nuclei via a Z' mediator, focussing on the case where both the dark matter and the $Z'$ have mass of a few GeV. Isospin violation (i.e. different couplings to protons and neutrons) arises naturally in this scenario...

  9. A performance comparison of direct- and indirect-detection flat-panel imagers

    CERN Document Server

    Partridge, M; Müller, L

    2002-01-01

    A comparison of the performance of a direct- and an indirect-detection amorphous silicon flat-panel X-ray imager is presented for a 6 MV beam. Experimental measurements of the noise characteristics, image lag, spectral response, spatial resolution and quantum efficiency are described, compared and discussed. The two systems are comprised of 512x512 pixel, 400 mu m pitch, arrays of a-Si:H p-i-n photodiodes and thin-film transistors. In the direct-detection system, X-rays interact to produce electron/hole pairs directly in the silicon photodiodes. For the indirect-detection system, a phosphor screen converts energy from the incident X-rays into visible light, which is then detected by the photodiodes. Both systems are shown to be quantum noise limited, with the total electronic noise in the detector 10-15 times smaller than the Poisson noise level in detected signal. The measured lag for both systems is 1.0+-0.1% or less in the first frame with subsequent signals decaying exponentially with frame read-out, with...

  10. Direct 13C-detected NMR experiments for mapping and characterization of hydrogen bonds in RNA

    International Nuclear Information System (INIS)

    Fürtig, Boris; Schnieders, Robbin; Richter, Christian; Zetzsche, Heidi; Keyhani, Sara; Helmling, Christina; Kovacs, Helena; Schwalbe, Harald

    2016-01-01

    In RNA secondary structure determination, it is essential to determine whether a nucleotide is base-paired and not. Base-pairing of nucleotides is mediated by hydrogen bonds. The NMR characterization of hydrogen bonds relies on experiments correlating the NMR resonances of exchangeable protons and can be best performed for structured parts of the RNA, where labile hydrogen atoms are protected from solvent exchange. Functionally important regions in RNA, however, frequently reveal increased dynamic disorder which often leads to NMR signals of exchangeable protons that are broadened beyond 1 H detection. Here, we develop 13 C direct detected experiments to observe all nucleotides in RNA irrespective of whether they are involved in hydrogen bonds or not. Exploiting the self-decoupling of scalar couplings due to the exchange process, the hydrogen bonding behavior of the hydrogen bond donor of each individual nucleotide can be determined. Furthermore, the adaption of HNN-COSY experiments for 13 C direct detection allows correlations of donor–acceptor pairs and the localization of hydrogen-bond acceptor nucleotides. The proposed 13 C direct detected experiments therefore provide information about molecular sites not amenable by conventional proton-detected methods. Such information makes the RNA secondary structure determination by NMR more accurate and helps to validate secondary structure predictions based on bioinformatics.

  11. Anti-impulse-noise Edge Detection via Anisotropic Morphological Directional Derivatives.

    Science.gov (United States)

    Shui, Peng-Lang; Wang, Fu-Ping

    2017-07-13

    Traditional differential-based edge detection suffers from abrupt degradation in performance when images are corrupted by impulse noises. The morphological operators such as the median filters and weighted median filters possess the intrinsic ability to counteract impulse noise. In this paper, by combining the biwindow configuration with weighted median filters, anisotropic morphological directional derivatives (AMDD) robust to impulse noise are proposed to measure the local grayscale variation around a pixel. For ideal step edges, the AMDD spatial response and directional representation are derived. The characteristics and edge resolution of two kinds of typical biwindows are analyzed thoroughly. In terms of the AMDD spatial response and directional representation of ideal step edges, the spatial matched filter is used to extract the edge strength map (ESM) from the AMDDs of an image. The spatial and directional matched filters are used to extract the edge direction map (EDM). Embedding the extracted ESM and EDM into the standard route of the differential-based edge detection, an anti-impulse-noise AMDD-based edge detector is constructed. It is compared with the existing state-of-the-art detectors on a recognized image dataset for edge detection evaluation. The results show that it attains competitive performance in noise-free and Gaussian noise cases and the best performance in impulse noise cases.

  12. Detection of directional eye movements based on the electrooculogram signals through an artificial neural network

    International Nuclear Information System (INIS)

    Erkaymaz, Hande; Ozer, Mahmut; Orak, İlhami Muharrem

    2015-01-01

    The electrooculogram signals are very important at extracting information about detection of directional eye movements. Therefore, in this study, we propose a new intelligent detection model involving an artificial neural network for the eye movements based on the electrooculogram signals. In addition to conventional eye movements, our model also involves the detection of tic and blinking of an eye. We extract only two features from the electrooculogram signals, and use them as inputs for a feed-forwarded artificial neural network. We develop a new approach to compute these two features, which we call it as a movement range. The results suggest that the proposed model have a potential to become a new tool to determine the directional eye movements accurately

  13. Direct detection of OTA by impedimetric aptasensor based on modified polypyrrole-dendrimers

    Energy Technology Data Exchange (ETDEWEB)

    Mejri-Omrani, Nawel [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Miodek, Anna; Zribi, Becem [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); Marrakchi, Mouna [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Université de Tunis El Manar, Higher Institute of Applied Biological Sciences (ISSBAT), 1006 Tunis (Tunisia); Hamdi, Moktar [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Marty, Jean-Louis [BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Korri-Youssoufi, Hafsa, E-mail: hafsa.korri-youssoufi@u-psud.fr [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France)

    2016-05-12

    Ochratoxin A (OTA) is a carcinogenic mycotoxin that contaminates food such as cereals, wine and beer; therefore it represents a risk for human health. Consequently, the allowed concentration of OTA in food is regulated by governmental organizations and its detection is of major agronomical interest. In the current study we report the development of an electrochemical aptasensor able to directly detect trace OTA without any amplification procedure. This aptasensor was constructed by coating the surface of a gold electrode with a film layer of modified polypyrrole (PPy), which was thereafter covalently bound to polyamidoamine dendrimers of the fourth generation (PAMAM G4). Finally, DNA aptamers that specifically binds OTA were covalently bound to the PAMAM G4 providing the aptasensor, which was characterized by using both Atomic Force Microscopy (AFM) and Surface Plasmon Resonance (SPR) techniques. The study of OTA detection by the constructed electrochemical aptasensor was performed using Electrochemical Impedance Spectroscopy (EIS) and revealed that the presence of OTA led to the modification of the electrical properties of the PPy layer. These modifications could be assigned to conformational changes in the folding of the aptamers upon specific binding of OTA. The aptasensor had a dynamic range of up to 5 μg L{sup −1} of OTA and a detection limit of 2 ng L{sup −1} of OTA, which is below the OTA concentration allowed in food by the European regulations. The efficient detection of OTA by this electrochemical aptasensor provides an unforeseen platform that could be used for the detection of various small molecules through specific aptamer association. - Highlights: • Development of innovative platform for direct and ultra-sensitive toxins detection. • Aptasensor based on modified conductive polypyrrole layer. • We demonstrate the conformation change of aptamer upon toxin binding. • We highlight that detection was obtained by modification of charge of

  14. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    Energy Technology Data Exchange (ETDEWEB)

    Caballero, David, E-mail: caballero@unistra.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Martinez, Elena [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Bausells, Joan [Centre Nacional de Microelectronica (CNM-IMB), CSIC, Campus UAB, 08193 Bellaterra (Spain); Errachid, Abdelhamid, E-mail: abdelhamid.errachid-el-salhi@univ-lyon1.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Universite Claude Bernard - Lyon 1, LSA - UMR 5180, 43 Bd du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Samitier, Josep [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. Black-Right-Pointing-Pointer Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. Black-Right-Pointing-Pointer Silicon nitride offers multiple advantages compared to other common materials. Black-Right-Pointing-Pointer The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si{sub 3}N{sub 4}) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si{sub 3}N{sub 4}-based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO{sub 2}/Si{sub 3}N{sub 4} structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10{sup -13}-10{sup -7} M were detected, showing a sensitivity of 0.128 {Omega} {mu}M{sup -1} and a limit of detection of 10{sup -14} M. The specificity of the sensor was also addressed by studying the

  15. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    International Nuclear Information System (INIS)

    Caballero, David; Martinez, Elena; Bausells, Joan; Errachid, Abdelhamid; Samitier, Josep

    2012-01-01

    Highlights: ► An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. ► Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. ► Silicon nitride offers multiple advantages compared to other common materials. ► The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si 3 N 4 ) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si 3 N 4 -based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO 2 /Si 3 N 4 structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10 −13 –10 −7 M were detected, showing a sensitivity of 0.128 Ω μM −1 and a limit of detection of 10 −14 M. The specificity of the sensor was also addressed by studying the interferences with a similar protein, bovine serum albumin. The results obtained show that the antibodies were efficiently immobilized and the proteins

  16. Performance of a direct detection camera for off-axis electron holography

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Shery L.Y., E-mail: shery.chang@asu.edu [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); LeRoy Eyring Center for Solid State Science, Arizona State University, Tempe, AZ 85287 (United States); Dwyer, Christian [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Department of Physics, Arizona State University, Tempe, AZ 85287 (United States); Barthel, Juri; Boothroyd, Chris B.; Dunin-Borkowski, Rafal E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany)

    2016-02-15

    The performance of a direct detection camera (DDC) is evaluated in the context of off-axis electron holographic experiments in a transmission electron microscope. Its performance is also compared directly with that of a conventional charge-coupled device (CCD) camera. The DDC evaluated here can be operated either by the detection of individual electron events (counting mode) or by the effective integration of many such events during a given exposure time (linear mode). It is demonstrated that the improved modulation transfer functions and detective quantum efficiencies of both modes of the DDC give rise to significant benefits over the conventional CCD cameras, specifically, a significant improvement in the visibility of the holographic fringes and a reduction of the statistical error in the phase of the reconstructed electron wave function. The DDC's linear mode, which can handle higher dose rates, allows optimisation of the dose rate to achieve the best phase resolution for a wide variety of experimental conditions. For suitable conditions, the counting mode can potentially utilise a significantly lower dose to achieve a phase resolution that is comparable to that achieved using the linear mode. The use of multiple holograms and correlation techniques to increase the total dose in counting mode is also demonstrated. - Highlights: • Performance of a direct detection camera for off-axis electron holography has been evaluated. • Better holographic fringe visibility and phase resolution are achieved using DDC. • Both counting and linear modes offered by DDC are advantageous for different dose regimes.

  17. Performance of a direct detection camera for off-axis electron holography

    International Nuclear Information System (INIS)

    Chang, Shery L.Y.; Dwyer, Christian; Barthel, Juri; Boothroyd, Chris B.; Dunin-Borkowski, Rafal E.

    2016-01-01

    The performance of a direct detection camera (DDC) is evaluated in the context of off-axis electron holographic experiments in a transmission electron microscope. Its performance is also compared directly with that of a conventional charge-coupled device (CCD) camera. The DDC evaluated here can be operated either by the detection of individual electron events (counting mode) or by the effective integration of many such events during a given exposure time (linear mode). It is demonstrated that the improved modulation transfer functions and detective quantum efficiencies of both modes of the DDC give rise to significant benefits over the conventional CCD cameras, specifically, a significant improvement in the visibility of the holographic fringes and a reduction of the statistical error in the phase of the reconstructed electron wave function. The DDC's linear mode, which can handle higher dose rates, allows optimisation of the dose rate to achieve the best phase resolution for a wide variety of experimental conditions. For suitable conditions, the counting mode can potentially utilise a significantly lower dose to achieve a phase resolution that is comparable to that achieved using the linear mode. The use of multiple holograms and correlation techniques to increase the total dose in counting mode is also demonstrated. - Highlights: • Performance of a direct detection camera for off-axis electron holography has been evaluated. • Better holographic fringe visibility and phase resolution are achieved using DDC. • Both counting and linear modes offered by DDC are advantageous for different dose regimes.

  18. A comparison of photographic, replication and direct clinical examination methods for detecting developmental defects of enamel

    Directory of Open Access Journals (Sweden)

    Pakshir Hamid-Reza

    2011-04-01

    Full Text Available Abstract Background Different methods have been used for detecting developmental defects of enamel (DDE. This study aimed to compare photographic and replication methods with the direct clinical examination method for detecting DDE in children's permanent incisors. Methods 110 8-10-year-old schoolchildren were randomly selected from an examined sample of 335 primary Shiraz school children. Modified DDE index was used in all three methods. Direct examinations were conducted by two calibrated examiners using flat oral mirrors and tongue blades. Photographs were taken using a digital SLR camera (Nikon D-80, macro lens, macro flashes, and matt flash filters. Impressions were taken using additional-curing silicon material and casts made in orthodontic stone. Impressions and models were both assessed using dental loupes (magnification=x3.5. Each photograph/impression/cast was assessed by two calibrated examiners. Reliability of methods was assessed using kappa agreement tests. Kappa agreement, McNemar's and two-sample proportion tests were used to compare results obtained by the photographic and replication methods with those obtained by the direct examination method. Results Of the 110 invited children, 90 were photographed and 73 had impressions taken. The photographic method had higher reliability levels than the other two methods, and compared to the direct clinical examination detected significantly more subjects with DDE (P = 0.002, 3.1 times more DDE (P Conclusion The photographic method was much more sensitive than direct clinical examination in detecting DDE and was the best of the three methods for epidemiological studies. The replication method provided less information about DDE compared to photography. Results of this study have implications for both epidemiological and detailed clinical studies on DDE.

  19. Direct electrochemistry of glucose oxidase assembled on graphene and application to glucose detection

    International Nuclear Information System (INIS)

    Wu Ping; Shao Qian; Hu Yaojuan; Jin Juan; Yin Yajing; Zhang Hui; Cai Chenxin

    2010-01-01

    The direct electrochemistry of glucose oxidase (GOx) integrated with graphene was investigated. The voltammetric results indicated that GOx assembled on graphene retained its native structure and bioactivity, exhibited a surface-confined process, and underwent effective direct electron transfer (DET) reaction with an apparent rate constant (k s ) of 2.68 s -1 . This work also developed a novel approach for glucose detection based on the electrocatalytic reduction of oxygen at the GOx-graphene/GC electrode. The assembled GOx could electrocatalyze the reduction of dissolved oxygen. Upon the addition of glucose, the reduction current decreased, which could be used for glucose detection with a high sensitivity (ca. 110 ± 3 μA mM -1 cm -2 ), a wide linear range (0.1-10 mM), and a low detection limit (10 ± 2 μM). The developed approach can efficiently exclude the interference of commonly coexisting electroactive species due to the use of a low detection potential (-470 mV, versus SCE). Therefore, this study has not only successfully achieved DET reaction of GOx assembled on graphene, but also established a novel approach for glucose detection and provided a general route for fabricating graphene-based biosensing platform via assembling enzymes/proteins on graphene surface.

  20. Image covariance and lesion detectability in direct fan-beam x-ray computed tomography.

    Science.gov (United States)

    Wunderlich, Adam; Noo, Frédéric

    2008-05-21

    We consider noise in computed tomography images that are reconstructed using the classical direct fan-beam filtered backprojection algorithm, from both full- and short-scan data. A new, accurate method for computing image covariance is presented. The utility of the new covariance method is demonstrated by its application to the implementation of a channelized Hotelling observer for a lesion detection task. Results from the new covariance method and its application to the channelized Hotelling observer are compared with results from Monte Carlo simulations. In addition, the impact of a bowtie filter and x-ray tube current modulation on reconstruction noise and lesion detectability are explored for full-scan reconstruction.

  1. Direct detection of light dark matter and solar neutrinos via color center production in crystals

    OpenAIRE

    Budnik, Ranny; Cheshnovsky, Ori; Slone, Oren; Volansky, Tomer

    2018-01-01

    We propose a new low-threshold direct-detection concept for dark matter and for coherent nuclear scattering of solar neutrinos, based on the dissociation of atoms and subsequent creation of color center type defects within a lattice. The novelty in our approach lies in its ability to detect single defects in a macroscopic bulk of material. This class of experiments features ultra-low energy thresholds which allows for the probing of dark matter as light as O(10) MeV through nuclear scattering...

  2. Image covariance and lesion detectability in direct fan-beam x-ray computed tomography

    International Nuclear Information System (INIS)

    Wunderlich, Adam; Noo, Frederic

    2008-01-01

    We consider noise in computed tomography images that are reconstructed using the classical direct fan-beam filtered backprojection algorithm, from both full- and short-scan data. A new, accurate method for computing image covariance is presented. The utility of the new covariance method is demonstrated by its application to the implementation of a channelized Hotelling observer for a lesion detection task. Results from the new covariance method and its application to the channelized Hotelling observer are compared with results from Monte Carlo simulations. In addition, the impact of a bowtie filter and x-ray tube current modulation on reconstruction noise and lesion detectability are explored for full-scan reconstruction

  3. Direct SUSY dark matter detection-theoretical rates due to the spin

    International Nuclear Information System (INIS)

    Vergados, J D

    2004-01-01

    The recent WMAP data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Thus direct dark matter detection, consisting of detecting the recoiling nucleus, is central to particle physics and cosmology. Supersymmetry provides a natural dark matter candidate, the lightest supersymmetric particle (LSP). The relevant cross sections arise out of two mechanisms: (i) the coherent mode, due to the scalar interaction and (ii) the spin contribution arising from the axial current. In this paper we will focus on the spin contribution, which is expected to dominate for light targets. For both modes it is possible to obtain detectable rates, but in most models the expected rates are much lower than the present experimental goals. So one should exploit two characteristic signatures of the reaction, namely the modulation effect and in directional experiments the correlation of the event rates with the sun's motion. In standard non-directional experiments the modulation is small, less than 2 per cent. In the case of the directional event rates we would like to suggest that the experiments exploit two features of the process, which are essentially independent of the SUSY model employed, namely: (1) the forward-backward asymmetry, with respect to the sun's direction of motion, is very large and (2) the modulation is much larger, especially if the observation is made in a plane perpendicular to the sun's velocity. In this case the difference between maximum and minimum can be larger than 40 per cent and the phase of the earth at the maximum is direction dependent

  4. Precision measurements, dark matter direct detection and LHC Higgs searches in a constrained NMSSM

    International Nuclear Information System (INIS)

    Bélanger, G.; Hugonie, C.; Pukhov, A.

    2009-01-01

    We reexamine the constrained version of the Next-to-Minimal Supersymmetric Standard Model with semi universal parameters at the GUT scale (CNMSSM). We include constraints from collider searches for Higgs and susy particles, upper bound on the relic density of dark matter, measurements of the muon anomalous magnetic moment and of B-physics observables as well as direct searches for dark matter. We then study the prospects for direct detection of dark matter in large scale detectors and comment on the prospects for discovery of heavy Higgs states at the LHC

  5. Direct detection of saponins in crude extracts of soapnuts by FTIR.

    Science.gov (United States)

    Almutairi, Meshari Saad; Ali, Muhammad

    2015-01-01

    Direct detection of saponins in soapnuts (Sapindus mukorossi) using Fourier transform infrared (FTIR) spectroscopy is investigated in this project. Potassium bromide powder was mixed with extracted powder of soapnuts and compressed to a thin pellet for examination process. The outcome of the FTIR spectra of saponin demonstrated characteristic triterpenoid saponin absorptions of OH, C = O, C-H, and C = C, while the glycoside linkages to the sapogenins were indicated by the absorptions of C-O. The significance of this study is that saponin absorption peaks are directly detectable in crude aqueous and 95% ethanol extracts of soapnuts powder using FTIR spectroscopy, thereby eliminating the need of further expensive and exhaustive purification steps. The extracts of soapnuts were screened for saponins along with controls by phytochemical tests, and advanced spectroscopic techniques such as ultra fast liquid chromatography and ultra performance liquid chromatography quadrupole-time of flight-mass spectrometry were also implemented to validate the saponins.

  6. Analyzing of singlet fermionic dark matter via the updated direct detection data

    Energy Technology Data Exchange (ETDEWEB)

    Ettefaghi, M.M.; Moazzemi, R. [University of Qom, Department of Physics, Qom (Iran, Islamic Republic of)

    2017-05-15

    We revisit the parameter space of singlet fermionic cold dark matter model in order to determine the role of the mixing angle between the standard model Higgs and a new singlet one. Furthermore, we restudy the direct detection constraints with the updated and new experimental data. As an important conclusion, this model is completely excluded by recent XENON100, PandaX II and LUX data. (orig.)

  7. Simplified dark matter models with charged mediators: prospects for direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Sandick, Pearl; Sinha, Kuver; Teng, Fei [Department of Physics and Astronomy, University of Utah,Salt Lake City, UT 84112 (United States)

    2016-10-05

    We consider direct detection prospects for a class of simplified models of fermionic dark matter (DM) coupled to left and right-handed Standard Model fermions via two charged scalar mediators with arbitrary mixing angle α. DM interactions with the nucleus are mediated by higher electromagnetic moments, which, for Majorana DM, is the anapole moment. After giving a full analytic calculation of the anapole moment, including its α dependence, and matching with limits in the literature, we compute the DM-nucleon scattering cross-section and show the LUX and future LZ constraints on the parameter space of these models. We then compare these results with constraints coming from Fermi-LAT continuum and line searches. Results in the supersymmetric limit of these simplified models are provided in all cases. We find that future direct detection experiments will be able to probe most of the parameter space of these models for O(100−200) GeV DM and lightest mediator mass ≲O(5%) larger than the DM mass. The direct detection prospects dwindle for larger DM mass and larger mass gap between the DM and the lightest mediator mass, although appreciable regions are still probed for O(200) GeV DM and lightest mediator mass ≲O(20%) larger than the DM mass. The direct detection bounds are also attenuated near certain “blind spots' in the parameter space, where the anapole moment is severely suppressed due to cancellation of different terms. We carefully study these blind spots and the associated Fermi-LAT signals in these regions.

  8. Horizontal Directional Drilling-Length Detection Technology While Drilling Based on Bi-Electro-Magnetic Sensing

    Directory of Open Access Journals (Sweden)

    Yudan Wang

    2017-04-01

    Full Text Available The drilling length is an important parameter in the process of horizontal directional drilling (HDD exploration and recovery, but there has been a lack of accurate, automatically obtained statistics regarding this parameter. Herein, a technique for real-time HDD length detection and a management system based on the electromagnetic detection method with a microprocessor and two magnetoresistive sensors employing the software LabVIEW are proposed. The basic principle is to detect the change in the magnetic-field strength near a current coil while the drill stem and drill-stem joint successively pass through the current coil forward or backward. The detection system consists of a hardware subsystem and a software subsystem. The hardware subsystem employs a single-chip microprocessor as the main controller. A current coil is installed in front of the clamping unit, and two magneto resistive sensors are installed on the sides of the coil symmetrically and perpendicular to the direction of movement of the drill pipe. Their responses are used to judge whether the drill-stem joint is passing through the clamping unit; then, the order of their responses is used to judge the movement direction. The software subsystem is composed of a visual software running on the host computer and a software running in the slave microprocessor. The host-computer software processes, displays, and saves the drilling-length data, whereas the slave microprocessor software operates the hardware system. A combined test demonstrated the feasibility of the entire drilling-length detection system.

  9. Direct and indirect fluorescent detection of tetracyclines using dually emitting carbon dots

    International Nuclear Information System (INIS)

    Qu, Fei; Sun, Zhe; Liu, Dongya; Zhao, Xianen; You, Jinmao

    2016-01-01

    The authors describe dual-emission carbon nanodots containing blue emitters (BE; peak emission at 385 nm under 315 nm excitation) and yellow emitters (YE; peak emission at 530 nm under 365 nm excitation), and how they can be applied to direct and indirect determination of tetracyclines (TCs). The direct detection scheme is based on the finding that tetracycline (TET), oxytetracycline, chlortetracycline and doxycycline quench the two emissions of the carbon dots. While direct determination is rapid and convenient, it cannot differentiate between TCs. The indirect detection scheme, in contrast, is based on the finding that Al (III) ions enhance the fluorescence of the YE in the carbon dots, and that they cause a blue shift in emission. It is, however, known that TET forms a strong complex with Al (III), and this can inhibit the interaction between Al (III) and the YE, so that the fluorescence of YE is not enhanced and blue-shifted by Al (III) in the presence of TET. This finding is exploited in a fluorescence turn-on/off assay for TET that can distinguish TET from other TCs. The linear range of indirect determination for TET extends from 1 nM to 30 μM, and the limit of detection is 0.52 nM. The indirect method was successfully applied to the determination of TET in spiked milk, fish and pork, and recoveries ranged from 91.7 to 102 %. (author)

  10. You can hide but you have to run: direct detection with vector mediators

    Energy Technology Data Exchange (ETDEWEB)

    D’Eramo, Francesco [Department of Physics, University of California Santa Cruz,1156 High St., Santa Cruz, CA 95064 (United States); Santa Cruz Institute for Particle Physics,1156 High St., Santa Cruz, CA 95064 (United States); Kavanagh, Bradley J. [Laboratoire de Physique Théorique et Hautes Energies, CNRS, UMR 7589,4 Place Jussieu, F-75252, Paris (France); Institut de Physique Théorique, Université Paris Saclay, CNRS, CEA,Orme des Merisiers batiment 774, F-91191 Gif-sur-Yvette Cedex (France); Panci, Paolo [Institut d’Astrophysique de Paris, UMR 7095 CNRS, Université Pierre et Marie Curie,98 bis Boulevard Arago, Paris 75014 (France)

    2016-08-18

    We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running. In some cases the inclusion of these effects changes the bounds by several orders of magnitude, as a consequence of operator mixing which generates new interactions at low energy. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Finally, we provide tools to facilitate the inclusion of these effects in future studies: general approximate expressions for the low energy couplings and a public code runDM to evolve the couplings between arbitrary energy scales.

  11. Detection of Low Molecular Weight Adulterants in Beverages by Direct Analysis in Real Time Mass Spectrometry.

    Science.gov (United States)

    Sisco, Edward; Dake, Jeffrey

    2016-04-14

    Direct Analysis in Real Time Mass Spectrometry (DART-MS) has been used to detect the presence of non-narcotic adulterants in beverages. The non-narcotic adulterants that were examined in this work incorporated a number low molecular weight alcohols, acetone, ammonium hydroxide, and sodium hypochlorite. Analysis of the adulterants was completed by pipetting 1 µL deposits onto glass microcapillaries along with an appropriate dopant species followed by introduction into the DART gas stream. It was found that detection of these compounds in the complex matrices of common beverages (soda, energy drinks, etc.) was simplified through the use of a dopant species to allow for adduct formation with the desired compound(s) of interest. Other parameters that were investigated included DART gas stream temperature, in source collision induced dissociation, ion polarity, and DART needle voltage. Sensitivities of the technique were found to range from 0.001 % volume fraction to 0.1 % volume fraction, comparable to traditional analyses completed using headspace gas chromatography mass spectrometry (HS-GC/MS). Once a method was established using aqueous solutions, , fifteen beverages were spiked with each of the nine adulterants, to simulate real world detection, and in nearly all cases the adulterant could be detected either in pure form, or complexed with the added dopant species. This technique provides a rapid way to directly analyze beverages believed to be contaminated with non-narcotic adulterants at sensitivities similar to or exceeding those of traditional confirmatory analyses.

  12. Direct Electrical Detection of Iodine Gas by a Novel Metal-Organic-Framework-Based Sensor.

    Science.gov (United States)

    Small, Leo J; Nenoff, Tina M

    2017-12-27

    High-fidelity detection of iodine species is of utmost importance to the safety of the population in cases of nuclear accidents or advanced nuclear fuel reprocessing. Herein, we describe the success at using impedance spectroscopy to directly detect the real-time adsorption of I 2 by a metal-organic framework zeolitic imidazolate framework (ZIF)-8-based sensor. Methanolic suspensions of ZIF-8 were dropcast onto platinum interdigitated electrodes, dried, and exposed to gaseous I 2 at 25, 40, or 70 °C. Using an unoptimized sensor geometry, I 2 was readily detected at 25 °C in air within 720 s of exposure. The specific response is attributed to the chemical selectivity of the ZIF-8 toward I 2 . Furthermore, equivalent circuit modeling of the impedance data indicates a >10 5 × decrease in ZIF-8 resistance when 116 wt % I 2 is adsorbed by ZIF-8 at 70 °C in air. This irreversible decrease in resistance is accompanied by an irreversible loss in the long-range crystallinity, as evidenced by X-ray diffraction and infrared spectroscopy. Air, argon, methanol, and water were found to produce minimal changes in ZIF-8 impedance. This report demonstrates how selective I 2 adsorption by ZIF-8 can be leveraged to create a highly selective sensor using >10 5 × changes in impedance response to enable the direct electrical detection of environmentally relevant gaseous toxins.

  13. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    Directory of Open Access Journals (Sweden)

    Jnnifer A. Sánchez

    2014-05-01

    Full Text Available Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%, II: nheA, hblC (2%, III: hblC, cytK (41.2%, IV: hblC (47%. Of 75 cassava starch samples, 44% were contaminated with toxigenic B. cereus and four different toxigenic consortia were determined: I: nheA, hblC, cytK (48.5%, II: nheA, hblC, cytK, cesB (3%, III: hblC, cytK (30.3%, IV: hblC (18.2%. In general, in dietary complement for children only enterotoxigenic consortia were detected while in cassava starch the enterotoxigenic consortia predominated over the emetic. Multiplex PCR was useful to detect toxigenic B. cereus contamination allowing direct and imultaneous detection of all toxin genes in foods. This study is the first in Colombia to evaluate toxigenic B. cereus, providing information of importance for microbiological risk evaluation in dried foods.

  14. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  15. Direct inference of SNP heterozygosity rates and resolution of LOH detection.

    Directory of Open Access Journals (Sweden)

    Xiaohong Li

    2007-11-01

    Full Text Available Single nucleotide polymorphisms (SNPs have been increasingly utilized to investigate somatic genetic abnormalities in premalignancy and cancer. LOH is a common alteration observed during cancer development, and SNP assays have been used to identify LOH at specific chromosomal regions. The design of such studies requires consideration of the resolution for detecting LOH throughout the genome and identification of the number and location of SNPs required to detect genetic alterations in specific genomic regions. Our study evaluated SNP distribution patterns and used probability models, Monte Carlo simulation, and real human subject genotype data to investigate the relationships between the number of SNPs, SNP HET rates, and the sensitivity (resolution for detecting LOH. We report that variances of SNP heterozygosity rate in dbSNP are high for a large proportion of SNPs. Two statistical methods proposed for directly inferring SNP heterozygosity rates require much smaller sample sizes (intermediate sizes and are feasible for practical use in SNP selection or verification. Using HapMap data, we showed that a region of LOH greater than 200 kb can be reliably detected, with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database. Higher densities of SNPs may exist in certain local chromosomal regions that provide some opportunities for reliably detecting LOH of segment sizes smaller than 50 kb. These results suggest that the interpretation of the results from genome-wide scans for LOH using commercial arrays need to consider the relationships among inter-SNP distance, detection probability, and sample size for a specific study. New experimental designs for LOH studies would also benefit from considering the power of detection and sample sizes required to accomplish the proposed aims.

  16. On Moderator Detection in Anchoring Research: Implications of Ignoring Estimate Direction

    Directory of Open Access Journals (Sweden)

    Nathan N. Cheek

    2018-05-01

    Full Text Available Anchoring, whereby judgments assimilate to previously considered standards, is one of the most reliable effects in psychology. In the last decade, researchers have become increasingly interested in identifying moderators of anchoring effects. We argue that a drawback of traditional moderator analyses in the standard anchoring paradigm is that they ignore estimate direction—whether participants’ estimates are higher or lower than the anchor value. We suggest that failing to consider estimate direction can sometimes obscure moderation in anchoring tasks, and discuss three potential analytic solutions that take estimate direction into account. Understanding moderators of anchoring effects is essential for a basic understanding of anchoring and for applied research on reducing the influence of anchoring in real-world judgments. Considering estimate direction reduces the risk of failing to detect moderation.

  17. Direct Detection Electron Energy-Loss Spectroscopy: A Method to Push the Limits of Resolution and Sensitivity.

    Science.gov (United States)

    Hart, James L; Lang, Andrew C; Leff, Asher C; Longo, Paolo; Trevor, Colin; Twesten, Ray D; Taheri, Mitra L

    2017-08-15

    In many cases, electron counting with direct detection sensors offers improved resolution, lower noise, and higher pixel density compared to conventional, indirect detection sensors for electron microscopy applications. Direct detection technology has previously been utilized, with great success, for imaging and diffraction, but potential advantages for spectroscopy remain unexplored. Here we compare the performance of a direct detection sensor operated in counting mode and an indirect detection sensor (scintillator/fiber-optic/CCD) for electron energy-loss spectroscopy. Clear improvements in measured detective quantum efficiency and combined energy resolution/energy field-of-view are offered by counting mode direct detection, showing promise for efficient spectrum imaging, low-dose mapping of beam-sensitive specimens, trace element analysis, and time-resolved spectroscopy. Despite the limited counting rate imposed by the readout electronics, we show that both core-loss and low-loss spectral acquisition are practical. These developments will benefit biologists, chemists, physicists, and materials scientists alike.

  18. Direct detection of cancer biomarkers in blood using a "place n play" modular polydimethylsiloxane pump.

    Science.gov (United States)

    Zhang, Honglian; Li, Gang; Liao, Lingying; Mao, Hongju; Jin, Qinghui; Zhao, Jianlong

    2013-01-01

    Cancer biomarkers have significant potential as reliable tools for the early detection of the disease and for monitoring its recurrence. However, most current methods for biomarker detection have technical difficulties (such as sample preparation and specific detector requirements) which limit their application in point of care diagnostics. We developed an extremely simple, power-free microfluidic system for direct detection of cancer biomarkers in microliter volumes of whole blood. CEA and CYFRA21-1 were chosen as model cancer biomarkers. The system automatically extracted blood plasma from less than 3 μl of whole blood and performed a multiplex sample-to-answer assay (nano-ELISA (enzyme-linked immunosorbent assay) technique) without the use of external power or extra components. By taking advantage of the nano-ELISA technique, this microfluidic system detected CEA at a concentration of 50 pg/ml and CYFRA21-1 at a concentration of 60 pg/ml within 60 min. The combination of PnP polydimethylsiloxane (PDMS) pump and nano-ELISA technique in a single microchip system shows great promise for the detection of cancer biomarkers in a drop of blood.

  19. Direct Detection of Potential Pyrethroids in Yangtze River via an Imprinted Multilayer Phosphorescence Probe.

    Science.gov (United States)

    Chen, Li; Lv, Xiaodong; Dai, Jiangdong; Sun, Lin; Huo, Pengwei; Li, Chunxiang; Yan, Yongsheng

    2018-01-01

    A novel tailored multilayer probe for monitoring potential pyrethroids in the Yangtze River was proposed. The room-temperature phosphorescence method was applied to realize a detection strategy that is superior to the fluorescence method. Efficient Mn-doped ZnS quantum dots with uniform size of 4.6 nm were firstly coated with a mesoporous silica to obtain a suitable intermediate transition layer, then an imprinted layer containing bifenthrin specific recognition sites was anchored. Characterizations verified the multilayer structure convincingly and the detection process relied on the electron transfer-induced fluorescence quenching mechanism. Optional detection time and standard detection curve were obtained within a concentration range from 5.0 to 50 μmol L -1 . The stability was verified to be good after 12 replicates. Feasibility of the probe was proved by monitoring water samples from the Zhenjiang reach of the Yangtze River. The probe offers promise for direct bifenthrin detection in unknown environmental water with an accurate and stable phosphorescence analysis strategy.

  20. Direct and long-term detection of gene doping in conventional blood samples.

    Science.gov (United States)

    Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

    2011-03-01

    The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

  1. An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data.

    Science.gov (United States)

    Wang, Yejun; MacKenzie, Keith D; White, Aaron P

    2015-05-07

    As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for

  2. First direct fluorescence polarization assay for the detection and quantification of spirolides in mussel samples

    Energy Technology Data Exchange (ETDEWEB)

    Otero, Paz; Alfonso, Amparo [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain); Alfonso, Carmen [CIFGA Laboratorio, Plaza de Santo Domingo, 1, 27001 Lugo (Spain); Araoz, Romulo; Molgo, Jordi [CNRS, Institut de Neurobiologie Alfred Fessard - FRC2118, Laboratoire de Neurobiologie et Developpement UPR3294, 1 Avenue de la Terrasse, 91198 Gif sur Yvette Cedex (France); Vieytes, Mercedes R. [Departamento de Fisiologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002 Lugo (Spain); Botana, Luis M., E-mail: luis.botana@usc.es [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain)

    2011-09-09

    Highlights: {yields} A direct assay based in the binding of nAChR to spirolide toxins by FP is described. {yields} A direct relationship between FP and 13-desMeC in the range of 10-500 nM is obtained. {yields} FP is dependent on the 13, 19-didesMeC in a higher concentration range than 13-desMeC. {yields} FP assay is a sensitive method to detect and quantify 13-desMeC in mussel samples. - Abstract: In 2009, we achieve the first inhibition FP assay to detect imine cyclic toxins. In the present paper we propose a new FP assay for direct quantify spirolides. This new method has resulted in significant improvement of sensitivity, rapidity and accessibility. In the method design, nicotinic acetylcholine receptor from Torpedo marmorata membranes labelled with a derivative of fluorescein was used. Spirolides, 13-desmethyl spirolide C (13-desMeC) and 13,19-didesmethyl spirolide C (13,19-didesMeC) were extracted and purified from cultures of the Alexandrium ostenfeldii dinoflagellate. Data showed the decrease of FP when toxin concentration was increased. Thus, a relationship between the FP units and the spirolides amount present in a sample was obtained. This direct assay is a reproducible, simple and very sensitive method with a detection limit about 25 nM for 13-desMeC and 150 nM for 13,19-didesMeC. The procedure was used to measure spirolides in mussel samples using an extraction and clean up protocol suitable for the FP assay. Results obtained show that this method is able to quantify 13-desMeC in the range of 50-350 {mu}g kg{sup -1} meat. Other liposoluble toxins did not interfere with the assay, proving a specific method. Moreover, the matrix do not affect in the range of toxin concentrations that involving risk of spirolides intoxication.

  3. First direct fluorescence polarization assay for the detection and quantification of spirolides in mussel samples

    International Nuclear Information System (INIS)

    Otero, Paz; Alfonso, Amparo; Alfonso, Carmen; Araoz, Romulo; Molgo, Jordi; Vieytes, Mercedes R.; Botana, Luis M.

    2011-01-01

    Highlights: → A direct assay based in the binding of nAChR to spirolide toxins by FP is described. → A direct relationship between FP and 13-desMeC in the range of 10-500 nM is obtained. → FP is dependent on the 13, 19-didesMeC in a higher concentration range than 13-desMeC. → FP assay is a sensitive method to detect and quantify 13-desMeC in mussel samples. - Abstract: In 2009, we achieve the first inhibition FP assay to detect imine cyclic toxins. In the present paper we propose a new FP assay for direct quantify spirolides. This new method has resulted in significant improvement of sensitivity, rapidity and accessibility. In the method design, nicotinic acetylcholine receptor from Torpedo marmorata membranes labelled with a derivative of fluorescein was used. Spirolides, 13-desmethyl spirolide C (13-desMeC) and 13,19-didesmethyl spirolide C (13,19-didesMeC) were extracted and purified from cultures of the Alexandrium ostenfeldii dinoflagellate. Data showed the decrease of FP when toxin concentration was increased. Thus, a relationship between the FP units and the spirolides amount present in a sample was obtained. This direct assay is a reproducible, simple and very sensitive method with a detection limit about 25 nM for 13-desMeC and 150 nM for 13,19-didesMeC. The procedure was used to measure spirolides in mussel samples using an extraction and clean up protocol suitable for the FP assay. Results obtained show that this method is able to quantify 13-desMeC in the range of 50-350 μg kg -1 meat. Other liposoluble toxins did not interfere with the assay, proving a specific method. Moreover, the matrix do not affect in the range of toxin concentrations that involving risk of spirolides intoxication.

  4. Directional support value of Gaussian transformation for infrared small target detection.

    Science.gov (United States)

    Yang, Changcai; Ma, Jiayi; Qi, Shengxiang; Tian, Jinwen; Zheng, Sheng; Tian, Xin

    2015-03-20

    Robust small target detection is one of the key techniques in IR search and tracking systems for self-defense or attacks. In this paper we present a robust solution for small target detection in a single IR image. The key ideas of the proposed method are to use the directional support value of Gaussian transform (DSVoGT) to enhance the targets, and use the multiscale representation provided by DSVoGT to reduce the false alarm rate. The original image is decomposed into sub-bands in different orientations by convolving the image with the directional support value filters, which are deduced from the weighted mapped least-squares-support vector machines (LS-SVMs). Based on the sub-band images, a support value of Gaussian matrix is constructed, and the trace of this matrix is then defined as the target measure. The corresponding multiscale correlations of the target measures are computed for enhancing target signal while suppressing the background clutter. We demonstrate the advantages of the proposed method on real IR images and compare the results against those obtained from standard detection approaches, including the top-hat filter, max-mean filter, max-median filter, min-local-Laplacian of Gaussian (LoG) filter, as well as LS-SVM. The experimental results on various cluttered background images show that the proposed method outperforms other detectors.

  5. Dispersion compensation of fiber optic communication system with direct detection using artificial neural networks (ANNs)

    Science.gov (United States)

    Maghrabi, Mahmoud M. T.; Kumar, Shiva; Bakr, Mohamed H.

    2018-02-01

    This work introduces a powerful digital nonlinear feed-forward equalizer (NFFE), exploiting multilayer artificial neural network (ANN). It mitigates impairments of optical communication systems arising due to the nonlinearity introduced by direct photo-detection. In a direct detection system, the detection process is nonlinear due to the fact that the photo-current is proportional to the absolute square of the electric field intensity. The proposed equalizer provides the most efficient computational cost with high equalization performance. Its performance is comparable to the benchmark compensation performance achieved by maximum-likelihood sequence estimator. The equalizer trains an ANN to act as a nonlinear filter whose impulse response removes the intersymbol interference (ISI) distortions of the optical channel. Owing to the proposed extensive training of the equalizer, it achieves the ultimate performance limit of any feed-forward equalizer (FFE). The performance and efficiency of the equalizer is investigated by applying it to various practical short-reach fiber optic communication system scenarios. These scenarios are extracted from practical metro/media access networks and data center applications. The obtained results show that the ANN-NFFE compensates for the received BER degradation and significantly increases the tolerance to the chromatic dispersion distortion.

  6. Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

    Science.gov (United States)

    Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

    2016-01-25

    We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

  7. Direct tissue blot immunoassay for detection of Xylella fastidiosa in olive trees

    Directory of Open Access Journals (Sweden)

    Khaled DJELOUAH

    2015-01-01

    Full Text Available A direct tissue blot immunoassay (DTBIA technique has been compared with ELISA and PCR for detection of Xylella fastidiosa in olive trees from Apulia (southern Italy. Fresh cross-sections of young twigs and leaf petioles were printed onto nitrocellulose membranes and analyzed in the laboratory. Analyses of a first group of 61 samples gave similar efficiency for the three diagnostic techniques for detection the bacterium (24 positive and 36 negative samples, except for a single sample which was positive only with DTBIA and PCR. Similar results were obtained by separately analyzing suckers and twigs collected from different sectors of tree canopies of a second group of 20 olive trees (ten symptomatic and ten symptomless. In this second test the three diagnostic techniques confirmed the irregular distribution of the bacterium in the tree canopies and erratic detectability of the pathogen in the young suckers. It is therefore necessary to analyse composite samples per tree which should be prepared with twigs collected from different sides of the canopy. The efficiency comparable to ELISA and PCR, combined with the advantages of easier handling, speed and cost, make DTBIA a valid alternative to ELISA in large-scale surveys for occurrence of X. fastidiosa. Moreover, the printing of membranes directly in the field prevents infections spreading to Xylella-free areas, through movement of plant material with pathogen vectors for laboratory testing.

  8. Direct RNA-based detection of CTX-M β-lactamases in human blood samples.

    Science.gov (United States)

    Stein, Claudia; Makarewicz, Oliwia; Pfeifer, Yvonne; Brandt, Christian; Pletz, Mathias W

    2015-05-01

    Bloodstream infections with ESBL-producers are associated with increased mortality, which is due to delayed appropriate treatment resulting in clinical failure. Current routine diagnostics for detection of bloodstream infections consists of blood culture followed by species identification and susceptibility testing. In attempts to improve and accelerate diagnostic procedures, PCR-based methods have been developed. These methods focus on species identification covering only a limited number of ESBL coding genes. Therefore, they fail to cover the steadily further evolving genetic diversity of clinically relevant β-lactamases. We have recently designed a fast and novel RNA targeting method to detect and specify CTX-M alleles from bacterial cultures, based on an amplification-pyrosequencing approach. We further developed this assay towards a diagnostic tool for clinical use and evaluated its sensitivity and specificity when applied directly to human blood samples. An optimized protocol for mRNA isolation allows detection of specific CTX-M groups from as little as 100 CFU/mL blood via reverse transcription, amplification, and pyrosequencing directly from human EDTA blood samples as well as from pre-incubated human blood cultures with a turnaround time for test results of <7 h. Copyright © 2015 Elsevier GmbH. All rights reserved.

  9. Nanoparticle-based optical biosensors for the direct detection of organophosphate chemical warfare agents and pesticides

    International Nuclear Information System (INIS)

    Simonian, A.L.; Good, T.A.; Wang, S.-S.; Wild, J.R.

    2005-01-01

    Neurotoxic organophosphates (OP) have found widespread use in the environment for insect control. In addition, there is the increasing threat of use of OP based chemical warfare agents in both ground based warfare and terrorist attacks. Together, these trends necessitate the development of simple and specific methods for discriminative detection of ultra low quantities of OP neurotoxins. In our previous investigations a new biosensor for the direct detection of organophosphorus neurotoxins was pioneered. In this system, the enzymatic hydrolysis of OP neurotoxins by organophosphate hydrolase (OPH) generated two protons in each hydrolytic turnover through reactions in which P-X bonds are cleaved. The sensitivity of this biosensor was limited due to the potentiometric method of detection. Recently, it was reported that a change in fluorescence properties of a fluorophore in the vicinity of gold nanoparticles might be used for detection of nanomolar concentrations of DNA oligonucleotides. The detection strategy was based on the fact that an enhancement or quenching of fluorescence intensity is a function of the distances between the gold nanoparticle and fluorophore. While these reports have demonstrated the use of nanoparticle-based sensors for the detection of target DNA, we observed that the specificity of enzyme-substrate interactions could be exploited in similar systems. To test the feasibility of this approach, OPH-gold nanoparticle conjugates were prepared, then incubated with a fluorescent enzyme inhibitor or decoy. The fluorescence intensity of the decoy was sensitive to the proximity of the gold nanoparticle, and thus could be used to indicate that the decoy was bound to the OPH. Then different paraoxon concentrations were introduced to the OPH-nanoparticle-conjugate-decoy mixtures, and normalized ratio of fluorescence intensities were measured. The greatest sensitivity to paraoxon was obtained when decoys and OPH-gold nanoparticle conjugates were present at

  10. Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

    Science.gov (United States)

    Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

    2014-05-08

    Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

  11. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    Directory of Open Access Journals (Sweden)

    Padmavathy

    2012-02-01

    Full Text Available Abstract Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to

  12. Risk of malaria transmission through blood transfusion and its detection by serological method

    International Nuclear Information System (INIS)

    Rahman, M.; Akhtar, G.N.; Rashid, S.; Lodhi, Y.

    2003-01-01

    Objective: To assess the risk of transmission of malaria through blood transfusion, and compare efficacy of testing by immuno chromatographic (ICT) devices vis a vis peripheral blood film (PBF). Results: Amongst healthy blood donors we did not find even a single case of malaria and there was no report of persistent post transfusion pyrexia. We are unable to comment on species frequency in blood donors. However, amongst known patients of malaria we found a higher frequency of Plasmodium viax(P.v) as compared to Plasmodium falciparum(P.f). Testing by serological method, helped us to diagnose 5% of our patients who were missed by peripheral blood films. Conclusion: Between properly selected voluntary non-remunerated blood donors the incidence of malaria transmission is zero and the blood is safe for transfusion. Serological testing shows good correlation with peripheral blood film detection. In fact, it can detect the disease even when film detection has been unsuccessful. If proper donor selection criteria are observed there is little risk of transmitting malaria through transfusion. However, as the donor pool in the Service is not necessarily totally the of voluntary non-remunerated donors and substantive numbers of replacement/first time, occasionally uneducated/unaware donors, are being bled, screening for malaria will not be totally unrewarding. (author)

  13. New Fpg probe chemistry for direct detection of recombinase polymerase amplification on lateral flow strips.

    Science.gov (United States)

    Powell, Michael L; Bowler, Frank R; Martinez, Aurore J; Greenwood, Catherine J; Armes, Niall; Piepenburg, Olaf

    2018-02-15

    Rapid, cost-effective and sensitive detection of nucleic acids has the ability to improve upon current practices employed for pathogen detection in diagnosis of infectious disease and food testing. Furthermore, if assay complexity can be reduced, nucleic acid amplification tests could be deployed in resource-limited and home use scenarios. In this study, we developed a novel Fpg (Formamidopyrimidine DNA glycosylase) probe chemistry, which allows lateral flow detection of amplification in undiluted recombinase polymerase amplification (RPA) reactions. The prototype nucleic acid lateral flow chemistry was applied to a human genomic target (rs1207445), Campylobacter jejuni 16S rDNA and two genetic markers of the important food pathogen E. coli O157:H7. All four assays have an analytical sensitivity between 10 and 100 copies DNA per amplification. Furthermore, the assay is performed with fewer hands-on steps than using the current RPA Nfo lateral flow method as dilution of amplicon is not required for lateral flow analysis. Due to the simplicity of the workflow, we believe that the lateral flow chemistry for direct detection could be readily adapted to a cost-effective single-use consumable, ideal for use in non-laboratory settings. Copyright © 2017. Published by Elsevier Inc.

  14. Detection of antibodies in human serum using trimellityl-erythrocytes: direct and indirect haemagglutination and haemolysis.

    Science.gov (United States)

    Turner, E S; Pruzansky, J J; Patterson, R; Zeiss, C R; Roberts, M

    1980-02-01

    Utilizing trimellityl-erythrocytes (TM-E), antibodies were detected in sera of seven workers with trimellitic anhydride (TMA) induced airway syndromes by direct haemagglutination, indirect haemagglutination with anti-human IgG, IgA or IgM or by haemolysis. Detectable levels of antibody were obtained with all three methods. The most sensitive technique was indirect haemagglutination using anti-IgG. When added as an inhibitor, TM-human serum albumin produced a 10- to 800-fold reduction in titres. TM-ovalbumin of similar epitope density was less inhibitory and sodium trimellitate the least inhibitory on a molar basis. All of the assays using haptenized human red cells were also capable of detecting anti-TM antibodies in Rhesus monkeys whose airways had been exposed to TMA. These assays are useful for detecting anti-TM antibodies and may also be adapted to demonstrate antibodies induced against other inhaled haptens in sera of environmentally exposed individuals or in animal models of such exposure.

  15. Direct detection of singlet dark matter in classically scale-invariant standard model

    Directory of Open Access Journals (Sweden)

    Kazuhiro Endo

    2015-10-01

    Full Text Available Classical scale invariance is one of the possible solutions to explain the origin of the electroweak scale. The simplest extension is the classically scale-invariant standard model augmented by a multiplet of gauge singlet real scalar. In the previous study it was shown that the properties of the Higgs potential deviate substantially, which can be observed in the International Linear Collider. On the other hand, since the multiplet does not acquire vacuum expectation value, the singlet components are stable and can be dark matter. In this letter we study the detectability of the real singlet scalar bosons in the experiment of the direct detection of dark matter. It is shown that a part of this model has already been excluded and the rest of the parameter space is within the reach of the future experiment.

  16. Towards understanding thermal history of the Universe through direct and indirect detection of dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Roszkowski, Leszek; Trojanowski, Sebastian [National Centre for Nuclear Research, Hoża 69, 00-681 Warsaw (Poland); Turzyński, Krzysztof, E-mail: leszek.roszkowski@ncbj.gov.pl, E-mail: sebastian.trojanowski@uci.edu, E-mail: Krzysztof-Jan.Turzynski@fuw.edu.pl [Institute of Theoretical Physics, Faculty of Physics, University of Warsaw, ul. Pasteura 5, 02-093 Warsaw (Poland)

    2017-10-01

    We examine the question to what extent prospective detection of dark matter by direct and indirect- detection experiments could shed light on what fraction of dark matter was generated thermally via the freeze-out process in the early Universe. By simulating putative signals that could be seen in the near future and using them to reconstruct WIMP dark matter properties, we show that, in a model- independent approach this could only be achieved in a thin sliver of the parameter space. However, with additional theoretical input the hypothesis about the thermal freeze-out as the dominant mechanism for generating dark matter can potentially be verified. We illustrate this with two examples: an effective field theory of dark matter with a vector messenger and a higgsino or wino dark matter within the MSSM.

  17. Detection system qualification for direct measurement of thyroid internal contamination by radioiodine

    International Nuclear Information System (INIS)

    Tiberi, V.; Battisti, P.; Gualdrini, G.

    1999-01-01

    The work deals with a detection system qualification for direct measurements of thyroid internal contamination by radioiodine. The isotopes 131 I and 125 I are the most frequently used in nuclear medicine. Because of their volatility they are very dangerous for thyroid contamination by inhalation. The system has been projected to be easily and fast used and above all transportable where the control is necessary. These characteristic make it able to realise supervision programs of internal contamination by radioiodine. In fact due the very high control frequencies (each 15 days for 131 I), these programs are usually very expensive and demanding when they are executed in external measurement laboratories. The following steps are described: devices presentation, calculation of energy and efficiency parameters, minimum detectable activity, time system reliability, best operative conditions in the measurements. At the end an application example of the system is reported [it

  18. Iodine-125 radioimmunoassay for the direct detection of benzodiazepines in blood and urine

    Energy Technology Data Exchange (ETDEWEB)

    Goddard, C.P.; Stead, A.H.; Mason, P.A.; Law, B.; Moffat, A.C.; McBrien, M.; Cosby, S.

    1986-05-01

    A radioimmunoassay (RIA) for the direct detection of benzodiazepines in blood and urine is described. It is based on a commercially available antiserum and an easily synthesised radio-iodinated derivative of clonazepam that allows the use of relatively simple gamma-counting procedures. The assay can detect low therapeutic levels of all of the benzodiazepines currently available in the UK in 50-..mu..l samples of blood and urine (1-50 ng ml/sup -1/, depending on the drug); no prior sample preparation is required. It is inexpensive, rapid, simple to perform and is broadly specific for the benzodiazepine class of drugs. The assay offers a most suitable means of screening large numbers of samples of forensic interest for the presence of the benzodiazepines.

  19. An iodine-125 radioimmunoassay for the direct detection of benzodiazepines in blood and urine

    International Nuclear Information System (INIS)

    Goddard, C.P.; Stead, A.H.; Mason, P.A.; Law, B.; Moffat, A.C.; McBrien, M.; Cosby, S.

    1986-01-01

    A radioimmunoassay (RIA) for the direct detection of benzodiazepines in blood and urine is described. It is based on a commercially available antiserum and an easily synthesised radio-iodinated derivative of clonazepam that allows the use of relatively simple gamma-counting procedures. The assay can detect low therapeutic levels of all of the benzodiazepines currently available in the UK in 50-μl samples of blood and urine (1-50 ng ml -1 , depending on the drug); no prior sample preparation is required. It is inexpensive, rapid, simple to perform and is broadly specific for the benzodiazepine class of drugs. The assay offers a most suitable means of screening large numbers of samples of forensic interest for the presence of the benzodiazepines. (author)

  20. Direct detection of lower hybrid wave using a reflectometer on Alcator C-Moda)

    Science.gov (United States)

    Shiraiwa, S.; Baek, S.; Dominguez, A.; Marmar, E.; Parker, R.; Kramer, G. J.

    2010-10-01

    The possibility of directly detecting a density perturbation produced by lower hybrid (LH) waves using a reflectometer is presented. We investigate the microwave scattering of reflectometer probe beams by a model density fluctuation produced by short wavelength LH waves in an Alcator C-Mod experimental condition. In the O-mode case, the maximum response of phase measurement is found to occur when the density perturbation is approximately centimeters in front of the antenna, where Bragg scattering condition is satisfied. In the X-mode case, the phase measurement is predicted to be more sensitive to the density fluctuation close to the cut-off layer. A feasibility test was carried out using a 50 GHz O-mode reflectometer on the Alcator C-Mod tokamak, and positive results including the detection of 4.6 GHz pump wave and parametric decay instabilities were obtained.

  1. The impact of baryons on the direct detection of dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Kelso, Chris [Department of Physics, University of North Florida, Jacksonville, FL 32224 (United States); Savage, Christopher; Freese, Katherine [Nordita, KTH Royal Institute of Technology and Stockholm University, SE-106 91 Stockholm (Sweden); Valluri, Monica [Department of Astronomy, University of Michigan, Ann Arbor, MI 48109 (United States); Stinson, Gregory S. [Max-Planck-Institut für Astronomie, Königstuhl 17, D-69117, Heidelberg (Germany); Bailin, Jeremy, E-mail: ckelso@unf.edu, E-mail: chris@savage.name, E-mail: mvalluri@umich.edu, E-mail: ktfreese@umich.edu, E-mail: stinson@mpia.de, E-mail: jbailin@ua.edu [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL 35487 (United States)

    2016-08-01

    The spatial and velocity distributions of dark matter particles in the Milky Way Halo affect the signals expected to be observed in searches for dark matter. Results from direct detection experiments are often analyzed assuming a simple isothermal distribution of dark matter, the Standard Halo Model (SHM). Yet there has been skepticism regarding the validity of this simple model due to the complicated gravitational collapse and merger history of actual galaxies. In this paper we compare the SHM to the results of cosmological hydrodynamical simulations of galaxy formation to investigate whether or not the SHM is a good representation of the true WIMP distribution in the analysis of direct detection data. We examine two Milky Way-like galaxies from the MaGICC cosmological simulations (a) with dark matter only and (b) with baryonic physics included. The inclusion of baryons drives the shape of the DM halo to become more spherical and makes the velocity distribution of dark matter particles less anisotropic especially at large heliocentric velocities, thereby making the SHM a better fit. We also note that we do not find a significant disk-like rotating dark matter component in either of the two galaxy halos with baryons that we examine, suggesting that dark disks are not a generic prediction of cosmological hydrodynamical simulations. We conclude that in the Solar neighborhood, the SHM is in fact a good approximation to the true dark matter distribution in these cosmological simulations (with baryons) which are reasonable representations of the Milky Way, and hence can also be used for the purpose of dark matter direct detection calculations.

  2. Rapid detection of NBOME's and other NPS on blotter papers by direct ATR-FTIR spectrometry.

    Science.gov (United States)

    Coelho Neto, José

    2015-07-01

    Blotter paper is among the most common forms of consumption of new psychotropic substances (NPS), formerly referred as designer drugs. In many cases, users are misled to believe they are taking LSD when, in fact, they are taking newer and less known drugs like the NBOMEs or other substituted phenethylamines. We report our findings in quick testing of blotter papers for illicit substances like NBOMEs and other NPS by taking ATR-FTIR spectra directly from blotters seized on the streets, without any sample preparation. Both sides (front and back) of each blotter were tested. Collected data were analyzed by single- and multi-component spectral matching and submitted to chemometric discriminant analysis. Our results showed that, on 66.7% of the cases analyzed, seized blotters contained one or more types of NBOMEs, confirming the growing presence of this novel substances on the market. Matching IR signals were detected on both or just one side of the blotters and showed variable strength. Although no quantitative analysis was made, detection of these substances by the proposed approach serves as indication of variable and possibly higher dosages per blotter when compared to LSD, which showed to be below the detection limit of the applied method. Blotters containing a mescaline-like compound, later confirmed by GC-MS and LC-MS to be MAL (methallylescaline), a substance very similar to mescaline, were detected among the samples tested. Validity of direct ATR-FTIR testing was confirmed by checking the obtained results against independent GC-MS or LC-MS results for the same cases/samples. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Defect detection and classification of machined surfaces under multiple illuminant directions

    Science.gov (United States)

    Liao, Yi; Weng, Xin; Swonger, C. W.; Ni, Jun

    2010-08-01

    Continuous improvement of product quality is crucial to the successful and competitive automotive manufacturing industry in the 21st century. The presence of surface porosity located on flat machined surfaces such as cylinder heads/blocks and transmission cases may allow leaks of coolant, oil, or combustion gas between critical mating surfaces, thus causing damage to the engine or transmission. Therefore 100% inline inspection plays an important role for improving product quality. Although the techniques of image processing and machine vision have been applied to machined surface inspection and well improved in the past 20 years, in today's automotive industry, surface porosity inspection is still done by skilled humans, which is costly, tedious, time consuming and not capable of reliably detecting small defects. In our study, an automated defect detection and classification system for flat machined surfaces has been designed and constructed. In this paper, the importance of the illuminant direction in a machine vision system was first emphasized and then the surface defect inspection system under multiple directional illuminations was designed and constructed. After that, image processing algorithms were developed to realize 5 types of 2D or 3D surface defects (pore, 2D blemish, residue dirt, scratch, and gouge) detection and classification. The steps of image processing include: (1) image acquisition and contrast enhancement (2) defect segmentation and feature extraction (3) defect classification. An artificial machined surface and an actual automotive part: cylinder head surface were tested and, as a result, microscopic surface defects can be accurately detected and assigned to a surface defect class. The cycle time of this system can be sufficiently fast that implementation of 100% inline inspection is feasible. The field of view of this system is 150mm×225mm and the surfaces larger than the field of view can be stitched together in software.

  4. Direct detection of a single evoked action potential with MRS in Lumbricus terrestris.

    Science.gov (United States)

    Poplawsky, Alexander J; Dingledine, Raymond; Hu, Xiaoping P

    2012-01-01

    Functional MRI (fMRI) measures neural activity indirectly by detecting the signal change associated with the hemodynamic response following brain activation. In order to alleviate the temporal and spatial specificity problems associated with fMRI, a number of attempts have been made to detect neural magnetic fields (NMFs) with MRI directly, but have thus far provided conflicting results. In this study, we used MR to detect axonal NMFs in the median giant fiber of the earthworm, Lumbricus terrestris, by examining the free induction decay (FID) with a sampling interval of 0.32 ms. The earthworm nerve cords were isolated from the vasculature and stimulated at the threshold of action potential generation. FIDs were acquired shortly after the stimulation, and simultaneous field potential recordings identified the presence or absence of single evoked action potentials. FIDs acquired when the stimulus did not evoke an action potential were summed as background. The phase of the background-subtracted FID exhibited a systematic change, with a peak phase difference of (-1.2 ± 0.3) × 10(-5) radians occurring at a time corresponding to the timing of the action potential. In addition, we calculated the possible changes in the FID magnitude and phase caused by a simulated action potential using a volume conductor model. The measured phase difference matched the theoretical prediction well in both amplitude and temporal characteristics. This study provides the first evidence for the direct detection of a magnetic field from an evoked action potential using MR. Copyright © 2011 John Wiley & Sons, Ltd.

  5. Characterization of a direct detection device imaging camera for transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Milazzo, Anna-Clare, E-mail: amilazzo@ncmir.ucsd.edu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Moldovan, Grigore [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Lanman, Jason [Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037 (United States); Jin, Liang; Bouwer, James C. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Klienfelder, Stuart [University of California at Irvine, Irvine, CA 92697 (United States); Peltier, Steven T.; Ellisman, Mark H. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Kirkland, Angus I. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Xuong, Nguyen-Huu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States)

    2010-06-15

    The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

  6. Characterization of a direct detection device imaging camera for transmission electron microscopy

    International Nuclear Information System (INIS)

    Milazzo, Anna-Clare; Moldovan, Grigore; Lanman, Jason; Jin, Liang; Bouwer, James C.; Klienfelder, Stuart; Peltier, Steven T.; Ellisman, Mark H.; Kirkland, Angus I.; Xuong, Nguyen-Huu

    2010-01-01

    The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

  7. Nuclear recoil energy scale in liquid xenon with application to the direct detection of dark matter

    International Nuclear Information System (INIS)

    Sorensen, Peter; Dahl, Carl Eric

    2011-01-01

    We show for the first time that the quenching of electronic excitation from nuclear recoils in liquid xenon is well-described by Lindhard theory, if the nuclear recoil energy is reconstructed using the combined (scintillation and ionization) energy scale proposed by Shutt et al. We argue for the adoption of this perspective in favor of the existing preference for reconstructing nuclear recoil energy solely from primary scintillation. We show that signal partitioning into scintillation and ionization is well described by the Thomas-Imel box model. We discuss the implications for liquid xenon detectors aimed at the direct detection of dark matter.

  8. PMD compensation in fiber-optic communication systems with direct detection using LDPC-coded OFDM.

    Science.gov (United States)

    Djordjevic, Ivan B

    2007-04-02

    The possibility of polarization-mode dispersion (PMD) compensation in fiber-optic communication systems with direct detection using a simple channel estimation technique and low-density parity-check (LDPC)-coded orthogonal frequency division multiplexing (OFDM) is demonstrated. It is shown that even for differential group delay (DGD) of 4/BW (BW is the OFDM signal bandwidth), the degradation due to the first-order PMD can be completely compensated for. Two classes of LDPC codes designed based on two different combinatorial objects (difference systems and product of combinatorial designs) suitable for use in PMD compensation are introduced.

  9. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    OpenAIRE

    Jnnifer A. Sánchez; Margarita M. Correa; Ángel E. Aceves Dies; Laura M. Castañeda Sandoval

    2014-01-01

    Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%), II: nheA, hbl...

  10. Method of shaping of direction-characterization of sensitivity of ionizing radiation detection probe

    International Nuclear Information System (INIS)

    Czarnecki, J.; Jaszczuk, J.; Kruczyk, M.; Slapa, M.; Wroblewski, T.

    1986-01-01

    A method of shaping of direction-characterization of sensitivity of the ionizing radiation detection probe, especially equipped with small gamma detectors is described. Two detectors are placed coaxially in the bases of the cylindrical shield. One of them is uncovered in the highest degree and the second is not covered to a maximum. The signals from them are processed on the standarized sequences of electrical impulses (taking into account the heights and the widths of the amplitude). 2 figs., 1 tab. (A.S.)

  11. LHC and Tevatron bounds on the dark matter direct detection cross-section for vector mediators

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Preston, Anthony

    2012-01-01

    We study the interactions of a new spin-1 mediator that connects the Standard Model to dark matter. We constrain its decay channels using monojet and monophoton searches, as well as searches for resonances in dijet, dilepton and diboson final states including those involving a possible Higgs. We...... then interpret the resulting limits as bounds on the cross-section for dark matter direct detection without the need to specify a particular model. For mediator masses between 300 and 1000 GeV these bounds are considerably stronger than the ones obtained under the assumption that the mediator can be integrated...

  12. Robustness and versatility of a nonlinear interdependence method for directional coupling detection from spike trains

    Science.gov (United States)

    Malvestio, Irene; Kreuz, Thomas; Andrzejak, Ralph G.

    2017-08-01

    The detection of directional couplings between dynamics based on measured spike trains is a crucial problem in the understanding of many different systems. In particular, in neuroscience it is important to assess the connectivity between neurons. One of the approaches that can estimate directional coupling from the analysis of point processes is the nonlinear interdependence measure L . Although its efficacy has already been demonstrated, it still needs to be tested under more challenging and realistic conditions prior to an application to real data. Thus, in this paper we use the Hindmarsh-Rose model system to test the method in the presence of noise and for different spiking regimes. We also examine the influence of different parameters and spike train distances. Our results show that the measure L is versatile and robust to various types of noise, and thus suitable for application to experimental data.

  13. Direct growth of graphene on quartz substrates for label-free detection of adenosine triphosphate.

    Science.gov (United States)

    Xu, Shicai; Man, Baoyuan; Jiang, Shouzhen; Yue, Weiwei; Yang, Cheng; Liu, Mei; Chen, Chuansong; Zhang, Chao

    2014-04-25

    We demonstrate that continuous, uniform graphene films can be directly synthesized on quartz substrates using a two-temperature-zone chemical vapor deposition system and that their layers can be controlled by adjusting the precursor partial pressure. Raman spectroscopy and transmission electron microscopy confirm the formation of monolayer graphene with a grain size of ∼100 nm. Hall measurements show a room-temperature carrier mobility above 1500 cm2 V(-1) s(-1). The optical transmittance and conductance of the graphene films are comparable to those of transferred metal-catalyzed graphene. The method avoids the complicated and skilled post-growth transfer process and allows the graphene to be directly incorporated into a fully functional biosensor for label-free detection of adenosine triphosphate (ATP). This device shows a fast response time of a few milliseconds and achieves a high sensitivity to ATP molecules over a very wide range from 0.002 to 5 mM.

  14. Prospects for direct detection of dark matter in an effective theory approach

    International Nuclear Information System (INIS)

    Catena, Riccardo

    2014-01-01

    We perform the first comprehensive analysis of the prospects for direct detection of dark matter with future ton-scale detectors in the general 11-dimensional effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. The theory includes 8 momentum and velocity dependent dark matter-nucleon interaction operators, besides the familiar spin-independent and spin-dependent operators. From a variegated sample of 27 benchmark points selected in the parameter space of the theory, we simulate independent sets of synthetic data for ton-scale Germanium and Xenon detectors. From the synthetic data, we then extract the marginal posterior probability density functions and the profile likelihoods of the model parameters. The associated Bayesian credible regions and frequentist confidence intervals allow us to assess the prospects for direct detection of dark matter at the 27 benchmark points. First, we analyze the data assuming the knowledge of the correct dark matter nucleon-interaction type, as it is commonly done for the familiar spin-independent and spin-dependent interactions. Then, we analyze the simulations extracting the dark matter-nucleon interaction type from the data directly, in contrast to standard analyses. This second approach requires an extensive exploration of the full 11-dimensional parameter space of the dark matter-nucleon effective theory. Interestingly, we identify 5 scenarios where the dark matter mass and the dark matter-nucleon interaction type can be reconstructed from the data simultaneously. We stress the importance of extracting the dark matter nucleon-interaction type from the data directly, discussing the main challenges found addressing this complex 11-dimensional problem

  15. Transfer Entropy Estimation and Directional Coupling Change Detection in Biomedical Time Series

    Directory of Open Access Journals (Sweden)

    Lee Joon

    2012-04-01

    Full Text Available Abstract Background The detection of change in magnitude of directional coupling between two non-linear time series is a common subject of interest in the biomedical domain, including studies involving the respiratory chemoreflex system. Although transfer entropy is a useful tool in this avenue, no study to date has investigated how different transfer entropy estimation methods perform in typical biomedical applications featuring small sample size and presence of outliers. Methods With respect to detection of increased coupling strength, we compared three transfer entropy estimation techniques using both simulated time series and respiratory recordings from lambs. The following estimation methods were analyzed: fixed-binning with ranking, kernel density estimation (KDE, and the Darbellay-Vajda (D-V adaptive partitioning algorithm extended to three dimensions. In the simulated experiment, sample size was varied from 50 to 200, while coupling strength was increased. In order to introduce outliers, the heavy-tailed Laplace distribution was utilized. In the lamb experiment, the objective was to detect increased respiratory-related chemosensitivity to O2 and CO2 induced by a drug, domperidone. Specifically, the separate influence of end-tidal PO2 and PCO2 on minute ventilation (V˙E before and after administration of domperidone was analyzed. Results In the simulation, KDE detected increased coupling strength at the lowest SNR among the three methods. In the lamb experiment, D-V partitioning resulted in the statistically strongest increase in transfer entropy post-domperidone for PO2→V˙E. In addition, D-V partitioning was the only method that could detect an increase in transfer entropy for PCO2→V˙E, in agreement with experimental findings. Conclusions Transfer entropy is capable of detecting directional coupling changes in non-linear biomedical time series analysis featuring a small number of observations and presence of outliers. The results

  16. Direct, Specific and Rapid Detection of Staphylococcal Proteins and Exotoxins Using a Multiplex Antibody Microarray.

    Directory of Open Access Journals (Sweden)

    Bettina Stieber

    Full Text Available S. aureus is a pathogen in humans and animals that harbors a wide variety of virulence factors and resistance genes. This bacterium can cause a wide range of mild to life-threatening diseases. In the latter case, fast diagnostic procedures are important. In routine diagnostic laboratories, several genotypic and phenotypic methods are available to identify S. aureus strains and determine their resistances. However, there is a demand for multiplex routine diagnostic tests to directly detect staphylococcal toxins and proteins.In this study, an antibody microarray based assay was established and validated for the rapid detection of staphylococcal markers and exotoxins. The following targets were included: staphylococcal protein A, penicillin binding protein 2a, alpha- and beta-hemolysins, Panton Valentine leukocidin, toxic shock syndrome toxin, enterotoxins A and B as well as staphylokinase. All were detected simultaneously within a single experiment, starting from a clonal culture on standard media. The detection of bound proteins was performed using a new fluorescence reading device for microarrays.110 reference strains and clinical isolates were analyzed using this assay, with a DNA microarray for genotypic characterization performed in parallel. The results showed a general high concordance of genotypic and phenotypic data. However, genotypic analysis found the hla gene present in all S. aureus isolates but its expression under given conditions depended on the clonal complex affiliation of the actual isolate.The multiplex antibody assay described herein allowed a rapid and reliable detection of clinically relevant staphylococcal toxins as well as resistance- and species-specific markers.

  17. On the Existence of Low-Mass Dark Matter and its Direct Detection

    Science.gov (United States)

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R.; Ulbricht, Hendrik

    2015-01-01

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too. PMID:25622565

  18. On the Existence of Low-Mass Dark Matter and its Direct Detection

    Science.gov (United States)

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R.; Ulbricht, Hendrik

    2015-01-01

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too.

  19. Anisotropic dark matter distribution functions and impact on WIMP direct detection

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Schwetz, Thomas; Catena, Riccardo

    2013-01-01

    Dark matter N-body simulations suggest that the velocity distribution of dark matter is anisotropic. In this work we employ a mass model for the Milky Way whose parameters are determined from a fit to kinematical data. Then we adopt an ansatz for the dark matter phase space distribution which allows to construct self-consistent halo models which feature a degree of anisotropy as a function of the radius such as suggested by the simulations. The resulting velocity distributions are then used for an analysis of current data from dark matter direct detection experiments. We find that velocity distributions which are radially biased at large galactocentric distances (up to the virial radius) lead to an increased high velocity tail of the local dark matter distribution. This affects the interpretation of data from direct detection experiments, especially for dark matter masses around 10 GeV, since in this region the high velocity tail is sampled. We find that the allowed regions in the dark matter mass-cross section plane as indicated by possible hints for a dark matter signal reported by several experiments as well as conflicting exclusion limits from other experiments shift in a similar way when the halo model is varied. Hence, it is not possible to improve the consistency of the data by referring to anisotropic halo models of the type considered in this work

  20. Direct detection of second harmonic and its use in alanine/EPR dosimetry

    International Nuclear Information System (INIS)

    Chen, F.; Guzman, C.S.; Graeff, C.F.O.; Baffa, O.

    2001-01-01

    In this work, the possible use of the second harmonic EPR signal from irradiated alanine for low radiation dose (∼1 Gy) was explored, aiming applications to HDR brachytherapy and teletherapy. The second harmonic signal was directly detected after overmodulation. A batch of DL-alanine/paraffin small cylindrical pellets was made. A VARIAN E-4 X-Band EPR spectrometer with optimized operation parameters like microwave power and modulation amplitude to obtain a signal with the highest amplitude was used. The modulation frequency and modulation amplitude were 100 kHz and 1.25 mT (to overmodulate the signal) respectively. The second harmonic signal was directly detected at twice the modulation frequency. One group of dosimeters was irradiated with a 192 Ir brachytherapy source and the other in a 10 MeV X-rays linear accelerator, both group at a dose range: 0.5 - 15 Gy. The second harmonic signal showed better resolution than the first harmonic one making possible a more easy localization of the signal. Moreover, for both types of radiation, the dose-response curve showed a good linear behavior for the dose range indicated. (author)

  1. On the direct detection of multi-component dark matter: sensitivity studies and parameter estimation

    Science.gov (United States)

    Herrero-Garcia, Juan; Scaffidi, Andre; White, Martin; Williams, Anthony G.

    2017-11-01

    We study the case of multi-component dark matter, in particular how direct detection signals are modified in the presence of several stable weakly-interacting-massive particles. Assuming a positive signal in a future direct detection experiment, stemming from two dark matter components, we study the region in parameter space where it is possible to distinguish a one from a two-component dark matter spectrum. First, we leave as free parameters the two dark matter masses and show that the two hypotheses can be significantly discriminated for a range of dark matter masses with their splitting being the critical factor. We then investigate how including the effects of different interaction strengths, local densities or velocity dispersions for the two components modifies these conclusions. We also consider the case of isospin-violating couplings. In all scenarios, we show results for various types of nuclei both for elastic spin-independent and spin-dependent interactions. Finally, assuming that the two-component hypothesis is confirmed, we quantify the accuracy with which the parameters can be extracted and discuss the different degeneracies that occur. This includes studying the case in which only a single experiment observes a signal, and also the scenario of having two signals from two different experiments, in which case the ratios of the couplings to neutrons and protons may also be extracted.

  2. Optimal level of Au nanoparticles on Pd nanostructures providing remarkable electro-catalysis in direct ethanol fuel cell

    Science.gov (United States)

    Dutta, Abhijit; Mondal, Achintya; Broekmann, Peter; Datta, Jayati

    2017-09-01

    The designing and fabrication of economically viable electro-catalysts for ethanol oxidation reaction (EOR) in direct ethanol fuel cell (DEFC) has been one of the challenging issues over the decades. The present work deals with controlled synthesis of Pd coupled Au nano structure, as the non Pt group of catalysts for DEFC. The catalytic proficiency of bimetallic NPs (2-10 nm) are found to be strongly dependent on the Pd:Au ratio. The over voltage of EOR is considerably reduced by ∼260 mV with 33% of Au content in PdAu composition compared to Pd alone, demonstrating the beneficial role of Au and/or its surface oxides providing oxygen species at much lower potentials compared to Pd. The catalysts are further subjected to electrochemical analysis through voltammetry along with the temperature study on activation parameters. The quantitative determination of EOR products during the electrolysis is carried out by ion chromatographic analysis; vis-a-vis the coulombic efficiency of the product yield were derived from each of the compositions. Furthermore, a strong correlation among catalytic performances and bimetallic composition is established by screening the catalysts in an in-house fabricated direct ethanol anion exchange membrane fuel cell, DE(AEM)FC. The performance testing demonstrates outstanding increase of peak power density (∼40 mWcm-2, 93%) for the best accomplishment Au (33%) covered Pd (67%) catalyst in comparison with the monometallic Pd.

  3. Detectability of planetary rings around super-earths by direct infrared imaging

    International Nuclear Information System (INIS)

    Morel, Carine

    2013-01-01

    Super-Earths, of which more than 80 have already been discovered, draw a lot of attention. With masses between those of the Earth and Neptune, they are ideal targets for searching for bio-signatures. All the gas giants of the solar system have a ring system, and even the Earth is suspected to have had rings in the past; their presence around super-Earths is thus expected and could give information on the formation process of these planets. The characterization of Super-Earths and their environment has thus become an important goal of modern astronomy. They are still difficult to study because of their small size, but the potential presence of planetary rings can make them easier to observe by the transit method and by direct imaging. This PhD evaluates the possibilities of detecting and characterizing rings around super-Earths by direct infrared imaging with the ELT-METIS instrument. To do this, a model to simulate the thermal emission of a super-Earth and its rings is developed. It is then used to study the influence of physical parameters and orientation of the rings and of planetary orbit on their detectability. The results show that ELT-METIS will be able to detect rings similar to the B and C rings of Saturn, extended within the Roche limit. The super-Earths surrounded by rings will be observable in middle orbit, between about 0.4 and 1 AU, around hot stars within 20 pc of the Sun. It is also shown that the photometric monitoring along the orbit of a super-Earth surrounded by rings should help constrain some of their physical characteristics. (author) [fr

  4. Direct detection of Trichomonas vaginalis virus in Trichomonas vaginalis positive clinical samples from the Netherlands.

    Science.gov (United States)

    Jehee, Ivo; van der Veer, Charlotte; Himschoot, Michelle; Hermans, Mirjam; Bruisten, Sylvia

    2017-12-01

    Trichomonas vaginalis is the most common sexually transmitted parasitical infection worldwide. T. vaginalis can carry a virus: Trichomonas vaginalis virus (TVV). To date, four TVV species have been described. Few studies have investigated TVV prevalence and its clinical importance. We have developed a nested reverse-transcriptase PCR, with novel, type specific primers to directly detect TVV RNA in T. vaginalis positive clinical samples. A total of 119T. vaginalis positive clinical samples were collected in Amsterdam and "s-Hertogenbosch, the Netherlands, from 2012 to 2016. For all samples T. vaginalis was genotyped using multi-locus sequence typing. The T. vaginalis positive samples segregated into a two-genotype population: type I (n=64) and type II (n=55). All were tested for TVV with the new TVV PCR. We detected 3 of the 4 TVV species. Sequencing of the amplified products showed high homology with published TVV genomes (82-100%). Half of the T. vaginalis clinical samples (n=60, 50.4%) were infected with one or more TVV species, with a preponderance for TVV infections in T. vaginalis type I (n=44, 73.3%). Clinical data was available for a subset of samples (n=34) and we observed an association between testing positive for (any) TVV and reporting urogenital symptoms (p=0.023). The nested RT-PCR allowed for direct detection of TVV in T. vaginalis positive clinical samples. This may be helpful in studies and clinical settings, since T. vaginalis disease and/or treatment outcome may be influenced by the protozoa"s virus. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Development of Piezoelectric DNA-Based Biosensor for Direct Detection of Mycobacterium Tuberculosis in Clinical Specimens

    Directory of Open Access Journals (Sweden)

    Thongchai KAEWPHINIT

    2010-02-01

    Full Text Available This study was focused on establishment of piezoelectric biosensor for direct detection of Mycobacterium tuberculosis (MTB in clinical specimens. The quartz crystal immobilized via 3-mercaptopropionic acid (MPA/avidin/DNA biotinylated probe on gold surface and hybridization of the DNA target to DNA biotinylated probe. The optimal concentration of MPA, avidin and 5’-biotinylated DNA probe for immobilization of specific DNA probe on gold surface were 15 mM, 0.1 mg/ml and 1.5 μM, respectively. The detection of genomic DNA digestion in the range from 0.5 to 30 μg/ml. The fabricated biosensor was evaluated through an examination of 200 samples. No cross hybridization were observed against M. avium complex (MAC and other microorganism. This target DNA preparation without amplification will reduce time consuming, costs, and the tedious step of amplification. This study can be extended to develop the new method which is high sensitivity, specificity, cheap, easy to use, and rapid for detection of MTB in many fields.

  6. A survey of direct inversion methods having possible application to tunnel detection

    International Nuclear Information System (INIS)

    Mager, R.D.

    1985-01-01

    Within recent years there has been considerable interest in the development of geophysical methods for the location of hidden underground tunnels and cavities. Consideration of this problem has been motivated by military applications, such as the detection of shallow man-made tunnels and arm caches, as well as civilian applications such as detection of limestone cavities in karst terrain and the mapping of abandoned mine workings. There are also applications for in-situ coal gasification and for the monitoring of nuclear waste disposal sites. The most reliable method presently used to map these underground anomalies has been direct detection by closely spaced drilling. However, the high cost of drilling renders this method impractical except for detailed and localized mapping, and certainly unfeasible for any type of broad-scale reconnaissance activity. Largely motivated by petroleum and mineral exploration needs, however, the seismic industry has seen a virtual revolution in acquisition and processing techniques within the past ten years. Paralleling these developments have been corresponding developments in acoustical imaging and non-destructive testing. Researchers in the field of inverse scattering have produced a number of new methods for target imaging from backscattered reflection data

  7. Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.

    Science.gov (United States)

    Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2017-09-28

    Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.

  8. Mixed Wino Dark Matter: consequences for direct, indirect and collider detection

    International Nuclear Information System (INIS)

    Baer, Howard; Mustafayev, Azar; Park, Eun-Kyung; Profumo, Stefano

    2005-01-01

    In supersymmetric models with gravity-mediated SUSY breaking and gaugino mass unification, the predicted relic abundance of neutralinos usually exceeds the strict limits imposed by the WMAP collaboration. One way to obtain the correct relic abundance is to abandon gaugino mass universality and allow a mixed wino-bino lightest SUSY particle (LSP). The enhanced annihilation and scattering cross sections of mixed wino dark matter (MWDM) compared to bino dark matter lead to enhanced rates for direct dark matter detection, as well as for indirect detection at neutrino telescopes and for detection of dark matter annihilation products in the galactic halo. For collider experiments, MWDM leads to a reduced but significant mass gap between the lightest neutralinos so that Z-tilde 2 two-body decay modes are usually closed. This means that dilepton mass edges- the starting point for cascade decay reconstruction at the CERN LHC- should be accessible over almost all of parameter space. Measurement of the m Z-tilde2 -m Z-tilde1 mass gap at LHC plus various sparticle masses and cross sections as a function of beam polarization at the International Linear Collider (ILC) would pinpoint MWDM as the dominant component of dark matter in the universe

  9. Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD)

    Science.gov (United States)

    Generazio, Edward R.

    2015-01-01

    Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD) Manual v.1.2 The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Design of experiments for validating probability of detection capability of nondestructive evaluation (NDE) systems (DOEPOD) is a methodology that is implemented via software to serve as a diagnostic tool providing detailed analysis of POD test data, guidance on establishing data distribution requirements, and resolving test issues. DOEPOD demands utilization of observance of occurrences. The DOEPOD capability has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit-Miss or signal amplitude testing. DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required. DOEPOD applications for supporting inspector qualifications is included.

  10. Markov chain Monte Carlo analysis to constrain dark matter properties with directional detection

    International Nuclear Information System (INIS)

    Billard, J.; Mayet, F.; Santos, D.

    2011-01-01

    Directional detection is a promising dark matter search strategy. Indeed, weakly interacting massive particle (WIMP)-induced recoils would present a direction dependence toward the Cygnus constellation, while background-induced recoils exhibit an isotropic distribution in the Galactic rest frame. Taking advantage of these characteristic features, and even in the presence of a sizeable background, it has recently been shown that data from forthcoming directional detectors could lead either to a competitive exclusion or to a conclusive discovery, depending on the value of the WIMP-nucleon cross section. However, it is possible to further exploit these upcoming data by using the strong dependence of the WIMP signal with: the WIMP mass and the local WIMP velocity distribution. Using a Markov chain Monte Carlo analysis of recoil events, we show for the first time the possibility to constrain the unknown WIMP parameters, both from particle physics (mass and cross section) and Galactic halo (velocity dispersion along the three axis), leading to an identification of non-baryonic dark matter.

  11. Detection of the Magnetic Easy Direction in Steels Using Induced Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Edgard M. Silva

    2016-12-01

    Full Text Available Conventional manufacturing processes cause plastic deformation that leads to magnetic anisotropy in processed materials. A deeper understanding of materials characterization under rotational magnetization enables engineers to optimize the overall volume, mass, and performance of devices such as electrical machines in industry. Therefore, it is important to find the magnetic easy direction of the magnetic domains in a simple and straightforward manner. The Magnetic easy direction can be obtained through destructive tests such as the Epstein frame method and the Single Sheet Tester by taking measurements in regions of irreversible magnetization usually called domains. In the present work, samples of rolled SAE 1045 steel (formed by perlite and ferrite microstructures were submitted to induced magnetic fields in the reversibility region of magnetic domains to detect the magnetic easy direction. The magnetic fields were applied to circular samples with different thicknesses and angles varying from 0° to 360° with steps of 45°. A square sample with a fixed thickness was also tested. The results showed that the proposed non-destructive approach is promising to evaluate the magnetic anisotropy in steels independently of the geometry of the sample. The region studied presented low induction losses and was affected by magnetic anisotropy, which did not occur in other works that only took into account regions of high induction losses.

  12. Direct detection of a break in the teraelectronvolt cosmic-ray spectrum of electrons and positrons

    Science.gov (United States)

    DAMPE Collaboration; Ambrosi, G.; An, Q.; Asfandiyarov, R.; Azzarello, P.; Bernardini, P.; Bertucci, B.; Cai, M. S.; Chang, J.; Chen, D. Y.; Chen, H. F.; Chen, J. L.; Chen, W.; Cui, M. Y.; Cui, T. S.; D'Amone, A.; de Benedittis, A.; De Mitri, I.; di Santo, M.; Dong, J. N.; Dong, T. K.; Dong, Y. F.; Dong, Z. X.; Donvito, G.; Droz, D.; Duan, K. K.; Duan, J. L.; Duranti, M.; D'Urso, D.; Fan, R. R.; Fan, Y. Z.; Fang, F.; Feng, C. Q.; Feng, L.; Fusco, P.; Gallo, V.; Gan, F. J.; Gao, M.; Gao, S. S.; Gargano, F.; Garrappa, S.; Gong, K.; Gong, Y. Z.; Guo, D. Y.; Guo, J. H.; Hu, Y. M.; Huang, G. S.; Huang, Y. Y.; Ionica, M.; Jiang, D.; Jiang, W.; Jin, X.; Kong, J.; Lei, S. J.; Li, S.; Li, X.; Li, W. L.; Li, Y.; Liang, Y. F.; Liang, Y. M.; Liao, N. H.; Liu, H.; Liu, J.; Liu, S. B.; Liu, W. Q.; Liu, Y.; Loparco, F.; Ma, M.; Ma, P. X.; Ma, S. Y.; Ma, T.; Ma, X. Q.; Ma, X. Y.; Marsella, G.; Mazziotta, M. N.; Mo, D.; Niu, X. Y.; Peng, X. Y.; Peng, W. X.; Qiao, R.; Rao, J. N.; Salinas, M. M.; Shang, G. Z.; H. Shen, W.; Shen, Z. Q.; Shen, Z. T.; Song, J. X.; Su, H.; Su, M.; Sun, Z. Y.; Surdo, A.; Teng, X. J.; Tian, X. B.; Tykhonov, A.; Vagelli, V.; Vitillo, S.; Wang, C.; Wang, H.; Wang, H. Y.; Wang, J. Z.; Wang, L. G.; Wang, Q.; Wang, S.; Wang, X. H.; Wang, X. L.; Wang, Y. F.; Wang, Y. P.; Wang, Y. Z.; Wen, S. C.; Wang, Z. M.; Wei, D. M.; Wei, J. J.; Wei, Y. F.; Wu, D.; Wu, J.; Wu, L. B.; Wu, S. S.; Wu, X.; Xi, K.; Xia, Z. Q.; Xin, Y. L.; Xu, H. T.; Xu, Z. L.; Xu, Z. Z.; Xue, G. F.; Yang, H. B.; Yang, P.; Yang, Y. Q.; Yang, Z. L.; Yao, H. J.; Yu, Y. H.; Yuan, Q.; Yue, C.; Zang, J. J.; Zhang, C.; Zhang, D. L.; Zhang, F.; Zhang, J. B.; Zhang, J. Y.; Zhang, J. Z.; Zhang, L.; Zhang, P. F.; Zhang, S. X.; Zhang, W. Z.; Zhang, Y.; Zhang, Y. J.; Zhang, Y. Q.; Zhang, Y. L.; Zhang, Y. P.; Zhang, Z.; Zhang, Z. Y.; Zhao, H.; Zhao, H. Y.; Zhao, X. F.; Zhou, C. Y.; Zhou, Y.; Zhu, X.; Zhu, Y.; Zimmer, S.

    2017-12-01

    High-energy cosmic-ray electrons and positrons (CREs), which lose energy quickly during their propagation, provide a probe of Galactic high-energy processes and may enable the observation of phenomena such as dark-matter particle annihilation or decay. The CRE spectrum has been measured directly up to approximately 2 teraelectronvolts in previous balloon- or space-borne experiments, and indirectly up to approximately 5 teraelectronvolts using ground-based Cherenkov γ-ray telescope arrays. Evidence for a spectral break in the teraelectronvolt energy range has been provided by indirect measurements, although the results were qualified by sizeable systematic uncertainties. Here we report a direct measurement of CREs in the energy range 25 gigaelectronvolts to 4.6 teraelectronvolts by the Dark Matter Particle Explorer (DAMPE) with unprecedentedly high energy resolution and low background. The largest part of the spectrum can be well fitted by a ‘smoothly broken power-law’ model rather than a single power-law model. The direct detection of a spectral break at about 0.9 teraelectronvolts confirms the evidence found by previous indirect measurements, clarifies the behaviour of the CRE spectrum at energies above 1 teraelectronvolt and sheds light on the physical origin of the sub-teraelectronvolt CREs.

  13. Detection of irradiated poultry products using the direct epifluorescence filter technique

    International Nuclear Information System (INIS)

    Copin, M.P.; Bourgeois, C.

    1992-01-01

    Food irradiation has developed during the last few years. Nevertheless this development would be larger if there was a recognized method to detect whether a foodstuff had been irradiated. BETTS et al. (1988) suggested a method based on the comparison of an aerobic plate count (APC) with a count obtained using the Direct Epifluorescence Filter Technique (DEFT). They showed that the APC of an irradiated product was considerably lower than that obtained by the DEFT; in this case the DEFT count gave an indication of the number of viable microbial population in the product before irradiation; the APC of a non irradiated product was very well correlated with the DEFT count. In the present work both methods were tested on deep frozen mechanically deboned chicken meat (MDCM) and fresh chicken meat. The fluorochrome used for the DEFT was acridine orange; the mesophilic microflora was counted on 'Plate Count Agar'. According to the results obtained with the deep frozen MDCM, aerobic plate counts and DEFT counts are very similar during 100 days of storage when the product has not been irradiated; if it has been irradiated the difference between the two counts is high (about two logarithmic units). With this method it is thus possible to detect an irradiated product and to know the number of viable microbial cells in the irradiated product before the treatment. The method was tested on fresh chicken meat stored at 4 deg C. At the beginning of the storage period, it is possible to detect irradiated products, but at the end the method fails. In the latter case, irradiation can be detected, but it would be impossible to say that a product had not been irradiated. This method is potentially applicable to deep frozen products, more than to fresh products

  14. Detecting paraprotein interference on a direct bilirubin assay by reviewing the photometric reaction data.

    Science.gov (United States)

    García-González, Elena; Aramendía, Maite; González-Tarancón, Ricardo; Romero-Sánchez, Naiara; Rello, Luis

    2017-07-26

    The direct bilirubin (D-Bil) assay on the AU Beckman Coulter instrumentation can be interfered by paraproteins, which may result in spurious D-Bil results. In a previous work, we took advantage of this fact to detect this interference, thus helping with the identification of patients with unsuspected monoclonal gammopathies. In this work, we investigate the possibility to detect interference based on the review of the photometric reactions, regardless of the D-Bil result. The D-Bil assay was carried out in a set of 2164 samples. It included a group of 164 samples with paraproteins (67 of which caused interference on the assay), as well as different groups of samples for which high absorbance background readings could also be expected (i.e. hemolyzed, lipemic, or icteric samples). Photometric reaction data were reviewed and receiver operating characteristics (ROC) curves were used to establish a cut-off for absorbance that best discriminates interference. The best cut-off was 0.0100 for the absorbance at the first photometric point of the complementary wavelength in the blank cuvette. Once the optimal cut-off for probable interference was selected, all samples analyzed in our laboratory that provided absorbance values above this cut-off were further investigated to try to discover paraproteins. During a period of 6 months, we detected 44 samples containing paraproteins, five of which belonged to patients with non-diagnosed monoclonal gammopathies. Review of the photometric reaction data permits the systematic detection of paraprotein interference on the D-Bil AU assay, even for samples for which reasonable results are obtained.

  15. Direct Detection of The Lyman Continuum of Star-forming Galaxies at z~3

    Science.gov (United States)

    Vasei, Kaveh; Siana, Brian; Shapley, Alice; Alavi, Anahita; Rafelski, Marc

    2018-01-01

    Star-forming galaxies are widely believed to be responsible for the reionization of the Universe and much of the ionizing background at z>3. Therefore, there has been much interest in quantifying the escape fraction of the Lyman continuum (LyC) radiation of the star-forming galaxies. Yet direct detection of LyC has proven to be exceptionally challenging. Despite numerous efforts only 7 galaxies at z2 have been robustly confirmed as LyC leakers. To avoid these challenges many studies use indirect methods to infer the LyC escape fraction. We tested these indirect methods by attempting to detect escaping LyC with a 10-orbit Hubble near-UV (F275W) image that is just below the Lyman limit at the redshift of the Cosmic Horseshoe (a lensed galaxy at z=2.4). We concluded that the measured escape fraction is lower, by more than a factor of five, than the expected escape fraction based on the indirect methods. This emphasizes that indirect determinations should only be interpreted as upper-limits. We also investigated the deepest near-UV Hubble images of the SSA22 field to detect LyC leakage from a large sample of candidate star-forming galaxies at z~3.1, whose redshift was obtained by deep Keck/LRIS spectroscopy and for which Keck narrow-band imaging was showing possible LyC leakage. The high spatial resolution of Hubble images is crucial to confirm our detections are clean from foreground contaminating galaxies, and also to ascertain the escape fraction of our final candidates. We identify five clean LyC emitting star-forming galaxies. The follow up investigation of these galaxies will significantly increase our knowledge of the LyC escape fraction and the mechanisms allowing for LyC escape.

  16. Laser Noise and its Impact on the Performance of Intensity-Modulation with Direct-Detection Analog Photonic Links

    National Research Council Canada - National Science Library

    Urick, Vincent J; Devgan, Preetpaul S; McKinney, Jason D; Dexter, James L

    2007-01-01

    The equations for radio-frequency gain, radio-frequency noise figure, compression dynamic range and spurious-free dynamic range are derived for an analog photonic link employing intensity modulation and direct detection...

  17. Direct electrochemistry and electrocatalysis of a glucose oxidase-functionalized bioconjugate as a trace label for ultrasensitive detection of thrombin.

    Science.gov (United States)

    Bai, Lijuan; Yuan, Ruo; Chai, Yaqin; Yuan, Yali; Wang, Yan; Xie, Shunbi

    2012-11-18

    For the first time, a glucose oxidase-functionalized bioconjugate was prepared and served as a new trace label through its direct electrochemistry and electrocatalysis in a sandwich-type electrochemical aptasensor for ultrasensitive detection of thrombin.

  18. Quantitative radioautographic determination of brain tyrosine hydroxylase after direct transfer into nitro-cellulose and immunochemical detection

    International Nuclear Information System (INIS)

    Weissmann, D.; Labatut, R.; Gillon, J.Y.

    1988-01-01

    An improved quantitative immuno chemical determination of tyrosine hydroxylase brain concentrations was designed by using direct transfer into nitro-cellulose from 20 μm thick brain sections followed by immuno-detection and quantitative radioautography [fr

  19. Improved security detection strategy in quantum secure direct communication protocol based on four-particle Green-Horne-Zeilinger state

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jian; Nie, Jin-Rui; Li, Rui-Fan [Beijing Univ. of Posts and Telecommunications, Beijing (China). School of Computer; Jing, Bo [Beijing Univ. of Posts and Telecommunications, Beijing (China). School of Computer; Beijing Institute of Applied Meteorology, Beijing (China). Dept. of Computer Science

    2012-06-15

    To enhance the efficiency of eavesdropping detection in the quantum secure direct communication protocol, an improved quantum secure direct communication protocol based on a four-particle Green-Horne-Zeilinger (GHZ) state is presented. In the protocol, the four-particle GHZ state is used to detect eavesdroppers, and quantum dense coding is used to encode the message. In the security analysis, the method of entropy theory is introduced, and two detection strategies are compared quantitatively by using the constraint between the information that the eavesdroppers can obtain and the interference that has been introduced. If the eavesdropper wants to obtain all the information, the detection rate of the quantum secure direct communication using an Einstein-Podolsky-Rosen (EPR) pair block will be 50% and the detection rate of the presented protocol will be 87%. At last, the security of the proposed protocol is discussed. The analysis results indicate that the protocol proposed is more secure than the others. (orig.)

  20. The detection of irradiated foods using the Direct Epifluorescent Filter Technique

    International Nuclear Information System (INIS)

    Betts, R.P.; Bankes, P.; Stringer, M.F.; Farr, L.

    1988-01-01

    A method was evaluated which has the potential to detect a food sample which has been irradiated. The technique will give an indication of the total number of viable micro-organisms present before irradiation. It is based on the comparison of an aerobic plate count (APC) with a count obtained using the Direct Epifluorescent Filter Technique (DEFT). When the APC of an irradiated sample was compared with the DEFT count on the same sample, the APC was considerably lower than that obtained by DEFT. The count of orange fluorescing cells after irradiation, however, correlated well with an APC of the same sample before irradiation. For the samples examined the DEFT count determined the viable microbial population in the sample before irradiation. The difference between the APC and the DEFT count gave the number of organisms rendered non-viable by the process. (author)

  1. Effect of gravitational focusing on annual modulation in dark-matter direct-detection experiments.

    Science.gov (United States)

    Lee, Samuel K; Lisanti, Mariangela; Peter, Annika H G; Safdi, Benjamin R

    2014-01-10

    The scattering rate in dark-matter direct-detection experiments should modulate annually due to Earth's orbit around the Sun. The rate is typically thought to be extremized around June 1, when the relative velocity of Earth with respect to the dark-matter wind is maximal. We point out that gravitational focusing can alter this modulation phase. Unbound dark-matter particles are focused by the Sun's gravitational potential, affecting their phase-space density in the lab frame. Gravitational focusing can result in a significant overall shift in the annual-modulation phase, which is most relevant for dark matter with low scattering speeds. The induced phase shift for light O(10)  GeV dark matter may also be significant, depending on the threshold energy of the experiment.

  2. First direct detection limits on sub-GeV dark matter from XENON10.

    Science.gov (United States)

    Essig, Rouven; Manalaysay, Aaron; Mardon, Jeremy; Sorensen, Peter; Volansky, Tomer

    2012-07-13

    The first direct detection limits on dark matter in the MeV to GeV mass range are presented, using XENON10 data. Such light dark matter can scatter with electrons, causing ionization of atoms in a detector target material and leading to single- or few-electron events. We use 15  kg day of data acquired in 2006 to set limits on the dark-matter-electron scattering cross section. The strongest bound is obtained at 100 MeV where σ(e)dark-matter masses between 20 MeV and 1 GeV are bounded by σ(e)dark-matter candidates with masses well below the GeV scale.

  3. Hypercharged dark matter and direct detection as a probe of reheating.

    Science.gov (United States)

    Feldstein, Brian; Ibe, Masahiro; Yanagida, Tsutomu T

    2014-03-14

    The lack of new physics at the LHC so far weakens the argument for TeV scale thermal dark matter. On the other hand, heavier, nonthermal dark matter is generally difficult to test experimentally. Here we consider the interesting and generic case of hypercharged dark matter, which can allow for heavy dark matter masses without spoiling testability. Planned direct detection experiments will be able to see a signal for masses up to an incredible 1010  GeV, and this can further serve to probe the reheating temperature up to about 109  GeV, as determined by the nonthermal dark matter relic abundance. The Z-mediated nature of the dark matter scattering may be determined in principle by comparing scattering rates on different detector nuclei, which in turn can reveal the dark matter mass. We will discuss the extent to which future experiments may be able to make such a determination.

  4. Signatures of Earth-scattering in the direct detection of Dark Matter

    DEFF Research Database (Denmark)

    Kavanagh, Bradley J.; Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation...... of this 'Earth-scattering' effect in the regime where DM particles scatter at most once before reaching the detector. We perform the calculation self-consistently, taking into account not only those particles which are scattered away from the detector, but also those particles which are deflected towards...... the detector. Taking into account a realistic model of the Earth and allowing for a range of DM-nucleon interactions, we present the EarthShadow code, which we make publicly available, for calculating the DM velocity distribution after Earth-scattering. Focusing on low-mass DM, we find that Earth...

  5. arXiv Inelastic Boosted Dark Matter at Direct Detection Experiments

    CERN Document Server

    Giudice, Gian F.; Park, Jong-Chul; Shin, Seodong

    2018-05-10

    We explore a novel class of multi-particle dark sectors, called Inelastic Boosted Dark Matter (iBDM). These models are constructed by combining properties of particles that scatter off matter by making transitions to heavier states (Inelastic Dark Matter) with properties of particles that are produced with a large Lorentz boost in annihilation processes in the galactic halo (Boosted Dark Matter). This combination leads to new signals that can be observed at ordinary direct detection experiments, but require unconventional searches for energetic recoil electrons in coincidence with displaced multi-track events. Related experimental strategies can also be used to probe MeV-range boosted dark matter via their interactions with electrons inside the target material.

  6. Model-independent determination of the WIMP mass from direct dark matter detection data

    International Nuclear Information System (INIS)

    Drees, Manuel; Shan, Chung-Lin

    2008-01-01

    Weakly interacting massive particles (WIMPs) are one of the leading candidates for dark matter. We develop a model-independent method for determining the mass m χ of the WIMP by using data (i.e. measured recoil energies) of direct detection experiments. Our method is independent of the as yet unknown WIMP density near the Earth, of the form of the WIMP velocity distribution, as well as of the WIMP–nucleus cross section. However, it requires positive signals from at least two detectors with different target nuclei. In a background-free environment, m χ ∼50 GeV could in principle be determined with an error of ∼35% with only 2 × 50 events; in practice, upper and lower limits on the recoil energy of signal events, imposed to reduce backgrounds, can increase the error. The method also loses precision if m χ significantly exceeds the mass of the heaviest target nucleus used

  7. Investigation of PMD in direct-detection optical OFDM with zero padding.

    Science.gov (United States)

    Li, Xiang; Alphones, Arokiaswami; Zhong, Wen-De; Yu, Changyuan

    2013-09-09

    We investigate the polarization-mode dispersion (PMD) effect of zero padding OFDM (ZP-OFDM) in direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) systems. We first study the conventional equalization method for ZP-OFDM. Then an equalization method based on sorted QR decomposition is proposed to further improve the performance. It is found that the performance improvement of ZP-OFDM is due to the frequency domain oversampling (FDO) induced inter-carrier interference (ICI). Numerical simulation results show that compared with cyclic prefix OFDM (CP-OFDM), ZP-OFDM has a significantly higher tolerance to PMD in DDO-OFDM systems when the channel spectral nulls occur at certain differential group delay (DGD) values.

  8. Direct Measurement of Trace Elemental Mercury in Hydrocarbon Matrices by Gas Chromatography with Ultraviolet Photometric Detection.

    Science.gov (United States)

    Gras, Ronda; Luong, Jim; Shellie, Robert A

    2015-11-17

    We introduce a technique for the direct measurement of elemental mercury in light hydrocarbons such as natural gas. We determined elemental mercury at the parts-per-trillion level with high precision [photometric detection (GC-UV) at 254 nm. Our approach requires a small sample volume (1 mL) and does not rely on any form of sample preconcentration. The GC-UV separation employs an inert divinylbenzene porous layer open tubular column set to separate mercury from other components in the sample matrix. We incorporated a 10-port gas-sampling valve in the GC-UV system, which enables automated sampling, as well as back flushing capability to enhance system cleanliness and sample throughput. Total analysis time is 98% over this range.

  9. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Science.gov (United States)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  10. FARADAY CUP AWARD: High Sensitivity Tune Measurement using Direct Diode Detection

    CERN Document Server

    Gasior, M

    2012-01-01

    Direct Diode Detection (3D) is a technique developed at CERN initially for the LHC tune measurement system, to reach a sensitivity allowing observation of beam betatron oscillations with amplitudes below a micrometre. In this technique simple peak diode detectors are used to convert short beam pulses from a beam position pick-up into slowly varying signals. Their DC components, constituting a large background related to beam offsets, are suppressed by series capacitors, while the small signals related to beam oscillations are passed to the subsequent stages for amplification and filtering. As the demodulated beam oscillation signals are already in the kHz range, their processing is simple and they can be digitised with high resolution audio ADCs. This paper presents the history as well as the adventures of the 3D development and prototyping, along with some technical details. It documents a very efficient collaboration between CERN and Brookhaven National Laboratory (BNL), with contributions from other labora...

  11. A multifunctional molecularly imprinted polymer-based biosensor for direct detection of doxycycline in food samples

    DEFF Research Database (Denmark)

    Ashley, Jon; Feng, Xiaotong; Sun, Yi

    2018-01-01

    In this study, we developed a new type of multifunctional molecularly imprinted polymer (MIP) composite as an all-in-one biosensor for the low-cost, rapid and sensitive detection of doxycycline in pig plasma. The MIP composite consisted of a magnetic core for ease of manipulation, and a shell...... of fluorescent MIPs for selective recognition of doxycycline. By simply incorporating a small amount of fluorescent monomer (fluorescein-Oacrylate), the fluorescent MIP layer was successfully grafted onto the magnetic core via a surface imprinting technique. The resultant MIP composites showed significant....... The multifunctional MIP composites were used to directly extract doxycycline from spiked pig plasma samples and quantify the antibiotics based on the quenched fluorescence signals. Recoveries of doxycycline were found in the range of 88–107%....

  12. Fiber-optic Michelson interferometer fixed in a tilted tube for direction-dependent ultrasonic detection

    Science.gov (United States)

    Gang, Tingting; Hu, Manli; Qiao, Xueguang; Li, JiaCheng; Shao, Zhihua; Tong, Rongxin; Rong, Qiangzhou

    2017-01-01

    A fiber-optic interferometer is proposed and demonstrated experimentally for ultrasonic detection. The sensor consists of a compact Michelson interferometer (MI), which is fixed in a tilted-tube end-face (45°). Thin gold films are used for the reflective coatings of two arms and one of the interference arms is etched serving as the sensing arm. The spectral sideband filter technique is used to interrogate the continuous and pulse ultrasonic signals (with frequency of 300 KHz). Furthermore, because of the asymmetrical structure of the sensor, it presents strong direction-dependent ultrasonic sensitivity, such that the sensor can be considered a vector detector. The experimental results show that the sensor is highly sensitive to ultrasonic signals, and thus it can be a candidate for ultrasonic imaging of seismic physical models.

  13. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    International Nuclear Information System (INIS)

    Phuong Dinh Tam; Mai Anh Tuan; Tran Trung; Nguyen Duc Chien

    2009-01-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  14. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Phuong Dinh Tam; Mai Anh Tuan [International Training Institute for Materials Science (Viet Nam); Tran Trung [Department of Electrochemistry, Hung-Yen University of Technology and Education (Viet Nam); Nguyen Duc Chien [Institute of Engineering Physics, Hanoi University of Technology, 1 Dai Co Viet Road, Hanoi (Viet Nam)], E-mail: tr_trunghut@yahoo.com

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  15. A method of simulating intensity modulation-direct detection WDM systems

    Institute of Scientific and Technical Information of China (English)

    HUANG Jing; YAO Jian-quan; LI En-bang

    2005-01-01

    In the simulation of Intensity Modulation-Direct Detection WDM Systems,when the dispersion and nonlinear effects play equally important roles,the intensity fluctuation caused by cross-phase modulation may be overestimated as a result of the improper step size.Therefore,the step size in numerical simulation should be selected to suppress false XPM intensity modulation (keep it much less than signal power).According to this criterion,the step size is variable along the fiber.For a WDM system,the step size depends on the channel separation.Different type of transmission fiber has different step size.In the split-step Fourier method,this criterion can reduce simulation time,and when the step size is bigger than 100 meters,the simulation accuracy can also be improved.

  16. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    Energy Technology Data Exchange (ETDEWEB)

    Mascagni, Daniela Branco Tavares [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Miyazaki, Celina Massumi [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil); Cruz, Nilson Cristino da [São Paulo State University - UNESP, Sorocaba, São Paulo (Brazil); Leite de Moraes, Marli [Federal University of São Paulo, Unifesp, Campus São José dos Campos, SP (Brazil); Riul, Antonio [University of Campinas - Unicamp, Campinas, São Paulo (Brazil); Ferreira, Marystela, E-mail: marystela@ufscar.br [Federal University of São Carlos, UFSCar, Campus Sorocaba, SP (Brazil)

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L{sup ‐1} and sensitivity of 2.47 μA·cm{sup −2}·mmol{sup −1}·L for glucose with the (GPDDA/GPSS){sub 1}/(GPDDA/GOx){sub 2} architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  17. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection

    International Nuclear Information System (INIS)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; Cruz, Nilson Cristino da; Leite de Moraes, Marli; Riul, Antonio; Ferreira, Marystela

    2016-01-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4 μmol·L ‐1 and sensitivity of 2.47 μA·cm −2 ·mmol −1 ·L for glucose with the (GPDDA/GPSS) 1 /(GPDDA/GOx) 2 architecture, whose thickness was 19.80 ± 0.28 nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. - Highlights: • Direct electrochemistry of glucose oxidase at functionalized reduced graphene oxide. • Thickness (layer-by-layer) LbL film determined by Surface Plasmon Resonance (SPR). • Selective determination of glucose in the presence of several interferents. • Real sample test: commercial oral electrolyte solution and lactose-free milk.

  18. Rapid Detection of Thrombin and Other Protease Activity Directly in Whole Blood

    Science.gov (United States)

    Yu, Johnson Chung Sing

    Thrombin is a serine protease that plays a key role in the clotting cascade to promote hemostasis following injury to the endothelium. From a clinical diagnostic perspective, in-vivo thrombin activity is linked to various blood clotting disorders, as well as cardiovascular disease (DVT, arteriosclerosis, etc). Thus, the ability to rapidly measure protease activity directly in whole blood will provide important new diagnostics, and clinical researchers with a powerful tool to further elucidate the relationship between circulating protease levels and disease. The ultimate goal is to design novel point of care (POC) diagnostic devices that are capable of monitoring protease activities directly in whole blood and biological sample. A charge-changing substrate specific to the thrombin enzyme was engineered and its functionality was confirmed by a series of experiments. This led to the preliminary design, construction, and testing of two device platforms deemed fully functional for the electrophoretic separation and focusing of charged peptide fragments. The concept of using the existing charge-changing substrate platform for bacterial protease detection was also investigated. Certain strains of E coli are associated with severe symptoms such as abdominal cramps, bloody diarrhea, and vomiting. The OmpT protease is expressed on the outer membrane of E coli and plays a role in the cleavage of antimicrobial peptides, the degradation of recombinant heterologous proteins, and the activation of plasminogen in the host. Thus, a synthetic peptide substrate specific to the OmpT protease was designed and modeled for the purpose of detecting E coli in biological sample.

  19. Receiver bandwidth effects on complex modulation and detection using directly modulated lasers.

    Science.gov (United States)

    Yuan, Feng; Che, Di; Shieh, William

    2016-05-01

    Directly modulated lasers (DMLs) have long been employed for short- and medium-reach optical communications due to their low cost. Recently, a new modulation scheme called complex modulated DMLs has been demonstrated showing a significant optical signal to noise ratio sensitivity enhancement compared with the traditional intensity-only detection scheme. However, chirp-induced optical spectrum broadening is inevitable in complex modulated systems, which may imply a need for high-bandwidth receivers. In this Letter, we study the impact of receiver bandwidth effects on the performance of complex modulation and coherent detection systems based on DMLs. We experimentally demonstrate that such systems exhibit a reasonable tolerance for the reduced receiver bandwidth. For 10 Gbaud 4-level pulse amplitude modulation signals, the required electrical bandwidth is as low as 8.5 and 7.5 GHz for 7% and 20% forward error correction, respectively. Therefore, it is feasible to realize DML-based complex modulated systems using cost-effective receivers with narrow bandwidth.

  20. Directly Detecting MeV-Scale Dark Matter Via Solar Reflection.

    Science.gov (United States)

    An, Haipeng; Pospelov, Maxim; Pradler, Josef; Ritz, Adam

    2018-04-06

    If dark matter (DM) particles are lighter than a few   MeV/c^{2} and can scatter off electrons, their interaction within the solar interior results in a considerable hardening of the spectrum of galactic dark matter received on Earth. For a large range of the mass versus cross section parameter space, {m_{e},σ_{e}}, the "reflected" component of the DM flux is far more energetic than the end point of the ambient galactic DM energy distribution, making it detectable with existing DM detectors sensitive to an energy deposition of 10-10^{3}  eV. After numerically simulating the small reflected component of the DM flux, we calculate its subsequent signal due to scattering on detector electrons, deriving new constraints on σ_{e} in the MeV and sub-MeV range using existing data from the XENON10/100, LUX, PandaX-II, and XENON1T experiments, as well as making projections for future low threshold direct detection experiments.

  1. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection.

    Science.gov (United States)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; da Cruz, Nilson Cristino; de Moraes, Marli Leite; Riul, Antonio; Ferreira, Marystela

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4μmol·L(-1) and sensitivity of 2.47μA·cm(-2)·mmol(-1)·L for glucose with the (GPDDA/GPSS)1/(GPDDA/GOx)2 architecture, whose thickness was 19.80±0.28nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Direct sequencing of mitochondrial DNA detects highly divergent haplotypes in blue marlin (Makaira nigricans).

    Science.gov (United States)

    Finnerty, J R; Block, B A

    1992-06-01

    We were able to differentiate between species of billfish (Istiophoridae family) and to detect considerable intraspecific variation in the blue marlin (Makaira nigricans) by directly sequencing a polymerase chain reaction (PCR)-amplified, 612-bp fragment of the mitochondrial cytochrome b gene. Thirteen variable nucleotide sites separated blue marlin (n = 26) into 7 genotypes. On average, these genotypes differed by 5.7 base substitutions. A smaller sample of swordfish from an equally broad geographic distribution displayed relatively little intraspecific variation, with an average of 1.3 substitutions separating different genotypes. A cladistic analysis of blue marlin cytochrome b variants indicates two major divergent evolutionary lines within the species. The frequencies of these two major evolutionary lines differ significantly between Atlantic and Pacific ocean basins. This finding is important given that the Atlantic stocks of blue marlin are considered endangered. Migration from the Pacific can help replenish the numbers of blue marlin in the Atlantic, but the loss of certain mitochondrial DNA haplotypes in the Atlantic due to overfishing probably could not be remedied by an influx of Pacific fish because of their absence in the Pacific population. Fishery management strategies should attempt to preserve the genetic diversity within the species. The detection of DNA sequence polymorphism indicates the utility of PCR technology in pelagic fishery genetics.

  3. Layered ACO-OFDM for intensity-modulated direct-detection optical wireless transmission.

    Science.gov (United States)

    Wang, Qi; Qian, Chen; Guo, Xuhan; Wang, Zhaocheng; Cunningham, David G; White, Ian H

    2015-05-04

    Layered asymmetrically clipped optical orthogonal frequency division multiplexing (ACO-OFDM) with high spectral efficiency is proposed in this paper for optical wireless transmission employing intensity modulation with direct detection. In contrast to the conventional ACO-OFDM, which only utilizes odd subcarriers for modulation, leading to an obvious spectral efficiency loss, in layered ACO-OFDM, the subcarriers are divided into different layers and modulated by different kinds of ACO-OFDM, which are combined for simultaneous transmission. In this way, more subcarriers are used for data transmission and the spectral efficiency is improved. An iterative receiver is also proposed for layered ACO-OFDM, where the negative clipping distortion of each layer is subtracted once it is detected so that the signals from different layers can be recovered. Theoretical analysis shows that the proposed scheme can improve the spectral efficiency by up to 2 times compared with conventional ACO-OFDM approaches with the same modulation order. Meanwhile, simulation results confirm a considerable signal-to-noise ratio gain over ACO-OFDM at the same spectral efficiency.

  4. Direct-detection optical OFDM superchannel for long-reach PON using pilot regeneration.

    Science.gov (United States)

    Hu, Rong; Yang, Qi; Xiao, Xiao; Gui, Tao; Li, Zhaohui; Luo, Ming; Yu, Shaohua; You, Shanhong

    2013-11-04

    We demonstrate a novel long-reach PON downstream scheme based on the regenerated pilot assisted direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) superchannel transmission. We use the optical comb source to form DDO-OFDM superchannel, and reserve the center carrier as a seed pilot. The seed pilot is further tracked and reused to generate multiple optical carriers at the local exchange. Each regenerated pilot carrier is selected to beat with an adjacent OFDM sub-band at ONU, so that the electrical bandwidth limitation can be much released compared to the conventional DDO-OFDM superchannel detection. With the proposed proof-of-concept architecture, we experimentally demonstrated a 116.7 Gb/s superchannel OFDM-PON system with transmission reach of 100 km, and 1:64 splitting ratio. We analyze the impact of carrier-to-sideband power ratio (CSPR) on system performance. The experiment result shows that, 5 dB power margin is still remained at ONU using such technique.

  5. Identification of Dark Matter particles with LHC and direct detection data

    CERN Document Server

    Bertone, Gianfranco; Fornasa, Mattia; de Austri, Roberto Ruiz; Trotta, Roberto

    2010-01-01

    Dark matter (DM) is currently searched for with a variety of detection strategies. Accelerator searches are particularly promising, but even if Weakly Interacting Massive Particles (WIMPs) are found at the Large Hadron Collider (LHC), it will be difficult to prove that they constitute the bulk of the DM in the Universe. We show that a significantly better reconstruction of the DM properties can be obtained with a combined analysis of LHC and direct detection (DD) data, by making a simple Ansatz on the WIMP local density, i.e. by assuming that the local density scales with the cosmological relic abundance. We demonstrate this method in an explicit example in the context of a 24-parameter supersymmetric model, with a neutralino LSP in the stau co-annihilation region. Our results show that future ton-scale DD experiments will allow to break degeneracies in the SUSY parameter space and achieve a significantly better reconstruction of the neutralino composition and its relic density than with LHC data alone.

  6. Probing GeV-scale MSSM neutralino dark matter in collider and direct detection experiments

    Science.gov (United States)

    Duan, Guang Hua; Wang, Wenyu; Wu, Lei; Yang, Jin Min; Zhao, Jun

    2018-03-01

    Given the recent constraints from the dark matter (DM) direct detections, we examine a light GeV-scale (2-30 GeV) neutralino DM in the alignment limit of the Minimal Supersymmetric Standard Model (MSSM). In this limit without decoupling, the heavy CP-even scalar H plays the role of the Standard Model (SM) Higgs boson while the other scalar h can be rather light so that the DM can annihilate through the h resonance or into a pair of h to achieve the observed relic density. With the current collider and cosmological constraints, we find that such a light neutralino DM above 6 GeV can be excluded by the XENON-1T (2017) limits while the survivied parameter space below 6 GeV can be fully tested by the future germanium-based light dark matter detections (such as CDEX), by the Higgs coupling precison measurements or by the production process e+e- → hA at an electron-positron collider (Higgs factory).

  7. Peaked signals from dark matter velocity structures in direct detection experiments

    Science.gov (United States)

    Lang, Rafael F.; Weiner, Neal

    2010-06-01

    In direct dark matter detection experiments, conventional elastic scattering of WIMPs results in exponentially falling recoil spectra. In contrast, theories of WIMPs with excited states can lead to nuclear recoil spectra that peak at finite recoil energies ER. The peaks of such signals are typically fairly broad, with ΔER/Epeak ~ 1. We show that in the presence of dark matter structures with low velocity dispersion, such as streams or clumps, peaks from up-scattering can become extremely narrow with FWHM of a few keV only. This differs dramatically from the conventionally expected WIMP spectrum and would, once detected, open the possibility to measure the dark matter velocity structure with high accuracy. As an intriguing example, we confront the observed cluster of 3 events near 42 keV from the CRESST commissioning run with this scenario. Inelastic dark matter particles with a wide range of parameters are capable of producing such a narrow peak. We calculate the possible signals at other experiments, and find that such particles could also give rise to the signal at DAMA, although not from the same stream. Over some range of parameters, a signal would be visible at xenon experiments. We show that such dark matter peaks are a very clear signal and can be easily disentangled from potential backgrounds, both terrestrial or due to WIMP down-scattering, by an enhanced annual modulation in both the amplitude of the signal and its spectral shape.

  8. Direct immune-detection of cortisol by chemiresistor graphene oxide sensor.

    Science.gov (United States)

    Kim, Yo-Han; Lee, Kyungmin; Jung, Hunsang; Kang, Hee Kyung; Jo, Jihoon; Park, In-Kyu; Lee, Hyun Ho

    2017-12-15

    In this study, a biosensor to detect a stress biomarker of cortisol using cortisol monoclonal antibody (c-Mab) covalently immobilized on reduced graphene oxide (rGO) channel as electrical sensing element was demonstrated. Highly specific immune-recognition between the c-Mab and the cortisol was identified and characterized on a basis of resistance change at the rGO channel based chemiresistor sensor achieving the limit of detection of 10pg/mL (27.6 pM). In addition, cortisol concentrations of real human salivary sample and buffer solution of rat adrenal gland acute slices, which could secret the cortisol induced by adrenocorticotropic hormone (ACTH), were directly measured by the chemiresistor corresponding to the specific sensing of the cortisol. The rGO chemiresistor could selectively measure the cortisol levels in spite of diverse neuroendocrine's existence. The potential perspective of this study can be a protocol of new cortisol sensor development, which will be applicable to point-of-care testing (POCT) targeted for salivary cortisol, in vitro psychobiological study on cortisol induction, and implantable sensor chip in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Directly Detecting MeV-Scale Dark Matter Via Solar Reflection

    Science.gov (United States)

    An, Haipeng; Pospelov, Maxim; Pradler, Josef; Ritz, Adam

    2018-04-01

    If dark matter (DM) particles are lighter than a few MeV /c2 and can scatter off electrons, their interaction within the solar interior results in a considerable hardening of the spectrum of galactic dark matter received on Earth. For a large range of the mass versus cross section parameter space, {me,σe}, the "reflected" component of the DM flux is far more energetic than the end point of the ambient galactic DM energy distribution, making it detectable with existing DM detectors sensitive to an energy deposition of 10 -103 eV . After numerically simulating the small reflected component of the DM flux, we calculate its subsequent signal due to scattering on detector electrons, deriving new constraints on σe in the MeV and sub-MeV range using existing data from the XENON10/100, LUX, PandaX-II, and XENON1T experiments, as well as making projections for future low threshold direct detection experiments.

  10. Peaked signals from dark matter velocity structures in direct detection experiments

    International Nuclear Information System (INIS)

    Lang, Rafael F.; Weiner, Neal

    2010-01-01

    In direct dark matter detection experiments, conventional elastic scattering of WIMPs results in exponentially falling recoil spectra. In contrast, theories of WIMPs with excited states can lead to nuclear recoil spectra that peak at finite recoil energies E R . The peaks of such signals are typically fairly broad, with ΔE R /E peak ∼ 1. We show that in the presence of dark matter structures with low velocity dispersion, such as streams or clumps, peaks from up-scattering can become extremely narrow with FWHM of a few keV only. This differs dramatically from the conventionally expected WIMP spectrum and would, once detected, open the possibility to measure the dark matter velocity structure with high accuracy. As an intriguing example, we confront the observed cluster of 3 events near 42 keV from the CRESST commissioning run with this scenario. Inelastic dark matter particles with a wide range of parameters are capable of producing such a narrow peak. We calculate the possible signals at other experiments, and find that such particles could also give rise to the signal at DAMA, although not from the same stream. Over some range of parameters, a signal would be visible at xenon experiments. We show that such dark matter peaks are a very clear signal and can be easily disentangled from potential backgrounds, both terrestrial or due to WIMP down-scattering, by an enhanced annual modulation in both the amplitude of the signal and its spectral shape

  11. Direct detection of chicken genomic DNA for gender determination by thymine-DNA glycosylase.

    Science.gov (United States)

    Porat, N; Bogdanov, K; Danielli, A; Arie, A; Samina, I; Hadani, A

    2011-02-01

    1. Birds, especially nestlings, are generally difficult to sex by morphology and early detection of chick gender in ovo in the hatchery would facilitate removal of unwanted chicks and diminish welfare objections regarding culling after hatch. 2. We describe a method to determine chicken gender without the need for PCR via use of Thymine-DNA Glycosylase (TDG). TDG restores thymine (T)/guanine (G) mismatches to cytosine (C)/G. We show here, that like DNA Polymerase, TDG can recognise, bind and function on a primer hybridised to chicken genomic DNA. 3. The primer contained a T to mismatch a G in a chicken genomic template and the T/G was cleaved with high fidelity by TDG. Thus, the chicken genomic DNA can be identified without PCR amplification via direct and linear detection. Sensitivity was increased using gender specific sequences from the chicken genome. 4. Currently, these are laboratory results, but we anticipate that further development will allow this method to be used in non-laboratory settings, where PCR cannot be employed.

  12. Optimisation of a direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores.

    Science.gov (United States)

    Henczka, Marek; Djas, Małgorzata; Filipek, Katarzyna

    2013-01-01

    A direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores has been optimised. The results of the application of four types of growth media (BAT agar, YSG agar, K agar and SK agar) regarding the recovery and enumeration of A. acidoterrestris spores were compared. The influence of the type of applied growth medium, heat shock conditions, incubation temperature, incubation time, plating technique and the presence of apple juice in the sample on the accuracy of the detection and enumeration of A. acidoterrestris spores was investigated. Among the investigated media, YSG agar was the most sensitive medium, and its application resulted in the highest recovery of A. acidoterrestris spores, while K agar and BAT agar were the least suitable media. The effect of the heat shock time on the recovery of spores was negligible. When there was a low concentration of spores in a sample, the membrane filtration method was superior to the spread plating method. The obtained results show that heat shock carried out at 80°C for 10 min and plating samples in combination with membrane filtration on YSG agar, followed by incubation at 46°C for 3 days provided the optimal conditions for the detection and enumeration of A. acidoterrestris spores. Application of the presented method allows highly efficient, fast and sensitive identification and enumeration of A. acidoterrestris spores in food products. This methodology will be useful for the fruit juice industry for identifying products contaminated with A. acidoterrestris spores, and its practical application may prevent economic losses for manufacturers. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Direct Detection of Protein Biomarkers in Human Fluids Using Site-Specific Antibody Immobilization Strategies

    Directory of Open Access Journals (Sweden)

    Maria Soler

    2014-01-01

    Full Text Available Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  14. Direct growth of graphene on quartz substrates for label-free detection of adenosine triphosphate

    International Nuclear Information System (INIS)

    Xu, Shicai; Man, Baoyuan; Jiang, Shouzhen; Yue, Weiwei; Yang, Cheng; Liu, Mei; Chen, Chuansong; Zhang, Chao

    2014-01-01

    We demonstrate that continuous, uniform graphene films can be directly synthesized on quartz substrates using a two-temperature-zone chemical vapor deposition system and that their layers can be controlled by adjusting the precursor partial pressure. Raman spectroscopy and transmission electron microscopy confirm the formation of monolayer graphene with a grain size of ∼100 nm. Hall measurements show a room-temperature carrier mobility above 1500 cm 2  V −1  s −1 . The optical transmittance and conductance of the graphene films are comparable to those of transferred metal-catalyzed graphene. The method avoids the complicated and skilled post-growth transfer process and allows the graphene to be directly incorporated into a fully functional biosensor for label-free detection of adenosine triphosphate (ATP). This device shows a fast response time of a few milliseconds and achieves a high sensitivity to ATP molecules over a very wide range from 0.002 to 5 mM. (paper)

  15. Detection and direction discrimination of single vortex rings by harbour seals (Phoca vitulina).

    Science.gov (United States)

    Krüger, Yvonne; Hanke, Wolf; Miersch, Lars; Dehnhardt, Guido

    2018-04-25

    Harbour seals possess highly sensitive vibrissae that enable them to track hydrodynamic trails left behind by a swimming fish. Most of these trails contain vortex rings as a main hydrodynamic component. They may reveal information about their generator as the trails differ depending on the fish species, the fish's body shape, size and swimming style. In addition, fish generate single vortex rings in diverse natural situations. In this study, the ability of blindfolded stationary harbour seals to detect and analyse single vortex rings regarding directional information has been investigated. In three different behavioural experiments, the animals were trained to respond to single artificially generated vortex rings. The results show that harbour seals are able to respond to a variety of different vortex rings upon vibrissal stimulation. The investigation of the minimum hydrodynamically perceivable angle revealed that it is at least as small as 5.7 deg, which was the smallest adjustable angle. Moreover, harbour seals are capable of analysing the travel direction of a vortex ring perceived by the mystacial vibrissae irrespective of whether the vibrissae were stimulated ipsilaterally or contralaterally. In situations in which no complex hydrodynamic trail is available, it is advantageous for a hunting seal to be able to extract information from a single vortex ring. © 2018. Published by The Company of Biologists Ltd.

  16. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection

    International Nuclear Information System (INIS)

    Ellis, John; Evans, Jason L.; Olive, Keith A.; Luo, Feng; Nagata, Natsumi; Sandick, Pearl

    2016-01-01

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale M in below the grand unification (GUT) scale M GUT , a scenario referred to as 'sub-GUT'. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if M in is close to M GUT , but it may lie within its reach if M in

  17. Direct detection of protein biomarkers in human fluids using site-specific antibody immobilization strategies.

    Science.gov (United States)

    Soler, Maria; Estevez, M-Carmen; Alvarez, Mar; Otte, Marinus A; Sepulveda, Borja; Lechuga, Laura M

    2014-01-29

    Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  18. RadSensor: Xray Detection by Direct Modulation of an Optical Probe Beam

    International Nuclear Information System (INIS)

    Lowry, M E; Bennett, C V; Vernon, S P; Bond, T; Welty, R; Behymer, E; Petersen, H; Krey, A; Stewart, R; Kobayashi, N P; Sperry, V; Stephan, P; Reinhardt, C; Simpson, S; Stratton, P; Bionta, R; McKernan, M; Ables, E; Ott, L; Bond, S; Ayers, J.; Landen, O L; Bell, P M

    2003-01-01

    We present a new x-ray detection technique based on optical measurement of the effects of x-ray absorption and electron hole pair creation in a direct band-gap semiconductor. The electron-hole pairs create a frequency dependent shift in optical refractive index and absorption. This is sensed by simultaneously directing an optical carrier beam through the same volume of semiconducting medium that has experienced an xray induced modulation in the electron-hole population. If the operating wavelength of the optical carrier beam is chosen to be close to the semiconductor band-edge, the optical carrier will be modulated significantly in phase and amplitude. This approach should be simultaneously capable of very high sensitivity and excellent temporal response, even in the difficult high-energy xray regime. At xray photon energies near 10 keV and higher, we believe that sub-picosecond temporal responses are possible with near single xray photon sensitivity. The approach also allows for the convenient and EMI robust transport of high-bandwidth information via fiber optics. Furthermore, the technology can be scaled to imaging applications. The basic physics of the detector, implementation considerations, and preliminary experimental data are presented and discussed

  19. Direction detection thresholds of passive self-motion in artistic gymnasts.

    Science.gov (United States)

    Hartmann, Matthias; Haller, Katia; Moser, Ivan; Hossner, Ernst-Joachim; Mast, Fred W

    2014-04-01

    In this study, we compared direction detection thresholds of passive self-motion in the dark between artistic gymnasts and controls. Twenty-four professional female artistic gymnasts (ranging from 7 to 20 years) and age-matched controls were seated on a motion platform and asked to discriminate the direction of angular (yaw, pitch, roll) and linear (leftward-rightward) motion. Gymnasts showed lower thresholds for the linear leftward-rightward motion. Interestingly, there was no difference for the angular motions. These results show that the outstanding self-motion abilities in artistic gymnasts are not related to an overall higher sensitivity in self-motion perception. With respect to vestibular processing, our results suggest that gymnastic expertise is exclusively linked to superior interpretation of otolith signals when no change in canal signals is present. In addition, thresholds were overall lower for the older (14-20 years) than for the younger (7-13 years) participants, indicating the maturation of vestibular sensitivity from childhood to adolescence.

  20. Evaluation of an inexpensive growth medium for direct detection of Escherichia coli in temperate and sub-tropical waters

    CSIR Research Space (South Africa)

    Bain, RES

    2015-10-01

    Full Text Available . In these settings the problem is exacerbated by the lack of inexpensive media for the detection of E. coli in drinking water. We developed a new low-cost growth medium, aquatest (AT), and validated its use for the direct detection of E. coli in temperate and sub...

  1. Direct Detection and Imaging of Low-Energy Electrons with Delta-Doped Charge-Coupled Devices

    Science.gov (United States)

    Nikzad, S.; Yu, Q.; Smith, A. L.; Jones, T. J.; Tombrello, T. A.; Elliott, S. T.

    1998-01-01

    We report the use fo delta-doped charge-coupled devices (CCDs) for direct detection of electrons in the 50-1500 eV energy range. These are the first measurements with a solid state device to detect electrons in this energy range.

  2. Development of a modular directional and spectral neutron detection system using solid-state detectors

    Energy Technology Data Exchange (ETDEWEB)

    Weltz, A., E-mail: weltza3@gmail.com; Torres, B.; McElwain, L.; Dahal, R.; Huang, J.; Bhat, I.; Lu, J.; Danon, Y.

    2015-08-21

    A detection system using room-temperature, microstructured solid-state thermal neutron detectors with very low leakage current has been developed at Rensselaer Polytechnic Institute (RPI) with the ability to provide positional and spectral information about an unknown neutron source. The Directional and Spectral Neutron Detection System (DSNDS) utilizes a set of small-but-scalable, zero-bias solid-state thermal neutron detectors which have demonstrated high thermal neutron efficiency and adequate gamma insensitivity. The DSNDS can gather spectral information about an unknown neutron source with a relatively small number of detectors, simplifying the detector electronics and minimizing cost; however, the DSNDS is modular in design, providing the capability to increase the detection efficiency and angular resolution. The system used in this paper was comprised of a stack of five high-density polyethylene (HDPE) disks with a thickness of 5 cm and a diameter of 30 cm, the middle disk containing 16 detectors positioned as one internal (moderated) and one external (unmoderated) ring of solid-state neutron detectors. These two detector rings provide the ability to determine the directionality of a neutron source. The system gathers spectral information about a neutron source in two ways: by measuring the relative responses of the internal ring of detectors as well as measuring the ratio of the internal-to-external detector responses. Experiments were performed with variable neutron spectra: a {sup 252}Cf spontaneous fission neutron source which was HDPE moderated, HDPE reflected, lead (Pb) shielded, and bare in order to benchmark the system for spectral sensitivity. Simulations were performed in order to characterize the neutron spectra corresponding to each of the source configurations and showed agreement with experimental measurements. The DSNDS demonstrates the ability to determine the relative angle of the source and the hardness of the neutron spectrum. By using the

  3. Yersinia enterocolitica in slaughter pig tonsils: enumeration and detection by enrichment versus direct plating culture.

    Science.gov (United States)

    Van Damme, Inge; Habib, Ihab; De Zutter, Lieven

    2010-02-01

    Tonsil samples from 139 slaughter pigs were examined for the presence of pathogenic Yersinia enterocolitica by enrichment procedures based on the standard method ISO 10273:2003. In addition, samples were tested by direct plating method to evaluate its efficiency compared to the enrichment culture methods and to quantify the level of contamination in porcine tonsils. In total, 52 samples (37.4%) were positive for pathogenic Y. enterocolitica, all belonging to bioserotype 4/O:3. Fifty out of the 52 positive samples (96.2%) were detected by direct plating. Enumeration showed an average concentration of 4.5 log(10) CFU g(-1) and 4.4 log(10) CFU g(-1) tonsil on Salmonella-Shigella-desoxycholate-calcium chloride (SSDC) and cefsulodin-irgasan-novobiocin (CIN) agar plates, respectively. The enrichment procedures recommended by the ISO 10273:2003 method were not optimal for the isolation of pathogenic Y. enterocolitica from pig tonsils: two days enrichment in irgasan-ticarcillin-potassium chlorate (ITC) broth resulted in an isolation rate of 84.6%, while 5 days enrichment in peptone-sorbitol-bile (PSB) broth recovered only 59.6% of positive samples. Reducing the enrichment time in PSB from 5 to 2 days resulted in a significantly higher recovery rate (94.2%) and might serve as an appropriate enrichment protocol for the isolation of pathogenic Y. enterocolitica from pig tonsils. Compared to enrichment culture methods, results based on direct plating can be obtained in a shorter time course and provide quantitative data that might be needed for further risk assessment studies.

  4. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  5. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  6. The local dark matter phase-space density and impact on WIMP direct detection

    International Nuclear Information System (INIS)

    Catena, Riccardo; Ullio, Piero

    2012-01-01

    We present a new determination of the local dark matter phase-space density. This result is obtained implementing, in the limit of isotropic velocity distribution and spherical symmetry, Eddington's inversion formula, which links univocally the dark matter distribution function to the density profile, and applying, within a Bayesian framework, a Markov Chain Monte Carlo algorithm to sample mass models for the Milky Way against a broad and variegated sample of dynamical constraints. We consider three possible choices for the dark matter density profile, namely the Einasto, NFW and Burkert profiles, finding that the velocity dispersion, which characterizes the width in the distribution, tends to be larger for the Burkert case, while the escape velocity depends very weakly on the profile, with the mean value we obtain being in very good agreement with estimates from stellar kinematics. The derived dark matter phase-space densities differ significantly — most dramatically in the high velocity tails — from the model usually taken as a reference in dark matter detection studies, a Maxwell-Boltzmann distribution with velocity dispersion fixed in terms of the local circular velocity and with a sharp truncation at a given value of the escape velocity. We discuss the impact of astrophysical uncertainties on dark matter scattering rates and direct detection exclusion limits, considering a few sample cases and showing that the most sensitive ones are those for light dark matter particles and for particles scattering inelastically. As a general trend, regardless of the assumed profile, when adopting a self-consistent phase-space density, we find that rates are larger, and hence exclusion limits stronger, than with the standard Maxwell-Boltzmann approximation. Tools for applying our result on the local dark matter phase-space density to other dark matter candidates or experimental setups are provided

  7. Direct detection of metal-insulator phase transitions using the modified Backus-Gilbert method

    Directory of Open Access Journals (Sweden)

    Ulybyshev Maksim

    2018-01-01

    Full Text Available The detection of the (semimetal-insulator phase transition can be extremely difficult if the local order parameter which characterizes the ordered phase is unknown. In some cases, it is even impossible to define a local order parameter: the most prominent example of such system is the spin liquid state. This state was proposed to exist in the Hubbard model on the hexagonal lattice in a region between the semimetal phase and the antiferromagnetic insulator phase. The existence of this phase has been the subject of a long debate. In order to detect these exotic phases we must use alternative methods to those used for more familiar examples of spontaneous symmetry breaking. We have modified the Backus-Gilbert method of analytic continuation which was previously used in the calculation of the pion quasiparticle mass in lattice QCD. The modification of the method consists of the introduction of the Tikhonov regularization scheme which was used to treat the ill-conditioned kernel. This modified Backus-Gilbert method is applied to the Euclidean propagators in momentum space calculated using the hybrid Monte Carlo algorithm. In this way, it is possible to reconstruct the full dispersion relation and to estimate the mass gap, which is a direct signal of the transition to the insulating state. We demonstrate the utility of this method in our calculations for the Hubbard model on the hexagonal lattice. We also apply the method to the metal-insulator phase transition in the Hubbard-Coulomb model on the square lattice.

  8. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    . The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result......A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry....

  9. Inhomogeneities detection in annual precipitation time series in Portugal using direct sequential simulation

    Science.gov (United States)

    Caineta, Júlio; Ribeiro, Sara; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2014-05-01

    Climate data homogenisation is of major importance in monitoring climate change, the validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. This happens because non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on geostatistical simulation (DSS - direct sequential simulation), where local probability density functions (pdf) are calculated at candidate monitoring stations, using spatial and temporal neighbouring observations, and then are used for detection of inhomogeneities. This approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). This study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneities detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall test, Wald-Wolfowitz runs test, Von Neumann ratio test, Standard normal homogeneity test (SNHT) for a single break, Pettit test, and Buishand range test). Moreover, a sensibility analysis is implemented to investigate the number of simulated realisations that should be used to accurately infer the local pdfs. Accordingly, the number of simulations per iteration is increased from 50 to 500, which resulted in a more representative local pdf. A set of default and recommended settings is provided, which will help

  10. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system.

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  11. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  12. Halo-independent analysis of direct detection data for light WIMPs

    International Nuclear Information System (INIS)

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng; Gondolo, Paolo

    2013-01-01

    We present a halo-independent analysis of direct detection data on ''light WIMPs'', i.e. weakly interacting massive particles with mass close to or below 10 GeV/c 2 . We include new results from silicon CDMS detectors (bounds and excess events), the latest CoGeNT acceptances, and recent measurements of low sodium quenching factors in NaI crystals. We focus on light WIMPs with spin-independent isospin-conserving and isospin-violating interactions with nucleons. For these dark matter candidates we find that a low quenching factor would make the DAMA modulation incompatible with a reasonable escape velocity for the dark matter halo, and that the tension among experimental data tightens in both the isospin-conserving and isospin-violating scenarios. We also find that a new although milder tension appears between the CoGeNT and DAMA annual modulations on one side and the silicon excess events on the other, in that it seems difficult to interpret them as the modulated and unmodulated aspects of the same WIMP dark matter signal

  13. Assessing Compatibility of Direct Detection Data: Halo-Independent Global Likelihood Analyses

    CERN Document Server

    Gelmini, Graciela B.

    2016-10-18

    We present two different halo-independent methods utilizing a global maximum likelihood that can assess the compatibility of dark matter direct detection data given a particular dark matter model. The global likelihood we use is comprised of at least one extended likelihood and an arbitrary number of Poisson or Gaussian likelihoods. In the first method we find the global best fit halo function and construct a two sided pointwise confidence band, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a "constrained parameter goodness-of-fit" test statistic, whose $p$-value we then use to define a "plausibility region" (e.g. where $p \\geq 10\\%$). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. $p < 10 \\%$). As an example we apply these methods to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic s...

  14. Direct detection signatures of self-interacting dark matter with a light mediator

    International Nuclear Information System (INIS)

    Nobile, Eugenio Del; Kaplinghat, Manoj; Yu, Hai-Bo

    2015-01-01

    Self-interacting dark matter (SIDM) is a simple and well-motivated scenario that could explain long-standing puzzles in structure formation on small scales. If the required self-interaction arises through a light mediator (with mass ∼ 10 MeV) in the dark sector, this new particle must be unstable to avoid overclosing the universe. The decay of the light mediator could happen due to a weak coupling of the hidden and visible sectors, providing new signatures for direct detection experiments. The SIDM nuclear recoil spectrum is more peaked towards low energies compared to the usual case of contact interactions, because the mediator mass is comparable to the momentum transfer of nuclear recoils. We show that the SIDM signal could be distinguished from that of DM particles with contact interactions by considering the time-average energy spectrum in experiments employing different target materials, or the average and modulated spectra in a single experiment. Using current limits from LUX and SuperCDMS, we also derive strong bounds on the mixing parameter between hidden and visible sector

  15. Direct Dark Matter Detection through the use of a Xenon Based TPC Detector

    Science.gov (United States)

    Daniel, Jonathan; Akerib, Daniel; LZ group at SLAC

    2018-01-01

    The vast majority of matter in the universe is unaccounted for. Only 15% of the universe's mass density is visible matter, while the other 85% is Dark Matter (DM). The Weakly Interacting Massive Particle (WIMP) is currently the frontrunner of the DM candidates. The Large Underground Xenon (LUX) and next generation LUX-ZEPLIN (LZ) experiments are designed to directly detect WIMPs. Both experiments are xenon-based Time Projection Chambers (TPC) used to observe possible WIMP interactions. These interactions produce photons and electrons with the photons being collected in a set of two photomultiplier tube (PMT) arrays and the electrons drifted upwards in the detector by a strong electric field to create a secondary production of photons in gaseous xenon. These two populations of photons are classified as S1 and S2 signals, respectively. Using these signals we reconstruct the energy and position of the interaction and in doing so we can eliminate background events that would otherwise “light up” the detector. My participation in the experiment, while at SLAC, was the creation of the grids that produce the large electric field, along with additional lab activities aimed at testing the grids. While at Stan State, I work on background modeling in order to distinguish a possible WIMP signal from ambient backgrounds.

  16. DEPFET detectors for direct detection of MeV dark matter particles

    Energy Technology Data Exchange (ETDEWEB)

    Baehr, A.; Ninkovic, J.; Treis, J. [Max-Planck-Gesellschaft Halbleiterlabor, Munich (Germany); Kluck, H.; Schieck, J. [Institut fuer Hochenergiephysik, Oesterreichische Akademie der Wissenschaften, Vienna (Austria); Atominstitut, Technische Universitaet Wien, Vienna (Austria)

    2017-12-15

    The existence of dark matter is undisputed, while the nature of it is still unknown. Explaining dark matter with the existence of a new unobserved particle is among the most promising possible solutions. Recently dark matter candidates in the MeV mass region received more and more interest. In comparison to the mass region between a few GeV to several TeV, this region is experimentally largely unexplored. We discuss the application of a RNDR DEPFET semiconductor detector for direct searches for dark matter in the MeV mass region. We present the working principle of the RNDR DEPFET devices and review the performance obtained by previously performed prototype measurements. The future potential of the technology as dark matter detector is discussed and the sensitivity for MeV dark matter detection with RNDR DEPFET sensors is presented. Under the assumption of six background events in the region of interest and an exposure of 1 kg year a sensitivity of about anti σ{sub e} = 10{sup -41} cm{sup 2} for dark matter particles with a mass of 10 MeV can be reached. (orig.)

  17. Direct detection of SERCA calcium transport and small-molecule inhibition in giant unilamellar vesicles

    International Nuclear Information System (INIS)

    Bian, Tengfei; Autry, Joseph M.; Casemore, Denise; Li, Ji; Thomas, David D.; He, Gaohong; Xing, Chengguo

    2016-01-01

    We have developed a charge-mediated fusion method to reconstitute the sarco/endoplasmic reticulum Ca 2+ -ATPase (SERCA) in giant unilamellar vesicles (GUV). Intracellular Ca 2+ transport by SERCA controls key processes in human cells such as proliferation, signaling, and contraction. Small-molecule effectors of SERCA are urgently needed as therapeutics for Ca 2+ dysregulation in human diseases including cancer, diabetes, and heart failure. Here we report the development of a method for efficiently reconstituting SERCA in GUV, and we describe a streamlined protocol based on optimized parameters (e.g., lipid components, SERCA preparation, and activity assay requirements). ATP-dependent Ca 2+ transport by SERCA in single GUV was detected directly using confocal fluorescence microscopy with the Ca 2+ indicator Fluo-5F. The GUV reconstitution system was validated for functional screening of Ca 2+ transport using thapsigargin (TG), a small-molecule inhibitor of SERCA currently in clinical trials as a prostate cancer prodrug. The GUV system overcomes the problem of inhibitory Ca 2+ accumulation for SERCA in native and reconstituted small unilamellar vesicles (SUV). We propose that charge-mediated fusion provides a widely-applicable method for GUV reconstitution of clinically-important membrane transport proteins. We conclude that GUV reconstitution is a technological advancement for evaluating small-molecule effectors of SERCA.

  18. A unified explanation for dark matter and electroweak baryogenesis with direct detection and gravitational wave signatures

    International Nuclear Information System (INIS)

    Chala, Mikael; Nardini, Germano; Sobolev, Ivan; Moscow State Univ.

    2016-05-01

    A minimal extension of the Standard Model that provides both a dark matter candidate and a strong first-order electroweak phase transition (EWPT) consists of two additional Lorentz and gauge singlets. In this paper we work out a composite Higgs version of this scenario, based on the coset SO(7)/SO(6). We show that by embedding the elementary fermions in appropriate representations of SO(7), all dominant interactions are described by only three free effective parameters. Within the model dependencies of the embedding, the theory predicts one of the singlets to be stable and responsible for the observed dark matter abundance. At the same time, the second singlet introduces new CP-violation phases and triggers a strong first-order EWPT, making electroweak baryogenesis feasible. It turns out that this scenario does not conflict with current observations and it is promising for solving the dark matter and baryon asymmetry puzzles. The tight predictions of the model will be accessible at the forthcoming dark matter direct detection and gravitational wave experiments.

  19. On the Capacity Region of the Intensity-Modulation Direct-Detection Optical Broadcast Channel

    KAUST Repository

    Chaaban, Anas

    2015-08-11

    The capacity of the intensity-modulation direct-detection free-space optical broadcast channel (OBC) is investigated. The Gaussian model with input-independent Gaussian noise is used, with both average and peak intensity constraints. An outer bound on the capacity region is derived by adapting Bergmans\\' approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian distributions or discrete distributions. While the discrete input distribution achieves higher rates than the truncated-Gaussian distribution, the latter allows expressing the achievable rate region in a closed form. At high signal-to-noise ratio (SNR), it is shown that the truncated-Gaussian distribution is nearly optimal. It achieves the symmetric-capacity within a constant gap (independent of SNR), which approaches half a bit as the number of users grows large. It also achieves the capacity region within a constant gap, which depends on the number of users. At low SNR, it is shown that on-off keying with time-division multiple-access (TDMA) is optimal, as it achieves any point on the boundary of the developed outer bound. This is interesting in practice since both OOK and TDMA have low complexity. At moderate SNR (typically [0,8] dB), a discrete distribution with a small alphabet size achieves a fairly good performance in terms of symmetric rate.

  20. Direct Generation and Detection of Quantum Correlated Photons with 3.2 um Wavelength Spacing.

    Science.gov (United States)

    Sua, Yong Meng; Fan, Heng; Shahverdi, Amin; Chen, Jia-Yang; Huang, Yu-Ping

    2017-12-13

    Quantum correlated, highly non-degenerate photons can be used to synthesize disparate quantum nodes and link quantum processing over incompatible wavelengths, thereby constructing heterogeneous quantum systems for otherwise unattainable superior performance. Existing techniques for correlated photons have been concentrated in the visible and near-IR domains, with the photon pairs residing within one micron. Here, we demonstrate direct generation and detection of high-purity photon pairs at room temperature with 3.2 um wavelength spacing, one at 780 nm to match the rubidium D2 line, and the other at 3950 nm that falls in a transparent, low-scattering optical window for free space applications. The pairs are created via spontaneous parametric downconversion in a lithium niobate waveguide with specially designed geometry and periodic poling. The 780 nm photons are measured with a silicon avalanche photodiode, and the 3950 nm photons are measured with an upconversion photon detector using a similar waveguide, which attains 34% internal conversion efficiency. Quantum correlation measurement yields a high coincidence-to-accidental ratio of 54, which indicates the strong correlation with the extremely non-degenerate photon pairs. Our system bridges existing quantum technology to the challenging mid-IR regime, where unprecedented applications are expected in quantum metrology and sensing, quantum communications, medical diagnostics, and so on.

  1. Frequency interleaving towards spectrally efficient directly detected optical OFDM for next-generation optical access networks.

    Science.gov (United States)

    Mehedy, Lenin; Bakaul, Masuduzzaman; Nirmalathas, Ampalavanapillai

    2010-10-25

    In this paper, we theoretically analyze and demonstrate that spectral efficiency of a conventional direct detection based optical OFDM system (DDO-OFDM) can be improved significantly using frequency interleaving of adjacent DDO-OFDM channels where OFDM signal band of one channel occupies the spectral gap of other channel and vice versa. We show that, at optimum operating condition, the proposed technique can effectively improve the spectral efficiency of the conventional DDO-OFDM system as much as 50%. We also show that such a frequency interleaved DDO-OFDM system, with a bit rate of 48 Gb/s within 25 GHz bandwidth, achieves sufficient power budget after transmission over 25 km single mode fiber to be used in next-generation time-division-multiplexed passive optical networks (TDM-PON). Moreover, by applying 64- quadrature amplitude modulation (QAM), the system can be further scaled up to 96 Gb/s with a power budget sufficient for 1:16 split TDM-PON.

  2. Can tonne-scale direct detection experiments discover nuclear dark matter?

    Energy Technology Data Exchange (ETDEWEB)

    Butcher, Alistair; Kirk, Russell; Monroe, Jocelyn; West, Stephen M., E-mail: Alistair.Butcher.2010@live.rhul.ac.uk, E-mail: Russell.Kirk.2008@live.rhul.ac.uk, E-mail: Jocelyn.Monroe@rhul.ac.uk, E-mail: Stephen.West@rhul.ac.uk [Department of Physics, Royal Holloway University of London, Egham, Surrey, TW20 0EX (United Kingdom)

    2017-10-01

    Models of nuclear dark matter propose that the dark sector contains large composite states consisting of dark nucleons in analogy to Standard Model nuclei. We examine the direct detection phenomenology of a particular class of nuclear dark matter model at the current generation of tonne-scale liquid noble experiments, in particular DEAP-3600 and XENON1T. In our chosen nuclear dark matter scenario distinctive features arise in the recoil energy spectra due to the non-point-like nature of the composite dark matter state. We calculate the number of events required to distinguish these spectra from those of a standard point-like WIMP state with a decaying exponential recoil spectrum. In the most favourable regions of nuclear dark matter parameter space, we find that a few tens of events are needed to distinguish nuclear dark matter from WIMPs at the 3 σ level in a single experiment. Given the total exposure time of DEAP-3600 and XENON1T we find that at best a 2 σ distinction is possible by these experiments individually, while 3 σ sensitivity is reached for a range of parameters by the combination of the two experiments. We show that future upgrades of these experiments have potential to distinguish a large range of nuclear dark matter models from that of a WIMP at greater than 3 σ .

  3. What is the probability that direct detection experiments have observed dark matter?

    International Nuclear Information System (INIS)

    Bozorgnia, Nassim; Schwetz, Thomas

    2014-01-01

    In Dark Matter direct detection we are facing the situation of some experiments reporting positive signals which are in conflict with limits from other experiments. Such conclusions are subject to large uncertainties introduced by the poorly known local Dark Matter distribution. We present a method to calculate an upper bound on the joint probability of obtaining the outcome of two potentially conflicting experiments under the assumption that the Dark Matter hypothesis is correct, but completely independent of assumptions about the Dark Matter distribution. In this way we can quantify the compatibility of two experiments in an astrophysics independent way. We illustrate our method by testing the compatibility of the hints reported by DAMA and CDMS-Si with the limits from the LUX and SuperCDMS experiments. The method does not require Monte Carlo simulations but is mostly based on using Poisson statistics. In order to deal with signals of few events we introduce the so-called ''signal length'' to take into account energy information. The signal length method provides a simple way to calculate the probability to obtain a given experimental outcome under a specified Dark Matter and background hypothesis

  4. Interpreting dark matter direct detection independently of the local velocity and density distribution

    International Nuclear Information System (INIS)

    Fox, Patrick J.; Kribs, Graham D.; Tait, Tim M. P.

    2011-01-01

    We demonstrate precisely what particle physics information can be extracted from a single direct detection observation of dark matter while making absolutely no assumptions about the local velocity distribution and local density of dark matter. Our central conclusions follow from a very simple observation: the velocity distribution of dark matter is positive definite, f(v)≥0. We demonstrate the utility of this result in several ways. First, we show a falling deconvoluted recoil spectrum (deconvoluted of the nuclear form factor), such as from ordinary elastic scattering, can be 'mocked up' by any mass of dark matter above a kinematic minimum. As an example, we show that dark matter much heavier than previously considered can explain the CoGeNT excess. Specifically, m χ Ge can be in just as good agreement as light dark matter, while m χ >m Ge depends on understanding the sensitivity of xenon to dark matter at very low recoil energies, E R < or approx. 6 keVnr. Second, we show that any rise in the deconvoluted recoil spectrum represents distinct particle physics information that cannot be faked by an arbitrary f(v). As examples of resulting nontrivial particle physics, we show that inelastic dark matter and dark matter with a form factor can both yield such a rise.

  5. Rate adaptive multilevel coded modulation with high coding gain in intensity modulation direct detection optical communication

    Science.gov (United States)

    Xiao, Fei; Liu, Bo; Zhang, Lijia; Xin, Xiangjun; Zhang, Qi; Tian, Qinghua; Tian, Feng; Wang, Yongjun; Rao, Lan; Ullah, Rahat; Zhao, Feng; Li, Deng'ao

    2018-02-01

    A rate-adaptive multilevel coded modulation (RA-MLC) scheme based on fixed code length and a corresponding decoding scheme is proposed. RA-MLC scheme combines the multilevel coded and modulation technology with the binary linear block code at the transmitter. Bits division, coding, optional interleaving, and modulation are carried out by the preset rule, then transmitted through standard single mode fiber span equal to 100 km. The receiver improves the accuracy of decoding by means of soft information passing through different layers, which enhances the performance. Simulations are carried out in an intensity modulation-direct detection optical communication system using MATLAB®. Results show that the RA-MLC scheme can achieve bit error rate of 1E-5 when optical signal-to-noise ratio is 20.7 dB. It also reduced the number of decoders by 72% and realized 22 rate adaptation without significantly increasing the computing time. The coding gain is increased by 7.3 dB at BER=1E-3.

  6. Assessing compatibility of direct detection data: halo-independent global likelihood analyses

    Energy Technology Data Exchange (ETDEWEB)

    Gelmini, Graciela B. [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA 90095 (United States); Huh, Ji-Haeng [CERN Theory Division,CH-1211, Geneva 23 (Switzerland); Witte, Samuel J. [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA 90095 (United States)

    2016-10-18

    We present two different halo-independent methods to assess the compatibility of several direct dark matter detection data sets for a given dark matter model using a global likelihood consisting of at least one extended likelihood and an arbitrary number of Gaussian or Poisson likelihoods. In the first method we find the global best fit halo function (we prove that it is a unique piecewise constant function with a number of down steps smaller than or equal to a maximum number that we compute) and construct a two-sided pointwise confidence band at any desired confidence level, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a “constrained parameter goodness-of-fit” test statistic, whose p-value we then use to define a “plausibility region” (e.g. where p≥10%). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. p<10%). We illustrate these methods by applying them to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic spin-independent isospin-conserving interactions or exothermic spin-independent isospin-violating interactions.

  7. Can tonne-scale direct detection experiments discover nuclear dark matter?

    International Nuclear Information System (INIS)

    Butcher, Alistair; Kirk, Russell; Monroe, Jocelyn; West, Stephen M.

    2017-01-01

    Models of nuclear dark matter propose that the dark sector contains large composite states consisting of dark nucleons in analogy to Standard Model nuclei. We examine the direct detection phenomenology of a particular class of nuclear dark matter model at the current generation of tonne-scale liquid noble experiments, in particular DEAP-3600 and XENON1T. In our chosen nuclear dark matter scenario distinctive features arise in the recoil energy spectra due to the non-point-like nature of the composite dark matter state. We calculate the number of events required to distinguish these spectra from those of a standard point-like WIMP state with a decaying exponential recoil spectrum. In the most favourable regions of nuclear dark matter parameter space, we find that a few tens of events are needed to distinguish nuclear dark matter from WIMPs at the 3 σ level in a single experiment. Given the total exposure time of DEAP-3600 and XENON1T we find that at best a 2 σ distinction is possible by these experiments individually, while 3 σ sensitivity is reached for a range of parameters by the combination of the two experiments. We show that future upgrades of these experiments have potential to distinguish a large range of nuclear dark matter models from that of a WIMP at greater than 3 σ .

  8. Direct electrochemistry of dopamine on gold-Agaricus bisporus laccase enzyme electrode: characterization and quantitative detection.

    Science.gov (United States)

    Shervedani, Reza Karimi; Amini, Akbar

    2012-04-01

    Direct electrochemistry of a new laccase enzyme immobilized on gold and its application as a biosensor for dopamine (DA) are investigated by voltammetry and electrochemical impedance spectroscopy. The sensor demonstrated a redox adsorption behavior with E(0') = + 180 mV vs. Ag/AgCl for immobilized Agaricus bisporus laccase (LacAB) enzyme. The MPA platform was assembled on Au with and without utilization of ultrasounds. Excellent results were obtained by using the enzyme electrode fabricated based on MPA assembled with sonication. The LacAB immobilized in this condition showed a large electrocatalytic activity for oxidation of DA. Accordingly, a third-generation (mediator free) biosensor was constructed for DA. The DA concentration could be measured in the linear range of 0.5 to 13.0 and 47.0 to 430.0 μmol L(-1) with correlation coefficients of 0.999 and 0.989, respectively, and a detection limit of 29.0 nmol L(-1). The biosensor was successfully tested for determination of DA in human blood plasma and pharmaceutical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Direct Molecular Detection and Genotyping of Borrelia burgdorferi from Whole Blood of Patients with Early Lyme Disease

    Science.gov (United States)

    Eshoo, Mark W.; Crowder, Christopher C.; Rebman, Alison W.; Rounds, Megan A.; Matthews, Heather E.; Picuri, John M.; Soloski, Mark J.; Ecker, David J.; Schutzer, Steven E.; Aucott, John N.

    2012-01-01

    Direct molecular tests in blood for early Lyme disease can be insensitive due to low amount of circulating Borrelia burgdorferi DNA. To address this challenge, we have developed a sensitive strategy to both detect and genotype B. burgdorferi directly from whole blood collected during the initial patient visit. This strategy improved sensitivity by employing 1.25 mL of whole blood, a novel pre-enrichment of the entire specimen extract for Borrelia DNA prior to a multi-locus PCR and electrospray ionization mass spectrometry detection assay. We evaluated the assay on blood collected at the initial presentation from 21 endemic area patients who had both physician-diagnosed erythema migrans (EM) and positive two-tiered serology either at the initial visit or at a follow-up visit after three weeks of antibiotic therapy. Results of this DNA analysis showed detection of B. burgdorferi in 13 of 21 patients (62%). In most cases the new assay also provided the B. burgdorferi genotype. The combined results of our direct detection assay with initial physician visit serology resulted in the detection of early Lyme disease in 19 of 21 (90%) of patients at the initial visit. In 5 of 21 cases we demonstrate the ability to detect B. burgdorferi in early Lyme disease directly from whole blood specimens prior to seroconversion. PMID:22590620

  10. Joint Direction-of-Departure and Direction-of-Arrival Estimation in a UWB MIMO Radar Detecting Targets with Fluctuating Radar Cross Sections

    Directory of Open Access Journals (Sweden)

    Idnin Pasya

    2014-01-01

    Full Text Available This paper presents a joint direction-of-departure (DOD and direction-of-arrival (DOA estimation in a multiple-input multiple-output (MIMO radar utilizing ultra wideband (UWB signals in detecting targets with fluctuating radar cross sections (RCS. The UWB MIMO radar utilized a combination of two-way MUSIC and majority decision based on angle histograms of estimated DODs and DOAs at each frequency of the UWB signal. The proposed angle estimation scheme was demonstrated to be effective in detecting targets with fluctuating RCS, compared to conventional spectra averaging method used in subband angle estimations. It was found that a wider bandwidth resulted in improved estimation performance. Numerical simulations along with experimental evaluations in a radio anechoic chamber are presented.

  11. Automatic Detection of Cortical Bones Haversian Osteonal Boundaries

    Directory of Open Access Journals (Sweden)

    Ilige Hage

    2015-10-01

    Full Text Available This work aims to automatically detect cement lines in decalcified cortical bone sections stained with H&E. Employed is a methodology developed previously by the authors and proven to successfully count and disambiguate the micro-architectural features (namely Haversian canals, canaliculi, and osteocyte lacunae present in the secondary osteons/Haversian system (osteon of cortical bone. This methodology combines methods typically considered separately, namely pulse coupled neural networks (PCNN, particle swarm optimization (PSO, and adaptive threshold (AT. In lieu of human bone, slides (at 20× magnification from bovid cortical bone are used in this study as proxy of human bone. Having been characterized, features with same orientation are used to detect the cement line viewed as the next coaxial layer adjacent to the outermost lamella of the osteon. Employed for this purpose are three attributes for each and every micro-sized feature identified in the osteon lamellar system: (1 orientation, (2 size (ellipse perimeter and (3 Euler number (a topological measure. From a training image, automated parameters for the PCNN network are obtained by forming fitness functions extracted from these attributes. It is found that a 3-way combination of these features attributes yields good representations of the overall osteon boundary (cement line. Near-unity values of classical metrics of quality (precision, sensitivity, specificity, accuracy, and dice suggest that the segments obtained automatically by the optimized artificial intelligent methodology are of high fidelity as compared with manual tracing. For bench marking, cement lines segmented by k-means did not fare as well. An analysis based on the modified Hausdorff distance (MHD of the segmented cement lines also testified to the quality of the detected cement lines vis-a-vis the k-means method.

  12. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    International Nuclear Information System (INIS)

    Traviesa-Alvarez, J.M.; Costa-Fernandez, J.M.; Pereiro, R.; Sanz-Medel, A.

    2007-01-01

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10 -4 M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples

  13. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Traviesa-Alvarez, J M [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Costa-Fernandez, J M [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Pereiro, R [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Sanz-Medel, A [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain)

    2007-04-18

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10{sup -4} M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples.

  14. Microlens Array/Pinhole Mask to Suppress Starlight for Direct Exoplanet Detection

    Science.gov (United States)

    Zimmerman, Neil

    Direct imaging of habitable exoplanets is a key priority of NASA’s Astrophysics roadmap, “Enduring Quests, Daring Visions.” A coronagraphic starlight suppression system situated on a large space telescope offers a viable path to achieving this goal. This type of instrument is central to both the LUVOIR and HabEx mission concepts currently under study for the 2020 Decadal Survey. To directly image an Earth-like exoplanet, an instrument must be sensitive to objects ten billion times dimmer than their parent star. Advanced coronagraphs are designed to modify the shape of the star’s image so that it does not overwhelm the planet's light. Coronagraphs are complex to design and fabricate, tend to sacrifice a significant portion of the exoplanet light entering the telescope, and are highly sensitive to errors in the telescope. The proposed work reduces the demands on the coronagraph and its sensitivity to errors in the telescope, by changing how we implement optics in the spectrograph following the coronagraph. Through optical analysis and modeling, we have found that a microlens array with a specially arranged pattern of pinholes can suppress residual starlight in the scientific image after the coronagraph by more than two orders of magnitude. This added layer of starlight rejection could be used to relax the extreme observatory stability requirements for exo-Earth imaging applications, for example shifting the wavefront stability requirement from a few picometers to a few nanometers. Ultimately this translates to the instrument detecting and spectrally characterizing more exoplanets than a conventional coronagraph system. This microlens/pinhole concept is also compatible with starshadebased starlight suppression systems. The proposed microlens/pinhole device is entirely passive and augments the performance of existing coronagraph designs, while potentially reducing their cost and risk for mission implementation. Our APRA proposal would support a testbed

  15. Dark matter direct detection signals inferred from a cosmological N-body simulation with baryons

    International Nuclear Information System (INIS)

    Ling, F.-S.; Nezri, E.; Athanassoula, E.; Teyssier, R.

    2010-01-01

    We extract at redshift z = 0 a Milky Way sized object including gas, stars and dark matter (DM) from a recent, high-resolution cosmological N-body simulation with baryons. Its resolution is sufficient to witness the formation of a rotating disk and bulge at the center of the halo potential, therefore providing a realistic description of the birth and the evolution of galactic structures in the ΛCDM cosmology paradigm. The phase-space structure of the central galaxy reveals that, throughout a thick region, the dark halo is co-rotating on average with the stellar disk. At the Earth's location, the rotating component, sometimes called dark disk in the literature, is characterized by a minimum lag velocity v lag ≅ 75 km/s, in which case it contributes to around 25% of the total DM local density, whose value is ρ DM ≅ 0.37GeV/cm 3 . The velocity distributions also show strong deviations from pure Gaussian and Maxwellian distributions, with a sharper drop of the high velocity tail. We give a detailed study of the impact of these features on the predictions for DM signals in direct detection experiments. In particular, the question of whether the modulation signal observed by DAMA is or is not excluded by limits set by other experiments (CDMS, XENON and CRESST...) is re-analyzed and compared to the case of a standard Maxwellian halo. We consider spin-independent interactions for both the elastic and the inelastic scattering scenarios. For the first time, we calculate the allowed regions for DAMA and the exclusion limits of other null experiments directly from the velocity distributions found in the simulation. We then compare these results with the predictions of various analytical distributions. We find that the compatibility between DAMA and the other experiments is improved. In the elastic scenario, the DAMA modulation signal is slightly enhanced in the so-called channeling region, as a result of several effects that include a departure from a Maxwellian

  16. Performances of a HGCDTE APD based direct detection lidar at 2 μm. Application to dial measurements

    Science.gov (United States)

    Gibert, Fabien; Dumas, Arnaud; Rothman, Johan; Edouart, Dimitri; Cénac, Claire; Pellegrino, Jessica

    2018-04-01

    A lidar receiver with a direct detection chain adapted to a HgCdTe APD based detector with electric cooling is associated to a 2.05 μm Ho :YLF pulsed dual wavelength single mode transmitter to provide the first atmospheric lidar measurements using this technology. Experiments confirm the outstanding sensitivity of the detector and hightligth its huge potential for DIAL measurements of trace gas (CO2 and H2O) in this spectral domain. Performances of coherent vs direct detection at 2.05 μm is assessed.

  17. Performances of a HGCDTE APD based direct detection lidar at 2 μm. Application to dial measurements

    Directory of Open Access Journals (Sweden)

    Gibert Fabien

    2018-01-01

    Full Text Available A lidar receiver with a direct detection chain adapted to a HgCdTe APD based detector with electric cooling is associated to a 2.05 μm Ho :YLF pulsed dual wavelength single mode transmitter to provide the first atmospheric lidar measurements using this technology. Experiments confirm the outstanding sensitivity of the detector and hightligth its huge potential for DIAL measurements of trace gas (CO2 and H2O in this spectral domain. Performances of coherent vs direct detection at 2.05 μm is assessed.

  18. DaMaSCUS: the impact of underground scatterings on direct detection of light dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Emken, Timon; Kouvaris, Chris, E-mail: emken@cp3.sdu.dk, E-mail: kouvaris@cp3.sdu.dk [CP3-Origins, University of Southern Denmark, Campusvej 55, DK-5230 Odense (Denmark)

    2017-10-01

    Conventional dark matter direct detection experiments set stringent constraints on dark matter by looking for elastic scattering events between dark matter particles and nuclei in underground detectors. However these constraints weaken significantly in the sub-GeV mass region, simply because light dark matter does not have enough energy to trigger detectors regardless of the dark matter-nucleon scattering cross section. Even if future experiments lower their energy thresholds, they will still be blind to parameter space where dark matter particles interact with nuclei strongly enough that they lose enough energy and become unable to cause a signal above the experimental threshold by the time they reach the underground detector. Therefore in case dark matter is in the sub-GeV region and strongly interacting, possible underground scatterings of dark matter with terrestrial nuclei must be taken into account because they affect significantly the recoil spectra and event rates, regardless of whether the experiment probes DM via DM-nucleus or DM-electron interaction. To quantify this effect we present the publicly available Dark Matter Simulation Code for Underground Scatterings (DaMaSCUS), a Monte Carlo simulator of DM trajectories through the Earth taking underground scatterings into account. Our simulation allows the precise calculation of the density and velocity distribution of dark matter at any detector of given depth and location on Earth. The simulation can also provide the accurate recoil spectrum in underground detectors as well as the phase and amplitude of the diurnal modulation caused by this shadowing effect of the Earth, ultimately relating the modulations expected in different detectors, which is important to decisively conclude if a diurnal modulation is due to dark matter or an irrelevant background.

  19. Antigen detection of rabies virus in brain smear using direct Rapid Immunohistochemistry Test

    Directory of Open Access Journals (Sweden)

    Damayanti R

    2014-03-01

    Full Text Available Rabies is zoonotic disease caused by a fatal, neurotropic virus. Rabies virus is classified into the Genus of Lyssavirus under the yang family of Rhabdoviridae. Rabies affecting hot- blooded animals, as well as human. Dogs, cats, monkeys are the vectors or reservoirs for rabies and the virus was transmitted through the saliva after infected animal’s bites. The aim of this study was to conduct rapid diagnosis to detect rabies viral antigen in brain smear using immunohistochemical (IHC method namely direct Rapid Immunohistochemical Test (dRIT. A total number of 119 brain samples were achieved from Bukittinggi Veterinary Laboratory, West Sumatra. Standardisation and validation of the method were compared to Fluorescent Antibody Test (FAT as a golden standard for rabies diagnosis. Results show that dRIT was a very good method, it can be performed within two hours without the need of fluorescent microscope. The samples were tested using FAT and from 119 samples tested, 80 (67.23% samples were positive for rabies and 39 (32.77% samples were negative for rabies whereas using dRIT showed that 78 (65.54% samples were positive for rabies and 41 (34.45% samples were negative for rabies. The dRIT results were validated by comparing them with FAT results as a golden standard for rabies. The relative sensitivity of dRIT to FAT was 97.5% and the relative specificity to FAT was 100% (with Kappa value of 0.976, stated as excellent. The achievement showed that dRIT is very potential diagnostic tool and is highly recommended to be used widely as a rapid diagnosis tool for rabies.

  20. Micro-Spec: an Integrated, Direct-Detection Spectrometer for Far-Infrared and Submillimeter Astronomy

    Science.gov (United States)

    Cataldo, Giuseppe

    2014-01-01

    The far-infrared and submillimeter portions of the electromagnetic spectrum provide a unique view of the astrophysical processes present in the early universe. Our ability to fully explore this rich spectral region has been limited, however, by the size and cost of the cryogenic spectrometers required to carry out such measurements. Micro-Spec (u-Spec) is a high-sensitivity, direct-detection spectrometer concept working in the 450-1000 micromillimeter wavelength range which will enable a wide range of flight missions that would otherwise be challenging due to the large size of current instruments with the required spectral resolution and sensitivity. The spectrometer design utilizes two internal antenna arrays, one for transmitting and one for receiving, superconducting microstrip transmission lines for power division and phase delay, and an array of microwave kinetic inductance detectors (MKIDs) to achieve these goals. The instrument will be integrated on a approximately 10 square cm silicon chip and can therefore become an important capability under the low background conditions accessible via space and high-altitude borne platforms. In this paper, an optical design methodology for Micro-Spec is presented, with particular attention given to its twodimensional diffractive region, where the light of different wavelengths is focused on the different detectors. The method is based on the maximization of the instrument resolving power and minimization of the RMS phase error on the instrument focal plane. This two-step optimization can generate geometrical configurations given specific requirements on spectrometer size, operating spectral range and performance. A point design with resolving power of 257, an RMS phase error less than 0.1 radians and four stigmatic points was developed for initial demonstration and will be the basis of future instruments with resolving power up to about 1200.

  1. DaMaSCUS: the impact of underground scatterings on direct detection of light dark matter

    International Nuclear Information System (INIS)

    Emken, Timon; Kouvaris, Chris

    2017-01-01

    Conventional dark matter direct detection experiments set stringent constraints on dark matter by looking for elastic scattering events between dark matter particles and nuclei in underground detectors. However these constraints weaken significantly in the sub-GeV mass region, simply because light dark matter does not have enough energy to trigger detectors regardless of the dark matter-nucleon scattering cross section. Even if future experiments lower their energy thresholds, they will still be blind to parameter space where dark matter particles interact with nuclei strongly enough that they lose enough energy and become unable to cause a signal above the experimental threshold by the time they reach the underground detector. Therefore in case dark matter is in the sub-GeV region and strongly interacting, possible underground scatterings of dark matter with terrestrial nuclei must be taken into account because they affect significantly the recoil spectra and event rates, regardless of whether the experiment probes DM via DM-nucleus or DM-electron interaction. To quantify this effect we present the publicly available Dark Matter Simulation Code for Underground Scatterings (DaMaSCUS), a Monte Carlo simulator of DM trajectories through the Earth taking underground scatterings into account. Our simulation allows the precise calculation of the density and velocity distribution of dark matter at any detector of given depth and location on Earth. The simulation can also provide the accurate recoil spectrum in underground detectors as well as the phase and amplitude of the diurnal modulation caused by this shadowing effect of the Earth, ultimately relating the modulations expected in different detectors, which is important to decisively conclude if a diurnal modulation is due to dark matter or an irrelevant background.

  2. The New Worlds Observer: Direct Detection and Study of Exoplanets from the Habitable Zone Outward

    Science.gov (United States)

    Cash, Webster C.; New Worlds Study Team

    2009-01-01

    Direct detection and spectroscopic study of the planets around the nearby stars is generally recognized as a prime goal of astronomy. The New Worlds Observer mission concept is being studied as an Astrophysics Strategic Mission Concept Study for this purpose. NWO features two spacecraft: a general purpose 4m telescope that operates from the UV to the Near IR, and a starshade, a flower-shaped occulter about 50m in diameter flying in alignment about 70,000km away. Our study shows this is the most effective way to map nearby planetary systems. Images will show dust and debris down to a fraction of our zodiacal light level. Planets fainter than the Earth can be seen from the Habitable Zone outward, at distances up to 20pc. High throughput and low noise enable immediate follow-up spectroscopy of discovered planets. NWO can discover many more Earth-like planets than all competing approaches including astrometric, interferometric, and internal coronagraphic. Within hours of discovery, a high quality spectrum can determine the true nature of the exoplanet and open the search for biomarkers and life. Over half of the time will be spent with the starshade in transit to the next target. During those times the telescope will be available to for general astrophysics purposes. Operating from the ultraviolet to the near infrared, this will be a true HST follow-on. The study shows all needed technologies already exist. The cost scales primarily with telescope size. The mission is definitely within the financial and technical reach of NASA for the coming decade.

  3. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  4. An assessment of independent component analysis for detection of military targets from hyperspectral images

    Science.gov (United States)

    Tiwari, K. C.; Arora, M. K.; Singh, D.

    2011-10-01

    Hyperspectral data acquired over hundreds of narrow contiguous wavelength bands are extremely suitable for target detection due to their high spectral resolution. Though spectral response of every material is expected to be unique, but in practice, it exhibits variations, which is known as spectral variability. Most target detection algorithms depend on spectral modelling using a priori available target spectra In practice, target spectra is, however, seldom available a priori. Independent component analysis (ICA) is a new evolving technique that aims at finding out components which are statistically independent or as independent as possible. The technique therefore has the potential of being used for target detection applications. A assessment of target detection from hyperspectral images using ICA and other algorithms based on spectral modelling may be of immense interest, since ICA does not require a priori target information. The aim of this paper is, thus, to assess the potential of ICA based algorithm vis a vis other prevailing algorithms for military target detection. Four spectral matching algorithms namely Orthogonal Subspace Projection (OSP), Constrained Energy Minimisation (CEM), Spectral Angle Mapper (SAM) and Spectral Correlation Mapper (SCM), and four anomaly detection algorithms namely OSP anomaly detector (OSPAD), Reed-Xiaoli anomaly detector (RXD), Uniform Target Detector (UTD) and a combination of Reed-Xiaoli anomaly detector and Uniform Target Detector (RXD-UTD) were considered. The experiments were conducted using a set of synthetic and AVIRIS hyperspectral images containing aircrafts as military targets. A comparison of true positive and false positive rates of target detections obtained from ICA and other algorithms plotted on a receiver operating curves (ROC) space indicates the superior performance of the ICA over other algorithms.

  5. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  6. Detection of thrombocytic antibodies with the direct and indirect haemolysis inhibition test and the radioimmuno-Coombs test

    International Nuclear Information System (INIS)

    Mettenboerger, D.; Vith, E.

    1982-01-01

    Methods of application of the direct and indirect haemolysis inhibition test were studied in order to optimise the test parameters: The ultimate aim was to standardize the test method and compare its sensitivity in detecting various platelet antibodies with platelet indirect radioactive Coombs-test and the platelet immunofluorescence test. (orig.) [de

  7. Direct {sup 13}C-detected NMR experiments for mapping and characterization of hydrogen bonds in RNA

    Energy Technology Data Exchange (ETDEWEB)

    Fürtig, Boris, E-mail: fuertig@nmr.uni-frankfurt.de; Schnieders, Robbin; Richter, Christian; Zetzsche, Heidi; Keyhani, Sara; Helmling, Christina [Johann Wolfgang Goethe Universität Frankfurt, Center for Biomolecular Magnetic Resonance (BMRZ), Institute of Organic Chemistry and Chemical Biology (Germany); Kovacs, Helena [Bruker BioSpin (Switzerland); Schwalbe, Harald, E-mail: schwalbe@nmr.uni-frankfurt.de [Johann Wolfgang Goethe Universität Frankfurt, Center for Biomolecular Magnetic Resonance (BMRZ), Institute of Organic Chemistry and Chemical Biology (Germany)

    2016-03-15

    In RNA secondary structure determination, it is essential to determine whether a nucleotide is base-paired and not. Base-pairing of nucleotides is mediated by hydrogen bonds. The NMR characterization of hydrogen bonds relies on experiments correlating the NMR resonances of exchangeable protons and can be best performed for structured parts of the RNA, where labile hydrogen atoms are protected from solvent exchange. Functionally important regions in RNA, however, frequently reveal increased dynamic disorder which often leads to NMR signals of exchangeable protons that are broadened beyond {sup 1}H detection. Here, we develop {sup 13}C direct detected experiments to observe all nucleotides in RNA irrespective of whether they are involved in hydrogen bonds or not. Exploiting the self-decoupling of scalar couplings due to the exchange process, the hydrogen bonding behavior of the hydrogen bond donor of each individual nucleotide can be determined. Furthermore, the adaption of HNN-COSY experiments for {sup 13}C direct detection allows correlations of donor–acceptor pairs and the localization of hydrogen-bond acceptor nucleotides. The proposed {sup 13}C direct detected experiments therefore provide information about molecular sites not amenable by conventional proton-detected methods. Such information makes the RNA secondary structure determination by NMR more accurate and helps to validate secondary structure predictions based on bioinformatics.

  8. Direct detection of early-stage cancers using circulating tumor DNA

    DEFF Research Database (Denmark)

    Phallen, Jillian; Sausen, Mark; Adleff, Vilmos

    2017-01-01

    Early detection and intervention are likely to be the most effective means for reducing morbidity and mortality of human cancer. However, development of methods for noninvasive detection of early-stage tumors has remained a challenge. We have developed an approach called targeted error correction...

  9. Sensitive detection of nucleic acids by PNA hybridization directed co-localization of fluorescent beads

    DEFF Research Database (Denmark)

    Shiraishi, Takehiko; Deborggraeve, Stijn; Büscher, Philippe

    2011-01-01

    )avidin-coated fluorescent beads, differing in size and color [green beads (1 µm) and red beads (5.9 µm)], thereby allowing distinct detection of each PNA probe by conventional fluorescence microscopy. These two PNA beads showed easily detectable co-localization when simultaneously hybridizing to a target nucleic acid...

  10. Circulating tumor cell detection: A direct comparison between negative and unbiased enrichment in lung cancer.

    Science.gov (United States)

    Xu, Yan; Liu, Biao; Ding, Fengan; Zhou, Xiaodie; Tu, Pin; Yu, Bo; He, Yan; Huang, Peilin

    2017-06-01

    Circulating tumor cells (CTCs), isolated as a 'liquid biopsy', may provide important diagnostic and prognostic information. Therefore, rapid, reliable and unbiased detection of CTCs are required for routine clinical analyses. It was demonstrated that negative enrichment, an epithelial marker-independent technique for isolating CTCs, exhibits a better efficiency in the detection of CTCs compared with positive enrichment techniques that only use specific anti-epithelial cell adhesion molecules. However, negative enrichment techniques incur significant cell loss during the isolation procedure, and as it is a method that uses only one type of antibody, it is inherently biased. The detection procedure and identification of cell types also relies on skilled and experienced technicians. In the present study, the detection sensitivity of using negative enrichment and a previously described unbiased detection method was compared. The results revealed that unbiased detection methods may efficiently detect >90% of cancer cells in blood samples containing CTCs. By contrast, only 40-60% of CTCs were detected by negative enrichment. Additionally, CTCs were identified in >65% of patients with stage I/II lung cancer. This simple yet efficient approach may achieve a high level of sensitivity. It demonstrates a potential for the large-scale clinical implementation of CTC-based diagnostic and prognostic strategies.

  11. First Direct-Detection Constraints on eV-Scale Hidden-Photon Dark Matter with DAMIC at SNOLAB.

    Science.gov (United States)

    Aguilar-Arevalo, A; Amidei, D; Bertou, X; Butner, M; Cancelo, G; Castañeda Vázquez, A; Cervantes Vergara, B A; Chavarria, A E; Chavez, C R; de Mello Neto, J R T; D'Olivo, J C; Estrada, J; Fernandez Moroni, G; Gaïor, R; Guardincerri, Y; Hernández Torres, K P; Izraelevitch, F; Kavner, A; Kilminster, B; Lawson, I; Letessier-Selvon, A; Liao, J; Matalon, A; Mello, V B B; Molina, J; Privitera, P; Ramanathan, K; Sarkis, Y; Schwarz, T; Settimo, M; Sofo Haro, M; Thomas, R; Tiffenberg, J; Tiouchichine, E; Torres Machado, D; Trillaud, F; You, X; Zhou, J

    2017-04-07

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30  eV c^{-2} with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter κ is competitive with constraints from solar emission, reaching a minimum value of 2.2×10^{-14} at 17  eV c^{-2}. These results are the most stringent direct detection constraints on hidden-photon dark matter in the galactic halo with masses 3-12  eV c^{-2} and the first demonstration of direct experimental sensitivity to ionization signals dark matter interactions.

  12. First Direct-Detection Constraints on eV-Scale Hidden-Photon Dark Matter with DAMIC at SNOLAB

    Energy Technology Data Exchange (ETDEWEB)

    Aguilar-Arevalo, A.; Amidei, D.; Bertou, X.; Butner, M.; Cancelo, G.; Castañeda Vázquez, A.; Cervantes Vergara, B. A.; Chavarria, A. E.; Chavez, C. R.; de Mello Neto, J. R. T.; D’Olivo, J. C.; Estrada, J.; Fernandez Moroni, G.; Gaïor, R.; Guardincerri, Y.; Hernández Torres, K. P.; Izraelevitch, F.; Kavner, A.; Kilminster, B.; Lawson, I.; Letessier-Selvon, A.; Liao, J.; Matalon, A.; Mello, V. B. B.; Molina, J.; Privitera, P.; Ramanathan, K.; Sarkis, Y.; Schwarz, T.; Settimo, M.; Sofo Haro, M.; Thomas, R.; Tiffenberg, J.; Tiouchichine, E.; Torres Machado, D.; Trillaud, F.; You, X.; Zhou, J.

    2017-04-05

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30 eV$c^{-2}$ with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter $\\kappa$ is competitive with constraints from solar emission, reaching a minimum value of 2.2$\\times$$10^{-14}$ at 17 eV$c^{-2}$. These results are the most stringent direct detection constraints on hidden-photon dark matter with masses 3-12 eV$c^{-2}$ and the first demonstration of direct experimental sensitivity to ionization signals $<$12 eV from dark matter interactions.

  13. Direct detection of rutin-degrading isozymes with polyacrylamide gel electrophoresis.

    Science.gov (United States)

    Li, Yuping; Deng, Dandan; Zhang, Xuebin; Zhang, Haina; Wang, Cong; Chen, Peng

    2013-12-15

    Rutin-degrading enzymes (RDEs) specifically hydrolyze the glycosidic linkages of rutin, producing quercetin and rutinose. Here we report a reliable and sensitive polyacrylamide gel electrophoresis and staining method for the detection of RDE isozymes, which is based on the aqueous solubility difference between rutin and quercetin, as well as the ultraviolet absorbance of quercetin. With this novel method, we achieved a detection limit of 12 ng with 107 U of RDE activity, enabling us to detect at least five RDE isozymes in tartary buckwheat seeds. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Direct Detection of Hardly Detectable Hidden Chirality of Hydrocarbons and Deuterated Isotopomers by a Helical Polyacetylene through Chiral Amplification and Memory.

    Science.gov (United States)

    Maeda, Katsuhiro; Hirose, Daisuke; Okoshi, Natsuki; Shimomura, Kouhei; Wada, Yuya; Ikai, Tomoyuki; Kanoh, Shigeyoshi; Yashima, Eiji

    2018-03-07

    We report the first direct chirality sensing of a series of chiral hydrocarbons and isotopically chiral compounds (deuterated isotopomers), which are almost impossible to detect by conventional optical spectroscopic methods, by a stereoregular polyacetylene bearing 2,2'-biphenol-derived pendants. The polyacetylene showed a circular dichroism due to a preferred-handed helix formation in response to the hardly detectable hidden chirality of saturated tertiary or chiroptical quaternary hydrocarbons, and deuterated isotopomers. In sharp contrast to the previously reported sensory systems, the chirality detection by the polyacetylene relies on an excess one-handed helix formation induced by the chiral hydrocarbons and deuterated isotopomers via significant amplification of the chirality followed by its static memory, through which chiral information on the minute and hidden chirality can be stored as an excess of a single-handed helix memory for a long time.

  15. Direct detection of near-surface faults by migration of back-scattered surface waves

    KAUST Repository

    Yu, Han; Guo, Bowen; Hanafy, Sherif; Lin, Fan-Chi; Schuster, Gerard T.

    2014-01-01

    We show that diffraction stack migration can be used to estimate the distribution of near-surface faults. The assumption is that near-surface faults generate detectable back-scattered surface waves from impinging surface waves. The processing steps

  16. Machine Learning Techniques for Optical Performance Monitoring from Directly Detected PDM-QAM Signals

    DEFF Research Database (Denmark)

    Thrane, Jakob; Wass, Jesper; Piels, Molly

    2017-01-01

    Linear signal processing algorithms are effective in dealing with linear transmission channel and linear signal detection, while the nonlinear signal processing algorithms, from the machine learning community, are effective in dealing with nonlinear transmission channel and nonlinear signal...... detection. In this paper, a brief overview of the various machine learning methods and their application in optical communication is presented and discussed. Moreover, supervised machine learning methods, such as neural networks and support vector machine, are experimentally demonstrated for in-band optical...

  17. A surface plasmon resonance biosensor for direct detection of the rabies virus

    Directory of Open Access Journals (Sweden)

    Jing Xu

    2012-01-01

    Full Text Available A surface plasmon resonance biosensor chip was constructed for detection of rabies virus. For the construction of the biosensor chip, N protein specific antibody and N protein specific antibody combined with G protein specific antibody of rabies virus were linked on two different flow cells on one CM5 chip, respectively. The chip was tested for the detection of rabies virus antigens using the crude extract of rabies virus from infected BHK cell strain culture. Tenfold serial dilutions of SRV9 strain virus-infected cell cultures were tested by the biosensor chip to establish the detection limit. The limit detection was approximately 70 pg/ml of nucleoprotein and glycoprotein. The biosensor chip developed in this study was employed for the detection of rabies virus in five suspect infectious specimens of brain tissue from guinea pigs; the results were compared by fluorescent antibody test. Surface plasmon resonance biosensor chip could be a useful automatic tool for prompt detection of rabies virus infection.

  18. Radiative corrections for the direct detection of neutralino dark matter and its relic density

    Energy Technology Data Exchange (ETDEWEB)

    Steppeler, Patrick Norbert

    2016-07-01

    In this thesis we calculate supersymmetric one-loop corrections of the strong interaction to elastic neutralino-nucleon scattering. The calculation is described in detail and performed in full generality within the Minimal Supersymmetric Standard Model (MSSM). In order to benefit from the well-established tensor reduction method, we have to stabilise the latter for vanishing Gram determinants. Afterwards the radiative corrections are matched onto an effective field theory based on the scalar operator anti χχ anti qq and the axial-vector operator anti χγ{sub 5}γ{sub μ}χ anti qγ{sub 5}γ{sup μ}q. This matching procedure is performed at the high scale μ{sub high}∝1000 GeV, whereas the associated nuclear matrix elements are defined at the low scale μ{sub low}∝5 GeV. To link both scales, the running of the effective operators and their corresponding Wilson coefficients is taken into account via renormalisation group equations. The lightest neutralino can be considered as a canonical example for a weakly interacting, massive particle which could constitute dark matter. To verify the existence of such particles, so-called direct detection experiments are conducted currently. These are based on the interaction between dark matter and nucleons. The leading contributions to the spin-independent and spin-dependent neutralino-nucleon cross sections are governed by the effective operators mentioned above, respectively. The calculation of the associated radiative corrections corresponds to a reduction of the theoretical uncertainty and permits to identify neutralino properties more reliably in case of positive findings and to set more robust exclusion bounds in case of negative findings. Furthermore, we calculate radiative corrections to annihilation and coannihilation processes of gauginos into quarks, where we focus again on supersymmetric one-loop corrections of the strong interaction. These processes contribute dominantly to the (co)annihilation cross section

  19. Direct and indirect singlet scalar dark matter detection in the lepton-specific two-Higgs-doublet model

    International Nuclear Information System (INIS)

    Boucenna, M. S.; Profumo, S.

    2011-01-01

    A recent study of gamma-ray data from the Galactic center motivates the investigation of light (∼7-10 GeV) particle dark matter models featuring tau-lepton pairs as dominant annihilation final state. The lepton-specific two-Higgs-doublet model provides a natural framework where light, singlet scalar dark matter can pair-annihilate dominantly into tau leptons. We calculate the nucleon-dark matter cross section for singlet scalar dark matter within the lepton-specific two-Higgs-doublet model framework, and compare with recent results from direct detection experiments. We study how direct dark matter searches can be used to constrain the dark matter interpretation of gamma-ray observations, for different dominant annihilation final states. We show that models exist with the correct thermal relic abundance that could fit the claimed gamma-ray excess from the Galactic center region and have direct detection cross sections of the order of what is needed to interpret recent anomalous events reported by direct detection experiments.

  20. Accelerating object detection via a visual-feature-directed search cascade: algorithm and field programmable gate array implementation

    Science.gov (United States)

    Kyrkou, Christos; Theocharides, Theocharis

    2016-07-01

    Object detection is a major step in several computer vision applications and a requirement for most smart camera systems. Recent advances in hardware acceleration for real-time object detection feature extensive use of reconfigurable hardware [field programmable gate arrays (FPGAs)], and relevant research has produced quite fascinating results, in both the accuracy of the detection algorithms as well as the performance in terms of frames per second (fps) for use in embedded smart camera systems. Detecting objects in images, however, is a daunting task and often involves hardware-inefficient steps, both in terms of the datapath design and in terms of input/output and memory access patterns. We present how a visual-feature-directed search cascade composed of motion detection, depth computation, and edge detection, can have a significant impact in reducing the data that needs to be examined by the classification engine for the presence of an object of interest. Experimental results on a Spartan 6 FPGA platform for face detection indicate data search reduction of up to 95%, which results in the system being able to process up to 50 1024×768 pixels images per second with a significantly reduced number of false positives.

  1. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  2. Radiation-induced germ-line mutations detected by a direct comparison of parents and children DNA sequences containing SNPs

    International Nuclear Information System (INIS)

    Morimyo, M.; Hongo, E.; Higashi, T.; Wu, J.; Matsumoto, I.; Okamoto, M.; Kawano, A.; Tsuji, S.

    2003-01-01

    Full text: Germ-line mutation is detected in mice but not in humans. To estimate genetic risk of humans, a new approach to extrapolate from animal data to humans or to directly detect radiation-induced mutations in man is expected. We have developed a new method to detect germ-line mutations by directly comparing DNA sequences of parents and children. The nucleotide sequences among mouse strains are almost identical except SNP markers that are detected at 1/1000 frequency. When gamma-irradiated male mice are mated with female mice, heterogeneous nucleotide sequences induced in children DNA are a candidate of mutation, whose assignment can be done by SNP analysis. This system can easily detect all types of mutations such as transition, transversion, frameshift and deletion induced by radiation and can be applied to humans having genetically heterogeneous nucleotide sequences and many SNP markers. C3H male mice of 8 weeks of gestation were irradiated with gamma rays of 3 and 1 Gy and after 3 weeks, they were mated with the same aged C57BL female mice. After 3 weeks breeding, DNA was extracted from parents and children mice. The nucleotide sequences of 150 STS markers containing 300-900 bp and SNPs of parents and children DNA were determined by a direct sequencing; amplification of STS markers by Taq DNA polymerase, purification of PCR products, and DNA sequencing with a dye-terminator method. At each radiation dose, a total amount of 5 Mb DNA sequences were examined to detect radiation-induced mutations. We could find 6 deletions in 3 Gy irradiated mice but not in 1 Gy and control mice. The mutation frequency was about 4.0 x 10 -7 /bp/ Gy or 1.6 x 10 -4 /locus/Gy, and suggested the non-linear increase of mutation rate with dose

  3. Direct Detection of the Close Companion of Polaris With the Hubble Space Telescope

    National Research Council Canada - National Science Library

    Evans, Nancy R; Schaefer, Gail H; Bond, Howard E; Bono, Giuseppe; Karovska, Margarita; Nelan, Edmund; Sasselov, Dimitar D; Mason6, Brian D

    2008-01-01

    ... 1.04 yr later confirms orbital motion in a retrograde direction. By combining our two measures with the spectroscopic orbit of Kamper and an analysis of the Hipparcos and FK5 proper motions by Wielen et al...

  4. Criegee Intermediates: What Direct Production and Detection Can Teach Us About Reactions of Carbonyl Oxides

    Science.gov (United States)

    Taatjes, Craig A.

    2017-05-01

    The carbonyl oxide intermediates in the ozonolysis of alkenes, often known as Criegee intermediates, are potentially important reactants in Earth's atmosphere. For decades, careful analysis of ozonolysis systems was employed to derive an understanding of the formation and reactions of these species. Recently it has proved possible to synthesize at least some of these intermediates separately from ozonolysis, and hence to measure their reaction kinetics directly. Direct measurements have allowed new or more detailed understanding of each type of gas-phase reaction that carbonyl oxides undergo, often acting as a complement to highly detailed ozonolysis experiments. Moreover, the use of direct characterization methods to validate increasingly accurate theoretical investigations can enhance their impact well beyond the set of specific reactions that have been measured. Reactions that initiate particles or fuel their growth could be a new frontier for direct measurements of Criegee intermediate chemistry.

  5. Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments.

    Science.gov (United States)

    Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K

    2014-03-01

    Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

  6. Consistency of direct microscopic examination and ELISA in detection of Giardia in stool specimen among children

    Directory of Open Access Journals (Sweden)

    Zohreh Torabi

    2014-09-01

    Full Text Available Objective: To investigate the consistency of direct microscopic examination and ELISA for determination of Giadia in stool specimen. Method: Study population consisted of children with any clinical symptoms of Giardia infestation since last two weeks. Fresh stool specimen was collected from each child. The stools specimens were assessed by two methods of direct microscopic examination and ELISA.The degree of agreement between direct stool exam and ELISA was calculated by Cohen's kappa coefficient. Results: In this study, 124 children with age range 2-12 years were investigated. A total of 64 (61.7% and 79 (65.7% of children had Giardia by direct stool exam and ELISA test respectively. There was association between frequency of constipation and Giardia infection (P=0.036. The Cohen's kappa coefficient calculated for degree of agreement between direct stool exam and ELISA showed κ=0.756 (P<0.001. Conclusions: The frequency of Giardia infection in symptomatic children was high and there was high agreement rate between ELISA and direct stool smear.

  7. Direct and label-free detection of the human growth hormone in urine by an ultrasensitive bimodal waveguide biosensor.

    Science.gov (United States)

    González-Guerrero, Ana Belén; Maldonado, Jesús; Dante, Stefania; Grajales, Daniel; Lechuga, Laura M

    2017-01-01

    A label-free interferometric transducer showing a theoretical detection limit for homogeneous sensing of 5 × 10 -8 RIU, being equivalent to a protein mass coverage resolution of 2.8 fg mm -2 , is used to develop a high sensitive biosensor for protein detection. The extreme sensitivity of this transducer combined with a selective bioreceptor layer enables the direct evaluation of the human growth hormone (hGH) in undiluted urine matrix in the 10 pg mL -1 range. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Correction factor to determine total hydrogen+deuterium concentration obtained by inert gas fusion-thermal conductivity detection (IGF- TCD) technique

    International Nuclear Information System (INIS)

    Ramakumar, K.L.; Sesha Sayi, Y.; Shankaran, P.S.; Chhapru, G.C; Yadav, C.S.; Venugopal, V.

    2004-01-01

    The limitation of commercially available dedicated equipment based on Inert Gas Fusion- Thermal Conductivity Detection (IGF - TCD) for the determination of hydrogen+deuterium is described. For a given molar concentration, deuterium is underestimated vis a vis hydrogen because of lower thermal conductivity and not considering its molecular weight in calculations. An empirical correction factor based on the differences between the thermal conductivities of hydrogen, deuterium and the carrier gas argon, and the mole fraction of deuterium in the sample has been derived to correct the observed hydrogen+deuterium concentration. The corrected results obtained by IGF - TCD technique have been validated by determining hydrogen and deuterium contents in a few samples using an independent method based on hot vacuum extraction-quadrupole mass spectrometry (HVE-QMS). Knowledge of mole fraction of deuterium (XD) is necessary to effect the correction. The correction becomes insignificant at low X D values (XD < 0.2) as the precision in the IGF measurements is comparable with the extent of correction. (author)

  9. Utility of Direct Fluorescent Antibody Test for detection of Chlamydia trachomatis and its detection in male patients with non gonococcal urethritis in New Delhi

    Directory of Open Access Journals (Sweden)

    Agrawal S

    2003-03-01

    Full Text Available The purpose of this study was assessment of prevalence of Chlamydia trachomatis and utility of Direct Fluorescent Antibody (DFA test for its detection in male patients with non gonococcal urethritis in New Delhi , India Thirty male patients with symptoms of dysuria showing polymorphs in their gram stained urethral smears with no evidence of Neisseria gonorrhoeae, and negative for Trichomonas vaginalis and Candida albicans by wet mount were subjected to DFA test for detection of C. trachomatis in urethral samples. Microscopic examination of gram stained urethral smears revealed 5-7 polymorphs / HPF in 90% of the patients. Evidence of C. trachomatis with DFA (MicroTrak was detected in 11 cases (36.67% when a cut off of 10 elementary bodies was considered essential. It is concluded that C. trachomatis is an important cause of non gonococcal urethritis in male patients in New Delhi and DFA test is a useful diagnostic tool in its detection. Where facilities are not available for its detection antichlamydial therapy should be recommended emperically.

  10. ED-XRF spectrometry-based trace element composition of genetically engineered rhizoclones vis-a-vis natural roots of a multi-medicinal plant, butterfly pea (Clitoria ternatea L.)

    International Nuclear Information System (INIS)

    Swain, S.S.; Chand, P.K.

    2012-01-01

    The energy dispersive X-ray fluorescence set-up incorporating a molybdenum secondary exciter was used for quantitative determination of major and minor elements in genetically transformed root somaclones (rhizoclones) of butterfly pea (Clitoria ternatea L.) which had been established via explant co-cultivation with Agrobacterium rhizogenes. The multi-elemental composition of these transformed rhizoclones was compared with that of the naturally grown in vivo donor plant. Trace elements namely Cr, Mn, Fe, Co, Ni, Cu, Zn, Se, Rb, Sr and Pb in addition to two macro-elements K and Ca were identified and quantified in root tissues of both sources. The elemental content of transformed root cultures was found to be at par with that of the natural roots of in vivo grown plants of the same species. These findings are implicated on the context of utilization of such Agrobacterium-mediated genetically transformed root cultures as a viable alternative to natural roots, the former being a fast-proliferating renewable resource of medicinally useful minerals essential for designing of effective drugs, besides providing an ex situ means for plant conservation. (author)

  11. Elements of comparison between different inert matrix fuels towards plutonium use and safety coefficients; Elements de comparaison de differentes matrices inertes vis a vis de l'utilisation du plutonium et des coefficients de surete

    Energy Technology Data Exchange (ETDEWEB)

    Baldi, St.; Porta, J. [CEA Cadarache, Dept. d' Etudes des Reacteurs, 13 - Saint-Paul-lez-Durance (France)

    2000-08-01

    This work deals with the CERMET fuels, chosen for their good behaviour under irradiation and their high thermal conductivity. The kinetic coefficients have been particularly studied. Comparisons have been made with other solutions using other composite fuels in particular the solid solutions and the ROX solution. The core control requiring an heterogeneous assembly, we propose an assembly whose characteristics are compared with those of the APA reference. (O.M.)

  12. Investigation of actinides speciation within the presence of ligands of interest for decorporation; Etude de la speciation des actinides vis-a-vis de ligands d'interet pour la decorporation

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, L

    2008-01-15

    Data about the behaviour of actinides in biological media are required in order to investigate their decorporation. Those data are obtained through in vivo experiments and the study of chemical speciation of actinides within the presence of biological constituents. A part of this work consists in the development of a method leading to the determination of the speciation of actinides at the oxidation state +IV within the presence of a complexing species, as well as its structure. The method was applied to two types of ligands: 1) a constituent of blood plasma: the citrate anion. The various complexes formed were investigated and their formation constants were quantified. The coordination mode of the ligand was then clarified through a structural study of the complexes, underlining the role of only one carboxylic site and of the alcohol function. 2) chelating agents used for decorporation. The formation constants of complexes of An(IV) with NTA and DTPA were determined. The coordination number of the metallic cation in those complexes as well as the role of the nitrogen atom were proved. Lastly, the behaviour of Pu(IV) within the presence of LIHOPO was investigated. This chelating agent, more efficient than DTPA in the case of in vivo decorporation of Np, forms very stable complexes with the metallic cation. One of those complexes can be assumed to present a stoichiometry 2:3. (author)

  13. The biological treatment of the wastes facing the greenhouse effect and the climatic change; Les traitements biologiques des dechets vis-a-vis de l'effet de serre et du changement climatique

    Energy Technology Data Exchange (ETDEWEB)

    Adler, E

    2007-07-01

    The weight of the wastes treatment in the accounting of the greenhouse gases production is really poor: 1 to 2% of the CO{sub 2} and NO{sub 2} emissions. The aim of this paper is to qualify and quantify the interest of biological solutions for the treatment of domestic wastes and sludges. (A.L.B.)

  14. Contribution to the study of the reactivity of graphite with respect to carbon dioxide and air; Contribution a l'etude de la reactivite du graphite vis-a-vis du gaz corbonique et de l'air

    Energy Technology Data Exchange (ETDEWEB)

    Jacquet, M [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1959-09-15

    The oxidation of nuclear-quality graphite by air and carbon dioxide has been studied at temperatures at which the reaction becomes measurable. These experiments have been carried out on graphites differing in the concentration and nature of their ash, and in their mode of preparation. The reaction velocities measured have been compared in an attempt to correlate these two factors. Ten types of graphite have thus been studied. Since the oxidation reactions are of the type gas-solid, their velocities have also been compared to the BET surface areas of the graphite studied and to the diameter distribution of the pores of this surface. The conclusion is that, even for these low impurity contents, the law relating the reaction velocity to the surface is masked by the impurities which appear to behave as preferential reaction sites. This has been shown by carrying out successive purifications on various types of graphite, which treatment results in an important decrease in the reactivity of all the samples studied. (author) [French] On a etudie l'oxydation de graphites de qualites nucleaires par l'air et par le gaz carbonique, a des temperatures telles que la reaction commence a etre mesurable. Ces essais ont porte sur des graphites differents aux points de vue de la concentration et de la nature des cendres, et differents par le mode de preparation. Les vitesses de reaction mesurees ont ete comparees afin de tenter de les relier a ces deux facteurs. Dix qualites de graphite ont ainsi ete etudiees. Les reactions d'oxydation etant des reactions gaz-solide, les vitesses ont ete egalement comparees aux surfaces specifiques B.E.T. des echantillons de graphite etudies et a la repartition par diametres des pores de cette surface. La conclusion est que, meme a ces teneurs faibles en impuretes, la loi de variation de la vitesse de reaction en fonction de la surface est masquee par les impuretes qui paraissent jouer le role de sites privilegies de reaction comme l'ont montre les purifications successives auxquelles diverses qualites de graphite ont ete soumises, traitement accompagne pour tous les echantillons d'une notable diminution de la reactivite. (auteur)

  15. Reflection on the efficiency criteria for a long duration disposal with respect to temporary abandonment situations; Reflexion sur les criteres de performance d'un entreposage de longue duree (ELD) vis-a-vis des situations de delaissement temporaire

    Energy Technology Data Exchange (ETDEWEB)

    Heriard-Dubreuil, G; Gadbois, S [Mutadis, 75 - Paris (France); Chieber, C; Schneider, Th [Centre d' Etude sur l' Evaluation de la Protection dans le Domaine Nucleaire, 92 - Fontenay aux Roses (France)

    2002-08-15

    A study carried out by Mutadis and CEPN, on request of the CEA, aimed at supplying some elements allowing to elaborate some performance criteria for a long-term management system in front of situations of temporary abandonment of radioactive waste disposal facilities. The first part of the study has been the identification of case studies illustrating situations of loss of maintenance or temporary abandonment. The second phase has been the selection and analysis of 4 case studies (the ancient underground cavities in Ile-de-France, the regulation relative to new underground quarries, the abandoned mines in Loraine basin, and Unesco's approach for the protection of mankind world patrimony). These cases have been analysed with respect to various aspects: actors involved, construction management and memory preservation, liabilities in time and space, prevention means, scheduling, and resumption strategies. The concepts of abandonment, scheduling and resumption have been precised and analysed in a third part according to the case studies. Three goals - avoiding abandonment, encouraging scheduling and resumption - and eight characteristics are drawn from this analysis, which are indicators of the robustness of the system implemented to fulfill these 3 goals. These characteristics appear as strongly interdependent. (J.S.)

  16. Reflection on the efficiency criteria for a long duration disposal with respect to temporary abandonment situations; Reflexion sur les criteres de performance d'un entreposage de longue duree (ELD) vis-a-vis des situations de delaissement temporaire

    Energy Technology Data Exchange (ETDEWEB)

    Heriard-Dubreuil, G.; Gadbois, S. [Mutadis, 75 - Paris (France); Chieber, C.; Schneider, Th. [Centre d' Etude sur l' Evaluation de la Protection dans le Domaine Nucleaire, 92 - Fontenay aux Roses (France)

    2002-08-15

    A study carried out by Mutadis and CEPN, on request of the CEA, aimed at supplying some elements allowing to elaborate some performance criteria for a long-term management system in front of situations of temporary abandonment of radioactive waste disposal facilities. The first part of the study has been the identification of case studies illustrating situations of loss of maintenance or temporary abandonment. The second phase has been the selection and analysis of 4 case studies (the ancient underground cavities in Ile-de-France, the regulation relative to new underground quarries, the abandoned mines in Loraine basin, and Unesco's approach for the protection of mankind world patrimony). These cases have been analysed with respect to various aspects: actors involved, construction management and memory preservation, liabilities in time and space, prevention means, scheduling, and resumption strategies. The concepts of abandonment, scheduling and resumption have been precised and analysed in a third part according to the case studies. Three goals - avoiding abandonment, encouraging scheduling and resumption - and eight characteristics are drawn from this analysis, which are indicators of the robustness of the system implemented to fulfill these 3 goals. These characteristics appear as strongly interdependent. (J.S.)

  17. Creative Art and Cinematographic Production Vis-a-Vis the State in Europe. International Colloquy Organised by the European Art and Experimental Cinema Association in Collaboration with the Council of Europe. Cultural Policy Studies Series 3.

    Science.gov (United States)

    Lescure, Jean; Degand, Claude

    Various aspects of the role of the state in fostering creative art and cinematography are discussed in the two reports presented in this volume. In "The Role of the Market in the Relation Between the State and Cinematographic Creation" Jean Lescure emphasizes that this relationship should be viewed as one of complicity rather than…

  18. Proximal surface caries detection with direct-exposure and rare earth screen/film imaging

    International Nuclear Information System (INIS)

    Lundeen, R.C.; McDavid, W.D.; Barnwell, G.M.

    1988-01-01

    This laboratory study compared five imaging systems for their diagnostic accuracy in detection of proximal surface dental caries. Ten viewers provided data on radiographic detectability of carious lesions. The diagnostic accuracy of each system was determined with receiver operating characteristic (ROC) curves by comparing viewer data with the true state of the teeth as determined microscopically. D-speed film marginally outperformed the other four systems, but the three screen/film systems matched the diagnostic accuracy of E-speed film. Radiation reductions between 62% and 92% were achieved with the screen/film systems when compared to the two conventional dental films. The feasibility of designing a screen/film bite-wing cassette was shown, but the poor diagnostic accuracy of the present bite-wing system indicated a need for a new technology in caries detection

  19. Optofluidic analysis system for amplification-free, direct detection of Ebola infection

    Science.gov (United States)

    Cai, H.; Parks, J. W.; Wall, T. A.; Stott, M. A.; Stambaugh, A.; Alfson, K.; Griffiths, A.; Mathies, R. A.; Carrion, R.; Patterson, J. L.; Hawkins, A. R.; Schmidt, H.

    2015-09-01

    The massive outbreak of highly lethal Ebola hemorrhagic fever in West Africa illustrates the urgent need for diagnostic instruments that can identify and quantify infections rapidly, accurately, and with low complexity. Here, we report on-chip sample preparation, amplification-free detection and quantification of Ebola virus on clinical samples using hybrid optofluidic integration. Sample preparation and target preconcentration are implemented on a PDMS-based microfluidic chip (automaton), followed by single nucleic acid fluorescence detection in liquid-core optical waveguides on a silicon chip in under ten minutes. We demonstrate excellent specificity, a limit of detection of 0.2 pfu/mL and a dynamic range of thirteen orders of magnitude, far outperforming other amplification-free methods. This chip-scale approach and reduced complexity compared to gold standard RT-PCR methods is ideal for portable instruments that can provide immediate diagnosis and continued monitoring of infectious diseases at the point-of-care.

  20. Prospects for direct detection of inflationary gravitational waves by next generation interferometric detectors

    International Nuclear Information System (INIS)

    Kuroyanagi, Sachiko; Chiba, Takeshi; Sugiyama, Naoshi

    2011-01-01

    We study the potential impact of detecting the inflationary gravitational wave background by the future space-based gravitational wave detectors, such as DECIGO and BBO. The signal-to-noise ratio of each experiment is calculated for chaotic/natural/hybrid inflation models by using the precise predictions of the gravitational wave spectrum based on numerical calculations. We investigate the dependence of each inflation model on the reheating temperature which influences the amplitude and shape of the spectrum, and find that the gravitational waves could be detected for chaotic/natural inflation models with high reheating temperature. From the detection of the gravitational waves, a lower bound on the reheating temperature could be obtained. The implications of this lower bound on the reheating temperature for particle physics are also discussed.

  1. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  2. "Salvage microbiology": detection of bacteria directly from clinical specimens following initiation of antimicrobial treatment.

    Directory of Open Access Journals (Sweden)

    John J Farrell

    Full Text Available PCR coupled with electrospray ionization mass spectrometry (ESI-MS is a diagnostic approach that has demonstrated the capacity to detect pathogenic organisms from culture negative clinical samples after antibiotic treatment has been initiated. [1] We describe the application of PCR/ESI-MS for detection of bacteria in original patient specimens that were obtained after administration of antibiotic treatment in an open investigation analysis.We prospectively identified cases of suspected bacterial infection in which cultures were not obtained until after the initiation of antimicrobial treatment. PCR/ESI-MS was performed on 76 clinical specimens that were submitted for conventional microbiology testing from 47 patients receiving antimicrobial treatment.In our series, 72% (55/76 of cultures obtained following initiation of antimicrobial treatment were non-diagnostic (45 negative cultures; and 10 respiratory specimens with normal flora (5, yeast (4, or coagulase-negative staphylococcus (1. PCR/ESR-MS detected organisms in 83% (39/47 of cases and 76% (58/76 of the specimens. Bacterial pathogens were detected by PCR/ESI-MS in 60% (27/45 of the specimens in which cultures were negative. Notably, in two cases of relapse of prosthetic knee infections in patients on chronic suppressive antibiotics, the previous organism was not recovered in tissue cultures taken during extraction of the infected knee prostheses, but was detected by PCR/ESI-MS.Molecular methods that rely on nucleic acid amplification may offer a unique advantage in the detection of pathogens collected after initiation of antimicrobial treatment and may provide an opportunity to target antimicrobial therapy and "salvage" both individual treatment regimens as well as, in select cases, institutional antimicrobial stewardship efforts.

  3. Direct radioimmunoassay for the detection of barbiturates in blood and urine

    International Nuclear Information System (INIS)

    Mason, P.A.; Law, B.; Pocock, K.; Moffat, A.C.

    1982-01-01

    A radioimmunoassay has been developed for the detection of barbiturates in blood and urine without any pre-treatment of the sample. It is based on a radioiodinated derivative of 4-hydroxyphenobarbitone which allows use of relatively simple gamma-counting procedures. The assay can detect therapeutic levels of barbiturates in very small amounts (50 μl) of blood and urine samples. It is cheap, rapid, simple to perform and is broadly specific for the barbiturate class of drugs to the exclusion of related drugs. The assay is, therefore, very well suited to the task of screening large numbers of samples for the presence of barbiturates. (author)

  4. Preliminary evaluation of second harmonic direct detection scheme for low-dose range in alanine/EPR dosimetry

    International Nuclear Information System (INIS)

    Chen, Felipe; Graeff, Carlos F.O.; Baffa, Oswaldo

    2002-01-01

    The usefulness of a direct detection scheme of the second harmonic (2h) overmodulated signal from irradiated alanine in EPR dosimetry was studied. For this purpose, a group of DL-alanine/paraffin cylindrical pellets was produced. The dosimeters were irradiated with a 60 Co radiotherapy gamma source with doses of 0.05, 0.1, 0.5, 1 and 5 Gy. The EPR measurements were carried out in a VARIAN-E4 spectrometer operating in X-band with optimized parameters to obtain highest amplitude signals of both harmonics. The 2h signal was detected directly at twice the modulation frequency. In preliminary results, the 2h showed some advantages over the 1h such as better resolution for doses below 1 Gy, better repeatability results and better linear behaviour in the dose range indicated. (author)

  5. Getting the astrophysics and particle physics of dark matter out of next-generation direct detection experiments

    International Nuclear Information System (INIS)

    Peter, Annika H. G.

    2010-01-01

    The next decade will bring massive new data sets from experiments of the direct detection of weakly interacting massive particle dark matter. Mapping the data sets to the particle-physics properties of dark matter is complicated not only by the considerable uncertainties in the dark-matter model, but by its poorly constrained local distribution function (the 'astrophysics' of dark matter). I propose a shift in how to think about direct-detection data analysis. I show that by treating the astrophysical and particle-physics uncertainties of dark matter on equal footing, and by incorporating a combination of data sets into the analysis, one may recover both the particle physics and astrophysics of dark matter. Not only does such an approach yield more accurate estimates of dark-matter properties, but it may illuminate how dark matter coevolves with galaxies.

  6. Directional Pair-Production Spectrometer Design for Airborne Stand-Off Detection of Special Nuclear Material

    Science.gov (United States)

    2011-03-01

    detectors arranged as shown in Figure 5. When the incoming gamma deposits its energy in the central detector, the resulting positron annihilates ...Compton detectors. Each pair of detectors can accomplish both spectroscopy and detection through application of energy filtering. The detectors are...electron- positron annihilation have three other detectors to interact with. Coincident techniques are used to provide real-time determination of

  7. Evaluation of the usefulness of smartphone-directed applications for measuring heart rate and arrhythmia detection

    Directory of Open Access Journals (Sweden)

    Michał Witkowski

    2017-12-01

    Conclusions: The majority of the free applications, available for smartphones, are able to measure HR precisely in patients with sinus rhythm, while in patients with AF, the exact measurement is significantly impeded by HR deficits. Only one out of 16 applications was able to measure HR in a patient with AF. None of the available applications could detect AF.

  8. Noise equalization for detection of microcalcification clusters in direct digital mammogram images.

    NARCIS (Netherlands)

    McLoughlin, K.J.; Bones, P.J.; Karssemeijer, N.

    2004-01-01

    Equalizing image noise is shown to be an important step in the automatic detection of microcalcifications in digital mammography. This study extends a well established film-screen noise equalization scheme developed by Veldkamp et al. for application to full-field digital mammogram (FFDM) images. A

  9. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  10. Ternary monolayers as DNA recognition interfaces for direct and sensitive electrochemical detection in untreated clinical samples

    Czech Academy of Sciences Publication Activity Database

    Campuzano, S.; Kuralay, F.; Lobo-Castanón, M.J.; Bartošík, Martin; Vyavahare, K.; Paleček, Emil; Haake, D.A.; Wang, J.

    2011-01-01

    Roč. 26, č. 8 (2011), s. 3577-3583 ISSN 0956-5663 R&D Projects: GA MŠk(CZ) ME09038 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : electrochemical detection * DNA hybridization * self-assembled monolayer Subject RIV: BO - Biophysics Impact factor: 5.602, year: 2011

  11. Direct protein detection with a nano-interdigitated array gate MOSFET.

    Science.gov (United States)

    Tang, Xiaohui; Jonas, Alain M; Nysten, Bernard; Demoustier-Champagne, Sophie; Blondeau, Franoise; Prévot, Pierre-Paul; Pampin, Rémi; Godfroid, Edmond; Iñiguez, Benjamin; Colinge, Jean-Pierre; Raskin, Jean-Pierre; Flandre, Denis; Bayot, Vincent

    2009-08-15

    A new protein sensor is demonstrated by replacing the gate of a metal oxide semiconductor field effect transistor (MOSFET) with a nano-interdigitated array (nIDA). The sensor is able to detect the binding reaction of a typical antibody Ixodes ricinus immunosuppressor (anti-Iris) protein at a concentration lower than 1 ng/ml. The sensor exhibits a high selectivity and reproducible specific detection. We provide a simple model that describes the behavior of the sensor and explains the origin of its high sensitivity. The simulated and experimental results indicate that the drain current of nIDA-gate MOSFET sensor is significantly increased with the successive binding of the thiol layer, Iris and anti-Iris protein layers. It is found that the sensor detection limit can be improved by well optimizing the geometrical parameters of nIDA-gate MOSFET. This nanobiosensor, with real-time and label-free capabilities, can easily be used for the detection of other proteins, DNA, virus and cancer markers. Moreover, an on-chip associated electronics nearby the sensor can be integrated since its fabrication is compatible with complementary metal oxide semiconductor (CMOS) technology.

  12. A Study of Nuclear Recoils in Liquid Argon Time Projection Chamber for the Direct Detection of WIMP Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Huajie [Princeton Univ., NJ (United States)

    2014-11-01

    Robust results of WIMP direct detection experiments depend on rm understandings of nuclear recoils in the detector media. This thesis documents the most comprehensive study to date on nuclear recoils in liquid argon - a strong candidate for the next generation multi-ton scale WIMP detectors. This study investigates both the energy partition from nuclear recoil energy to secondary modes (scintillation and ionization) and the pulse shape characteristics of scintillation from nuclear recoils.

  13. Geometric detection of coupling directions by means of inter-system recurrence networks

    International Nuclear Information System (INIS)

    Feldhoff, Jan H.; Donner, Reik V.; Donges, Jonathan F.; Marwan, Norbert; Kurths, Jürgen

    2012-01-01

    We introduce a geometric method for identifying the coupling direction between two dynamical systems based on a bivariate extension of recurrence network analysis. Global characteristics of the resulting inter-system recurrence networks provide a correct discrimination for weakly coupled Rössler oscillators not yet displaying generalised synchronisation. Investigating two real-world palaeoclimate time series representing the variability of the Asian monsoon over the last 10,000 years, we observe indications for a considerable influence of the Indian summer monsoon on climate in Eastern China rather than vice versa. The proposed approach can be directly extended to studying K>2 coupled subsystems.

  14. Use of Directional Spectra for Detection of Engine Cylinder Power Fault

    Directory of Open Access Journals (Sweden)

    Chong-Won Lee

    1997-01-01

    Full Text Available A diagnostic method, which uses the two-sided directional power spectra of complex-valued engine vibration signals, is presented and tested with four-cylinder compression and spark ignition engines for the diagnosis of cylinder power faults. As spectral estimators, the maximum likelihood and FFT methods are compared, and the multi-layer neural network is employed for pattern recognition. Experimental results show that the success rate for identifying the misfired cylinder is much higher with the use of two-sided directional power spectra than conventional one-sided power spectra.

  15. INS/EKF-based stride length, height and direction intent detection for walking assistance robots.

    Science.gov (United States)

    Brescianini, Dario; Jung, Jun-Young; Jang, In-Hun; Park, Hyun Sub; Riener, Robert

    2011-01-01

    We propose an algorithm used to obtain the information on stride length, height difference, and direction based on user's intent during walking. For exoskeleton robots used to assist paraplegic patients' walking, this information is used to generate gait patterns by themselves in on-line. To obtain this information, we attach an inertial measurement unit(IMU) on crutches and apply an extended kalman filter-based error correction method to reduce the phenomena of drift due to bias of the IMU. The proposed method is verifed in real walking scenarios including walking, climbing up-stairs, and changing direction of walking with normal. © 2011 IEEE

  16. Dual-focus Magnification, High-Definition Endoscopy Improves Pathology Detection in Direct-to-Test Diagnostic Upper Gastrointestinal Endoscopy.

    Science.gov (United States)

    Bond, Ashley; Burkitt, Michael D; Cox, Trevor; Smart, Howard L; Probert, Chris; Haslam, Neil; Sarkar, Sanchoy

    2017-03-01

    In the UK, the majority of diagnostic upper gastrointestinal (UGI) endoscopies are a result of direct-to-test referral from the primary care physician. The diagnostic yield of these tests is relatively low, and the burden high on endoscopy services. Dual-focus magnification, high-definition endoscopy is expected to improve detection and classification of UGI mucosal lesions and also help minimize biopsies by allowing better targeting. This is a retrospective study of patients attending for direct-to-test UGI endoscopy from January 2015 to June 2015. The primary outcome of interest was the identification of significant pathology. Detection of significant pathology was modelled using logistic regression. 500 procedures were included. The mean age of patients was 61.5 (±15.6) years; 60.8% of patients were female. Ninety-four gastroscopies were performed using dual-focus magnification high-definition endoscopy. Increasing age, male gender, type of endoscope, and type of operator were all identified as significant factors influencing the odds of detecting significant mucosal pathology. Use of dual-focus magnification, high-definition endoscopy was associated with an odds ratio of 1.87 (95%CI 1.11-3.12) favouring the detection of significant pathology. Subsequent analysis suggested that the increased detection of pathology during dual-focus magnification, high-definition endoscopy also influenced patient follow-up and led to a 3.0 fold (p=0.04) increase in the proportion of patients entered into an UGI endoscopic surveillance program. Dual-focus magnification, high-definition endoscopy improved the diagnostic yield for significant mucosal pathology in patients referred for direct-to-test endoscopy. If this finding is recapitulated elsewhere it will have substantial impact on the provision of UGI endoscopic services.

  17. MSSM A-funnel and the galactic center excess: prospects for the LHC and direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Freese, Katherine [Nordita (Nordic Institute for Theoretical Physics),KTH Royal Institute of Technology and Stockholm University,Roslagstullsbacken 23, SE-106 91 Stockholm (Sweden); The Oskar Klein Center for Cosmoparticle Physics, AlbaNova University Center,University of Stockholm,10691 Stockholm (Sweden); Michigan Center for Theoretical Physics, Department of Physics, University of Michigan,Ann Arbor, MI 48109 (United States); López, Alejandro [Michigan Center for Theoretical Physics, Department of Physics, University of Michigan,Ann Arbor, MI 48109 (United States); Shah, Nausheen R. [Michigan Center for Theoretical Physics, Department of Physics, University of Michigan,Ann Arbor, MI 48109 (United States); Department of Physics and Astronomy, Wayne State University,Detroit, Michigan 48201 (United States); Shakya, Bibhushan [Michigan Center for Theoretical Physics, Department of Physics, University of Michigan,Ann Arbor, MI 48109 (United States)

    2016-04-11

    The pseudoscalar resonance or “A-funnel' in the Minimal Supersymmetric Standard Model (MSSM) is a widely studied framework for explaining dark matter that can yield interesting indirect detection and collider signals. The well-known Galactic Center excess (GCE) at GeV energies in the gamma ray spectrum, consistent with annihilation of a ≲40 GeV dark matter particle, has more recently been shown to be compatible with significantly heavier masses following reanalysis of the background. In this paper, we explore the LHC and direct detection implications of interpreting the GCE in this extended mass window within the MSSM A-funnel framework. We find that compatibility with relic density, signal strength, collider constraints, and Higgs data can be simultaneously achieved with appropriate parameter choices. The compatible regions give very sharp predictions of 200–600 GeV CP-odd/even Higgs bosons at low tan β at the LHC and spin-independent cross sections ≈10{sup −11} pb at direct detection experiments. Regardless of consistency with the GCE, this study serves as a useful template of the strong correlations between indirect, direct, and LHC signatures of the MSSM A-funnel region.

  18. Electrochemical detection of uric acid using ruthenium-dioxide-coated carbon nanotube directly grown onto Si wafer

    Science.gov (United States)

    Shih, Yi-Ting; Lee, Kuei-Yi; Lin, Chung-Kuang

    2015-12-01

    Carbon nanotubes (CNTs) directly grown onto a Si substrate by thermal chemical vapor deposition were used in uric acid (UA) detection. The process is simple and formation is easy without the need for additional chemical treatments. However, CNTs lack selectivity and sensitivity to UA. To enhance the electrochemical analysis, ruthenium oxide was used as a catalytic mediator in the modification of electrodes. The electrochemical results show that RuO2 nanostructures coated onto CNTs can strengthen the UA signal. The peak currents of RuO2 nanostructures coated onto CNTs linearly increase with increasing UA concentration, meaning that they can work as electrodes for UA detection. The lowest detection limit and highest sensitivity were 55 nM and 4.36 µA/µM, respectively. Moreover, the characteristics of RuO2 nanostructures coated onto CNTs were examined by scanning electron microscopy, transmission electron microscopy, and Raman spectroscopy.

  19. Determination of ammonium in river water and sewage samples by capillary zone electrophoresis with direct UV detection.

    Science.gov (United States)

    Fukushi, Keiichi; Ito, Hideyuki; Kimura, Kenichi; Yokota, Kuriko; Saito, Keiitsu; Chayama, Kenji; Takeda, Sahori; Wakida, Shin-ichi

    2006-02-17

    We developed capillary zone electrophoresis (CZE) with direct UV detection for determination of ammonium in environmental water samples. Ammonium in the samples was partly converted into ammonia in the alkaline background electrolyte (BGE) during migration and was detected by molecular absorption of ammonia at 190 nm in approximately 7 min. The limit of detection (LOD) for ammonium was 0.24 mg/l (as nitrogen) at a signal-to-noise ratio of three. The respective values of the relative standard deviation (RSD) of peak area, peak height, and migration time for ammonium were 2.1, 1.8, and 0.46%. Major alkali and alkaline earth metal ions coexisting in the samples did not interfere with ammonium determination by the proposed method. The proposed method determined ammonium in surface water and sewage samples. The results were compared to those obtained using ion chromatography (IC).

  20. Rapid low dose electron tomography using a direct electron detection camera

    NARCIS (Netherlands)

    V. Migunov (Vadim); H. Ryll; X. Zhuge (Jason); M. Simson; L. Strüder; K.J. Batenburg (Joost); L. Houben; R.E. Dunin-Borkowski (Rafal)

    2015-01-01

    htmlabstractWe demonstrate the ability to record a tomographic tilt series containing 3487 images in only 3.5 s by using a direct electron detector in a transmission electron microscope. The electron dose is lower by at least one order of magnitude when compared with that used to record a

  1. Exploiting direct and indirect methods for the detection of the total carotenoid content in dried pasta

    NARCIS (Netherlands)

    Doka, O.; Bicanic, D.D.; Végvári, G.; Buijnsters, J.G.; Spruijt, R.B.; Luterotti, S.

    2010-01-01

    The total carotenoid concentration (TCC) of several commercially available dried pastas prepared with or without eggs was assessed by means of the two well-established destructive approaches [spectrophotometry (SP) and high-performance liquid chromatography (HPLC)] and three non-destructive, direct

  2. Automatic Detection of Cortical Arousals in Sleep using Bi-direction LSTM Networks

    DEFF Research Database (Denmark)

    Brink-Kjaer, A.; Olesen, Alexander Neergaard; Jespersen, C. A.

    2018-01-01

    ) and chin electromyography (EMG) to compute a probability of arousals through a bi-directional long short-term memory neural network. The study used a dataset of 233 nocturnal PSGs of population-based samples from Wisconsin Sleep Cohort (WSC) and 30 nocturnal PSGs of clinical samples from the Stanford Sleep...

  3. Direct measurement of lithium in whole blood using microchip capillary electrophoresis with integrated conductivity detection

    NARCIS (Netherlands)

    Vrouwe, E.X.; Lüttge, Regina; van den Berg, Albert

    2004-01-01

    The direct measurement of lithium in whole blood is described. Using microchip capillary electrophoresis (CE) with defined sample loading and applying the principles of column coupling, alkali metals were determined in a drop of whole blood. Blood collected from a finger stick was mixed with

  4. Direct detection of the parametrically generated half-harmonic voltage in a Josephson tunnel junction

    DEFF Research Database (Denmark)

    Mygind, Jesper; Pedersen, Niels Falsig; Sørensen, O. H.

    1976-01-01

    The first direct observation of the parametrically generated half-harmonic voltage in a Josephson tunnel junction is reported. A microwave signal at f=17.25 GHz is applied to the junction dc current biased at zero voltage such that the Josephson plasma resonance fp=f/2. Under these conditions...

  5. Rapid whole genome sequencing for the detection and characterization of microorganisms directly from clinical samples

    DEFF Research Database (Denmark)

    Hasman, Henrik; Saputra, Dhany; Sicheritz-Pontén, Thomas

    2014-01-01

    Whole genome sequencing (WGS) is becoming available as a routine tool for clinical microbiology. If applied directly on clinical samples this could further reduce diagnostic time and thereby improve control and treatment. A major bottle-neck is the availability of fast and reliable bioinformatics...

  6. Direct detection of cysteine using functionalized BaTiO3 nanoparticles film based self-powered biosensor.

    Science.gov (United States)

    Selvarajan, Sophia; Alluri, Nagamalleswara Rao; Chandrasekhar, Arunkumar; Kim, Sang-Jae

    2017-05-15

    Simple, novel, and direct detection of clinically important biomolecules have continuous demand among scientific community as well as in market. Here, we report the first direct detection and facile fabrication of a cysteine-responsive, film-based, self-powered device. NH 2 functionalized BaTiO 3 nanoparticles (BT-NH 2 NPs) suspended in a three-dimensional matrix of an agarose (Ag) film, were used for cysteine detection. BaTiO 3 nanoparticles (BT NPs) semiconducting as well as piezoelectric properties were harnessed in this study. The changes in surface charge properties of the film with respect to cysteine concentrations were determined using a current-voltage (I-V) technique. The current response increased with cysteine concentration (linear concentration range=10µM-1mM). Based on the properties of the composite (BT/Ag), we created a self-powered cysteine sensor in which the output voltage from a piezoelectric nanogenerator was used to drive the sensor. The potential drop across the sensor was measured as a function of cysteine concentrations. Real-time analysis of sensor performance was carried out on urine samples by non-invasive method. This novel sensor demonstrated good selectivity, linear concentration range and detection limit of 10µM; acceptable for routine analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Direct immobilization of antibodies on Zn-doped Fe_3O_4 nanoclusters for detection of pathogenic bacteria

    International Nuclear Information System (INIS)

    Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin

    2017-01-01

    Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe_3O_4 nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S_t_h_i_o_l bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.

  8. Direct determination of recoil ion detection efficiency for coincidence time-of-flight studies of molecular fragmentation

    International Nuclear Information System (INIS)

    Ben-Itzhak, I.; Carnes, K.D.; Ginther, S.G.; Johnson, D.T.; Norris, P.J.; Weaver, O.L.

    1993-01-01

    Molecular fragmentation of diatomic and small polyatomic molecules caused by fast ion impact has been studied. The evaluation of the cross sections of the different fragmentation channels depends strongly on the recoil ion detection efficiency, ε r (single ions proportional to ε r , and ion pairs to ε 2 r , etc.). A method is suggested for the direct determination of this detection efficiency. This method is based on the fact that fast H + + CH 4 collisions produce C 2+ fragments only in coincidence with H + and H + 2 fragments, that is, there is a negligible number of C 2+ singles, if any. The measured yield of C 2+ singles is therefore due to events in which the H + m of the H + m + C 2+ ion pair was not detected and thus is proportional to 1 - ε r . Methane fragmentation caused by 1 MeV proton impact is used to evaluate directly the recoil ion detection efficiency and to demonstrate the method of deriving the cross sections of all breakup channels. (orig.)

  9. Detecting and monitoring of water inrush in tunnels and coal mines using direct current resistivity method: A review

    Directory of Open Access Journals (Sweden)

    Shucai Li

    2015-08-01

    Full Text Available Detecting, real-time monitoring and early warning of underground water-bearing structures are critically important issues in prevention and mitigation of water inrush hazards in underground engineering. Direct current (DC resistivity method is a widely used method for routine detection, advanced detection and real-time monitoring of water-bearing structures, due to its high sensitivity to groundwater. In this study, the DC resistivity method applied to underground engineering is reviewed and discussed, including the observation mode, multiple inversions, and real-time monitoring. It is shown that a priori information constrained inversion is desirable to reduce the non-uniqueness of inversion, with which the accuracy of detection can be significantly improved. The focused resistivity method is prospective for advanced detection; with this method, the flanking interference can be reduced and the detection distance is increased subsequently. The time-lapse resistivity inversion method is suitable for the regions with continuous conductivity changes, and it can be used to monitor water inrush in those regions. Based on above-mentioned features of various methods in terms of benefits and limitations, we propose a three-dimensional (3D induced polarization method characterized with multi-electrode array, and introduce it into tunnels and mines combining with real-time monitoring with time-lapse inversion and cross-hole resistivity method. At last, the prospective applications of DC resistivity method are discussed as follows: (1 available advanced detection technology and instrument in tunnel excavated by tunnel boring machine (TBM, (2 high-resolution detection method in holes, (3 four-dimensional (4D monitoring technology for water inrush sources, and (4 estimation of water volume in water-bearing structures.

  10. Enabling tools for high-throughput detection of metabolites: Metabolic engineering and directed evolution applications.

    Science.gov (United States)

    Lin, Jyun-Liang; Wagner, James M; Alper, Hal S

    2017-12-01

    Within the Design-Build-Test Cycle for strain engineering, rapid product detection and selection strategies remain challenging and limit overall throughput. Here we summarize a wide variety of modalities that transduce chemical concentrations into easily measured absorbance, luminescence, and fluorescence signals. Specifically, we cover protein-based biosensors (including transcription factors), nucleic acid-based biosensors, coupled enzyme reactions, bioorthogonal chemistry, and fluorescent and chromogenic dyes and substrates as modalities for detection. We focus on the use of these methods for strain engineering and enzyme discovery and conclude with remarks on the current and future state of biosensor development for application in the metabolic engineering field. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Stretchable Complementary Split Ring Resonator (CSRR-Based Radio Frequency (RF Sensor for Strain Direction and Level Detection

    Directory of Open Access Journals (Sweden)

    Seunghyun Eom

    2016-10-01

    Full Text Available In this paper, we proposed a stretchable radio frequency (RF sensor to detect strain direction and level. The stretchable sensor is composed of two complementary split ring resonators (CSRR with microfluidic channels. In order to achieve stretchability, liquid metal (eutectic gallium-indium, EGaIn and Ecoflex substrate are used. Microfluidic channels are built by Ecoflex elastomer and microfluidic channel frames. A three-dimensional (3D printer is used for fabrication of microfluidic channel frames. Two CSRR resonators are designed to resonate 2.03 GHz and 3.68 GHz. When the proposed sensor is stretched from 0 to 8 mm along the +x direction, the resonant frequency is shifted from 3.68 GHz to 3.13 GHz. When the proposed sensor is stretched from 0 to 8 mm along the −x direction, the resonant frequency is shifted from 2.03 GHz to 1.78 GHz. Therefore, we can detect stretched length and direction from independent variation of two resonant frequencies.

  12. An empirically grounded agent based model for modeling directs, conflict detection and resolution operations in air traffic management.

    Science.gov (United States)

    Bongiorno, Christian; Miccichè, Salvatore; Mantegna, Rosario N

    2017-01-01

    We present an agent based model of the Air Traffic Management socio-technical complex system aiming at modeling the interactions between aircraft and air traffic controllers at a tactical level. The core of the model is given by the conflict detection and resolution module and by the directs module. Directs are flight shortcuts that are given by air controllers to speed up the passage of an aircraft within a certain airspace and therefore to facilitate airline operations. Conflicts between flight trajectories can occur for two main reasons: either the planning of the flight trajectory was not sufficiently detailed to rule out all potential conflicts or unforeseen events during the flight require modifications of the flight plan that can conflict with other flight trajectories. Our model performs a local conflict detection and resolution procedure. Once a flight trajectory has been made conflict-free, the model searches for possible improvements of the system efficiency by issuing directs. We give an example of model calibration based on real data. We then provide an illustration of the capability of our model in generating scenario simulations able to give insights about the air traffic management system. We show that the calibrated model is able to reproduce the existence of a geographical localization of air traffic controllers' operations. Finally, we use the model to investigate the relationship between directs and conflict resolutions (i) in the presence of perfect forecast ability of controllers, and (ii) in the presence of some degree of uncertainty in flight trajectory forecast.

  13. An empirically grounded agent based model for modeling directs, conflict detection and resolution operations in air traffic management.

    Directory of Open Access Journals (Sweden)

    Christian Bongiorno

    Full Text Available We present an agent based model of the Air Traffic Management socio-technical complex system aiming at modeling the interactions between aircraft and air traffic controllers at a tactical level. The core of the model is given by the conflict detection and resolution module and by the directs module. Directs are flight shortcuts that are given by air controllers to speed up the passage of an aircraft within a certain airspace and therefore to facilitate airline operations. Conflicts between flight trajectories can occur for two main reasons: either the planning of the flight trajectory was not sufficiently detailed to rule out all potential conflicts or unforeseen events during the flight require modifications of the flight plan that can conflict with other flight trajectories. Our model performs a local conflict detection and resolution procedure. Once a flight trajectory has been made conflict-free, the model searches for possible improvements of the system efficiency by issuing directs. We give an example of model calibration based on real data. We then provide an illustration of the capability of our model in generating scenario simulations able to give insights about the air traffic management system. We show that the calibrated model is able to reproduce the existence of a geographical localization of air traffic controllers' operations. Finally, we use the model to investigate the relationship between directs and conflict resolutions (i in the presence of perfect forecast ability of controllers, and (ii in the presence of some degree of uncertainty in flight trajectory forecast.

  14. Network analysis to detect common strategies in Italian foreign direct investment

    Science.gov (United States)

    De Masi, G.; Giovannetti, G.; Ricchiuti, G.

    2013-03-01

    In this paper we reconstruct and discuss the network of Italian firms investing abroad, exploiting information from complex network analysis. This method, detecting the key nodes of the system (both in terms of firms and countries of destination), allows us to single out the linkages among firms without ex-ante priors. Moreover, through the examination of affiliates’ economic activity, it allows us to highlight different internationalization strategies of “leaders” in different manufacturing sectors.

  15. The Direct Detection and Characterization of M-dwarf Planets Using Light Echoes

    Science.gov (United States)

    Sparks, William B.; White, Richard L.; Lupu, Roxana E.; Ford, Holland C.

    2018-02-01

    Exoplanets orbiting M-dwarf stars are a prime target in the search for life in the universe. M-dwarf stars are active, with powerful flares that could adversely impact prospects for life, though there are counter-arguments. Here, we turn flaring to advantage and describe ways in which it can be used to enhance the detectability of planets, in the absence of transits or a coronagraph, significantly expanding the accessible discovery and characterization space. Flares produce brief bursts of intense luminosity, after which the star dims. Due to the light travel time between the star and planet, the planet receives the high-intensity pulse, which it re-emits through scattering (a light echo) or intrinsic emission when the star is much fainter, thereby increasing the planet’s detectability. The planet’s light-echo emission can potentially be discriminated from that of the host star by means of a time delay, Doppler shift, spatial shift, and polarization, each of which can improve the contrast of the planet to the star. Scattered light can reveal the albedo spectrum of the planet to within a size scale factor, and is likely to be polarized. Intrinsic emission mechanisms include fluorescent pumping of multiple molecular hydrogen and neutral oxygen lines by intense Lyα and Lyβ flare emission, recombination radiation of ionized and photodissociated species, and atmospheric processes such as terrestrial upper atmosphere airglow and near-infrared hydroxyl emission. We discuss the feasibility of detecting light echoes and find that light echo detection is possible under favorable circumstances.

  16. Direct colorimetric detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles.

    Science.gov (United States)

    Baetsen-Young, Amy M; Vasher, Matthew; Matta, Leann L; Colgan, Phil; Alocilja, Evangelyn C; Day, Brad

    2018-03-15

    The interaction between gold nanoparticles (AuNPs) and nucleic acids has facilitated a variety of diagnostic applications, with further diversification of synthesis match bio-applications while reducing biotoxicity. However, DNA interactions with unique surface capping agents have not been fully defined. Using dextrin-capped AuNPs (d-AuNPs), we have developed a novel unamplified genomic DNA (gDNA) nanosensor, exploiting dispersion and aggregation characteristics of d-AuNPs, in the presence of gDNA, for sequence-specific detection. We demonstrate that d-AuNPs are stable in a five-fold greater salt concentration than citrate-capped AuNPs and the d-AuNPs were stabilized by single stranded DNA probe (ssDNAp). However, in the elevated salt concentrations of the DNA detection assay, the target reactions were surprisingly further stabilized by the formation of a ssDNAp-target gDNA complex. The results presented herein lead us to propose a mechanism whereby genomic ssDNA secondary structure formation during ssDNAp-to-target gDNA binding enables d-AuNP stabilization in elevated ionic environments. Using the assay described herein, we were successful in detecting as little as 2.94 fM of pathogen DNA, and using crude extractions of a pathogen matrix, as few as 18 spores/µL. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Plasmonic detection and visualization of directed adsorption of charged single nanoparticles to patterned surfaces

    International Nuclear Information System (INIS)

    Scherbahn, Vitali; Nizamov, Shavkat; Mirsky, Vladimir M.

    2016-01-01

    It has recently been shown that surface plasmon microscopy (SPM) allows single nanoparticles (NPs) on sensor surfaces to be detected and analyzed. The authors have applied this technique to study the adsorption of single metallic and plastic NPs. Binding of gold NPs (40, 60 and 100 nm in size) and of 100 nm polystyrene NPs to gold surfaces modified by differently ω-functionalized alkyl thiols was studied first. Self-assembled monolayers (SAM) with varying terminal functions including amino, carboxy, oligo(ethylene glycol), methyl, or trimethylammonium groups were deposited on gold films to form surfaces possessing different charge and hydrophobicity. The affinity of NPs to these surfaces depends strongly on the type of coating. SAMs terminated with trimethylammonium groups and carboxy group display highly different affinity and therefore were preferred when creating patterned charged surfaces. Citrate-stabilized gold NPs and sulfate-terminated polystyrene NPs were used as negatively charged NPs, while branched polyethylenimine-coated silver NPs were used as positively charged NPs. It is shown that the charged patterned areas on the gold films are capable of selectively adsorbing oppositely charged NPs that can be detected and analyzed with an ∼1 ng⋅mL −1 detection limit. (author)

  18. Receiver Signal to Noise Ratios for IPDA Lidars Using Sine-wave and Pulsed Laser Modulation and Direct Detections

    Science.gov (United States)

    Sun, Xiaoli; Abshire, James B.

    2011-01-01

    Integrated path differential absorption (IPDA) lidar can be used to remotely measure the column density of gases in the path to a scattering target [1]. The total column gas molecular density can be derived from the ratio of the laser echo signal power with the laser wavelength on the gas absorption line (on-line) to that off the line (off-line). 80th coherent detection and direct detection IPDA lidar have been used successfully in the past in horizontal path and airborne remote sensing measurements. However, for space based measurements, the signal propagation losses are often orders of magnitude higher and it is important to use the most efficient laser modulation and detection technique to minimize the average laser power and the electrical power from the spacecraft. This paper gives an analysis the receiver signal to noise ratio (SNR) of several laser modulation and detection techniques versus the average received laser power under similar operation environments. Coherent detection [2] can give the best receiver performance when the local oscillator laser is relatively strong and the heterodyne mixing losses are negligible. Coherent detection has a high signal gain and a very narrow bandwidth for the background light and detector dark noise. However, coherent detection must maintain a high degree of coherence between the local oscillator laser and the received signal in both temporal and spatial modes. This often results in a high system complexity and low overall measurement efficiency. For measurements through atmosphere the coherence diameter of the received signal also limits the useful size of the receiver telescope. Direct detection IPDA lidars are simpler to build and have fewer constraints on the transmitter and receiver components. They can use much larger size 'photon-bucket' type telescopes to reduce the demands on the laser transmitter. Here we consider the two most widely used direct detection IPDA lidar techniques. The first technique uses two CW

  19. Signals of composite electroweak-neutral Dark Matter: LHC/direct detection interplay

    International Nuclear Information System (INIS)

    Barbieri, Riccardo; Rychkov, Slava; Torre, Riccardo

    2010-01-01

    In a strong-coupling picture of ElectroWeak Symmetry Breaking, a composite electroweak-neutral state in the TeV mass range, carrying a global (quasi-)conserved charge, makes a plausible Dark Matter (DM) candidate, with the ongoing direct DM searches being precisely sensitive to the expected signals. To exploit the crucial interplay between direct DM searches and the LHC, we consider a composite iso-singlet vector V, mixed with the hypercharge gauge field, as the essential mediator of the interaction between the DM particle and the nucleus. Based on a suitable effective chiral Lagrangian, we give the expected properties and production rates of V, showing its possible discovery at the maximal LHC energy with about 100 fb -1 of integrated luminosity.

  20. Prenatal diagnosis of autosomal dominant hereditary spastic paraplegia (SPG4) using direct mutation detection

    DEFF Research Database (Denmark)

    Nielsen, Jørgen E; Koefoed, Pernille; Kjaergaard, Susanne

    2004-01-01

    OBJECTIVE: To present a report on prenatal diagnosis using direct SPG4 gene analysis in a family with autosomal dominant hereditary spastic paraplegia (AD-HSP). METHODS: Genetic linkage and haplotype analysis were previously carried out with chromosome 2p markers. DNA was obtained from affected...... individuals, the affected father, the mother, and fetal DNA from an ongoing pregnancy by chorionic villus sampling (CVS) in the first trimester. The spastin gene (SPG4) was completely sequenced. RESULTS: A novel 832insGdelAA frameshift mutation, predicted to cause loss of functional protein, was identified...... in the affected father and in the fetal DNA. CONCLUSIONS: This is the first report on direct prenatal diagnosis of chromosome 2p-linked AD-HSP (SPG4). In addition, we report a novel SPG4-combined small insertion/deletion mutation in exon 5, which may be the first SPG4 mutational hot spot....

  1. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  2. Rapid detection of sugar alcohol precursors and corresponding nitrate ester explosives using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Sisco, Edward; Forbes, Thomas P

    2015-04-21

    This work highlights the rapid detection of nitrate ester explosives and their sugar alcohol precursors by direct analysis in real time mass spectrometry (DART-MS) using an off-axis geometry. Demonstration of the effect of various parameters, such as ion polarity and in-source collision induced dissociation (CID) on the detection of these compounds is presented. Sensitivity of sugar alcohols and nitrate ester explosives was found to be greatest in negative ion mode with sensitivities ranging from hundreds of picograms to hundreds of nanograms, depending on the characteristics of the particular molecule. Altering the in-source CID potential allowed for acquisition of characteristic molecular ion spectra as well as fragmentation spectra. Additional studies were completed to identify the role of different experimental parameters on the sensitivity for these compounds. Variables that were examined included the DART gas stream temperature, the presence of a related compound (i.e., the effect of a precursor on the detection of a nitrate ester explosive), incorporation of dopant species and the role of the analysis surface. It was determined that each variable affected the response and detection of both sugar alcohols and the corresponding nitrate ester explosives. From this work, a rapid and sensitive method for the detection of individual sugar alcohols and corresponding nitrate ester explosives, or mixtures of the two, has been developed, providing a useful tool in the real-world identification of homemade explosives.

  3. Direct detection of common and rare inversion mutations in the genetic diagnosis of severe hemophilia A

    Energy Technology Data Exchange (ETDEWEB)

    Windsor, A.S.; Lillicrap, D.P.; Taylor, S.A.M. [Queen`s Univ., Ontario (Canada)

    1994-09-01

    Approximately 50% of the cases of severe hemophilia A (factor VIII:C < 0.01 units/ml) may be due to gross rearrangements of the factor VIII gene. The mutation involves homologous sequences upstream of the factor VIII locus and within intron 22 in an intrachromosomal recombination, inversion, event. The rearrangements can readily be detected on a Southern blot using a probe that is complementary to sequences from within intron 22. We describe here the analysis of this mutation in 71 severe hemophilia A patients. Thirty two of the patients (45%) showed evidence of a rearrangement. Five different patterns of rearrangements were seen, two of which have previously been described and account for the majority of cases (pattern 1, 70% and pattern 2, 16%). Three other abnormal patterns were observed. The inversion mechanism does not usually result in the loss or gain of any genetic material, but in one patient, in whom a unique rearrangement pattern was observed (pattern 3), we have previously documented a gross deletion which removes exons 1-22 of the factor VII gene as well as sequences 5{prime} to the gene. In another individual a fourth pattern in which an extra 19.0 kb band is present was detected. In this case it is unclear as to whether the rearrangement is responsible for the disease or is simply coincident normal variation. A fifth pattern, in which an extra 16.0 kb band was detected, was observed in a family with a new mutation causing hemophilia A. The affected individual and his mother inherited a de novo rearrangement of the factor VIII gene from his unaffected grandfather, implicating it as the cause of the disease. In conclusion, testing for the factor VIII inversion mutation was positive in approximately 45% of severe hemophiliacs, 72% of whom were isolated cases, and as such should constitute the initial stage in the genetic testing protocol for these patients` families.

  4. DIRECT DETECTION OF THE HELICAL MAGNETIC FIELD GEOMETRY FROM 3D RECONSTRUCTION OF PROMINENCE KNOT TRAJECTORIES

    Energy Technology Data Exchange (ETDEWEB)

    Zapiór, Maciej; Martinez-Gómez, David, E-mail: zapior.maciek@gmail.com [Physics Department, University of the Balearic Islands, Cra. de Valldemossa, km 7.5. Palma (Illes Balears), E-07122 (Spain)

    2016-02-01

    Based on the data collected by the Vacuum Tower Telescope located in the Teide Observatory in the Canary Islands, we analyzed the three-dimensional (3D) motion of so-called knots in a solar prominence of 2014 June 9. Trajectories of seven knots were reconstructed, giving information of the 3D geometry of the magnetic field. Helical motion was detected. From the equipartition principle, we estimated the lower limit of the magnetic field in the prominence to ≈1–3 G and from the Ampère’s law the lower limit of the electric current to ≈1.2 × 10{sup 9} A.

  5. Direct Detection of the Helical Magnetic Field Geometry from 3D Reconstruction of Prominence Knot Trajectories

    Science.gov (United States)

    Zapiór, Maciej; Martínez-Gómez, David

    2016-02-01

    Based on the data collected by the Vacuum Tower Telescope located in the Teide Observatory in the Canary Islands, we analyzed the three-dimensional (3D) motion of so-called knots in a solar prominence of 2014 June 9. Trajectories of seven knots were reconstructed, giving information of the 3D geometry of the magnetic field. Helical motion was detected. From the equipartition principle, we estimated the lower limit of the magnetic field in the prominence to ≈1-3 G and from the Ampère’s law the lower limit of the electric current to ≈1.2 × 109 A.

  6. Automatic cardiac cycle determination directly from EEG-fMRI data by multi-scale peak detection method.

    Science.gov (United States)

    Wong, Chung-Ki; Luo, Qingfei; Zotev, Vadim; Phillips, Raquel; Chan, Kam Wai Clifford; Bodurka, Jerzy

    2018-03-31

    In simultaneous EEG-fMRI, identification of the period of cardioballistic artifact (BCG) in EEG is required for the artifact removal. Recording the electrocardiogram (ECG) waveform during fMRI is difficult, often causing inaccurate period detection. Since the waveform of the BCG extracted by independent component analysis (ICA) is relatively invariable compared to the ECG waveform, we propose a multiple-scale peak-detection algorithm to determine the BCG cycle directly from the EEG data. The algorithm first extracts the high contrast BCG component from the EEG data by ICA. The BCG cycle is then estimated by band-pass filtering the component around the fundamental frequency identified from its energy spectral density, and the peak of BCG artifact occurrence is selected from each of the estimated cycle. The algorithm is shown to achieve a high accuracy on a large EEG-fMRI dataset. It is also adaptive to various heart rates without the needs of adjusting the threshold parameters. The cycle detection remains accurate with the scan duration reduced to half a minute. Additionally, the algorithm gives a figure of merit to evaluate the reliability of the detection accuracy. The algorithm is shown to give a higher detection accuracy than the commonly used cycle detection algorithm fmrib_qrsdetect implemented in EEGLAB. The achieved high cycle detection accuracy of our algorithm without using the ECG waveforms makes possible to create and automate pipelines for processing large EEG-fMRI datasets, and virtually eliminates the need for ECG recordings for BCG artifact removal. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Detecting peptidic drugs, drug candidates and analogs in sports doping: current status and future directions.

    Science.gov (United States)

    Thevis, Mario; Thomas, Andreas; Schänzer, Wilhelm

    2014-12-01

    With the growing availability of mature systems and strategies in biotechnology and the continuously expanding knowledge of cellular processes and involved biomolecules, human sports drug testing has become a considerably complex field in the arena of analytical chemistry. Proving the exogenous origin of peptidic drugs and respective analogs at lowest concentration levels in biological specimens (commonly blood, serum and urine) of rather limited volume is required to pursue an action against cheating athletes. Therefore, approaches employing chromatographic-mass spectrometric, electrophoretic, immunological and combined test methods have been required and developed. These allow detecting the misuse of peptidic compounds of lower (such as growth hormone-releasing peptides, ARA-290, TB-500, AOD-9604, CJC-1295, desmopressin, luteinizing hormone-releasing hormones, synacthen, etc.), intermediate (e.g., insulins, IGF-1 and analogs, 'full-length' mechano growth factor, growth hormone, chorionic gonadotropin, erythropoietin, etc.) and higher (e.g., stamulumab) molecular mass with desired specificity and sensitivity. A gap between the technically possible detection and the day-to-day analytical practice, however, still needs to be closed.

  8. Piezoelectric Materials Under Natural and Man-Made Radiation: The Potential for Direct Radiation Detection

    Science.gov (United States)

    Wart, Megan; Simpson, Evan; Flaska, Marek

    2018-01-01

    Radiation detection systems used for monitoring long term waste storage need to be compact, rugged, and have low or no power requirements. By using piezoelectric materials it may be possible to create a reliable self-powered radiation detection system. To determine the feasibility of this approach, the electrical signal response of the piezoelectric materials to radiation must be characterized. To do so, an experimental geometry has been designed and a neutron source has been chosen as described in this paper, which will be used to irradiate a uranium foil for producing fission fragments. These future experiments will be aimed at finding the threshold of exposure of lead zirconate titanate (PZT) plates needed to produce and electrical signal. Based on the proposed experimental geometry the thermal neutron beam-line at the Breazeale Reactor at The Pennsylvania State University will be used as the neutron source. The uranium foil and neutron source will be able to supply a maximum flux of 1.5e5 fission fragments/second*cm2 to each of the PZT plates.

  9. Gold nanoparticles directly modified glassy carbon electrode for non-enzymatic detection of glucose

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Gang; Shu, Honghui; Ji, Kai [Ministry-of-Education Key Laboratory for the Green Preparation and Application of Functional Materials, Faculty of Materials Science and Engineering, Hubei University, No. 368 Youyi Avenue, Wuchang, Wuhan 430062 (China); Oyama, Munetaka [Department of Material Chemistry, Graduate School of Engineering, Kyoto University, Nishikyo-ku, Kyoto 615-8520 (Japan); Liu, Xiong [Ministry-of-Education Key Laboratory for the Green Preparation and Application of Functional Materials, Faculty of Materials Science and Engineering, Hubei University, No. 368 Youyi Avenue, Wuchang, Wuhan 430062 (China); He, Yunbin, E-mail: ybhe@hubu.edu.cn [Ministry-of-Education Key Laboratory for the Green Preparation and Application of Functional Materials, Faculty of Materials Science and Engineering, Hubei University, No. 368 Youyi Avenue, Wuchang, Wuhan 430062 (China)

    2014-01-01

    This work describes controllable preparation of gold nanoparticles on glassy carbon electrodes by using the seed mediated growth method, which contains two steps, namely, nanoseeds attachment and nanocrystals growth. The size and the dispersion of gold nanoparticles grown on glassy carbon electrodes could be easily tuned through the growth time based on results of field-emission scanning electron microscopy. Excellent electrochemical catalytic characteristics for glucose oxidation were observed for the gold nanoparticles modified glassy carbon electrodes (AuNPs/GC), resulting from the extended active surface area provided by the dense gold nanoparticles attached. It exhibited a wide linear range from 0.1 mM to 25 mM with the sensitivity of 87.5 μA cm{sup −2} mM{sup −1} and low detection limit down to 0.05 mM for the sensing of glucose. The common interfering species such as chloride ion, ascorbic acid, uric acid and 4-acetamidophenol were verified having no interference effect on the detection of glucose. It is demonstrated that the seed mediated method is one of the facile approaches for fabricating Au nanoparticles modified substrates, which could work as one kind of promising electrode materials for the glucose nonenzymatic sensing.

  10. Piezoelectric Materials Under Natural and Man-Made Radiation: The Potential for Direct Radiation Detection

    Directory of Open Access Journals (Sweden)

    Wart Megan

    2018-01-01

    Full Text Available Radiation detection systems used for monitoring long term waste storage need to be compact, rugged, and have low or no power requirements. By using piezoelectric materials it may be possible to create a reliable self-powered radiation detection system. To determine the feasibility of this approach, the electrical signal response of the piezoelectric materials to radiation must be characterized. To do so, an experimental geometry has been designed and a neutron source has been chosen as described in this paper, which will be used to irradiate a uranium foil for producing fission fragments. These future experiments will be aimed at finding the threshold of exposure of lead zirconate titanate (PZT plates needed to produce and electrical signal. Based on the proposed experimental geometry the thermal neutron beam-line at the Breazeale Reactor at The Pennsylvania State University will be used as the neutron source. The uranium foil and neutron source will be able to supply a maximum flux of 1.5e5 fission fragments/second*cm2 to each of the PZT plates.

  11. Direct detection and quantification of transition metal ions in human atherosclerotic plaques

    DEFF Research Database (Denmark)

    Stadler, Nadina; Lindner, Robyn A; Davies, Michael Jonathan

    2004-01-01

    OBJECTIVE: The involvement of transition metals in atherosclerosis is controversial. Some epidemiological studies have reported a relationship between iron (Fe) and cardiovascular disease, whereas others have not. Experimental studies have reported elevated levels of iron and copper (Cu) in disea......OBJECTIVE: The involvement of transition metals in atherosclerosis is controversial. Some epidemiological studies have reported a relationship between iron (Fe) and cardiovascular disease, whereas others have not. Experimental studies have reported elevated levels of iron and copper (Cu......) in diseased human arteries but have often used methods that release metal ions from proteins. METHODS AND RESULTS: In this study, we have used the minimally invasive technique of electron paramagnetic resonance (EPR) spectroscopy and inductively coupled plasma mass spectroscopy (ICPMS) to quantify iron...... and copper in ex vivo healthy human arteries and carotid lesions. The EPR spectra detected are characteristic of nonheme Fe(III) complexes. Statistically elevated levels of iron were detected in the intima of lesions compared with healthy controls (0.370 versus 0.022 nmol/mg tissue for EPR, 0.525 versus 0...

  12. Detecting directional selection in the presence of recent admixture in African-Americans.

    Science.gov (United States)

    Lohmueller, Kirk E; Bustamante, Carlos D; Clark, Andrew G

    2011-03-01

    We investigate the performance of tests of neutrality in admixed populations using plausible demographic models for African-American history as well as resequencing data from African and African-American populations. The analysis of both simulated and human resequencing data suggests that recent admixture does not result in an excess of false-positive results for neutrality tests based on the frequency spectrum after accounting for the population growth in the parental African population. Furthermore, when simulating positive selection, Tajima's D, Fu and Li's D, and haplotype homozygosity have lower power to detect population-specific selection using individuals sampled from the admixed population than from the nonadmixed population. Fay and Wu's H test, however, has more power to detect selection using individuals from the admixed population than from the nonadmixed population, especially when the selective sweep ended long ago. Our results have implications for interpreting recent genome-wide scans for positive selection in human populations. © 2011 by the Genetics Society of America

  13. Amperometric magnetoimmunoassay for the direct detection of tumor necrosis factor alpha biomarker in human serum

    Energy Technology Data Exchange (ETDEWEB)

    Eletxigerra, U. [Micro-NanoFabrication Unit, IK4-Tekniker, Eibar (Spain); CIC microGUNE, Arrasate-Mondragón (Spain); Martinez-Perdiguero, J. [CIC microGUNE, Arrasate-Mondragón (Spain); Merino, S. [Micro-NanoFabrication Unit, IK4-Tekniker, Eibar (Spain); CIC microGUNE, Arrasate-Mondragón (Spain); Villalonga, R.; Pingarrón, J.M. [Departamento de Química Analítica, Facultad de CC. Químicas, Universidad Complutense de Madrid, Madrid (Spain); Campuzano, S., E-mail: susanacr@quim.ucm.es [Departamento de Química Analítica, Facultad de CC. Químicas, Universidad Complutense de Madrid, Madrid (Spain)

    2014-08-01

    Highlights: • Electrochemical magnetoimmunosensor for tumor necrosis factor alpha (TNFα) biomarker. • Sensitive and selective detection of TNFα in undiluted serum. • LOD achieved lower than the cut-off value established for relevant illnesses. • Useful and affordable alternative to ELISAs for TNFα determination in serum. - Abstract: An amperometric immunoassay for the determination of tumor necrosis factor alpha (TNFα) protein biomarker in human serum based on the use of magnetic microbeads (MBs) and disposable screen-printed carbon electrodes (SPCEs) has been developed. The specifically modified microbeads were magnetically captured on the working electrode surface and the amperometric responses were measured at −0.20 V (vs. Ag pseudo-reference electrode), upon addition of hydroquinone (HQ) as electron transfer mediator and H{sub 2}O{sub 2} as the enzyme substrate. After a thorough optimization of the assay, extremely low limits of detection were achieved: 2.0 pg mL{sup −1} (36 fM) and 5.8 pg mL{sup −1} (105 fM) for standard solutions and spiked human serum, respectively. The simplicity, robustness and this clinically interesting LOD proved the developed TNFα immunoassay as a good contender for real clinical application.

  14. Amperometric magnetoimmunoassay for the direct detection of tumor necrosis factor alpha biomarker in human serum

    International Nuclear Information System (INIS)

    Eletxigerra, U.; Martinez-Perdiguero, J.; Merino, S.; Villalonga, R.; Pingarrón, J.M.; Campuzano, S.

    2014-01-01

    Highlights: • Electrochemical magnetoimmunosensor for tumor necrosis factor alpha (TNFα) biomarker. • Sensitive and selective detection of TNFα in undiluted serum. • LOD achieved lower than the cut-off value established for relevant illnesses. • Useful and affordable alternative to ELISAs for TNFα determination in serum. - Abstract: An amperometric immunoassay for the determination of tumor necrosis factor alpha (TNFα) protein biomarker in human serum based on the use of magnetic microbeads (MBs) and disposable screen-printed carbon electrodes (SPCEs) has been developed. The specifically modified microbeads were magnetically captured on the working electrode surface and the amperometric responses were measured at −0.20 V (vs. Ag pseudo-reference electrode), upon addition of hydroquinone (HQ) as electron transfer mediator and H 2 O 2 as the enzyme substrate. After a thorough optimization of the assay, extremely low limits of detection were achieved: 2.0 pg mL −1 (36 fM) and 5.8 pg mL −1 (105 fM) for standard solutions and spiked human serum, respectively. The simplicity, robustness and this clinically interesting LOD proved the developed TNFα immunoassay as a good contender for real clinical application

  15. Detection of solar radio brightness oscillations with 160.01-min period from direct measurements

    International Nuclear Information System (INIS)

    Efanov, V.A.; Moiseev, I.G.; Nesterov, N.S.

    1983-01-01

    It is shown that direct measurements of the quiet Sun brightness at 8.2 and 13.5 mm wavelengths corrected for extinction in the Earth atmosphere by means of the Bouguer law reveal the 160.01-min periodic component. The relative amplitudes of variations are of approximately 6x10 -4 at the shorter wavelength and of 10 -3 at the longer one. The brightness maximum coincides with the phase of the maximal radius of the photosphere as derived from the optical data

  16. Direct HST Dust Lane Detection in Powerful Narrow-Line Radio Galaxies

    Energy Technology Data Exchange (ETDEWEB)

    Ramírez, Edgar A.; Aretxaga, Itziar [Instituto Nacional de Astrofísica, Óptica y Electrónica, Puebla (Mexico); Tadhunter, Clive N. [Department of Physics and Astronomy, University of Sheffield, Sheffield (United Kingdom); Lopez-Rodriguez, Enrique [NASA Ames Research Center, SOFIA Science Center, SOFIA/USRA, Mountain View, CA (United States); Department of Astronomy, University of Texas at Austin, Austin, TX (United States); McDonald Observatory, University of Texas at Austin, Austin, TX (United States); Packham, Chris, E-mail: e.ramirez@inaoep.mx [Department of Physics and Astronomy, University of Texas at San Antonio, San Antonio, TX (United States); National Astronomical Observatory of Japan, Tokyo (Japan)

    2017-11-22

    We present the analysis of near-infrared Hubble Space Telescope imaging of 10 Fanaroff Riley II powerful radio galaxies at low redshift (0.03 < z < 0.11) optically classified as narrow-line radio galaxies. The photometric properties of the host galaxy are measured using galfit, and compared with those from the literature. Our high resolution near-infrared observations provide new and direct information on the central kpc-scale dust lanes in our sample that could be connected to the pc-scale torus structure. Moreover, analyzing the infrared spectrograph Spitzer spectra of our sample, we suggest properties of the dust size of the torus.

  17. MACHe3: A new generation detector for non-baryonic dark matter direct detection

    International Nuclear Information System (INIS)

    Santos, D.; Mayet, F.; Perrin, G.; Moulin, E.; Bunkov, Yu. M.; Godfrin, H.; Krusius, M.

    2002-01-01

    MACHe3 (MAtrix of Cells of superfluid 3 H e) is a project of a new detector for direct Dark Matter (DM) search, using superfluid 3 He as a sensitive medium. An experiment on a prototype cell has been performed and the st results reported here are encouraging to develop of a multicell prototype. In order to investigate the discovery potential of MACHe3, and its complementarity with other DM detectors, a phenomenological study done with the DarkSUSY code is shown. (authors)

  18. Gamma irradiation does not induce detectable changes in DNA methylation directly following exposure of human cells.

    Directory of Open Access Journals (Sweden)

    Christoph Lahtz

    Full Text Available Environmental chemicals and radiation have often been implicated in producing alterations of the epigenome thus potentially contributing to cancer and other diseases. Ionizing radiation, released during accidents at nuclear power plants or after atomic bomb explosions, is a potentially serious health threat for the exposed human population. This type of high-energy radiation causes DNA damage including single- and double-strand breaks and induces chromosomal rearrangements and mutations, but it is not known if ionizing radiation directly induces changes in the epigenome of irradiated cells. We treated normal human fibroblasts and normal human bronchial epithelial cells with different doses of γ-radiation emitted from a cesium 137 ((137Cs radiation source. After a seven-day recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA in combination with high-resolution microarrays. Bioinformatics analysis revealed only a small number of potential methylation changes with low fold-difference ratios in the irradiated cells. These minor methylation differences seen on the microarrays could not be verified by COBRA (combined bisulfite restriction analysis or bisulfite sequencing of selected target loci. Our study shows that acute γ-radiation treatment of two types of human cells had no appreciable direct effect on DNA cytosine methylation patterns in exposed cells.

  19. Directional Stand-off Detection of Fast Neutrons and Gammas Using Angular Scattering Distributions

    Energy Technology Data Exchange (ETDEWEB)

    Vanier P. e.; Dioszegi, I.; Salwen, C.; Forman, L.

    2009-10-25

    We have investigated the response of a DoubleScatter Neutron Spectrometer (DSNS) for sources at long distances (gr than 200 meters). We find that an alternative method for analyzing double scatter data avoids some uncertainties introduced by amplitude measurements in plastic scintillators.Time of flight is used to discriminate between gamma and neutron events, and the kinematic distributions of scattering angles are assumed to apply. Non-relativistic neutrons are most likely to scatter at 45°, while gammas with energies greater than 2 MeV are most likely to be forward scattered. The distribution of scattering angles of fission neutrons arriving from a distant point source generates a 45° cone, which can be back-projected to give the source direction. At the same time, the distribution of Compton-scattered gammas has a maximum in the forward direction, and can be made narrower by selecting events that deposit minimal energy in the first scattering event. We have further determined that the shape of spontaneous fission neutron spectra at ranges gr than 110 m is still significantly different from thecosmic ray background.

  20. Canadian Public Health Laboratory Network Laboratory Guidelines for the Use of Direct Tests to Detect Syphilis in Canada

    Directory of Open Access Journals (Sweden)

    Raymond SW Tsang

    2015-01-01

    Full Text Available Treponema pallidum subsp. pallidum and/or its nucleic acid can be detected by various methods such as microscopy, rabbit infectivity test or polymerase chain reaction (PCR tests. The rabbit infectivity test for T. pallidum, although very sensitive, has been discontinued from most laboratories due to ethical issues related to the need for animal inoculation with live T. pallidum, the technically demanding procedure and long turnaround time for results, thus making it impractical for routine diagnostic use. Dark-field and phase-contrast microscopy are still useful at clinic- or hospital-based laboratories for near-bedside detection of T. pallidum in genital, skin or mucous lesions although their availability is decreasing. The lack of reliable and specific anti-T. pallidum antibodies and its inferior sensitivity to PCR may explain why the direct fluorescent antibody test for T. pallidum is not widely available for clinical use. Immunohistochemical staining for T. pallidum also depends on the availability of specific antibodies, and the method is only applicable for histopathological examination of biopsy and autopsy specimens necessitating an invasive specimen collection approach. With recent advances in molecular diagnostics, PCR is considered to be the most reliable, versatile and practical for laboratories to implement. In addition to being an objective and sensitive test for direct detection of Treponema pallidum subsp. pallidum DNA in skin and mucous membrane lesions, the resulting PCR amplicons from selected gene targets can be further characterized for antimicrobial (macrolide susceptibility testing, strain typing and identification of T. pallidum subspecies.

  1. Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

    Science.gov (United States)

    Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

    2014-07-01

    2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Diagnostic accuracy of direct ophthalmoscopy for detection of diabetic retinopathy using fundus photographs as a reference standard.

    Science.gov (United States)

    Ahsan, Shahid; Basit, Abdul; Ahmed, Kazi Rumana; Ali, Liaquat; Shaheen, Fariha; Ulhaque, Muhammad Saif; Fawwad, Asher

    2014-01-01

    To determine the diagnostic accuracy of direct ophthalmoscopy for the presence and severity of diabetic retinopathy (DR) using fundus photographs as a reference standard. Patients with type 2 diabetes attending the outpatient department (OPD) of a tertiary care diabetes center, from October 2009 to March 2010 were recruited in the study after obtaining signed informed consent. Patients with type 1 diabetes and gestational diabetes or having eye problems were excluded. After checking visual acuity, direct ophthalmoscopy of each eye was done by diabetologist, followed by photography of two fields of retina by fundus camera. DR was graded by a retinal specialist, according to International Diabetic Retinopathy Disease Severity Scale. According to severity, patients with DR were grouped into non-sight threatening diabetic retinopathy (NSTDR) and sight threatening diabetic retinopathy (STDR). Sensitivity and specificity of direct ophthalmoscopy for detection of any retinopathy, NSTDR and STDR was calculated. A total of 728 eyes were examined by direct ophthalmoscopy as well as fundus photography. Sensitivity (95% CI) of direct ophthalmoscopy for any retinopathy, NSTDR and STDR was found to be 55.67% (50.58-60.78), 37.63% (32.67-42.59) and 68.25% (63.48-73.02) respectively. Whereas, specificity of direct ophthalmoscopy was found to be 76.78% (72.45-81.11), 71.27% (CI: 66.63-75.91) and 90.0% (86.93-93.07) for any retinopathy, NSTDR and STDR respectively. The sensitivity and specificity of direct ophthalmoscopy performed by the diabetologist for the presence and severity of DR was lower compared to the recommended level of sensitivity and specificity of a screening test of DR. Copyright © 2014 Diabetes India. Published by Elsevier Ltd. All rights reserved.

  3. Direct fluorescence detection of VirE2 secretion by Agrobacterium tumefaciens

    Science.gov (United States)

    Yaakov, Noga; Barak, Yoav; Pereman, Idan; Christie, Peter J.; Elbaum, Michael

    2017-01-01

    VirE2 is a ssDNA binding protein essential for virulence in Agrobacterium tumefaciens. A tetracysteine mutant (VirE2-TC) was prepared for in vitro and in vivo fluorescence imaging based on the ReAsH reagent. VirE2-TC was found to be biochemically active as it binds both ssDNA and the acidic secretion chaperone VirE1. It was also biologically functional in complementing virE2 null strains transforming Arabidopsis thaliana roots and Nicotiana tabacum leaves. In vitro experiments demonstrated a two-color fluorescent complex using VirE2-TC/ReAsH and Alexa Fluor 488 labeled ssDNA. In vivo, fluorescent VirE2-TC/ReAsH was detected in bacteria and in plant cells at time frames relevant to transformation. PMID:28403156

  4. Direct detection of near-surface faults by migration of back-scattered surface waves

    KAUST Repository

    Yu, Han

    2014-08-05

    We show that diffraction stack migration can be used to estimate the distribution of near-surface faults. The assumption is that near-surface faults generate detectable back-scattered surface waves from impinging surface waves. The processing steps are to isolate the back-scattered surface waves, and then migrate them by diffraction migration using the surface wave velocity as the migration velocity. Instead of summing events along trial quasi-hyperbolas, surface wave migration sums events along trial quasi-linear trajectories that correspond to the moveout of back-scattered surface waves. A deconvolution filter derived from the data can be used to collapse a dispersive arrival into a non-dispersive event. Results with synthetic data and field records validate the feasibility of this method. Applying this method to USArray data or passively recorded exploration data might open new opportunities in mapping tectonic features over the extent of the array.

  5. Studies of Ink Trapping III Direct Detection of Small Air Bubbles in Ink Layer

    Directory of Open Access Journals (Sweden)

    Ikuo Naito

    2006-12-01

    Full Text Available Ink trappings were studied by using polyethylene terephthalate (PET film with black inks for offset proofing and synthetic paper. By observing printed matter from reverse side through the PET film, we detected many air bubbles in the ink layer and between the ink layer and the PET film. They are classified roughly to two groups, small number of large ones (φ = 2 - 5 μm and many small ones (φ = 0.5 - 1.0 μm. The former ones were fixed air bubbles during the trapping. The latter ones decreased according to increase the amount of ink trapped (y. Because number of the air bubbles (Nair bubble increased with increasing the ink distribution time, they seemed to be yielded by suspension of air into the ink layer during ink distribution. By observing printed surface, we also detected many ink peaks (immediately after the trapping and pinholes (at 24 h. The numbers of the ink peaks and pinholes (Nink peak and Npinhole, respectively decreased also with increasing the y value and increased with increasing the ink distribution time. We studied effects of nip width on these values (distribution time = 2 min.; nip width = 2, 3 and 4 mm. The Nair bubble value decreased with increasing nip width contrary to increase the Nink peak and Npinhole values. The effects can be represented by differences in the values of 2 and 4 mm nip widths. At y = 2 gm-2, the difference in the Nair bubble value is about one third (synthetic paper ink or a half (offset proofing ink of the difference in the Nink peak values.

  6. Detecting consistent patterns of directional adaptation using differential selection codon models.

    Science.gov (United States)

    Parto, Sahar; Lartillot, Nicolas

    2017-06-23

    Phylogenetic codon models are often used to characterize the selective regimes acting on protein-coding sequences. Recent methodological developments have led to models explicitly accounting for the interplay between mutation and selection, by modeling the amino acid fitness landscape along the sequence. However, thus far, most of these models have assumed that the fitness landscape is constant over time. Fluctuations of the fitness landscape may often be random or depend on complex and unknown factors. However, some organisms may be subject to systematic changes in selective pressure, resulting in reproducible molecular adaptations across independent lineages subject to similar conditions. Here, we introduce a codon-based differential selection model, which aims to detect and quantify the fine-grained consistent patterns of adaptation at the protein-coding level, as a function of external conditions experienced by the organism under investigation. The model parameterizes the global mutational pressure, as well as the site- and condition-specific amino acid selective preferences. This phylogenetic model is implemented in a Bayesian MCMC framework. After validation with simulations, we applied our method to a dataset of HIV sequences from patients with known HLA genetic background. Our differential selection model detects and characterizes differentially selected coding positions specifically associated with two different HLA alleles. Our differential selection model is able to identify consistent molecular adaptations as a function of repeated changes in the environment of the organism. These models can be applied to many other problems, ranging from viral adaptation to evolution of life-history strategies in plants or animals.

  7. Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

    Science.gov (United States)

    Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

    2017-10-01

    Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Direct detection of projectile relics from the end of the lunar basin-forming epoch.

    Science.gov (United States)

    Joy, Katherine H; Zolensky, Michael E; Nagashima, Kazuhide; Huss, Gary R; Ross, D Kent; McKay, David S; Kring, David A

    2012-06-15

    The lunar surface, a key proxy for the early Earth, contains relics of asteroids and comets that have pummeled terrestrial planetary surfaces. Surviving fragments of projectiles in the lunar regolith provide a direct measure of the types and thus the sources of exogenous material delivered to the Earth-Moon system. In ancient [>3.4 billion years ago (Ga)] regolith breccias from the Apollo 16 landing site, we located mineral and lithologic relics of magnesian chondrules from chondritic impactors. These ancient impactor fragments are not nearly as diverse as those found in younger (3.4 Ga to today) regolith breccias and soils from the Moon or that presently fall as meteorites to Earth. This suggests that primitive chondritic asteroids, originating from a similar source region, were common Earth-Moon-crossing impactors during the latter stages of the basin-forming epoch.

  9. Displaying results of direct detection dark matter experiments free of astrophysical uncertainties

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Ludwig [Max Planck Institut fuer Kernphysik, Heidelberg (Germany); Collaboration: Collaboration XENON 100

    2015-07-01

    A number of experiments try to measure WIMP interactions by using different detector technologies and target elements. Hence, energy thresholds and sensitivities to light or heavy WIMP masses differ. However, due to large systematic uncertainties in the parameters defining the dark matter halo, a comparison of detectors is demanding. By mapping experimental results from the traditional cross section vs. dark matter mass parameter-space into a dark matter halo independent phase space, direct comparisons between experiments can be made. This is possible due to the monotonicity of the velocity integral which enables to combine all astrophysical assumptions into one parameter common to all experiments. In this talk the motivation as well as the mapping method are explained based on the XENON100 data.

  10. Direct solid-phase radioimmunoassay for the detection of Aujeszky's disease antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Doeller, G; Jakubik, J

    1980-06-01

    A direct solid-phase radioimmunoassy (dRIA) was developed in order to demonstrate antibodies against Aujeszky's disease virus (ADV) in sera obtained from pigs and rabbits. In the presence of guinea-pig complement the above test is 160-fold to 1500-fold more sensitive than the neutralization test (NT) and 320-fold to 150 000-fold more sensitive than sera obtained from an ADV-infected farm, which were found to be negative in the complement assisted NT. It is possible to test a single dilution of unknown serum by dRIA by comparing same with a standard curve and to make a statement regarding its ADV-specific binding capacity to /sup 125/I-labelled ADV antigen. The advantages of dRIA in comparison to the indirect RIA and the advantages and disadvantages with regard to ELISA were discussed.

  11. First Evidence of pep Solar Neutrinos by Direct Detection in Borexino

    Science.gov (United States)

    Bellini, G.; Benziger, J.; Bick, D.; Bonetti, S.; Bonfini, G.; Bravo, D.; Buizza Avanzini, M.; Caccianiga, B.; Cadonati, L.; Calaprice, F.; Carraro, C.; Cavalcante, P.; Chavarria, A.; Chepurnov, A.; D'Angelo, D.; Davini, S.; Derbin, A.; Etenko, A.; Fomenko, K.; Franco, D.; Galbiati, C.; Gazzana, S.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Grandi, L.; Guardincerri, E.; Hardy, S.; Ianni, Aldo; Ianni, Andrea; Korablev, D.; Korga, G.; Koshio, Y.; Kryn, D.; Laubenstein, M.; Lewke, T.; Litvinovich, E.; Loer, B.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Machulin, I.; Manecki, S.; Maneschg, W.; Manuzio, G.; Meindl, Q.; Meroni, E.; Miramonti, L.; Misiaszek, M.; Montanari, D.; Mosteiro, P.; Muratova, V.; Oberauer, L.; Obolensky, M.; Ortica, F.; Otis, K.; Pallavicini, M.; Papp, L.; Perasso, L.; Perasso, S.; Pocar, A.; Quirk, J.; Raghavan, R. S.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Sabelnikov, A.; Saldanha, R.; Salvo, C.; Schönert, S.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Vignaud, D.; Vogelaar, R. B.; von Feilitzsch, F.; Winter, J.; Wojcik, M.; Wright, A.; Wurm, M.; Xu, J.; Zaimidoroga, O.; Zavatarelli, S.; Zuzel, G.

    2012-02-01

    We observed, for the first time, solar neutrinos in the 1.0-1.5 MeV energy range. We determined the rate of pep solar neutrino interactions in Borexino to be 3.1±0.6stat±0.3systcounts/(day·100ton). Assuming the pep neutrino flux predicted by the standard solar model, we obtained a constraint on the CNO solar neutrino interaction rate of Mikheyev-Smirnov-Wolfenstein large mixing angle solution to solar neutrino oscillations, these values correspond to solar neutrino fluxes of (1.6±0.3)×108cm-2s-1 and <7.7×108cm-2s-1 (95% C.L.), respectively, in agreement with both the high and low metallicity standard solar models. These results represent the first direct evidence of the pep neutrino signal and the strongest constraint of the CNO solar neutrino flux to date.

  12. A new method for detecting hemoglobin directly in whole blood using photon attenuation techniques

    International Nuclear Information System (INIS)

    Medhat, M.E.

    2014-01-01

    The objective of the proposed work is focused on measuring iron concentration directly in whole blood as tool for estimating hemoglobin and anemic conditions in patients across the world. The investigated method depends on theory of photon attenuation through transmission of low energy in whole blood sample. The mathematical expressions for calculating hemoglobin and iron deficit on blood using photon attenuation are derived. Calculations are carried out for estimating concentration of iron in blood samples taken from children, adults and old patients and therefore measuring their hemoglobin and iron deficit from normal values. Theoretical mass attenuation coefficient values were obtained using the XCOM program. A high-resolution gamma-ray spectrometry based on high purity germanium detector was employed to measure attenuation of strongly collimated monoenergetic gamma beam through blood samples. (author)

  13. Direct metagenomic detection of viral pathogens in nasal and fecal specimens using an unbiased high-throughput sequencing approach.

    Directory of Open Access Journals (Sweden)

    Shota Nakamura

    Full Text Available With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3 and fecal specimens (N = 5, and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738 reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90% of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered, except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures.

  14. Carbon nanotube ensembled hybrid nanocomposite electrode for direct electrochemical detection of epinephrine in pharmaceutical tablets and urine.

    Science.gov (United States)

    Koteshwara Reddy, K; Satyanarayana, M; Yugender Goud, K; Vengatajalabathy Gobi, K; Kim, Hern

    2017-10-01

    An efficient electrochemical sensor for selective detection of the neurotransmitter, epinephrine (Epn), has been fabricated with the aid of a functionalized multiwall carbon nanotube-chitosan biopolymer nanocomposite (Chit-fCNT) electrode. Multiwall carbon nanotubes (CNT) were successfully functionalized with the aid of nitric acid and confirmed by the Raman spectral data. Functionalized carbon nanotubes (fCNT) were dispersed in chitosan solution and the resulting bio-nanocomposite was used for the fabrication of sensor surface by drop and cast method. Electrochemical characteristics of the fabricated sensor were understood using cyclic, differential pulse voltammetry (CV, DPV) and electrochemical impedance analysis for the detection of Epn in phosphate buffer (pH7.4). CV and impedance analysis revealed that the Chit-fCNT modified electrode enhances the electrodic reaction of Epn and facilitated the electron transfer more readily compared to that of bare electrode. Applying DPV for the detection of Epn, achieved 30nM as the lowest detection limit in the determination range of 0.05-10μM and the analytical time as low as 10s. Selective determination of Epn against the coexistence of a number of biological electroactive interferents and reproducible results for the determination of Epn were demonstrated. The present biosensor has been found efficient for successful direct determination of Epn from pharmaceutical adrenaline formulations and urine samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Possible detection of an emission feature near 584 A in the direction of G191-B2B

    Science.gov (United States)

    Green, James; Bowyer, Stuart; Jelinsky, Patrick

    1990-01-01

    A possible spectral emission feature is reported in the direction of the nearby hot white dwarf G191-B2B at 581.5 + or - 6 A with a significance of 3.8 sigma. This emission has been identified as He I 584.3 A. The emission cannot be due to local geocoronal emission or interplanetary backscatter of solar He I 584 A emission because the feature is not detected in a nearby sky exposure. Possible sources for this emission are examined, including the photosphere of G191-B2B, the comparison star G191-B2A, and a possible nebulosity near or around G191-B2B. The parameters required to explain the emission are derived for each case. All of these explanations require unexpected physical conditions; hence we believe this result must receive confirming verification despite the statistical likelihood of the detection.

  16. Possible detection of an emission feature near 584 A in the direction of G191-B2B

    International Nuclear Information System (INIS)

    Green, J.; Bowyer, S.; Jelinsky, P.

    1990-01-01

    A possible spectral emission feature is reported in the direction of the nearby hot white dwarf G191-B2B at 581.5 + or - 6 A with a significance of 3.8 sigma. This emission has been identified as He I 584.3 A. The emission cannot be due to local geocoronal emission or interplanetary backscatter of solar He I 584 A emission because the feature is not detected in a nearby sky exposure. Possible sources for this emission are examined, including the photosphere of G191-B2B, the comparison star G191-B2A, and a possible nebulosity near or around G191-B2B. The parameters required to explain the emission are derived for each case. All of these explanations require unexpected physical conditions; hence we believe this result must receive confirming verification despite the statistical likelihood of the detection. 15 refs

  17. Detection of nicotine as an indicator of tobacco smoke by direct analysis in real time (DART) tandem mass spectrometry

    Science.gov (United States)

    Kuki, Ákos; Nagy, Lajos; Nagy, Tibor; Zsuga, Miklós; Kéki, Sándor

    2015-01-01

    The residual tobacco smoke contamination (thirdhand smoke, THS) on the clothes of a smoker was examined by direct analysis in real time (DART) mass spectrometry. DART-MS enabled sensitive and selective analysis of nicotine as the indicator of tobacco smoke pollution. Tandem mass spectrometric (MS/MS) experiments were also performed to confirm the identification of nicotine. Transferred thirdhand smoke originated from the fingers of a smoker onto other objects was also detected by DART mass spectrometry. DART-MS/MS was utilized for monitoring the secondhand tobacco smoke (SHS) in the air of the laboratory using nicotine as an indicator. To the best of our knowledge, this is the first report on the application of DART-MS and DART-MS/MS to the detection of thirdhand smoke and to the monitoring of secondhand smoke.

  18. Evaluation of a Direct Immunofluorescent Assay and/or Conjunctival Cytology for Detection of Canine Distemper Virus Antigen.

    Science.gov (United States)

    Athanasiou, Labrini V; Kantere, Maria C; Kyriakis, Constantinos S; Pardali, Dimitra; Adamama Moraitou, Katerina; Polizopoulou, Zoe S

    2018-04-01

    Canine distemper is a common and potentially lethal multisystemic disease caused by the Canine distemper virus (CDV). We evaluated the diagnostic performance of direct immunofluorescent assay (FA) and cytology to detect CDV antigen in conjunctival cells compared with an established polymerase chain reaction (PCR) detection assay used as a gold standard for CDV diagnosis. Samples were collected from 57 young dogs presenting with central nervous system signs compatible with distemper disease. Exfoliative epithelial cells were collected from the right and left conjunctiva of each animal using nylon-bristled cytobrushes for cytology and cotton swabs for FA and PCR. For the direct FA, samples were stained with anti-CDV polyclonal antiserum conjugated to fluorescein isothiocyanate and imaged using a fluorescent microscope. Out of 57 dogs tested, 19 were PCR positive (15 positive in direct FA and 4 positive in cytology, including one that was negative by PCR), whereas 37 dogs were negative in all methods. A good agreement was observed between the FA and PCR, with a κ-value of 0.833 (95% CI: 0.678-0.989). Meanwhile, there was poor agreement between cytology and PCR (κ-value of 0.164; 95% CI: -0.045 to 0.373) and a fair agreement between FA and cytology (κ-value of 0.231; 95% CI: -0.026 to 0.487). Our results indicated a poor performance of cytology for the detection of CDV antigen. In contrast, FA is a 100% specific and an adequately sensitive assay (sensitivity: 78.95%, negative likelihood ratio: 0.21, 95% CI: 0.09-0.50) for antemortem diagnosis of canine distemper.

  19. Development and validation of a 64 channel front end ASIC for 3D directional detection for MIMAC

    International Nuclear Information System (INIS)

    Richer, J P; Bourrion, O; Bosson, G; Guillaudin, O; Mayet, F; Santos, D

    2011-01-01

    A front end ASIC has been designed to equip the μTPC prototype developed for the MIMAC project, which requires 3D reconstruction of low energy particle tracks in order to perform directional detection of galactic Dark Matter. Each ASIC is able to monitor 64 strips of pixels and provides the 'Time Over Threshold' information for each of those. These 64 digital informations, sampled at a rate of 50 MHz, can be transferred at 400 MHz by eight LVDS serial links. Eight ASIC were validated on a 2 × 256 strips of pixels prototype.

  20. Toward the development of the direct and selective detection of nitrates by a bioinspired Mo-Cu system.

    Science.gov (United States)

    Marom, Hanit; Popowski, Yanay; Antonov, Svetlana; Gozin, Michael

    2011-10-21

    The development of a new platform for the direct and selective detection of nitrates is described. Two thioether-based chemosensors and the corresponding sulfoxides and sulfones were prepared, and their photophysical properties were evaluated. Upon selective sulfoxidation of these thioethers with nitrates via an oxygen-transfer reaction promoted by a bioinspired Mo-Cu system, significant fluorescence shifts were measured. A selective response of these systems, discriminating between nitrate salts and H(2)O(2), was also shown. © 2011 American Chemical Society