WorldWideScience

Sample records for direct detection vis-a-vis

  1. Astrophysical limitations to the identification of dark matter: indirect neutrino signals vis-a-vis direct detection recoil rates

    CERN Document Server

    Serpico, Pasquale D

    2010-01-01

    A convincing identification of dark matter (DM) particles can probably be achieved only through a combined analysis of different detections strategies, which provides an effective way of removing degeneracies in the parameter space of DM models. In practice, however, this program is made complicated by the fact that different strategies depend on different physical quantities, or on the same quantities but in a different way, making the treatment of systematic errors rather tricky. We discuss here the uncertainties on the recoil rate in direct detection experiments and on the muon rate induced by neutrinos from dark matter annihilations in the Sun, and we show that, contrarily to the local DM density or overall cross section scale, irreducible astrophysical uncertainties affect the two rates in a different fashion, therefore limiting our ability to reconstruct the parameters of the dark matter particle. By varying within their respective errors astrophysical parameters such as the escape velocity and the velo...

  2. Power system modeling and optimization methods vis-a-vis integrated resource planning (IRP)

    Science.gov (United States)

    Arsali, Mohammad H.

    1998-12-01

    The state-of-the-art restructuring of power industries is changing the fundamental nature of retail electricity business. As a result, the so-called Integrated Resource Planning (IRP) strategies implemented on electric utilities are also undergoing modifications. Such modifications evolve from the imminent considerations to minimize the revenue requirements and maximize electrical system reliability vis-a-vis capacity-additions (viewed as potential investments). IRP modifications also provide service-design bases to meet the customer needs towards profitability. The purpose of this research as deliberated in this dissertation is to propose procedures for optimal IRP intended to expand generation facilities of a power system over a stretched period of time. Relevant topics addressed in this research towards IRP optimization are as follows: (1) Historical prospective and evolutionary aspects of power system production-costing models and optimization techniques; (2) A survey of major U.S. electric utilities adopting IRP under changing socioeconomic environment; (3) A new technique designated as the Segmentation Method for production-costing via IRP optimization; (4) Construction of a fuzzy relational database of a typical electric power utility system for IRP purposes; (5) A genetic algorithm based approach for IRP optimization using the fuzzy relational database.

  3. Comparative study of ionization chamber detectors vis-a-vis a CCD detector for dispersive XAS measurement in transmission geometry

    Energy Technology Data Exchange (ETDEWEB)

    Poswal, A. K.; Agrawal, A.; Bhattachryya, D.; Jha, S. N.; Sahoo, N. K. [Applied Spectroscopy Division, Bhabha Atomic Research Centre, Mumbai -400 085 (India)

    2013-02-05

    We have designed and fabricated parallel plate ionization chamber detectors and voltage vs. current characteristics (V-I curve) of the detectors were recorded with synchrotron radiation to qualify for use in X-ray Absorption Spectroscopy (XAS) measurements. After qualifying the ionization chambers, the detectors were used in the dispersive EXAFS beamline (BL-08) at INDUS-2 SRS in Turbo-XAS geometry. Using the same setup and under the same setting, XAS spectra were also recorded with a CCD detector and the observation on relative performance of the ionization chamber vis-a-vis the CCD detector is presented in this paper.

  4. Migratory Trends in the Czech Republic: “Divergence or Convergence” vis-a-vis the Developed World?

    Directory of Open Access Journals (Sweden)

    Dušan Drbohlav

    2002-09-01

    Full Text Available The main goal of this paper is to analyse whether the geopolitical and socio-economic integration and “harmonisation” of the Czech Republic with Western Europe is accompanied by a divergence or convergence of the Czech migratory reality vis-a-vis the developed western world. When testing resemblance two kinds of measurements are used: 1 quantitative – (in terms of the numbers of international migrants, and 2 “qualitative” – a in terms of regularities linked with the migration itself and those that tackle mutual relationships among immigration, the socio-economic development of the destination country and subjective attitudes of the majority population towards minority groups: 3 hypotheses are tested in this regard; b in terms of migratory policies and practices. The results clearly show us that convergence rather than divergence is characteristic of the current migratory trends in the Czech Republic as compared to the developed world, mainly Western Europe.

  5. The meaning of marriage vis-a-vis childbearing in Europe and the United States

    OpenAIRE

    Holland, Jennifer

    2015-01-01

    This paper extends Holland’s (2013) marriage typology, linking the timing of marriage, childbearing, and cohabitation, and apply it to the Harmonized Histories covering a range of European countries and the United States. The meaning of marriage is organized around six ideal types: Direct Family Forming, Post-Cohabitation Family Forming, Conception-Related Legitimizing, Birth-Related Legitimizing, Reinforcing and Capstone marriage. Although smaller shares of women entered marriage at each age...

  6. Understanding urban vehicular pollution problem vis-a-vis ambient air quality--case study of a megacity (Delhi, India).

    Science.gov (United States)

    Goyal, S K; Ghatge, S V; Nema, P; M Tamhane, S

    2006-08-01

    Air pollution has become a growing problem in megacities and large urban areas through out the globe, and transportation is recognized as the major source of air pollution in many cities, especially in developing countries. Contribution of automobiles is reported in the range of 40 to 80% of the total air pollution. The challenge facing megacities is how to reduce the adverse environmental impacts and other negative effects of transportation without giving up the benefits of mobility. The dilemma becomes most pressing under conditions of rapid urban growth, which is likely to increase travel demand significantly. The paper is aimed at understanding the problem of vehicular pollution vis-a-vis ambient air quality for a highly traffic affected megacity, Delhi, wherein, the contribution of transport sector was estimated to be as high as 72%. An effort has been made to review and evaluate the benefits (in terms of improved air quality) of the technological interventions/policies adopted for vehicular pollution control in Delhi. It also highlights the outcome of the efforts and suggests further improvements thereon. The importance of public participation and awareness are also discussed. The paper focuses on deriving the benefits of the implementation of management strategies, supported by scientific and technical data/interpretation, so that the people can realize and participate in the government's endeavor for clean city drive in a more effective manner.

  7. Kojic Acid vis-a-vis its Combinations with Hydroquinone and Betamethasone Valerate in Melasma: A Randomized, Single Blind, Comparative Study of Efficacy and Safety

    Science.gov (United States)

    Deo, Kirti S.; Dash, Kedar N.; Sharma, Yugal K.; Virmani, Neha C.; Oberai, Chetan

    2013-01-01

    Background: Melasma is a relatively common, acquired symmetric hypermelanosis characterized by irregular light to gray-brown macules involving sun-exposed areas. Kojic acid, with its depigmenting potential due to tyrosinase inhibition and suppression of melanogenesis, has become a vital component of the dermatologists’ armamentarium against melasma. Aim: To study and compare the efficacy of kojic acid 1% alone, vis-a-vis its separate combinations with 2% hydroquinone or 0.1% betamethasone valerate and a combination of all these three agents with respect to the duration of symptoms and level of pigmentation in the therapy of melasma. Materials and Methods: Eighty patients from a single tertiary care center objectively assessed by calculating the melasma area severity index (MASI) and randomized (simple randomization) into four parallel groups (A, B, C, and D) of 20 each were prescribed once daily local application at night, (participants blinded regarding the difference in identity of interventions), as follows: Group A – kojic acid 1% cream. Group B – kojic acid 1% and hydroquinone 2% cream. Group C – kojic acid 1% and betamethasone valerate 0.1% cream. Group D – kojic acid 1%, hydroquinone 2%, and betamethasone valerate 0.1% cream. Strict photoprotection and use of a SPF 15 sunscreen was advised during the day. Patients were evaluated every 2 weeks and a fall in MASI score was calculated at the end of the study period of 12 weeks by the same investigator. Results: The response was compared according to percentage decrease in MASI score. Efficacy was evaluated among the groups at the end of 3 months using bivariate analysis and calculated by using the paired ‘t’ test. The clinical efficacy of group B was the highest followed closely by group D and group A, that of group C being the lowest. Conclusion: Kojic acid in synergy with hydroquinone is a superior depigmenting agent as compared with other combinations. PMID:23918998

  8. Can biophysics tell us something about the weak equivalence principle vis a vis the thought experiment of Einstein involving human subjects?

    Science.gov (United States)

    Thaheld, Fred H

    2009-08-01

    Over a period of several decades it has been noticed that most astronauts, either orbiting the earth or on trips to the moon, have observed phosphenes or light flashes (LF) including streaks, spots and clouds of light when their eyes are closed or they are in a darkened cabin. Scientists suspect that two separate components of cosmic rays cause these flashes due to direct interaction with the retina. This phenomenon is not noticed on the ground because of cosmic ray interaction with the atmosphere. The argument is advanced that this effect may provide us with a new method of exploring the weak equivalence principle from the standpoint of Einstein's original thought experiment involving human subjects. This can be done, utilizing the retina only, as an animate quantum mechanical measuring device or, in conjunction with the Anomalous Long Term Effects on Astronauts (ALTEA) facility.

  9. Approaches to characterize extended spectrum beta-lactamase/beta-lactamase producing Escherichia coli in healthy organized vis-a-vis backyard farmed pigs in India.

    Science.gov (United States)

    Samanta, Indranil; Joardar, Siddhartha N; Mahanti, Achintya; Bandyopadhyay, Samiran; Sar, Tapas K; Dutta, Tapan K

    2015-12-01

    The study was undertaken to investigate the occurrence and to characterize the ESBL/beta-lactamase producing-Escherichia coli in healthy pigs of organized and backyard farms in West Bengal, India. Total 200 rectal swabs were collected randomly from healthy pigs maintained in four organized farms and 10 backyard farms (n=100 each) and 76 isolates were identified as E. coli from organized (48/100, 48%) and backyard pigs (28/100, 28%). Twelve E. coli isolates (6%) in the present study were detected to possess any of the ESBL/beta-lactamase genes studied. ESBL/beta-lactamase producers were isolated with significantly more frequency from backyard pigs than the organized farm pigs (p=0.026). Six of ESBL/beta-lactamase producing isolates were phenotypically confirmed as CTX-M producers and ten of them were confirmed as TEM/SHV producers. PCR and sequencing of the amplified product from representative isolates revealed the presence of blaCTX-M-9, blaSHV-12 and blaTEM-1. No unique combination of the studied beta lactamase genes for organized and backyard farm pig isolates was noted. The ESBL isolates belonged to O13, O55, O133, O153, O157, O158, O166, rough and OUT serogroups. The association of heat labile toxin (elt) (pIndia.

  10. Arsenic accumulation in root and shoot vis-a-vis its effects on growth and level of phytochelatins in seedlings of Cicer arietinum L.

    Science.gov (United States)

    Gupta, D K; Tripathi, R D; Mishra, S; Srivastava, S; Dwivedi, S; Rai, U N; Yang, X E; Huanji, H; Inouhe, M

    2008-05-01

    Arsenic (As) contamination of water and soil has become a subject of prime interest due to its direct effect on human health through drinking water and food. In present study two varieties (CSG-8962 and C-235) of chickpea, Cicer arietinum L., which is a major supplementary food in many parts of India and a valuable source of protein, has been selected to estimate the level of arsenate in root and shoot of five day old seedlings vis-à-vis effect of arsenate on seedling growth and induction of thiols including glutathione (GSH) and phytochelatins (PCs) and their homologues. Both varieties accumulated arsenate to similar levels and most of the metalloid was confined to roots, only about 2.5% was translocated to shoot. Plant growth was also not affected significantly in both the varieties. Arsenate exposure significantly induced the levels of thiols including PCs and homophytochelatins (hPCs). The induction of thiols was much higher in roots than shoots and was greater in var C-235 between the two tested ones. Thus, both varieties tolerated and detoxified arsenic through chelation with GSH, PCs and hPCs, primarily in roots, however var C-235 performed better

  11. Internet vis-a-vis marine biology

    Digital Repository Service at National Institute of Oceanography (India)

    Chavan, V.S.

    hosted on Internet by leading research organizations worldwide. Present paper reviews the marine biology related information available on Internet and Internet potentials for marine biologists from developing and underdeveloped nations is discussed....

  12. JATIDIRI ORANG MADURA (vis a vis INDUSTRIALISASI

    Directory of Open Access Journals (Sweden)

    Ainurrahman Hidayat Ainurrahman Hidayat

    2012-04-01

    Full Text Available Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 Abstrac From the perspective of industrialization policy, the characterization of Madurese is comprehended as two different kinds of things. It seems that they diametrichally post in the distinctive area. This comprehension clearly misleads and shallowize the essence of Madura industrialization. This article is to find a holisctic understanding on Madura industrialization with characterization as an absolut constitutive element. This is also the reflection of the writer using an object formal approach of characterization theory issued by Alfred North Whitehead. The research source of material object has been the entire thought, comprehension, and Madura industrialization meaning from the writer’s perspective. The results indicates that the characterization of Madurese is tightly connected to personality, identity and the uniqueness of Madurese in interacting with the environment--- religious values, hard-wroker, life survivor, and straight forwarder. The strategical plan must be established on the basis of those characterizations. To seperate diametrichally that characterization with the policy of industrialization is truly marginalized the Madurese. Otherwise, it could be inferred a genocide process against Madurese characterization done gradually from the extreme perspective. Kata-kata kunci identity/characterization, Madura-industrialization, marginalization

  13. ‘Indicator’ carbonaceous phyllite/graphitic schist in the Archean Kundarkocha gold deposit, Singhbhum orogenic belt, eastern India: Implications for gold mineralization vis-a-vis organic matter

    Indian Academy of Sciences (India)

    P R Sahoo; A S Venkatesh

    2014-10-01

    Carbonaceous rocks in the form of graphitic schist and carbonaceous phyllite are the major host rocks of the gold mineralization in Kundarkocha gold deposit of the Precambrian Singhbhum orogenic belt in eastern India. The detection of organic carbon, essentially in the carbonaceous phyllite and graphitized schist within the Precambrian terrain, is noted from this deposit. A very close relationship exists between gold mineralization and ubiquitous carbonaceous rocks containing organic carbon that seems to play a vital role in the deposition of gold in a Precambrian terrain in India and important metallogenetic implications for such type of deposits elsewhere. However, the role played by organic matter in a Precambrian gold deposit is debatable and the mechanism of precipitation of gold and other metals by organic carbon has been reported elsewhere. Fourier transform infrared spectroscopy (FTIR) results and total organic carbon (TOC) values suggest that at least part of the organic material acted as a possible source for the reduction that played a significant role in the precipitation of gold. Lithological, electron probe analysis (EPMA), fluid inclusions associated with gold mineralization, Total Carbon (TC), TOC and FTIR results suggest that the gold mineralization is spatially and genetically associated with graphitic schist, carbonaceous phyllite/shale that are constituted of immature organic carbon or kerogen. Nano-scale gold inclusions along with free milling gold are associated with sulfide mineral phases present within the carbonaceous host rocks as well as in mineralized quartz-carbonate veins. Deposition of gold could have been facilitated due to the organic redox reactions and the graphitic schist and carbonaceous phyllite zone may be considered as the indicator zone.

  14. Macromolecules Vis-a-Vis the Traditions of Chemistry

    Science.gov (United States)

    Flory, Paul J.

    1973-01-01

    Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…

  15. Independence properties Vis-A-Vis several utility representations

    NARCIS (Netherlands)

    Marley, AAJ; Luce, RD

    2005-01-01

    A detailed theoretical analysis is presented of what five utility representations - subjective expected utility (SEU), rank-dependent (cumulative or Choquet) utility (RDU), gains decomposition utility (GDU), rank weighted utility (RWU), and a configural-weight model (TAX) that we show to be equivale

  16. Relasi Antagonistik Barat-Timur: Orientalisme vis a vis Oksidentalisme

    Directory of Open Access Journals (Sweden)

    Moh. Fudholi

    2015-10-01

    Full Text Available Encounter of the East and the West due to such various interests as economic, political, scientific, cultural has been a major factor in the study of western scientists (Orientalists about the East that produces a variety of works in the fields of archeology, history, literature, environment, customs, and Islamic studies. Meanwhile, resistance against Orientalism in the form of Occidentalism, as initiated by Hasan Hanafî, seems to be closely related to ‘obsession’ and hopes of someone who frustrated and dissatisfied with the condition of the world he has dealt with as the project of civilization he offered seemed to be too theoretical to be applied into the form of well established science. This is a fact that, unlike Orientalism that has born from strength, power, and has been then smoothly formed, Occidentalism was created by the East that was defeated and suffered from weakness and at the same time merely has an obsession. In spite of the impression, apparently, what has been attempted in Occidentalism is dismantling the text, another interpretation, and building a new, more proportional context.

  17. Syariah REITs Vis-A-Vis Conventional REITs: An Analysis

    Directory of Open Access Journals (Sweden)

    Nor Edi Azhar binti Mohamad

    2012-07-01

    Full Text Available The development of Islamic capital market products has been highly innovative in Malaysia as has pioneered various innovative Syariah compliant products over the past few years. Of importance is the introduction of the first Syariah real estate investment trusts (S-REITs. In November 2005, The Malaysian Government through the Securities Commission (SC of Malaysia has issued the Guidelines for Islamic Real Estate Investment Trusts (S-REITs. Thus it provides new investment opportunity for investors who wish to invest in real estate through Syariah-compliant capital market instruments. Based on this strategic difference, the purpose of this paper is to provide an understanding on the performances of these two natures of REITs in the Malaysian capital market, namely conventional REITs (C-REITs and Syariah REITs by comparing the risk and return of S-REITs and C-REITs from Malaysia perspective. The secondary data for analysis is retrieved from Bloomberg’s Database of 12 listed REITs in the Bursa Malaysia main board for three year period from 2007 to 2009 with quarterly observation. Sharpe Index, Jensen Index and Treynor Index are used as a proxy to the return of REITs, while beta, standard deviation and coefficient of variation are used as a proxy to represent REITs’s risk. Applying correlations and independent sample t-test, the result has provided evidence on the association between return and risk on REITs.

  18. Directional Antineutrino Detection

    CERN Document Server

    Safdi, Benjamin R

    2014-01-01

    We propose the first truly directional antineutrino detector for antineutrinos above the hydrogen inverse beta decay (IBD) threshold, with potential applications including monitoring for nuclear nonproliferation, spatially mapping geo-neutrinos, characterizing the diffuse supernova neutrino background, and searching for new physics in the neutrino sector. The detector consists of adjacent and separated target and capture scintillator planes. IBD events take place in the target layers, which are thin enough to allow the neutrons to escape without scattering elastically. The neutrons are detected in the thicker, boron-loaded capture layers. The location of the IBD event and the momentum of the positron are determined by tracking the positron's trajectory through the detector. Our design is a straightforward modification of existing antineutrino detectors; a prototype could be built with existing technology.

  19. Directional Antineutrino Detection

    Science.gov (United States)

    Safdi, B. R.; Suerfu, J.

    2014-12-01

    We propose the first truly directional antineutrino detector for antineutrinos near the threshold for the inverse beta decay (IBD) of hydrogen, with potential applications including the spatial mapping of geo-neutrinos, searches for stellar antineutrinos, and the monitoring of nuclear reactors. The detector consists of adjacent and separated target and neutron-capture layers. The IBD events, which result in a neutron and a positron, take place in the target layers. These layers are thin enough so that the neutrons escape without scattering elastically. The neutrons are detected in the thicker neutron-capture layers. The location of the IBD event is determined from the energy deposited by the positron as it slows in the medium and from the two gamma rays that come from the positron annihilation. Since the neutron recoils in the direction of the antineutrino's motion, a line may then be drawn between the IBD event location and the neutron-capture location to approximate the antineutrino's velocity. In some events, we may even measure the positron's velocity, which further increases our ability to reconstruct the antineutrino's direction of motion. Our method significantly improves upon previous methods by allowing the neutron to freely travel a long distance before diffusing and being captured. Moreover, our design is a straightforward modification of existing antineutrino detectors; a prototype could easily be built with existing technology. We verify our design through Monte Carlo simulations in Geant4, using commercially-available boron-loaded plastic scintillators for the target and neutron-capture layer materials. We are able to discriminate from background using multiple coincidence signatures within a short, ~microsecond time interval. We conclude that the detector could likely operate above ground with minimal shielding.

  20. Plasma dark matter direct detection

    CERN Document Server

    Clarke, Jackson D

    2015-01-01

    Dark matter in spiral galaxies like the Milky Way may take the form of a dark plasma. Hidden sector dark matter charged under an unbroken $U(1)'$ gauge interaction provides a simple and well defined particle physics model realising this possibility. The assumed $U(1)'$ neutrality of the Universe then implies (at least) two oppositely charged dark matter components with self-interactions mediated via a massless "dark photon" (the $U(1)'$ gauge boson). In addition to nuclear recoils such dark matter can give rise to keV electron recoils in direct detection experiments. In this context, the detailed physical properties of the dark matter plasma interacting with the Earth is required. This is a complex system, which is here modelled as a fluid governed by the magnetohydrodynamic equations. These equations are numerically solved for some illustrative examples, and implications for direct detection experiments discussed. In particular, the analysis presented here leaves open the intriguing possibility that the DAMA...

  1. Model Independent Direct Detection Analyses

    CERN Document Server

    Fitzpatrick, A Liam; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2012-01-01

    Following the construction of the general effective theory for dark matter direct detection in 1203.3542, we perform an analysis of the experimental constraints on the full parameter space of elastically scattering dark matter. We review the prescription for calculating event rates in the general effective theory and discuss the sensitivity of various experiments to additional nuclear responses beyond the spin-independent (SI) and spin-dependent (SD) couplings: an angular-momentum-dependent (LD) and spin-and-angular-momentum-dependent (LSD) response, as well as a distinction between transverse and longitudinal spin-dependent responses. We consider the effect of interference between different operators and in particular look at directions in parameter space where such cancellations lead to holes in the sensitivity of individual experiments. We explore the complementarity of different experiments by looking at the improvement of bounds when experiments are combined. Finally, our scan through parameter space sho...

  2. The median recoil direction as a WIMP directional detection signal

    OpenAIRE

    Green, Anne M; MORGAN, BEN

    2010-01-01

    Direct detection experiments have reached the sensitivity required to detect dark matter WIMPs. Demonstrating that a putative signal is due to WIMPs, and not backgrounds, is a major challenge however. The direction dependence of the WIMP scattering rate provides a potential WIMP `smoking gun'. If the WIMP distribution is predominantly smooth, the Galactic recoil distribution is peaked in the direction opposite to the direction of Solar motion. Previous studies have found that, for an ideal de...

  3. Direct dark matter detection: The diurnal variation in directional experiments

    CERN Document Server

    Vergados, J D

    2011-01-01

    We present some theoretical results relevant to the direct dark matter detection experiments, paying particular attention to directional experiments, i.e. experiments in which, not only the energy but the direction of the recoiling nucleus is observed. In directional experiments the detection rate depends on the angle between the line observation and the sun's direction of motion. Since, however, the direction of observation is fixed with respect the earth, while the Earth is rotating around its axis, in a directional experiment the angle between the direction of observation and the Sun's direction of motion will change during the day. So the observed signal in such experiments will exhibit a very interesting and characteristic periodic diurnal variation.

  4. Directional detection of galactic dark matter

    CERN Document Server

    Mayet, F; Santos, D

    2012-01-01

    Directional detection is a promising Dark Matter search strategy. Taking advantage on the rotation of the Solar system around the galactic center through the Dark Matter halo, it allows to show a direction dependence of WIMP events that may be a powerful tool to identify genuine WIMP events as such. Directional detection strategy requires the simultaneous measurement of the energy and the 3D track of low energy recoils, which is a common challenge for all current projects of directional detectors.

  5. Theoretical prospects for directional WIMP detection

    CERN Document Server

    O'Hare, Ciaran A J

    2015-01-01

    Direct detection of dark matter with directional sensitivity is a promising concept for improving the search for weakly interacting massive particles. With information on the direction of WIMP induced nuclear recoils one has access to the full 3-dimensional velocity distribution of the local dark matter halo and thus a potential avenue for studying WIMP astrophysics. Furthermore the unique angular signature of the WIMP recoil distribution provides a crucial discriminant from neutrinos which currently represent the ultimate background to direct detection experiments.

  6. Gaze Direction Detection in Autism Spectrum Disorder

    Science.gov (United States)

    Forgeot d'Arc, Baudouin; Delorme, Richard; Zalla, Tiziana; Lefebvre, Aline; Amsellem, Frédérique; Moukawane, Sanaa; Letellier, Laurence; Leboyer, Marion; Mouren, Marie-Christine; Ramus, Franck

    2017-01-01

    Detecting where our partners direct their gaze is an important aspect of social interaction. An atypical gaze processing has been reported in autism. However, it remains controversial whether children and adults with autism spectrum disorder interpret indirect gaze direction with typical accuracy. This study investigated whether the detection of…

  7. The median recoil direction as a WIMP directional detection signal

    CERN Document Server

    Green, Anne M

    2010-01-01

    Direct detection experiments have reached the sensitivity required to detect dark matter WIMPs. Demonstrating that a putative signal is due to WIMPs, and not backgrounds, is a major challenge however. The direction dependence of the WIMP scattering rate provides a potential WIMP `smoking gun'. If the WIMP distribution is predominantly smooth, the Galactic recoil distribution is peaked in the direction opposite to the direction of Solar motion. Previous studies have found that, for an ideal detector, of order 10 WIMP events would be sufficient to reject isotropy, and rule out an isotropic background. We examine how the median recoil direction could be used to confirm the WIMP origin of an anisotropic recoil signal. Specifically we determine the number of events required to reject the null hypothesis that the median direction is random (corresponding to an isotropic Galactic recoil distribution) at 95% confidence. We find that for zero background 31 events are required, a factor of roughly 2 more than are requi...

  8. Directional detection of galactic Dark Matter

    CERN Document Server

    Mayet, F; Bernard, G; Bosson, G; Bourrion, O; Grignon, C; Guillaudin, O; Koumeir, C; Richer, J P; Santos, D; Colas, P; Ferer, E; Giomataris, I; Allaoua, A; Lebreton, L

    2010-01-01

    Directional detection of galactic Dark Matter is a promising search strategy for discriminating geniune WIMP events from background ones. We present technical progress on gaseous detectors as well as recent phenomenological studies, allowing the design and construction of competitive experiments.

  9. High Throughput Direct Detection Doppler Lidar Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Lite Cycles, Inc. (LCI) proposes to develop a direct-detection Doppler lidar (D3L) technology called ELITE that improves the system optical throughput by more than...

  10. Direct Detection of Dynamical Dark Matter

    CERN Document Server

    Dienes, Keith R; Thomas, Brooks

    2012-01-01

    Dynamical dark matter (DDM) is an alternative framework for dark-matter physics in which the dark-matter candidate is an ensemble of constituent fields with differing masses, lifetimes, and cosmological abundances. In this framework, it is the balancing of these quantities against each other across the ensemble as a whole which ensures phenomenological viability. In this paper, we examine the prospects for the direct detection of a DDM ensemble. In particular, we study the constraints imposed by current limits from direct-detection experiments on the parameter space of DDM models, and we assess the prospects for detecting such an ensemble and distinguishing it from traditional dark-matter candidates on the basis of data from the next generation of direct-detection experiments. For concreteness, we focus primarily on the case in which elastic scattering via spin-independent interactions dominates the interaction rate between atomic nuclei and the constituent particles of the ensemble. We also briefly discuss t...

  11. Edge detection based on directional space

    Institute of Scientific and Technical Information of China (English)

    YUAN Wei-qi; LI De-sheng

    2006-01-01

    A new method for edge detection based on directional space is proposed.The principle is that:firstly,the directional differential space is set up in which the ridge edge pixels and valley edge pixels are abstracted with the help of the method of logical judgments along the direction of differential function,forming a directional roof edge map;secondly,step edge pixels are abstracted between the neighboring directional ridge edge and directional valley edge along the direction of differential function;finally,the ridge edge map,valley edge map and step edge map gained along different directions are combined into corresponding ridge edge map,valley edge map and step edge map.This method is different from classical algorithms in which the gray differential values of the mutual vertical direction are combined into one gradient value.The experiment of edge detection is made for the images of nature scenery,human body and accumulative raw material,whose result is compared with the one of classical algorithms and showing the robustness of the proposed method.

  12. Disentangling Dark Matter Dynamics with Directional Detection

    Energy Technology Data Exchange (ETDEWEB)

    Lisanti, Mariangela; Wacker, Jay G.; /SLAC

    2009-12-16

    Inelastic dark matter reconciles the DAMA anomaly with other null direct detection experiments and points to a non-minimal structure in the dark matter sector. In addition to the dominant inelastic interaction, dark matter scattering may have a subdominant elastic component. If these elastic interactions are suppressed at low momentum transfer, they will have similar nuclear recoil spectra to inelastic scattering events. While upcoming direct detection experiments will see strong signals from such models, they may not be able to unambiguously determine the presence of the subdominant elastic scattering from the recoil spectra alone. We show that directional detection experiments can separate elastic and inelastic scattering events and discover the underlying dynamics of dark matter models.

  13. Microgels for multiplex and direct fluorescence detection

    Science.gov (United States)

    Causa, Filippo; Aliberti, Anna; Cusano, Angela M.; Battista, Edmondo; Netti, Paolo A.

    2015-05-01

    Blood borne oligonucleotides fragments contain useful clinical information whose detection and monitoring represent the new frontier in liquid biopsy as they can transform the current diagnosis procedure. For instance, recent studies have identified a new class of circulating biomarkers such as s miRNAs, and demonstrated that changes in their concentration are closely associated with the development of cancer and other pathologies. However, direct detection of miRNAs in body fluids is particularly challenging and demands high sensitivity -concentration range between atto to femtomolarspecificity, and multiplexing Here we report on engineered multifunctional microgels and innovative probe design for a direct and multiplex detection of relevant clinical miRNAs in fluorescence by single particle assay. Polyethyleneglycol-based microgels have a coreshell architecture with two spectrally encoded fluorescent dyes for multiplex analyses and are endowed with fluorescent probes for miRNA detection. Encoding and detection fluorescence signals are distinguishable by not overlapping emission spectra. Tuneable fluorescence probe conjugation and corresponding emission confinement on single microgel allows for enhanced target detection. Such suspension array has indeed high selectivity and sensitivity with a detection limit of 10-15 M and a dynamic range from 10-9 to 10-15 M. We believe that sensitivity in the fM concentration range, signal background minimization, multiplexed capability and direct measurement of such microgels will translate into diagnostic benefits opening up new roots toward liquid biopsy in the context of point-of-care testing through an easy and fast detection of sensitive diagnostic biomarkers directly in serum.

  14. Comparing Conventional Bank Credit Vis A Vis Shariah Bank Musharakah: Experimental Economic Approach

    Directory of Open Access Journals (Sweden)

    Muhamad Abduh

    2008-01-01

    Full Text Available Central Bank of Indonesia with dual banking system – i.e Shariah and Conventional Bank – keep on developing system that considered as an answer to generate the national economic growth. One of the banking activities that emphasized by the Central Bank of Indonesia is fund distribution through either conventional bank credit or shariah bank fi nancing. Having the Experimental Economic Approach based on Induced Value Theory and employing ANOVA, this paper found that shariah bank musharakah fi nancing system would come up with higher profi t opportunity compare to conventional credit system. One main reason is that musharakah fi nancing in shariah bank applies profi t and lost sharing (PLS scheme so that will not be a burden to the customer when he fi nd low profi t.Keywords: Credit Loan, Musharakah Financing, Induced Value Theory, Experimental Economic Approach, Analysis of Variance (ANOVA.

  15. ROLE OF STATISTICAL VIS-A-VIS PHYSICS-OFFAILURE METHODS IN RELIABILITY ENGINEERING

    Directory of Open Access Journals (Sweden)

    P.V.Varde

    2009-01-01

    Full Text Available Traditionally the statistical or more specifically probabilistic methods form the basicframework for assessing the reliability characteristics of the components. However the recenttrend for predicting the reliability or life of the component involves application of physics-offailuremethods. This rather new approach is finding wider application as it is based on basicfundamentals of science and thereby provides an improved framework to understand the failuremechanism. Since accelerated testing of component forms part of this approach, the prediction oftime-to-failure of the components is more accurate compared to the existing methods whichdepends only historical data and its evaluation using probabilistic methods. The new approach isall the more relevant when it comes to assessment of reliability of new components as thetraditional probabilistic approach is not adequate to predict reliability of new components as itdepends on historical data for prediction of reliability.In view of the above this paper investigates the role of statistical or probabilisticapproach and physics-of-failure approach for reliability assessment of engineering components ingeneral and electronics components in particular.

  16. THE DYNAMICS OF THE FORM OF NUSANTARA MOSQUE: ARCHITECTURAL HOMOGENEITY VIS A VIS ARCHITECTURAL HYBRIDITY

    Directory of Open Access Journals (Sweden)

    Pudji Pratitis Wismantara

    2012-09-01

    Full Text Available There are two points of departure in the design of mosque architecture in Nusantara, namely architectural homogeneity and architectural hybridity. Each provides the legitimacy of the architecture of identity formation. This paper seeks to explore the comparative, the concept of homogeneity and hybridity architecture, with a critical theory approach. The  results of this search is, the concept of architectural homogeneity establishing assumption that certain architectural forms are supposed to represent "universal identity and modernity" of Muslim architecture. Meanwhile, the concept of architectural hybridity to show enrichment architecture identity because of the attempt to combine aspects of the universality of Islam with locality of Nusantara. Both these aspects can be positioned as the two subjects of mutual dialogue in a parallel position. As architecture strategy, the concept of hybridity reflects the effort or ijtihad in interpreting local and universal contextuality in the contemporary conditions that are constantly evolving and open.Keywords: Nusantara mosque, hybridity of architecture, homogeneity of architecture, architecture strategy

  17. Chemical characterization of meltwater from East Rathong glacier vis-a-vis Western Himalayan glaciers

    Digital Repository Service at National Institute of Oceanography (India)

    Sharma, B.M.; Tayal, S.; Chakraborty, P.; Bharat, G.K.

    at high altitudes. This study elucidate the variation of major cations (Li+, Mg2+, NH4 +, K+, Na+, Ca2+) and major anions (PO4 3-, F-, NO2...

  18. The United States Vis-a-Vis Peru: A Strategy for Defeating Their Communist Insurgency.

    Science.gov (United States)

    1992-02-13

    43.Ev OF "VDNGI5PONSOFNG ft OFF SLczt PROuMAIENT BMSAIDENT M MMI IL ADM $$ KAY . a W C*COW 10SNC OF FUO MMS t1. TITLE P’cA* SocwN Coawfte’t The Uni ted...at the National University of San Cristobal de Huamanga in Ayacucho, Guzman has been the primary force behind the movement’s ideological development

  19. Russian Energy Policy vis-a-vis Europe: Natural Resources as a Means of Foreign Policy

    Science.gov (United States)

    2012-06-01

    words, states’ behavior is stipulated by the “language of power and interests”39. Another contemporary scholar, Hans Joachim Morgenthau , views...their utility in light both of those preferences and of their perceptions of the nature of reality.” Finally, Morgenthau sees the balance of power... Morgenthau , revised by Kenneth W. Thompson, Politics among Nations: The Struggle for Power and Peace (New York: McGraw-Hill, 1993), 4. 41 Keohane

  20. [Agreement and asymmetry. Population and wages vis vis a vis the globalization of the economy].

    Science.gov (United States)

    Jusidman, C

    1991-01-01

    The free flow of labor and services across national borders will be 1 of the most difficult problems of future negotiations for integration of the markets of the US, Mexico, and Canada. The free flow of products and increasingly of capital have been accepted in general terms, and land and natural resources are entering the globalization process through external investment. In the trilateral free trade treaty between Mexico, the US, and Canada, the US is particularly interested in access to the service markets of Canada and Mexico. Mexico would like freer access to the other markets, and to protect its migrant workers. Canada needs foreign labor for its agricultural production. All 3 countries would potentially benefit from more flexible population movement. Mexico, Canada, and the US have very different structures, population dynamics, and labor markets. Mexico's population growth rate is the highest and its active population is increasing the most rapidly. Mexico must generate 1 million new jobs annually, the US requires 2.1 million, and Canada around 230,000. The 3 countries, with about 360 million inhabitants in 1991, must create 3.4 million new jobs annually. Because of differences in occupational and activity structures, levels of skill, salaries, productivity, and cultures of work in the 3 countries, it is clear that the new jobs correspond to different labor markets, making predictions about average salaries difficult. The 1990 average minimum wage in the US was about 10 times that of Mexico, while the average minimum in the manufacturing sector as about 7 times greater. The degree to which the trilateral treaty can contribute to reducing the differential is an important question. 3 possible scenarios suggest themselves. If current restrictions on mobility of workers are maintained, wage disparities will probably continue unless there is a very great foreign investment in activities throughout Mexico that require significant labor inputs. This would probably have a positive effect on unskilled wages. If Mexico does not open its service market, foreign companies would need to train and advance Mexican workers. A 2nd scenario assumes a general easing of restrictions for high-tech services while restrictions remain for unskilled workers. Unemployment among Mexican professionals and technicians in service industries might increase if they were unable to compete. The final scenario represents the longterm possibility of eliminating all restrictions on labor mobility between the 3 countries, which would result in improving the quality of life and working conditions of a large number of persons. Regardless of the outcome, Mexico faces the task of increasing the productivity of its labor force.

  1. The Achuar People of the Corrientes Basin: The State vis a vis its own Paradigm

    Directory of Open Access Journals (Sweden)

    Alberto Chirif

    2010-12-01

    Full Text Available The paper analyses the events leading to the 2006 uprising of theAchuar people of the Corrientes basin (Loreto, who have sufferedfour decades of contamination due to oil exploitation. It also examinesthe Peruvian State’s and the oil company´s attitudes throughoutthe protest and after signing an agreement aiming to stop contaminationand remedy environmental and social havoc. Materials usedinclude interviews conducted with different stake holders and a widerange of written records, such as political declarations, reports onlocal people´s health´s and remediation work, agreement documentsand letters exchanged between stake holders, as well as historicaland socio economic background information. Findings highlight thestrength of organized indigenous people´s claiming for their rights;the greater commitment to assuming responsibility shown by the oilcompany´s as compared to the Peruvian State; and the weakness ofa political discourse equating development with the extraction ofnatural resources. The main conclusion is that the Peruvian Statedoes not fulfill the paradigm set in the first article of the Constitution:that the defense of the human person and the respect of its dignityare its supreme aim.

  2. Public-Private Partnerships: an International Development vis a vis Indonesia Experience

    Directory of Open Access Journals (Sweden)

    Rizal Yaya

    2014-08-01

    Full Text Available For more than two decades, Public Private Partnerships (PPP had developed worldwide as an instrument to procure public infrastructure where government funds are limited. This practice supports the covergent theory of the public and private sector. Indonesia experience with PPP follows most of what had been done by countries overseas with some deviations. The main reasons for going for PPP for Indonesia government is to fill the gap in finance and capability in procuring the infrastructure. Unofficial reason such as for off-balance sheet and ideological is not relevant. Up to now, the Government only allow investment in hard economic infrastructure. Instead of using pure private finance, Indonesia Government facilitates public funds either from Central Government or Local Governments to finance PPP projects. In most cases, this involvement is because of marginality of the project. This results in the condition where the Government still has dominant role in the existing PPP projects. Compared to the PPP framework in other countries like in the UK, Indonesia PPP lacks of attention on output specification and risk transfer. This may be because of lacking of experiences as well as due to high degree of Government involvement. Rigorous policy is needed in this area to ensure Government to achieve better value for money.

  3. Literacy and Hegemony: Critical Pedagogy Vis-a-vis Contending Paradigms

    Science.gov (United States)

    Chege, Mwangi

    2009-01-01

    Critical pedagogy has become commonplace in contemporary academe. Despite its prominence, the pedagogy continues to face relentless attacks: some scholars have dismissed the pedagogy as essentialist, populist, and unpatriotic, among other labels. The fact of the matter is that these critiques are driven by ideologically masked epistemologies. By…

  4. Development and Environment: An Assessment of Population Growth vis-a-vis Soil Erosion in Nepal

    Directory of Open Access Journals (Sweden)

    Rishikesh Pandey

    2014-05-01

    Full Text Available This paper discusses the environmental myths and narratives prevailing in Nepal in reference to the population growth and soil erosion. Soil erosion is taken as primary element of environmental degradation by the theory of the Himalayan Environmental Degradation (HED. Many myths and narratives were generated by the vested interest groups to develop the HED. Population growth and over exploitation of natural resource were considered as the prominent causes of soil erosion related environmental degradation. The myths and narratives based on the theory of the HED are still influential in development and environmental policy process in Nepal. In this background this paper highlights some of the research findings that are contrary to conventional belief i.e. population growth lead to soil erosion. The paper is based on literature review. The research evidences from both social and natural sciences are entertained. This paper generates alternative thinking to end the hegemony and unquestionable acceptance of the findings of research undertaken by 'Western, White men' as truth; and their recommendations as the 'blue print' solutions. Critics over orthodox environmentalism and neo-Malthusian accounts are made to validate the ‘hybrid knowledge’ generated in this paper. There are evidences that population pressure have promoted soil erosion. However, Himalayan environmental dynamism which is purely a natural process is far more responsible for soil erosion in the Himalaya. Hence, it is suggested that a critical assessment of any ‘facts’ obtained from research should be made before making them the narratives and reflecting them in policy process. DOI: http://dx.doi.org/10.3126/dsaj.v7i0.10442 Dhaulagiri Journal of Sociology and Anthropology Vol. 7, 2013; 173-196

  5. Results and Perspectives in HEP, vis-a-vis Lattice QCD

    CERN Document Server

    Mangano, Michelangelo L

    2000-01-01

    I review in this presentation some aspects of phenomenology in High Energy Physics which are related to recent and possibly future progress in lattice QCD. In particular, I cover (i) the extraction of CKM matrix elements from B physics, (ii) the determination of epsilon'/epsilon, as well as (iii) some issues emerged in the physics of high energy jets produced in hadronic collisions, where input from non-perturbative calculations would benefit our capability to perform better theoretical predictions.

  6. Personal vis-a-vis social responsibility for disparities in health status: An issue of justice.

    Science.gov (United States)

    Jha, Ayan; Dobe, Madhumita

    2016-01-01

    Health inequities are disparities which can be avoided through rational actions on the part of policymakers. Such inequalities are unnecessary and unjust and may exist between and within nations, societies, and population groups. Social determinants such as wealth, income, occupation, education, gender, and racial/ethnic groups are the principal drivers of this inequality since they determine the health risks and preventive behaviors, access to, and affordability of health care. Within this framework, there is a debate on assigning a personal responsibility factor over and above societal responsibility to issues of ill health. One school of philosophy argues that when individuals are worse-off than others for no fault of their own, it is unjust, as opposed to health disparities that arise due to avoidable personal choices such as smoking and drug addiction for which there should (can) be a personal responsibility. Opposing thoughts have pointed out that the relative socioeconomic position of an individual dictates how his/her life may progress from education to working conditions and aging, susceptibility to diseases and infirmity, and the consequences thereof. The existence of a social gradient in health outcomes across populations throughout the world is a testimony to this truth. It has been emphasized that assuming personal responsibility for health in public policy-making can only have a peripheral place. Instead, the concept of individual responsibility should be promoted as a positive concept of enabling people to gain control over the determinants of health through conscious, informed, and healthy choices.

  7. Usable Security and E-Banking: ease of use vis-a-vis security

    Directory of Open Access Journals (Sweden)

    Morten Hertzum

    2004-05-01

    Full Text Available Electronic banking must be secure and easy to use. An evaluation of six Danish web-based electronic banking systems indicates that the systems have serious weaknesses with respect to ease of use. Our analysis of the weaknesses suggests that security requirements are among their causes and that the weaknesses may in turn cause decreased security. We view the conflict between ease of use and security in the context of usable security, a concept that is intended to match security principles and demands against user knowledge and motivation. Automation, instruction, and understanding can be identified as different approaches to usable security. Instruction is the main approach of the systems evaluated; automation relieves the user from involvement in security, as far as possible; and understanding goes beyond step-by-step instructions, to enable users to act competently and safely in situations that transcend preconceived instructions. We discuss the pros and cons of automation and understanding as alternative approaches to the design of web-based e-banking systems.

  8. Future challenges for explosive industry vis-a-vis underground coal blasting

    Energy Technology Data Exchange (ETDEWEB)

    Roy, S.K.; Singh, R.R.; Ram, P.; Paul, R.K. [Central Mining Research Institute, Dhanbad (India)

    2002-03-01

    It is apprehended that with contribution of open cast mines in total production of coal going up further, the deterioration trend in coal quality will continue. Production from underground coal mines has to be increased in coming years for sustainable growth of coal industry and to meet the ever increasing power demand. So, to compete with the mechanical cutting of coal, the explosive industry needs a breakthrough in innovativeness, production and uses. The explosive industry and concerned organisations have to accept future challenges in development of safer products, more efficient application technique and strict quality control of products. Change in some of the regulations governing the uses of explosive in underground coal blasting also is called for. 14 refs.

  9. Career Intent of Women VIS A VIS Men in the United States Air Force.

    Science.gov (United States)

    1970-09-01

    4 4.0 0 r- 0LA C) .. r 0 0 w -4 Q) H .. .- 4 .1J4 rq I co2 a)4 I- I*Iit U E-4 rn r- 040 0 4J4 M 4~ 44 r. u 4.3 QJC’ r.w2 wn 0)ir-r4al Q 0 04 w= H 0...food stamps and monetary jayment (,iON? C S EChITY: Cuarante,, em ploymient;: retitement benefits; insurance; pLct-.ction Eor self and :amily. 29. ’o

  10. Christian Theological Attitudes vis-a-vis Islam: The Effect on West-Muslim Relations

    Science.gov (United States)

    2002-12-01

    which those attitudes were formed, and that understanding how those attitudes were formed explains Christianity’s “ exclusivist ” attitude and refusal to...New York: Vintage Books, 1997). 194 Chapman, 262. 63 Muslims or otherwise, will fall in defeat at the Lord’s coming.195 Such an exclusivist ...followers need to convert to Christianity or face eternal separation from God. This “ exclusivist ” perspective leaves little room for ecumenism. One

  11. First evidence of denitrification vis-a-vis monsoon in the Arabian Sea since late Miocene

    Digital Repository Service at National Institute of Oceanography (India)

    Tripathi, S.; Tiwari, M.; Lee, J.; Khim, B.-K.; Pandey, D.K.; Clift, P.D.; Kulhanek, D.K.; Ando, S.; Bendle, J.A.P.; Aharonovich, S.; Griffith, E.M.; Gurumurthy, G.P.; Hahn, A.; Iwai, M.; Kumar, A.; Kumar, A.G.; Liddy, H.M.; Lu, H.; Lyle, M.W.; Mishra, R.; Radhakrishna, T.; Routledge, C.M.; Saraswat, R.; Saxena, R.; Scardia, G.; Sharma, G.K.; Singh, A.D.; Steinke, S.; Suzuki, K.; Tauxe, L.; Xu, Z.; Yu, Z.

    in contrast to a few previous studies, (ii) on tectonic timescale, both the SAM and the East Asian Monsoon (EAM) varied synchronously, (iii) the first evidence of denitrification and productivity/SAM intensification was at ~3.2–2.8 Ma that coincided with Mid...

  12. Evolution of Zipf's Law for Indian Urban Agglomerations vis-\\`{a}-vis Chinese Urban Agglomerations

    CERN Document Server

    Gangopadhyay, Kausik

    2012-01-01

    We investigate into the rank-size distributions of urban agglomerations for India between 1981 to 2011. The incidence of a power law tail is prominent. A relevant question persists regarding the evolution of the power tail coefficient. We have developed a methodology to meaningfully track the power law coefficient over time, when a country experience population growth. A relevant dynamic law, Gibrat's law, is empirically tested in this connection. We argue that these empirical findings for India goes in contrast with the findings in case of China, another country with population growth but monolithic political system.

  13. Personal vis-a-vis social responsibility for disparities in health status: An issue of justice

    Directory of Open Access Journals (Sweden)

    Ayan Jha

    2016-01-01

    Full Text Available Health inequities are disparities which can be avoided through rational actions on the part of policymakers. Such inequalities are unnecessary and unjust and may exist between and within nations, societies, and population groups. Social determinants such as wealth, income, occupation, education, gender, and racial/ethnic groups are the principal drivers of this inequality since they determine the health risks and preventive behaviors, access to, and affordability of health care. Within this framework, there is a debate on assigning a personal responsibility factor over and above societal responsibility to issues of ill health. One school of philosophy argues that when individuals are worse-off than others for no fault of their own, it is unjust, as opposed to health disparities that arise due to avoidable personal choices such as smoking and drug addiction for which there should (can be a personal responsibility. Opposing thoughts have pointed out that the relative socioeconomic position of an individual dictates how his/her life may progress from education to working conditions and aging, susceptibility to diseases and infirmity, and the consequences thereof. The existence of a social gradient in health outcomes across populations throughout the world is a testimony to this truth. It has been emphasized that assuming personal responsibility for health in public policy-making can only have a peripheral place. Instead, the concept of individual responsibility should be promoted as a positive concept of enabling people to gain control over the determinants of health through conscious, informed, and healthy choices.

  14. Dark matter direct-detection experiments

    Science.gov (United States)

    Marrodán Undagoitia, Teresa; Rauch, Ludwig

    2016-01-01

    In recent decades, several detector technologies have been developed with the quest to directly detect dark matter interactions and to test one of the most important unsolved questions in modern physics. The sensitivity of these experiments has improved with a tremendous speed due to a constant development of the detectors and analysis methods, proving uniquely suited devices to solve the dark matter puzzle, as all other discovery strategies can only indirectly infer its existence. Despite the overwhelming evidence for dark matter from cosmological indications at small and large scales, clear evidence for a particle explaining these observations remains absent. This review summarises the status of direct dark matter searches, focusing on the detector technologies used to directly detect a dark matter particle producing recoil energies in the keV energy scale. The phenomenological signal expectations, main background sources, statistical treatment of data and calibration strategies are discussed.

  15. Dark matter direct-detection experiments

    CERN Document Server

    Undagoitia, Teresa Marrodan

    2015-01-01

    In the past decades, several detector technologies have been developed with the quest to directly detect dark matter interactions and to test one of the most important unsolved questions in modern physics. The sensitivity of these experiments has improved with a tremendous speed due to a constant development of the detectors and analysis methods, proving uniquely suited devices to solve the dark matter puzzle, as all other discovery strategies can only indirectly infer its existence. Despite the overwhelming evidence for dark matter from cosmological indications at small and large scales, a clear evidence for a particle explaining these observations remains absent. This review summarises the status of direct dark matter searches, focussing on the detector technologies used to directly detect a dark matter particle producing recoil energies in the keV energy scale. The phenomenological signal expectations, main background sources, statistical treatment of data and calibration strategies are discussed.

  16. Direct detection of dark matter axions with directional sensitivity

    CERN Document Server

    Irastorza, Igor G

    2012-01-01

    We study the directional effect of the expected axion dark matter signal in a resonant cavity of an axion haloscope detector, for cavity geometries not satisfying the condition that the axion de Broglie wavelength is much larger than the cavity dimensions. We focus on long thin cavities immersed in dipole magnets and find, for appropriately chosen cavity lengths, an O(1) modulation of the signal with the cavity orientation with respect the momentum distribution of the relic axion background predicted by the isothermal sphere model for the galactic dark matter halo. This effect can be exploited to design directional axion dark matter detectors, providing an unmistakable signature of the extraterrestrial origin of a possible positive detection. Moreover, the precise shape of the modulation may give information of the galactic halo distribution and, for specific halo models, give extra sensitivity for higher axion masses.

  17. Scalar Dark Matter: Direct vs. Indirect Detection

    CERN Document Server

    Duerr, Michael; Smirnov, Juri

    2015-01-01

    We revisit the simplest model for dark matter. In this context the dark matter candidate is a real scalar field which interacts with the Standard Model particles through the Higgs portal. We discuss the relic density constraints as well as the predictions for direct and indirect detection. The final state radiation processes are investigated in order to understand the visibility of the gamma lines from dark matter annihilation. We find two regions where one could observe the gamma lines at gamma-ray telescopes. We point out that the region where the dark matter mass is between 100 and 300 GeV can be tested in the near future at direct and indirect detection experiments.

  18. Direct optical nanoscopy with axially localized detection

    CERN Document Server

    Bourg, N; Dupuis, G; Barroca, T; Bon, P; Lécart, S; Fort, E; Lévêque-Fort, S

    2014-01-01

    Evanescent light excitation is widely used in super-resolution fluorescence microscopy to confine light and reduce background noise. Herein we propose a method of exploiting evanescent light in the context of emission. When a fluorophore is located in close proximity to a medium with a higher refractive index, its near-field component is converted into light that propagates beyond the critical angle. This so-called Supercritical Angle Fluorescence (SAF) can be captured using a hig-NA objective and used to determine the axial position of the fluorophore with nanometer precision. We introduce a new technique for 3D nanoscopy that combines direct STochastic Optical Reconstruction Microscopy (dSTORM) imaging with dedicated detection of SAF emission. We demonstrate that our approach of a Direct Optical Nanoscopy with Axially Localized Detection (DONALD) yields a typical isotropic 3D localization precision of 20 nm.

  19. Dark matter directional detection with MIMAC

    CERN Document Server

    Grignon, C; Bosson, G; Bourrion, O; Guillaudin, O; Koumeir, C; Mayet, F; Santos, D; Colas, P; Ferrer, E; Giomataris, Yu

    2009-01-01

    MiMac is a project of micro-TPC matrix of gaseous (He3, CF4) chambers for direct detection of non-baryonic dark matter. Measurement of both track and ionization energy will allow the electron-recoil discrimination, while access to the directionnality of the tracks will open a unique way to distinguish a geniune WIMP signal from any background. First reconstructed tracks of 5.9 keV electrons are presented as a proof of concept.

  20. On the direct detection of gravitational waves

    Science.gov (United States)

    Pustovoit, V. I.

    2016-10-01

    Different types of gravitational wave (GW) detectors are considered. It is noted that interferometric techniques offer the greatest prospects for GW registration due to their high sensitivity and extremely wide frequency band. Using laser interferometers, proposed as far back as 1962 in the work by M E Gertsenshtein and V I Pustovoit published in Russian (Zh. Eksp. Teor. Fiz., vol. 43, p. 605, 1962) and in English translation (Sov. Phys. JETP, vol. 16, p. 433, 1963), it proved possible for the first time to directly detect GW emission from a merger of two black holes. It is noted that the assertion that Gertsen-shtein-Pustovoit's work was unknown to some of those experts involved in direct GW detection is inconsistent with reality. The problems of high-power laser radiation affecting the electrostatic polarization of free-mass mirrors are discussed. It is shown that mirror polarization can lead to additional links with electrically conducting elements of the design resulting in the interferometer's reduced sensitivity. Some new prospects for developing high reflection structures are discussed and heat extraction problems are considered. This article is the revised and extended version of the report “On the first direct detection of gravitational waves” delivered by V I Pustovoit at the Scientific Session of the Physical Sciences Division of the Russian Academy of Sciences (March 2, 2016). All other reports presented at the session were published in the preceding issue of Physics-Uspekhi (September 2016) (see Refs [108, 111-113]). (Editorial note)

  1. Coaxial direct-detection lidar-system

    DEFF Research Database (Denmark)

    2014-01-01

    The invention relates to a coaxial direct-detection LIDAR system for measuring velocity, temperature and/or particulate density. The system comprises a laser source for emitting a laser light beam having a lasing center frequency along an emission path. The system further comprises an optical...... frequency and/or the center filter frequency may be scanned. The invention further relates to an aircraft airspeed measurement device, and a wind turbine airspeed measurement device comprising the LIDAR system....... delivery system arranged in the emission path of the laser source, the optical delivery system being arranged for delivering the laser light beam in a measuring direction, the optical delivery system further being configured for collecting a return signal backscattered along the measuring direction...

  2. Complementarity between collider, direct detection, and indirect detection experiments

    CERN Document Server

    Cahill-Rowley, Matthew

    2014-01-01

    We examine the capabilities of planned direct detection, indirect detection, and collider experiments in exploring the 19-parameter p(henomenological)MSSM, focusing on the complementarity between the different search techniques. In particular, we consider dark matter searches at the 7, 8 (and eventually 14) TeV LHC, \\Fermi, CTA, IceCube/DeepCore, and LZ. We see that the search sensitivities depend strongly on the WIMP mass and annihilation mechanism, with the result that different search techniques explore orthogonal territory. We also show that advances in each technique are necessary to fully explore the space of Supersymmetric WIMPs.

  3. Bayesian analysis of multiple direct detection experiments

    CERN Document Server

    Arina, Chiara

    2013-01-01

    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the classical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for th...

  4. Detectability of ranking hierarchies in directed networks

    CERN Document Server

    Letizia, Elisa; Lillo, Fabrizio

    2016-01-01

    Identifying hierarchies and rankings of nodes in directed graphs is fundamental in many applications such as social network analysis, biology, economics, and finance. A recently proposed method identifies the hierarchy by finding the ordered partition of nodes which minimizes a score function, termed agony. This function penalizes the links violating the hierarchy in a way depending on the strength of the violation. To investigate the detectability of ranking hierarchies we introduce an ensemble of random graphs, the Hierarchical Stochastic Block Model. We find that agony may fail to identify hierarchies when the structure is not strong enough and the size of the classes is small with respect to the whole network. We analytically characterize the detectability threshold and we show that an iterated version of agony can partly overcome this resolution limit.

  5. Dark Matter directional detection with MIMAC

    CERN Document Server

    Riffard, Q; Bosson, G; Bourrion, O; Guillaudin, O; Lamblin, J; Mayet, F; Muraz, J -F; Richer, J -P; Santos, D; Lebreton, L; Maire, D; Busto, J; Brunner, J; Fouchez, D

    2013-01-01

    Directional detection is a promising direct Dark Matter (DM) search strategy. The angular distribution of the nuclear recoil tracks from WIMP events should present an anisotropy in galactic coordinates. This strategy requires both a measurement of the recoil energy with a threshold of about 5 keV and 3D recoil tracks down to few millimeters. The MIMAC project, based on a \\textmu-TPC matrix, with $CF_4$ and $CHF_3$, is being developed. In June 2012, a bi-chamber prototype was installed at the LSM (Laboratoire Souterrain de Modane). A preliminary analysis of the first four months data taking allowed, for the first time, the observation of recoils from the $\\mathrm{^{222}Rn}$ progeny.

  6. Direct dark matter detection: the next decade

    CERN Document Server

    Baudis, Laura

    2012-01-01

    Direct dark matter searches are promising techniques to identify the nature of dark matter particles. I describe the future of this field of research, focussing on the question of what can be achieved in the next decade. I will present the main techniques and R&D projects that will allow to build so-called ultimate WIMP detectors, capable of probing spin-independent interactions down to the unimaginably low cross section of 1e-48 cm2, before the irreducible neutrino background takes over. If a discovery is within the reach of a near-future dark matter experiment, these detectors will be able to constrain WIMP properties such as its mass, scattering cross section and possibly spin. With input from the LHC and from indirect searches, direct detection experiments will hopefully allow to determine the local density and to constrain the local phase-space structure of our dark matter halo.

  7. Direct Path Detection Method in Indoor Location

    Institute of Scientific and Technical Information of China (English)

    HUA Hu; LI Zheng

    2006-01-01

    A search algorithm for the detection of a direct path signal in the presence of dense multipath in indoor environment using UWB is Proposed. This algorithm is based on signal correlation and differential coefficient. Statistical analysis of the algorithm is given out and computer simulation results are presented to validate the effectiveness of the algorithm.The results based on the algorithm proposed are compared with those based on Maximum Likelihood Estimator(MLE)and Peak Tracking(PT)in the simulation which shows that this algorithm achieves the highest accuracy in most cases and gives out relatively stable results in different Signal Noise Ratio(SNR).

  8. Direct optical nanoscopy with axially localized detection

    Science.gov (United States)

    Bourg, N.; Mayet, C.; Dupuis, G.; Barroca, T.; Bon, P.; Lécart, S.; Fort, E.; Lévêque-Fort, S.

    2015-09-01

    Evanescent light excitation is widely used in super-resolution fluorescence microscopy to confine light and reduce background noise. Here, we propose a method of exploiting evanescent light in the context of emission. When a fluorophore is located in close proximity to a medium with a higher refractive index, its near-field component is converted into light that propagates beyond the critical angle. This so-called supercritical-angle fluorescence can be captured using a high-numerical-aperture objective and used to determine the axial position of the fluorophore with nanometre precision. We introduce a new technique for three-dimensional nanoscopy that combines direct stochastic optical reconstruction microscopy (dSTORM) with dedicated detection of supercritical-angle fluorescence emission. We demonstrate that our approach of direct optical nanoscopy with axially localized detection (DONALD) typically yields an isotropic three-dimensional localization precision of 20 nm within an axial range of ∼150 nm above the coverslip.

  9. Bayesian analysis of multiple direct detection experiments

    Science.gov (United States)

    Arina, Chiara

    2014-12-01

    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the frequentist statistical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for their excessive complexity. Secondly, we confront several coherent scattering models to determine the current best physical scenario compatible with the experimental hints. We find that exothermic and inelastic dark matter are moderatly disfavored against the elastic scenario, while the isospin violating model has a similar evidence. Lastly the Bayes' factor gives inconclusive evidence for an incompatibility between the data sets of XENON100 and the hints of detection. The same question assessed with goodness of fit would indicate a 2 σ discrepancy. This suggests that more data are therefore needed to settle this question.

  10. Dark Matter Direct Detection with Accelerometers

    CERN Document Server

    Graham, Peter W; Mardon, Jeremy; Rajendran, Surjeet; Terrano, William A

    2015-01-01

    The mass of the dark matter particle is unknown, and may be as low as ~$10^{-22}$ eV. The lighter part of this range, below ~eV, is relatively unexplored both theoretically and experimentally but contains an array of natural dark matter candidates. An example is the relaxion, a light boson predicted by cosmological solutions to the hierarchy problem. One of the few generic signals such light dark matter can produce is a time-oscillating, EP-violating force. We propose searches for this using accelerometers, and consider in detail the examples of torsion balances, atom interferometry, and pulsar timing. These approaches have the potential to probe large parts of unexplored parameter space in the next several years. Thus such accelerometers provide radically new avenues for the direct detection of dark matter.

  11. The Earth's velocity for direct detection experiments

    CERN Document Server

    McCabe, Christopher

    2013-01-01

    The Earth's velocity relative to the Sun in galactic coordinates is required in the rate calculation for direct detection experiments. We provide a rigorous derivation of this quantity to first order in the eccentricity of the Earth's orbit. We also discuss the effect of the precession of the equinoxes, which has previously been ignored. Comparing with other expressions in the literature, we confirm that the expression of Lee, Lisanti and Safdi is correct, while the expression of Lewin and Smith, the de facto standard expression, contains an error. For calculations of the absolute event rate, the leading order expression is sufficient while for modulation searches, an expression with the eccentricity is required for accurate predictions of the modulation phase.

  12. Direct Detection of Dark Matter Debris Flows

    CERN Document Server

    Kuhlen, Michael; Spergel, David N

    2012-01-01

    Tidal stripping of dark matter from subhalos falling into the Milky Way produces narrow, cold tidal streams as well as more spatially extended "debris flows" in the form of shells, sheets, and plumes. Here we focus on the debris flow in the Via Lactea II simulation, and show that this incompletely phase-mixed material exhibits distinctive high-velocity behavior. Unlike tidal streams, which may not necessarily intersect the Earth's location, debris flow is spatially uniform at 8 kpc and thus guaranteed to be present in the dark matter flux incident on direct detection experiments. At Earth-frame velocities greater than 450 km/s, debris flow comprises more than half of the dark matter at the Sun's location, and up to 80% at even higher velocities. Therefore, debris flow is most important for experiments that are particularly sensitive to the high velocity tail of the dark matter distribution, such as searches for light or inelastic dark matter or experiments with directional sensitivity. We show that debris flo...

  13. Direct detection of soil-bound prions.

    Directory of Open Access Journals (Sweden)

    Sacha Genovesi

    Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.

  14. Direct and indirect detection of supersymmetric dark matter; Detection directe et indirecte de matiere sombre supersymetrique

    Energy Technology Data Exchange (ETDEWEB)

    Mayet, F

    2001-09-01

    A substantial body of astrophysical evidence supports the existence of non-baryonic dark matter in the universe. One of the leading dark matter candidates is the neutralino predicted by the supersymmetric extensions of the standard model of particle physics. Different detectors have been designed for the detection, either indirect or direct, of the neutralino. Related to indirect detection, the present work has been performed in the context of the AMS experiment. A precursor version of the spectrometer was flown on the space shuttle Discovery in June 1998. The detector included an Aerogel Threshold Cherenkov counter (ATC) to identify antiprotons, whose spectrum may be used to infer a neutralino signal. The analysis of the ATC data is presented including an evaluation of the flight performance and a description of the optimization of the antiproton selection. An antiproton analysis is also reported. A phenomenological study allows us to investigate the discovery potential of this indirect method. This thesis also includes the development of a new detector (MACHe3) designed for direct neutralino search using a superfluid {sup 3}He bolometer operated at ultra low temperatures. The data analysis of the prototype cell is presented. A Monte Carlo simulation has been developed, in order to optimize the detector design for direct neutralino search. These results are compared with theoretical predictions of supersymmetric models, thus highlighting the discovery potential of this detector and its complementarity with existing devices. (author)

  15. Dark Matter: Connecting LHC searches to direct detection

    CERN Document Server

    Crivellin, Andreas; Procura, Massimiliano; Tunstall, Lewis C

    2015-01-01

    In these proceedings we review the interplay between LHC searches for dark matter and direct detection experiments. For this purpose we consider two prime examples: the effective field theory (EFT) approach and the minimal supersymmetric standard model (MSSM). In the EFT scenario we show that for operators which do not enter directly direct detection at tree-level, but only via loop effects, LHC searches give complementary constraints. In the MSSM stop and Higgs exchange contribute to the direct detection amplitude. Therefore, LHC searches for supersymmetric particles and heavy Higgses place constraints on the same parameter space as direct detection.

  16. On the Direct Detection of Dark Matter Annihilation

    DEFF Research Database (Denmark)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2015-01-01

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection...... cross sections has already been reached in a class of models. Moreover, the compatibility of dark matter direct detection experiments can be compared directly in $E_{{\\rm min}}$ space without making assumptions about DM astrophysics, mass, or scattering form factors. Lastly, when DM has direct couplings...

  17. Systematic aspects of direct extrasolar planet detection

    Science.gov (United States)

    Brown, Robert A.

    1988-01-01

    Using the first optical observatory in space, the Hubble Space Telescope, images of possible extrasolar planets will have poor contrast against the background of diffracted and scattered starlight. The very long exposure time required to achieve an adequate signal-to-noise ratio will make their detection infeasible. For a future telescope, a 16-fold increase in either the smoothness of the collecting area of the optics would reduce the exposure time to a tolerable value, but the contrast would remain low and the required photometric precision high. In this situation, the feasibility of detection would be contingent on the careful identification and control of systematic errors.

  18. An Improved Direction Relation Detection Model for Spatial Objects

    Institute of Scientific and Technical Information of China (English)

    FENG Yucai; YI Baolin

    2004-01-01

    Direction is a common spatial concept that is used in our daily life. It is frequently used as a selection condition in spatial queries. As a result, it is important for spatial databases to provide a mechanism for modeling and processing direction queries and reasoning. Depending on the direction relation matrix, an inverted direction relation matrix and the concept of direction pre- dominance are proposed to improve the detection of direction relation between objects. Direction predicates of spatial systems are also extended. These techniques can improve the veracity of direction queries and reasoning. Experiments show excellent efficiency and performance in view of direction queries.

  19. Inverted dipole feature in directional detection of exothermic dark matter

    CERN Document Server

    Bozorgnia, Nassim; Gondolo, Paolo

    2016-01-01

    Directional dark matter detection attempts to measure the direction of motion of nuclei recoiling after having interacted with dark matter particles in the halo of our Galaxy. Due to Earth's motion with respect to the Galaxy, the dark matter flux is concentrated around a preferential direction. An anisotropy in the recoil direction rate is expected as an unmistakable signature of dark matter. The average nuclear recoil direction is expected to coincide with the average direction of dark matter particles arriving to Earth. Here we point out that for a particular type of dark matter, inelastic exothermic dark matter, the mean recoil direction as well as a secondary feature, a ring of maximum recoil rate around the mean recoil direction, could instead be opposite to the average dark matter arrival direction. Thus, the detection of an average nuclear recoil direction opposite to the usually expected direction would constitute a spectacular experimental confirmation of this type of dark matter.

  20. Indirect detection of radiation sources through direct detection of radiolysis products

    Energy Technology Data Exchange (ETDEWEB)

    Farmer, Joseph C [Tracy, CA; Fischer, Larry E [Los Gatos, CA; Felter, Thomas E [Livermore, CA

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  1. Review of dark matter direct detection experiments

    Indian Academy of Sciences (India)

    Rupak Mahapatra

    2012-11-01

    Matter, as we know it, makes up less than 5% of the Universe. Various astrophysical observations have confirmed that one quarter of the Universe and most of the matter content in the Universe is made up of dark matter. The nature of dark matter is yet to be discovered and is one of the biggest questions in physics. Particle physics combined with astrophysical measurements of the abundance gives rise to a dark matter candidate called weakly interacting massive particle (WIMP). The low density of WIMPs in the galaxies and the extremely weak nature of the interaction with ordinary matter make detection of the WIMP an extraordinarily challenging task, with abundant fakes from various radioactive and cosmogenic backgrounds with much stronger electromagnetic interaction. The extremely weak nature of the WIMP interaction dictates detectors that have extremely low naturally occurring radioactive background, a large active volume (mass) of sensitive detector material to maximize statistics, a highly efficient detector-based rejection mechanism for the dominant electromagnetic background and sophisticated analysis techniques to reject any residual background. This paper reviews currently available major technologies being pursued by various collaborations, with special emphasis on the cryogenic Ge detector technology used by the Cryogenic Dark Matter Search Collaboration (CDMS).

  2. Detecting Blackholes and Volcanoes in Directed Networks

    CERN Document Server

    Li, Zhongmou; Liu, Yanchi

    2010-01-01

    In this paper, we formulate a novel problem for finding blackhole and volcano patterns in a large directed graph. Specifically, a blackhole pattern is a group which is made of a set of nodes in a way such that there are only inlinks to this group from the rest nodes in the graph. In contrast, a volcano pattern is a group which only has outlinks to the rest nodes in the graph. Both patterns can be observed in real world. For instance, in a trading network, a blackhole pattern may represent a group of traders who are manipulating the market. In the paper, we first prove that the blackhole mining problem is a dual problem of finding volcanoes. Therefore, we focus on finding the blackhole patterns. Along this line, we design two pruning schemes to guide the blackhole finding process. In the first pruning scheme, we strategically prune the search space based on a set of pattern-size-independent pruning rules and develop an iBlackhole algorithm. The second pruning scheme follows a divide-and-conquer strategy to fur...

  3. Readout technologies for directional WIMP Dark Matter detection

    CERN Document Server

    Battat, J B R; Aleksandrov, A; Guler, M Ali; Asada, T; Baracchini, E; Billard, J; Bosson, G; Bourrion, O; Bouvier, J; Buonaura, A; Burdge, K; Cebrian, S; Colas, P; Consiglio, L; Dafni, T; D'Ambrosio, N; Deaconu, C; De Lellis, G; Descombes, T; Di Crescenzo, A; Di Marco, N; Druitt, G; Eggleston, R; Ferrer-Ribas, E; Fusayasu, T; Galan, J; Galati, G; Garcia, J A; Garza, J G; Gentile, V; Garcia-Sciveres, M; Giomataris, Y; Guerrero, N; Guillaudin, O; Harton, J; Hashimoto, T; Hedges, M T; Iguaz, F; Ikeda, T; Jaegle, I; Kadyk, J A; Katsuragawa, T; Komura, S; Kubo, H; Kuge, K; Lamblin, J; Lauria, A; Lee, E R; Lewis, P; Leyton, M; Loomba, D; Lopez, J P; Luzon, G; Mayet, F; Mirallas, H; Miuchi, K; Mizumoto, T; Mizumura, Y; Monacelli, P; Monroe, J; Montesi, M C; Naka, T; Nakamura, K; Nishimura, H; Ochi, A; Papevangelou, T; Parker, J D; Phan, N S; Pupilli, F; Richer, J P; Riffard, Q; Rosa, G; Santos, D; Sawano, T; Sekiya, H; Seong, I S; Snowden-Ifft, D P; Spooner, N J C; Sugiyama, A; Taishaku, R; Takada, A; Takeda, A; Tanaka, M; Tanimori, T; Thorpe, T N; Tioukov, V; Tomita, H; Umemoto, A; Vahsen, S E; Yamaguchi, Y; Yoshimoto, M; Zayas, E

    2016-01-01

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  4. Readout technologies for directional WIMP Dark Matter detection

    Science.gov (United States)

    Battat, J. B. R.; Irastorza, I. G.; Aleksandrov, A.; Asada, T.; Baracchini, E.; Billard, J.; Bosson, G.; Bourrion, O.; Bouvier, J.; Buonaura, A.; Burdge, K.; Cebrián, S.; Colas, P.; Consiglio, L.; Dafni, T.; D'Ambrosio, N.; Deaconu, C.; De Lellis, G.; Descombes, T.; Di Crescenzo, A.; Di Marco, N.; Druitt, G.; Eggleston, R.; Ferrer-Ribas, E.; Fusayasu, T.; Galán, J.; Galati, G.; García, J. A.; Garza, J. G.; Gentile, V.; Garcia-Sciveres, M.; Giomataris, Y.; Guerrero, N.; Guillaudin, O.; Guler, A. M.; Harton, J.; Hashimoto, T.; Hedges, M. T.; Iguaz, F. J.; Ikeda, T.; Jaegle, I.; Kadyk, J. A.; Katsuragawa, T.; Komura, S.; Kubo, H.; Kuge, K.; Lamblin, J.; Lauria, A.; Lee, E. R.; Lewis, P.; Leyton, M.; Loomba, D.; Lopez, J. P.; Luzón, G.; Mayet, F.; Mirallas, H.; Miuchi, K.; Mizumoto, T.; Mizumura, Y.; Monacelli, P.; Monroe, J.; Montesi, M. C.; Naka, T.; Nakamura, K.; Nishimura, H.; Ochi, A.; Papevangelou, T.; Parker, J. D.; Phan, N. S.; Pupilli, F.; Richer, J. P.; Riffard, Q.; Rosa, G.; Santos, D.; Sawano, T.; Sekiya, H.; Seong, I. S.; Snowden-Ifft, D. P.; Spooner, N. J. C.; Sugiyama, A.; Taishaku, R.; Takada, A.; Takeda, A.; Tanaka, M.; Tanimori, T.; Thorpe, T. N.; Tioukov, V.; Tomita, H.; Umemoto, A.; Vahsen, S. E.; Yamaguchi, Y.; Yoshimoto, M.; Zayas, E.

    2016-11-01

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  5. Snowmass CF1 Summary: WIMP Dark Matter Direct Detection

    OpenAIRE

    Cushman, P.; Galbiati,C; McKinsey, DN; Robertson, H; Tait, TMP; Bauer, D.; Borgland, A.; Cabrera, B; Calaprice, F.; Cooley, J.; Empl, T; Essig, R.; Figueroa-Feliciano, E.; Gaitskell, R.; Golwala, S

    2017-01-01

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of exp...

  6. Assessing the discovery potential of directional detection of Dark Matter

    CERN Document Server

    Billard, J; Santos, D

    2011-01-01

    There is a worldwide effort toward the development of a large TPC (Time Projection Chamber) devoted to directional Dark Matter detection. All current projects are being designed to fulfill a unique goal : identifying weakly interacting massive particle (WIMP) as such by taking advantage of the expected direction dependence of WIMP-induced events toward the constellation Cygnus. However such proof of discovery requires a careful statistical data treatment. In this paper, the discovery potential of forthcoming directional detectors is adressed by using a frequentist approach based on the profile likelihood ratio test statistic. This allows us to estimate the expected significance of a Dark Matter detection. Moreover, using this powerful test statistic, it is possible to propagate astrophysical and experimental uncertainties in the determination of the discovery potential of a given directional detection experiment. This way, we found that a 30 kg.year CF$_4$ directional experiment could reach a 3$\\sigma$ sensit...

  7. Direction finding antenna system for spark detection and localization

    Science.gov (United States)

    Topor, Raluca E.; Bucuci, Stefania C.; Tamas, Razvan D.; Danisor, Alin; Dumitrascu, Ana; Berescu, Serban

    2015-02-01

    This paper proposes a novel UWB antenna system for spark detection and localization by using the amplitude comparison direction finding (DF) method. The proposed design consists of two identical axially crossed "padlock" shaped UWB antennas, with unbalanced feeding. Simulation results show that such radiating systems can be used for assessing the direction of arrival for short pulses.

  8. Direct 13C NMR Detection in HPLC Hyphenation Mode

    DEFF Research Database (Denmark)

    Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils

    2012-01-01

    Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments......, and an acquisition time of 13 h resulted in spectra with adequate signal-to-noise ratios to detect all C-13 signals....

  9. Clinical and economic outcomes of Acinetobacter vis a vis non-Acinetobacter infections in an Indian teaching hospital

    Directory of Open Access Journals (Sweden)

    Priyendu Asim

    2016-01-01

    Full Text Available Context: Acinetobacter infections are a major nosocomial infection causing epidemics of infection in the Intensive Care Units (ICU. Aims: This study estimates the clinical and economic outcomes of Acinetobacter infections and compares them with those of non-Acinetobacter bacterial infections. Settings and Design: Prospective cross-sectional observational study carried out for 6 months in the medicine ICU of a tertiary care hospital. Materials and Methods: Patients were divided in two groups, one group with Acinetobacter infections and the other with non-Acinetobacter infections. The data was collected for infection, length of stay (LOS, mortality and cost along with patient demographics from the hospital records for analysis. Statistical Analysis Used: The data was analyzed using Statistical Package for the Social Sciences Version 15.0. The LOS and cost of treatment (COT for the two groups were compared using the nonparametric Mann–Whitney U-test. Results: A total of 220 patients were studied out of which 91 had Acinetobacter infections. The median LOS was 20 days in Group-A and 12 days in Group-B (P < 0.0001. The median COT was INR 125,862 in Group-A and INR 68,228 in the Group-B (P < 0.0001. Mortality in Group-A and Group-B was 32.97 and 32.56 (P = 0.949 respectively. Conclusion: The burden of Acinetobacter infections in ICUs is increasing with the increase in LOS and COT for the patients. The infection control team has to play a major role in reducing the rate of nosocomial infections.

  10. Factors Which Impact the Distribution of Leadership for an ICT Reform: Expertise vis-a-vis Formal Role?

    Science.gov (United States)

    Ho, Jeanne Marie; Ng, David

    2012-01-01

    This study examined the process of Information Communication Technology reform in a Singapore school. The focus was on distributed leadership actions, and the factors which enabled and constrained the distribution of leadership. This study adopted a naturalistic inquiry approach, involving the case study of a school. The study found that…

  11. A Geo-Environmental Analysis of the Groundwater Resource vis-a-vis Surface Water Scenario in Guwahati City

    Directory of Open Access Journals (Sweden)

    Neelkamal Das

    2013-08-01

    Full Text Available Guwahati city is located on a unique geo-environmental setting with an interface of hills and valleys along with a prominent river front. The existence of various surface water sources, geo-hydrological set up and rainfall intensity play a significant role in the ground water regime of the city. However, rapid urbanisation of the city during the last few decades has altered the landscape of the city and disturbed the water retention capacity as well as the flow dynamics of various surface water sources, thereby affecting the infiltration rate to a great extent. Unprecedented rise in the population of the city has exerted more pressure on the various sources of water, particularly the groundwater resource. It has thus become imperative to utilise the various sources of water in a more systematic and scientific manner, giving due emphasis to the water requirement and the prevailing hydrological conditions of the area. Moreover, it is also observed that the city experiences an average annual rainfall of 162 cm with about 110 rainy days per year. The city thus has enough potential for harvesting the rainwater it receives, instead of allowing it to flow untapped. Rainwater can be tapped and utilised to revive the various surface water sources of the city, thereby facilitating natural groundwater recharge, as surface water bodies like wetlands, lakes and ponds do act as potential groundwater recharge zones.

  12. Socioeconomic-Ethnic Status Inconsistency Vis-A-Vis Students' Potential for Mobilization. An Examination of Status Relationships.

    Science.gov (United States)

    Eby, Maureen A.

    In an attempt to further analyse the status backgrounds of participants in the student movement by utilizing the concept socioeconomic-ethnic status inconsistency as it is used in the studies of voting behavior, it was discovered that the more actively mobilized students were recruited from low ascribed/high achieved status backgrounds while the…

  13. How Can France’s New NATO Policy Be Explained vis-a-vis European Security Cooperation?

    Science.gov (United States)

    2010-05-21

    PERFORMING ORGANIZATION REPORT NUMBER Dr. Charles Pentland, Director, Queen’c Centre for International Relations Queen’s University Robert Sutherland...States Army Dr. Charles Pentland Director, Queen‟s Centre for International Relations Disclaimer The views expressed in the...President George Pompidou initiated this divergence from Gaullism by lifting the French veto, allowing the U.K. into the European Community in 1973

  14. Evaluation of FFTF fuel pin design procedure vis-a-vis steady state irradiation performance in EBR II

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, R.J.

    1976-11-01

    The FFTF fuel pin design analysis is shown to be conservative through comparison with pin irradiation experience in EBR-II. This comparison shows that the actual lifetimes of EBR-II fuel pins are either greater than 80,000 MWd/MTM or greater than the calculated allowable lifetimes based on thermal creep strain.

  15. [The elderly and the transition to a market economy in Romania. Discriminating attitudes vis-a-vis the elderly].

    Science.gov (United States)

    Radulescu, S M

    1993-01-01

    Population aging has started late in Romania but has increased rapidly in the last few decades. The share of the population aged 60 and over reached 17% in 1992 and the decline in fertility after 1989 will considerably increase this share in the future. The author provides a detailed analysis of the present economic and social situation of the elderly in Romania. Factors such as the economic crisis, and particularly the deterioration of the standard of living, the very low income (pension) level, the high rate of inflation, and the lack of appropriate medical care have pushed most of the aged population into poverty. According to recent surveys, 1.5 million people out of the 3.8 million aged 60 and over live below the poverty line.

  16. Mosques as Communities of Memories vis-a-vis Muslim Identity and Integration in the European Union

    Directory of Open Access Journals (Sweden)

    Nazila Isgandarova

    2016-01-01

    Full Text Available Mosques represent an important element of Muslim identity. This identity may be social, political, personal, etc., and depends on language they speak, attitudes they have, place where they live in, and activities they enjoy to do. In this regard, mosques manifest gender, ethnic, social class, religion, and culture dimensions of Muslim identity. As a place of community of memory mosques play the memory-preserving function for Muslim generations and retain Muslim identity. European mosques combine the traditions of the worshippers with those of their new environment. Thus, Muslims' attachment to Europe grows and they start to identify themselves with their places in Europe. During this transaction between the two, not only Muslims change under the current European tendencies, but Europe also changes by Muslims' identities. This becomes more evident in increasing number of mosques in EU and the debate about its place in EU life.

  17. Spirituality vis-a-vis Islam as prerequisite to Arab American well being: the implications of Eurocentrism for mainstream psychology.

    Science.gov (United States)

    Hall, Ronald E; Breland-Noble, Alfiee

    2011-01-01

    Due to the historical preponderance of racial and/or intellectual homogeneity in the field of psychology, Eurocentrism set the "gold standard" for its method of intervention. As such, it might be argued that psychology remains a bastion of Eurocentric thought despite the globalization of knowledge and the influx of racially and ethnically diverse scientists into the research endeavor. At the same time and the significant increase in the immigrant Arab population, Arab Americans remain a less familiar component of society. Among the various Arab populations, spirituality through Islam is fundamental. Thus, psychologists would be remiss to exclude a critical aspect of Arab American life from intervention when it is essential to well-being.

  18. An Evaluation of Grades 9 and 10 Mathematics Textbooks vis-a-vis Fostering Problem Solving Skills

    Science.gov (United States)

    Buishaw, Alemayehu; Ayalew, Assaye

    2013-01-01

    This study sought to evaluate the adequacy of integration of problematic situations and general problem-solving strategies (heuristics) in grades 9 and 10 mathematics textbooks. Grade 9 and grade 10 mathematics textbooks were used for analysis. Document analysis and interview were used as data gathering instruments. Document analysis was carried…

  19. Direct 13C NMR Detection in HPLC Hyphenation Mode

    DEFF Research Database (Denmark)

    Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils

    2012-01-01

    Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments...... application of HPLC-SPE-NMR analysis using direct-detected (13)C NMR spectra. HPLC column loading, accumulative SPE trappings, and the effect of different elution solvents were evaluated and optimized. A column loading of approximately 600 mug of a prefractionated triterpenoid mixture, six trappings...

  20. Overlapping Communities Detection Based on Link Partition in Directed Networks

    Directory of Open Access Journals (Sweden)

    Qingyu Zou

    2013-09-01

    Full Text Available Many complex systems can be described as networks to comprehend both the structure and the function. Community structure is one of the most important properties of complex networks. Detecting overlapping communities in networks have been more attention in recent years, but the most of approaches to this problem have been applied to the undirected networks. This paper presents a novel approach based on link partition to detect overlapping communities structure in directed networks. In contrast to previous researches focused on grouping nodes, our algorithm defines communities as groups of directed links rather than nodes with the purpose of nodes naturally belong to more than one community. This approach can identify a suitable number of overlapping communities without any prior knowledge about the community in directed networks. We evaluate our algorithm on a simple artificial network and several real-networks. Experimental results demonstrate that the algorithm proposed is efficient for detecting overlapping communities in directed networks.  

  1. On the Direct Detection of Dark Matter Annihilation

    CERN Document Server

    Cherry, John F; Shoemaker, Ian M

    2015-01-01

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection experiments is controlled by relativistic kinematics. This results in a distinctive recoil spectrum, a non-standard and or even {\\it absent} annual modulation, and the ability to probe DM masses as low as a $\\sim$10 MeV. We use current LUX data to show that experimental sensitivity to thermal relic annihilation cross sections has already been reached in a class of models. Moreover, the compatibility of dark matter direct detection experiments can be compared directly in $E_{min}$ space without making assumptions about DM astrophysics. Lastly, when DM has direct couplings to nuclei, the limit from annihilation to relativistic particles in the Sun can be stronger than that of conventional non-relativistic direct detect...

  2. Halo Independent Direct Detection of Momentum-Dependent Dark Matter

    CERN Document Server

    Cherry, John F; Shoemaker, Ian M

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be $\\lesssim 10$ MeV for DM in the 20-1000 GeV range in a halo-independent manner.

  3. Diversity among other worlds: characterization of exoplanets by direct detection

    CERN Document Server

    Schneider, J; Aylward, A; Baudoz, P; Beuzit, J L; Brown, R; Cho, J; Dohlen, K; Ferrari, M; Galicher, R; Grasset, O; Grenfell, L; Guyon, O; Hough, J; Kasper, M; Keller, Ch; Longmore, A; López, B; Martin, E; Mawet, D; Ménard, F; Merin, B; Palle, E; Perrin, G; Pinfield, D; Sein, E; Shore, P; Sotin, Ch; Sozzetti, A; Stam, D; Surdej, J; Tamburini, F; Tinetti, G; Udry, S; Verinaud, C; Walker, D

    2008-01-01

    The physical characterization of exoplanets will require to take spectra at several orbital positions. For that purpose, a direct imaging capability is necessary. Direct imaging requires an efficient stellar suppression mechanism, associated with an ultrasmooth telescope. We show that before future large space missions (interferometer, 4-8 m class coronograph, external occulter or Fresnel imager), direct imaging of giant planets and close-by super-Earth are at the cross-road of a high scientific interest and a reasonable feasibility. The scientific interest lies in the fact that super-Earths share common geophysical attributes with Earths. They already begin to be detected by radial velocity (RV) and, together with giant planets, they have a larger area than Earths, making them detectable with a 1.5-2 m class telescope in reflected light. We propose such a (space) telescope be a first step before large direct imaging missions.

  4. Snowmass CF1 Summary: WIMP Dark Matter Direct Detection

    CERN Document Server

    Cushman, P; McKinsey, D N; Robertson, H; Tate, T M P; Bauer, D; Borgland, A; Cabrera, B; Calaprice, F; Cooley, J; Empl, T; Essig, R; Figueroa-Feliciano, E; Gaitskell, R; Golwala, S; Hall, J; Hill, R; Hime, A; Hoppe, E; Hsu, L; Hungerford, E; Jacobsen, R; Kelsey, M; Lang, R F; Lippincott, W H; Loer, B; Luitz, S; Mandic, V; Mardon, J; Maricic, J; Maruyama, R; Mohapatra, R; Nelson, H; Orrell, J; Palladino, K; Pantic, E; Partridge, R; Ryd, A; Saab, T; Sadoulet, B; Schnee, R; Shepherd, W; Sonnenschein, A; Sorensen, P; Szydagis, M; Volansky, T; Witherell, M; Wright, D; Zurek, K

    2013-01-01

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  5. Working Group Report: WIMP Dark Matter Direct Detection

    Energy Technology Data Exchange (ETDEWEB)

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-10-30

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  6. Evading Direct Dark Matter Detection in Higgs Portal Models

    CERN Document Server

    Arcadi, Giorgio; Lebedev, Oleg; Pokorski, Stefan; Toma, Takashi

    2016-01-01

    Many models of Higgs portal Dark Matter (DM) find themselves under pressure from increasingly tight direct detection constraints. In the framework of gauge field DM, we study how such bounds can be relaxed while retaining the thermal WIMP paradigm. When the hidden sector gauge symmetry is broken via the Higgs mechanism, the hidden sector generally contains unstable states which are lighter than dark matter. These states provide DM with an efficient annihilation channel. As a result, the DM relic abundance and the direct detection limits are controlled by different parameters, and the two can easily be reconciled. This simple setup realizes the idea of `secluded' dark matter naturally.

  7. Prospectives on Direct Detection of the Cosmic Neutrino Background

    Science.gov (United States)

    Li, Yu-Feng

    2017-09-01

    The cosmic neutrino background (CνB) is a fundamental prediction of the hot Big Bang cosmology. Although cosmological observations provide indirect evidence for the existence of the CνB, we still lack a direct detection in a laboratory. In this work we present the current possible detection methods of the CνB. The method of CνB captures on the radioactive decaying nuclei is particularly emphasized in light of the PTOLEMY project. We stress that such direct measurements might not be hopeless in the long term.

  8. An Introduction to Dark Matter Direct Detection Searches & Techniques

    CERN Document Server

    Saab, Tarek

    2012-01-01

    Weakly Interacting Massive Particles (WIMPs), are a leading candidate for the dark matter that is observed to constitute ~25% of the total mass-energy density of the Universe. The direct detection of relic WIMPs (those produced during the early moments of the Universe's expansion) is at the forefront of active research areas in particle astrophysics with a numerous international experimental collaborations pursuing this goal. This paper presents an overview of the theoretical and practical considerations common to the design and operation of direct detection experiments, as well as their unique features and capabilities.

  9. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    Science.gov (United States)

    2015-01-01

    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  10. The Maximum Patch Method for Directional Dark Matter Detection

    CERN Document Server

    Henderson, Shawn; Fisher, Peter

    2008-01-01

    Present and planned dark matter detection experiments search for WIMP-induced nuclear recoils in poorly known background conditions. In this environment, the maximum gap statistical method provides a way of setting more sensitive cross section upper limits by incorporating known signal information. We give a recipe for the numerical calculation of upper limits for planned directional dark matter detection experiments, that will measure both recoil energy and angle, based on the gaps between events in two-dimensional phase space.

  11. Detailed noise statistics for an optically preamplified direct detection receiver

    DEFF Research Database (Denmark)

    Danielsen, Søren Lykke; Mikkelsen, Benny; Durhuus, Terji

    1995-01-01

    We describe the exact statistics of an optically preamplified direct detection receiver by means of the moment generating function. The theory allows an arbitrary shaped electrical filter in the receiver circuit. The moment generating function (MGF) allows for a precise calculation of the error...

  12. Sol-gel matrices for direct colorimetric detection of analytes

    Science.gov (United States)

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2000-01-01

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  13. Micromegas detector developments for Dark Matter directional detection with MIMAC

    CERN Document Server

    Iguaz, F J; Calvet, D; Colas, P; Druillole, F; Ferrer-Ribas, E; Giomataris, I; Mols, J P; Pancin, J; Papaevangelou, T; Billard, J; Bosson, G; Bouly, J L; Bourrion, O; Fourel, Ch; Grignon, C; Guillaudin, O; Mayet, F; Richer, J P; Santos, D; Golabek, C; Lebreton, L

    2011-01-01

    The aim of the MIMAC project is to detect non-baryonic Dark Matter with a directional TPC using a high precision Micromegas readout plane. We will describe in detail the recent developments done with bulk Micromegas detectors as well as the characterisation measurements performed in an Argon(95%)-Isobutane(5%) mixture. Track measurements with alpha particles will be shown.

  14. Micromegas detector developments for Dark Matter directional detection with MIMAC

    Energy Technology Data Exchange (ETDEWEB)

    Iguaz, F J; Attie, D; Calvet, D; Colas, P; Druillole, F; Ferrer-Ribas, E; Giomataris, I; Mols, J P; Papaevangelou, T [CEA/DSM/IRFU, CEA, 91191 Gif sur Yvette (France); Pancin, J [GANIL, Bvd H. Becquerel, Caen (France); Billard, J; Bosson, G; Bouly, J L; Bourrion, O; Fourel, Ch; Grignon, C; Guillaudin, O; Mayet, F; Richer, J P; Santos, D, E-mail: esther.ferrer.ribas@cea.fr [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble (France)

    2011-07-15

    The aim of the MIMAC project is to detect non-baryonic Dark Matter with a directional TPC using a high precision Micromegas readout plane. We will describe in detail the recent developments done with bulk Micromegas detectors as well as the characterisation measurements performed in an Argon(95%)-Isobutane(5%) mixture. Track measurements with alpha particles will be shown.

  15. Fundamental statistical limitations of future dark matter direct detection experiments

    NARCIS (Netherlands)

    Strege, C.; Trotta, F.; Bertone, G.; Peter, A.H.G.; Scott, P.

    2012-01-01

    We discuss irreducible statistical limitations of future ton-scale dark matter direct detection experiments. We focus in particular on the coverage of confidence intervals, which quantifies the reliability of the statistical method used to reconstruct the dark matter parameters and the bias of the r

  16. Direct detection of the Enceladus water torus with Herschel

    NARCIS (Netherlands)

    Hartogh, P.; Lellouch, E.; Moreno, R.; Bockelee-Morvan, D.; Biver, N.; Cassidy, T.; Rengel, M.; Jarchow, C.; Cavalie, T.; Crovisier, J.; Helmich, F. P.; Kidger, M.

    Cryovolcanic activity near the south pole of Saturn's moon Enceladus produces plumes of H2O-dominated gases and ice particles, which escape and populate a torus-shaped cloud. Using submillimeter spectroscopy with Herschel, we report the direct detection of the Enceladus water vapor torus in four

  17. Direct detection of the Enceladus water torus with Herschel

    NARCIS (Netherlands)

    Hartogh, P.; Lellouch, E.; Moreno, R.; Bockelee-Morvan, D.; Biver, N.; Cassidy, T.; Rengel, M.; Jarchow, C.; Cavalie, T.; Crovisier, J.; Helmich, F. P.; Kidger, M.

    2011-01-01

    Cryovolcanic activity near the south pole of Saturn's moon Enceladus produces plumes of H2O-dominated gases and ice particles, which escape and populate a torus-shaped cloud. Using submillimeter spectroscopy with Herschel, we report the direct detection of the Enceladus water vapor torus in four rot

  18. Direct Detection of Sub-GeV Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Essig, Rouven; Mardon, Jeremy; Volansky, Tomer

    2012-03-20

    Direct detection strategies are proposed for dark matter particles with MeV to GeV mass. In this largely unexplored mass range, dark matter scattering with electrons can cause single-electron ionization signals, which are detectable with current technology. Ultraviolet photons, individual ions, and heat are interesting alternative signals. Focusing on ionization, we calculate the expected dark matter scattering rates and estimate the sensitivity of possible experiments. Backgrounds that may be relevant are discussed. Theoretically interesting models can be probed with existing technologies, and may even be within reach using ongoing direct detection experiments. Significant improvements in sensitivity should be possible with dedicated experiments, opening up a window to new regions in dark matter parameter space.

  19. The Direct Detectability of Giant Exoplanets in the Optical

    CERN Document Server

    Greco, Johnny P

    2015-01-01

    (abridged) Motivated by the possibility that an optical coronagraph will be put on WFIRST/AFTA, we present an exploration of the general character of the direct detectability of extrasolar giant planets (EGPs) in the optical. We quantify a planet's direct detectability by the fraction of its orbit for which it is in an observable configuration--defined to be its observability fraction ($f_{obs}$). Using a suite of Monte Carlo experiments, we study the dependence of $f_{obs}$ upon various technological and astrophysical parameters, including the inner working angle (IWA) and minimum achievable contrast ($C_{min}$) of the direct-imaging observatory; the planet's scattering phase function, geometric albedo, single-scattering albedo, radius, and distance from Earth; and the semi-major axis distribution of EGPs. We assume cloud-free, homogeneous atmospheres and calculate phase functions for a given geometric or single-scattering albedo, assuming various scattering mechanisms. We find that the often-assumed Lambert...

  20. An Antenna for Directional Detection of WISPy Dark Matter

    CERN Document Server

    Jaeckel, Joerg

    2013-01-01

    It is an intriguing possibility that the cold dark matter of the Universe may consist of very light and very weakly interacting particles such as axion(-like particles) and hidden photons. This opens up (but also requires) new techniques for direct detection. One possibility is to use reflecting surfaces to facilitate the conversion of dark matter into photons, which can be concentrated in a detector with a suitable geometry. In this note we show that this technique also allows for directional detection and inference of the full vectorial velocity spectrum of the dark matter particles. We also note that the non-vanishing velocity of dark matter particles is relevant for the conception of (non-directional) discovery experiments and outline relevant features.

  1. Directional Detection of Dark Matter with 2D Targets

    CERN Document Server

    Hochberg, Yonit; Lisanti, Mariangela; Tully, Christopher G; Zurek, Kathryn M

    2016-01-01

    We propose two-dimensional materials as targets for direct detection of dark matter. Using graphene as an example, we focus on the case where dark matter scattering deposits sufficient energy on a valence-band electron to eject it from the target. We show that the sensitivity of graphene to dark matter of MeV to GeV mass can be comparable, for similar exposure and background levels, to that of semiconductor targets such as silicon and germanium. Moreover, a two-dimensional target is an excellent directional detector, as the ejected electron retains information about the angular dependence of the incident dark matter particle. This proposal can be implemented by the PTOLEMY experiment, presenting for the first time an opportunity for directional detection of sub-GeV dark matter.

  2. Dark matter directional detection in non-relativistic effective theories

    CERN Document Server

    Catena, Riccardo

    2015-01-01

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF$_4$, CS$_2$ and $^{3}$He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  3. Reliable detection of directional couplings using rank statistics.

    Science.gov (United States)

    Chicharro, Daniel; Andrzejak, Ralph G

    2009-08-01

    To detect directional couplings from time series various measures based on distances in reconstructed state spaces were introduced. These measures can, however, be biased by asymmetries in the dynamics' structure, noise color, or noise level, which are ubiquitous in experimental signals. Using theoretical reasoning and results from model systems we identify the various sources of bias and show that most of them can be eliminated by an appropriate normalization. We furthermore diminish the remaining biases by introducing a measure based on ranks of distances. This rank-based measure outperforms existing distance-based measures concerning both sensitivity and specificity for directional couplings. Therefore, our findings are relevant for a reliable detection of directional couplings from experimental signals.

  4. Direct Detection of Dark Matter Bound to the Earth

    CERN Document Server

    Catena, Riccardo

    2016-01-01

    We study the properties and direct detection prospects of an as of yet neglected population of dark matter (DM) particles moving in orbits gravitationally bound to the Earth. This DM population is expected to form via scattering by nuclei in the Earth's interior. We compute fluxes and nuclear recoil energy spectra expected at direct detection experiments for the new DM population considering detectors with and without directional sensitivity, and different types of target materials and DM-nucleon interactions. DM particles bound to the Earth manifest as a prominent rise in the low-energy part of the observed nuclear recoil energy spectrum. Ultra-low threshold energies of about 1 eV are needed to resolve this effect. Its shape is independent of the DM-nucleus scattering cross-section normalisation.

  5. Direct detection of expanded trinucleotide repeats using DNA hybridization techniques

    Energy Technology Data Exchange (ETDEWEB)

    Petronis, A.; Tatuch, Y.; Kennedy, J.L. [Univ. of Toronto (Canada)] [and others

    1994-09-01

    Recently, unstable trinucleotide repeats have been shown to be the etiologic factor in several neuropsychiatric diseases, and they may play a similar role in other disorders. To our knowledge, a method that detects expanded trinucleotide sequences with the opportunity for direct localization and cloning has not been achieved. We have developed a set of hybridization-based methods for direct detection of unstable DNA expansion. Our analysis of myotonic dystrophy patients that possess different degrees of (CTG){sub n} expansion, versus unaffected controls, has demonstrated the identification of the trinucleotide instability site without any prior information regarding genetic map location. High stringency modified Southern blot hybridization with a PCR-generated trinucleotide repeat probe allowed us to detect the DNA fragment containing the expansion in myotonic dystrophy patients. The same probe was used for fluorescent in situ hybridization and several regions of (CTG){sub n}/(CAG){sub n} repeats in the human genome were detected, including the myotonic dystrophy locus on chromosome 19q. These strategies can be applied to directly clone genes involved in disorders caused by unstable DNA.

  6. Searching for Dark Absorption with Direct Detection Experiments

    CERN Document Server

    Bloch, Itay M; Tobioka, Kohsaku; Volansky, Tomer; Yu, Tien-Tien

    2016-01-01

    We consider the absorption by bound electrons of dark matter in the form of dark photons and axion-like particles, as well as of dark photons from the Sun, in current and next-generation direct detection experiments. Experiments sensitive to electron recoils can detect such particles with masses between a few eV to more than 10 keV. For dark photon dark matter, we update a previous bound based on XENON10 data and derive new bounds based on data from XENON100 and CDMSlite. We find these experiments to disfavor previously allowed parameter space. Moreover, we derive sensitivity projections for SuperCDMS at SNOLAB for silicon and germanium targets, as well as for various possible experiments with scintillating targets (cesium iodide, sodium iodide, and gallium arsenide). The projected sensitivity can probe large new regions of parameter space. For axion-like particles, the same current direction detection data improves on previously known direct-detection constraints but does not bound new parameter space beyond...

  7. Direct versus indirect detection of supersymmetric dark matter

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    This document gathers the slides that were presented during the workshop 'direct versus indirect detection of supersymmetric dark matter'(about 30 contributions). This workshop intended to bring together people from the particle theory community, astrophysicists and cosmologists, as well as experimentalists involved in the detection of dark matter. The aim is to generate a discussion about current and future strategies for detection of SUSY dark matter (with focus, but not exclusively, on neutralinos). Complementarities between accelerator, direct and indirect searches as well as a comparison between the uncertainties in direct and indirect searches of dark matter, are supposed to be discussed. Among the issues which will be addressed are: -) the crucial questions related to the structure of galaxies (local dark matter density, clumping, anomalous velocity distributions, etc.) ; -) the possibilities offered by the present and future experimental facilities for direct and indirect (photon, neutrino) searches; -) the potential for the discovery of SUSY at LHC and beyond; and -) the parameterization of the SUSY breaking models beyond the minimal versions.

  8. Assessing Alternatives for Directional Detection of a WIMP Halo

    CERN Document Server

    Copi, C J; Simmons-Duffin, D; Stroiney, S R; Copi, Craig J.; Krauss, Lawrence M.; Simmons-Duffin, David; Stroiney, Steven R.

    2005-01-01

    The future of direct terrestrial WIMP detection lies on two fronts: new, much larger low background detectors sensitive to energy deposition, and detectors with directional sensitivity. The former can large range of WIMP parameter space using well tested technology while the latter may be necessary if one is to disentangle particle physics parameters from astrophysical halo parameters. Because directional detectors will be quite difficult to construct it is worthwhile exploring in advance generally which experimental features will yield the greatest benefits at the lowest costs. We examine the sensitivity of directional detectors with varying angular tracking resolution with and without the ability to distinguish forward versus backward recoils, and compare these to the sensitivity of a detector where the track is projected onto a two-dimensional plane. The latter detector regardless of where it is placed on the Earth, can be oriented to produce a significantly better discrimination signal than a 3D detector ...

  9. (In)Direct detection of boosted dark matter

    Science.gov (United States)

    Agashe, Kaustubh; Cui, Yanou; Necib, Lina; Thaler, Jesse

    2016-05-01

    We present a new multi-component dark matter model with a novel experimental signature that mimics neutral current interactions at neutrino detectors. In our model, the dark matter is composed of two particles, a heavier dominant component that annihilates to produce a boosted lighter component that we refer to as boosted dark matter. The lighter component is relativistic and scatters off electrons in neutrino experiments to produce Cherenkov light. This model combines the indirect detection of the dominant component with the direct detection of the boosted dark matter. Directionality can be used to distinguish the dark matter signal from the atmospheric neutrino background. We discuss the viable region of parameter space in current and future experiments.

  10. Directional detection of dark matter in universal bound states

    CERN Document Server

    Laha, Ranjan

    2015-01-01

    It has been suggested that several small-scale structure anomalies in $\\Lambda$CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown by Braaten and Hammer that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Laha and Braaten studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angular recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.

  11. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeno, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, Priscilla B.; Daal, M.; Di Stefano, P. C.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, Jeter C.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, W.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-01

    We examine the consequences of the effective eld theory (EFT) of dark matter-nucleon scattering or current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral di*erences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  12. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. Here. we demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. In conclusion, we discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  13. Dark matter effective field theory scattering in direct detection experiments

    CERN Document Server

    Schneck, K; Cerdeno, D G; Mandic, V; Rogers, H E; Agnese, R; Anderson, A J; Asai, M; Balakishiyeva, D; Barker, D; Thakur, R Basu; Bauer, D A; Billard, J; Borgland, A; Brandt, D; Brink, P L; Bunker, R; Caldwell, D O; Calkins, R; Chagani, H; Chen, Y; Cooley, J; Cornell, B; Crewdson, C H; Cushman, P; Daal, M; Di Stefano, P C F; Doughty, T; Esteban, L; Fallows, S; Figueroa-Feliciano, E; Godfrey, G L; Golwala, S R; Hall, J; Harris, H R; Hofer, T; Holmgren, D; Hsu, L; Huber, M E; Jardin, D M; Jastram, A; Kamaev, O; Kara, B; Kelsey, M H; Kennedy, A; Leder, A; Loer, B; Asamar, E Lopez; Lukens, P; Mahapatra, R; McCarthy, K A; Mirabolfathi, N; Moffatt, R A; Mendoza, J D Morales; Oser, S M; Page, K; Page, W A; Partridge, R; Pepin, M; Phipps, A; Prasad, K; Pyle, M; Qiu, H; Rau, W; Redl, P; Reisetter, A; Ricci, Y; Roberts, A; Saab, T; Sadoulet, B; Sander, J; Schnee, R W; Scorza, S; Serfass, B; Shank, B; Speller, D; Toback, D; Upadhyayula, S; Villano, A N; Welliver, B; Wilson, J S; Wright, D H; Yang, X; Yellin, S; Yen, J J; Young, B A; Zhang, J

    2015-01-01

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  14. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  15. An Automated Directed Spectral Search Methodology for Small Target Detection

    Science.gov (United States)

    Grossman, Stanley I.

    Much of the current efforts in remote sensing tackle macro-level problems such as determining the extent of wheat in a field, the general health of vegetation or the extent of mineral deposits in an area. However, for many of the remaining remote sensing challenges being studied currently, such as border protection, drug smuggling, treaty verification, and the war on terror, most targets are very small in nature - a vehicle or even a person. While in typical macro-level problems the objective vegetation is in the scene, for small target detection problems it is not usually known if the desired small target even exists in the scene, never mind finding it in abundance. The ability to find specific small targets, such as vehicles, typifies this problem. Complicating the analyst's life, the growing number of available sensors is generating mountains of imagery outstripping the analysts' ability to visually peruse them. This work presents the important factors influencing spectral exploitation using multispectral data and suggests a different approach to small target detection. The methodology of directed search is presented, including the use of scene-modeled spectral libraries, various search algorithms, and traditional statistical and ROC curve analysis. The work suggests a new metric to calibrate analysis labeled the analytic sweet spot as well as an estimation method for identifying the sweet spot threshold for an image. It also suggests a new visualization aid for highlighting the target in its entirety called nearest neighbor inflation (NNI). It brings these all together to propose that these additions to the target detection arena allow for the construction of a fully automated target detection scheme. This dissertation next details experiments to support the hypothesis that the optimum detection threshold is the analytic sweet spot and that the estimation method adequately predicts it. Experimental results and analysis are presented for the proposed directed

  16. Direct gastroscopy for detecting gastric cancer in the elderly

    Institute of Scientific and Technical Information of China (English)

    张子其; 万军; 朱成; 王孟薇; 赵东海; 付永和; 张建萍; 王亚红; 吴本俨

    2002-01-01

    Objective To evaluate the safety and effectiveness of direct gastroscopy for detecting gastric cancer. Methods Clinical screening by direct gastroscopy was performed for gastric cancer (GC) from September 1985 to July 1998. 3048 elderly people were screened. Their age ranged from 60 to 93 years, and 2034 of the 3084 were followed up. Results Ninety-two patients with gastric cancer were discovered by gastroscopy, representing 3.02% of the screened population. The rate of early gastric cancer (EGC) was 63.04% (58/92) of all gastric cancers detected. The rate was up to 79.59% (39/49) on follow-up, and was 74.14% (43/51) in asymptomatic patients with gastric cancer. The excision rate was 88.89% for patients with gastric cancer, and 100% for patients with early gastric cancer. The 5-year survival rate was 91.89% for patients with gastric cancer, and 96.30% for patients with early gastric cancer. Conclusion Clinical screening and follow-up by direct gastroscopy in persons over 60 years of age are a safe and effective method for raising the 5-year survival and detection rate of gastric cancer, especially early gastric cancer.

  17. Superconducting Nuclear Recoil Sensor for Directional Dark Matter Detection

    Science.gov (United States)

    Junghans, Ann; Baldwin, Kevin; Hehlen, Markus; Lafler, Randy; Loomba, Dinesh; Phan, Nguyen; Weisse-Bernstein, Nina

    The Universe consists of 72% dark energy, 23% dark matter and only 5% of ordinary matter. One of the greatest challenges of the scientific community is to understand the nature of dark matter. Current models suggest that dark matter is made up of slowly moving, weakly interacting massive particles (WIMPs). But detecting WIMPs is challenging, as their expected signals are small and rare compared to the large background that can mimic the signal. The largest and most robust unique signature that sets them apart from other particles is the day-night variation of the directionality of dark matter on Earth. This modulation could be observed with a direction-sensitive detector and hence, would provide an unambiguous signature for the galactic origin of WIMPs. There are many studies underway to attempt to detect WIMPs both directly and indirectly, but solid-state WIMP detectors are widely unexplored although they would present many advantages to prevalent detectors that use large volumes of low pressure gas. We present first results of a novel multi-layered architecture, in which WIMPs would interact primarily with solid layers to produce nuclear recoils that then induce measureable voltage pulses in adjacent superconductor layers. This work was supported by the U.S. Department of Energy through the LANL Laboratory Directed Research and Development Program.

  18. Three-dimensional track reconstruction for directional Dark Matter detection

    CERN Document Server

    Billard, J; Santos, D

    2012-01-01

    Directional detection of Dark Matter is a promising search strategy. However, to perform such detection, a given set of parameters has to be retrieved from the recoiling tracks : direction, sense and position in the detector volume. In order to optimize the track reconstruction and to fully exploit the data of forthcoming directional detectors, we present a likelihood method dedicated to 3D track reconstruction. This new analysis method is applied to the MIMAC detector. It requires a full simulation of track measurements in order to compare real tracks to simulated ones. We conclude that a good spatial resolution can be achieved, i.e. sub-mm in the anode plane and cm along the drift axis. This opens the possibility to perform a fiducialization of directional detectors. The angular resolution is shown to range between 20$^\\circ$ to 80$^\\circ$, depending on the recoil energy, which is however enough to achieve a high significance discovery of Dark Matter. On the contrary, we show that sense recognition capabili...

  19. (In)direct detection of boosted dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Agashe, Kaustubh; Cui, Yanou [Maryland Center for Fundamental Physics, University of Maryland, College Park, MD 20742 (United States); Necib, Lina; Thaler, Jesse, E-mail: kagashe@umd.edu, E-mail: cuiyo@umd.edu, E-mail: lnecib@mit.edu, E-mail: jthaler@mit.edu [Center for Theoretical Physics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)

    2014-10-01

    We initiate the study of novel thermal dark matter (DM) scenarios where present-day annihilation of DM in the galactic center produces boosted stable particles in the dark sector. These stable particles are typically a subdominant DM component, but because they are produced with a large Lorentz boost in this process, they can be detected in large volume terrestrial experiments via neutral-current-like interactions with electrons or nuclei. This novel DM signal thus combines the production mechanism associated with indirect detection experiments (i.e. galactic DM annihilation) with the detection mechanism associated with direct detection experiments (i.e. DM scattering off terrestrial targets). Such processes are generically present in multi-component DM scenarios or those with non-minimal DM stabilization symmetries. As a proof of concept, we present a model of two-component thermal relic DM, where the dominant heavy DM species has no tree-level interactions with the standard model and thus largely evades direct and indirect DM bounds. Instead, its thermal relic abundance is set by annihilation into a subdominant lighter DM species, and the latter can be detected in the boosted channel via the same annihilation process occurring today. Especially for dark sector masses in the 10 MeV–10 GeV range, the most promising signals are electron scattering events pointing toward the galactic center. These can be detected in experiments designed for neutrino physics or proton decay, in particular Super-K and its upgrade Hyper-K, as well as the PINGU/MICA extensions of IceCube. This boosted DM phenomenon highlights the distinctive signatures possible from non-minimal dark sectors.

  20. Highly sensitive detection of Staphylococcus aureus directly from patient blood.

    Directory of Open Access Journals (Sweden)

    Padmapriya P Banada

    Full Text Available BACKGROUND: Rapid detection of bloodstream infections (BSIs can be lifesaving. We investigated the sample processing and assay parameters necessary for highly-sensitive detection of bloodstream bacteria, using Staphylococcus aureus as a model pathogen and an automated fluidic sample processing-polymerase chain reaction (PCR platform as a model diagnostic system. METHODOLOGY/PRINCIPAL FINDINGS: We compared a short 128 bp amplicon hemi-nested PCR and a relatively shorter 79 bp amplicon nested PCR targeting the S. aureus nuc and sodA genes, respectively. The sodA nested assay showed an enhanced limit of detection (LOD of 5 genomic copies per reaction or 10 colony forming units (CFU per ml blood over 50 copies per reaction or 50 CFU/ml for the nuc assay. To establish optimal extraction protocols, we investigated the relative abundance of the bacteria in different components of the blood (white blood cells (WBCs, plasma or whole blood, using the above assays. The blood samples were obtained from the patients who were culture positive for S. aureus. Whole blood resulted in maximum PCR positives with sodA assay (90% positive as opposed to cell-associated bacteria (in WBCs (71% samples positive or free bacterial DNA in plasma (62.5% samples positive. Both the assays were further tested for direct detection of S. aureus in patient whole blood samples that were contemporaneous culture positive. S. aureus was detected in 40/45 of culture-positive patients (sensitivity 89%, 95% CI 0.75-0.96 and 0/59 negative controls with the sodA assay (specificity 100%, 95% CI 0.92-1. CONCLUSIONS: We have demonstrated a highly sensitive two-hour assay for detection of sepsis causing bacteria like S. aureus directly in 1 ml of whole blood, without the need for blood culture.

  1. Clustering and community detection in directed networks: A survey

    Science.gov (United States)

    Malliaros, Fragkiskos D.; Vazirgiannis, Michalis

    2013-12-01

    Networks (or graphs) appear as dominant structures in diverse domains, including sociology, biology, neuroscience and computer science. In most of the aforementioned cases graphs are directed - in the sense that there is directionality on the edges, making the semantics of the edges nonsymmetric as the source node transmits some property to the target one but not vice versa. An interesting feature that real networks present is the clustering or community structure property, under which the graph topology is organized into modules commonly called communities or clusters. The essence here is that nodes of the same community are highly similar while on the contrary, nodes across communities present low similarity. Revealing the underlying community structure of directed complex networks has become a crucial and interdisciplinary topic with a plethora of relevant application domains. Therefore, naturally there is a recent wealth of research production in the area of mining directed graphs - with clustering being the primary method sought and the primary tool for community detection and evaluation. The goal of this paper is to offer an in-depth comparative review of the methods presented so far for clustering directed networks along with the relevant necessary methodological background and also related applications. The survey commences by offering a concise review of the fundamental concepts and methodological base on which graph clustering algorithms capitalize on. Then we present the relevant work along two orthogonal classifications. The first one is mostly concerned with the methodological principles of the clustering algorithms, while the second one approaches the methods from the viewpoint regarding the properties of a good cluster in a directed network. Further, we present methods and metrics for evaluating graph clustering results, demonstrate interesting application domains and provide promising future research directions.

  2. Halo-Independent Direct Detection Analyses Without Mass Assumptions

    CERN Document Server

    Anderson, Adam J; Kahn, Yonatan; McCullough, Matthew

    2015-01-01

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the $m_\\chi-\\sigma_n$ plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the $v_{min}-\\tilde{g}$ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from $v_{min}$ to nuclear recoil momentum ($p_R$), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call $\\tilde{h}(p_R)$. The entire family of conventional halo-independent $\\tilde{g}(v_{min})$ plots for all DM masses are directly found from the single $\\tilde{h}(p_R)$ plot through a simple re...

  3. Congratulations on the direct detection of gravitational waves

    CERN Multimedia

    2016-01-01

    This week saw the announcement of an extraordinary physics result: the first direct detection of gravitational waves by the LIGO Scientific Collaboration, which includes the GEO team, and the Virgo Collaboration, using the twin Laser Interferometer Gravitational-wave Observatory (LIGO) detectors located in Livingston, Louisiana, and Hanford, Washington, USA.   Albert Einstein predicted gravitational waves in a paper published 100 years ago in 1916. They are a natural consequence of the theory of general relativity, which describes the workings of gravity and was published a few months earlier. Until now, they have remained elusive. Gravitational waves are tiny ripples in space-time produced by violent gravitational phenomena. Because the fractional change in the space-time geometry can be at the level of 10-21 or smaller, extremely sophisticated, high-sensitivity instruments are needed to detect them. Recently, the Advanced LIGO detector increased its sensitivity by alm...

  4. The Past and Future of Light Dark Matter Direct Detection

    CERN Document Server

    Davis, Jonathan H

    2015-01-01

    We review the status and future of direct searches for light dark matter. We start by answering the question: `Whatever happened to the light dark matter anomalies?' i.e. the fate of the potential dark matter signals observed by the CoGeNT, CRESST-II, CDMS-Si and DAMA/LIBRA experiments. We discuss how the excess events in the first two of these experiments have been explained by previously underestimated backgrounds. For DAMA we summarise the progress and future of mundane explanations for the annual modulation reported in its event rate. Concerning the future of direct detection we focus on the irreducible background from solar neutrinos. We explain broadly how it will affect future searches and summarise efforts to mitigate its effects.

  5. Theoretical Antineutrino Detection, Direction and Ranging at Long Distances

    CERN Document Server

    Jocher, G R; Dobbs, B M; Dye, S T; Learned, J A Georges III J G; Mulliss, C L; Usman, S

    2013-01-01

    In this paper we introduce the concept of what we call "NUDAR" (NeUtrino Direction and Ranging), making the point that measurements of the observed energy and direction vectors can be employed to passively deduce the exact three-dimensional location and thermal power of geophysical and anthropogenic neutrino sources from even a single detector. We present the most precise background estimates to date, all handled in full three dimensions, as functions of depth and geographical location. For the present calculations, we consider a hypothetical 138 kiloton detector which can be transported to an ocean site and deployed to an operational depth. We present a Bayesian estimation framework to incorporate any a priori knowledge of the reactor that we are trying to detect, as well as the estimated uncertainty in the background and the oscillation parameters. Most importantly, we fully employ the knowledge of the reactor spectrum and the distance-dependent effects of neutrino oscillations on such spectra. The latter, ...

  6. Silicon avalanche photodiodes for direct detection of X-rays.

    Science.gov (United States)

    Baron, Alfred Q R; Kishimoto, Shunji; Morse, John; Rigal, Jean Marie

    2006-03-01

    Silicon avalanche photodiodes (APDs) are discussed as fast X-ray detectors for synchrotron radiation. The emphasis is on ;direct' detection, where the X-ray is absorbed within the silicon APD itself, and, therefore, on use with medium-energy X-rays, <30 keV. The impact of APD structure on device performance is examined, and representative data from many different commercial devices are presented. Specific areas discussed include signal shapes, high-rate behavior, time resolution and pulse-height response. Data from several APD arrays are also presented, as is a detailed description of an integrated package system. Tables are included comparing commercially available devices, including arrays.

  7. Direct detection experiments explained with mirror dark matter

    Science.gov (United States)

    Foot, R.

    2014-01-01

    Recently, the CDMS/Si experiment has observed a low energy excess of events in their dark matter search. In light of this new result we update the mirror dark matter explanation of the direction detection experiments. We find that the DAMA, CoGeNT, CRESST-II and CDMS/Si data can be simultaneously explained by halo ∼Fe‧ interactions provided that vrot≈200 km/s. Other parameter space is also possible. Forthcoming experiments, including CDMSlite, CDEX, COUPP, LUX, C-4, … should be able to further scrutinize mirror dark matter and closely related hidden sector models in the near future.

  8. Direct detection experiments explained with mirror dark matter

    CERN Document Server

    Foot, R

    2014-01-01

    Recently, the CDMS/Si experiment has observed a low energy excess of events in their dark matter search. In light of this new result we update the mirror dark matter explanation of the direction detection experiments. We find that the DAMA, CoGeNT, CRESST-II and CDMS/Si data can be simultaneously explained by halo $\\sim Fe'$ interactions provided that $v_{rot} \\approx 200$ km/s. Other parameter space is also possible. Forthcoming experiments, including CDMSlite, CDEX, COUPP, LUX, C-4,... should be able to further scrutinize mirror dark matter and closely related hidden sector models in the near future.

  9. Simultaneous mass detection for direct inlet mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Gordon, R.L.

    1979-05-01

    The evolution of analytical techniques for application in trace analysis has led to interest in practical methods for real-time monitoring. Direct inlet mass spectrometry (DIMS) has been the subject of considerable activity in recent years. A DIMS instrument is described which consists of an inlet system designed to permit particles entrained in the inlet air stream to strike a hot, oxidized rhenium filament which serves as a surface ionization source. A mass analyzer and detection system then permits identification of the elemental composition of particulates which strike the filament.

  10. Self-interacting Dark Matter Without Direct Detection Constraints

    OpenAIRE

    Zhang, Yue

    2016-01-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the d...

  11. Unstable gravitino dark matter prospects for indirect and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Grefe, Michael

    2011-11-15

    We confront the signals expected from unstable gravitino dark matter with observations of indirect dark matter detection experiments in all possible cosmic-ray channels. For this purpose we calculate in detail the gravitino decay widths in theories with bilinear violation of R parity, particularly focusing on decay channels with three particles in the final state. Based on these calculations we predict the fluxes of gamma rays, charged cosmic rays and neutrinos expected from decays of gravitino dark matter. Although the predicted spectra could in principal explain the anomalies observed in the cosmic ray positron and electron fluxes as measured by PAMELA and Fermi LAT, we find that this possibility is ruled out by strong constraints from gamma-ray and antiproton observations. Therefore, we employ current data of indirect detection experiments to place strong constraints on the gravitino lifetime and the strength of R-parity violation. In addition, we discuss the prospects of forthcoming searches for a gravitino signal in the spectrum of cosmic-ray antideuterons, finding that they are in particular sensitive to rather low gravitino masses. Finally, we discuss in detail the prospects for detecting a neutrino signal from gravitino dark matter decays, finding that the sensitivity of neutrino telescopes like IceCube is competitive to observations in other cosmic ray channels, especially for rather heavy gravitinos. Moreover, we discuss the prospects for a direct detection of gravitino dark matter via R-parity violating inelastic scatterings off nucleons. We find that, although the scattering cross section is considerably enhanced compared to the case of elastic gravitino scattering, the expected signal is many orders of magnitude too small in order to hope for a detection in underground detectors. (orig.)

  12. Direct detection of fourth generation Majorana neutrino dark matter

    CERN Document Server

    Zhou, Yu-Feng

    2012-01-01

    Heavy stable fourth generation Majorana neutrinos contribute to a small fraction of the relic density of dark matter (DM) in the Universe. Due to its relatively strong coupling to the standard model particles, it can be probed by the current direct and indirect DM detection experiments even it is a subdominant component of the halo DM. We show that the current Xenon100 data constrain the mass of the stable Majorana neutrino to be greater than the mass of the top quark. The effective spin-independent cross section for the neutrino elastic scattering off nucleon is predicted to be $\\sim 1.5\\times 10^{-44} cm^2$, which is insensitive to the neutrino mass and mixing and can be reached by the direct DM detection experiments in the near future. In the same mass region the predicted effective spin-dependent cross section for the heavy neutrino scattering off proton is in the range of $2\\times 10^{-40} cm^2\\sim 2\\times 10^{-39} cm^2$, which is within the reach of the ongoing DM indirect search experiments. We demonst...

  13. Physics from solar neutrinos in dark matter direct detection experiments

    CERN Document Server

    Cerdeño, David G; Jubb, Thomas; Machado, Pedro A N; Vincent, Aaron C; hm, Céline Bøe

    2016-01-01

    The next generation of dark matter direct detection experiments will be sensitive to both coherent neutrino-nucleus and neutrino-electron scattering. This will enable them to explore aspects of solar physics, perform the lowest energy measurement of the weak angle to date, and probe contributions from new theories with light mediators. In this article, we compute the projected nuclear and electron recoil rates expected in several dark matter direct detection experiments due to solar neutrinos, and use these estimates to infer errors on future measurements of the neutrino fluxes, weak mixing angle and solar observables, as well as to constrain new physics in the neutrino sector. The combined rates of solar neutrino events in second generation experiments (SuperCDMS and LZ) can yield a measurement of the pp flux to 2.5% accuracy via electron recoil, and slightly improve the boron-8 flux determination. Assuming a low-mass argon phase, projected tonne-scale experiments like DARWIN can reduce the uncertainty on bo...

  14. Stokes-vector direct detection for optical communications

    Science.gov (United States)

    Shieh, William; Li, An; Che, Di; Yuan, Feng; Khodakarami, Hamid

    2017-01-01

    To cope with the exponential growth of the Internet traffic, optical communications has advanced by leaps and bounds. For several decades, Intensity modulation with direct detection (IM-DD) dominates the commercial short-reach optical communications. However, when upgrading the data-rate distance product to 1000 Gb/s·km per wavelength and beyond, IM-DD faces severe performance barrier. Aiming to improve the electrical SE and extend the transmission distance, advanced DD modulation formats have been proposed through a so-called self-coherent (SCOH) approach, where a carrier is transmitted together with the signal to achieve a linear mapping between the electrical baseband signal and the optical field. In that way, the impact of the CD can be removed from the received signal, greatly extending the transmission distance of the DD system. Particularly, Stokes-vector direct detection (SV-DD) has been proposed to realize linear complex optical channels as well as enhance the electrical spectral efficiency and transmission reach. In this talk, we present the principle and discuss the performance of SV-DD systems.

  15. Effect of directional speech warnings on road hazard detection.

    Science.gov (United States)

    Serrano, Jesús; Di Stasi, Leandro L; Megías, Alberto; Catena, Andrés

    2011-12-01

    In the last 2 decades, cognitive science and the transportation psychology field have dedicated a lot of effort to designing advanced driver support systems. Verbal warning systems are increasingly being implemented in modern automobiles in an effort to increase road safety. The study presented here investigated the impact of directional speech alert messages on the participants' speed to judge whether or not naturalistic road scenes depicted a situation of impending danger. Thirty-eight volunteers performed a computer-based key-press reaction time task. Findings indicated that semantic content of verbal warning signals can be used for increasing driving safety and improving hazard detection. Furthermore, the classical result regarding signal accuracy is confirmed: directional informative speech messages lead to faster hazard detection compared to drivers who received a high rate of false alarms. Notwithstanding some study limitations (lack of driver experience and low ecological validity), this evidence could provide important information for the specification of future Human-Machine-interaction (HMI) design guidelines.

  16. Development of a novel gamma probe for detecting radiation direction

    Science.gov (United States)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  17. Directional eye fixation sensor using birefringence-based foveal detection

    Science.gov (United States)

    Gramatikov, Boris I.; Zalloum, Othman H. Y.; Wu, Yi Kai; Hunter, David G.; Guyton, David L.

    2007-04-01

    We recently developed and reported an eye fixation monitor that detects the fovea by its radial orientation of birefringent nerve fibers. The instrument used a four-quadrant photodetector and a normalized difference function to check for a best match between the detector quadrants and the arms of the bow-tie pattern of polarization states surrounding the fovea. This function had a maximum during central fixation but could not tell where the subject was looking relative to the center. We propose a linear transformation to obtain horizontal and vertical eye position coordinates from the four photodetector signals, followed by correction based on a priori calibration information. The method was verified on both a computer model and on human eyes. The major advantage of this new eye-tracking method is that it uses true information coming from the fovea, rather than reflections from other structures, to identify the direction of foveal gaze.

  18. Direct Detection of Stealth Dark Matter through Electromagnetic Polarizability

    CERN Document Server

    Appelquist, Thomas; Brower, Richard C; Buchoff, Michael I; Fleming, George T; Jin, Xiao-Yong; Kiskis, Joe; Kribs, Graham D; Neil, Ethan T; Osborn, James C; Rebbi, Claudio; Rinaldi, Enrico; Schaich, David; Schroeder, Chris; Syritsyn, Sergey; Vranas, Pavlos; Weinberg, Evan; Witzel, Oliver

    2015-01-01

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar baryon dark matter candidate -- "Stealth Dark Matter", that is based on a dark SU(4) confining gauge theory. In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest baryons in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to...

  19. Assessing Astrophysical Uncertainties in Direct Detection with Galaxy Simulations

    CERN Document Server

    Sloane, Jonathan D; Brooks, Alyson M; Governato, Fabio

    2016-01-01

    We study the local dark matter velocity distribution in four simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the Solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The baryonic effects responsible for the transfer of energy to the dark matter component increase the amount of high velocity dark matter, resulting in velocity distributions which are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Further, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulation. We show the impact on the direct detection experiments LUX, DAMA/Libra, and CoGent using our simulated velocity distributions. Our results indicate that the Standard Halo Model overpredicts the amount of dark matter in the high velocity ta...

  20. Self-interacting Dark Matter Without Direct Detection Constraints

    CERN Document Server

    Zhang, Yue

    2016-01-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the dark matter self-interaction strength. We derive the new parameter space of a pseudo-Dirac self-interacting dark matter. Interestingly, with increasing mass splitting, a weak scale dark matter mass window survives that could be probed by the LHC and future colliders.

  1. Light Magnetic Dark Matter in Direct Detection Searches

    DEFF Research Database (Denmark)

    Del Nobile, Eugenio; Kouvaris, Christoforos; Panci, Paolo

    2012-01-01

    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out...... by the CDMS, XENON and PICASSO experiments. We offer an analytic understanding of how the long-range interaction modifies the experimental allowed regions, in the cross section versus Dark Matter mass parameter space, with respect to the typically assumed contact interaction. Finally, in the context...... of a symmetric Dark Matter sector, we determine the associated thermal relic density, and further provide relevant constraints imposed by indirect searches and colliders....

  2. Self-interacting dark matter without direct detection constraints

    Science.gov (United States)

    Zhang, Yue

    2017-03-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the dark matter self-interaction strength. We derive the new parameter space of a pseudo-Dirac self-interacting dark matter. Interestingly, with increasing mass splitting, a weak scale dark matter mass window survives that could be probed by the LHC and future colliders.

  3. New Completeness Methods for Estimating Exoplanet Discoveries by Direct Detection

    CERN Document Server

    Brown, Robert A

    2010-01-01

    We report new methods for evaluating realistic observing programs that search stars for planets by direct imaging, where observations are selected from an optimized star list, and where stars can be observed multiple times. We show how these methods bring critical insight into the design of the mission & its instruments. These methods provide an estimate of the outcome of the observing program: the probability distribution of discoveries (detection and/or characterization), & an estimate of the occurrence rate of planets (eta). We show that these parameters can be accurately estimated from a single mission simulation, without the need for a complete Monte Carlo mission simulation, & we prove the accuracy of this new approach. Our methods provide the tools to define a mission for a particular science goal, for example defined by the expected number of discoveries and its confidence level. We detail how an optimized star list can be built & how successive observations can be selected. Our approa...

  4. The Earth's velocity for direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    McCabe, Christopher, E-mail: christopher.mccabe@durham.ac.uk [Institute for Particle Physics Phenomenology, Durham University, South Road, Durham, DH1 3LE (United Kingdom)

    2014-02-01

    The Earth's velocity relative to the Sun in galactic coordinates is required in the rate calculation for direct detection experiments. We provide a rigorous derivation of this quantity to first order in the eccentricity of the Earth's orbit. We also discuss the effect of the precession of the equinoxes, which has hitherto received little explicit discussion. Comparing with other expressions in the literature, we confirm that the expression of Lee, Lisanti and Safdi is correct, while the expression of Lewin and Smith, the de facto standard expression, contains an error. For calculations of the absolute event rate, the leading order expression is sufficient while for modulation searches, an expression with the eccentricity is required for accurate predictions of the modulation phase.

  5. Assessing Astrophysical Uncertainties in Direct Detection with Galaxy Simulations

    Science.gov (United States)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M.; Governato, Fabio

    2016-11-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  6. Lenslet array to further suppress starlight for direct exoplanet detection

    Science.gov (United States)

    Gong, Qian; McElwain, Michael; Shiri, Ron

    2016-07-01

    Direct imaging plays a key role in the detection and characterization of exoplanets orbiting within its host star's habitable zone. Many innovative ideas for starlight suppression and wavefront control have been proposed and developed over the past decade. However, several technological challenges still lie ahead to achieve the required contrast, including controlling the observatory pointing performance, fabricating occulting masks with tight optical tolerances, developing wavefront control algorithms, controlling stray light, advancing single photon detecting detectors, and integrated system-level issues. This paper explores how a lenslet array and pinhole mask may be implemented to further suppress uncorrected starlight that leaks through the occulting mask. An external occulter, or star shade, is simulated to demonstrate this concept, although this approach can be implemented for internal coronagraphs as well. We describe how to use simple relay optics to control the scene near the inner working angle and the level of the suppression expected. Furthermore, if the lenslet array is the input to an integral field spectrograph, as planned for the WFIRST mission, the spectral content of the exoplanet atmospheres can be obtained to determine if the observed planet is habitable and ultimately, if it is inhabited.

  7. Direct and Indirect Dark Matter Detection in Gauge Theories

    Energy Technology Data Exchange (ETDEWEB)

    Queiroz, Farinaldo [Federal Univ. of Paraba (Brazil)

    2013-01-01

    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.

  8. Direct detection of brown dwarf companions of nearby stars

    Science.gov (United States)

    Oppenheimer, Ben R.

    This thesis presents the first direct detection of a substellar companion of a star other than the Sun. This object, a brown dwarf called Gliese 229B, presented a unique opportunity to characterize low-temperature brown dwarfs for the first time. The discovery and initial spectrum of Gliese 229B show that the object must be substellar based on its intrinsic luminosity of 6.4×10-6Lsolar and its cool surface temperature, 900 K. Detailed study of Gliese 229B includes extensive photometric measurements from 0.5 to 12 μm, high signal-to-noise ratio spectroscopy from 0.84 to 5.0 μm and the detection of 0'' t; yr-1 of orbital motion. These results are presented in Chapters 2 and 3. A detailed review of brown dwarf science leads to a complete and scientifically meaningful definition of the classes ``planet'' and ``brown dwarf''' in Chapter 1. After the discovery of Gliese 229B, which was found in a survey for companions of young stars, we began an extensive search for brown dwarf companions in orbit about all known stars within 8 pc of the Sun and with δ > -35°. The search includes optical coronagraphic and infrared direct imaging of these stars, conducted on the Palomar 60' and 200' telescopes respectively. The search was designed to find companions of each star without color bias. While the search revealed no other brown dwarf companions of these stars, it did uncover 6 new stellar companions. The sensitivity limits of the survey permit the detection of brown dwarfs up to four magnitudes fainter than Gliese 229B around 90% of the stars. The sensitivity is, however, not uniform spatially or from star to star. This limits our ability to make strong statements about the prevalence of brown dwarf companions of nearby stars. The survey does have sensitivity to all stellar companions between 3 and 30' from the survey stars, however. Chapter 5 describes related work on very low-mass stars in the Pleiades star cluster. This optical spectroscopy involved trying to find a

  9. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    Science.gov (United States)

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  10. The effective field theory of dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Fitzpatrick, A. Liam; Haxton, Wick; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2013-02-01

    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  11. SUSY under siege from direct and indirect WIMP detection experiments

    Science.gov (United States)

    Baer, Howard; Barger, Vernon; Serce, Hasan

    2016-12-01

    We examine updated prospects for detecting WIMPs in supersymmetric models via direct and indirect dark matter search experiments. We examine several historical and also still viable scenarios: projections for well-tempered neutralinos (WTN), projections from the MasterCode (MC), BayesFits (BF) and Fittino (FO) collaborations, nonthermal wino dark matter (NThW) and finally mixed axion-Higgsino dark matter from SUSY with radiatively driven naturalness (RNS). The WTN is ruled out by recent limits from XENON and LUX collaborations. The NThW scenario, previously on tenuous ground due to gamma-line searches, appears also ruled out by recent combined Fermi-LAT/MAGIC limits combined with new HESS results from continuum gamma rays. Substantial portions of MC parameter space and 1 TeV Higgsino parameter space from BF group are ruled out. The 100-300 GeV Higgsino-like WIMP from RNS survives due to its possible depleted local abundance (where the axion may make up the bulk of dark matter). Projections from ton-scale noble liquid detectors should discover or rule out WIMPs from the remaining parameter space of these surviving models.

  12. SUSY under siege from direct and indirect WIMP detection experiments

    CERN Document Server

    Baer, Howard; Serce, Hasan

    2016-01-01

    We examine updated prospects for detecting WIMPs in supersymmetric models via direct and indirect dark matter search experiments. We examine several historical and also still viable scenarios: projections for well-tempered neutralinos (WTN), projections from the MasterCode (MC) collaboration, projections from the BayesFits (BF) collaboration, non-thermal wino dark matter (NThW) and finally mixed axion-higgsino dark matter from SUSY with radiatively-driven naturalness (RNS). The WTN is ruled out by recent limits from XENON and LUX collaborations. The NThW scenario, previously on tenuous ground due to gamma-line searches, appears also ruled out by recent combined Fermi-LAT/MAGIC limits combined with new HESS results from continuum gamma rays. Substantial portions of MC parameter space and 1 TeV higgsino parameter space from BF group are ruled out. The 100-300 GeV higgsino-like WIMP from RNS survives due to its possible depleted local abundance (where the axion may make up the bulk of dark matter). Projections f...

  13. Direct detection of exothermic dark matter with light mediator

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Chao-Qiang [Chongqing University of Posts & Telecommunications,Chongqing, 400065 (China); Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Huang, Da; Lee, Chun-Hao [Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Wang, Qing [Department of Physics, Tsinghua University,Beijing, 100084 (China); Collaborative Innovation Center of Quantum Matter,Beijing, 100084 (China)

    2016-08-05

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  14. Direct detection of exothermic dark matter with light mediator

    Science.gov (United States)

    Geng, Chao-Qiang; Huang, Da; Lee, Chun-Hao; Wang, Qing

    2016-08-01

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  15. Direct Detection of Exothermic Dark Matter with Light Mediator

    CERN Document Server

    Geng, Chao-Qiang; Lee, Chun-Hao; Wang, Qing

    2016-01-01

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  16. Direct detection of light anapole and magnetic dipole DM

    Energy Technology Data Exchange (ETDEWEB)

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng [Department of Physics and Astronomy, UCLA, 475 Portola Plaza, Los Angeles, CA 90095 (United States); Gondolo, Paolo, E-mail: delnobile@physics.ucla.edu, E-mail: gelmini@physics.ucla.edu, E-mail: paolo.gondolo@utah.edu, E-mail: jhhuh@physics.ucla.edu [Department of Physics and Astronomy, University of Utah, 115 South 1400 East #201, Salt Lake City, UT 84112 (United States)

    2014-06-01

    We present comparisons of direct detection data for ''light WIMPs'' with an anapole moment interaction (ADM) and a magnetic dipole moment interaction (MDM), both assuming the Standard Halo Model (SHM) for the dark halo of our galaxy and in a halo-independent manner. In the SHM analysis we find that a combination of the 90% CL LUX and CDMSlite limits or the new 90% CL SuperCDMS limit by itself exclude the parameter space regions allowed by DAMA, CoGeNT and CDMS-II-Si data for both ADM and MDM. In our halo-independent analysis the new LUX bound excludes the same potential signal regions as the previous XENON100 bound. Much of the remaining signal regions is now excluded by SuperCDMS, while the CDMSlite limit is much above them. The situation is of strong tension between the positive and negative search results both for ADM and MDM. We also clarify the confusion in the literature about the ADM scattering cross section.

  17. Enabling Technologies for Direct Detection Optical Phase Modulation Formats

    Science.gov (United States)

    Xu, Xian

    Phase modulation formats are believed to be one of the key enabling techniques for next generation high speed long haul fiber-optic communication systems due to the following main advantages: (1) with a balanced detection, a better receiver sensitivity over conventional intensity modulation formats, e.g., a ˜3-dB sensitivity improvement using differential phase shift keying (DPSK) and a ˜1.3-dB sensitivity improvement using differential quadrature phase shift keying (DQPSK); (2) excellent robustness against fiber nonlinearities; (3) high spectrum efficiency when using multilevel phase modulation formats, such as DQPSK. As the information is encoded in the phase of the optical field, the phase modulation formats are sensitive to the phase-related impairments and the deterioration induced in the phase-intensity conversion. This consequently creates new challenging issues. The research objective of this thesis is to depict some of the challenging issues and provide possible solutions. The first challenge is the cross-phase modulation (XPM) penalty for the phase modulated channels co-propagating with the intensity modulated channels. The penalty comes from the pattern dependent intensity fluctuations of the neighboring intensity modulated channels being converted into phase noise in the phase modulation channels. We propose a model to theoretically analyze the XPM penalty dependence on the walk off effect. From this model, we suggest that using fibers with large local dispersion or intentionally introducing some residual dispersion per span would help mitigate the XPM penalty. The second challenge is the polarization dependent frequency shift (PDf) induced penalty during the phase-intensity conversion. The direct detection DPSK is usually demodulated in a Mach-Zehnder delay interferometer (DI). The polarization dependence of DI introduces a PDf causing a frequency offset between the laser's frequency and the transmissivity peak of DI, degrading the demodulated DPSK

  18. Directional dark matter by polar angle direct detection and application of columnar recombination

    CERN Document Server

    Li, Jin

    2015-01-01

    We report a systematic study on the directional sensitivity of a direct dark matter detector that detects the polar angle of a recoiling nucleus. A WIMP-mass independent method is used to obtain the sensitivity of a general detector in an isothermal galactic dark matter halo. By using two-dimensional distributions of energy and polar angle, a detector without head-tail information with 6.3 times the statistics is found to achieve the same performance level as a full three-dimensional tracking dark matter detector. Optimum operation orientations are obtained for various experimental configurations, with detectors that are space- or Earth-fixed, have head-tail capability or not, and use energy information or not. Earth-fixed detectors are found to have best sensitivity when the polar axis is oriented at a 45 degree angle from the Earth's pole. The WIMP-mass dependence of the performance of a detector with a 3 keV energy threshold that uses xenon as target material is reported. We apply realistic experimental re...

  19. Optical intensity modulation direct detection versus heterodyne detection: A high-SNR capacity comparison

    KAUST Repository

    Chaaban, Anas

    2016-09-15

    An optical wireless communications system which employs either intensity-modulation and direct-detection (IM-DD) or heterodyne detection (HD) is considered. IM-DD has lower complexity and cost than HD, but on the other hand, has lower capacity. It is therefore interesting to investigate the capacity gap between the two systems. The main focus of this paper is to investigate this gap at high SNR. Bounds on this gap are established for two cases: between IM-DD and HD, and between IM-DD and an HD-PAM which is an HD system employing pulse-amplitude modulation (PAM). While the gap between IM-DD and HD increases as the signal-to-noise ratio (SNR) increases, the gap between IM-DD and an HD-PAM is upper bounded by a constant at high SNR. © 2015 IEEE.

  20. Identifying the theory of dark matter with direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Gluscevic, Vera [School of Natural Sciences, Institute for Advanced Study,Einstein Drive, Princeton NJ 08540 (United States); Gresham, Moira I. [Whitman College,Walla Walla, WA 99362 (United States); McDermott, Samuel D. [C.N. Yang Institute for Theoretical Physics,Stony Brook, NY 11794 (United States); Peter, Annika H.G. [CCAPP and Department of Physics, The Ohio State University,191 W. Woodruff Ave., Columbus, OH 43210 (United States); Department of Astronomy, The Ohio State University,140 W. 18th Ave., Columbus, OH 43210 (United States); Zurek, Kathryn M. [Theoretical Physics Group, Lawrence Berkeley National Laboratory,Berkeley, CA 94720 (United States); Berkeley Center for Theoretical Physics, University of California,erkeley, CA 94720 (United States)

    2015-12-29

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either “heavy” or “light” mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  1. Direct Detection of Extra-Solar Comets is Possible

    OpenAIRE

    Jura, M.

    2005-01-01

    The dust tails of comets similar to Hale-Bopp can scatter as much optical light as does the Earth. Space-based observatories such as the Terrestrial Planet Finder or Darwin that will detect extra-solar terrestrial planets also will be able to detect extra-solar comets.

  2. Discovery potential for directional dark matter detection with nuclear emulsions

    Science.gov (United States)

    Guler, A. M.; NEWSdm Collaboration

    2017-06-01

    Direct Dark Matter searches are nowadays one of the most exciting research topics. Several Experimental efforts are concentrated on the development, construction, and operation of detectors looking for the scattering of target nuclei with Weakly Interactive Massive Particles (WIMPs). In this field a new frontier can be opened by directional detectors able to reconstruct the direction of the WIMP-recoiled nucleus thus allowing to extend dark matter searches beyond the neutrino floor. Exploiting directionality would also give a proof of the galactic origin of dark matter making it possible to have a clear and unambiguous signal to background separation. The angular distribution of WIPM-scattered nuclei is indeed expected to be peaked in the direction of the motion of the Solar System in the Galaxy, i.e. toward the Cygnus constellation, while the background distribution is expected to be isotropic. Current directional experiments are based on the use of gas TPC whose sensitivity is limited by the small achievable detector mass. In this paper we show the potentiality in terms of exclusion limit of a directional experiment based on the use of a solid target made by newly developed nuclear emulsions and read-out systems reaching sub-micrometric resolution.

  3. Towards graphene-based detectors for dark matter directional detection

    CERN Document Server

    Wang, Shang-Yung

    2015-01-01

    Dark matter detectors with directional sensitivity have the capability to distinguish dark matter induced nuclear recoils from isotropic backgrounds, thus providing a smoking gun signature for dark matter in the Galactic halo. Here we propose a conceptually novel class of high directional sensitivity dark matter detectors utilizing graphene-based van der Waals heterostructures. The advantages over conventional low pressure gas time projection chamber-based directional detectors are discussed in detail. A practical implementation using graphene/hexagonal boron nitride and graphene/molybdenum disulfide heterostructures is presented together with an overwhelming amount of experimental evidence in strong support of its feasibility.

  4. Simplified Protocol for Carba NP Test for Enhanced Detection of Carbapenemase Producers Directly from Bacterial Cultures.

    Science.gov (United States)

    Pasteran, Fernando; Tijet, Nathalie; Melano, Roberto G; Corso, Alejandra

    2015-12-01

    We compared carbapenemase detection among 266 Gram-negative bacilli (161 carbapenemase producers) using the Carba NP tests issued by the CLSI (CNPt-CLSI) and a novel protocol (CNPt-direct) designed for carbapenemase detection direct from bacterial cultures (instead of bacterial extracts required by the CLSI tests). The specificities were comparable (100%), but the CNPt-direct was more sensitive (98% versus 84%). The CNPt-direct was easier to perform due to the direct use of colonies and offered a more robust detection of carbapenemase producers. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Direct detection at submillimetre wavelengths using superconducting tunnel junctions

    NARCIS (Netherlands)

    Withington, S; Isaak, KG; Kovtonyuk, SA; Panhuyzen, RA; Klapwijk, TM

    1995-01-01

    Superconducting tunnel-junction direct detectors are considered in some detail. For frequencies below twice that of the gap there is some bias voltage for which the input impedance is real, the responsivity quantum limited, and the dynamic range high. A susperconducting detector saturates for two re

  6. WildCARDs: Inflammatory caspases directly detect LPS

    OpenAIRE

    Hagar, Jon Alan; Aachoui, Youssef; Miao, Edward Axel

    2014-01-01

    Inflammasomes are sensors that serve as activation platforms for caspase-1 — a mechanism that set the prevailing paradigm for inflammatory caspase activation. A recent Nature paper by Shi et al. upends this paradigm by describing an unprecedented model for caspase activation whereby caspase-4, -5, and -11 directly bind their agonist, cytosolic LPS, triggering auto-activation and subsequent pyroptotic cell death.

  7. Teleconnection Paths via Climate Network Direct Link Detection

    Science.gov (United States)

    Zhou, Dong; Gozolchiani, Avi; Ashkenazy, Yosef; Havlin, Shlomo

    2015-12-01

    Teleconnections describe remote connections (typically thousands of kilometers) of the climate system. These are of great importance in climate dynamics as they reflect the transportation of energy and climate change on global scales (like the El Niño phenomenon). Yet, the path of influence propagation between such remote regions, and weighting associated with different paths, are only partially known. Here we propose a systematic climate network approach to find and quantify the optimal paths between remotely distant interacting locations. Specifically, we separate the correlations between two grid points into direct and indirect components, where the optimal path is found based on a minimal total cost function of the direct links. We demonstrate our method using near surface air temperature reanalysis data, on identifying cross-latitude teleconnections and their corresponding optimal paths. The proposed method may be used to quantify and improve our understanding regarding the emergence of climate patterns on global scales.

  8. The detection of transient directional couplings based on phase synchronization

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, T; Fell, J; Lehnertz, K, E-mail: twagner@uni-bonn.d [Department of Epileptology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany)

    2010-05-15

    We extend recent approaches based on the concept of phase synchronization to enable the time-resolved investigation of directional relationships between coupled dynamical systems from short and transient noisy time series. For our approach, we consider an observed ensemble of a sufficiently large number of time series as multiple realizations of a process. We derive an index that quantifies the direction of transient interactions and assess its statistical significance using surrogate techniques. Analysing time series from noisy and chaotic systems, we demonstrate numerically the applicability and limitations of our approach. Our findings from an exemplary application to event-related brain activities underline the importance of our method for improving knowledge about the mechanisms underlying memory formation in humans.

  9. A review of the discovery reach of directional Dark Matter detection

    CERN Document Server

    Mayet, F; Battat, J B R; Billard, J; Bozorgnia, N; Gelmini, G B; Gondolo, P; Kavanagh, B J; Lee, S K; Loomba, D; Monroe, J; Morgan, B; O'Hare, C A J; Peter, A H G; Phan, N S; Vahsen, S E

    2016-01-01

    Cosmological observations indicate that most of the matter in the Universe is Dark Matter. Dark Matter in the form of Weakly Interacting Massive Particles (WIMPs) can be detected directly, via its elastic scattering off target nuclei. Most current direct detection experiments only measure the energy of the recoiling nuclei. However, directional detection experiments are sensitive to the direction of the nuclear recoil as well. Due to the Sun's motion with respect to the Galactic rest frame, the directional recoil rate has a dipole feature, peaking around the direction of the Solar motion. This provides a powerful tool for demonstrating the Galactic origin of nuclear recoils and hence unambiguously detecting Dark Matter. Furthermore, the directional recoil distribution depends on the WIMP mass, scattering cross section and local velocity distribution. Therefore, with a large number of recoil events it will be possible to study the physics of Dark Matter in terms of particle and astrophysical properties. We rev...

  10. Direct Detection Phenomenology in Models Where the Products of Dark Matter Annihilation Interact with Nuclei

    DEFF Research Database (Denmark)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2015-01-01

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection...... cross sections has already been reached in a class of models. Moreover, the compatibility of dark matter direct detection experiments can be compared directly in $E_{{\\rm min}}$ space without making assumptions about DM astrophysics, mass, or scattering form factors. Lastly, when DM has direct couplings...... to nuclei, the limit from annihilation to relativistic particles in the Sun can be stronger than that of conventional non-relativistic direct detection by more than three orders of magnitude for masses in a 2-7 GeV window....

  11. Direct detection of relic active and sterile neutrinos

    CERN Document Server

    Li, Yu-Feng

    2016-01-01

    Both active and sterile sub-eV neutrinos can form the cosmic neutrino background in the early Universe. We consider the beta-decaying (e.g., $^3$H) and EC-decaying (e.g., $^{163}$Ho) nuclei as the promising targets to capture relic neutrinos in the laboratory. We calculate the capture rates of relic electron neutrinos and antineutrinos against the corresponding beta decay or electron capture (EC) decay backgrounds in the (3+$N_{\\rm s}$) flavor mixing scheme, and discuss the future prospect in terms of the PTOLEMY project. We stress that such direct measurements of hot DM might not be hopeless in the long term.

  12. Dark Matter Overview: Collider, Direct and Indirect Detection Searches

    CERN Document Server

    Queiroz, Farinaldo S

    2016-01-01

    The complementarity of direct, indirect and collider searches for dark matter has improved our understanding concerning the properties of the dark matter particle. I will review the basic concepts that these methods rely upon and highlight what are the most important information they provide when it comes down to interpret the results in terms of Weakly Interacting Massive Particles (WIMPs). Later, I go over some of the latest results emphasizing the implications to dark matter theory in a broad sense and point out recent developments and prospects in the field.

  13. ANOMALY DETECTION AND ATTRIBUTION USING AUTO FORECAST AND DIRECTED GRAPHS

    Directory of Open Access Journals (Sweden)

    Vivek Sankar

    2016-03-01

    Full Text Available In the business world, decision makers rely heavily on data to back their decisions. With the quantum of data increasing rapidly, traditional methods used to generate insights from reports and dashboards will soon become intractable. This creates a need for efficient systems which can substitute human intelligence and reduce time latency in decision making. This paper describes an approach to process time series data with multiple dimensions such as geographies, verticals, products, efficiently, and to detect anomalies in the data and further, to explain potential reasons for the occurrence of the anomalies. The algorithm implements auto selection of forecast models to make reliable forecasts and detect such anomalies. Depth First Search (DFS is applied to analyse each of these anomalies and find its root causes. The algorithm filters the redundant causes and reports the insights to the stakeholders. Apart from being a hair-trigger KPI tracking mechanism, this algorithm can also be customized for problems lke A/B testing, campaign tracking and product evaluations.

  14. RFLP analysis in rice by using ECL direct nucleic acid labeling and detection system

    Institute of Scientific and Technical Information of China (English)

    ZHANGShanhong; LIUBin; LUOLin; ZHUXiaoyuan; YANGQiyun; WUShangzhong

    1998-01-01

    ECL (Enhanced Chemiluminescence) direct nu cleic acid labeling and detection syslem were used for RFLP analysis in rice. The system involved directly labeling DNA probe with the enzyme horseradish peroxidase (HRP), and the detection of non-radioactive signal based on chemiluminescence, that was the generation of light via enzyme (HRP)-catalyzed reactions. It was a simple, safe,

  15. Detection of Human Head Direction Based on Facial Normal Algorithm

    Directory of Open Access Journals (Sweden)

    Lam Thanh Hien

    2015-01-01

    Full Text Available Many scholars worldwide have paid special efforts in searching for advance approaches to efficiently estimate human head direction which has been successfully applied in numerous applications such as human-computer interaction, teleconferencing, virtual reality, and 3D audio rendering. However, one of the existing shortcomings in the current literature is the violation of some ideal assumptions in practice. Hence, this paper aims at proposing a novel algorithm based on the normal of human face to recognize human head direction by optimizing a 3D face model combined with the facial normal model. In our experiments, a computational program was also developed based on the proposed algorithm and integrated with the surveillance system to alert the driver drowsiness. The program intakes data from either video or webcam, and then automatically identify the critical points of facial features based on the analysis of major components on the faces; and it keeps monitoring the slant angle of the head closely and makes alarming signal whenever the driver dozes off. From our empirical experiments, we found that our proposed algorithm effectively works in real-time basis and provides highly accurate results

  16. Direct detection at submillimetre wavelengths using superconducting tunnel junctions

    Science.gov (United States)

    Withington, S.; Isaak, K. G.; Kovtonyuk, S. A.; Panhuyzen, R. A.; Klapwijk, T. M.

    1995-12-01

    Superconducting tunnel-junction direct detectors are considered in some detail. For frequencies below twice that of the gap there is some bias voltage for which the input impedance is real, the responsivity quantum limited, and the dynamic range high. A susperconducting detector saturates for two reasons: intrinsic saturation due to the relative increase in two-photon tunnelling processes, and extrinsic saturation due to the input match changing with bias voltage. The responsivity of a detector with a resistive RF source is least sensitive to bias-voltage changes and has the greatest dynamic range when operating with a sloping load line. In the case of an inductive source, the dynamic range can be higher than the intrinsic saturation rate would suggest. Ideally, superconducting tunnel-junction detectors should be biased in a constant-voltage mode. If the responsivity is to be depressed by no more than a few percent, the photon step should have a height which is no more than one quarter of the total current turn-on at the gap. Superconducting direct detectors can be used to make precise and well-calibrated optical measurements at submillimetre wavelengths.

  17. Theoretical interpretation of experimental data from direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Shan Chung-Lin

    2007-10-15

    I derive expressions that allow to reconstruct the normalized one-dimensional velocity distribution function of halo WIMPs and to determine its moments from the recoil energy spectrum as well as from experimental data directly. The reconstruction of the velocity distribution function is further extended to take into account the annual modulation of the event rate. All these expressions are independent of the as yet unknown WIMP density near the Earth as well as of the WIMP-nucleus cross section. The only information about the nature of halo WIMPs which one needs is the WIMP mass. I also present a method for the determination of the WIMP mass by combining two (or more) experiments with different detector materials. This method is not only independent of the model of Galactic halo but also of that of WIMPs. (orig.)

  18. Detection of directional energy damping in vibrating systems

    Indian Academy of Sciences (India)

    B R Amruth; Souri Banerjee

    2009-04-01

    The transmission efficiency, frequency and amplitude alteration have been measured by a simple technique of coupled oscillators with a frequency gradient and in a system of non-Newtonian fluid in the form of corn-flour slime. The system of coupled oscillators was found to exhibit preferential energy transfer towards the low frequency end with the reverse propagation severely damped. Energy transfer in all directions was damped in the non-Newtonian fluid in comparison with water. Also the damping in non-Newtonian fluids works only after a lower limit for input amplitude. While most of the previous studies focussed on dissipation of energy within shock-absorbing systems, we demonstrate the contribution of re-distribution of energy reaching the output end to achieve shock absorbing.

  19. Integrating In Dark Matter Astrophysics at Direct Detection Experiments

    CERN Document Server

    Friedland, Alexander

    2013-01-01

    We study the capabilities of the MAJORANA DEMONSTRATOR, a neutrinoless double-beta decay experiment currently under construction at the Sanford Underground Laboratory, as a light WIMP detector. For a cross section near the current experimental bound, the MAJORANA DEMONSTRATOR should collect hundreds or even thousands of recoil events. This opens up the possibility of simultaneously determining the physical properties of the dark matter and its local velocity distribution, directly from the data. We analyze this possibility and find that allowing the dark matter velocity distribution to float considerably worsens the WIMP mass determination. This result is traced to a previously unexplored degeneracy between the WIMP mass and the velocity dispersion. We simulate spectra using both isothermal and Via Lactea II velocity distributions and comment on the possible impact of streams. We conclude that knowledge of the dark matter velocity distribution will greatly facilitate the mass and cross section determination f...

  20. Direct detection of variable tropospheric clouds near Titan's south pole.

    Science.gov (United States)

    Brown, Michael E; Bouchez, Antonin H; Griffith, Caitlin A

    Atmospheric conditions on Saturn's largest satellite, Titan, allow the possibility that it could possess a methane condensation and precipitation cycle with many similarities to Earth's hydrological cycle. Detailed imaging studies of Titan have hitherto shown no direct evidence for tropospheric condensation clouds, although there has been indirect spectroscopic evidence for transient clouds. Here we report images and spectra of Titan that show clearly transient clouds, concentrated near the south pole, which is currently near the point of maximum solar heating. The discovery of these clouds demonstrates the existence of condensation and localized moist convection in Titan's atmosphere. Their location suggests that methane cloud formation is controlled seasonally by small variations in surface temperature, and that the clouds will move from the south to the north pole on a 15-year timescale.

  1. A Pilot Study to Investigate the Effectiveness of Multimedia CD-ROM vis-a-vis Traditional Print-Based Technology in Teaching Fourth-Grade Children

    Science.gov (United States)

    Shana, Zuhrieh A.

    2009-01-01

    The purpose of this study was to examine the degree of effectiveness of multimedia technology in teaching in comparison to the traditional print-based teaching methods. Multimedia CD was designed to teach the second semester unit of science and Islamic studies for the fourth graders. The unit's content was the same in the print-based teaching…

  2. Kojic acid vis-a-vis its combinations with hydroquinone and betamethasone valerate in melasma: A randomized, single blind, comparative study of efficacy and safety

    Directory of Open Access Journals (Sweden)

    Kirti S Deo

    2013-01-01

    Strict photoprotection and use of a SPF 15 sunscreen was advised during the day. Patients were evaluated every 2 weeks and a fall in MASI score was calculated at the end of the study period of 12 weeks by the same investigator. Results: The response was compared according to percentage decrease in MASI score. Efficacy was evaluated among the groups at the end of 3 months using bivariate analysis and calculated by using the paired ′t′ test. The clinical efficacy of group B was the highest followed closely by group D and group A, that of group C being the lowest. Conclusion: Kojic acid in synergy with hydroquinone is a superior depigmenting agent as compared with other combinations.

  3. Effect of supplementation of lysine producing microbes vis-a-vis source and level of dietary protein on performance and egg quality characteristics of post-peak layers.

    Science.gov (United States)

    Manju, G U; Reddy, B S V; Gloridoss, Gideon; Prabhu, T M; Giridhar, K S; Suma, N

    2015-04-01

    The aim was to study the effect of supplementation of lysine producing microbes (LPM) as an in vivo source of lysine on performance and egg quality characters of post-peak layers. BIS (1992) specified diets (except crude protein [CP] and lysine) were prepared using either soybean meal (SBM) or groundnut extractions (GNE) or sunflower extractions (SFE) with 16 and 15% CP resulting in six control diets. Further, each control diet was fortified with either synthetic lysine or LPM to meet BIS (1992) specified lysine requirement resulting in the set of 12 test diets. Each of the eighteen diets was offered to quadruplets groups of 4 post-peak (52 weeks) commercial laying hens in each. The trial lasted for 119 days. The results revealed that the feed consumption and body weight changes and Roche yolk color and yolk index were significantly (p ≤ 0.05) different among different treatments. However, egg production, feed efficiency, egg weight, egg shape index, Haugh unit score, albumen index and shell thickness, and net returns remained non-significant (p ≤ 0.05) among different treatments. Among main factors, protein level (16% and 15% CP) made a significant (p ≤ 0.05) difference in egg production (79.6 and 75.1%) and feed efficiency (2.64 and 2.81 kg feed/kg egg mass, respectively). Among protein source GNE- and SFE-based diet fed groups showed significantly (p < 0.0%) higher feed consumption and body weight gain than SBM based diets fed birds. Yolk color (7.0, 7.3 and 7.3, respectively) and yolk index (0.40, 0.38 and 0.43, respectively) were significantly (p ≤ 0.05) different from the protein sources. CP level and Protein source interaction effects showed significant differences in albumen index and Haugh unit score. Optimum level of protein (16% CP) and GNE as a source of protein tended to be superior in increasing the performance and egg characteristics of post-peak layers and supplementation of lysine in either synthetic or LPM form found to be beneficial in optimizing their performance.

  4. Disciplining of Student's vis-a-vis the Duties/Responsibilities of Vice Principals in Secondary Institutions in Oyo State: Yesterday and Today

    Science.gov (United States)

    Adewusi, Aderogba Oladiran

    2012-01-01

    This paper focused on how Nigeria' teeming youth requires a high level of seriousness from all stakeholders: the student, school administrators, teaching staff, parents, educational agencies and the government. There had been much emphasis on the need for everyone to understand and play specifically assigned roles, and to ensure that the posterity…

  5. [Pierre-Joseph Duhem (1758-1807), doctor regicide, and other National Convention physician-deputies vis-a-vis the lawsuit of Louis XVI].

    Science.gov (United States)

    Dupont, Geneviève; Lellouch, Alain; Olry, Régis

    2006-01-01

    On January 16, 1793, seven hundred aud forty nine deputies of the National Convention are called on to express their opinion by word of mouth about this question: "What penalty Louis, former king of the French, brought upon himself ?" Among these deputies, 47 are or were physicians : 22 vote for death without delay, 3 for suspended death sentence, 20 for indulgence (imprisonment till the peace and banishment thereafter), and 2 refuse to vote. This paper aims at summarizing the attitude of the physicians-deputies, and more specifically those of Pierre-Joseph Duhem, at the time of one of the most famous trials of the history of France.

  6. Mapping Ecology of Literacies in Educational Setting: The Case of Local Mother Tongues Vis-a-Vis Urdu and English Languages in Pakistan

    Science.gov (United States)

    Manan, Syed Abdul; David, Maya Khemlani

    2014-01-01

    This study critically examines the literacy levels of undergraduate students in Pakistan to compare and contrast the proficiency levels, particularly reading and writing of their mother tongues versus Urdu and English, and to study real and perceived vitality of local/regional mother tongues vis-à-vis Urdu and English. The research investigated…

  7. Development of Some Larval Nematodes in Experimental and Natural Animal Hosts: An Insight into Development of Pathological Lesions vis-a-vis Host-Parasite Interactions

    Directory of Open Access Journals (Sweden)

    N. Chowdhury

    2013-01-01

    Full Text Available Infective third-stage larvae of three spiruroid nematodes, Ascarops strongylina and Physocephalus sexalatus of pigs and Spirocerca lupi of dogs, were recovered from 14 species of coprophagous beetles belonging to 4 different genera. These larvae were fed to rabbits and/or guinea pigs to study their development in these experimental hosts. Larvae of A. strongylina reached the adult stage in all rabbits and one guinea pig. The adult worms recovered in these hosts were 40% and 4%, respectively, and became diminutive in comparison to their natural hosts. The larvae of P. sexalatus became reencysted in the gastric wall of rabbits inducing marked pathological changes. The infective larvae of S. lupi became reencapsulated in the stomach wall of the rabbit and also showed development in the aortic wall. Adults of Toxocara canis of dog, collected from 5 different regions of the Indian subcontinent, varied significantly in size. The mouse passage of infective larvae of one of these types led to the recovery of the adults from the experimental dogs that were smaller in size and caused severe pathology in natural experimental hosts. Developmental effects shown in experimental hosts and host specificity are of value in understanding the evolution of nematode parasitism.

  8. TP53 Mutation vis-a-vis Malignant Progression in Astrocytoma WHO Grade Ⅱ%TP53突变与胶质瘤恶性进展

    Institute of Scientific and Technical Information of China (English)

    岳伟英; 俞苏寰; 李志强; 赵世光; 陈忠平

    2008-01-01

    背景与目的:WHO Ⅱ级的星形细胞瘤手术后在部分患者可能复发,而且,复发时多出现恶性程度增加.本研究探讨TP53蛋白质分子的表达与胶质瘤恶性进展之问的关系.方法:收集第一次手术时为星形细胞瘤(WHO Ⅱ级)的石蜡包埋标本53例份,其中10例复发时第二次手术肿瘤仍然为Ⅱ级(复发无进展组);10例复发时肿瘤级别升高(Ⅲ级或Ⅳ级)(复发进展组);另外13例在5年内没有复发(无复发组).免疫组化检测TP53在肿瘤中的表达,并采用DNA测序法分析TP53蛋白阳性标本TP53外显子5、7、8的突变情况.结果:LTP53阳性率为45.5%(15/33).复发恶性进展组TP53高于无复发组和无进展组(P<0.05);TP53无进展组与无复发组之间差异无统计学意义.基因测序共在6例组织中发现7个(共4类)突变,其中1例同时存在2个突变.所有突变者都是恶性进展组病例.结论:TP53突变/蛋白质分子过表达可能是Ⅱ级星形胶质细胞瘤复发恶性进展的预示指标.

  9. Premiers resultats experimentaux sur le comportement de Tabebuia heterophylla (DC) Britton et de Hymenaea courbaril L. vis-a vis de la secheresse

    OpenAIRE

    Huc, Roland

    1985-01-01

    Deux espèces de la forêt de basse altitude d’Amérique tropicale (Antilles), Tabebebuia heterophylla (poirier-pays) et Hymenaea courbaril (courbaril), se révèlent intéressantes pour le reboisement des régions les moins arrosées. Le comportement de ces espèces vis-à-vis de la sécheresse est étudié grâce à un traitement sous forme d’arrosage différencié appliqué à des jeunes plants âgés de 1 an, en pépinière. L'évolution de l’état hydrique des plants est suivie au cours de 6 mois d’expéri...

  10. Oseltamivir prescription and regulatory actions vis-a-vis abnormal behavior risk in Japan: drug utilization study using a nationwide pharmacy database.

    Directory of Open Access Journals (Sweden)

    Hisashi Urushihara

    Full Text Available BACKGROUND: In March 2007, a regulatory advisory was issued in Japan to restrict oseltamivir use in children aged 10-19 years because of safety concerns over abnormal behavior. The effectiveness and validity of regulatory risk minimization actions remain to be reviewed, despite their significant public health implications. To assess the impact of the regulatory actions on prescribing practices and safety reporting. METHODOLOY/PRINICPAL FINDINGS: In this retrospective review of a nationwide pharmacy database, we analyzed 100,344 dispensation records for oseltamivir and zanamivir for the period from November 2006 to March 2009. The time trend in dispensations for these antiviral agents was presented before and after the regulatory actions, contrasted with intensity of media coverage and the numbers of spontaneous adverse reaction reports with regard to antivirals. The 2007 regulatory actions, together with its intense media coverage, reduced oseltamivir dispensation in targeted patients in fiscal year 2008 to 20.4% of that in fiscal year 2006, although influenza activities were comparable between these fiscal years. In contrast, zanamivir dispensation increased approximately nine-fold across all age groups. The number of abnormal behavior reports associated with oseltamivir in children aged 10-19 years decreased from fiscal year 2006 to 2008 (24 to 9 cases; this decline was offset by the increased number of reports of abnormal behavior in children under age 10 (12 to 28 cases. The number of reports associated with zanamivir increased in proportion to increased dispensation of this drug (11 to 114 cases. CONCLUSIONS/SIGNIFICANCE: The 2007 actions effectively reduced oseltamivir prescriptions and the number of reports of abnormal behavior in the targeted group. The observed increase in abnormal behavior reports in oseltamivir patients under age 10 and in zanamivir patients suggests that these patient groups may also be at risk, calling into question the validity of the current discrimination by age and agent (Abstract translation is available in Japanese: Appendix S1.

  11. Non-Profit Education Providers vis-a-vis the Private Sector: Comparative Analysis of Non-Governmental Organizations and Traditional Voluntary Organizations in Pakistan

    Science.gov (United States)

    Bano, Masooda

    2008-01-01

    Under the New Policy Agenda, international development institutions have promoted non-profit organizations (NPOs) in developing countries, on a dual logic: firstly, they deliver social services more efficiently than the state; secondly, they mitigate equity concerns around privatization of basic social services by reaching out to the poor. Based…

  12. Representations et Competencies vis-a-vis de l'Ecrit Chez des Enfants Francais et Allemands d'Age Prescolaire.

    Science.gov (United States)

    Preteur, Yves; Louvet-Schmauss, Eva

    1994-01-01

    Compares German and French preschool children's attitudes about school and literacy. Notes that French preschools aim to prepare children for primary education, whereas German preschools give priority to learning through play. Finds that children developed attitudes in line with their preschool system and that only French children from deprived…

  13. Visualization and co-occurrence of journals in the area of information science in vis-a-vis the Qualis/Capes system in Brazil

    Directory of Open Access Journals (Sweden)

    Adilson Luiz Pinto

    2016-05-01

    Full Text Available This paper aims at qualifying scientific journals that are part of the listing Qualis/Capes Brazil. The site of Capes only lists a few influential international titles. Included in this list are “Information Processing & Management, Organization Knowledge and Library” but several other important titles in Information Science are not covered. Our study describes 27 scientific worldwide journals, representing the world stage in Information Science, and which for some reason are not well respected in Brazil. The influence of these international journals (which are part of Web of Science is evidenced by measuring the power they have in the scientific field of Information Science as well as the power of major authors (Salton, Spink, Nicholas, Belkin, Saracevic, Dervin, Garfield and others. Citation index comparison with the other journals in the area and index of impact factor are also analyzed. The results highlight the importance of JASIST, Information Processing & Management, College Research Library, Journal of Documentation, ARIST, Journal Information Sciences, Information Retrieval and Library Trends, both in the matter of world representativeness and in the number of citations.

  14. Globalização vis-a-vis a história do nacionalismo na América Latina: o caso do Brasil

    Directory of Open Access Journals (Sweden)

    Céli Regina Jardim Pinto

    2012-12-01

    Full Text Available The article has as start point a central question: Is it possible to identify a reaction to the globalization of capitalism, in term of a globalized movement that involves an alternative to the system or to the north hegemony in relation to the south countries, many of them in conditions of complete miserably and deep social inequality? To examine this question the article is divided in to four small sections: 1.The Internationalism and nationalism; 2. The Nationalism in Brazil; 3. The global civil society; 4. A conclusion. This article concludes that we are far away from a global civil society able to propose a way of life that problematize the capitalist system and all forms of exploitation and class, gender and race dominations.

  15. Dissociated reality vis-a-vis integrative planning of AYUSH in Maternal Health Program: A situational analysis in Jaleswar block of Balasore district of Odisha, India.

    Science.gov (United States)

    Dehury, Ranjit Kumar; Chatterjee, Suhita Chopra

    2016-01-01

    Mainstreaming of AYUSH and revitalization of local health traditions is one of the innovative components of the National Rural Health Mission (NRHM) in the state of Odisha, India. In this study, an attempt was made to assess the potential of collocating AYUSH to improve maternal health services in tribal dominated Jaleswar block of the Balasore district. In addition, the study aimed at unearthing the underlying challenges and constraints in mainstreaming AYUSH and linking it with the Maternal Health Program. Review of the policy documents and guidelines, both central and state government, was made to assess the implementation of AYUSH in Odisha. Primary data were collected through interviews with AYUSH doctors, district and block level health administrators, and tribal women. The study revealed the inadequacy of basic amenities, infrastructure, drugs, and consumables in the health centers for integrating AYUSH in the delivery of maternal health services. Analysis of the job chart and work pattern of AYUSH doctors showed underutilization of their specialized knowledge to treat patients. Lack of continued medical education, standard operating procedures for treatment and spatial marginalization made suboptimal utilization of AYUSH services. This is unfortunate given the fact that such regions are economically underdeveloped and already have a distinct orientation toward indigenous health systems. AYUSH, on account of its holistic approach and proven cost-effectiveness, could be a viable option for improving maternal health in the region. The study concluded that although there is huge scope for integrating AYUSH in Maternal Health Program under the ongoing NRHM, the full potential is yet to be exploited. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  16. A CLINICAL STUDY ON THE EFFICACY OF PATALADI KASHAYA IN THE MANAGEMENT OF ‘VATASHTEELA’ VIS A VIS ‘BPH’ (BENIGN PROSTATIC HYPERTROPHY

    Directory of Open Access Journals (Sweden)

    Pradeep E K

    2013-12-01

    Full Text Available In the present clinical study the cases of disease ‘Vatashteela’, which is a type of Mutraghata in terms of Benign Prostate Hypertrophy (BPH, were considered. The objective of the study was to assess the efficacy of Pataladi kashaya in Vatashteela ‘vis a vis’ BPH. Total 30 patients having signs and symptoms of ‘Vatashteela’ ‘vis a vis’ BPH were included according to criteria of AUA-SI (American Urological Association – Symptom Index, and also after diagnosing BPH by Digital Rectal Examination, and Ultrasonography of Abdomen and pelvis. Patients were assigned into a single group consisting of 30 patients for whom Pataladi kashaya 30 ml thrice a day before food with sukhoshna jala for 30 days was administered. Incomplete emptying, Frequency, Urgency, Intermittency, Straining, Weak stream and Nocturia were the Subjective parameters, data of which were collected before (day 0, during (day 15, after (day 30 and follow up (day 60. The objective parameters were residual urine, volume and size of the prostate. These data were collected before (day 0 and after (day 30 of the clinical trial. The analysis was done statistically by using Repeated Measure ANOVA, student‘t’ test and contingency co-efficient table. The statistical values showed significant results in subjective and objective parameters. In lateral lobe enlargement, symptoms were relieved to a greater extent compared to median lobe enlargement. Residual urine, volume of the prostate, obstructive symptoms showed marked improvement in many of the patients, and there was also significant decrease in size of the prostate. Overall assessment showed marked and moderate improvement in many patients. Pataladi kashaya is useful in reducing the signs and symptoms of ‘Vatashteela’ ‘vis a vis’ ‘BPH’ and even residual urine, volume and size of the prostate. Pataladi kashaya is beneficial due to its properties in improving obstructive symptoms and reducing the size of the prostate.

  17. A self-interaction-free local hybrid functional: Accurate binding energies vis-\\`a-vis accurate ionization potentials from Kohn-Sham eigenvalues

    CERN Document Server

    Schmidt, Tobias; Makmal, Adi; Kronik, Leeor; Kümmel, Stephan

    2014-01-01

    We present and test a new approximation for the exchange-correlation (xc) energy of Kohn-Sham density functional theory. It combines exact exchange with a compatible non-local correlation functional. The functional is by construction free of one-electron self-interaction, respects constraints derived from uniform coordinate scaling, and has the correct asymptotic behavior of the xc energy density. It contains one parameter that is not determined ab initio. We investigate whether it is possible to construct a functional that yields accurate binding energies and affords other advantages, specifically Kohn-Sham eigenvalues that reliably reflect ionization potentials. Tests for a set of atoms and small molecules show that within our local-hybrid form accurate binding energies can be achieved by proper optimization of the free parameter in our functional, along with an improvement in dissociation energy curves and in Kohn-Sham eigenvalues. However, the correspondence of the latter to experimental ionization potent...

  18. Direct detection of dark matter with noble liquid detectors

    Science.gov (United States)

    Spaans, Jason

    The search for non-baryonic, non-luminous dark matter that comprises approximately 23% of our universe is an exciting endeavor. However, detecting this matter has proved difficult as it does not interact through the electromagnetic force but only by scattering elastically off of target nuclei on the weak scale; therefore evidence of dark matter must be demonstrated through the observation of nuclear recoils induced by dark matter candidates. Because nuclear recoils can be caused by any type of elastic scattering reactions induced by radiogenic and cosmogenic processes, a dark matter detector must have an extremely low background. Moreover, the low energy signal of a dark matter event requires building detectors with large volumes of target material with low background. Noble liquids provide a promising target for the detection of dark matter. Of the noble elements, argon and xenon have been shown to be ideal targets in dark matter searches as they have excellent scintillation yield and are relatively inexpensive and scalable. However, natural argon contains a radioactive isotope, 39Ar, that must be reduced in order to observe a rare dark matter event. Several technologies exist that can be utilized to reduce the concentration of this element including thermal diffusion, underground water sources and laser isotope separation. Thermal diffusion employs a temperature gradient in order to separate gaseous argon isotopes along the length of a cylindrical column. A test bench thermal diffusion column has been constructed which resulted in the significant depletion of 36Ar in a natural argon sample. Underground water sources have also been evaluated in the pursuit of natural argon depleted of the 39Ar isotope. Since the water in these sources has not been in contact with atmospheric air for several thousand years that 39Ar should have decayed away. A water source at Wall, SD has been obtained and evaluated for depleted argon using a water degassing apparatus and a

  19. First Direct Detection of Clay Minerals on Mars

    Science.gov (United States)

    Singer, R. B.; Owensby, P. D.; Clark, R. N.

    1985-01-01

    Magnesian clays or clay-type minerals were conclusively detected in the martian regolith. Near-IR spectral observations of Mars using the Mauna Kea 2.2-m telescope show weak but definite absorption bands near microns. The absorption band positions and widths match those produced by combined OH stretch and Mg-OH lattice modes and are diagnostic of minerals with structural OH such as clays and amphiboles. Likely candidate minerals include serpentine, talc, hectorite, and sponite. There is no spectral evidence for aluminous hydroxylated minerals. No distinct band occurs at 2.55 microns, as would be expected if carbonates were responsible for the 2.35 micron absorption. High-albedo regions such as Elysium and Utopia have the strongest bands near 2.35 microns, as would be expected for heavily weathered soils. Low-albedo regions such as Iapygia show weaker but distinct bands, consistent with moderate coatings, streaks, and splotches of bright weathered material. In all areas observed, the 2.35-micron absorption is at least three times weaker than would be expected if well-crystallized clay minerals made up the bulk of bright soils on Mars.

  20. Direct phosphorescent detection of primary event of photodynamic action

    Science.gov (United States)

    Losev, Anatoly P.; Knukshto, Valentin N.; Zhuravkin, Ivan N.

    1994-07-01

    Highly phosphorescent photosensitizer Pd-tetra (o-methoxy-p-sulfo) phenyl porphyrin (Pd-MSPP) was used to follow the primary events of photodynamic action - quenching of triplet states by free oxygen in different systems: water solutions of proteins, cells and tissues in vivo and in vitro. The photosensitizer forms complexes with proteins in solutions and biosystems showing remarkable hypsochromic shifts of band and an increase of the quantum yield and lifetime of phosphorescence at the binding to proteins. In absence of oxygen the lifetime of phosphorescence is almost single exponential, and depends on the energy of lowest triplet state of the sensitizer. The photochemical quenching of the triplets by cell components is negligible. In presence of free oxygen the quenching of the sensitizer triplets takes place. The emission spectrum of singlet oxygen with maximum 1271 nm was recorded in water protein solutions and quantum yield of sensitized luminescence was measured. In the systems studied, oxygen consumption was detected and oxygen concentration was estimated in the course of photodynamics by an increase in photosensitizer phosphorescence lifetime, using laser flash photolysis technique. At least two exponential kinetics of the phosphorescence decay shows that the distribution of the free oxygen is not uniform in tissues.

  1. A direct immunoassay for detecting diatoms in groundwater as an indicator of the direct influence of surface water

    Science.gov (United States)

    Walker, C.E.; Schrock, R.M.; Reilly, T.J.; Baehr, A.L.

    2005-01-01

    Groundwater under the direct influence of surface water (GWUDISW) is of concern in communities where growing public demand on groundwater resources has resulted in increased withdrawals and hydraulic stress near surface water bodies. Under these conditions, contaminants such as methyl-tert butyl ether (MTBE) and biological materials have been detected in domestic wells. Other contaminants and pathogens associated with surface water are not routinely tested for in groundwater-supplied systems. To address the need for methods to easily identify potentially vulnerable supplies, a direct immunoassay for the quantitative detection of diatoms in raw water samples was developed as a measure of surface water influence on groundwater. Cell wall preparations from Nitzschia palea Ku??tzing, a freshwater diatom found throughout North America, were used to produce a polyclonal antibody that was applied in a direct enzyme-linked immunosorbent assay (ELISA) developed to detect the presence of N. palea cell wall components. The direct immunoassay allows detection at 500 cells L-1, a level similar to diatom concentrations observed in samples of groundwater collected near the test site. This investigation was the first attempt to utilize an ELISA as an indicator of surface water influence on groundwater. Further research is needed to develop more specific diatom-based monoclonal antibodies, determine cross-reactivity, and optimize sample processing and ELISA procedures for development of a standardized method. ?? Springer 2005.

  2. Criteria for Directly Detecting Topological Fermi Arcs in Weyl Semimetals.

    Science.gov (United States)

    Belopolski, Ilya; Xu, Su-Yang; Sanchez, Daniel S; Chang, Guoqing; Guo, Cheng; Neupane, Madhab; Zheng, Hao; Lee, Chi-Cheng; Huang, Shin-Ming; Bian, Guang; Alidoust, Nasser; Chang, Tay-Rong; Wang, BaoKai; Zhang, Xiao; Bansil, Arun; Jeng, Horng-Tay; Lin, Hsin; Jia, Shuang; Hasan, M Zahid

    2016-02-12

    The recent discovery of the first Weyl semimetal in TaAs provides the first observation of a Weyl fermion in nature and demonstrates a novel type of anomalous surface state, the Fermi arc. Like topological insulators, the bulk topological invariants of a Weyl semimetal are uniquely fixed by the surface states of a bulk sample. Here we present a set of distinct conditions, accessible by angle-resolved photoemission spectroscopy (ARPES), each of which demonstrates topological Fermi arcs in a surface state band structure, with minimal reliance on calculation. We apply these results to TaAs and NbP. For the first time, we rigorously demonstrate a nonzero Chern number in TaAs by counting chiral edge modes on a closed loop. We further show that it is unreasonable to directly observe Fermi arcs in NbP by ARPES within available experimental resolution and spectral linewidth. Our results are general and apply to any new material to demonstrate a Weyl semimetal.

  3. Halo-independent direct detection of momentum-dependent dark matter

    DEFF Research Database (Denmark)

    Cherry, J. F.; Frandsen, M. T.; Shoemaker, I. M.

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given...... a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can...

  4. Less-simplified models of dark matter for direct detection and the LHC

    CERN Document Server

    Choudhury, Arghya; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J

    2015-01-01

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for WIMP masses >10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that complementary use of several searches at the LHC can strongly constrain the direct detection blind spot by setting limits on the coupling constants and mediator masses. We derive the strongest limi...

  5. Fabry-Perot for the Integrated Direct Detection Lidar (FIDDL) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Develop an etalon front end receiver (FIDDL) and combine it with the Optical Autocovariance Wind Lidar (OAWL) for an integrated direct detection (IDD) wind lidar....

  6. Evaluation of two methods for direct detection of Fusarium spp. in water.

    Science.gov (United States)

    Graça, Mariana G; van der Heijden, Inneke M; Perdigão, Lauro; Taira, Cleison; Costa, Silvia F; Levin, Anna S

    2016-04-01

    Fusarium is a waterborne fungus that causes severe infections especially in patients with prolonged neutropenia. Traditionally, the detection of Fusarium in water is done by culturing which is difficult and time consuming. A faster method is necessary to prevent exposure of susceptible patients to contaminated water. The objective of this study was to develop a molecular technique for direct detection of Fusarium in water. A direct DNA extraction method from water was developed and coupled to a genus-specific PCR, to detect 3 species of Fusarium (verticillioides, oxysporum and solani). The detection limits were 10 cells/L and 1 cell/L for the molecular and culture methods, respectively. To our knowledge, this is the first method developed to detect Fusarium directly from water. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Dark matter direct detection rate in a generic model with micrOMEGAs2.2

    OpenAIRE

    Belanger, G.; Boudjema, F.; Pukhov, A.; Semenov, A.

    2008-01-01

    We present a new module of the micrOMEGAs package for the calculation of WIMP-nuclei elastic scattering cross sections relevant for the direct detection of dark matter through its interaction with nuclei in a large detector. With this new module, the computation of the direct detection rate is performed automatically for a generic model of new physics which contains a WIMP candidate. This model needs to be implemented within micrOMEGAs2.1.

  8. The Diurnal Variation of the Wimp Detection Event Rates in Directional Experiments

    CERN Document Server

    Vergados, J D

    2009-01-01

    The recent WMAP data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Modern particle theories naturally provide viable cold dark matter candidates with masses in the GeV-TeV region. Supersymmetry provides the lightest supersymmetric particle (LSP), theories in extra dimensions supply the lightest Kaluza-Klein particle (LKP) etc. The nature of dark matter can only be unraveled only by its direct detection in the laboratory. All such candidates will be called WIMPs (Weakly Interacting Massive Particles). In any case the direct dark matter search, which amounts to detecting the recoiling nucleus, following its collision with WIMP, is central to particle physics and cosmology. In this work we briefly review the theoretical elements relevant to the direct dark matter detection experiments, paying particular attention to directional experiments. i.e experiments in which, not only the energy but the direction of the recoiling nucleus is ob...

  9. The utility of direct specimen detection by Sanger sequencing in hospitalized pediatric patients.

    Science.gov (United States)

    Mongkolrattanothai, Kanokporn; Dien Bard, Jennifer

    2017-02-01

    Direct microbial DNA detection from clinical specimens by polymerase chain reaction and Sanger sequencing has been developed to address the innate limitations of traditional culture-based work-up. We report our institution's experience with direct specimen sequencing, its clinical utility, and barriers to effective clinical implementation.

  10. PREFACE: CYGNUS 2013: 4th Workshop on Directional Detection of Dark Matter

    Science.gov (United States)

    Naka, Tatsuhiro; Miuchi, Kentaro

    2013-12-01

    It is a great pleasure to publish the proceedings of the 4th Workshop on Directional Detection of Dark Matter held in Toyama, Japan on 10-12 June 2013 (CYGNUS 2013). These proceedings contain written versions of the presentations made at CYGNUS 2013 as scientific outputs of the directional detection of dark matter. The GYGNUS workshop started in 2007 at Boulby Underground Laboratory (UK), followed by CYGNUS 2009 (MIT in Cambridge, Massachusetts, USA) and CYGNUS 2011 (AUSSOIS, France). CYGNUS 2013 was held by the combination of a two and a half days of scientific program and a half day visit to the underground laboratory (Kamioka Observatory) as a 'tradition' of CYGNUS workshops. The name 'CYGNUS' came from the fact that the 'dark matter wind' is expected to come from the direction of the constellation Cygnus due to the motion of the Solar system in the galaxy. A general aim of these CYGNUS workshops is to bring together the theoretical and experimental studies on the directional dark matter detection. Directional detection of dark matter is a promising approach to a 'clear detection' and also to 'further investigations' of galactic dark matter, or Weakly Interacting Massive Particles (WIMPs). Directional detection requires the simultaneous detection of the energy and track of low energy recoils. Among many technological challenges for the requirement above, three of them, namely size, background, and directionality (angular resolution and head-tail detection), are most important to demonstrate and improve the quality as a dark matter detector. In the workshop, up-to-date activities by the international reserchers are discussed. The workshop was a great success thanks to the oral contributions and fruitful discussions held throughout the workshop period. We hope that readers will remember and share the great enthusiasm shown during the CYGNUS 2013 workshop. The Editors Tatsuhiro Naka and Kentaro Miuchi

  11. Prospects for detecting dark matter with neutrino telescopes in light of recent results from direct detection experiments

    Science.gov (United States)

    Halzen, Francis; Hooper, Dan

    2006-06-01

    Direct detection dark matter experiments, lead by the CDMS Collaboration, have placed increasingly stronger constraints on the cross sections for elastic scattering of weakly interacting massive particles (WIMPs) on nucleons. These results impact the prospects for the indirect detection of dark matter using neutrino telescopes. With this in mind, we revisit the prospects for detecting neutrinos produced by the annihilation of WIMPs in the Sun. We find that the latest bounds do not seriously limit the models most accessible to next generation kilometer-scale neutrino telescopes such as IceCube. This is largely due to the fact that models with significant spin-dependent couplings to protons are the least constrained and, at the same time, the most promising because of the efficient capture of WIMPs in the Sun. We identify models where dark matter particles are beyond the reach of any planned direct detection experiments while within reach of neutrino telescopes. In summary, we find that, even when contemplating recent direct detection results, neutrino telescopes still have the opportunity to play an important as well as complementary role in the search for particle dark matter.

  12. The Methods for Direct Detection of WIMP with Mass <0.5 GeV

    CERN Document Server

    Ovchinnikov, B M; Parusov, V V

    2015-01-01

    The chamber for direct detection of WIMP with mass <0.5 Gev/c2 was developed. The chamber is filled with gas mixture Ne+10%H2 (0-1bar)+0,15ppm Ge(CH3)4. For events detection used GEM+pin-anodes , which provides the energy threshold about eV. The electron background is suppressed owing to photosensitive addition Ge(CH3)4 . It is proposed also for direct detection of WIMP the liquid argon chamber with H2 dissolved in liquid argon at a concentration 100ppm+0,015ppm Ge(CH3)4 .

  13. Acquisition algorithm for direct-detection ladars with Geiger-mode avalanche photodiodes.

    Science.gov (United States)

    Milstein, Adam B; Jiang, Leaf A; Luu, Jane X; Hines, Eric L; Schultz, Kenneth I

    2008-01-10

    An optimal algorithm for detecting a target using a ladar system employing Geiger-mode avalanche photodiodes (GAPDs) is presented. The algorithm applies to any scenario where a ranging direct detection ladar is used to determine the presence of a target against a sky background within a specified range window. A complete statistical model of the detection process for GAPDs is presented, including GAPDs that are inactive for a fixed period of time each time they fire. The model is used to develop a constant false alarm rate detection algorithm that minimizes acquisition time. Numerical performance predictions, simulation results, and experimental results are presented.

  14. A comparison of directed search target detection versus in-scene target detection in Worldview-2 datasets

    Science.gov (United States)

    Grossman, S.

    2015-05-01

    Since the events of September 11, 2001, the intelligence focus has moved from large order-of-battle targets to small targets of opportunity. Additionally, the business community has discovered the use of remotely sensed data to anticipate demand and derive data on their competition. This requires the finer spectral and spatial fidelity now available to recognize those targets. This work hypothesizes that directed searches using calibrated data perform at least as well as inscene manually intensive target detection searches. It uses calibrated Worldview-2 multispectral images with NEF generated signatures and standard detection algorithms to compare bespoke directed search capabilities against ENVI™ in-scene search capabilities. Multiple execution runs are performed at increasing thresholds to generate detection rates. These rates are plotted and statistically analyzed. While individual head-to-head comparison results vary, 88% of the directed searches performed at least as well as in-scene searches with 50% clearly outperforming in-scene methods. The results strongly support the premise that directed searches perform at least as well as comparable in-scene searches.

  15. Nonlinear impairment compensation for DFT-S OFDM signal transmission with directly modulated laser and direct detection

    Science.gov (United States)

    Gou, Pengqi; Wang, Kaihui; Qin, Chaoyi; Yu, Jianjun

    2017-03-01

    We experimentally demonstrate a 16-ary quadrature amplitude modulation (16QAM) DFT-spread optical orthogonal frequency division multiplexing (OFDM) transmission system utilizing a cost-effective directly modulated laser (DML) and direct detection. For 20-Gbaud 16QAM-OFDM signal, with the aid of nonlinear equalization (NLE) algorithm, we respectively provide 6.2-dB and 5.2-dB receiver sensitivity improvement under the hard-decision forward-error-correction (HD-FEC) threshold of 3.8×10-3 for the back-to-back (BTB) case and after transmission over 10-km standard single mode fiber (SSMF) case, related to only adopt post-equalization scheme. To our knowledge, this is the first time to use dynamic nonlinear equalizer (NLE) based on the summation of the square of the difference between samples in one IM/DD OFDM system with DML to mitigate nonlinear distortion.

  16. Application of head flexion detection for enhancing eye gaze direction classification.

    Science.gov (United States)

    Al-Rahayfeh, Amer; Faezipour, Miad

    2014-01-01

    Extensive research has been conducted on the tracking and detection of the eye gaze and head movement detection as these aspects of technology can be applied as alternative approaches for various interfacing devices. This paper proposes enhancements to the classification of the eye gaze direction. Viola Jones face detector is applied to first declare the region of the eye. Circular Hough Transform is then used to detect the iris location. Support Vector Machine (SVM) is applied to classify the eye gaze direction. Accuracy of the system is enhanced by calculating the flexion angle of the head through the utilization of a microcontroller and flex sensors. In case of rotated face images, the face can be rotated back to zero degrees through the flexion angle calculation. This is while Viola Jones face detector is limited to face images with very little or no rotation angle. Accuracy is initiated by enhancing the effectiveness of the system in the overall procedure of classifying the direction of the eye gaze. Therefore, the head direction is a main determinant in enhancing the control method. Different control signals are enhanced by the eye gaze direction classification and the head direction detection.

  17. Detection of Mycobacterium avium subsp. paratuberculosis by a Direct In Situ PCR Method

    Directory of Open Access Journals (Sweden)

    Fernando Delgado

    2011-01-01

    Full Text Available In situ detection of Mycobacterium avium subsp. paratuberculosis is useful for diagnosis and research of paratuberculosis. The aim of this paper was to detect this agent in formalin-fixed, paraffin-embedded tissue samples by a direct in situ PCR. The technique was performed on ileum or ileocaecal lymph node samples from 8 naturally infected cattle and 1 healthy calf, by using p89 and p92 primers for amplification of IS900 sequence. Moderate positive signal was detected in all positive samples and not in negative control, but tissues resulted were affected in many cases due to the enzymatic treatment and the high temperature exposition. Although the technique was useful for Map detection, the signal was lower than immunohistochemistry probably because of the fixation process. In one case, signal was higher, which might be due to the detection of spheroplasts. Thus, the described method should be recommended when others resulted negative or for spheroplasts detection.

  18. On the importance of loop-induced spin-independent interactions for dark matter direct detection

    CERN Document Server

    Haisch, Ulrich

    2013-01-01

    The latest results from LHC searches for jets in association with missing transverse energy place strong bounds on the scattering cross section of dark matter. For the case of spin-dependent or momentum suppressed interactions these limits seem to be superior to the bounds from direct detection experiments. In this article, we show that loop contributions can significantly alter this conclusion and boost direct detection bounds, whenever they induce spin-independent interactions. This effect is most striking for tensor and pseudotensor interactions, which induce magnetic and electric dipole moments at loop level. For axialvector and anapole interactions a relevant contribution to direct detection signals arises from loop-induced Yukawa-like couplings between dark matter and quarks. We furthermore compare the resulting bounds to additional constraints on these effective operators arising from indirect searches and relic density requirements.

  19. Loop-induced dark matter direct detection signals from gamma-ray lines

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Haisch, Ulrich; Kahlhoefer, Felix

    2012-01-01

    Improved limits as well as tentative claims for dark matter annihilation into gamma-ray lines have been presented recently. We study the direct detection cross section induced from dark matter annihilation into two photons in a model-independent fashion, assuming no additional couplings between...... dark matter and nuclei. We find a striking non-standard recoil spectrum due to different destructively interfering contributions to the dark matter nucleus scattering cross section. While in the case of s-wave annihilation the current sensitivity of direct detection experiments is insufficient...... to compete with indirect detection searches, for p-wave annihilation the constraints from direct searches are comparable. This will allow to test dark matter scenarios with p-wave annihilation that predict a large di-photon annihilation cross section in the next generation of experiments....

  20. Halo-independent direct detection of momentum-dependent dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Cherry, John F. [Theoretical Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Frandsen, Mads T.; Shoemaker, Ian M., E-mail: jcherry@lanl.gov, E-mail: frandsen@cp3-origins.net, E-mail: shoemaker@cp3-origins.net [CP3-Origins and the Danish Institute for Advanced Study, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark)

    2014-10-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be ∼< 10 MeV for DM in the 20-1000 GeV range in a halo-independent manner.

  1. MIMAC: MIcro-tpc MAtrix of Chambers for dark matter directional detection

    CERN Document Server

    Santos, D; Bouly, J L; Bourrion, O; Fourel, Ch; Guillaudin, O; Lamblin, J; Mayet, F; Muraz, J F; Richer, J P; Riffard, Q; Lebreton, L; Maire, D; Busto, J; Brunner, J; Fouchez, D

    2013-01-01

    Directional detection of non-baryonic Dark Matter is a promising search strategy for discriminating WIMP events from neutrons, the ultimate background for dark matter direct detection. This strategy requires both a precise measurement of the energy down to a few keV and 3D reconstruction of tracks down to a few mm. The MIMAC (MIcro-tpc MAtrix of Chambers) collaboration has developed in the last years an original prototype detector based on the direct coupling of large pixelized micromegas with a special developed fast self-triggered electronics showing the feasibility of a new generation of directional detectors. The first bi-chamber prototype has been installed at Modane, underground laboratory in June 2012. The first undergournd background events, the gain stability and calibration are shown. The first spectrum of nuclear recoils showing 3D tracks coming from the radon progeny is presented.

  2. Migratory birds use head scans to detect the direction of the earth's magnetic field.

    Science.gov (United States)

    Mouritsen, Henrik; Feenders, Gesa; Liedvogel, Miriam; Kropp, Wiebke

    2004-11-09

    Night-migratory songbirds are known to use a magnetic compass , but how do they detect the reference direction provided by the geomagnetic field, and where is the sensory organ located? The most prominent characteristic of geomagnetic sensory input, whether based on visual patterns or magnetite-mediated forces , is the predicted symmetry around the north-south or east-west magnetic axis. Here, we show that caged migratory garden warblers perform head-scanning behavior well suited to detect this magnetic symmetry plane. In the natural geomagnetic field, birds move toward their migratory direction after head scanning. In a zero-magnetic field , where no symmetry plane exists, the birds almost triple their head-scanning frequency, and the movement direction after a head scan becomes random. Thus, the magnetic sensory organ is located in the bird's head, and head scans are used to locate the reference direction provided by the geomagnetic field.

  3. Time and direction of arrival detection and filtering for imaging in strongly scattering random media

    CERN Document Server

    Borcea, Liliana; Tsogka, Chrysoula

    2016-01-01

    We study detection and imaging of small reflectors in heavy clutter, using an array of transducers that emits and receives sound waves. Heavy clutter means that multiple scattering of the waves in the heterogeneous host medium is strong and overwhelms the arrivals from the small reflectors. Building on the adaptive time-frequency filter of [1], we propose a robust method for detecting the direction of arrival of the direct echoes from the small reflectors, and suppressing the unwanted clutter backscatter. This improves the resolution of imaging. We illustrate the performance of the method with realistic numerical simulations in a non-destructive testing setup.

  4. Study of dual-polarization OQAM-OFDM PON with direct detection

    Science.gov (United States)

    Luo, Qing-long; Feng, Min; Bai, Cheng-lin; Hu, Wei-sheng

    2016-01-01

    An offset quadrature amplitude modulation orthogonal frequency-division multiplexing (OQAM-OFDM) passive optical network (PON) architecture with direct detection is brought up to increase the transmission range and improve the system performance. In optical line terminal (OLT), OQAM-OFDM signals at 40 Gbit/s are transmitted as downstream. At each optical network unit (ONU), the optical OQAM-OFDM signal is demodulated with direct detection. The results show that the transmission distance can exceed 20 km with negligible penalty under the experimental conditions.

  5. Exploring the Cosmic Frontier, Task A - Direct Detection of Dark Matter, Task B - Experimental Particle Astrophysics

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, John A.J. [Univ. of New Mexico, Albuquerque, NM (United States); Gold, Michael S. [Univ. of New Mexico, Albuquerque, NM (United States)

    2016-08-11

    This report summarizes the work of Task A and B for the period 2013-2016. For Task A the work is for direct detection of dark matter with the single-phase liquid argon experiment Mini-CLEAN. For Task B the work is for the search for new physics in the analysis of fluorescence events with the Auger experiment and for the search for the indirect detection of dark matter with the HAWC experiment.

  6. Directed Design of Experiments (DOE) for Determining Probability of Detection (POD) Capability of NDE Systems (DOEPOD)

    Science.gov (United States)

    Generazio, Ed

    2007-01-01

    This viewgraph presentation reviews some of the issues that people who specialize in Non destructive evaluation (NDE) have with determining the statistics of the probability of detection. There is discussion of the use of the binominal distribution, and the probability of hit. The presentation then reviews the concepts of Directed Design of Experiments for Validating Probability of Detection of Inspection Systems (DOEPOD). Several cases are reviewed, and discussed. The concept of false calls is also reviewed.

  7. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Garny, Mathias [Deutsches Elektronen-Synchrotron DESY, Notkestraße 85, 22603 Hamburg (Germany); Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan, E-mail: mathias.garny@desy.de, E-mail: ibarra@tum.de, E-mail: miguel.pato@tum.de, E-mail: stefan.vogl@tum.de [Physik-Department T30d, Technische Universität München, James-Franck-Straße, 85748 Garching (Germany)

    2012-11-01

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  8. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Garny, Mathias [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan [Technische Univ. Muenchen, Garching (Germany). Physik-Department

    2012-07-15

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  9. Development of a monoclonal sandwich ELISA for direct detection of bluetongue virus 8 in infected animals.

    Science.gov (United States)

    Ten Haaf, Andre; Kohl, Johannes; Pscherer, Sibylle; Hamann, Hans-Peter; Eskens, Hans Ulrich; Bastian, Max; Gattenlöhner, Stefan; Tur, Mehmet Kemal

    2017-05-01

    Bluetongue is an infectious viral disease which can cause mortality in affected ruminants, and tremendous economic damage via impacts upon fertility, milk production and the quality of wool. The disease is caused by bluetongue virus (BTV) which is transmitted by species of Culicoides biting midge. Rapid detection of BTV is required to contain disease outbreaks and reduce economic losses. The purpose of this study was to develop a monoclonal sandwich ELISA for direct detection of BTV in infected animals. Phage display technology was used to isolate BTV specific antibody fragments by applying the human scFv Tomlinson antibody libraries directly on purified BTV-8 particles. Three unique BTV-8 specific human antibody fragments were isolated which were able to detect purified BTV particles and also BTV in serum of an infected sheep. A combination of a human/mouse scFv-Fc chimeric fusion protein and a human Fab fragment in a sandwich ELISA format was able to detect BTV specifically with a limit of detection (LOD) of 10(4) infectious virus particles, as determined by tissue culture titration. This approach provided pilot data towards the development of a novel diagnostic test that might be used for direct detection of BTV-8 particles. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Detecting Different Types of Directional Land Cover Changes Using MODIS NDVI Time Series Dataset

    Directory of Open Access Journals (Sweden)

    Lili Xu

    2016-06-01

    Full Text Available This study proposed a multi-target hierarchical detection (MTHD method to simultaneously and automatically detect multiple directional land cover changes. MTHD used a hierarchical strategy to detect both abrupt and trend land cover changes successively. First, Grubbs’ test eliminated short-lived changes by considering them outliers. Then, the Brown-Forsythe test and the combination of Tomé’s method and the Chow test were applied to determine abrupt changes. Finally, Sen’s slope estimation coordinated with the Mann-Kendall test detection method was used to detect trend changes. Results demonstrated that both abrupt and trend land cover changes could be detected accurately and automatically. The overall accuracy of abrupt land cover changes was 87.0% and the kappa index was 0.74. Detected trends of land cover change indicated high consistency between NDVI (Normalized Difference Vegetation Index, change trends from LTS (Landsat Thematic Mapper and Enhanced Thematic Mapper Plus time series dataset, and MODIS (Moderate Resolution Imaging Spectroradiometer time series datasets with the percentage of samples indicating consistency of 100%. For cropland, trends of millet yield per unit and average NDVI of cropland indicated high consistency with a linear regression determination coefficient of 0.94 (p < 0.01. Compared with other multi-target change detection methods, the changes detected by the MTHD could be related closely with specific ecosystem changes, reducing the risk of false changes in the area with frequent and strong interannual fluctuations.

  11. 16-level differential phase shift keying (D16PSK) in direct detection optical communication systems

    DEFF Research Database (Denmark)

    Sambaraju, R.; Tokle, Torger; Jensen, J.B.;

    2006-01-01

    Optical 16-level differential phase shift keying (D16PSK) carrying four bits for every symbol is proposed for direct detection optical communication systems. Transmitter and receiver schematics are presented, and the receiver sensitivity is discussed. We numerically investigate the impact...

  12. Probing WIMP particle physics and astrophysics with direct detection and neutrino telescope data

    NARCIS (Netherlands)

    Kavanagh, B.J.; Fornasa, M.; Green, A.M.

    2015-01-01

    With positive signals from multiple direct detection experiments, it will, in principle, be possible to measure the mass and cross sections of weakly interacting massive particle (WIMP) dark matter. Recent work has shown that, with a polynomial parametrization of the WIMP speed distribution, it is p

  13. Direct imaging Raman microscope based on tunable wavelength excitation and narrow band emission detection

    NARCIS (Netherlands)

    Puppels, G.J.; Grond, M.; Greve, J.

    1993-01-01

    A new type of imaging Raman microscope is described. First the advantages and disadvantages of the two possible approaches to Raman microscopy based on signal detection by means of a charge-coupled-device camera (i.e., direct imaging and image reconstruction) are discussed. Arguments are given to sh

  14. Amplification of RNA by NASBA allows direct detection of viable cells of Ralstonia solanacearum in potato

    NARCIS (Netherlands)

    Bentsink, L.; Leone, G.O.M.; Beckhoven, van J.R.C.M.; Schijndel, van H.B.; Gemen, van B.; Wolf, van der J.M.

    2002-01-01

    Aims: The objective of this study was to develop a Nucleic Acid Sequence Based Amplification (NASBA) assay, targeting 16S rRNA sequences, for direct detection of viable cells of Ralstonia solanacearum, the causal organism of bacterial wilt. The presence of intact 16S rRNA is considered to be a usefu

  15. Inability to directly detect magnetic field changes associated with neuronal activity

    NARCIS (Netherlands)

    Parkes, L.M.; Lange, F.P. de; Fries, P.; Toni, I.; Norris, D.G.

    2007-01-01

    The ability to directly detect neuronal magnetic fields by MRI would help investigators achieve the "holy grail" of neuroimaging, namely both high spatial and temporal resolution. Both positive and negative findings have been reported in the literature, with no clear consensus as to the feasibility

  16. Fifth ASTROD Symposium and Outlook of Direct Gravitational-Wave Detection

    CERN Document Server

    Arun, K G; Ni, Wei-Tou

    2012-01-01

    From July 11 to July 13, 2012, Raman Research Institute (Bangalore, India) hosted the Fifth International ASTROD Symposium on Laser Astrodynamics, Space Test of Relativity and Gravitational-Wave Astronomy. This is a report on the symposium with an exposition of the outlook of direct gravitational-wave detection.

  17. Interplay and Characterization of Dark Matter Searches at Colliders and in Direct Detection Experiments

    CERN Document Server

    Malik, Sarah A.; Araujo, Henrique; Belyaev, A.; Bœhm, Céline; Brooke, Jim; Buchmueller, Oliver; Davies, Gavin; De Roeck, Albert; de Vries, Kees; Dolan, Matthew J.; Ellis, John; Fairbairn, Malcolm; Flaecher, Henning; Gouskos, Loukas; Khoze, Valentin V.; Landsberg, Greg; Newbold, Dave; Papucci, Michele; Sumner, Timothy; Thomas, Marc; Worm, Steven

    2015-01-01

    In this White Paper we present and discuss a concrete proposal for the consistent interpretation of Dark Matter searches at colliders and in direct detection experiments. Based on a specific implementation of simplified models of vector and axial-vector mediator exchanges, this proposal demonstrates how the two search strategies can be compared on an equal footing.

  18. Less-simplified models of dark matter for direct detection and the LHC

    Science.gov (United States)

    Choudhury, Arghya; Kowalska, Kamila; Roszkowski, Leszek; Sessolo, Enrico Maria; Williams, Andrew J.

    2016-04-01

    We construct models of dark matter with suppressed spin-independent scattering cross section utilizing the existing simplified model framework. Even simple combinations of simplified models can exhibit interference effects that cause the tree level contribution to the scattering cross section to vanish, thus demonstrating that direct detection limits on simplified models are not robust when embedded in a more complicated and realistic framework. In general for fermionic WIMP masses ≳ 10 GeV direct detection limits on the spin-independent scattering cross section are much stronger than those coming from the LHC. However these model combinations, which we call less-simplified models, represent situations where LHC searches become more competitive than direct detection experiments even for moderate dark matter mass. We show that a complementary use of several searches at the LHC can strongly constrain the direct detection blind spots by setting limits on the coupling constants and mediators' mass. We derive the strongest limits for combinations of vector + scalar, vector + "squark", and "squark" + scalar mediator, and present the corresponding projections for the LHC 14 TeV for a number of searches: mono-jet, jets + missing energy, and searches for heavy vector resonances.

  19. Direct Imaging Detection of Methane in the Atmosphere of GJ 504 b

    NARCIS (Netherlands)

    Janson, M.; et al., [Unknown; Thalmann, C.

    2013-01-01

    Most exoplanets detected by direct imaging thus far have been characterized by relatively hot (gsim1000 K) and cloudy atmospheres. A surprising feature in some of their atmospheres has been a distinct lack of methane, possibly implying non-equilibrium chemistry. Recently, we reported the discovery o

  20. Direct biosensor immunoassays for the detection of nonmilk proteins in milk powder

    NARCIS (Netherlands)

    Haasnoot, W.; Olieman, K.; Cazemier, G.; Verheijen, R.

    2001-01-01

    The low prices of some nonmilk proteins make them attractive as potential adulterants in dairy products. An optical biosensor (BIACORE 3000) was used to develop a direct and combined biosensor immunoassay (BIA) for the simultaneous detection of soy, pea, and soluble wheat proteins in milk powders.

  1. Horizontal Directional Drilling-Length Detection Technology While Drilling Based on Bi-Electro-Magnetic Sensing.

    Science.gov (United States)

    Wang, Yudan; Wen, Guojun; Chen, Han

    2017-04-27

    The drilling length is an important parameter in the process of horizontal directional drilling (HDD) exploration and recovery, but there has been a lack of accurate, automatically obtained statistics regarding this parameter. Herein, a technique for real-time HDD length detection and a management system based on the electromagnetic detection method with a microprocessor and two magnetoresistive sensors employing the software LabVIEW are proposed. The basic principle is to detect the change in the magnetic-field strength near a current coil while the drill stem and drill-stem joint successively pass through the current coil forward or backward. The detection system consists of a hardware subsystem and a software subsystem. The hardware subsystem employs a single-chip microprocessor as the main controller. A current coil is installed in front of the clamping unit, and two magneto resistive sensors are installed on the sides of the coil symmetrically and perpendicular to the direction of movement of the drill pipe. Their responses are used to judge whether the drill-stem joint is passing through the clamping unit; then, the order of their responses is used to judge the movement direction. The software subsystem is composed of a visual software running on the host computer and a software running in the slave microprocessor. The host-computer software processes, displays, and saves the drilling-length data, whereas the slave microprocessor software operates the hardware system. A combined test demonstrated the feasibility of the entire drilling-length detection system.

  2. An FPGA-based data acquisition system for directional dark matter detection

    Science.gov (United States)

    Yang, Chen; Nicoloff, Catherine; Sanaullah, Ahmed; Sridhar, Arvind; Herbordt, Martin; Battat, James; Battat Lab at Wellesley College Team; CAAD Lab at Boston University Team

    2017-01-01

    Directional dark matter detection is a powerful tool in the search for dark matter. Low-pressure gas TPCs are commonly used for directional detection, and dark-matter-induced recoils are mm long. These tracks can be reconstructed by micropatterned readouts. Because large detector volumes are needed, a cost-effective data acquisition system capable of scaling to large channel counts (105 or 106) is required. The Directional Recoil Identification From Tracks (DRIFT) collaboration has pioneered the use of TPCs for directional detection. We employ a negative ion gas with drift speed comparable to the electron drift speed in liquid argon (LAr). We aim to use electronics developed for million-channel readouts in large LAr neutrino detectors. We have built a prototype Micromegas-based directional detector with 103 channels. A FPGA-based back-end system (BE) receives a 12 Gbps data stream from eight ASIC-based front-end boards (FE), each with 128 detector channels. The BE buffers 3 μs of pretrigger data for all channels in DRAM, and streams triggered data to a host PC. We will describe the system architecture and present preliminary measurements from the DAQ. We acknowledge the support of the Research Corporation for Science Advancement, the NSF and the Massachusetts Space Grant Consortium.

  3. The effect of dark matter velocity profile on directional detection of dark matter

    CERN Document Server

    Laha, Ranjan

    2016-01-01

    Directional detection is an important way to detect dark matter. An input to these experiments is the dark matter velocity distribution. Recent hydrodynamical simulations have shown that the dark matter velocity distribution differs substantially from the Standard Halo Model. We study the impact of some of these updated velocity distribution in dark matter directional detection experiments. We calculate the ratio of events required to confirm the forward-backward asymmetry and the existence of the ring of maximum recoil rate using different dark matter velocity distributions for $^{19}$F and Xe targets. We show that with the use of updated dark matter velocity profiles, the forward-backward asymmetry and the ring of maximum recoil rate can be confirmed using a factor of $\\sim$2 -- 3 less events when compared to that using the Standard Halo Model.

  4. Direct detection of OTA by impedimetric aptasensor based on modified polypyrrole-dendrimers

    Energy Technology Data Exchange (ETDEWEB)

    Mejri-Omrani, Nawel [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Miodek, Anna; Zribi, Becem [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); Marrakchi, Mouna [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Université de Tunis El Manar, Higher Institute of Applied Biological Sciences (ISSBAT), 1006 Tunis (Tunisia); Hamdi, Moktar [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Marty, Jean-Louis [BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Korri-Youssoufi, Hafsa, E-mail: hafsa.korri-youssoufi@u-psud.fr [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France)

    2016-05-12

    Ochratoxin A (OTA) is a carcinogenic mycotoxin that contaminates food such as cereals, wine and beer; therefore it represents a risk for human health. Consequently, the allowed concentration of OTA in food is regulated by governmental organizations and its detection is of major agronomical interest. In the current study we report the development of an electrochemical aptasensor able to directly detect trace OTA without any amplification procedure. This aptasensor was constructed by coating the surface of a gold electrode with a film layer of modified polypyrrole (PPy), which was thereafter covalently bound to polyamidoamine dendrimers of the fourth generation (PAMAM G4). Finally, DNA aptamers that specifically binds OTA were covalently bound to the PAMAM G4 providing the aptasensor, which was characterized by using both Atomic Force Microscopy (AFM) and Surface Plasmon Resonance (SPR) techniques. The study of OTA detection by the constructed electrochemical aptasensor was performed using Electrochemical Impedance Spectroscopy (EIS) and revealed that the presence of OTA led to the modification of the electrical properties of the PPy layer. These modifications could be assigned to conformational changes in the folding of the aptamers upon specific binding of OTA. The aptasensor had a dynamic range of up to 5 μg L{sup −1} of OTA and a detection limit of 2 ng L{sup −1} of OTA, which is below the OTA concentration allowed in food by the European regulations. The efficient detection of OTA by this electrochemical aptasensor provides an unforeseen platform that could be used for the detection of various small molecules through specific aptamer association. - Highlights: • Development of innovative platform for direct and ultra-sensitive toxins detection. • Aptasensor based on modified conductive polypyrrole layer. • We demonstrate the conformation change of aptamer upon toxin binding. • We highlight that detection was obtained by modification of charge of

  5. Detecting Direction of Pepper Stem by Using CUDA-Based Accelerated Hybrid Intuitionistic Fuzzy Edge Detection and ANN

    Directory of Open Access Journals (Sweden)

    Mahit Gunes

    2016-01-01

    Full Text Available In recent years, computer vision systems have been used in almost every field of industry. In this study, image processing algorithm has been developed by using CUDA (GPU which is 79 times faster than CPU. We had used this accelerated algorithm in destemming process of pepper. 65 percent of total national production of pepper is produced in our cities, Kahramanmaras and Gaziantep in Turkey. Firstly, hybrid intuitionistic fuzzy algorithm edge detection has been used for preprocessing of original image and Otsu method has been used for determining automatic threshold in this algorithm. Then the multilayer perceptron artificial neural network has been used for the classification of patterns in processed images. Result of ANN test for detection direction of pepper has shown high accuracy performance in CPU-based implementation and in GPU-based implementation.

  6. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    Energy Technology Data Exchange (ETDEWEB)

    Caballero, David, E-mail: caballero@unistra.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Martinez, Elena [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Bausells, Joan [Centre Nacional de Microelectronica (CNM-IMB), CSIC, Campus UAB, 08193 Bellaterra (Spain); Errachid, Abdelhamid, E-mail: abdelhamid.errachid-el-salhi@univ-lyon1.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Universite Claude Bernard - Lyon 1, LSA - UMR 5180, 43 Bd du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Samitier, Josep [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. Black-Right-Pointing-Pointer Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. Black-Right-Pointing-Pointer Silicon nitride offers multiple advantages compared to other common materials. Black-Right-Pointing-Pointer The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si{sub 3}N{sub 4}) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si{sub 3}N{sub 4}-based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO{sub 2}/Si{sub 3}N{sub 4} structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10{sup -13}-10{sup -7} M were detected, showing a sensitivity of 0.128 {Omega} {mu}M{sup -1} and a limit of detection of 10{sup -14} M. The specificity of the sensor was also addressed by studying the

  7. Direct Write Protein Patterns for Multiplexed Cytokine Detection From Live Cells Using Electron Beam Lithography

    Science.gov (United States)

    Lau, Uland Y.; Saxer, Sina S.; Lee, Juneyoung; Bat, Erhan; Maynard, Heather D.

    2016-01-01

    Simultaneous detection of multiple biomarkers, such as extracellular signaling molecules, is a critical aspect in disease profiling and diagnostics. Precise positioning of antibodies on surfaces, especially at the micro- and nano- scale, is important for the improvement of assays, biosensors, and diagnostics on the molecular level, and therefore, the pursuit of device miniaturization for parallel, fast, low-volume assays is a continuing challenge. Here, we describe a multiplexed cytokine immunoassay utilizing electron beam lithography and a trehalose glycopolymer as a resist for the direct writing of antibodies on silicon substrates allowing for micro- and nano-scale precision of protein immobilization. Specifically, anti-interleukin 6 (IL-6) and anti-tumor necrosis factor alpha (TNFα) antibodies were directly patterned. Retention of the specific binding properties of the patterned antibodies was shown by the capture of secreted cytokines from stimulated RAW 264.7 macrophages. A sandwich immunoassay was employed using gold nanoparticles and enhancement with silver for the detection and visualization of bound cytokines to the patterns by localized surface plasmon resonance detected with dark field microscopy. Multiplexing with both IL-6 and TNFα on a single chip was also successfully demonstrated with high specificity and in relevant cell culture conditions and at different times after cell stimulation. The direct fabrication of capture antibody patterns for cytokine detection described here could be useful for biosensing applications. PMID:26679368

  8. Direct Write Protein Patterns for Multiplexed Cytokine Detection from Live Cells Using Electron Beam Lithography.

    Science.gov (United States)

    Lau, Uland Y; Saxer, Sina S; Lee, Juneyoung; Bat, Erhan; Maynard, Heather D

    2016-01-26

    Simultaneous detection of multiple biomarkers, such as extracellular signaling molecules, is a critical aspect in disease profiling and diagnostics. Precise positioning of antibodies on surfaces, especially at the micro- and nanoscale, is important for the improvement of assays, biosensors, and diagnostics on the molecular level, and therefore, the pursuit of device miniaturization for parallel, fast, low-volume assays is a continuing challenge. Here, we describe a multiplexed cytokine immunoassay utilizing electron beam lithography and a trehalose glycopolymer as a resist for the direct writing of antibodies on silicon substrates, allowing for micro- and nanoscale precision of protein immobilization. Specifically, anti-interleukin 6 (IL-6) and antitumor necrosis factor alpha (TNFα) antibodies were directly patterned. Retention of the specific binding properties of the patterned antibodies was shown by the capture of secreted cytokines from stimulated RAW 264.7 macrophages. A sandwich immunoassay was employed using gold nanoparticles and enhancement with silver for the detection and visualization of bound cytokines to the patterns by localized surface plasmon resonance detected with dark-field microscopy. Multiplexing with both IL-6 and TNFα on a single chip was also successfully demonstrated with high specificity and in relevant cell culture conditions and at different times after cell stimulation. The direct fabrication of capture antibody patterns for cytokine detection described here could be useful for biosensing applications.

  9. Magnetic resonance pulmonary angiography and direct imaging of embolus for the detection of pulmonary emboli.

    Science.gov (United States)

    Moody, A R; Liddicoat, A; Krarup, K

    1997-08-01

    The authors developed a two-dimensional breathhold magnetic resonance (MR) technique for the direct imaging of pulmonary emboli. In vitro MR imaging was performed to demonstrate the potential generation of clot-blood contrast by in vivo pulmonary embolism (PE). A two-dimensional magnetization prepared gradient-echo (turbo-FLASH) breathhold technique was designed to directly image intravascular emboli by the selective nulling of the blood signal. A turbo-FLASH pulmonary angiographic breathhold sequence was used to provide spatial localization of detected emboli. Thirteen patients with suspected PE were studied; 6 patients underwent conventional pulmonary angiography (CPA) and the remaining 7 had diagnoses based on findings from other studies. In vitro study of blood clot demonstrated an initial rise and then fall in T1 sufficient to generate clot-blood contrast after eight days of clot formation. All patients with CPA or alternative study evidence of PE were diagnosed as positive with direct embolus imaging MR. There were no false-positive diagnoses. Three additional emboli were detected using the MR technique compared with CPA. The MR pulmonary angiographic sequence provided a useful road map for localization of intravascular emboli but was less sensitive for PE detection than the embolus imaging technique. The direct imaging of PE is feasible using a simple two-dimensional breathhold technique.

  10. TLC-Direct Bioautography as a High Throughput Method for Detection of Antimicrobials in Plants

    Directory of Open Access Journals (Sweden)

    Irena M. Choma

    2015-05-01

    Full Text Available The richness of bioactive compounds in plant materials encourages continuous development of separation methods and bioassays for their isolation and identification. Thin-layer chromatography-direct bioautography links separation on the adsorbent layer with biological tests performed directly on it. Therefore, the method is very convenient for searching plant constituents with biological activity, such as antibiotics. Test bacteria grow directly on a plate surface excluding places where antibacterials are located. They can be detected with reagents converted by living bacteria. TLC-DB is a high throughput method enabling analyses of many samples in parallel and the comparison of their activity. Both screening and semi-quantitative analysis is possible. The targeted compounds can be identified using spectroscopic methods, mostly mass spectrometry, that can be performed directly on a TLC plate. This paper discusses all above mentioned aspects of TLC-DB, illustrating them with literature, schemes and our own results.

  11. Direct detection of sub-GeV dark matter with semiconductor targets

    Science.gov (United States)

    Essig, Rouven; Fernández-Serra, Marivi; Mardon, Jeremy; Soto, Adrián; Volansky, Tomer; Yu, Tien-Tien

    2016-05-01

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their {O} (1 eV) band gaps allow for ionization signals from dark matter particles as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcoming several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the reach for these upcoming experiments has the potential to be orders of magnitude beyond current direct detection constraints and that sub-GeV dark matter has a sizable modulation signal. We also give the first direct detection limits on sub-GeV dark matter from its scattering off electrons in a semiconductor target (silicon) based on published results from DAMIC. We make available publicly our code, QEdark URL"/> , with which we calculate our results. Our results can be used by experimental collaborations to calculate their own sensitivities based on their specific setup. The searches we propose will probe vast new regions of unexplored dark matter model and parameter space.

  12. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    Science.gov (United States)

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  13. Direct detection and drug-resistance profiling of bacteremias using inertial microfluidics.

    Science.gov (United States)

    Hou, Han Wei; Bhattacharyya, Roby P; Hung, Deborah T; Han, Jongyoon

    2015-05-21

    Detection of bacteria in bloodstream infections and their antibiotic susceptibility patterns is critical to guide therapeutic decision-making for optimal patient care. Current culture-based assays are too slow (>48 h), leading to excessive up-front use of broad-spectrum antibiotics and/or incorrect antibiotic choices due to resistant bacteria, each with deleterious consequences for patient care and public health. To approach this problem, we describe a method to rapidly isolate bacteria from whole blood using inertial microfluidics and directly determine pathogen identity and antibiotic susceptibility with hybridization-based RNA detection. Using the principle of Dean flow fractionation, bacteria are separated from host blood cells in a label-free separation method with efficient recovery of even low abundance bacteria. Ribosomal RNA detection can then be applied for direct identification of low abundance pathogens (~100 per mL) from blood without culturing or enzymatic amplification. Messenger RNA detection of antibiotic-responsive transcripts after brief drug exposure permits rapid susceptibility determination from bacteria with minimal culturing (~10(5) per mL). This unique coupling of microfluidic cell separation with RNA-based molecular detection techniques represents significant progress towards faster diagnostics (~8 hours) to guide antibiotic therapy.

  14. Direct detection of Marek's disease virus in poultry dust by loop-mediated isothermal amplification.

    Science.gov (United States)

    Woźniakowski, Grzegorz; Samorek-Salamonowicz, Elżbieta

    2014-11-01

    Marek's disease virus (MDV) is a serious concern for poultry production and represents a unique herpesvirus model. MDV can be shed by doubly infected chickens despite vaccination. The fully infectious MDV particles are produced in the feather follicle epithelium (FFE), and MDV remains infectious for many months in fine skin particles and feather debris. Molecular biology methods including PCR and real-time PCR have been shown to be valuable for the detection of MDV DNA in farm dust. Recently, loop-mediated isothermal amplification (LAMP) was found to be useful in the detection of MDV in feathers and internal organs of infected chickens. LAMP is also less affected by the inhibitors present in DNA samples. Taking into account the advantages of LAMP, direct detection of MDV DNA in poultry dust has been conducted in this research. The detection of MDV DNA was possible in 11 out of the 12 examined dust samples without DNA extraction. The DNA was retrieved from dust samples by dilution and incubation at 95 °C for 5 min. The direct detection of MDV DNA in the dust was possible within 30 min using a water bath and UV light. The results were confirmed by electrophoresis and melting curve analysis of the LAMP products. Our results show that LAMP may be used to test for the presence of virulent MDV in poultry farm dust without DNA extraction.

  15. Detection of directivity in seismic site response from microtremor spectral analysis

    Directory of Open Access Journals (Sweden)

    V. Del Gaudio

    2008-07-01

    Full Text Available Recent observations have shown that slope response to seismic shaking can be characterised by directional variations of a factor of 2–3 or larger, with maxima oriented along local topography features (e.g. maximum slope direction. This phenomenon appears influenced by slope material properties and has occasionally been detected on landslide-prone slopes, where a down-slope directed amplification could enhance susceptibility to seismically-induced landsliding. The exact conditions for the occurrence of directional amplification remain still unclear and the implementation of investigation techniques capable to reveal the presence of such phenomena is desirable. To this purpose we tested the applicability of a method commonly used to evaluate site resonance properties (Horizontal to Vertical Noise Ratio – HVNR or Nakamura's method as reconnaissance technique for the identification of site response directivity. Measurements of the azimuthal variation of H/V spectral ratios (i.e. between horizontal and vertical component of ambient microtremors were conducted in a landslide-prone study area of central Italy where a local accelerometric network had previously provided evidence of directivity phenomena on some slopes. The test results were compared with average H/V spectral ratios obtained for low-to-moderate earthquakes recorded by the accelerometric stations. In general, noise and seismic recordings provided different amplitudes of spectral ratios at similar frequencies, likely because of differences in signal and instrument characteristics. Nevertheless, both kinds of recordings showed that at sites affected by site response directivity major H/V peaks have orientations consistent (within 20°–30° with the direction of maximum shaking energy. Therefore, HVNR appears to be a promising technique for identifying seismic response directivity. Furthermore, in a comparative test conducted on a slope mantled in part by a deep-seated landslide

  16. Readout strategies for directional dark matter detection beyond the neutrino background

    CERN Document Server

    O'Hare, Ciaran A J; Billard, Julien; Figueroa-Feliciano, Enectali; Strigari, Louis E

    2015-01-01

    The search for weakly interacting massive particles (WIMPs) by direct detection faces an encroaching background due to coherent neutrino-nucleus scattering. As the sensitivity of these experiments improves, the question of how to best distinguish a dark matter signal from neutrinos will become increasingly important. A proposed method of overcoming this so-called 'neutrino floor' is to utilize the directional signature that both neutrino and dark matter induced recoils possess. We show that directional experiments can indeed probe WIMP-nucleon cross-sections below the neutrino floor with little loss in sensitivity due to the neutrino background. In particular we find at low WIMP masses (around 6 GeV) the discovery limits for directional detectors penetrate below the non-directional limit by several orders of magnitude. For high WIMP masses (around 100 GeV), the non-directional limit is overcome by a factor of a few. Furthermore we show that even for directional detectors which can only measure 1- or 2-dimensi...

  17. A Digital Method for the Detection of Blood Flow Direction in Ultrasonic Doppler Systems

    Directory of Open Access Journals (Sweden)

    P. Acevedo–Contla.

    2010-01-01

    Full Text Available Doppler ultrasound systems are widely used to study blood flow and diagnosis of vascular diseases. An important characteristic of these systems is the ability to detect the direction of the blood flow. Most Doppler ultrasound systems apply a quadrature demodulation technique on the ultrasonic transducer output signal. Therefore additional treatment is necessary to separate forward and reverse flow signals. This work presents a digital method to convert signals in quadrature into directional signals using a Fast Fourier Transform (FFT approach. Validation of the method has been achieved using simulated Doppler ultrasound signals.

  18. Testing keV sterile neutrino dark matter in future direct detection experiments

    CERN Document Server

    Campos, Miguel D

    2016-01-01

    We determine constraints on sterile neutrino warm dark matter through direct detection experiments, taking XENON100 and its future stages as example. If keV-scale sterile neutrinos scatter inelastically with bound electrons of the target material, an electron recoil signal is generated. This can be used to set limits on the sterile neutrino mass and its mixing with the active sector. While not competitive with astrophysical constraints from X-ray data, the constraints are the first direct laboratory bounds on sterile neutrino warm dark matter, and will be in some parts of parameter space the strongest limits on keV-scale neutrinos.

  19. Colorless ONU implementation for WDM-PON using direct-detection optical OFDM

    Science.gov (United States)

    Feng, Min; Luo, Qing-long; Bai, Cheng-lin

    2013-03-01

    A novel architecture for the colorless optical network unit (ONU) is proposed and experimentally demonstrated with direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM). In this architecture, polarization-division multiplexing is used to reduce the cost at ONU. In optical line terminal (OLT), quadrature amplitude modulation (QAM) intensity-modulated OFDM signal with x-polarization at 10 Gbit/s is transmitted as downstream. At each ONU, the optical OFDM signal is demodulated with direct detection, and γ-polarization signal is modulated for upstream on-off keying (OOK) data at 5 Gbit/s. Simulation results show that the power penalty is negligible for both optical OFDM downstream and the on-off keying upstream signals after over 50 km single-mode fiber (SMF) transmission.

  20. Directed Design of Experiments for Validating Probability of Detection Capability of Nde Systems (doepod)

    Science.gov (United States)

    Generazio, E. R.

    2008-02-01

    The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Directed design of experiments for probability of detection (DOEPOD) has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit-Miss or signal amplitude testing. Specifically, DOEPOD demands utilization of observance of occurrences. Directed DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required.

  1. Pinning down inelastic dark matter in the Sun and in direct detection

    CERN Document Server

    Blennow, Mattias; Herrero-Garcia, Juan

    2015-01-01

    We study the solar capture rate of inelastic dark matter with endothermic and/or exothermic interactions. By assuming that an inelastic dark matter signal will be observed in next generation direct detection experiments we can set a lower bound on the capture rate that is independent of the local dark matter density, the velocity distribution, the galactic escape velocity as well as the scattering cross section. In combination with upper limits from neutrino observatories we can place upper bounds on the annihilation channels leading to neutrinos. We find that, while endothermic scattering limits are weak in the isospin-conserving case, strong bounds may be set for exothermic interactions, in particular in the spin-dependent case. Furthermore, we study the implications of observing two direct detection signals, in which case one can halo-independently obtain the dark matter mass and the mass splitting, and disentangle the endothermic/exothermic nature of the scattering. Finally we discuss isospin violation.

  2. Analyzing of singlet fermionic dark matter via the updated direct detection data

    Energy Technology Data Exchange (ETDEWEB)

    Ettefaghi, M.M.; Moazzemi, R. [University of Qom, Department of Physics, Qom (Iran, Islamic Republic of)

    2017-05-15

    We revisit the parameter space of singlet fermionic cold dark matter model in order to determine the role of the mixing angle between the standard model Higgs and a new singlet one. Furthermore, we restudy the direct detection constraints with the updated and new experimental data. As an important conclusion, this model is completely excluded by recent XENON100, PandaX II and LUX data. (orig.)

  3. Simplified polarization demultiplexing based on Stokes vector analysis for intensity-modulation direct-detection systems

    Science.gov (United States)

    Zhou, Xinyu; Yan, Lianshan; Chen, Zhiyu; Yi, Anlin; Pan, Yan; Jiang, Lin; Pan, Wei; Luo, Bin

    2016-10-01

    A simple and effective polarization demultiplexing method is proposed based on the improved Stokes vector analysis and digital signal processor algorithm for the intensity-modulation direct-detection optical communication systems. Such a scheme could significantly simplify optical receivers with low system cost. The experimental results demonstrate the feasibility of our proposed method and show that only 1- and 1.7-dB power penalties are measured for 10- and 25-km transmissions compared to back-to-back case.

  4. Neutron beam test of barium fluoride crystal for dark matter direct detection

    Science.gov (United States)

    Guo, C.; Ma, X. H.; Wang, Z. M.; Bao, J.; Dai, C. J.; Guan, M. Y.; Liu, J. C.; Li, Z. H.; Ren, J.; Ruan, X. C.; Yang, C. G.; Yu, Z. Y.; Zhong, W. L.

    2016-10-01

    In order to test the capabilities of Barium Fluoride (BaF2) crystal for dark matter direct detection, nuclear recoils are studied with mono-energetic neutron beam. The energy spectra of nuclear recoils, quenching factors for elastic scattering neutrons and discrimination capability between neutron inelastic scattering events and γ events are obtained for various recoil energies of the F content in BaF2.

  5. Direct detection of the Josephson radiation emitted from superconducting thin-film microbridges

    DEFF Research Database (Denmark)

    Pedersen, Niels Falsig; Sørensen, O. H.; Mygind, Jesper;

    1976-01-01

    We report direct measurements of the Josephson radiation emitted in X band from a superconducting thin-film microbridge coupled to a resonance cavity. Power is emitted if one of the harmonics of the Josephson frequency is in the bandwidth of the receiver. The maximum power emitted during our expe...... experiment was 10−13 W. The Josephson radiation could easily be detected at frequencies off resonance. Applied Physics Letters is copyrighted by The American Institute of Physics....

  6. Transfer Entropy Estimation and Directional Coupling Change Detection in Biomedical Time Series

    OpenAIRE

    Lee Joon; Nemati Shamim; Silva Ikaro; Edwards Bradley A; Butler James P; Malhotra Atul

    2012-01-01

    Abstract Background The detection of change in magnitude of directional coupling between two non-linear time series is a common subject of interest in the biomedical domain, including studies involving the respiratory chemoreflex system. Although transfer entropy is a useful tool in this avenue, no study to date has investigated how different transfer entropy estimation methods perform in typical biomedical applications featuring small sample size and presence of outliers. Methods With respec...

  7. Transfer Entropy Estimation and Directional Coupling Change Detection in Biomedical Time Series

    OpenAIRE

    Lee, Joon; Nemati, Shamim; Silva, Ikaro; Edwards, Bradley A.; Butler, James P.; Malhotra, Atul

    2011-01-01

    Background: The detection of change in magnitude of directional coupling between two non-linear time series is a common subject of interest in the biomedical domain, including studies involving the respiratory chemoreflex system. Although transfer entropy is a useful tool in this avenue, no study to date has investigated how different transfer entropy estimation methods perform in typical biomedical applications featuring small sample size and presence of outliers. Methods: ...

  8. Real-time PCR detection of Plasmodium directly from whole blood and filter paper samples

    OpenAIRE

    Taylor, Brian. J.; Martin, Kimberly A; Arango, Eliana; Agudelo, Olga M; Maestre, Amanda; Yanow, Stephanie K.

    2011-01-01

    Background Real-time PCR is a sensitive and specific method for the analysis of Plasmodium DNA. However, prior purification of genomic DNA from blood is necessary since PCR inhibitors and quenching of fluorophores from blood prevent efficient amplification and detection of PCR products. Methods Reagents designed to specifically overcome PCR inhibition and quenching of fluorescence were evaluated for real-time PCR amplification of Plasmodium DNA directly from blood. Whole blood from clinical s...

  9. Neutron Beam Tests of Barium Fluoride Crystal for Dark Matter Direct Detection

    CERN Document Server

    Guo, Cong; Wang, Zhimin; Bao, Jie; Dai, Changjiang; Guan, Mengyun; Liu, Jinchang; Li, Zuhao; Ren, Jie; Ruan, Xichao; Yang, Changgen; Yu, Zeyuan; Zhong, Weili

    2016-01-01

    In order to test the capabilities of Barium Fluoride (BaF2) Crystal for dark matter direct detection, nuclear recoils are studied with mono-energetic neutron beam. The energy spectra of nuclear recoils, quenching factors for elastic scattering neutrons and discrimination capability between neutron inelastic scattering events and {\\gamma} events are obtained for various recoil energies of the F content in BaF2.

  10. Horizontal Directional Drilling-Length Detection Technology While Drilling Based on Bi-Electro-Magnetic Sensing

    Directory of Open Access Journals (Sweden)

    Yudan Wang

    2017-04-01

    Full Text Available The drilling length is an important parameter in the process of horizontal directional drilling (HDD exploration and recovery, but there has been a lack of accurate, automatically obtained statistics regarding this parameter. Herein, a technique for real-time HDD length detection and a management system based on the electromagnetic detection method with a microprocessor and two magnetoresistive sensors employing the software LabVIEW are proposed. The basic principle is to detect the change in the magnetic-field strength near a current coil while the drill stem and drill-stem joint successively pass through the current coil forward or backward. The detection system consists of a hardware subsystem and a software subsystem. The hardware subsystem employs a single-chip microprocessor as the main controller. A current coil is installed in front of the clamping unit, and two magneto resistive sensors are installed on the sides of the coil symmetrically and perpendicular to the direction of movement of the drill pipe. Their responses are used to judge whether the drill-stem joint is passing through the clamping unit; then, the order of their responses is used to judge the movement direction. The software subsystem is composed of a visual software running on the host computer and a software running in the slave microprocessor. The host-computer software processes, displays, and saves the drilling-length data, whereas the slave microprocessor software operates the hardware system. A combined test demonstrated the feasibility of the entire drilling-length detection system.

  11. Direct 13C-detection for carbonyl relaxation studies of protein dynamics

    Science.gov (United States)

    Pasat, Gabriela; Zintsmaster, John S.; Peng, Jeffrey W.

    2008-08-01

    We describe a method that uses direct 13C-detection for measuring rotating-frame carbonyl ( 13CO) relaxation rates to describe protein functional dynamics. Key advantages of method include the following: (i) unique access to 13CO groups that lack a scalar-coupled 15N- 1H group; (ii) insensitivity to 15N/ 1H exchange-broadening that can derail 1H-detected 15N and HNCO methods; (iii) avoidance of artifacts caused by incomplete water suppression. We demonstrate the approach for both backbone and side-chain 13CO groups. Accuracy of the 13C-detected results is supported by their agreement with those obtained from established HNCO-based approaches. Critically, we show that the 13C-detection approach provides access to the 13CO groups of functionally important residues that are invisible via 1H-detected HNCO methods because of exchange-broadening. Hence, the 13C-based method fills gaps inherent in canonical 1H-detected relaxation experiments, and thus provides a novel complementary tool for NMR studies of biomolecular flexibility.

  12. You can hide but you have to run: direct detection with vector mediators

    CERN Document Server

    D'Eramo, Francesco; Panci, Paolo

    2016-01-01

    We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running and find that in some cases these bounds differ by several orders of magnitude. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Finally, we provide tools to facilitate th...

  13. Electroweak corrections to the direct detection cross section of inert Higgs dark matter

    Science.gov (United States)

    Klasen, Michael; Yaguna, Carlos E.; Ruiz-Álvarez, José D.

    2013-04-01

    The inert Higgs model is a minimal extension of the Standard Model that features a viable dark matter candidate, the so-called inert Higgs (H0). In this paper, we compute and analyze the dominant electroweak corrections to the direct detection cross section of dark matter within this model. These corrections arise from one-loop diagrams mediated by gauge bosons that, contrary to the tree-level result, do not depend on the unknown scalar coupling λ. We study in detail these contributions and show that they can modify in a significant way the prediction of the spin-independent direct detection cross section. In both viable regimes of the model, MH0direct detection experiments.

  14. Electroweak corrections to the direct detection cross section of inert higgs dark matter

    CERN Document Server

    Klasen, Michael; Ruiz-Alvarez, Jose D

    2013-01-01

    The inert higgs model is a minimal extension of the Standard Model that features a viable dark matter candidate, the so-called inert higgs ($H^0$). In this paper, we compute and analyze the dominant electroweak corrections to the direct detection cross section of dark matter within this model. These corrections arise from one-loop diagrams mediated by gauge bosons that, contrary to the tree-level result, do not depend on the unknown scalar coupling $\\lambda$. We study in detail these contributions and show that they can modify in a significant way the prediction of the spin-independent direct detection cross section. In both viable regimes of the model, $\\mhdirect detection experiments.

  15. Lepton-Flavored Asymmetric Dark Matter and Interference in Direct Detection

    CERN Document Server

    Hamze, Ali; Koeller, Jason; Trendafilova, Cynthia; Yu, Jiang-Hao

    2014-01-01

    In flavored dark matter models, dark matter can scatter off of nuclei through Higgs and photon exchange, both of which can arise from renormalizable interactions and individually lead to strong constraints from direct detection. While these two interaction channels can destructively interfere in the scattering amplitude, for a thermal relic with equal abundances for the dark matter particle and its antiparticle, this produces no effect on the total event rate. Focusing on lepton-flavored dark matter, we show that it is quite natural for dark matter to have become asymmetric during high-scale leptogenesis, and that in this case the direct detection bounds can be significantly weakened due to interference. We quantify this by mapping out and comparing the regions of parameter space that are excluded by direct detection for the symmetric and asymmetric cases of lepton-flavored dark matter. In particular, we show that the entire parameter region is ruled out for symmetric dark matter, while large portions of para...

  16. Direct molecule-specific glucose detection by Raman spectroscopy based on photonic crystal fiber.

    Science.gov (United States)

    Yang, Xuan; Zhang, Alissa Y; Wheeler, Damon A; Bond, Tiziana C; Gu, Claire; Li, Yat

    2012-01-01

    This paper reports the first step toward the development of a glucose biosensor based on Raman spectroscopy and a photonic crystal fiber (PCF) probe. Historically, it has been very challenging to detect glucose directly by Raman spectroscopy due to its inherently small Raman scattering cross-section. In this work, we report the first quantitative glucose Raman detection in the physiological concentration range (0-25 mM) with a low laser power (2 mW), a short integration time (30 s), and an extremely small sampling volume (~50 nL) using the highly sensitive liquid-filled PCF probe. As a proof of concept, we also demonstrate the molecular specificity of this technique in the presence of a competing sugar, such as fructose. High sensitivity, flexibility, reproducibility, low cost, small sampling volume, and in situ remote sensing capability make PCF a very powerful platform for potential glucose detection based on Raman spectroscopy.

  17. Direct exoplanet detection and characterization using the ANDROMEDA method: Performance on VLT/NaCo data

    CERN Document Server

    Cantalloube, F; Mugnier, L M; Milli, J; Absil, O; Gonzalez, C A Gomez; Chauvin, G; Beuzit, J -L; Cornia, A

    2015-01-01

    Context. The direct detection of exoplanets with high-contrast imaging requires advanced data processing methods to disentangle potential planetary signals from bright quasi-static speckles. Among them, angular differential imaging (ADI) permits potential planetary signals with a known rotation rate to be separated from instrumental speckles that are either statics or slowly variable. The method presented in this paper, called ANDROMEDA for ANgular Differential OptiMal Exoplanet Detection Algorithm is based on a maximum likelihood approach to ADI and is used to estimate the position and the flux of any point source present in the field of view. Aims. In order to optimize and experimentally validate this previously proposed method, we applied ANDROMEDA to real VLT/NaCo data. In addition to its pure detection capability, we investigated the possibility of defining simple and efficient criteria for automatic point source extraction able to support the processing of large surveys. Methods. To assess the performan...

  18. Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples

    Directory of Open Access Journals (Sweden)

    Trindade Giliane S

    2009-09-01

    Full Text Available Abstract Background Orthopoxvirus (OPV and Parapoxvirus (PPV have been associated with worldwide exanthematic outbreaks. Some species of these genera are able to infect humans and domestic animals, causing serious economic losses and public health impact. Rapid, useful and highly specific methods are required to detect and epidemiologically monitor such poxviruses. In the present paper, we describe the development of a nested-multiplex PCR method for the simultaneous detection of OPV and PPV species directly from exanthematic lesions, with no previous viral isolation or DNA extraction. Methods and Results The OPV/PPV nested-multiplex PCR was developed based on the evaluation and combination of published primer sets, and was applied to the detection of the target pathogens. The method showed high sensitivity, and the specificity was confirmed by amplicon sequencing. Exanthematic lesion samples collected during bovine vaccinia or contagious ecthyma outbreaks were submitted to OPV/PPV nested-multiplex PCR and confirmed its applicability. Conclusion These results suggest that the presented multiplex PCR provides a highly robust and sensitive method to detect OPV and PPV directly from clinical samples. The method can be used for viral identification and monitoring, especially in areas where OPV and PPV co-circulate.

  19. Direct detection of exoplanets in the 3 -- 10 micron range with E-ELT/METIS

    CERN Document Server

    Quanz, Sascha P; Meyer, Michael R; Schmalzl, Eva; Held, Jenny

    2014-01-01

    We quantify the scientific potential for exoplanet imaging with the Mid-infrared E-ELT Imager and Spectrograph (METIS) foreseen as one of the instruments of the European Extremely Large Telescope (E-ELT). We focus on two main science cases: (1) the direct detection of known gas giant planets found by radial velocity (RV) searches; and (2) the direct detection of small (1 - 4 R_earth) planets around the nearest stars. Under the assumptions made in our modeling, in particular on the achievable inner working angle and sensitivity, our analyses reveal that within a reasonable amount of observing time METIS is able to image >20 already known, RV-detected planets in at least one filter. Many more suitable planets with dynamically determined masses are expected to be found in the coming years with the continuation of RV-surveys and the results from the GAIA astrometry mission. In addition, by extrapolating the statistics for close-in planets found by \\emph{Kepler}, we expect METIS might detect ~10 small planets with...

  20. Detecting magnetic field direction by a micro beam operating in different vibration modes

    Institute of Scientific and Technical Information of China (English)

    Chen Jie; Qin Ming; Huang Qing-An

    2011-01-01

    A new method to detect the magnetic field direction by using a silicon structure is presented in this paper. The structure includes a micro beam and an in-plane coil electrode. When the electrode under a magnetic field is applied with an alternating current,the micro beam is actuated under the effect of the Lorentz forces. Magnetic fields of different directions cause different vibration profiles. The direction of the magnetic field is obtained by measuring the vibration amplitudes of the micro beam,which is driven to work at first- and second-order resonant modes. A micro structure has been fabricated using the bulk micromachined silicon process. A laser Doppler vibrometer system is implemented to measure the vibration amplitudes. The experimental results show that the amplitude of the structure,which depends on the different modes,is a sine or cosine function of the angle of the magnetic field. It agrees well with the simulation result. Currently a resolution of 100 for the magnetic field direction measurement can be obtained using the detecting principle.

  1. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR

    Directory of Open Access Journals (Sweden)

    Cristina P. Araújo

    2014-06-01

    Full Text Available Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  2. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  3. MIMAC: A micro-tpc matrix for dark matter directional detection

    CERN Document Server

    Santos, D; Bosson, G; Bouly, J L; Bourrion, O; Fourel, C; Guillaudin, O; Lamblin, J; Muraz, J F; Mayet, F; Richer, J P; Riffard, Q; Ferrer, E; Giomataris, I; Iguaz, F J; Lebreton, L; Maire, D

    2013-01-01

    The dark matter directional detection opens a new field in cosmology bringing the possibility to build a map of nuclear recoils that would be able to explore the galactic dark matter halo giving access to a particle characterization of such matter and the shape of the halo. The MIMAC (MIcro-tpc MAtrix of Chambers) collaboration has developed in the last years an original prototype detector based on the direct coupling of large pixelized micromegas with a devoted fast self-triggered electronics showing the feasibility of a new generation of directional detectors. The discovery potential of this search strategy is discussed and illustrated. In June 2012, the first bi-chamber prototype has been installed at Modane Underground Laboratory (LSM) and the first underground background events, the gain stability and calibration are shown.

  4. A novel prediction methodology for detecting failures and instabilities in directional wireless networks

    Science.gov (United States)

    Coleman, David M.; Milner, Stuart D.; Davis, Christopher C.

    2012-10-01

    Even though advances in wireless technology have yielded lower power consumption, higher data rates, and numerous other improvements, the ability to develop a proactive strategy towards handling degradations and failures in directional wireless networks has evaded the research community. In this paper, we introduce a methodology using an analogy to molecular systems in which a directional wireless network utilizing free space optical (FSO) or RF links is modeled as a molecule whose links can grow/retract similarly to bonds. A normal mode analysis (NMA) is performed to identify link instabilities (degradations and failures) and an N-dimensional potential energy surface (PES) is derived with respect to network and environmental parameters to aide in the detection of when a new topology is available ahead of the topology computation stage. Together, the NMA and PES form a basis for a proactive network methodology aimed at improving performance in directional wireless networks.

  5. Direct inference of SNP heterozygosity rates and resolution of LOH detection.

    Directory of Open Access Journals (Sweden)

    Xiaohong Li

    2007-11-01

    Full Text Available Single nucleotide polymorphisms (SNPs have been increasingly utilized to investigate somatic genetic abnormalities in premalignancy and cancer. LOH is a common alteration observed during cancer development, and SNP assays have been used to identify LOH at specific chromosomal regions. The design of such studies requires consideration of the resolution for detecting LOH throughout the genome and identification of the number and location of SNPs required to detect genetic alterations in specific genomic regions. Our study evaluated SNP distribution patterns and used probability models, Monte Carlo simulation, and real human subject genotype data to investigate the relationships between the number of SNPs, SNP HET rates, and the sensitivity (resolution for detecting LOH. We report that variances of SNP heterozygosity rate in dbSNP are high for a large proportion of SNPs. Two statistical methods proposed for directly inferring SNP heterozygosity rates require much smaller sample sizes (intermediate sizes and are feasible for practical use in SNP selection or verification. Using HapMap data, we showed that a region of LOH greater than 200 kb can be reliably detected, with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database. Higher densities of SNPs may exist in certain local chromosomal regions that provide some opportunities for reliably detecting LOH of segment sizes smaller than 50 kb. These results suggest that the interpretation of the results from genome-wide scans for LOH using commercial arrays need to consider the relationships among inter-SNP distance, detection probability, and sample size for a specific study. New experimental designs for LOH studies would also benefit from considering the power of detection and sample sizes required to accomplish the proposed aims.

  6. A rapid molecular detection protocol for Chikungunya virus directly performed on Aedes albopictus (tiger mosquito

    Directory of Open Access Journals (Sweden)

    Simone Barocci

    2010-03-01

    Full Text Available In the last few years tiger mosquitoes (Aedes albopictus, quickly and widely spread in Italy, represent ideal vectors for different Arboviruses, particularly Dengue virus (DenV and Chikungunya virus (ChikV, who are causing millions of patients in the world per year. For ChikV, appeared for the first time in Italy in 2007, a Surveillance Plan was defined in the Marche Region, a neighbour county of the Italian outbreak site. As a support for this surveillance, we decided to create a new multiplex RT-PCR protocol to detect ChikV directly in tiger mosquitoes. All the mosquitoes were collected with BG-Sentinel® traps (Biogents AG, Regensburg, Germany.Total RNA extraction was carried with Helix RNA plus kit (Diatech srl, Jesi, Italy. For retro-transcription and amplification a Mastercycler® ep gradient S thermal cycler (Eppendorf AG, Hamburg, Germany was used. From the whole RNA extracted from captured mosquitoes, we developed a new end-point multiplex retro transcriptase polymerase chain reaction (RT-PCR, for both the detection and identification of Aedes spp. and ChikV. This RT-PCR protocol is able to detect ChikV directly from adult insects, during alerts or emergencies.The entomological trapping associated with bio-molecular methods represents an effective strategy to detect ChikV directly from vectors. Moreover, after a specific evaluation, this RT-PCR protocol could be applied also for human blood samples in regions with the certain presence of this virus.

  7. Direct detection of trimethylamine in meat food products using ion mobility spectrometry.

    Science.gov (United States)

    Bota, Gheorghe M; Harrington, Peter B

    2006-01-15

    Biogenic amines are degradation products generated by bacteria in meat products. These amines can indicate bacterial contamination or have a carcinogenic effect to humans consuming spoiled meats; therefore, their rapid detection is essential. Trimethylamine (TMA) is a good target for the detection of biogenic amines because its volatility. TMA was directly detected in meat food products using ion mobility spectrometry (IMS). TMA concentrations were measured in chicken meat juice for a quantitative evaluation of the meat decaying process. The lowest detected TMA concentration in chicken juice was 0.6+/-0.2 ng and the lowest detected signal for TMA in a standard aqueous solution was 0.6 ng. IMS data were processed using partial least squares (PLS) and Fuzzy rule-building expert system (FuRES). Using these two chemometric methods, trimethylamine concentrations of different days of meat spoilage can be separated, indicating the decaying of meat products. Comparing the two methods, FuRES provided a better classification of different days of meat spoilage.

  8. Paper-based fluorescence resonance energy transfer assay for directly detecting nucleic acids and proteins.

    Science.gov (United States)

    Li, Hua; Fang, Xueen; Cao, Hongmei; Kong, Jilie

    2016-06-15

    Paper-based fluorescence resonance energy transfer assay (FRET) is gaining great interest in detecting macro-biological molecule. It is difficult to achieve conveniently and fast detection for macro-biological molecule. Herein, a graphene oxide (GO)-based paper chip (glass fiber) integrated with fluorescence labeled single-stranded DNA (ssDNA) for fast, inexpensive and direct detection of biological macromolecules (proteins and nucleic acids) has been developed. In this paper, we employed the Cy3/FAM-labeled ssDNA as the reporter and the GO as quencher and the original glass fiber paper as data acquisition substrates. The chip which was designed and fabricated by a cutting machine is a miniature biosensor that monitors fluorescence recovery from resonance energy transfer. The hybridization assays and fluorescence detection were all simplified, and the surface of the chip did not require immobilization or washing. A Nikon Eclipse was employed as excited resource and a commercial digital camera was employed for capturing digital images. This paper-based microfluidics chip has been applied in the detection of proteins and nucleic acids. The biosensing capability meets many potential requirements for disease diagnosis and biological analysis.

  9. First direct fluorescence polarization assay for the detection and quantification of spirolides in mussel samples

    Energy Technology Data Exchange (ETDEWEB)

    Otero, Paz; Alfonso, Amparo [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain); Alfonso, Carmen [CIFGA Laboratorio, Plaza de Santo Domingo, 1, 27001 Lugo (Spain); Araoz, Romulo; Molgo, Jordi [CNRS, Institut de Neurobiologie Alfred Fessard - FRC2118, Laboratoire de Neurobiologie et Developpement UPR3294, 1 Avenue de la Terrasse, 91198 Gif sur Yvette Cedex (France); Vieytes, Mercedes R. [Departamento de Fisiologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002 Lugo (Spain); Botana, Luis M., E-mail: luis.botana@usc.es [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain)

    2011-09-09

    Highlights: {yields} A direct assay based in the binding of nAChR to spirolide toxins by FP is described. {yields} A direct relationship between FP and 13-desMeC in the range of 10-500 nM is obtained. {yields} FP is dependent on the 13, 19-didesMeC in a higher concentration range than 13-desMeC. {yields} FP assay is a sensitive method to detect and quantify 13-desMeC in mussel samples. - Abstract: In 2009, we achieve the first inhibition FP assay to detect imine cyclic toxins. In the present paper we propose a new FP assay for direct quantify spirolides. This new method has resulted in significant improvement of sensitivity, rapidity and accessibility. In the method design, nicotinic acetylcholine receptor from Torpedo marmorata membranes labelled with a derivative of fluorescein was used. Spirolides, 13-desmethyl spirolide C (13-desMeC) and 13,19-didesmethyl spirolide C (13,19-didesMeC) were extracted and purified from cultures of the Alexandrium ostenfeldii dinoflagellate. Data showed the decrease of FP when toxin concentration was increased. Thus, a relationship between the FP units and the spirolides amount present in a sample was obtained. This direct assay is a reproducible, simple and very sensitive method with a detection limit about 25 nM for 13-desMeC and 150 nM for 13,19-didesMeC. The procedure was used to measure spirolides in mussel samples using an extraction and clean up protocol suitable for the FP assay. Results obtained show that this method is able to quantify 13-desMeC in the range of 50-350 {mu}g kg{sup -1} meat. Other liposoluble toxins did not interfere with the assay, proving a specific method. Moreover, the matrix do not affect in the range of toxin concentrations that involving risk of spirolides intoxication.

  10. A TLC-Direct Bioautography Method for Detection of Antiurolithiatic Metabolites.

    Science.gov (United States)

    Patil, Anita Surendra; Paikrao, Hariprasad Madhukarrao; Kale, Ankit Subhash; Manik, Surendra Raghoba

    2017-05-01

    Hyperoxaluria is major urinary disorder troubling largest population throughout the world predominantly involving calcium oxalate (CaOx) crystals. Ancient Ayurvedic system of medicine in India claims better option in treatment of urolithiasis. A plant from "Pashanbheda" group is Phyllanthus niruri L., possessing antiurolithiatic activity, needed to be screened and validated. In the present study, a rapid, easy and efficient method for CaOx crystal inhibition in the agar gel system analogous to antimicrobial well diffusion assay is proposed. A novel thin-layer chromatography (TLC)-direct bioautography method was also proposed to detect the antilithiatic metabolites. It helps to localize the active metabolites in P. niruri, further the partial structure elucidation was characterized by High Resolution Liquid Chromatography by mass spectroscopy (LC-HRMS) analysis. The agar well diffusion method shows 50% inhibitory concentration (IC50) value at 228.55 and 493.529 mg/mL for tri-sodium citrate and P. niruri extract, respectively. The lowest concentration showing visible crystal inhibition (minimum inhibitory concentration, MIC) in both samples was found to be 20 mg/mL. In this study, a unique agar gel well diffusion and TLC-direct bioautography method successfully screened, detected and confirmed CaOx crystal inhibitory metabolites from P. niruri. The tuberonic acid was detected in bioactive fraction of P. niruri by LC-HRMS characterization. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Direct detection of expanded trinucleotide repeats using PCR and DNA hybridization techniques

    Energy Technology Data Exchange (ETDEWEB)

    Petronis, A.; Tatuch, Y.; Klempan, T.A.; Kennedy, J.L. [Hospital for Sick Children, Toronto (Canada)] [and others

    1996-02-16

    Recently, unstable trinucleotide repeats have been shown to be the etiologic factor in seven neuropsychiatric diseases, and they may play a similar role in other genetic disorders which exhibit genetic anticipation. We have tested one polymerase chain reaction (PCR)-based and two hybridization-based methods for direct detection of unstable DNA expansion in genomic DNA. This technique employs a single primer (asymmetric) PCR using total genomic DNA as a template to efficiently screen for the presence of large trinucleotide repeat expansions. High-stringency Southern blot hybridization with a PCR-generated trinucleotide repeat probe allowed detection of the DNA fragment containing the expansion. Analysis of myotonic dystrophy patients containing different degrees of (CTG){sub n} expansion demonstrated the identification of the site of trinucleotide instability in some affected individuals without any prior information regarding genetic map location. The same probe was used for fluorescent in situ hybridization and several regions of (CTG){sub n}/(CAG){sub n} repeats in the human genome were detected, including the myotonic dystrophy locus on chromosome 19q. Although limited at present to large trinucleotide repeat expansions, these strategies can be applied to directly clone genes involved in disorders caused by large expansions of unstable DNA. 33 refs., 4 figs.

  12. Fabrication of SERS swab for direct detection of trace explosives in fingerprints.

    Science.gov (United States)

    Gong, Zhengjun; Du, Hongjie; Cheng, Fansheng; Wang, Cong; Wang, Canchen; Fan, Meikun

    2014-12-24

    Swab sampling is of great importance in surface contamination analysis. A cotton swab (cotton Q-tip) was successfully transformed into surface-enhanced Raman scattering (SERS) substrate (SERS Q-tip) through a bottom-up strategy, where Ag NPs were first self-assembled onto the Q-tip followed by in situ growing. The capability for direct swab detection of Raman probe Nile Blue A (NBA) and a primary explosive marker 2,4-dinitrotoluene (2,4-DNT) using the SERS Q-tip was explored. It was found that at optimum conditions, a femotogram of NBA on glass surface could be swab-detected. The lowest detectable amount for 2,4-DNT is only ∼1.2 ng/cm(2) (total amount of 5 ng) on glass surface, 2 orders of magnitude more sensitive than similar surface analysis achieved with infrared technique, and comparable even with that obtained by ion mobility spectrometry-mass spectrometry. Finally, 2,4-DNT left on fingerprints was also analyzed. It was found that SERS signal of 2,4-DNT from 27th fingerprint after touching 2,4-DNT powder can still be clearly identified by swabbing with the SERS Q-tip. We believe this is the first direct SERS swabbing test of explosives on fingerprint on glass. Considering its relative long shelf life (>30 d), the SERS Q-tip may find great potential in future homeland security applications when combined with portable Raman spectrometers.

  13. Signatures of Earth-scattering in the direct detection of Dark Matter

    Science.gov (United States)

    Kavanagh, Bradley J.; Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation of this `Earth-scattering' effect in the regime where DM particles scatter at most once before reaching the detector. We perform the calculation self-consistently, taking into account not only those particles which are scattered away from the detector, but also those particles which are deflected towards the detector. Taking into account a realistic model of the Earth and allowing for a range of DM-nucleon interactions, we present the EARTHSHADOW code, which we make publicly available, for calculating the DM velocity distribution after Earth-scattering. Focusing on low-mass DM, we find that Earth-scattering reduces the direct detection rate at certain detector locations while increasing the rate in others. The Earth's rotation induces a daily modulation in the rate, which we find to be highly sensitive to the detector latitude and to the form of the DM-nucleon interaction. These distinctive signatures would allow us to unambiguously detect DM and perhaps even identify its interactions in regions of the parameter space within the reach of current and future experiments.

  14. Direct Detection of sub-GeV Dark Matter with Semiconductor Targets

    CERN Document Server

    Essig, Rouven; Mardon, Jeremy; Soto, Adrian; Volansky, Tomer; Yu, Tien-Tien

    2015-01-01

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their ${\\cal O}(1~\\rm{eV})$ band gaps allow for ionization signals from dark matter as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcoming several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the r...

  15. Newly established monoclonal antibody diagnostic assays for Schistosoma mansoni direct detection in areas of low endemicity.

    Directory of Open Access Journals (Sweden)

    Rafaella Fortini Queiroz Grenfell

    Full Text Available BACKGROUND: Current available methods for diagnosis of schistosomiasis mansoni lack sufficient sensitivity, which results in underreporting of infectious in areas of low endemicity. METHODOLOGY/PRINCIPAL FINDINGS: We developed three novel diagnostic methodologies for the direct detection of schistosome infection in serum samples. These three new methods were evaluated with positive patients from a low endemicity area in southeast Brazil. The basis of the assay was the production of monoclonal antibodies against the protein backbone of heavily glycosylated Circulating Cathodic Antigen (CCA. The antibodies were also selected for having no specificity to repeating poly-Lewis x units. Assays based on the detection CCA-protein should not encounter a limitation in sensitivity due to a biological background of this particular epitope. Three diagnostic methodologies were developed and validated, (i Immunomagnetic Separation based on improved incubation steps of non-diluted serum, (ii Direct Enzyme-linked Immunosorbent Assay and (iii Fluorescent Microscopy Analysis as a qualitative assay. The two quantitative assays presented high sensitivity (94% and 92%, respectively and specificity (100%, equivalent to the analysis of 3 stool samples and 16 slides by Kato-Katz, showing promising results on the determination of cure. CONCLUSIONS/SIGNIFICANCE: The Immunomagnetic Separation technique showed excellent correlation with parasite burden by Cohen coefficient. The qualitative method detected 47 positive individuals out of 50 with the analysis of 3 slides. This easy-to-do method was capable of discriminating positive from negative cases, even for patients with low parasite burden.

  16. Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

    Science.gov (United States)

    Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

    2016-01-25

    We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

  17. Guidelines for the Direct Detection of Anaplasma spp. in Diagnosis and Epidemiological Studies.

    Science.gov (United States)

    Silaghi, Cornelia; Santos, Ana Sofia; Gomes, Jacinto; Christova, Iva; Matei, Ioana Adriana; Walder, Gernot; Domingos, Ana; Bell-Sakyi, Lesley; Sprong, Hein; von Loewenich, Friederike D; Oteo, José A; de la Fuente, José; Dumler, J Stephen

    2017-01-01

    The genus Anaplasma (Rickettsiales: Anaplasmataceae) comprises obligate intracellular Gram-negative bacteria that are mainly transmitted by ticks, and currently includes six species: Anaplasma bovis, Anaplasma centrale, Anaplasma marginale, Anaplasma phagocytophilum, Anaplasma platys, and Anaplasma ovis. These have long been known as etiological agents of veterinary diseases that affect domestic and wild animals worldwide. A zoonotic role has been recognized for A. phagocytophilum, but other species can also be pathogenic for humans. Anaplasma infections are usually challenging to diagnose, clinically presenting with nonspecific symptoms that vary greatly depending on the agent involved, the affected host, and other factors such as immune status and coinfections. The substantial economic impact associated with livestock infection and the growing number of human cases along with the risk of transfusion-transmitted infections, determines the need for accurate laboratory tests. Because hosts are usually seronegative in the initial phase of infection and serological cross-reactions with several Anaplasma species are observed after seroconversion, direct tests are the best approach for both case definition and epidemiological studies. Blood samples are routinely used for Anaplasma spp. screening, but in persistently infected animals with intermittent or low-level bacteremia, other tissues might be useful. These guidelines have been developed as a direct outcome of the COST action TD1303 EURNEGVEC ("European Network of Neglected Vectors and Vector-Borne Diseases"). They review the direct laboratory tests (microscopy, nucleic acid-based detection and in vitro isolation) currently used for Anaplasma detection in ticks and vertebrates and their application.

  18. Improving the emergency department detection rate of domestic violence using direct questioning.

    Science.gov (United States)

    Morrison, L J; Allan, R; Grunfeld, A

    2000-08-01

    The purpose of this study was to compare the domestic violence (DV) rate identified with simple direct questioning to a historical cohort of patients receiving routine emergency department (ED) care. One thousand ED charts of female patients were retrospectively reviewed. Each patient in the prospective cohort was asked five DV specific questions. The historical cohort revealed a DV prevalence rate of 0.4%. The prospective study group of 302 patients identified 11 (3.6%) patients who admitted to acute DV on direct questioning. Ten of these patients accepted help. Twenty (6.6%) were identified as probable DV and 12 (4%) admitted to past violence. The total number of victims of DV, past, present, and probable was 43 (14.2%). This increase in detection from 0.4% (4/1000) to 14.2% (43/302) is significant at p patients refused to participate in the DV specific questions. The conclusion of the study indicated that the use of simple, direct questioning significantly improves the detection rate of DV in the ED.

  19. Dark matter direct detection rate in a generic model with micrOMEGAs_2.2

    Science.gov (United States)

    Bélanger, G.; Boudjema, F.; Pukhov, A.; Semenov, A.

    2009-05-01

    We present a new module of the micrOMEGAs package for the calculation of WIMP-nuclei elastic scattering cross sections relevant for the direct detection of dark matter through its interaction with nuclei in a large detector. With this new module, the computation of the direct detection rate is performed automatically for a generic model of new physics which contains a WIMP candidate. This model needs to be implemented within micrOMEGAs 2.2. Program summaryProgram title: micrOMEGAs2.2 Catalogue identifier: ADQR_v2_2 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADQR_v2_2.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 206 949 No. of bytes in distributed program, including test data, etc.: 2 245 230 Distribution format: tar.gz Programming language: C and Fortran Computer: PC, Alpha, Mac Operating system: UNIX (Linux, OSF1, Darwin, Cygwin) RAM: 17 MB depending on the number of processes required Classification: 1.9, 11.6 Catalogue identifier of previous version: ADQR_v2_1 Journal reference of previous version: Comput. Phys. Comm. 177 (2007) 894 Does the new version supersede the previous version?: Yes Nature of problem: Calculation of the relic density and of direct and indirect detection rates of the lightest stable particle in a generic new model of particle physics. Solution method: In numerically solving the evolution equation for the density of darkmatter, relativistic formulae for the thermal average are used. All tree-level processes for annihilation and coannihilation of new particles in the model are included. The cross-sections for all processes are calculated exactly with CalcHEP after definition of a model file. Higher-order QCD corrections to Higgs couplings to quark pairs are included. The coefficients of the effective Lagrangian which describes the

  20. Design and Development of a Scanning Airborne Direct Detection Doppler Lidar System

    Science.gov (United States)

    Gentry, Bruce; McGill, Matthew; Schwemmer, Geary; Hardesty, Michael; Brewer, Alan; Wilkerson, Thomas; Atlas, Robert; Sirota, Marcos; Lindemann, Scott

    2006-01-01

    In the fall of 2005 we began developing an airborne scanning direct detection molecular Doppler lidar. The instrument is being built as part of the Tropospheric Wind Lidar Technology Experiment (TWiLiTE), a three year project selected by the NASA Earth Sun Technology Office under the Instrument Incubator Program. The TWiLiTE project is a collaboration involving scientists and engineers from NASA Goddard Space Flight Center, NOAA ESRL, Utah State University Space Dynamics Lab, Michigan Aerospace Corporation and Sigma Space Corporation. The TWiLiTE instrument will leverage significant research and development investments made by NASA Goddard and it's partners in the past several years in key lidar technologies and sub-systems (lasers, telescopes, scanning systems, detectors and receivers) required to enable spaceborne global wind lidar measurement. These sub-systems will be integrated into a complete molecular direct detection Doppler wind lidar system designed for autonomous operation on a high altitude aircraft, such as the NASA WB57. The WB57 flies at an altitude of 18 km and from this vantage point the nadir viewing Doppler lidar will be able to profile winds through the full troposphere. The TWiLiTE integrated airborne Doppler lidar instrument will be the first demonstration of a airborne scanning direct detection Doppler lidar and will serve as a critical milestone on the path to a future spaceborne tropospheric wind system. In addition to being a technology testbed for space based tropospheric wind lidar, when completed the TWiLiTE high altitude airborne lidar will be used for studying mesoscale dynamics and storm research (e.g. winter storms, hurricanes) and could be used for calibration and validation of satellite based wind systems such as ESA's Aeolus Atmospheric Dynamics Mission. The TWiLiTE Doppler lidar will have the capability to profile winds in clear air from the aircraft altitude of 18 km to the surface with 250 m vertical resolution and < 2mls

  1. The impact of baryons on the direct detection of dark matter

    Science.gov (United States)

    Kelso, Chris; Savage, Christopher; Valluri, Monica; Freese, Katherine; Stinson, Gregory S.; Bailin, Jeremy

    2016-08-01

    The spatial and velocity distributions of dark matter particles in the Milky Way Halo affect the signals expected to be observed in searches for dark matter. Results from direct detection experiments are often analyzed assuming a simple isothermal distribution of dark matter, the Standard Halo Model (SHM). Yet there has been skepticism regarding the validity of this simple model due to the complicated gravitational collapse and merger history of actual galaxies. In this paper we compare the SHM to the results of cosmological hydrodynamical simulations of galaxy formation to investigate whether or not the SHM is a good representation of the true WIMP distribution in the analysis of direct detection data. We examine two Milky Way-like galaxies from the MaGICC cosmological simulations (a) with dark matter only and (b) with baryonic physics included. The inclusion of baryons drives the shape of the DM halo to become more spherical and makes the velocity distribution of dark matter particles less anisotropic especially at large heliocentric velocities, thereby making the SHM a better fit. We also note that we do not find a significant disk-like rotating dark matter component in either of the two galaxy halos with baryons that we examine, suggesting that dark disks are not a generic prediction of cosmological hydrodynamical simulations. We conclude that in the Solar neighborhood, the SHM is in fact a good approximation to the true dark matter distribution in these cosmological simulations (with baryons) which are reasonable representations of the Milky Way, and hence can also be used for the purpose of dark matter direct detection calculations.

  2. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    Directory of Open Access Journals (Sweden)

    Padmavathy

    2012-02-01

    Full Text Available Abstract Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to

  3. Detection of serum IgE antibody directed to aminothiazole using immobilized cephalosporins without protein conjugation

    Directory of Open Access Journals (Sweden)

    Akihito Yokoyama

    1999-01-01

    Full Text Available It is well known that allergic reactions may sometimes occur in patients under treatment with β-lactam antibiotics. For the detection of antidrug antibodies in vitro, conjugation with human serum albumin has been considered to be essential. In this study, we found that cefotiam, cefpirome, and ceftazidime could be immobilized without conjugation to carrier protein to construct a solid-phase enzyme-linked immunosorbent assay (ELISA system. We describe a patient (26-year-old female nurse with contact urticaria induced by antibiotics. Using the serum of this patient, we successfully detected IgE antibody directed to the aminothiazolyl group of cephalosporins, which has not previously been reported. Results suggest that the simple ELISA using unconjugated antibiotics could be applicable to patients with allergy to some cephalosporins and the aminothiazole side chain of the cephalosporins could cause an IgE-mediated allergic reaction.

  4. SUSY-QCD corrections for direct detection of neutralino dark matter and correlations with relic density

    Science.gov (United States)

    Klasen, M.; Kovařík, K.; Steppeler, P.

    2016-11-01

    In this paper, we perform a full next-to-leading order (NLO) QCD calculation of neutralino scattering on protons or neutrons in the minimal supersymmetric standard model. We match the results of the NLO QCD calculation to the scalar and axial-vector operators in the effective field theory approach. These govern the spin-independent and spin-dependent detection rates, respectively. The calculations have been performed for general bino, wino and higgsino decompositions of neutralino dark matter and required a novel tensor reduction method of loop integrals with vanishing relative velocities and Gram determinants. Numerically, the NLO QCD effects are shown to be of at least of similar size and sometimes larger than the currently estimated nuclear uncertainties. We also demonstrate the interplay of the direct detection rate with the relic density when consistently analyzed with the program dm@nlo.

  5. DESIGN OF DPSK MODULATOR AND DIRECT DETECTION RECEIVER FOR DWDM BASED OPTICAL COMMUNICATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Gurjit Kaur

    2016-06-01

    Full Text Available In this paper a 16-bit differential phase shift keying (DPSK modulator is designed for 32 dense wavelength division multiplexing (DWDM channels. The DWDM channels are designed with 0.8nm separation in wavelength and operated at 4dBm input power. In the DWDM system, these 32 multiplexed signals propagate through a fiber length of 100 km followed by an erbium-doped fiber amplifier (EDFA inline. The channel is equipped with pre-amplifier and a dispersion compensating fiber for better performance. Also, a threshold detector is designed for both in-phase and quadrature components to detect the input amplitude and provide a quantized output amplitude level. The result shows that, a 16-bit DPSK optical signal is demodulated successfully using direct detection receiver.

  6. Community Detecting and Feature Analysis in Real Directed Weighted Social Networks

    Directory of Open Access Journals (Sweden)

    Yao Liu

    2013-06-01

    Full Text Available Real social networks usually have some structural features of the complex networks, such as community structure, the scale-free degree distribution, clustering, "small world" network, dynamic evolution and so on. A new community detecting algorithm for directed and weighted social networks is proposed in this paper. Due to the use of more reference information, the accuracy of the algorithm is better than some of the typical detecting algorithms. And because of the use of heap structure and multi-task modular architecture, the algorithm also got a high computational efficiency than other algorithms. The effectiveness and efficiency of the algorithm is validated by experiments on real social networks. Based on the theories and models of complex networks, the features of the real large social networks are analyzed.

  7. Direct detection of oxygen free radicals produced in theviscera of burned rats using electron paramagneticresonance spectroscopy

    Institute of Scientific and Technical Information of China (English)

    路卫; 陈玉琳; 夏照帆

    2002-01-01

    Objective: To detect superoxide anion (O-2) signalsin the heart, liver, lung and kidney tissues after burns.Methods: Twenty-four male rats were randomizedinto 4 groups. The rats of experimental groups wereimmersed in 100℃ water for 15 seconds and 25% third-degree burn was created. Thoracotomy or laparotomy wasperformed at 5, 10, 15, 20 and 30 minutes after burn, andspecimens of the heart, lung, liver kidney were obtained forburned rats. The specimens were then preserved in liquidnitrogen for cryo-preservation and detected immediatelyusing EPR.Results: The signals of superoxide O radicalappeared in the heart, lung, liver and kidney specimens10-15 minutes after burn.Conclusions: There is a direct evidence of oxygen freeradicals (OFRs) injury to viscera of burned rats between10-15 minutes after burn.

  8. Ground-Based Direct Detection of Exoplanets with the Gemini Planet Imager (GPI)

    CERN Document Server

    Graham, James R; Doyon, Rene; Gavel, Don; Larkin, James; Levine, Marty; Oppenheimer, Ben; Palmer, David; Saddlemyer, Les; Sivaramakrishnan, Anand; Veran, Jean-Pierre; Wallace, Kent

    2007-01-01

    The Gemini Planet (GPI) imager is an "extreme" adaptive optics system being designed and built for the Gemini Observatory. GPI combines precise and accurate wavefront control, diffraction suppression, and a speckle-suppressing science camera with integral field and polarimetry capabilities. GPI's primary science goal is the direct detection and characterization of young, Jovian-mass exoplanets. For systems younger than 2 Gyr exoplanets more massive than 6 MJ and semimajor axes beyond 10 AU are detected with completeness greater than 50%. GPI will also discover faint debris disks, explore icy moons and minor planets in the solar system, reveal high dynamic range main-sequence binaries, and study mass loss from evolved stars. This white paper explains the role of GPI in exoplanet discovery and characterization and summarizes our recommendations to the NSF-NASA-DOE Astronomy and Astrophysics Advisory Committee ExoPlanet Task Force.

  9. A theoretical look at the direct detection of giant planets outside the Solar System

    CERN Document Server

    Burrows, A

    2005-01-01

    Astronomy is at times a science of unexpected discovery. When it is, and if we are lucky, new intellectual territories emerge to challenge our views of the cosmos. The recent indirect detections using high-precision Doppler spectroscopy of now more than one hundred giant planets orbiting more than one hundred nearby stars is an example of such rare serendipity. What has been learned has shaken our preconceptions, for none of the planetary systems discovered to date is like our own. However, the key to unlocking a planet's chemical, structural, and evolutionary secrets is the direct detection of the planet's light. I review the embryonic theory of the spectra, atmospheres, and light curves of irradiated giant planets and put this theory into the context of the many proposed astronomical campaigns to image them.

  10. Direct detection of singlet dark matter in classically scale-invariant standard model

    Directory of Open Access Journals (Sweden)

    Kazuhiro Endo

    2015-10-01

    Full Text Available Classical scale invariance is one of the possible solutions to explain the origin of the electroweak scale. The simplest extension is the classically scale-invariant standard model augmented by a multiplet of gauge singlet real scalar. In the previous study it was shown that the properties of the Higgs potential deviate substantially, which can be observed in the International Linear Collider. On the other hand, since the multiplet does not acquire vacuum expectation value, the singlet components are stable and can be dark matter. In this letter we study the detectability of the real singlet scalar bosons in the experiment of the direct detection of dark matter. It is shown that a part of this model has already been excluded and the rest of the parameter space is within the reach of the future experiment.

  11. Direct detection of x-rays for protein crystallography employing a thick, large area CCD

    Science.gov (United States)

    Atac, Muzaffer; McKay, Timothy

    1999-01-01

    An apparatus and method for directly determining the crystalline structure of a protein crystal. The crystal is irradiated by a finely collimated x-ray beam. The interaction of the x-ray beam with the crystal produces scattered x-rays. These scattered x-rays are detected by means of a large area, thick CCD which is capable of measuring a significant number of scattered x-rays which impact its surface. The CCD is capable of detecting the position of impact of the scattered x-ray on the surface of the CCD and the quantity of scattered x-rays which impact the same cell or pixel. This data is then processed in real-time and the processed data is outputted to produce a image of the structure of the crystal. If this crystal is a protein the molecular structure of the protein can be determined from the data received.

  12. Direct detection of lower hybrid wave using a reflectometer on Alcator C-Moda)

    Science.gov (United States)

    Shiraiwa, S.; Baek, S.; Dominguez, A.; Marmar, E.; Parker, R.; Kramer, G. J.

    2010-10-01

    The possibility of directly detecting a density perturbation produced by lower hybrid (LH) waves using a reflectometer is presented. We investigate the microwave scattering of reflectometer probe beams by a model density fluctuation produced by short wavelength LH waves in an Alcator C-Mod experimental condition. In the O-mode case, the maximum response of phase measurement is found to occur when the density perturbation is approximately centimeters in front of the antenna, where Bragg scattering condition is satisfied. In the X-mode case, the phase measurement is predicted to be more sensitive to the density fluctuation close to the cut-off layer. A feasibility test was carried out using a 50 GHz O-mode reflectometer on the Alcator C-Mod tokamak, and positive results including the detection of 4.6 GHz pump wave and parametric decay instabilities were obtained.

  13. Determination of urinary vanillylmandelic acid by direct injection and coupled-column chromatography with electrochemical detection.

    Science.gov (United States)

    Eriksson, B M; Persson, B A; Wikström, M

    1990-04-27

    An automated column-switching system for determination of vanillylmandelic acid in urine is described. The liquid chromatographic system was composed of two separation columns with different selectivity properties, an octadecyl column coated with tributyl phosphate as stationary liquid phase and a silica-based anion exchanger. Urine samples were injected directly onto the first column, where vanillylmandelic acid was separated from the main part of the sample matrix. The internal standard isovanillylmandelic acid was co-eluting with vanillylmandelic acid, and a fraction of the eluate containing both substances was switched to the second column, where separation was performed. To assess peak purity, detection was performed with dual working electrodes in parallel mode. A relative standard deviation of 3.5% was obtained for determination of human urine samples containing 3 microM vanillylmandelic acid, and less than 0.1 microM could be detected.

  14. Iodine-125 radioimmunoassay for the direct detection of benzodiazepines in blood and urine

    Energy Technology Data Exchange (ETDEWEB)

    Goddard, C.P.; Stead, A.H.; Mason, P.A.; Law, B.; Moffat, A.C.; McBrien, M.; Cosby, S.

    1986-05-01

    A radioimmunoassay (RIA) for the direct detection of benzodiazepines in blood and urine is described. It is based on a commercially available antiserum and an easily synthesised radio-iodinated derivative of clonazepam that allows the use of relatively simple gamma-counting procedures. The assay can detect low therapeutic levels of all of the benzodiazepines currently available in the UK in 50-..mu..l samples of blood and urine (1-50 ng ml/sup -1/, depending on the drug); no prior sample preparation is required. It is inexpensive, rapid, simple to perform and is broadly specific for the benzodiazepine class of drugs. The assay offers a most suitable means of screening large numbers of samples of forensic interest for the presence of the benzodiazepines.

  15. Direct Measurement of Mammographic X-Ray Spectra with a Digital CdTe Detection System

    Directory of Open Access Journals (Sweden)

    Giuseppe Raso

    2012-06-01

    Full Text Available In this work we present a detection system, based on a CdTe detector and an innovative digital pulse processing (DPP system, for high-rate X-ray spectroscopy in mammography (1–30 keV. The DPP system performs a height and shape analysis of the detector pulses, sampled and digitized by a 14-bit, 100 MHz ADC. We show the results of the characterization of the detection system both at low and high photon counting rates by using monoenergetic X-ray sources and a nonclinical X-ray tube. The detection system exhibits excellent performance up to 830 kcps with an energy resolution of 4.5% FWHM at 22.1 keV. Direct measurements of clinical molybdenum X-ray spectra were carried out by using a pinhole collimator and a custom alignment device. A comparison with the attenuation curves and the half value layer values, obtained from the measured and simulated spectra, from an ionization chamber and from a solid state dosimeter, also shows the accuracy of the measurements. These results make the proposed detection system a very attractive tool for both laboratory research, calibration of dosimeters and advanced quality controls in mammography.

  16. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    Science.gov (United States)

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  17. Detection of Giardia lamblia and Cryptosporidium parvum by direct immunofluorescence assay in stool specimen.

    Science.gov (United States)

    Rahman, M M; Hossain, M A; Paul, S K; Ahmed, S; Islam, A; Ehsan, M A; Alam, M M; Kabir, M R; Sarkar, S R

    2014-07-01

    Giardia and Cryptosporidium are the pathogens which transmitted through contaminated soil and contaminated water are significant causes of diarrhea and nutritional disorders in institutional and community peoples. Children and immune compromise persons are more vulnerable for these infections. Both Giardiasis and Cryptosporidiosis were included in 2004 as WHO Neglected Disease. So this is a major public health problem in developing countries. The present study was carried out to detect the Giardia and Cryptosporidium from diarrheic or patient having loose stool by Direct Immunofluorescence assay. The study was conducted during July 20012 to February 2013 and the work was done in Mymensingh Medical College in the department of Microbiology and in Bangladesh Agricultural University in the department of Veterinary Medicine. A total of 100 loose stools were collected from school children of different area and hospital under sadar upazilla, Mymensingh. The detection of Giardia lamblia and Cryptosporidium parvum showed the individual prevalence 8% and 4% respectively. The highest cyst/oocyst count was 85,000 and 1,000/gm of stool and the lowest being 100 and 50/gm of stool for Giardiasis and Cryptosporidiosis respectively. The detection rate of Giardia and Cryptosporidium by Immunofluorescence assay was relatively higher than the previous study done in Bangladesh and this was the first report from Bangladesh over human stool specimen using Immunofluorescence assay. So, Immunofluorescence assay could be adapted for rapid and accurate detection of Giardia and Cryptosporidium.

  18. Detecting Direct Collapse Black Holes: making the case for CR7

    CERN Document Server

    Agarwal, Bhaskar; Zackrisson, Erik; Labbe, Ivo; Bosch, Frank C van den; Natarajan, Priyamvada; Khochfar, Sadegh

    2015-01-01

    We propose that one of the sources in the recently detected system CR7 by Sobral et al. (2015) through spectro-photometric measurements at $z = 6.6$ harbors a direct collapse blackhole (DCBH). We argue that the LW radiation field required for direct collapse in source A is provided by sources B and C. By tracing the LW production history and star formation rate over cosmic time for the halo hosting CR7 in a $\\Lambda$CDM universe, we demonstrate that a DCBH could have formed at $z\\sim 20$. The spectrum of source A is well fit by nebular emission from primordial gas around a BH with MBH $\\sim 4.4 \\times 10^6 \\ M_{\\odot}$ accreting at a 40% of the Eddington rate, which strongly supports our interpretation of the data. Combining these lines of evidence, we argue that CR7 might well be the first DCBH candidate.

  19. Detecting direct collapse black holes: making the case for CR7

    Science.gov (United States)

    Agarwal, Bhaskar; Johnson, Jarrett L.; Zackrisson, Erik; Labbe, Ivo; van den Bosch, Frank C.; Natarajan, Priyamvada; Khochfar, Sadegh

    2016-08-01

    We propose that one of the sources in the recently detected system CR7 by Sobral et al. through spectrophotometric measurements at z = 6.6 harbours a direct collapse black hole (DCBH). We argue that the LW radiation field required for direct collapse in source A is provided by sources B and C. By tracing the LW production history and star formation rate over cosmic time for the halo hosting CR7 in a ΛCDM universe, we demonstrate that a DCBH could have formed at z ˜ 20. The spectrum of source A is well fit by nebular emission from primordial gas around a BH with MBH ˜4.4 × 106 M⊙ accreting at a 40 per cent of the Eddington rate, which strongly supports our interpretation of the data. Combining these lines of evidence, we argue that CR7 might well be the first DCBH candidate.

  20. Data acquisition electronics and reconstruction software for directional detection of dark matter with MIMAC

    Energy Technology Data Exchange (ETDEWEB)

    Bourrion, O., E-mail: olivier.bourrion@lpsc.in2p3.f [Laboratoire de Physique Subatomique et de Cosmologie, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, 53, rue des Martyrs, Grenoble (France); Bosson, G.; Grignon, C.; Bouly, J.L.; Richer, J.P.; Guillaudin, O.; Mayet, F.; Santos, D. [Laboratoire de Physique Subatomique et de Cosmologie, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, 53, rue des Martyrs, Grenoble (France)

    2010-10-01

    Directional detection of galactic dark matter requires 3D reconstruction of low energy nuclear recoils tracks. A dedicated acquisition electronics with auto triggering feature and a real time track reconstruction software have been developed within the framework of the MIMAC project of detector. This auto-triggered acquisition electronic uses embedded processing to reduce data transfer to its useful part only, i.e. decoded coordinates of hit tracks and corresponding energy measurements. An acquisition software with online monitoring and 3D track reconstruction is also presented.

  1. Data acquisition electronics and reconstruction software for directional detection of Dark Matter with MIMAC

    CERN Document Server

    Bourrion, O; Grignon, C; Bouly, J L; Richer, J P; Guillaudin, O; Mayet, F; Santos, D

    2010-01-01

    Directional detection of galactic Dark Matter requires 3D reconstruction of low energy nuclear recoils tracks. A dedicated acquisition electronics with auto triggering feature and a real time track reconstruction software have been developed within the framework of the MIMAC project of detector. This auto-triggered acquisition electronic uses embedded processing to reduce data transfer to its useful part only, i.e. decoded coordinates of hit tracks and corresponding energy measurements. An acquisition software with on-line monitoring and 3D track reconstruction is also presented.

  2. A novel modulation and direct detection scheme of optical phase shift keying

    Institute of Scientific and Technical Information of China (English)

    Yongcai Yang(杨永才); Wolfgang Vogel

    2004-01-01

    This paper introduces a new modulation and direct detection scheme of optical phase shift keying (PSK)which is simple and practical in fiber optical communication. A phase modulator is used to modulate a continuous wave (CW) laser source and return-to-zero (RZ) signal that is changed from the initial transmitting information is used to control a phase modulator to form a optical PSK signal. In the receiver terminal, just add a signal delayed a half of one bit to itself so that the initial information can be restored.

  3. Direct detection of dark matter in models with a light Z'

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Sarkar, Subir

    2011-01-01

    We discuss the direct detection signatures of dark matter interacting with nuclei via a Z' mediator, focussing on the case where both the dark matter and the $Z'$ have mass of a few GeV. Isospin violation (i.e. different couplings to protons and neutrons) arises naturally in this scenario....... In particular it is possible to reconcile the preferred parameter regions inferred from the observed DAMA and CoGeNT modulations with the bounds from XENON100, which requires f_n/f_p = -0.7. Moreover, the Z' mediator can also yield a large spin-dependent cross-section which could contribute to the DAMA signal...

  4. Wavelet packet transform-based optical orthogonal frequency-division multiplexing transmission using direct detection

    Science.gov (United States)

    Zhang, Hongbo; Yi, Xingwen; Chen, Lei; Zhang, Jing; Deng, Mingliang; Qiu, Kun

    2012-10-01

    As an alternate to fast Fourier transform-based orthogonal frequency-division multiplexing (OFDM), wavelet packet transform (WPT)-based OFDM (WPT-OFDM) does not require cyclic prefix to avoid inter-symbol-interference. The wavelet has many varieties and therefore, it can provide more freedom for system design to suit different applications. We propose a real-valued WPT-OFDM that uses intensity modulation/direct detection. We also conduct an experiment to verify its performance through a 75-km standard single-mode fiber.

  5. Nuclear recoil energy scale in liquid xenon with application to the direct detection of dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Sorensen, P; Dahl, C E

    2011-02-14

    We show for the first time that the quenching of electronic excitation from nuclear recoils in liquid xenon is well-described by Lindhard theory, if the nuclear recoil energy is reconstructed using the combined (scintillation and ionization) energy scale proposed by Shutt et al.. We argue for the adoption of this perspective in favor of the existing preference for reconstructing nuclear recoil energy solely from primary scintillation. We show that signal partitioning into scintillation and ionization is well-described by the Thomas-Imel box model. We discuss the implications for liquid xenon detectors aimed at the direct detection of dark matter.

  6. MAXI/GSC detection of weak X-ray enhancement from the direction of NGC 6440

    Science.gov (United States)

    Negoro, H.; Ueno, S.; Tomida, H.; Ishikawa, M.; Sugawara, Y.; Isobe, N.; Shimomukai, R.; Mihara, T.; Sugizaki, M.; Nakahira, S.; Iwakiri, W.; Shidatsu, M.; Yatabe, F.; Takao, Y.; Matsuoka, M.; Kawai, N.; Sugita, S.; Yoshii, T.; Tachibana, Y.; Harita, S.; Morita, K.; Yoshida, A.; Sakamoto, T.; Serino, M.; Kawakubo, Y.; Kitaoka, Y.; Hashimoto, T.; Tsunemi, H.; Yoneyama, T.; Nakajima, M.; Kawase, T.; Sakamaki, A.; Ueda, Y.; Hori, T.; Tanimoto, A.; Oda, S.; Tsuboi, Y.; Nakamura, Y.; Sasaki, R.; Kawai, H.; Yamauchi, M.; Hanyu, C.; Hidaka, K.; Kawamuro, T.; Yamaoka, K.

    2017-10-01

    MAXI/GSC detects weak X-ray enhancement from the direction of the globular cluster NGC 6440. The 4-10 keV X-ray flux has been increasing since around 2017 September 29. Using data in 7 scan transits from 23:08 on October 3 to 06:07 on October 4, we obtain the source position at (R.A., Dec) = (267.335 deg, -20.047 deg) = (17 49 20, -20 02 49) (J2000) with a statistical 90% C.L. elliptical error region with long and short radii of 0.38 deg and 0.28 deg, respectively.

  7. Flipped-Exponential Nyquist Pulse Technique to Optimize PAPR in Optical Direct-Detection OFDM Systems

    Institute of Scientific and Technical Information of China (English)

    Jiangnan Xiao; Zizheng Cao; Fan Li; Jin Tang; Lin Chen

    2012-01-01

    In this paper, we describe a novel technique based on the flipped-exponential (FE) Nyquist pulse method for reducing peak-to-average power ratio (PAPR) in an optical direct-detection orthogonal frequency-division multiplexing (DD-QFDM) system, The technique involves proper selection of the FE Nyquist pulses for shaping the different subcarriers of the OFDM. We apply this technique to a DD-OFDM transmission system to significantly reduce PAPR. We also investigate the sensitivity of a received OFDM signal with strong nonlinearity in a standard single-mode fiber (SMF).

  8. Terahertz Direct Detection Characteristics of a Superconducting NbN Bolometer

    Institute of Scientific and Technical Information of China (English)

    REN Yuan; MIAO Wei; YAO Qi-Jun; ZHANG Wen; SHI Sheng-Cai

    2011-01-01

    We report the terahertz direct detection characteristics of a spiral antenna coupled NbN superconducting hot-electron bolometer (HEB) at a bath temperature of 4.2 K. Thermal conductance determined from resistance transition curves with different bias currents is found to be 3 × 10-7 W/K. The device shows a read-out circuit limited noise equivalent power (NEP) of 4.5×10-12 W/Hz1/2 at 4.2 K with a home-made transimpedance amplifier operating at room temperature.

  9. Direct detection in Transmission Electron Microscopy with a 5{mu}m pitch CMOS pixel sensor

    Energy Technology Data Exchange (ETDEWEB)

    Contarato, Devis, E-mail: DContarato@lbl.go [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Denes, Peter; Doering, Dionisio; Joseph, John; Krieger, Brad [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States)

    2011-04-11

    This paper presents the characterization of a CMOS monolithic pixel sensor prototype optimized for direct detection in Transmission Electron Microscopy (TEM). The sensor was manufactured in a deep-submicron commercial CMOS process and features pixels of 5{mu}m pitch. Different pixel architectures have been implemented in the test chip, and the best performing architecture has been selected from a series of tests performed with 300 keV electrons. Irradiation tests to high electron doses have also been performed in order to estimate device lifetime.

  10. Rapid detection of NBOME's and other NPS on blotter papers by direct ATR-FTIR spectrometry.

    Science.gov (United States)

    Coelho Neto, José

    2015-07-01

    Blotter paper is among the most common forms of consumption of new psychotropic substances (NPS), formerly referred as designer drugs. In many cases, users are misled to believe they are taking LSD when, in fact, they are taking newer and less known drugs like the NBOMEs or other substituted phenethylamines. We report our findings in quick testing of blotter papers for illicit substances like NBOMEs and other NPS by taking ATR-FTIR spectra directly from blotters seized on the streets, without any sample preparation. Both sides (front and back) of each blotter were tested. Collected data were analyzed by single- and multi-component spectral matching and submitted to chemometric discriminant analysis. Our results showed that, on 66.7% of the cases analyzed, seized blotters contained one or more types of NBOMEs, confirming the growing presence of this novel substances on the market. Matching IR signals were detected on both or just one side of the blotters and showed variable strength. Although no quantitative analysis was made, detection of these substances by the proposed approach serves as indication of variable and possibly higher dosages per blotter when compared to LSD, which showed to be below the detection limit of the applied method. Blotters containing a mescaline-like compound, later confirmed by GC-MS and LC-MS to be MAL (methallylescaline), a substance very similar to mescaline, were detected among the samples tested. Validity of direct ATR-FTIR testing was confirmed by checking the obtained results against independent GC-MS or LC-MS results for the same cases/samples.

  11. Passive mass transport for direct and quantitative SERS detection using purified silica encapsulated metal nanoparticles

    Science.gov (United States)

    Shrestha, Binaya Kumar

    This thesis focuses on understanding implications of nanomaterial quality control and mass transport through internally etched silica coated nanoparticles for direct and quantitative molecular detection using surface enhanced Raman scattering (SERS). Prior to use, bare nanoparticles (partially or uncoated with silica) are removal using column chromatography to improve the quality of these nanomaterials and their SERS reproducibility. Separation of silica coated nanoparticles with two different diameters is achieved using Surfactant-free size exclusion chromatography with modest fractionation. Next, selective molecular transport is modeled and monitored using SERS and evaluated as a function of solution ionic strength, pH, and polarity. Molecular detection is achieved when the analytes first partition through the silica membrane then interact with the metal surface at short distances (i.e., less than 2 nm). The SERS intensities of unique molecular vibrational modes for a given molecule increases as the number of molecules that bind to the metal surface increases and are enhanced via both chemical and electromagnetic enhancement mechanisms as long as the vibrational mode has a component of polarizability tensor along the surface normal. SERS signals increase linearly with molecular concentration until the three-dimensional SERS-active volume is saturated with molecules. Implications of molecular orientation as well as surface selection rules on SERS intensities of molecular vibrational modes are studied to improve quantitative and reproducible SERS detection using internally etched Ag Au SiO2 nanoparticles. Using the unique vibrational modes, SERS intensities for p-aminothiophenol as a function of metal core compositions and plasmonics are studied. By understanding molecular transport mechanisms through internally etched silica matrices coated on metal nanoparticles, important experimental and materials design parameters are learned, which can be subsequently applied

  12. Eye detection based on DirectShow%基于Di rectShow的人眼检测

    Institute of Scientific and Technical Information of China (English)

    万泉; 徐斌; 刘晓亮; 王元庆; 曹利群; 周必业; 李鸣皋

    2015-01-01

    To achieve the 3D stereoscopic displays watched by naked eyes based on non‐intrusive stereoscopic display technology , aiming at the eye location w hich is one of the key technologies of the 3D display by user tracker ,the eye detection based on Di‐rectShow was proposed .To implement the eye detection ,color detection ,AdaBoost and active shape model (ASM ) were com‐bined .And bifocal sight splicing technology was proposed to increase the longitudinal detection range of the eyes .The effects of data transmission ,hardware differences and synchronization on the application were eliminated by using DirectShow .The switch of the camera was completed with little change of the system ,and the least amount of Filter was used to implement the entire system .Finally ,the good effects on the aspects of the real‐time ,accuracy and the longitudinal detection range were validated by practical application .%为实现基于无侵扰立体显示技术的裸眼3D立体显示器,针对用户跟踪式立体显示(3D display by user tracker )关键技术之一的人眼定位,提出基于DirectShow 的人眼检测算法。通过将肤色检测、AdaBoost和主动变形模板(ASM )相结合,完成人眼位置检测的目的;提出双焦视距拼接技术,增加人眼检测的纵向探测范围;描述通过DirectShow消除数据传输、硬件差异、同步性对应用程序的影响的方法,在几乎不改变系统的情况下完成摄像头的切换,以最少的 Filter数量实现系统功能。通过实例验证了该方法在实时、精确和纵向探测范围几方面拥有良好效果。

  13. Transfer Entropy Estimation and Directional Coupling Change Detection in Biomedical Time Series

    Directory of Open Access Journals (Sweden)

    Lee Joon

    2012-04-01

    Full Text Available Abstract Background The detection of change in magnitude of directional coupling between two non-linear time series is a common subject of interest in the biomedical domain, including studies involving the respiratory chemoreflex system. Although transfer entropy is a useful tool in this avenue, no study to date has investigated how different transfer entropy estimation methods perform in typical biomedical applications featuring small sample size and presence of outliers. Methods With respect to detection of increased coupling strength, we compared three transfer entropy estimation techniques using both simulated time series and respiratory recordings from lambs. The following estimation methods were analyzed: fixed-binning with ranking, kernel density estimation (KDE, and the Darbellay-Vajda (D-V adaptive partitioning algorithm extended to three dimensions. In the simulated experiment, sample size was varied from 50 to 200, while coupling strength was increased. In order to introduce outliers, the heavy-tailed Laplace distribution was utilized. In the lamb experiment, the objective was to detect increased respiratory-related chemosensitivity to O2 and CO2 induced by a drug, domperidone. Specifically, the separate influence of end-tidal PO2 and PCO2 on minute ventilation (V˙E before and after administration of domperidone was analyzed. Results In the simulation, KDE detected increased coupling strength at the lowest SNR among the three methods. In the lamb experiment, D-V partitioning resulted in the statistically strongest increase in transfer entropy post-domperidone for PO2→V˙E. In addition, D-V partitioning was the only method that could detect an increase in transfer entropy for PCO2→V˙E, in agreement with experimental findings. Conclusions Transfer entropy is capable of detecting directional coupling changes in non-linear biomedical time series analysis featuring a small number of observations and presence of outliers. The results

  14. Transfer entropy estimation and directional coupling change detection in biomedical time series.

    Science.gov (United States)

    Lee, Joon; Nemati, Shamim; Silva, Ikaro; Edwards, Bradley A; Butler, James P; Malhotra, Atul

    2012-04-13

    The detection of change in magnitude of directional coupling between two non-linear time series is a common subject of interest in the biomedical domain, including studies involving the respiratory chemoreflex system. Although transfer entropy is a useful tool in this avenue, no study to date has investigated how different transfer entropy estimation methods perform in typical biomedical applications featuring small sample size and presence of outliers. With respect to detection of increased coupling strength, we compared three transfer entropy estimation techniques using both simulated time series and respiratory recordings from lambs. The following estimation methods were analyzed: fixed-binning with ranking, kernel density estimation (KDE), and the Darbellay-Vajda (D-V) adaptive partitioning algorithm extended to three dimensions. In the simulated experiment, sample size was varied from 50 to 200, while coupling strength was increased. In order to introduce outliers, the heavy-tailed Laplace distribution was utilized. In the lamb experiment, the objective was to detect increased respiratory-related chemosensitivity to O2 and CO2 induced by a drug, domperidone. Specifically, the separate influence of end-tidal PO2 and PCO2 on minute ventilation (V˙E) before and after administration of domperidone was analyzed. In the simulation, KDE detected increased coupling strength at the lowest SNR among the three methods. In the lamb experiment, D-V partitioning resulted in the statistically strongest increase in transfer entropy post-domperidone for PO2 → VE. In addition, D-V partitioning was the only method that could detect an increase in transfer entropy for PCO2 → VE, in agreement with experimental findings. Transfer entropy is capable of detecting directional coupling changes in non-linear biomedical time series analysis featuring a small number of observations and presence of outliers. The results of this study suggest that fixed-binning, even with ranking, is

  15. Detection by ELISA of bluetongue antigen directly in the blood of experimentally infected sheep.

    Science.gov (United States)

    Stanislawek, W L; Lunt, R A; Blacksell, S D; Newberry, K M; Hooper, P T; White, J R

    1996-09-01

    An antigen-capture ELISA (Ag-ELISA) was developed to detect bluetongue virus (BTV) antigen directly from blood samples. Four blood preparations [whole blood, buffy coat, washed red blood cells (RBC) and plasma] taken pre-inoculation and on days 6 to 9 post-inoculation (PI) were used in the ELISA to study antigenaemia in forty sheep, each experimentally infected with one of 20 South African BTV serotypes. Seventeen of the 20 serotypes were detected and 27 of the 40 sheep were at some stage Ag-ELISA positive. Over the period of sampling, Ag-ELISA positive results were most frequently returned from whole blood taken on days 6 and 7 PI. However in some instances the quantity and/or duration of BTV antigenaemia was greater in buffy coat and washed RBC preparations. In a selection of samples examined, positive Ag-ELISA results were generally obtained when samples had an infectious virus titre in eggs of > 10(3.2) egg lethal doses (ELD50/ml). The appearance and duration of detectable antigenaemia was compared with the development of clinical signs and antibody responses of infected sheep. On days 6 and 7 PI the presence of fever (> 40 degrees C) was indicative to the likelihood of detectable antigenaemia. After day 5 PI antigenaemia declined and clinical signs of swollen face and inflamed feet appeared together with the first detectable antibody response. The Ag-ELISA, when used in conjunction with clinical observations and serologic data, should be useful as a rapid diagnostic procedure for bluetongue disease.

  16. Rapid detection of haloarchaeal carotenoids via liquid-liquid microextraction enabled direct TLC MALDI-MS.

    Science.gov (United States)

    Manikandan, Muthu; Hasan, Nazim; Wu, Hui-Fen

    2013-03-30

    For the first time, we demonstrate the use of TiO2 nanoparticles (NPs) for enhancing the carotenoid production by the extremophilic haloarchea, Haloferax mediterranei. TiO2 NPs at optimal concentration of 375 mg/L results in a 95% increase in the production of carotenoid pigment compared to the control (no TiO2 NPs). The carotenoid pigments extracted from TiO2 NPs treated H. mediterranei cells, were separated using thin layer chromatography (TLC). The separated carotenoid spots were subjected directly for MALDI MS detection. To limit the sample diffusion during matrix addition on TLC plates, a simple bordering mode was exercised. Using this method we were able to detect the pigments successfully using MALDI-MS, directly from TLC plates after separation. In addition, we also applied the Pt NPs capped with ODT via Liquid-liquid microextraction (LLME) for extracting the pigment molecules from the halobacteria in MALDI-MS. These novel NP approaches possess numerous advantages such as; rapidity, ease in synthesis, high sensitivity and low cost. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Leptophilic Dark Matter in Direct Detection Experiments and in the Sun

    Energy Technology Data Exchange (ETDEWEB)

    Kopp, Joachim; Niro, Viviana; Schwetz, Thomas; Zupan, Jure

    2010-11-01

    Dark matter interacting predominantly with leptons instead of nuclear matter has received a lot of interest recently. In this talk, we investigate the signals expected from such 'leptophilic Dark Matter' in direct detection experiments and in experiments looking for Dark Matter annihilation into neutrinos in the Sun. In a model-independent framework, we calculate the expected interaction rates for different scattering processes, including elastic and inelastic scattering off atomic electron shells, as well as loop-induced scattering off atomic nuclei. In those cases where the last effect dominates, leptophilic Dark Matter cannot be distinguished from conventional WIMPs. On the other hand, if inelastic scattering off the electron shell dominates, the expected event spectrum in direct detection experiments is different and would provide a distinct signal. However, we find that the signals in DAMA and/or CoGeNT cannot be explained by invoking leptophilic DM because the predicted and observed energy spectra do not match, and because of neutrino bounds from the Sun.

  18. Detection without deflection? A hypothesis for direct sensing of sound pressure by hair cells

    Indian Academy of Sciences (India)

    Andrew Bell

    2007-03-01

    It is widely thought that organisms detect sound by sensing the deflection of hair-like projections, the stereocilia, at the apex of hair cells. In the case of mammals, the standard interpretation is that hair cells in the cochlea respond to deflection of stereocilia induced by motion generated by a hydrodynamic travelling wave. But in the light of persistent anomalies, an alternative hypothesis seems to have some merit: that sensing cells (in particular the outer hair cells) may, at least at low intensities, be reacting to a different stimulus – the rapid pressure wave that sweeps through the cochlear fluids at the speed of sound in water. This would explain why fast responses are sometimes seen before the peak of the travelling wave. Yet how could cells directly sense fluid pressure? Here, a model is constructed of the outer hair cell as a pressure vessel able to sense pressure variations across its cuticular pore, and this ‘fontanelle’ model, based on the sensing action of the basal body at this compliant spot, could explain the observed anomalies. Moreover, the fontanelle model can be applied to a wide range of other organisms, suggesting that direct pressure detection is a general mode of sensing complementary to stereociliar displacement.

  19. Simplified Dark Matter Models with Charged Mediators: Prospects for Direct Detection

    CERN Document Server

    Sandick, Pearl; Teng, Fei

    2016-01-01

    We consider direct detection prospects for a class of simplified models of fermionic dark matter (DM) coupled to left and right-handed Standard Model fermions via two charged scalar mediators with arbitrary mixing angle $\\alpha$. DM interactions with the nucleus are mediated by higher electromagnetic moments, which, for Majorana DM, is the anapole moment. After giving a full analytic calculation of the anapole moment, including its $\\alpha$ dependence, and matching with limits in the literature, we compute the DM-nucleon scattering cross-section and show the LUX and future LZ constraints on the parameter space of these models. We then compare these results with constraints coming from $Fermi$-LAT continuum and line searches. Results in the supersymmetric limit of these simplified models are provided in all cases. We find that future direct detection experiments will be able to probe most of the parameter space of these models for $\\mathcal{O}(100-200)$ GeV DM and lightest mediator mass $\\lesssim \\mathcal{O}(5...

  20. On the Existence of Low-Mass Dark Matter and its Direct Detection

    CERN Document Server

    Bateman, James; Merle, Alexander; Morris, Tim R; Ulbricht, Hendrik

    2014-01-01

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM $\\chi$ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of...

  1. Dark Matter Mass Constrained by the Relic Abundance, Direct Detections, and Colliders

    CERN Document Server

    Tsai, Ho-Chin

    2013-01-01

    We take into account a generic form of a Dirac fermionic dark matter (DM), which communicates with the Standard Model quarks via a scalar mediator, in a model-independent way. Four special interaction scenarios are investigated, where one is parity conserving and the other three are parity violating. Three of them result in the $v$ suppressed DM-nucleon cross sections, where $v \\sim 10^{-3} c$ is the velocity of the DM in the laboratory frame. We constrain the masses of the dark matter and mediator as well as the couplings from the thermal relic abundance, and the recent results of the XENON100 direct detection and collider experiments involving the two channels: (i) monojet plus large missing transverse energy, and (ii) dijet. The current monojet constraint is not stronger than that from the requirement of the correct relic density and the null result by the XENON100 direct detection. We find that the dijet resonance measurements can exclude a large portion of the parameter space $(m_\\chi, m_Y)$, where the c...

  2. The impact of baryons on the direct detection of dark matter

    CERN Document Server

    Kelso, Chris; Valluri, Monica; Freese, Katherine; Stinson, Gregory S; Bailin, Jeremy

    2016-01-01

    The spatial and velocity distributions of dark matter particles in the Milky Way Halo affect the signals expected to be observed in searches for dark matter. Results from direct detection experiments are often analyzed assuming a simple isothermal distribution of dark matter, the Standard Halo Model (SHM). Yet there has been skepticism regarding the validity of this simple model due to the complicated gravitational collapse and merger history of actual galaxies. In this paper we compare the SHM to the results of cosmological hydrodynamical simulations of galaxy formation to investigate whether or not the SHM is a good representation of the true WIMP distribution in the analysis of direct detection data. We examine two Milky Way-like galaxies from the MaGICC cosmological simulations (a) with dark matter only and (b) with baryonic physics included. The inclusion of baryons drives the shape of the DM halo to become more spherical and makes the velocity distribution of dark matter particles less anisotropic espec...

  3. Turbine Reliability and Operability Optimization through the use of Direct Detection Lidar Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, David K; Lewis, Matthew J; Pavlich, Jane C; Wright, Alan D; Johnson, Kathryn E; Pace, Andrew M

    2013-02-01

    The goal of this Department of Energy (DOE) project is to increase wind turbine efficiency and reliability with the use of a Light Detection and Ranging (LIDAR) system. The LIDAR provides wind speed and direction data that can be used to help mitigate the fatigue stress on the turbine blades and internal components caused by wind gusts, sub-optimal pointing and reactionary speed or RPM changes. This effort will have a significant impact on the operation and maintenance costs of turbines across the industry. During the course of the project, Michigan Aerospace Corporation (MAC) modified and tested a prototype direct detection wind LIDAR instrument; the resulting LIDAR design considered all aspects of wind turbine LIDAR operation from mounting, assembly, and environmental operating conditions to laser safety. Additionally, in co-operation with our partners, the National Renewable Energy Lab and the Colorado School of Mines, progress was made in LIDAR performance modeling as well as LIDAR feed forward control system modeling and simulation. The results of this investigation showed that using LIDAR measurements to change between baseline and extreme event controllers in a switching architecture can reduce damage equivalent loads on blades and tower, and produce higher mean power output due to fewer overspeed events. This DOE project has led to continued venture capital investment and engagement with leading turbine OEMs, wind farm developers, and wind farm owner/operators.

  4. Signatures of Earth-scattering in the direct detection of Dark Matter

    CERN Document Server

    Kavanagh, Bradley J; Kouvaris, Chris

    2016-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation of this `Earth-scattering' effect in the regime where DM particles scatter at most once before reaching the detector. We perform the calculation self-consistently, taking into account not only those particles which are scattered away from the detector, but also those particles which are deflected towards the detector. Taking into account a realistic model of the Earth and allowing for a range of DM-nucleon interactions, we present the EarthShadow code, which we make publicly available, for calculating the DM velocity distribution after Earth-scattering. Focusing on low-mass DM, we find that Earth-scattering reduces the direct detection rate at certain detector locations while increasing the rate in others. The Earth's ro...

  5. On the existence of low-mass dark matter and its direct detection.

    Science.gov (United States)

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R; Ulbricht, Hendrik

    2015-01-27

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too.

  6. Blind symbol synchronization for direct detection optical OFDM using a reduced number of virtual subcarriers.

    Science.gov (United States)

    Bouziane, R; Killey, R I

    2015-03-09

    Symbol synchronization constitutes a major component in optical OFDM transceivers. In this paper, we propose reducing the complexity of a blind symbol synchronization technique for direct detection OFDM receivers based on virtual subcarriers by optimizing the number and location of the virtual subcarriers. Compared to the system design in our previous study, this new technique offers a reduction of 92% in the number of virtual subcarriers (from 26 to 2 in a system with 50 data carrying subchannels) resulting in significant savings in complexity with a minimal penalty. Moreover, it offers an increase in the system capacity as more subcarriers can be used to transmit data. The technique was assessed experimentally using a transmission system of direct detection 16-QAM optical OFDM operating at a data rate of 30.65 Gb/s over 23.3 km SSMF with BER of 10(-3). Negligible penalty was observed at high received powers. However, at low received powers, the number of averaging symbols had to be increased in order to improve the robustness of the method.

  7. What can(not) be measured with ton-scale dark matter direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Pato, Miguel, E-mail: migpato@physik.uzh.ch [Institute for Theoretical Physics, University of Zürich, Winterthurerstrasse 190, CH-8057 (Switzerland)

    2011-10-01

    Direct searches for dark matter have prompted in recent years a great deal of excitement within the astroparticle physics community, but the compatibility between signal claims and null results of different experiments is far from being a settled issue. In this context, we study here the prospects for constraining the dark matter parameter space with the next generation of ton-scale detectors. Using realistic experimental capabilities for a wide range of targets (including fluorine, sodium, argon, germanium, iodine and xenon), the role of target complementarity is analysed in detail while including the impact of astrophysical uncertainties in a self-consistent manner. We show explicitly that a multi-target signal in future direct detection facilities can determine the sign of the ratio of scalar couplings f{sub n}/f{sub p}, but not its scale. This implies that the scalar-proton cross-section is left essentially unconstrained if the assumption f{sub p} ∼ f{sub n} is relaxed. Instead, we find that both the axial-proton cross-section and the ratio of axial couplings a{sub n}/a{sub p} can be measured with fair accuracy if multi-ton instruments using sodium and iodine will eventually come online. Moreover, it turns out that future direct detection data can easily discriminate between elastic and inelastic scatterings. Finally, we argue that, with weak assumptions regarding the WIMP couplings and the astrophysics, only the dark matter mass and the inelastic parameter (i.e. mass splitting) may be inferred from the recoil spectra — specifically, we anticipate an accuracy of tens of GeV (tens of keV) in the measurement of the dark matter mass (inelastic parameter)

  8. GEM-based TPC with CCD imaging for directional dark matter detection

    Science.gov (United States)

    Phan, N. S.; Lauer, R. J.; Lee, E. R.; Loomba, D.; Matthews, J. A. J.; Miller, E. H.

    2016-11-01

    The most mature directional dark matter experiments at present all utilize low-pressure gas Time Projection Chamber (TPC) technologies. We discuss some of the challenges for this technology, for which balancing the goal of achieving the best sensitivity with that of cost effective scale-up requires optimization over a large parameter space. Critical for this are the precision measurements of the fundamental properties of both electron and nuclear recoil tracks down to the lowest detectable energies. Such measurements are necessary to provide a benchmark for background discrimination and directional sensitivity that could be used for future optimization studies for directional dark matter experiments. In this paper we describe a small, high resolution, high signal-to-noise GEM-based TPC with a 2D CCD readout designed for this goal. The performance of the detector was characterized using alpha particles, X-rays, gamma-rays, and neutrons, enabling detailed measurements of electron and nuclear recoil tracks. Stable effective gas gains of greater than 1 × 105 were obtained in 100 Torr of pure CF4 by a cascade of three standard CERN GEMs each with a 140 μm pitch. The high signal-to-noise and sub-millimeter spatial resolution of the GEM amplification and CCD readout, together with low diffusion, allow for excellent background discrimination between electron and nuclear recoils down below ∼10 keVee (∼23 keVr fluorine recoil). Even lower thresholds, necessary for the detection of low mass WIMPs for example, might be achieved by lowering the pressure and utilizing full 3D track reconstruction. These and other paths for improvements are discussed, as are possible fundamental limitations imposed by the physics of energy loss.

  9. Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD)

    Science.gov (United States)

    Generazio, Edward R.

    2015-01-01

    Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD) Manual v.1.2 The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Design of experiments for validating probability of detection capability of nondestructive evaluation (NDE) systems (DOEPOD) is a methodology that is implemented via software to serve as a diagnostic tool providing detailed analysis of POD test data, guidance on establishing data distribution requirements, and resolving test issues. DOEPOD demands utilization of observance of occurrences. The DOEPOD capability has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit-Miss or signal amplitude testing. DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required. DOEPOD applications for supporting inspector qualifications is included.

  10. Using a CCD for the direct detection of electrons in a low energy space plasma spectrometer

    Science.gov (United States)

    Bedington, R.; Kataria, D.; Walton, D.

    2012-01-01

    An E2V CCD64 back-illuminated, ion-implanted CCD (charge-coupled device) has been used as a direct electron imaging detector with CATS (Conceptual And Tiny Spectrometer), a highly miniaturised prototype plasma analyser head. This is in place of an MCP (microchannel plate) with a position sensing anode which would more conventionally be used as a detector in traditional low energy space plasma analyser instruments. The small size of CATS however makes it well matched to the size of the CCD, and the ion implants reduce the depth of the CCD backside electron potential well making it more sensitive to lower energy electrons than standard untreated silicon. Despite ionisation damage from prolonged exposure to excessively energetic electrons, the CCD has been able to detect electrons with energies above 500eV, at temperatures around room temperature. Using both a long integration 'current measuring' mode and a short integration `electron counting' mode it has been used to image the low energy electrons exiting the analyser, enhancing our understanding of the CATS electrostatic optics. The CCD has been selected as the detector for use with CATS for an instrument on a low-altitude student sounding rocket flight. Although it cannot detect the lowest energy electrons that an MCP can detect, and it is more sensitive to stray light, the low voltages required, the lack of vacuum requirements and its novelty and availability made it the most attractive candidate detector.

  11. Spectroscopic direct detection of reflected light from extra-solar planets

    CERN Document Server

    Martins, Jorge H C; Santos, Nuno; Lovis, Christophe

    2013-01-01

    At optical wavelengths, an exoplanet's signature is essentially reflected light from the host star - several orders of magnitude fainter. Since it is superimposed on the star spectrum its detection has been a difficult observational challenge. However, the development of a new generation of instruments like ESPRESSO and next generation telescopes like the E-ELT put us in a privileged position to detect these planets' reflected light as we will have access to extremely high signal-to-noise ratio spectra. With this work, we propose an alternative approach for the direct detection of the reflected light of an exoplanet. We simulated observations with ESPRESSO@VLT and HIRES@E-ELT of several star+planet systems, encompassing 10h of the most favourable orbital phases. To the simulated spectra we applied the Cross Correlation Function to operate in a much higher signal-to-noise ratio domain than when compared with the spectra. The use of the Cross-Correlation Function permitted us to recover the simulated the planet...

  12. Multiplex PCR for colony direct detection of Gram-positive histamine- and tyramine-producing bacteria.

    Science.gov (United States)

    Coton, Emmanuel; Coton, Monika

    2005-12-01

    Formation of biogenic amines (BA) may occur in fermented foods and beverages due to the amino acid decarboxylase activities of Gram-positive bacteria. These compounds may cause food poisoning and therefore could imply food exportation problems. A set of consensual primers based on histidine decarboxylase gene (hdc) sequences of different bacteria was designed for the detection of histamine-producing Gram-positive bacteria. A multiplex PCR based on these hdc primers and recently designed primers targeting the tyrosine decarboxylase (tyrdc) gene was created. A third set of primers targeting the 16S rRNA gene of eubacteria was also used as an internal control. This multiplex PCR was performed on extracted DNA as well as directly on cell colonies. The results obtained show that this new molecular tool allowed for the detection of Gram-positive histamine- and/or tyramine-producing bacteria. The use of this molecular tool for early and rapid detection of Gram-positive BA-producing bacteria is of interest in evaluating the potential of cultured indigenous strains to produce biogenic amines in a fermented food product as well as to validate the innocuity of potential starter strains in the food industry.

  13. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    Directory of Open Access Journals (Sweden)

    Jnnifer A. Sánchez

    2015-09-01

    Full Text Available Bacillus cereus is a food contaminant anda known human pathogen that can causeemetic and diarrheal syndromes. In this studywe evaluated the presence of toxigenic B.cereus by multiplex PCR directly in dietarycomplement for children and cassava starchsamples collected on Medellin, Colombia.Of 75 dietary complement for childrensamples evaluated, 70.7% were contaminatedwith toxigenic B. cereus and four differenttoxigenic consortia were detected: I: nheA,hblC, cytK (9.8%, II: nheA, hblC (2%,III: hblC, cytK (41.2%, IV: hblC (47%.Of 75 cassava starch samples, 44% werecontaminated with toxigenic B. cereus andfour different toxigenic consortia weredetermined: I: nheA, hblC, cytK (48.5%,II: nheA, hblC, cytK, cesB (3%, III: hblC,cytK (30.3%, IV: hblC (18.2%. In general,in dietary complement for children onlyenterotoxigenic consortia were detectedwhile in cassava starch the enterotoxigenicconsortia predominated over the emetic.Multiplex PCR was useful to detect toxigenicB. cereus contamination allowing directand simultaneous detection of all toxingenes in foods. This study is the first inColombia to evaluate toxigenic B. cereus,providing information of importance formicrobiological risk evaluation in driedfoods.

  14. Direct determination of amino acids and carbohydrates by high-performance capillary electrophoresis with refractometric detection.

    Science.gov (United States)

    Ivano, A R; Nazimov, I V; Lobazov, A P; Popkovich, G B

    2000-10-13

    This is an initial report to propose a novel approach in high-performance capillary electrophoresis (HPCE) for the direct detection of compounds without natural absorbance in the UV and visible spectral range, such as amino acids and carbohydrates. A refractometry detector with the 2 nl cell (Applied Systems, Minsk, Belarus) was employed to identify amino acids and carbohydrates without derivatization. The first results are provided on separation of seven free amino acids in the phosphate running buffer and three free carbohydrates in the borate-sodium dodecyl sulfate running buffer and detection by refractometer. Fused capillaries of 50 or 75 microm internal diameter and separation voltage (10-23 kV) were applied. Detection limits ranged typically from 10 to 100 fmol and the response was linear over two orders of magnitude for most of the amino acids and carbohydrates. The HPCE system demonstrated good long-term stability and reproducibility with a relative standard deviation, less than 5% for the migration time (n=10).

  15. Detection of particle flow patterns in tumor by directional spatial frequency analysis

    Science.gov (United States)

    Russell, Stewart; Camara, Hawa; Shi, Lingyan; Hoopes, P. Jack; Kaufman, Peter; Pogue, Brian; Alfano, Robert

    2016-04-01

    Drug delivery to tumors is well known to be chaotic and limited, partly from dysfunctional vasculature, but also because of microscopic regional variations in composition. Modeling the of transport of nanoparticle therapeutics, therefore must include not only a description of vascular permeability, but also of the movement of the drug as suspended in tumor interstitial fluid (TIF) once it leaves the blood vessel. Understanding of this area is limited because we currently lack the tools and analytical methods to characterize it. We have previously shown that directional anisotropy of drug delivery can be detected using Directional Fourier Spatial Frequency (DFSF) Analysis. Here we extend this approach to generate flow line maps of nanoparticle transport in TIF relative to tumor ultrastructure, and show that features of tumor spatial heterogeneity can be identified that are directly related to local flow isometries. The identification of these regions of limited flow may be used as a metric for determining response to therapy, or for the optimization of adjuvant therapies such as radiation pre-treatment, or enzymatic degradation.

  16. GEM-based TPC with CCD Imaging for Directional Dark Matter Detection

    CERN Document Server

    Phan, N S; Lee, E R; Loomba, D; Matthews, J A J; Miller, E H

    2015-01-01

    Directional dark matter detection will require scale-ups to large volumes if low-pressure gas Time Projection Chambers (TPCs) are the only viable technology. We discuss some of the challenges for this technology, where balancing the goal of achieving the best sensitivity with that of cost effective scale-up requires an optimization over a large parameter space. Critical for this are the precision measurements of the fundamental properties of both electron and nuclear recoil tracks down to the lowest energies. Such measurements would provide a benchmark for background discrimination and directional sensitivity that could be used for future optimization studies for directional dark matter experiments. In this paper we describe a small, high resolution, high signal-to-noise GEM-based TPC with a 2D CCD readout designed for this goal. The performance of the detector was characterized using X-rays, gamma-rays, and neutrons, enabling detailed measurements of electron and nuclear recoil tracks. Stable effective gas g...

  17. Detection of the Magnetic Easy Direction in Steels Using Induced Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Edgard M. Silva

    2016-12-01

    Full Text Available Conventional manufacturing processes cause plastic deformation that leads to magnetic anisotropy in processed materials. A deeper understanding of materials characterization under rotational magnetization enables engineers to optimize the overall volume, mass, and performance of devices such as electrical machines in industry. Therefore, it is important to find the magnetic easy direction of the magnetic domains in a simple and straightforward manner. The Magnetic easy direction can be obtained through destructive tests such as the Epstein frame method and the Single Sheet Tester by taking measurements in regions of irreversible magnetization usually called domains. In the present work, samples of rolled SAE 1045 steel (formed by perlite and ferrite microstructures were submitted to induced magnetic fields in the reversibility region of magnetic domains to detect the magnetic easy direction. The magnetic fields were applied to circular samples with different thicknesses and angles varying from 0° to 360° with steps of 45°. A square sample with a fixed thickness was also tested. The results showed that the proposed non-destructive approach is promising to evaluate the magnetic anisotropy in steels independently of the geometry of the sample. The region studied presented low induction losses and was affected by magnetic anisotropy, which did not occur in other works that only took into account regions of high induction losses.

  18. Optimal level of Au nanoparticles on Pd nanostructures providing remarkable electro-catalysis in direct ethanol fuel cell

    Science.gov (United States)

    Dutta, Abhijit; Mondal, Achintya; Broekmann, Peter; Datta, Jayati

    2017-09-01

    The designing and fabrication of economically viable electro-catalysts for ethanol oxidation reaction (EOR) in direct ethanol fuel cell (DEFC) has been one of the challenging issues over the decades. The present work deals with controlled synthesis of Pd coupled Au nano structure, as the non Pt group of catalysts for DEFC. The catalytic proficiency of bimetallic NPs (2-10 nm) are found to be strongly dependent on the Pd:Au ratio. The over voltage of EOR is considerably reduced by ∼260 mV with 33% of Au content in PdAu composition compared to Pd alone, demonstrating the beneficial role of Au and/or its surface oxides providing oxygen species at much lower potentials compared to Pd. The catalysts are further subjected to electrochemical analysis through voltammetry along with the temperature study on activation parameters. The quantitative determination of EOR products during the electrolysis is carried out by ion chromatographic analysis; vis-a-vis the coulombic efficiency of the product yield were derived from each of the compositions. Furthermore, a strong correlation among catalytic performances and bimetallic composition is established by screening the catalysts in an in-house fabricated direct ethanol anion exchange membrane fuel cell, DE(AEM)FC. The performance testing demonstrates outstanding increase of peak power density (∼40 mWcm-2, 93%) for the best accomplishment Au (33%) covered Pd (67%) catalyst in comparison with the monometallic Pd.

  19. Direct electrochemistry and electrocatalysis of a glucose oxidase-functionalized bioconjugate as a trace label for ultrasensitive detection of thrombin.

    Science.gov (United States)

    Bai, Lijuan; Yuan, Ruo; Chai, Yaqin; Yuan, Yali; Wang, Yan; Xie, Shunbi

    2012-11-18

    For the first time, a glucose oxidase-functionalized bioconjugate was prepared and served as a new trace label through its direct electrochemistry and electrocatalysis in a sandwich-type electrochemical aptasensor for ultrasensitive detection of thrombin.

  20. Directed Design of Experiments for Validating Probability of Detection Capability of a Testing System

    Science.gov (United States)

    Generazio, Edward R. (Inventor)

    2012-01-01

    A method of validating a probability of detection (POD) testing system using directed design of experiments (DOE) includes recording an input data set of observed hit and miss or analog data for sample components as a function of size of a flaw in the components. The method also includes processing the input data set to generate an output data set having an optimal class width, assigning a case number to the output data set, and generating validation instructions based on the assigned case number. An apparatus includes a host machine for receiving the input data set from the testing system and an algorithm for executing DOE to validate the test system. The algorithm applies DOE to the input data set to determine a data set having an optimal class width, assigns a case number to that data set, and generates validation instructions based on the case number.

  1. Direct detection of resonant electron pitch angle scattering by whistler waves in a laboratory plasma.

    Science.gov (United States)

    Van Compernolle, B; Bortnik, J; Pribyl, P; Gekelman, W; Nakamoto, M; Tao, X; Thorne, R M

    2014-04-11

    Resonant interactions between energetic electrons and whistler mode waves are an essential ingredient in the space environment, and in particular in controlling the dynamic variability of Earth's natural radiation belts, which is a topic of extreme interest at the moment. Although the theory describing resonant wave-particle interaction has been present for several decades, it has not been hitherto tested in a controlled laboratory setting. In the present Letter we report on the first laboratory experiment to directly detect resonant pitch angle scattering of energetic (∼keV) electrons due to whistler mode waves. We show that the whistler mode wave deflects energetic electrons at precisely the predicted resonant energy, and that varying both the maximum beam energy, and the wave frequency, alters the energetic electron beam very close to the resonant energy.

  2. FARADAY CUP AWARD: High Sensitivity Tune Measurement using Direct Diode Detection

    CERN Document Server

    Gasior, M

    2012-01-01

    Direct Diode Detection (3D) is a technique developed at CERN initially for the LHC tune measurement system, to reach a sensitivity allowing observation of beam betatron oscillations with amplitudes below a micrometre. In this technique simple peak diode detectors are used to convert short beam pulses from a beam position pick-up into slowly varying signals. Their DC components, constituting a large background related to beam offsets, are suppressed by series capacitors, while the small signals related to beam oscillations are passed to the subsequent stages for amplification and filtering. As the demodulated beam oscillation signals are already in the kHz range, their processing is simple and they can be digitised with high resolution audio ADCs. This paper presents the history as well as the adventures of the 3D development and prototyping, along with some technical details. It documents a very efficient collaboration between CERN and Brookhaven National Laboratory (BNL), with contributions from other labora...

  3. A detection system to measure muon-induced neutrons for direct dark matter searches

    Energy Technology Data Exchange (ETDEWEB)

    Kozlov, V.Yu.; Chantelauze, A.; Kluck, H.; Eitel, K. [Karlsruhe Institute of Technology, Institut fuer Kernphysik, Postfach 3640, 76021 Karlsruhe (Germany); Armengaud, E.; Besida, O.; Gerbier, G.; Gros, M.; Hannawald, M.; Herve, S.; Lemrani, R.; Navick, X.F.; Paul, B.; Torrento-Coello, A.S. [CEA, Centre d' Etudes Nucleaires de Saclay, IRFU, 91191 Gif-sur-Yvette Cedex (FR); Augier, C.; Charlieux, F.; De Jesus, M.; Di Stefano, P.; Gascon, J.; Juillard, A.; Sanglard, V.; Scorza, S.; Vagneron, L.; Verdier, M.A. [Institut de Physique Nucleaire de Lyon, Universite de Lyon - Universite Claude Bernard Lyon 1 et IN2P3-CNRS, 4 rue Enrico Fermi, 69622 Villeurbanne (FR); Benoit, A. [Institut Neel, CNRS, 25 Avenue des Martyrs, 38042 Grenoble Cedex 9 (FR); Berge, L.; Broniatowski, A.; Chapellier, M.; Chardin, G.; Collin, S.; Defay, X.; Dolgorouki, Y.; Dumoulin, L.; Marnieros, S.; Olivieri, E. [Centre de Spectroscopie Nucleaire et de Spectroscopie de Masse, UMR8609 IN2P3-CNRS, Univ. Paris Sud, bat 108, 91405 Orsay Campus (FR); Bluemer, J. [Karlsruhe Institute of Technology, Institut fuer Kernphysik, Postfach 3640, 76021 Karlsruhe (Germany); Karlsruhe Institute of Technology, Institut fuer Experimentelle Kernphysik, Gaedestr. 1, 76128 Karlsruhe (Germany); Brudanin, V.; Lubashevskiy, A.; Rozov, S.; Semikh, S.; Yakushev, E. [Laboratory of Nuclear Problems, JINR, Joliot-Curie 6, 141980 Dubna, Moscow Region (RU); Domange, J. [CEA, Centre d' Etudes Nucleaires de Saclay, IRFU, 91191 Gif-sur-Yvette Cedex (FR); Centre de Spectroscopie Nucleaire et de Spectroscopie de Masse, UMR8609 IN2P3-CNRS, Univ. Paris Sud, bat 108, 91405 Orsay Campus (FR); Loaiza, P. [Laboratoire Souterrain de Modane, CEA-CNRS, 1125 route de Bardonneche, 73500 Modane (FR); Pari, P. [CEA, Centre d' Etudes Nucleaires de Saclay, IRAMIS, 91191 Gif-sur-Yvette Cedex (FR)

    2010-07-01

    Muon-induced neutrons constitute a prominent background component in a number of low count rate experiments, namely direct searches for dark matter. In this work we describe a neutron detector to measure this background in an underground laboratory, the Laboratoire Souterrain de Modane. The system is based on 1 m{sup 3} of Gd-loaded scintillator and it is linked with the muon veto of the EDELWEISS-II experiment for coincident muon detection. The system was installed in autumn 2008 and passed since then a number of commissioning tests proving its full functionality. The data-taking is continuously ongoing and a count rate of the order of 1 muon-induced neutron per day has been achieved. (authors)

  4. Fiber-optic Michelson interferometer fixed in a tilted tube for direction-dependent ultrasonic detection

    Science.gov (United States)

    Gang, Tingting; Hu, Manli; Qiao, Xueguang; Li, JiaCheng; Shao, Zhihua; Tong, Rongxin; Rong, Qiangzhou

    2017-01-01

    A fiber-optic interferometer is proposed and demonstrated experimentally for ultrasonic detection. The sensor consists of a compact Michelson interferometer (MI), which is fixed in a tilted-tube end-face (45°). Thin gold films are used for the reflective coatings of two arms and one of the interference arms is etched serving as the sensing arm. The spectral sideband filter technique is used to interrogate the continuous and pulse ultrasonic signals (with frequency of 300 KHz). Furthermore, because of the asymmetrical structure of the sensor, it presents strong direction-dependent ultrasonic sensitivity, such that the sensor can be considered a vector detector. The experimental results show that the sensor is highly sensitive to ultrasonic signals, and thus it can be a candidate for ultrasonic imaging of seismic physical models.

  5. Effects of nuclear deformation on the form factor for direct dark matter detection

    Institute of Scientific and Technical Information of China (English)

    CHEN Ya-Zheng; CHEN Jun-Mou; LUO Yan-An; SHEN Hong; LI Xue-Qian

    2012-01-01

    For the detection of direct dark matter,in order to extract useful information about the fundamental interactions from the data,it is crucial to properly determine the nuclear form factor.The form factor for the spin-independent cross section of collisions between dark matter particles and the nucleus has been thoroughly studied by many authors.When the analysis was carried out,the nuclei were always supposed to be spherically symmetric.In this work,we investigate the effects of the deformation of nuclei from a spherical shape to an elliptical one on the form factor.Our results indicate that as long as the ellipticity is not too large,such deformation will not cause any substantial effects.In particular,when the nuclei are randomly orientated in room-temperature circumstances,one can completely neglect them.

  6. MIMAC : A micro-tpc matrix for directional detection of dark matter

    CERN Document Server

    Santos, D; Bosson, G; Bouly, J L; Bourrion, O; Fourel, Ch; Grignon, C; Guillaudin, O; Mayet, F; Richer, J P; Delbart, A; Ferrer, E; Giomataris, I; Iguaz, F J; Mols, J P; Golabek, C; Lebreton, L

    2011-01-01

    Directional detection of non-baryonic Dark Matter is a promising search strategy for discriminating WIMP events from background. However, this strategy requires both a precise measurement of the energy down to a few keV and 3D reconstruction of tracks down to a few mm. To achieve this goal, the MIMAC project has been developed. It is based on a gaseous micro-TPC matrix, filled with CF4 and CHF3. The first results on low energy nuclear recoils (H, F) obtained with a low mono-energetic neutron field are presented. The discovery potential of this search strategy is discussed and illustrated by a realistic case accessible to MIMAC.

  7. MIMAC: A micro-tpc matrix for directional detection of dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Santos, D; Billard, J; Bosson, G; Bouly, J L; Bourrion, O; Fourel, Ch; Grignon, C; Guillaudin, O; Mayet, F; Richer, J P [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble (France); Delbart, A; Ferrer, E; Giomataris, I; Iguaz, F J; Mols, J P [IRFU,CEA Saclay, 91191 Gif-sur-Yvette cedex (France); Golabek, C; Lebreton, L, E-mail: Daniel.Santos@lpsc.in2p3.fr [LMDN, IRSN Cadarache, 13115 Saint-Paul-Lez-Durance (France)

    2011-08-10

    Directional detection of non-baryonic Dark Matter is a promising search strategy for discriminating WIMP events from background. However, this strategy requires both a precise measurement of the energy down to a few keV and 3D reconstruction of tracks down to a few mm. To achieve this goal, the MIMAC project has been developed. It is based on a gaseous micro-TPC matrix, filled with CF{sub 4} and CHF{sub 3}. The first results on low energy nuclear recoils ({sup 1}H and {sup 19}F) obtained with a low mono-energetic neutron field are presented. The discovery potential of this search strategy is discussed and illustrated by a realistic case accessible to MIMAC.

  8. MIMAC: A micro-tpc matrix project for directional detection of dark matter

    CERN Document Server

    Santos, D; Bosson, G; Bouly, J L; Bourrion, O; Fourel, Ch; Guillaudin, O; Mayet, F; Richer, J P; Delbart, A; Ferrer, E; Giomataris, I; Iguaz, F J; Mols, J P; Golabek, C; Lebreton, L

    2011-01-01

    Directional detection of non-baryonic DarkMatter is a promising search strategy for discriminating WIMP events from background ones. This strategy requires both a measurement of the recoil energy down to a few keV and 3D reconstruction of tracks down to a few mm. The MIMAC project, based on a micro-TPC matrix, filled with CF4 and CHF3 is being developed. The first results of a chamber prototype of this matrix, on low energy nuclear recoils (1H and 19F) obtained with mono-energetic neutron fields are presented. The discovery potential of this search strategy is illustrated by a realistic case accessible to MIMAC.

  9. MIMAC : A micro-tpc matrix for directional detection of dark matter

    CERN Document Server

    Santos, D; Bosson, G; Bourrion, O; Grignon, C; Guillaudin, O; Mayet, F; Richer, J P; Ferrer, E; Giomataris, I; Iguaz, F J; Mols, J P; Allaoua, A; Golabek, C; Lebreton, L

    2010-01-01

    Directional detection of non-baryonic Dark Matter is a promising search strategy for discriminating WIMP events from background. However, this strategy requires both a precise measurement of the energy down to a few keV and 3D reconstruction of tracks down to a few mm. To achieve this goal, the MIMAC project has been developed. It is based on a gaseous micro-TPC matrix, filled with 3He, CF4 and/or C4H10. The first results on low energy nuclear recoils (1H and 19F) obtained with a low mono-energetic neutron field are presented. The discovery potential of this search strategy is discussed and illustrated by a realistic case accessible to MIMAC.

  10. 2-Micron Pulsed Direct Detection IPDA Lidar for Atmospheric CO2 Measurement

    Science.gov (United States)

    Yu, Jirong; Petros, Mulugeta; Refaat, Tamer; Reithmaier, Karl; Remus, Ruben; Singh, Upendra; Johnson, Will; Boyer, Charlie; Fay, James; Johnston, Susan; Murchison, Luke

    2014-01-01

    A 2-micron high energy, pulsed Integrated Path Differential Absorption (IPDA) lidar has been developed for atmospheric CO2 measurements. Development of this lidar heavily leverages the 2-micron laser technologies developed in LaRC over the last decade. The high pulse energy, direct detection lidar operating at CO2 2-micron absorption band provides an alternate approach to measure CO2 concentrations. This new 2-micron pulsed IPDA lidar has been flown in spring of this year for total ten flights with 27 flight hours. It is able to make measurements of the total amount of atmospheric CO2 from the aircraft to the ground or cloud. It is expected to provide high-precision measurement capability by unambiguously eliminating contamination from aerosols and clouds that can bias the IPDA measurement.

  11. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Science.gov (United States)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  12. Direct detection of antibody concentration and affinity in human serum using microscale thermophoresis.

    Science.gov (United States)

    Lippok, Svenja; Seidel, Susanne A I; Duhr, Stefan; Uhland, Kerstin; Holthoff, Hans-Peter; Jenne, Dieter; Braun, Dieter

    2012-04-17

    The direct quantification of both the binding affinity and absolute concentration of disease-related biomarkers in biological fluids is particularly beneficial for differential diagnosis and therapy monitoring. Here, we extend microscale thermophoresis to target immunological questions. Optically generated thermal gradients were used to deplete fluorescently marked antigens in 2- and 10-fold-diluted human serum. We devised and validated an autocompetitive strategy to independently fit the concentration and dissociation constant of autoimmune antibodies against the cardiac β1-adrenergic receptor related to dilated cardiomyopathy. As an artificial antigen, the peptide COR1 was designed to mimic the second extracellular receptor loop. Thermophoresis resolved antibody concentrations from 2 to 200 nM and measured the dissociation constant as 75 nM. The approach quantifies antibody binding in its native serum environment within microliter volumes and without any surface attachments. The simplicity of the mix and probe protocol minimizes systematic errors, making thermophoresis a promising detection method for personalized medicine.

  13. The Scientific Reach of Multi-Ton Scale Dark Matter Direct Detection Experiments

    CERN Document Server

    Newstead, Jayden L; Krauss, Lawrence M; Dent, James B; Ferrer, Francesc

    2013-01-01

    The next generation of large scale WIMP direct detection experiments have the potential to go beyond the discovery phase and reveal detailed information about both the particle physics and astrophysics of dark matter. We report here on early results arising from the development of a detailed numerical code modeling the proposed DARWIN detector, involving both liquid argon and xenon targets. We incorporate realistic detector physics, particle physics and astrophysical uncertainties and demonstrate to what extent two targets with similar sensitivities can remove various degeneracies and allow a determination of dark matter cross sections and masses while also probing rough aspects of the dark matter phase space distribution. We find that, even assuming dominance of spin-independent scattering, multi-ton scale experiments still have degeneracies that depend sensitively on the dark matter mass, and on the possibility of isospin violation and inelasticity in interactions. We find that these experiments are best ab...

  14. Directional detection of Dark Matter with the MIcro-tpc MAtrix of Chambers

    CERN Document Server

    Couturier, C; Naraghi, F; Riffard, Q; Santos, D; Sauzet, N; Colas, P; Ribas, E Ferrer; Giomataris, I; Busto, J; Fouchez, D; Tao, C; Zhou, N

    2016-01-01

    Particles weakly interacting with ordinary matter, with an associated mass of the order of an atomic nucleus (WIMPs), are plausible candidates for Dark Matter. The direct detection of an elastic collision of a target nuclei induced by one of these WIMPs has to be discriminated from the signal produced by the neutrons, which leaves the same signal in a detector. The MIMAC (MIcro-tpc MAtrix of Chambers) collaboration has developed an original prototype detector which combines a large pixelated Micromegas coupled with a fast, self-triggering, electronics. Aspects of the two-chamber module in operation in the Modane Underground Laboratory are presented: calibration, characterization of the $^{222}$Rn progeny. A new test bench combining a MIMAC chamber with the COMIMAC portable quenching line has been set up to characterize the 3D tracks of low energy ions in the MIMAC gas mixture: the preliminary results thereof are presented. Future steps are briefly discussed.

  15. Directional Microwave Antenna Structures for the Detection of Dark Matter Axions

    CERN Document Server

    Betz, M; Zioutas, K

    2011-01-01

    Present detectors for dark matter axions in the microwave range use lower-order cavity modes which inherently suer from low directivity and a small detection volume for higher axion masses. We discuss here an alternative type of axion antenna structure in the microwave range. It consists of a rectangular waveguide, shorted at its ends, representing a TE 10n-resonator. It is placed in the bore of a wiggler or undulator magnet. The magnetic eld strength is sinusoidal along the magnet length which is exploited to work around the disadvantages of a lower-order mode cavity. Movable dielectric slabs at the side of the structure provide a straightforward way to scan over a range of axion masses in the order of 10%.

  16. Effect of gravitational focusing on annual modulation in dark-matter direct-detection experiments.

    Science.gov (United States)

    Lee, Samuel K; Lisanti, Mariangela; Peter, Annika H G; Safdi, Benjamin R

    2014-01-10

    The scattering rate in dark-matter direct-detection experiments should modulate annually due to Earth's orbit around the Sun. The rate is typically thought to be extremized around June 1, when the relative velocity of Earth with respect to the dark-matter wind is maximal. We point out that gravitational focusing can alter this modulation phase. Unbound dark-matter particles are focused by the Sun's gravitational potential, affecting their phase-space density in the lab frame. Gravitational focusing can result in a significant overall shift in the annual-modulation phase, which is most relevant for dark matter with low scattering speeds. The induced phase shift for light O(10)  GeV dark matter may also be significant, depending on the threshold energy of the experiment.

  17. Hypercharged dark matter and direct detection as a probe of reheating.

    Science.gov (United States)

    Feldstein, Brian; Ibe, Masahiro; Yanagida, Tsutomu T

    2014-03-14

    The lack of new physics at the LHC so far weakens the argument for TeV scale thermal dark matter. On the other hand, heavier, nonthermal dark matter is generally difficult to test experimentally. Here we consider the interesting and generic case of hypercharged dark matter, which can allow for heavy dark matter masses without spoiling testability. Planned direct detection experiments will be able to see a signal for masses up to an incredible 1010  GeV, and this can further serve to probe the reheating temperature up to about 109  GeV, as determined by the nonthermal dark matter relic abundance. The Z-mediated nature of the dark matter scattering may be determined in principle by comparing scattering rates on different detector nuclei, which in turn can reveal the dark matter mass. We will discuss the extent to which future experiments may be able to make such a determination.

  18. First direct detection limits on sub-GeV dark matter from XENON10.

    Science.gov (United States)

    Essig, Rouven; Manalaysay, Aaron; Mardon, Jeremy; Sorensen, Peter; Volansky, Tomer

    2012-07-13

    The first direct detection limits on dark matter in the MeV to GeV mass range are presented, using XENON10 data. Such light dark matter can scatter with electrons, causing ionization of atoms in a detector target material and leading to single- or few-electron events. We use 15  kg day of data acquired in 2006 to set limits on the dark-matter-electron scattering cross section. The strongest bound is obtained at 100 MeV where σ(e)dark-matter masses between 20 MeV and 1 GeV are bounded by σ(e)dark-matter candidates with masses well below the GeV scale.

  19. Theoretical and experimental investigation of direct detection optical OFDM transmission using beat interference cancellation receiver.

    Science.gov (United States)

    Nezamalhosseini, S Alireza; Chen, Lawrence R; Zhuge, Qunbi; Malekiha, Mahdi; Marvasti, Farokh; Plant, David V

    2013-07-01

    We theoretically and experimentally evaluate a beat interference cancellation receiver (BICR) for direct detection optical orthogonal frequency-division multiplexing (DD-OFDM) systems that improves the spectral efficiency (SE) by reducing the guard band between the optical carrier and the optical OFDM signal while mitigating the impact of signal-signal mixing interference (SSMI). Experimental results show that the bit-error-rate (BER) is improved by about three orders of magnitude compared to the conventional receiver after 320 km single-mode fiber (SMF) transmission for 10 Gb/s data with a 4-QAM modulation using reduced guard band single-sideband OFDM (RSSB-OFDM) signal with 1.67 bits/s/Hz SE.

  20. Digital baseband predistortion for SSII cancellation in EAM-based direct-detection OFDM systems

    Science.gov (United States)

    Yang, Pengfei; Shi, Hu; Chen, Xue

    2017-01-01

    To increase the available bandwidth of electro-absorption modulator (EAM)-based direct-detection orthogonal frequency division multiplexing (DD-OFDM) systems, which suffers from dispersion- and chirp-induced power fading, the multiband subcarrier allocation scheme and adaptive modulation formats are adopted. However, the subcarrier-to-subcarrier intermixing interference (SSII) would degrade signal-to-noise ratio on the increased bandwidth and become a bottleneck of the multiband systems. In this paper, a novel digital baseband predistortion is proposed to minimize the penalty of SSII. The experimental results show that a 30 Gbps EAM-based DD-OFDM system with the proposed technique could improve 3 dB receiver sensitivity compared with the system without the technique over 100 km long single mode fiber transmission and only decreases 1.0 dB in comparison with the back-to-back situation.

  1. Investigation of PMD in direct-detection optical OFDM with zero padding.

    Science.gov (United States)

    Li, Xiang; Alphones, Arokiaswami; Zhong, Wen-De; Yu, Changyuan

    2013-09-09

    We investigate the polarization-mode dispersion (PMD) effect of zero padding OFDM (ZP-OFDM) in direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) systems. We first study the conventional equalization method for ZP-OFDM. Then an equalization method based on sorted QR decomposition is proposed to further improve the performance. It is found that the performance improvement of ZP-OFDM is due to the frequency domain oversampling (FDO) induced inter-carrier interference (ICI). Numerical simulation results show that compared with cyclic prefix OFDM (CP-OFDM), ZP-OFDM has a significantly higher tolerance to PMD in DDO-OFDM systems when the channel spectral nulls occur at certain differential group delay (DGD) values.

  2. Study of direct back EMF detection for sensorless brushless DC motor

    Institute of Scientific and Technical Information of China (English)

    ZOU Ji-bin; JIANG Shan-lin; LIANG Wei-yan

    2010-01-01

    In this paper,a new rotor position detecting method for the sensorless control of brushless DC motor(BLDCM)is introduced.It obtains the phase back EMF signal from the motor terminal voltage by properly choosing the PWM and sensing strategy directly and needn' t the motor neutral point voltage information.The paper analyzes both the steady-state of PWM on the high side modulator mode which doesnt consider the parasitic capacitance Coes in the switches and the transient-state of PWM on the high side modulator mode which considers the parasitic capacitance Coes in the switches in detail.The experimental results verify that the proposed method is not sensitive to switching noise,no filtering is required,and good motor performance is achieved within a wide speed range.

  3. Atypical sensors for direct and rapid neuronal detection of bacterial pathogens.

    Science.gov (United States)

    Lim, Ji Yeon; Choi, Seung-In; Choi, Geunyeol; Hwang, Sun Wook

    2016-03-09

    Bacterial infection can threaten the normal biological functions of a host, often leading to a disease. Hosts have developed complex immune systems to cope with the danger. Preceding the elimination of pathogens, selective recognition of the non-self invaders is necessary. At the forefront of the body's defenses are the innate immune cells, which are equipped with particular sensor molecules that can detect common exterior patterns of invading pathogens and their secreting toxins as well as with phagocytic machinery. Inflammatory mediators and cytokines released from these innate immune cells and infected tissues can boost the inflammatory cascade and further recruit adaptive immune cells to maximize the elimination and resolution. The nervous system also seems to interact with this process, mostly known to be affected by the inflammatory mediators through the binding of neuronal receptors, consequently activating neural circuits that tune the local and systemic inflammatory states. Recent research has suggested new contact points: direct interactions of sensory neurons with pathogens. Latest findings demonstrated that the sensory neurons not only share pattern recognition mechanisms with innate immune cells, but also utilize endogenous and exogenous electrogenic components for bacterial pathogen detection, by which the electrical firing prompts faster information flow than what could be achieved when the immune system is solely involved. As a result, rapid pain generation and active accommodation of the immune status occur. Here we introduced the sensory neuron-specific detector molecules for directly responding to bacterial pathogens and their signaling mechanisms. We also discussed extended issues that need to be explored in the future.

  4. Rapid Detection of Thrombin and Other Protease Activity Directly in Whole Blood

    Science.gov (United States)

    Yu, Johnson Chung Sing

    Thrombin is a serine protease that plays a key role in the clotting cascade to promote hemostasis following injury to the endothelium. From a clinical diagnostic perspective, in-vivo thrombin activity is linked to various blood clotting disorders, as well as cardiovascular disease (DVT, arteriosclerosis, etc). Thus, the ability to rapidly measure protease activity directly in whole blood will provide important new diagnostics, and clinical researchers with a powerful tool to further elucidate the relationship between circulating protease levels and disease. The ultimate goal is to design novel point of care (POC) diagnostic devices that are capable of monitoring protease activities directly in whole blood and biological sample. A charge-changing substrate specific to the thrombin enzyme was engineered and its functionality was confirmed by a series of experiments. This led to the preliminary design, construction, and testing of two device platforms deemed fully functional for the electrophoretic separation and focusing of charged peptide fragments. The concept of using the existing charge-changing substrate platform for bacterial protease detection was also investigated. Certain strains of E coli are associated with severe symptoms such as abdominal cramps, bloody diarrhea, and vomiting. The OmpT protease is expressed on the outer membrane of E coli and plays a role in the cleavage of antimicrobial peptides, the degradation of recombinant heterologous proteins, and the activation of plasminogen in the host. Thus, a synthetic peptide substrate specific to the OmpT protease was designed and modeled for the purpose of detecting E coli in biological sample.

  5. Electronic polarization-division demultiplexing based on digital signal processing in intensity-modulation direct-detection optical communication systems.

    Science.gov (United States)

    Kikuchi, Kazuro

    2014-01-27

    We propose a novel configuration of optical receivers for intensity-modulation direct-detection (IM · DD) systems, which can cope with dual-polarization (DP) optical signals electrically. Using a Stokes analyzer and a newly-developed digital signal-processing (DSP) algorithm, we can achieve polarization tracking and demultiplexing in the digital domain after direct detection. Simulation results show that the power penalty stemming from digital polarization manipulations is negligibly small.

  6. Direct exoplanet detection and characterization using the ANDROMEDA method: Performance on VLT/NaCo data

    Science.gov (United States)

    Cantalloube, F.; Mouillet, D.; Mugnier, L. M.; Milli, J.; Absil, O.; Gomez Gonzalez, C. A.; Chauvin, G.; Beuzit, J.-L.; Cornia, A.

    2015-10-01

    Context. The direct detection of exoplanets with high-contrast imaging requires advanced data processing methods to disentangle potential planetary signals from bright quasi-static speckles. Among them, angular differential imaging (ADI) permits potential planetary signals with a known rotation rate to be separated from instrumental speckles that are either statics or slowly variable. The method presented in this paper, called ANDROMEDA for ANgular Differential OptiMal Exoplanet Detection Algorithm, is based on a maximum likelihood approach to ADI and is used to estimate the position and the flux of any point source present in the field of view. Aims: In order to optimize and experimentally validate this previously proposed method, we applied ANDROMEDA to real VLT/NaCo data. In addition to its pure detection capability, we investigated the possibility of defining simple and efficient criteria for automatic point source extraction able to support the processing of large surveys. Methods: To assess the performance of the method, we applied ANDROMEDA on VLT/NaCo data of TYC-8979-1683-1 which is surrounded by numerous bright stars and on which we added synthetic planets of known position and flux in the field. In order to accommodate the real data properties, it was necessary to develop additional pre-processing and post-processing steps to the initially proposed algorithm. We then investigated its skill in the challenging case of a well-known target, β Pictoris, whose companion is close to the detection limit and we compared our results to those obtained by another method based on principal component analysis (PCA). Results: Application on VLT/NaCo data demonstrates the ability of ANDROMEDA to automatically detect and characterize point sources present in the image field. We end up with a robust method bringing consistent results with a sensitivity similar to the recently published algorithms, with only two parameters to be fine tuned. Moreover, the companion flux

  7. Nuclear uncertainties in the spin-dependent structure functions for direct dark matter detection

    CERN Document Server

    Cerdeno, David G; Huh, Ji-Haeng; Peiro, Miguel

    2012-01-01

    We study the effect that uncertainties in the nuclear spin-dependent structure functions have in the determination of the dark matter (DM) parameters in a direct detection experiment. We show that different nuclear models that describe the spin-dependent structure function of specific target nuclei can lead to variations in the reconstructed values of the DM mass and scattering cross-section. We propose a parametrization of the spin structure functions that allows us to treat these uncertainties as variations of three parameters, with a central value and deviation that depend on the specific nucleus. The method is illustrated for germanium and xenon detectors with an exposure of 300 kg yr, assuming a hypothetical detection of DM and studying a series of benchmark points for the DM properties. We find that the effect of these uncertainties can be similar in amplitude to that of astrophysical uncertainties, especially in those cases where the spin-dependent contribution to the elastic scattering cross-section i...

  8. Direct electrochemical sensor for label-free DNA detection based on zero current potentiometry.

    Science.gov (United States)

    Wu, Nai-ying; Gao, Wei; He, Xu-lun; Chang, Zhu; Xu, Mao-tian

    2013-01-15

    A direct electrochemical DNA biosensor based on zero current potentiometry was fabricated by immobilization of ssDNA onto gold nanoparticles (AuNPs) coated pencil graphite electrode (PGE). One ssDNA/AuNPs/PGE was connected in series between clips of working and counter electrodes of a potentiostat, and then immersed into the solution together with a reference electrode, establishing a novel DNA biosensor for specific DNA detection. The variation of zero current potential difference (ΔE(zcp)) before and after hybridization of the self-assembled probe DNA with the target DNA was used as a signal to characterize and quantify the target DNA sequence. The whole DNA biosensor fabrication process was characterized by cyclic voltammetry and electrochemical impedance spectroscopy with the use of ferricyanide as an electrochemical redox indicator. Under the optimized conditions, ΔE(zcp) was linear with the concentrations of the complementary target DNA in the range from 10nM to 1μM, with a detection limit of 6.9nM. The DNA biosensor showed a good reproducibility and selectivity. Prepared DNA biosensor is facile and sensitive, and it eliminates the need of using exogenous reagents to monitor the oligonucleotides hybridization.

  9. Lenslet Array to Further Suppress Star Light for Direct Exoplanet Detection

    Science.gov (United States)

    Gong, Qian; McElwain, Michael; Shiri, Ron

    2016-01-01

    Direct imaging plays a key role in the detection and characterization of exoplanets orbiting within its host star's habitable zone. Many innovative ideas for starlight suppression and wavefront control have been proposed and developed over the past decade. However, several technological challenges still lie ahead to achieve the required contrast, including controlling the observatory pointing performance, fabricating occulting masks with tight optical tolerances, developing wavefront control algorithms, controlling stray light, advancing single photon detecting detectors, and integrated system-level issues. This paper explores how a lenslet array and pinhole mask may be implemented to further suppress uncorrected starlight that leaks through the occulting mask. An external occulter, or star shade, is simulated to demonstrate this concept, although this approach can be implemented for internal coronagraphs as well. We describe how to use simple relay optics to control the scene near the inner working angle and the level of the suppression expected. Furthermore, if the lenslet array is the input to an integral field spectrograph, as planned for the WFIRST mission, the spectral content of the exoplanet atmospheres can be obtained to determine if the observed planet is habitable and ultimately, if it is inhabited.

  10. Theoretical direct WIMP detection rates for transitions to nuclear excited states

    CERN Document Server

    Vergados, J D; Pirinen, P; Srivastava, P C; Kortelainen, M; Suhonen, J

    2015-01-01

    The recent WMAP and Planck data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Many extensions of the standard model provide dark matter candidates, in particular Weakly Interacting Massive Particles (WIMPs). Thus the direct dark matter detection is central to particle physics and cosmology. Most of the research on this issue has hitherto focused on the detection of the recoiling nucleus. In this paper we study transitions to the excited states, possible in some nuclei, which have sufficiently low lying excited states. Examples considered previously were the first excited states of $^{127}$I and $^{129}$Xe. We examine here $^{83}$Kr, which offers some kinematical advantages and is currently considered as a possible target. We find appreciable branching ratios for the inelastic scattering mediated by the spin cross sections, with an inelastic event rate of $4.4\\times 10^{-4}$kg$^{-1}$d$^{-1}$. So, the extra signature of the gamma ra...

  11. An impedimetric immunosensor for the detection of autoantibodies directed against gliadins.

    Science.gov (United States)

    Balkenhohl, T; Lisdat, F

    2007-04-01

    An immunosensor has been developed for the detection of autoantibodies directed against wheat gliadin, a protein fraction of cereal gluten which is involved in celiac disease. The immunosensor is based on the immobilization of gliadins onto gold electrodes covered with a polyelectrolyte layer of poly(4-styrenesulfonic acid sodium salt). The immobilization was monitored by quartz crystal microbalance (QCM) analysis. The antigen-antibody interaction signal was amplified by an incubation step with peroxidase-labeled immunoglobulins and subsequent peroxidase-catalyzed oxidation of 3-amino-9-ethylcarbazole (AEC). Changes in the insulating properties of the electrode layer were measured by electrochemical impedance spectroscopy (EIS) in the presence of ferri/ferro-cyanide. Impedance spectra could be fitted to a Randles equivalent circuit with high accuracy. Exposing the sensor electrodes to various antigliadin antibody concentrations resulted in proportional changes in the charge transfer resistance. A calibration graph for the detection of antigliadin antibodies was established for antibody concentrations between 10(-8) and 10(-6) M. Finally, the sensor was used for the determination of antigliadin autoantibodies of the IgG and IgA type in several human sera.

  12. Application of CdSe quantum dots for the direct detection of TNT.

    Science.gov (United States)

    Yi, Kui-Yu

    2016-02-01

    CdSe quantum dots were synthesized through a simple, green organic-phase method. Paraffin was used as the reaction solvent and a reducing agent, oleic acid was the reaction ligand, and oleyl amine was the stabilizer. Based on the phenomenon of TNT quenched oil-soluble CdSe quantum dot fluorescence, a simple, fast, and direct method of TNT detection was established. Under optimum conditions, the degree of fluorescence quenching of oil-soluble CdSe quantum dots had a good linear correlation with TNT concentration in the 1.0×10(-7)-5.0×10(-5) mol/L range, and the correlation coefficient was 0.9990. TNT detection limit was 2.1×10(-8)mol/L. The method was successfully used to determine TNT-explosion dust samples, results were satisfactory. The fluorescence quenching mechanism of oil-soluble CdSe quantum dots by TNT was also discussed.

  13. Detection and Quantization of Bearing Fault in Direct Drive Wind Turbine via Comparative Analysis

    Directory of Open Access Journals (Sweden)

    Wei Teng

    2016-01-01

    Full Text Available Bearing fault is usually buried by intensive noise because of the low speed and heavy load in direct drive wind turbine (DDWT. Furthermore, varying wind speed and alternating loads make it difficult to quantize bearing fault feature that indicates the degree of deterioration. This paper presents the application of multiscale enveloping spectrogram (MuSEnS and cepstrum to detect and quantize bearing fault in DDWT. MuSEnS can manifest fault modulation information adaptively based on the capacity of complex wavelet transform, which enables the weak bearing fault in DDWT to be detected. Cepstrum can calculate the average interval of periodic components in frequency domain and is suitable for quantizing bearing fault feature under varying operation conditions due to the logarithm weight on the power spectrum. Through comparing a faulty DDWT with a normal one, the bearing fault feature is evidenced and the quantization index is calculated, which show a good application prospect for condition monitoring and fault diagnosis in real DDWT.

  14. Direct Detection of a (Proto)Binary-Disk System in IRAS 20126+4104

    CERN Document Server

    Sridharan, T K; Fuller, G A

    2005-01-01

    We report the direct detection of a binary/disk system towards the high-mass (proto)stellar object IRAS20126+4104 at infrared wavengths. The presence of a multiple system had been indicated by the precession of the outflow and the double jet system detected earlier at cm-wavelengths. Our new K, L' & M' band infrared images obtained with the UKIRT under exceptional seeing conditions on Mauna Kea are able to resolve the central source for the first time, and we identify two objects separated by ~ 0.5'' (850 AU). The K and L' images also uncover features characteristic of a nearly edge-on disk, similar to many low mass protostars with disks: two emission regions oriented along an outflow axis and separated by a dark lane. The peaks of the L' & M' band and mm-wavelength emission are on the dark lane, presumably locating the primary young star. The thickness of the disk is measured to be ~ 850 AU for radii < 1000 AU. Approximate limits on the NIR magnitudes of the two young stars indicate a high-mass sy...

  15. Direct Imaging Detection of Methane in the Atmosphere of GJ 504 b

    Science.gov (United States)

    Janson, Markus; Brandt, Timothy; Kuzuhara, Masayuki; Spiegel, David; Thalmann, Christian; Currie, Thayne; Bonnefoy, Mickael; Zimmerman, Neil; Sorahana, Satoko; Kotani, Takayuki; Schlieder, Joshua; Hashimoto, Jun; Kudo, Tomoyuki; Kusakabe, Nobuhiko; Abe, Lyu; Brandner, Wolfgang; Carson, Joseph; Egner, Sebastian; Feldt, Markus; Goto, Miwa; Grady, Carol; Guyon, Olivier; Hayano, Yutaka; Hayashi, Masahiko; McElwain, Michael

    2013-01-01

    Most exoplanets detected by direct imaging so far have been characterized by relatively hot (approximately greater than1000 K) and cloudy atmospheres. A surprising feature in some of their atmospheres has been a distinct lack of methane, possibly implying non-equilibrium chemistry. Recently, we reported the discovery of a planetary companion to the Sun-like star GJ 504 using Subaru/HiCIAO within the SEEDS survey. The planet is substantially colder (less than 600 K) than previously imaged planets, and has indications of fewer clouds, which implies that it represents a new class of planetary atmospheres with expected similarities to late T-type brown dwarfs in the same temperature range. If so, one might also expect the presence of significant methane absorption, which is characteristic of such objects. Here, we report the detection of deep methane absorption in the atmosphere of GJ 504 b, using the Spectral Differential Imaging mode of HiCIAO to distinguish the absorption feature around 1.6 micrometers. We also report updated JHK photometry based on new K(sub s)-band data and a re-analysis of the existing data. The results support the notion that GJ 504 b has atmospheric properties distinct from other imaged exoplanets, and will become a useful reference object for future planets in the same temperature range.

  16. Direct Detection of Erythromycin-Resistant Bordetella pertussis in Clinical Specimens by PCR.

    Science.gov (United States)

    Wang, Zengguo; Han, Ruijun; Liu, Ying; Du, Quanli; Liu, Jifeng; Ma, Chaofeng; Li, Hengxin; He, Qiushui; Yan, Yongping

    2015-11-01

    Resistance of Bordetella pertussis to erythromycin has been increasingly reported. We developed an allele-specific PCR method for rapid detection of erythromycin-resistant B. pertussis directly from nasopharyngeal (NP) swab samples submitted for diagnostic PCR. Based on the proven association of erythromycin resistance with the A2047G mutation in the 23S rRNA of B. pertussis, four primers, two of which were designed to be specific for either the wild-type or the mutant allele, were used in two different versions of the allele-specific PCR assay. The methods were verified with results obtained by PCR-based sequencing of 16 recent B. pertussis isolates and 100 NP swab samples submitted for diagnostic PCR. The detection limits of the two PCR assays ranged from 10 to 100 fg per reaction for both erythromycin-susceptible and -resistant B. pertussis. Two amplified fragments of each PCR, of 286 and 112 bp, respectively, were obtained from a mutant allele of the isolates and/or NP swab samples containing B. pertussis DNAs. For the wild-type allele, only a 286-bp fragment was visible when the allele-specific PCR assay 1 was performed. No amplification was found when a number of non-Bordetella bacterial pathogens and NP swab samples that did not contain the DNAs of B. pertussis were examined. This assay can serve as an alternative for PCR-based sequencing, especially for local laboratories in resource-poor countries.

  17. Direct Imaging Detection of Methane in the Atmosphere of GJ 504 b

    CERN Document Server

    Janson, M; Kuzuhara, M; Spiegel, D; Thalmann, C; Currie, T; Bonnefoy, M; Zimmerman, N; Sorahana, S; Kotani, T; Schlieder, J; Hashimoto, J; Kudo, T; Kusakabe, N; Abe, L; Brandner, W; Carson, J; Egner, S; Feldt, M; Goto, M; Grady, C; Guyon, O; Hayano, Y; Hayashi, M; Hayashi, S; Henning, T; Hodapp, K; Ishii, M; Iye, M; Kandori, R; Knapp, G; Kwon, J; Matsuo, T; McElwain, M; Mede, K; Miyama, S; Morino, J -I; Moro-Martin, A; Nakagawa, T; Nishimura, T; Pyo, T -S; Serabyn, E; Suenaga, T; Suto, H; Suzuki, R; Takahashi, Y; Takami, M; Takato, N; Terada, H; Tomono, D; Turner, E; Watanabe, M; Wisniewski, J; Yamada, T; Takami, H; Usuda, T; Tamura, M

    2013-01-01

    Most exoplanets detected by direct imaging so far have been characterized by relatively hot (> ~1000 K) and cloudy atmospheres. A surprising feature in some of their atmospheres has been a distinct lack of methane, possibly implying non-equilibrium chemistry. Recently, we reported the discovery of a planetary companion to the Sun-like star GJ 504 using Subaru/HiCIAO within the SEEDS survey. The planet is substantially colder (<600 K) than previously imaged planets, and has indications of fewer clouds, which implies that it represents a new class of planetary atmospheres with expected similarities to late T-type brown dwarfs in the same temperature range. If so, one might also expect the presence of significant methane absorption, which is characteristic of such objects. Here, we report the detection of deep methane absorption in the atmosphere of GJ 504 b, using the Spectral Differential Imaging mode of HiCIAO to distinguish the absorption feature around 1.6 um. We also report updated JHK photometry based ...

  18. How clean is clean: Non-destructive/direct methods of flux, residue detection

    Energy Technology Data Exchange (ETDEWEB)

    Welch, C.S. [Coll. of William & Mary, Williamsburg, VA (United States); Ray, U. [AT& T Bell Labs. (United States); Stallard, B.R.; Watkins, R.D.; Koch, M.W.; Moya, M.M. [Sandia National Labs., Albuquerque, NM (United States)

    1994-06-01

    The feasibility of three different non-destructive and direct methods of evaluating PCB (printed circuit boards) cleanliness was demonstrated. The detection limits associated with each method were established. In addition, the pros and cons of these methods as routine quality control inspection tools were discussed. OSEE (Optically Stimulated Electron Emission) was demonstrated to be a sensitive technique for detection of low levels of flux residues on insulating substances. However, future work including development of rugged OSEE instrumentation will determine whether the PCB industry can accept this technique in a production environment. FTIR (Fourier Transform Infrared) microscopy is a well established technique with well known characteristics. The inability of FTIR to discriminate an organic contaminant from an organic substrate limits its usefulness as a PCB line inspection tool, but it will still remain a technique for the QC/QA laboratory. One advantage of FTIR over the other two techniques described here is its ability to identify the chemical nature of the residue, which is important in Failure Mode Analysis. Optical imaging using sophisticated pattern recognition algorithms was found to be limited to high concentrations of residue. Further work on improved sensor techniques is necessary.

  19. Direct-detection optical OFDM superchannel for long-reach PON using pilot regeneration.

    Science.gov (United States)

    Hu, Rong; Yang, Qi; Xiao, Xiao; Gui, Tao; Li, Zhaohui; Luo, Ming; Yu, Shaohua; You, Shanhong

    2013-11-04

    We demonstrate a novel long-reach PON downstream scheme based on the regenerated pilot assisted direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) superchannel transmission. We use the optical comb source to form DDO-OFDM superchannel, and reserve the center carrier as a seed pilot. The seed pilot is further tracked and reused to generate multiple optical carriers at the local exchange. Each regenerated pilot carrier is selected to beat with an adjacent OFDM sub-band at ONU, so that the electrical bandwidth limitation can be much released compared to the conventional DDO-OFDM superchannel detection. With the proposed proof-of-concept architecture, we experimentally demonstrated a 116.7 Gb/s superchannel OFDM-PON system with transmission reach of 100 km, and 1:64 splitting ratio. We analyze the impact of carrier-to-sideband power ratio (CSPR) on system performance. The experiment result shows that, 5 dB power margin is still remained at ONU using such technique.

  20. Layered ACO-OFDM for intensity-modulated direct-detection optical wireless transmission.

    Science.gov (United States)

    Wang, Qi; Qian, Chen; Guo, Xuhan; Wang, Zhaocheng; Cunningham, David G; White, Ian H

    2015-05-04

    Layered asymmetrically clipped optical orthogonal frequency division multiplexing (ACO-OFDM) with high spectral efficiency is proposed in this paper for optical wireless transmission employing intensity modulation with direct detection. In contrast to the conventional ACO-OFDM, which only utilizes odd subcarriers for modulation, leading to an obvious spectral efficiency loss, in layered ACO-OFDM, the subcarriers are divided into different layers and modulated by different kinds of ACO-OFDM, which are combined for simultaneous transmission. In this way, more subcarriers are used for data transmission and the spectral efficiency is improved. An iterative receiver is also proposed for layered ACO-OFDM, where the negative clipping distortion of each layer is subtracted once it is detected so that the signals from different layers can be recovered. Theoretical analysis shows that the proposed scheme can improve the spectral efficiency by up to 2 times compared with conventional ACO-OFDM approaches with the same modulation order. Meanwhile, simulation results confirm a considerable signal-to-noise ratio gain over ACO-OFDM at the same spectral efficiency.

  1. Direct Detection of Protein Biomarkers in Human Fluids Using Site-Specific Antibody Immobilization Strategies

    Directory of Open Access Journals (Sweden)

    Maria Soler

    2014-01-01

    Full Text Available Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  2. Light Neutralino Dark Matter: Direct/Indirect Detection and Collider Searches

    CERN Document Server

    Han, Tao; Su, Shufang

    2014-01-01

    We study the neutralino being the Lightest Supersymmetric Particle (LSP) as a cold Dark Matter (DM) candidate with a mass less than 40 GeV in the framework of the Next-to-Minimal-Supersymmetric-Standard-Model (NMSSM). We find that with the current collider constraints from LEP, the Tevatron and the LHC, there are three types of light DM solutions consistent with the direct/indirect searches as well as the relic abundance considerations: (i) A1, H1-funnels, (ii) stau coannihilation and (iii) sbottom coannihilation. Type-(i) may take place in any theory with a light scalar (or pseudo-scalar) near the LSP pair threshold; while Type-(ii) and (iii) could occur in the framework of Minimal-Supersymmetric-Standard-Model (MSSM) as well. We present a comprehensive study on the properties of these solutions and point out their immediate relevance to the experiments of the underground direct detection such as superCDMS and LUX/LZ, and the astro-physical indirect search such as Fermi-LAT. We also find that the decays of t...

  3. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection.

    Science.gov (United States)

    Ellis, John; Evans, Jason L; Luo, Feng; Nagata, Natsumi; Olive, Keith A; Sandick, Pearl

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale [Formula: see text]below the grand unification (GUT) scale [Formula: see text], a scenario referred to as 'sub-GUT'. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if [Formula: see text] is close to [Formula: see text], but it may lie within its reach if [Formula: see text] GeV. Likewise, generalizing the CMSSM to allow non-universal supersymmetry-breaking contributions to the Higgs offers extensive possibilities for models within reach of the LZ experiment that have long proton lifetimes.

  4. A Mode Detection Method Using the Azimuthal Directivity of a Turbofan Model

    Science.gov (United States)

    Thomas, R. H.; Farassat, F.; Clark, L. R.; Gerhold, C. H.; Kelly, J. J.; Becker, L. E.

    1999-01-01

    The azimuthal, far field directivity of a scale fan model was measured in high resolution. The model is a 12 inch diameter rotor with 16 blades followed by 40 stator vanes. The tests were conducted at the nominal 100% speed corresponding to a tip speed of 905 ft/sec. Measurement of the radiated sound field, forward of the fan, was made in an anechoic chamber with an inflow control device and a baffle separating the aft and forward radiated interaction noise. The acoustic field was surveyed with a circular hoop array of 16 microphones which was moved to 14 axial stations. At each axial station the hoop was rotated in half-degree increments to take 736 points in the azimuthal angle. In addition to sound pressure level, the phase angle relative to a reference microphone was measured at each point. The sound pressure level is shown to vary in patterns by 10-15 dB especially for the fundamental tone but also for the first and second harmonic. A far field mode detection method has been developed and used with the data which determines the modes generated by the fan and which then interact to form the azimuthal directivity.

  5. RadSensor: Xray Detection by Direct Modulation of an Optical Probe Beam

    Energy Technology Data Exchange (ETDEWEB)

    Lowry, M E; Bennett, C V; Vernon, S P; Bond, T; Welty, R; Behymer, E; Petersen, H; Krey, A; Stewart, R; Kobayashi, N P; Sperry, V; Stephan, P; Reinhardt, C; Simpson, S; Stratton, P; Bionta, R; McKernan, M; Ables, E; Ott, L; Bond, S; Ayers, J.; Landen, O L; Bell, P M

    2003-08-01

    We present a new x-ray detection technique based on optical measurement of the effects of x-ray absorption and electron hole pair creation in a direct band-gap semiconductor. The electron-hole pairs create a frequency dependent shift in optical refractive index and absorption. This is sensed by simultaneously directing an optical carrier beam through the same volume of semiconducting medium that has experienced an xray induced modulation in the electron-hole population. If the operating wavelength of the optical carrier beam is chosen to be close to the semiconductor band-edge, the optical carrier will be modulated significantly in phase and amplitude. This approach should be simultaneously capable of very high sensitivity and excellent temporal response, even in the difficult high-energy xray regime. At xray photon energies near 10 keV and higher, we believe that sub-picosecond temporal responses are possible with near single xray photon sensitivity. The approach also allows for the convenient and EMI robust transport of high-bandwidth information via fiber optics. Furthermore, the technology can be scaled to imaging applications. The basic physics of the detector, implementation considerations, and preliminary experimental data are presented and discussed.

  6. Direct detection of protein biomarkers in human fluids using site-specific antibody immobilization strategies.

    Science.gov (United States)

    Soler, Maria; Estevez, M-Carmen; Alvarez, Mar; Otte, Marinus A; Sepulveda, Borja; Lechuga, Laura M

    2014-01-29

    Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  7. Syntax-directed content analysis of videotext: application to a map detection recognition system

    Science.gov (United States)

    Aradhye, Hrishikesh; Herson, James A.; Myers, Gregory

    2003-01-01

    Video is an increasingly important and ever-growing source of information to the intelligence and homeland defense analyst. A capability to automatically identify the contents of video imagery would enable the analyst to index relevant foreign and domestic news videos in a convenient and meaningful way. To this end, the proposed system aims to help determine the geographic focus of a news story directly from video imagery by detecting and geographically localizing political maps from news broadcasts, using the results of videotext recognition in lieu of a computationally expensive, scale-independent shape recognizer. Our novel method for the geographic localization of a map is based on the premise that the relative placement of text superimposed on a map roughly corresponds to the geographic coordinates of the locations the text represents. Our scheme extracts and recognizes videotext, and iteratively identifies the geographic area, while allowing for OCR errors and artistic freedom. The fast and reliable recognition of such maps by our system may provide valuable context and supporting evidence for other sources, such as speech recognition transcripts. The concepts of syntax-directed content analysis of videotext presented here can be extended to other content analysis systems.

  8. Controlled fabrication of nanopores using a direct focused ion beam approach with back face particle detection.

    Science.gov (United States)

    Patterson, N; Adams, D P; Hodges, V C; Vasile, M J; Michael, J R; Kotula, P G

    2008-06-11

    We report a direct, ion drilling technique that enables the reproducible fabrication and placement of nanopores in membranes of different thickness. Using a 30 keV focused Ga ion beam column combined with an in situ, back face, multi-channelplate particle detector, nanopores are sputtered in Si(3)N(4) and W/Si(3)N(4) to have diameters as small as 12 nm. Transmission electron microscopy shows that focused ion beam-drilled holes are near-conical with the diameter decreasing from entry to exit side. By monitoring the detector signal during ion exposure, the drilled hole width can be minimized such that the exit-side diameter is smaller than the full width at half-maximum of the nominally Gaussian-shaped incident beam. Judicious choice of the beam defining aperture combined with back face particle detection allows for reproducible exit-side hole diameters between 18 and 100 nm. The nanopore direct drilling technique does not require potentially damaging broad area exposure to tailor hole sizes. Moreover, this technique successfully achieves breakthrough despite the effects of varying membrane thickness, redeposition, polycrystalline grain structure, and slight ion beam current fluctuations.

  9. Direct detection of orchid viruses using nanorod-based fiber optic particle plasmon resonance immunosensor.

    Science.gov (United States)

    Lin, Hsing-Ying; Huang, Chen-Han; Lu, Sin-Hong; Kuo, I-Ting; Chau, Lai-Kwan

    2014-01-15

    A fiber optic particle plasmon resonance (FOPPR) immunosensor is developed for label-free detection of orchid viruses that use gold nanorods (AuNRs) as the sensing material. The AuNRs are employed to create a near-infrared sensing window to solve the color interference problem of sample matrix for direct sensing of target analyte. This work cannot be achieved using gold nanospheres (AuNSs) because the signal of sample color absorption largely overlaps the signal of molecular recognition events in the visible spectrum, making the signal interpretation much more difficult. The AuNRs are immobilized on the unclad fiber core surface, and functionalized by antibodies which can specifically recognize the corresponding Cymbidium mosaic virus (CymMV) or Odontoglossum ringspot virus (ORSV) for rapid viral infection diagnosis. The refractive index resolution of the AuNR-FOPPR sensor is estimated to be 8×10(-6) RIU. The limits of detection (LODs) for CymMV and ORSV in leaf saps are 48 and 42 pg/mL, respectively, which are better than the LODs of 1200 pg/mL for both viruses obtained by enzyme-linked immunosorbent assay (ELISA). Exploiting the AuNR-FOPPR sensing strategy not only solves the color interference problem encountered by using AuNSs, but provides faster analysis, better reproducibility, and lower detection limit than ELISA. The sensor can distinguish between healthy and infected orchids in 10 min, and can further provide the quantitative analysis of infection level. It is potentially applicable to the quality control of orchid cultivation industry, but not limited to this, especially for creating special spectral sensing window for particular samples. © 2013 Elsevier B.V. All rights reserved.

  10. Direct detection of sub-GeV dark matter with scintillating targets

    Science.gov (United States)

    Derenzo, Stephen; Essig, Rouven; Massari, Andrea; Soto, Adrián; Yu, Tien-Tien

    2017-07-01

    We suggest a novel experimental concept for detecting MeV-to-GeV-mass dark matter, in which the dark matter scatters off electrons in a scintillating target and produces a signal of one or a few photons. New large-area photodetectors are needed to measure the photon signal with negligible dark counts, which could be constructed from transition edge sensor (TES) or microwave kinetic inductance detector (MKID) technology. Alternatively, detecting two photons in coincidence may allow the use of conventional photodetectors like photomultiplier tubes. We describe why scintillators may have distinct advantages over other experiments searching for a low ionization signal from sub-GeV dark matter, as there are fewer potential sources of spurious backgrounds. We discuss various target choices, but focus on calculating the expected dark matter-electron scattering rates in three scintillating crystals: sodium iodide (NaI), cesium iodide (CsI), and gallium arsenide (GaAs). Among these, GaAs has the lowest band gap (1.52 eV) compared to NaI (5.9 eV) or CsI (6.4 eV), which in principle allows it to probe dark matter masses as low as ˜0.5 MeV , compared to ˜1.5 MeV with NaI or CsI. We compare these scattering rates with those expected in silicon (Si) and germanium (Ge). The proposed experimental concept presents an important complementary path to existing efforts, and its potential advantages may make it the most sensitive direct-detection probe of dark matter down to MeV masses.

  11. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    . The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result...

  12. Bacteroides fragilis in biopsies of patients with major abscesses and diabetic foot infections: direct molecular versus culture-based detection

    OpenAIRE

    Stappers, Mark H. T.; Hagen, Ferry; Reimnitz, Peter; Mouton, Johan W.; Meis, Jacques F.; Gyssens, Inge C

    2016-01-01

    Direct determination by pathogen-specific real-time PCR assay for Bacteroides fragilis was compared to culture in major abscess and diabetic foot infection biopsy samples. Real-time PCR resulted in an increased detection rate of 12% for B. fragilis and could improve the detection of B. fragilis in clinical samples. (C) 2016 Elsevier Inc. All rights reserved.

  13. Direct Joint Detection from Humanoid 3D Models without using Skeleton Information

    Directory of Open Access Journals (Sweden)

    Terumasa Aoki

    2014-05-01

    Full Text Available Skeletonization, or automatic skeleton extraction, is one of the most essential technologies in 3DCG. This technology makes it possible to automatically extract skeletons (i.e. bones, joints and their hierarchical structures from 3D models. Such skeletons are important shape and pose descriptors for object representation, object recognition etc. They are used in many applications such as 3D model search, virtual character's pose estimation and collision detection between two or more 3D models. However, existing skeletonization methods have some drawbacks. Most of the existing skeletonization methods have difficulties in correctly extracting the positions of joints. In most methods, bones are extracted from a 3D model first and joints are defined as the cross points of bones. However some errors always occur when bones are extracted. Hence joints cannot be found in this scheme so often. Furthermore, they are not allowing for controlling the number of bones/joints and their structure. Therefore applying motion data acquired from motion capture devices to 3D models still involves a lot of cumbersome manual work. In this paper, we propose a novel joint detection method suited for kinematic skeleton generation, skeleton rigging etc. Unlike the existing methods, the proposed method detects joint positions directly without using skeleton (bone information. So the proposed method can avoid propagating errors occurred by skeletonization process. Also, the proposed method is able to extract the same numbers of joints/bones and the same structure as in given motion data, i.e. one can directly apply existing motion data without the need of manual adjustment. In general, 3D models describe shape information and pose information simultaneously. Distinguishing one from the other seems to be very difficult. However, the proposed method solves this problem by extracting only the pose information of 3D models by using a vertex Gauss sphere representation and

  14. Detecting and monitoring of water inrush in tunnels and coal mines using direct current resistivity method: A review

    OpenAIRE

    Shucai Li; Bin Liu; Lichao Nie; Zhengyu Liu; Mingzhen Tian; Shirui Wang; Maoxin Su; Qian Guo

    2015-01-01

    Detecting, real-time monitoring and early warning of underground water-bearing structures are critically important issues in prevention and mitigation of water inrush hazards in underground engineering. Direct current (DC) resistivity method is a widely used method for routine detection, advanced detection and real-time monitoring of water-bearing structures, due to its high sensitivity to groundwater. In this study, the DC resistivity method applied to underground engineering is reviewed and...

  15. Direction/location estimation and modulation detection for RF sources using steerable 3D IIR digital beam filters

    Science.gov (United States)

    Udayanga, Nilan; Madanayake, Arjuna; Wijenayake, Chamith

    2014-05-01

    A planar antenna array based feature detection scheme is proposed to estimate the directional, location and modulation information pertaining to radio sources in a cognitive radio environment. The proposed system employs multiple direction estimation stations and a fusion station. Planar antenna arrays and three-dimensional (3-D) infinite impulse response (IIR) digital filters are employed to perform volume scanning of the radio environment, leading to a spatial power profile, which is subjected to peak detection in order to estimate the direction of arrival corresponding to each source. Cyclosationay feature detection is then performed along each direction to estimate the frequency and modulation information. Two simulation examples are provided to verify the feasibility of the proposed approach.

  16. Development of a nested PCR detection procedure for Nectria fuckeliana direct from Norway spruce bark extracts.

    Science.gov (United States)

    Langrell, Stephen R H

    2005-01-01

    A pair of primers specific for Nectria fuckeliana, a bark infecting pathogen predominantly of Norway spruce (Picea abies), were designed from comparisons of nucleotide sequences of the nuclear ribosomal internal transcribed spacer (ITS) regions of nine isolates from Norway, Lithuania, Switzerland, Austria, Slovakia, Scotland (Larix sp.) and New Zealand (Pinus radiata), and other closely related nectriaceous species, including Neo. Neomacrospora, and 'N'. mammoidea, to which it exhibits taxonomic similarities. Complete ITS sequence homology was observed between each of the nine N. fuckeliana isolates, regardless of geographic provenance, including a previously published Danish strain. Primers Cct1 and Cct2 consistently amplified a single product of 360 bp from DNA prepared from 20 isolates covering the principle range of the disease from Central and Northern Europe, but not from other Neonectria, 'Nectria' or a range of species commonly encountered in forest ecosystems, as well as P. abies or P. radiata DNA. A quick, simple and efficient mechanical lysis procedure for the extraction of high quality total DNA from bark, coupled with post-extraction polyvinylpolypyrrolidone (PVPP) chromatography purification, is described to facilitate successful PCR detection of N. fuckeliana direct from bark extracts. Detection of N. fuckeliana from bark preparations was only possible following nested PCR of PVPP purified extracts using universal primers ITS5 and 4 in first round amplification. The identity of products from bark tissues was confirmed by Southern hybridisation and sequencing. Using the above procedure, positive diagnosis of N. fuckeliana was achievable within 5 h and has the potential for full exploitation as both a forest management and ecological research tool. As the DNA extraction procedure described here has been successful in application against other tree species, it has potential for incorporation into other molecular diagnostic systems for other

  17. Goal-Directed Modulation of Neural Memory Patterns: Implications for fMRI-Based Memory Detection.

    Science.gov (United States)

    Uncapher, Melina R; Boyd-Meredith, J Tyler; Chow, Tiffany E; Rissman, Jesse; Wagner, Anthony D

    2015-06-03

    Remembering a past event elicits distributed neural patterns that can be distinguished from patterns elicited when encountering novel information. These differing patterns can be decoded with relatively high diagnostic accuracy for individual memories using multivoxel pattern analysis (MVPA) of fMRI data. Brain-based memory detection--if valid and reliable--would have clear utility beyond the domain of cognitive neuroscience, in the realm of law, marketing, and beyond. However, a significant boundary condition on memory decoding validity may be the deployment of "countermeasures": strategies used to mask memory signals. Here we tested the vulnerability of fMRI-based memory detection to countermeasures, using a paradigm that bears resemblance to eyewitness identification. Participants were scanned while performing two tasks on previously studied and novel faces: (1) a standard recognition memory task; and (2) a task wherein they attempted to conceal their true memory state. Univariate analyses revealed that participants were able to strategically modulate neural responses, averaged across trials, in regions implicated in memory retrieval, including the hippocampus and angular gyrus. Moreover, regions associated with goal-directed shifts of attention and thought substitution supported memory concealment, and those associated with memory generation supported novelty concealment. Critically, whereas MVPA enabled reliable classification of memory states when participants reported memory truthfully, the ability to decode memory on individual trials was compromised, even reversing, during attempts to conceal memory. Together, these findings demonstrate that strategic goal states can be deployed to mask memory-related neural patterns and foil memory decoding technology, placing a significant boundary condition on their real-world utility.

  18. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Ellis, John [Theoretical Physics and Cosmology Group, Department of Physics, King’s College London, Strand, WC2R 2LS, London (United Kingdom); TH Division, Physics Department, CERN, 1211, Geneva 23 (Switzerland); Evans, Jason L. [William I. Fine Theoretical Physics Institute, School of Physics and Astronomy, University of Minnesota, 55455, Minneapolis, MN (United States); Luo, Feng [TH Division, Physics Department, CERN, 1211, Geneva 23 (Switzerland); Nagata, Natsumi [William I. Fine Theoretical Physics Institute, School of Physics and Astronomy, University of Minnesota, 55455, Minneapolis, MN (United States); Kavli IPMU (WPI), UTIAS, University of Tokyo, 277-8583, Kashiwa, Chiba (Japan); Olive, Keith A. [William I. Fine Theoretical Physics Institute, School of Physics and Astronomy, University of Minnesota, 55455, Minneapolis, MN (United States); Sandick, Pearl, E-mail: sandick@physics.utah.edu [Department of Physics and Astronomy, University of Utah, 84112, Salt Lake City, UT (United States)

    2016-01-05

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale M{sub in}below the grand unification (GUT) scale M{sub GUT}, a scenario referred to as ‘sub-GUT’. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if M{sub in} is close to M{sub GUT}, but it may lie within its reach if M{sub in}≲10{sup 11} GeV. Likewise, generalizing the CMSSM to allow non-universal supersymmetry-breaking contributions to the Higgs offers extensive possibilities for models within reach of the LZ experiment that have long proton lifetimes.

  19. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Ellis, John [King' s College London, Theoretical Physics and Cosmology Group, Department of Physics, London (United Kingdom); CERN, TH Division, Physics Department, Geneva 23 (Switzerland); Evans, Jason L.; Olive, Keith A. [University of Minnesota, William I. Fine Theoretical Physics Institute, School of Physics and Astronomy, Minneapolis, MN (United States); Luo, Feng [CERN, TH Division, Physics Department, Geneva 23 (Switzerland); Nagata, Natsumi [University of Minnesota, William I. Fine Theoretical Physics Institute, School of Physics and Astronomy, Minneapolis, MN (United States); University of Tokyo, Kavli IPMU (WPI), UTIAS, Kashiwa, Chiba (Japan); Sandick, Pearl [University of Utah, Department of Physics and Astronomy, Salt Lake City, UT (United States)

    2016-01-15

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale M{sub in} below the grand unification (GUT) scale M{sub GUT}, a scenario referred to as 'sub-GUT'. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if M{sub in} is close to M{sub GUT}, but it may lie within its reach if M{sub in}

  20. Detection of inhomogeneities in precipitation time series in Portugal using direct sequential simulation

    Science.gov (United States)

    Ribeiro, Sara; Caineta, Júlio; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2016-05-01

    Climate data homogenisation is of major importance in climate change monitoring, validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. The reason is that non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on a geostatistical simulation technique (DSS - direct sequential simulation), where local probability density functions (pdfs) are calculated at candidate monitoring stations using spatial and temporal neighbouring observations, which then are used for the detection of inhomogeneities. Such approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). That study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneity detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall, Wald-Wolfowitz runs, Von Neumann ratio, Pettitt, Buishand range test, and standard normal homogeneity test (SNHT) for a single break). Moreover, a sensitivity analysis is performed to investigate the number of simulated realisations which should be used to infer the local pdfs with more accuracy. Accordingly, the number of simulations per iteration was increased from 50 to 500, which resulted in a more representative local pdf. As in the previous study, the results are compared with those from the

  1. Inhomogeneities detection in annual precipitation time series in Portugal using direct sequential simulation

    Science.gov (United States)

    Caineta, Júlio; Ribeiro, Sara; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2014-05-01

    Climate data homogenisation is of major importance in monitoring climate change, the validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. This happens because non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on geostatistical simulation (DSS - direct sequential simulation), where local probability density functions (pdf) are calculated at candidate monitoring stations, using spatial and temporal neighbouring observations, and then are used for detection of inhomogeneities. This approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). This study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneities detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall test, Wald-Wolfowitz runs test, Von Neumann ratio test, Standard normal homogeneity test (SNHT) for a single break, Pettit test, and Buishand range test). Moreover, a sensibility analysis is implemented to investigate the number of simulated realisations that should be used to accurately infer the local pdfs. Accordingly, the number of simulations per iteration is increased from 50 to 500, which resulted in a more representative local pdf. A set of default and recommended settings is provided, which will help

  2. Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes

    Directory of Open Access Journals (Sweden)

    Wu Bai-Lin

    2009-10-01

    Full Text Available Abstract Background One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive. These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels. The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. Results An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other

  3. Lyman alpha emitting galaxies at high redshift: Direct detection of young galaxies in a young universe

    Science.gov (United States)

    Dawson, Steven Arthur

    An early result of galaxy formation theory was the prediction that the copious ionizing radiation produced in nascent galaxies undergoing their first starbursts should in turn produce a strong Lya emission line. We report on our efforts to detect and characterize primeval galaxies by searching for this expected Lya signature with two observational techniques: serendipitous slit spectroscopy, and narrowband imaging selection. In Part I, we describe our serendipitous slit spectroscopy survey of the Hubble Deep Field and its environs, which resulted in a catalog of 74 spectroscopic redshifts spanning 0.10 5. Follow-up observations at higher resolution resulted in the additional serendipitous detection of a strong Lya-emitting galaxy at z = 5.190 (ES1). At the time of its discovery, ES1 was one of only nine known galaxies at z > 5, and was the sixth most distant known galaxy. The unprecedented spectral purity of the observation offers evidence for a galaxy-scale outflow with a. velocity of v > 300 km s -1 , consistent with wind speeds observed in powerful local starbursts (typically 10 2 to 10 3 km s -1 ), and with simulations of the late- stage evolution of Lya emission in star-forming systems. Our final serendipitous detection is the remarkable source CXOHDFN J123635.6+621424, which is both the highest redshift known spiral galaxy, and a rare example of a high redshift, hard X-ray-emitting Type II AGN. Significantly, all of these results were acquired with no direct allocation of telescope time. In Part II, we report on our implementation of narrowband imaging selection, with which we traded redshift coverage for survey volume, focusing on the systematic study of galaxies at a particular epoch in favor of chasing that rare, most-distant object. This effort resulted in a catalog of 76 z [approximate] 4.5 Lya-emitting galaxies spectroscopically-confirmed in campaigns of Keck/LRIS and Keck/DEIMOS follow-up observations to candidates selected in the Large Area Lyman

  4. Direct Dark Matter Detection - A spin 3/2 WIMP candidate

    CERN Document Server

    Savvidy, Konstantin G

    2012-01-01

    We consider a Dark Matter candidate particle of spin 3/2 with neutrino-like Standard Model strength interactions. In the Majorana case, the particle can account for all of the Dark Matter for a range of masses between 70-160 GeV, depending on the strength of the Higgs couplings. The elementary spin-dependent cross section on the nucleon is calculated to be 1.7 x 10^-2 pb, and does not depend on the mass or any additional parameters. The Dirac case is excluded by the very large coherent cross section. The amplitude at the nuclear level is of the purely isovector form. We make detailed predictions for differential and total rates of scattering on a variety of nuclear targets of interest to the current direct detection experiments. For heavy targets the annual modulation amplitude is predicted to be negative, which may help to determine the mass of the WIMP if and when data become available.

  5. Complementarity of dark matter direct detection: the role of bolometric targets

    CERN Document Server

    Cerdeno, D G; Fornasa, M; Garcia, E; Ginestra, C; Huh, Ji-Haeng; Martinez, M; Ortigoza, Y; Peiro, M; Puimedon, J; Robledo, L; Sarsa, M L

    2013-01-01

    We study how the combined observation of dark matter in various direct detection experiments can be used to determine the phenomenological properties of WIMP dark matter: mass, spin-dependent (SD) and spin-independent (SI) scattering cross section off nucleons. A convenient choice of target materials, including nuclei that couple to dark matter particles through a significantly different ratio of SD vs SI interactions, could break the degeneracies in the determination of those parameters that a single experiment cannot discriminate. In this work we investigate different targets that can be used as scintillating bolometers and could provide complementary information to germanium and xenon detectors. We observe that Al2O3 and LiF bolometers could allow a good reconstruction of the DM properties over regions of the parameter space with a SD scattering cross section as small as 10^(-5) pb and a SI cross section as small as 5x10^(-10) pb for a 50 GeV WIMP. In the case of a CaWO4 bolometer the area in which full co...

  6. Halo-independent analysis of direct detection data for light WIMPs

    CERN Document Server

    Del Nobile, Eugenio; Gondolo, Paolo; Huh, Ji-Haeng

    2013-01-01

    We present a halo-independent analysis of direct detection data on "light WIMPs," i.e. weakly interacting massive particles with mass close to or below 10 GeV/c^2. We include new results from silicon CDMS detectors (bounds and excess events), the latest CoGeNT acceptances, and recent measurements of low sodium quenching factors in NaI crystals. We focus on light WIMPs with spin-independent isospin-conserving and isospin-violating interactions with nucleons. For these dark matter candidates we find that a low quenching factor would make the DAMA modulation incompatible with a reasonable escape velocity for the dark matter halo, and that the tension among experimental data tightens in both the isospin-conserving and isospin-violating scenarios. We also find that a new although milder tension appears between the CoGeNT and DAMA annual modulations on one side and the silicon excess events on the other, in that it seems difficult to interpret them as the modulated and unmodulated aspects of the same WIMP dark matt...

  7. Uncovering Natural Supersymmetry via the interplay between the LHC and Direct Dark Matter Detection

    CERN Document Server

    Barducci, Daniele; Bharucha, Aoife K M; Porod, Werner; Sanz, Veronica

    2015-01-01

    We have explored Natural Supersymmetry (NSUSY) scenarios with low values of the $\\mu$ parameter which are characterised by higgsino-like Dark Matter (DM) and compressed spectra for the lightest MSSM particles, $\\chi^0_1$, $\\chi^0_2$ and $\\chi^\\pm_1$. This scenario could be probed via monojet signatures, but as the signal-to-background ratio (S/B) is low we demonstrate that the 8 TeV LHC cannot obtain limits on the DM mass beyond those of LEP2. On the other hand, we have found, for the 13 TeV run of the LHC, that by optimising kinematical cuts we can bring the S/B ratio up to the 5(3)% level which would allow the exclusion of the DM mass up to 200(250) GeV respectively, significantly extending LEP2 limits. Moreover, we have found that LUX/XENON1T and LHC do play very complementary roles in exploring the parameter space of NSUSY, as the LHC has the capability to access regions where DM is quasi-degenerate with other higgsinos, which are challenging for direct detection experiments.

  8. Direct Detection Signatures of Self-Interacting Dark Matter with a Light Mediator

    CERN Document Server

    Del Nobile, Eugenio; Yu, Hai-Bo

    2015-01-01

    Self-interacting dark matter (SIDM) is a simple and well-motivated scenario that could explain long-standing puzzles in structure formation on small scales. If the required self-interaction arises through a light mediator (with mass $\\sim 10$ MeV) in the dark sector, this new particle must be unstable to avoid overclosing the universe. The decay of the light mediator could happen due to a weak coupling of the hidden and visible sectors, providing new signatures for direct detection experiments. The SIDM nuclear recoil spectrum is more peaked towards low energies compared to the usual case of contact interactions, because the mediator mass is comparable to the momentum transfer of nuclear recoils. We show that the SIDM signal could be distinguished from that of DM particles with contact interactions by considering the time-average energy spectrum in experiments employing different target materials, or the average and modulated spectra in a single experiment. Using current limits from LUX and SuperCDMS, we also...

  9. Zooming in on light relic neutralinos by direct detection and measurements of galactic antimatter

    CERN Document Server

    Bottino, A; Fornengo, N; Scopel, S

    2007-01-01

    The DAMA Collaboration has recently analyzed its data of the extensive WIMP direct search (DAMA/NaI) which detected an annual modulation, by taking into account the channelling effect which occurs when an ion traverses a detector with a crystalline structure. Among possible implications, this Collaboration has considered the case of a coherent WIMP-nucleus interaction and then derived the form of the annual modulation region in the plane of the WIMP-nucleon cross section versus the WIMP mass, using a specific modelling for the channelling effect. In the present paper we first show that light neutralinos fit the annual modulation region also when channelling is taken into account. To discuss the connection with indirect signals consisting in galactic antimatter, in our analysis we pick up a specific galactic model, the cored isothermal-sphere. In this scheme we determine the sets of supersymmetric models selected by the annual modulation regions and then prove that these sets are compatible with the available ...

  10. On the Capacity Region of the Intensity-Modulation Direct-Detection Optical Broadcast Channel

    KAUST Repository

    Chaaban, Anas

    2015-08-11

    The capacity of the intensity-modulation direct-detection free-space optical broadcast channel (OBC) is investigated. The Gaussian model with input-independent Gaussian noise is used, with both average and peak intensity constraints. An outer bound on the capacity region is derived by adapting Bergmans\\' approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian distributions or discrete distributions. While the discrete input distribution achieves higher rates than the truncated-Gaussian distribution, the latter allows expressing the achievable rate region in a closed form. At high signal-to-noise ratio (SNR), it is shown that the truncated-Gaussian distribution is nearly optimal. It achieves the symmetric-capacity within a constant gap (independent of SNR), which approaches half a bit as the number of users grows large. It also achieves the capacity region within a constant gap, which depends on the number of users. At low SNR, it is shown that on-off keying with time-division multiple-access (TDMA) is optimal, as it achieves any point on the boundary of the developed outer bound. This is interesting in practice since both OOK and TDMA have low complexity. At moderate SNR (typically [0,8] dB), a discrete distribution with a small alphabet size achieves a fairly good performance in terms of symmetric rate.

  11. Direct detection of a magnetic field in the innermost regions of an accretion disk.

    Science.gov (United States)

    Donati, Jean-François; Paletou, Fréderic; Bouvier, Jérome; Ferreira, Jonathan

    2005-11-24

    Models predict that magnetic fields play a crucial role in the physics of astrophysical accretion disks and their associated winds and jets. For example, the rotation of the disk twists around the rotation axis the initially vertical magnetic field, which responds by slowing down the plasma in the disk and by causing it to fall towards the central star. The magnetic energy flux produced in this process points away from the disk, pushing the surface plasma outwards, leading to a wind from the disk and sometimes a collimated jet. But these predictions have hitherto not been supported by observations. Here we report the direct detection of the magnetic field in the core of the protostellar accretion disk FU Orionis. The surface field reaches strengths of about 1 kG close to the centre of the disk, and it includes a significant azimuthal component, in good agreement with recent models. But we find that the field is very filamentary and slows down the disk plasma much more than models predict, which may explain why FU Ori fails to collimate its wind into a jet.

  12. Can Tonne-Scale Direct Detection Experiments Discover Nuclear Dark Matter?

    CERN Document Server

    Butcher, A; Monroe, J; West, S M

    2016-01-01

    Models of nuclear dark matter propose that the dark sector contains large composite states consisting of dark nucleons in analogy to Standard Model nuclei. We examine the direct detection phenomenology of a particular class of nuclear dark matter model at the current generation of tonne-scale liquid noble experiments, in particular DEAP-3600 and XENON1T. In our chosen nuclear dark matter scenario distinctive features arise in the recoil energy spectra due to the non-point-like nature of the composite dark matter state. We calculate the number of events required to distinguish these spectra from those of a standard point-like WIMP state with a decaying exponential recoil spectrum. In the most favourable regions of nuclear dark matter parameter space, we find that a few tens of events are needed to distinguish nuclear dark matter from WIMPs at the $3\\,\\sigma$ level in a single experiment. Given the total exposure time of DEAP-3600 and XENON1T we find that at best a $2\\,\\sigma$ distinction is possible by these e...

  13. Development of a front end ASIC for Dark Matter directional detection with MIMAC

    CERN Document Server

    Richer, J P; Bourrion, O; Grignon, C; Guillaudin, O; Mayet, F; Santos, D

    2009-01-01

    A front end ASIC (BiCMOS-SiGe 0.35 um) has been developed within the framework of the MIMAC detector project, which aims at directional detection of non-baryonic Dark Matter. This search strategy requires 3D reconstruction of low energy (keV) tracks with a gazeous uTPC. The development of this front end ASIC is a key point in this project, allowing the 3D track reconstruction. Each ASIC monitors 16 strips of pixels with charge preamplifiers and their time over threshold is provided in real time by current discriminators via two serializing LVDS links working at 320 MHz. The charge is summed over the 16 strips and provided via a shaper. These specifications have been chosen in order to build an auto triggered electronic. An acquisition board and the related software were developed in order to validate this methodology on a prototype chamber. The prototype detector presents an anode where 2x96 strips are monitored.

  14. Development of a front end ASIC for Dark Matter directional detection with MIMAC

    Energy Technology Data Exchange (ETDEWEB)

    Richer, J.P.; Bosson, G. [Laboratoire de Physique Subatomique et de Cosmologie, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, 53, rue des Martyrs, Grenoble (France); Bourrion, O., E-mail: olivier.bourrion@lpsc.in2p3.f [Laboratoire de Physique Subatomique et de Cosmologie, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, 53, rue des Martyrs, Grenoble (France); Grignon, C.; Guillaudin, O.; Mayet, F.; Santos, D. [Laboratoire de Physique Subatomique et de Cosmologie, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, 53, rue des Martyrs, Grenoble (France)

    2010-08-21

    A front end ASIC (BiCMOS-SiGe 0.35{mu}m) has been developed within the framework of the MIMAC detector project, which aims at directional detection of non-baryonic Dark Matter. This search strategy requires 3D reconstruction of low energy (a few keV) tracks with a gaseous {mu}TPC. The development of this front end ASIC is a key point of the project, allowing the 3D track reconstruction. Each ASIC monitors 16 strips of pixels with charge preamplifiers and their time over threshold is provided in real time by current discriminators via two serializing LVDS links working at 320 MHz. The charge is summed over the 16 strips and provided via a shaper. These specifications have been chosen in order to build an auto triggered electronics. An acquisition board and the related software were developed in order to validate this methodology on a prototype chamber. The prototype detector presents an anode where 2x96 strips of pixels are monitored.

  15. Assessing compatibility of direct detection data: halo-independent global likelihood analyses

    Energy Technology Data Exchange (ETDEWEB)

    Gelmini, Graciela B. [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA 90095 (United States); Huh, Ji-Haeng [CERN Theory Division,CH-1211, Geneva 23 (Switzerland); Witte, Samuel J. [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA 90095 (United States)

    2016-10-18

    We present two different halo-independent methods to assess the compatibility of several direct dark matter detection data sets for a given dark matter model using a global likelihood consisting of at least one extended likelihood and an arbitrary number of Gaussian or Poisson likelihoods. In the first method we find the global best fit halo function (we prove that it is a unique piecewise constant function with a number of down steps smaller than or equal to a maximum number that we compute) and construct a two-sided pointwise confidence band at any desired confidence level, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a “constrained parameter goodness-of-fit” test statistic, whose p-value we then use to define a “plausibility region” (e.g. where p≥10%). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. p<10%). We illustrate these methods by applying them to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic spin-independent isospin-conserving interactions or exothermic spin-independent isospin-violating interactions.

  16. Extended maximum likelihood halo-independent analysis of dark matter direct detection data

    Energy Technology Data Exchange (ETDEWEB)

    Gelmini, Graciela B.; Georgescu, Andreea [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA, 90095 (United States); Gondolo, Paolo [Department of Physics and Astronomy, University of Utah,115 South 1400 East #201, Salt Lake City, UT, 84112 (United States); Huh, Ji-Haeng [Department of Physics and Astronomy, UCLA,475 Portola Plaza, Los Angeles, CA, 90095 (United States)

    2015-11-24

    We extend and correct a recently proposed maximum-likelihood halo-independent method to analyze unbinned direct dark matter detection data. Instead of the recoil energy as independent variable we use the minimum speed a dark matter particle must have to impart a given recoil energy to a nucleus. This has the advantage of allowing us to apply the method to any type of target composition and interaction, e.g. with general momentum and velocity dependence, and with elastic or inelastic scattering. We prove the method and provide a rigorous statistical interpretation of the results. As first applications, we find that for dark matter particles with elastic spin-independent interactions and neutron to proton coupling ratio f{sub n}/f{sub p}=−0.7, the WIMP interpretation of the signal observed by CDMS-II-Si is compatible with the constraints imposed by all other experiments with null results. We also find a similar compatibility for exothermic inelastic spin-independent interactions with f{sub n}/f{sub p}=−0.8.

  17. A unified explanation for dark matter and electroweak baryogenesis with direct detection and gravitational wave signatures

    Energy Technology Data Exchange (ETDEWEB)

    Chala, Mikael [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Nardini, Germano [Bern Univ. (Switzerland). Inst. for Theoretical Physics; Sobolev, Ivan [Russian Academy of Sciences, Moscow (Russian Federation). Inst. for Nuclear Research; Moscow State Univ. (Russian Federation). Dept. of Particle Physics and Cosmology

    2016-05-15

    A minimal extension of the Standard Model that provides both a dark matter candidate and a strong first-order electroweak phase transition (EWPT) consists of two additional Lorentz and gauge singlets. In this paper we work out a composite Higgs version of this scenario, based on the coset SO(7)/SO(6). We show that by embedding the elementary fermions in appropriate representations of SO(7), all dominant interactions are described by only three free effective parameters. Within the model dependencies of the embedding, the theory predicts one of the singlets to be stable and responsible for the observed dark matter abundance. At the same time, the second singlet introduces new CP-violation phases and triggers a strong first-order EWPT, making electroweak baryogenesis feasible. It turns out that this scenario does not conflict with current observations and it is promising for solving the dark matter and baryon asymmetry puzzles. The tight predictions of the model will be accessible at the forthcoming dark matter direct detection and gravitational wave experiments.

  18. Direct detection signatures of self-interacting dark matter with a light mediator

    Energy Technology Data Exchange (ETDEWEB)

    Nobile, Eugenio Del [Department of Physics and Astronomy, University of California, Los Angeles,CA, 90095 (United States); Kaplinghat, Manoj [Department of Physics and Astronomy, University of California, Riverside,CA, 92507 (United States); Yu, Hai-Bo [Department of Physics and Astronomy, University of California, Irvine,CA, 92697 (United States)

    2015-10-27

    Self-interacting dark matter (SIDM) is a simple and well-motivated scenario that could explain long-standing puzzles in structure formation on small scales. If the required self-interaction arises through a light mediator (with mass ∼10 MeV) in the dark sector, this new particle must be unstable to avoid overclosing the universe. The decay of the light mediator could happen due to a weak coupling of the hidden and visible sectors, providing new signatures for direct detection experiments. The SIDM nuclear recoil spectrum is more peaked towards low energies compared to the usual case of contact interactions, because the mediator mass is comparable to the momentum transfer of nuclear recoils. We show that the SIDM signal could be distinguished from that of DM particles with contact interactions by considering the time-average energy spectrum in experiments employing different target materials, or the average and modulated spectra in a single experiment. Using current limits from LUX and SuperCDMS, we also derive strong bounds on the mixing parameter between hidden and visible sector.

  19. DETECTION OF FAST-MOVING WAVES PROPAGATING OUTWARD ALONG SUNSPOTS’ RADIAL DIRECTION IN THE PHOTOSPHERE

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Junwei; Chen, Ruizhu [W. W. Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305-4085 (United States); Hartlep, Thomas [BAER Institute, NASA Ames Research Center, Moffet Field, CA 94043 (United States); Kosovichev, Alexander G. [Department of Physics, New Jersey Institute of Technology, Newark, NJ 07102 (United States)

    2015-08-10

    Helioseismic and magnetohydrodynamic waves are abundant in and above sunspots. Through cross-correlating oscillation signals in the photosphere observed by the Solar Dynamics Observatory/Helioseismic and Magnetic Imager, we reconstruct how waves propagate away from virtual wave sources located inside a sunspot. In addition to the usual helioseismic wave, a fast-moving wave is detected traveling along the sunspot’s radial direction from the umbra to about 15 Mm beyond the sunspot boundary. The wave has a frequency range of 2.5–4.0 mHz with a phase velocity of 45.3 km s{sup −1}, substantially faster than the typical speeds of Alfvén and magnetoacoustic waves in the photosphere. The observed phenomenon is consistent with a scenario of that a magnetoacoustic wave is excited at approximately 5 Mm beneath the sunspot. Its wavefront travels to and sweeps across the photosphere with a speed higher than the local magnetoacoustic speed. The fast-moving wave, if truly excited beneath the sunspot’s surface, will help open a new window for studying the internal structure and dynamics of sunspots.

  20. Direct estimation of carbaryl by gas liquid chromatography with nitrogen phosphorus detection.

    Science.gov (United States)

    Battu, Raminderjit Singh; Mandal, Kousik; Urvashi; Pandher, Suneet; Takkar, Reenu; Singh, Balwinder

    2012-07-01

    A simple and efficient analytical method was standardized for the estimation of residues of carbaryl in various substrates comprising grape berries, kinnow pulps, kinnow rind and soil. The samples were refluxed using mixture of methanol: 0.5 N HCl (1:1 v/v); diluted with brine solution, partitioned into chloroform and dried over anhydrous sodium sulfate. Further the samples were treated with anhydrous magnesium sulfate and primary secondary amine. Final clear extracts were concentrated under vacuum and reconstituted the volume into acetone. The residues were estimated directly on gas liquid chromatograph equipped with nitrogen phosphorus detection system equipped with a capillary column packed with 5 % diphenyl 95 % dimethyl polysiloxane non-polar phase. A consistent recovery from 82 % to 97 % for carbaryl was observed when samples were spiked at levels ranging from 0.05 to 1.00 mg kg(-1). The limit of quantification of the method was worked out to be 0.05 mg kg(-1) for grape berries, kinnow pulp, kinnow rind and soil.

  1. Direct electrochemistry of dopamine on gold-Agaricus bisporus laccase enzyme electrode: characterization and quantitative detection.

    Science.gov (United States)

    Shervedani, Reza Karimi; Amini, Akbar

    2012-04-01

    Direct electrochemistry of a new laccase enzyme immobilized on gold and its application as a biosensor for dopamine (DA) are investigated by voltammetry and electrochemical impedance spectroscopy. The sensor demonstrated a redox adsorption behavior with E(0') = + 180 mV vs. Ag/AgCl for immobilized Agaricus bisporus laccase (LacAB) enzyme. The MPA platform was assembled on Au with and without utilization of ultrasounds. Excellent results were obtained by using the enzyme electrode fabricated based on MPA assembled with sonication. The LacAB immobilized in this condition showed a large electrocatalytic activity for oxidation of DA. Accordingly, a third-generation (mediator free) biosensor was constructed for DA. The DA concentration could be measured in the linear range of 0.5 to 13.0 and 47.0 to 430.0 μmol L(-1) with correlation coefficients of 0.999 and 0.989, respectively, and a detection limit of 29.0 nmol L(-1). The biosensor was successfully tested for determination of DA in human blood plasma and pharmaceutical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Unified explanation for dark matter and electroweak baryogenesis with direct detection and gravitational wave signatures

    Science.gov (United States)

    Chala, Mikael; Nardini, Germano; Sobolev, Ivan

    2016-09-01

    A minimal extension of the Standard Model that provides both a dark matter candidate and a strong first-order electroweak phase transition (EWPT) consists of two additional Lorentz and gauge singlets. In this paper we work out a composite Higgs version of this scenario, based on the coset S O (7 )/S O (6 ). We show that by embedding the elementary fermions in appropriate representations of S O (7 ), all dominant interactions are described by only three free effective parameters. Within the model dependencies of the embedding, the theory predicts one of the singlets to be stable and responsible for the observed dark matter abundance. At the same time, the second singlet introduces new C P -violation phases and triggers a strong first-order EWPT, making electroweak baryogenesis feasible. It turns out that this scenario does not conflict with current observations and it is promising for solving the dark matter and baryon asymmetry puzzles. The tight predictions of the model will be accessible at the forthcoming dark matter direct detection and gravitational wave experiments.

  3. Dark matter in Draco and the Local Group Implications for direct detection experiments

    CERN Document Server

    Moore, B; Stadel, J; Quinn, T; Lake, G; Ghigna, S; Governato, F; Moore, Ben; Calcaneo-Roldan, Carlos; Stadel, Joachim; Quinn, Tom; Lake, George; Ghigna, Sebastiano; Governato, Fabio

    2001-01-01

    We use a cosmological simulation of the Local Group to make quantitative and speculative predictions for direct detection experiments. Cold dark matter (CDM) halos form via a complex series of mergers, accretion events and violent relaxation which precludes the formation of significant caustic features predicted by axially symmetric collapse. The halo density profiles are combined with observational constraints on the galactic mass distribution to constrain the local density of cold dark matter to lie in the range 0.18 <~ rho_CDM(R_solar)/GeV cm^-3 <~ 0.30. In velocity space, coherent streams of dark matter from tidally disrupted halos fill the halo and provide a tracer of the merging hierarchy. The particle velocities within triaxial CDM halos cannot be approximated by a simple Maxwellian distribution and is radially biased at the solar position. The detailed phase space structure within the solar system will depend on the early merger history of the progenitor halos and the importance of major mergers...

  4. Assessing Compatibility of Direct Detection Data: Halo-Independent Global Likelihood Analyses

    CERN Document Server

    Gelmini, Graciela B; Witte, Samuel J

    2016-01-01

    We present two different halo-independent methods utilizing a global maximum likelihood that can assess the compatibility of dark matter direct detection data given a particular dark matter model. The global likelihood we use is comprised of at least one extended likelihood and an arbitrary number of Poisson or Gaussian likelihoods. In the first method we find the global best fit halo function and construct a two sided pointwise confidence band, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a "constrained parameter goodness-of-fit" test statistic, whose $p$-value we then use to define a "plausibility region" (e.g. where $p \\geq 10\\%$). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. $p < 10 \\%$). As an example we apply these methods to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic s...

  5. Multihit mode direct-detection laser radar system using a Geiger-mode avalanche photodiode.

    Science.gov (United States)

    Oh, Min Seok; Kong, Hong Jin; Kim, Tae Hoon; Hong, Keun Ho; Kim, Byung Wook; Park, Dong Jo

    2010-03-01

    In this paper, a direct-detection laser radar system that uses a Geiger-mode avalanche photodiode (GAPD) of relatively short dead time (45 ns) is described. A passively Q-switched microchip laser is used as a laser source and a compact peripheral component interconnect system, which includes a time-to-digital converter (TDC), is set up for fast signal processing. With both the GAPD and the TDC functioning multistop acquisition, the system operates in a multihit mode. The software for the three-dimensional visualization and an algorithm for the removal of noise are developed. It is shown that the single-shot precision of the system is approximately 10 cm (sigma) and the precision is improved by increasing the number of laser pulses to be averaged so that the precision of approximately 1 cm (sigma) was acquired with more than 150 laser pulses scattered from the target. The accuracy of the system is measured to be 12 cm when the energy of the emitted laser pulse varies with a factor of 7.

  6. The first direct detection of a gravitational microlens toward the Galactic bulge

    CERN Document Server

    Kozlowski, S; Mao, S; Wood, A

    2007-01-01

    We present a direct detection of the gravitational lens that caused the microlensing event MACHO-95-BLG-37. This is the first fully resolved microlensing system involving a source in the Galactic bulge, and the second such system in general. The lens and source are clearly resolved in images taken with the High Resolution Channel of the Advanced Camera for Surveys on board the Hubble Space Telescope (HST) ~9 years after the microlensing event. Only one plausible scenario fits all currently available data without invoking unusual physics or geometry. The lens is most likely a 0.6 solar mass main-sequence star of spectral type K2 with a sub-solar metallicity and located at a distance of ~3.5 kpc. However, in the view of challenges and limitations of the present data combined with a natural scatter in the physical properties of stars in the Galaxy, it is possible that different solutions will be found with the addition of new observations.

  7. Detection of Fast-Moving Waves Propagating Outward along Sunspots' Radial Direction in the Photosphere

    CERN Document Server

    Zhao, Junwei; Hartlep, Thomas; Kosovichev, Alexander G

    2015-01-01

    Helioseismic and magnetohydrodynamic waves are abundant in and above sunspots. Through cross-correlating oscillation signals in the photosphere observed by the SDO/HMI, we reconstruct how waves propagate away from virtual wave sources located inside a sunspot. In addition to the usual helioseismic wave, a fast-moving wave is detected traveling along the sunspot's radial direction from the umbra to about 15 Mm beyond the sunspot boundary. The wave has a frequency range of 2.5 - 4.0 mHz with a phase velocity of 45.3 km/s, substantially faster than the typical speeds of Alfven and magnetoacoustic waves in the photosphere. The observed phenomenon is consistent with a scenario of that a magnetoacoustic wave is excited at approximately 5 Mm beneath the sunspot, and its wavefront travels to and sweeps across the photosphere with a speed higher than the local magnetoacoustic speed. The fast-moving wave, if truly excited beneath the sunspot's surface, will help open a new window to study the internal structure and dyn...

  8. Prompt directional detection of galactic supernova by combining large liquid scintillator neutrino detectors

    CERN Document Server

    Fischer, V; Lasserre, T; Volpe, C; Cribier, M; Durero, M; Gaffiot, J; Houdy, T; Letourneau, A; Mention, G; Pequignot, M; Sibille, V; Vivier, M

    2015-01-01

    Core-collapse supernovae produce an intense burst of electron antineutrinos in the few-tens-of-MeV range. Several Large Liquid Scintillator-based Detectors (LLSD) are currently operated worldwide, being very effective for low energy antineutrino detection through the Inverse Beta Decay (IBD) process. In this article, we develop a procedure for the prompt extraction of the supernova location by revisiting the details of IBD kinematics over the broad energy range of supernova neutrinos. Combining all current scintillator-based detector, we show that one can locate a canonical supernova at 10 kpc with an accuracy of 45 degrees (68% C.L.). After the addition of the next generation of scintillator-based detectors, the accuracy could reach 12 degrees (68% C.L.), therefore reaching the performances of the large water Cerenkov neutrino detectors. We also discuss a possible improvement of the SuperNova Early Warning System (SNEWS) inter-experiment network with the implementation of a directionality information in each...

  9. Detection and confirmation of serum lipid biomarkers for preeclampsia using direct infusion mass spectrometry[S

    Science.gov (United States)

    Anand, Swati; Young, SydneyA.; Esplin, M. Sean; Peaden, Benjamin; Tolley, H. Dennis; Porter, T. Flint; Varner, Michael W.; D’Alton, Mary E.; Jackson, Bruce J.; Graves, Steven W.

    2016-01-01

    Despite substantial research, the early diagnosis of preeclampsia remains elusive. Lipids are now recognized to be involved in regulation and pathophysiology of some disease. Shotgun lipidomic studies were undertaken to determine whether serum lipid biomarkers exist that predict preeclampsia later in the same in pregnancy. A discovery study was performed using sera collected at 12–14 weeks pregnancy from 27 controls with uncomplicated pregnancies and 29 cases that later developed preeclampsia. Lipids were extracted and analyzed by direct infusion into a TOF mass spectrometer. MS signals, demonstrating apparent differences were selected, their abundances determined, and statistical differences tested. Statistically significant lipid markers were reevaluated in a second confirmatory study having 43 controls and 37 preeclampsia cases. Multi-marker combinations were developed using those lipid biomarkers confirmed in the second study. The initial study detected 45 potential preeclampsia markers. Of these, 23 markers continued to be statistically significant in the second confirmatory set. Most of these markers, representing several lipid classes, were chemically characterized, typically providing lipid class and potential molecular components using MS2. Several multi-marker panels with areas under the curve >0.85 and high predictive values were developed. Developed panels of serum lipidomic biomarkers appear to be able to identify most women at risk for preeclampsia in a given pregnancy at 12–14 weeks gestation. PMID:26891737

  10. Direct Detection of Pu-242 with a Metallic Magnetic Calorimeter Gamma-Ray Detector

    Science.gov (United States)

    Bates, C.; Pies, C.; Kempf, S.; Hengstler, D.; Fleischmann, A.; Gastaldo, L.; Enss, C.; Friedrich, S.

    2016-07-01

    Cryogenic high-resolution γ -ray detectors can improve the accuracy of non-destructive assay (NDA) of nuclear materials in cases where conventional high-purity germanium detectors are limited by line overlap or by the Compton background. We have improved the performance of gamma detectors based on metallic magnetic calorimeters (MMCs) by separating the 0.5 × 2 × 0.25 mm3 Au absorber from the Au:Er sensor with sixteen 30-\\upmu m-diameter Au posts. This ensures that the entire γ -ray energy thermalizes in the absorber before heating the Au:Er sensor, and improves the energy resolution at 35 mK to as low as 90 eV FWHM at 60 keV. This energy resolution enables the direct detection of γ -rays from Pu-242, an isotope that cannot be measured by traditional NDA and whose concentration is therefore inferred through correlations with other Pu isotopes. The Pu-242 concentration of 11.11 ± 0.42 % measured by NDA with MMCs agrees with mass spectrometry results and exceeds the accuracy of correlation measurements.

  11. Frequency interleaving towards spectrally efficient directly detected optical OFDM for next-generation optical access networks.

    Science.gov (United States)

    Mehedy, Lenin; Bakaul, Masuduzzaman; Nirmalathas, Ampalavanapillai

    2010-10-25

    In this paper, we theoretically analyze and demonstrate that spectral efficiency of a conventional direct detection based optical OFDM system (DDO-OFDM) can be improved significantly using frequency interleaving of adjacent DDO-OFDM channels where OFDM signal band of one channel occupies the spectral gap of other channel and vice versa. We show that, at optimum operating condition, the proposed technique can effectively improve the spectral efficiency of the conventional DDO-OFDM system as much as 50%. We also show that such a frequency interleaved DDO-OFDM system, with a bit rate of 48 Gb/s within 25 GHz bandwidth, achieves sufficient power budget after transmission over 25 km single mode fiber to be used in next-generation time-division-multiplexed passive optical networks (TDM-PON). Moreover, by applying 64- quadrature amplitude modulation (QAM), the system can be further scaled up to 96 Gb/s with a power budget sufficient for 1:16 split TDM-PON.

  12. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Traviesa-Alvarez, J.M. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Costa-Fernandez, J.M. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Pereiro, R. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Sanz-Medel, A. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain)]. E-mail: asm@uniovi.es

    2007-04-18

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10{sup -4} M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples.

  14. Direct detection of the tertiary component in the massive multiple HD 150136 with VLTI

    Science.gov (United States)

    Sanchez-Bermudez, J.; Schödel, R.; Alberdi, A.; Barbá, R. H.; Hummel, C. A.; Maíz Apellániz, J.; Pott, J.-U.

    2013-06-01

    Context. Massive stars are of fundamental importance for almost all aspects of astrophysics, but there still exist large gaps in our understanding of their properties and formation because they are rare and therefore distant. It has been found that most O-stars are multiples. It may well be that almost all massive stars are born as triples or higher multiples, but their large distances require milliarcsecond angular resolution for a direct detection of the companions. Aims: HD 150136 is the nearest system to Earth with >100 M⊙ and provides a unique opportunity to study an extremely massive system. Recently, evidence for the existence of a third component in HD 150136, in addition to the tight spectroscopic binary that forms the main component, was found in spectroscopic observations. Our aim was to image and obtain astrometric and photometric measurements of this component using long-baseline optical interferometry to further constrain the nature of this component. Methods: We observed HD 150136 with the near-infrared instrument AMBER attached to the ESO VLT Interferometer, which provides an angular resolution of 2 mas. The recovered closure phases are robust to systematic errors and provide unique information on the source asymmetry. Therefore, they are of crucial relevance for both image reconstruction and model fitting of the source structure. Results: The third component in HD 150136 is clearly detected in the high-quality data from AMBER. It is located at a projected angular distance of 7.3 mas, or about 13 AU at the line-of-sight distance of HD 150136, at a position angle of 209 degrees east of north, and has a flux ratio of 0.25 with respect to the inner binary. Our findings agree with previous results and have permitted us to improve the orbital solutions of the tertiary around the inner system. Conclusions: We resolved the third component of HD 150136 in J, H and K filters. The luminosity and color of the tertiary agrees with the predictions and shows

  15. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved...... by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization......Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens...

  16. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    OpenAIRE

    Ana Sofia Ferreira; Pedro Costa; Teresa Rocha; Ana Amaro; Maria Luísa Vieira; Ahmed Ahmed; Gertrude Thompson; Hartskeerl, Rudy A.; João Inácio

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpet...

  17. Micro-spec: an Integrated Direct-detection Spectrometer for Far-infrared Space Telescopes

    Science.gov (United States)

    Cataldo, Giuseppe; Hsieh, Wen-Ting; Huang, Wei-Chung; Moseley, S. Harvey; Stevenson, Thomas R.; Wollack, Edward J.

    2014-01-01

    The far-infrared and submillimeter portions of the electromagnetic spectrum provide a unique view of the astrophysical processes present in the early universe. Our ability to fully explore this rich spectral region has been limited, however, by the size and cost of the cryogenic spectrometers required to carry out such measurements.Micro-Spec (µ-Spec) is a high-sensitivity, direct-detection spectrometer concept working in the 450-1000 (micrometers) wavelength range which will enable a wide range of flight missions that would otherwise be challenging due tothe large size of current instruments with the required spectral resolution and sensitivity. The spectrometer design utilizes two internal antenna arrays, one for transmitting and one for receiving, superconducting microstrip transmission lines for power division and phase delay, and an array of microwave kinetic inductance detectors (MKIDs) to achieve these goals. The instrument will be integrated on a approximately 10 sq cm silicon chip and can therefore become an important capability under the low background conditions accessible via space and high-altitude borne platforms. In this paper, an optical design methodology for micro-Spec is presented, with particular attention given to its two-dimensional diffractive region, where the light of different wavelengths is focused on the different detectors. The method is based on the maximization of the instrument resolving power and minimization of the RMS phase error on the instrument focal plane. This two-step optimization can generate geometrical configurations given specific requirements on spectrometer size, operating spectral range and performance.Two point designs with resolving power of 260 and 520 and an RMS phase error less than approximately 0.004 radians were developed for initial demonstration and will be the basis of future instruments with resolving power up to about 1200.

  18. Detection and prediction of Streptococcus pneumoniae serotypes directly from nasopharyngeal swabs using PCR.

    Science.gov (United States)

    Lang, Amanda L S; McNeil, Shelly A; Hatchette, Todd F; Elsherif, May; Martin, Irene; LeBlanc, Jason J

    2015-08-01

    Monitoring Streptococcus pneumoniae serotype distribution is important to assess the impact and effectiveness of pneumococcal vaccine programs. With the challenges of Quellung serotyping, PCR-based serotype prediction is increasingly being used for large-scale epidemiological studies. This study used real-time (RT)-PCR targeting the genes encoding autolysin (lytA) and capsular biosynthesis gene A (cpsA) of S. pneumoniae in nucleic acids extracted directly from nasopharyngeal (NP) swabs submitted for viral studies. If the specimen was lytA or cpsA PCR-positive, then serotype prediction was performed on the same nucleic acid using eight conventional multiplex PCRs (cmPCRs) and seven real-time multiplex PCRs (rmPCRs). Of 1770 NP swabs, 132 (7.5  %) were lytA-positive and 122 (6.9  %) were positive for both targets (lytA and cpsA). Of the 122 lytA(+)cpsA(+) specimens, a serotype could be assigned in 52 (41.8  %) using cmPCR alone and the yield was increased to 70 (57.4  %) with the addition of rmPCR. Based on sensitivity, incremental yield and more efficient workflow, an algorithm was proposed where lytA and cpsA RT-PCR screening was followed by serotype deduction using rmPCR and a modified set of four instead of eight cmPCRs. This algorithm was validated for use on NP swabs, and the distribution of S. pneumoniae serotypes deduced from this approach showed good concordance with those obtained with cultured isolates serotyped by Quellung and PCR. Overall, molecular detection and serotyping of S. pneumoniae from NP swabs was found to be a valuable tool to assess S. pneumoniae colonization and monitor trends in serotype distribution.

  19. Directly detected (55)Mn MRI: application to phantoms for human hyperpolarized (13)C MRI development.

    Science.gov (United States)

    von Morze, Cornelius; Carvajal, Lucas; Reed, Galen D; Swisher, Christine Leon; Tropp, James; Vigneron, Daniel B

    2014-12-01

    In this work we demonstrate for the first time directly detected manganese-55 ((55)Mn) magnetic resonance imaging (MRI) using a clinical 3T MRI scanner designed for human hyperpolarized (13)C clinical studies with no additional hardware modifications. Due to the similar frequency of the (55)Mn and (13)C resonances, the use of aqueous permanganate for large, signal-dense, and cost-effective "(13)C" MRI phantoms was investigated, addressing the clear need for new phantoms for these studies. Due to 100% natural abundance, higher intrinsic sensitivity, and favorable relaxation properties, (55)Mn MRI of aqueous permanganate demonstrates dramatically increased sensitivity over typical (13)C phantom MRI, at greatly reduced cost as compared with large (13)C-enriched phantoms. A large sensitivity advantage (22-fold) was demonstrated. A cylindrical phantom (d=8 cm) containing concentrated aqueous sodium permanganate (2.7 M) was scanned rapidly by (55)Mn MRI in a human head coil tuned for (13)C, using a balanced steady state free precession acquisition. The requisite penetration of radiofrequency magnetic fields into concentrated permanganate was investigated by experiments and high frequency electromagnetic simulations, and found to be sufficient for (55)Mn MRI with reasonably sized phantoms. A sub-second slice-selective acquisition yielded mean image signal-to-noise ratio of ~60 at 0.5 cm(3) spatial resolution, distributed with minimum central signal ~40% of the maximum edge signal. We anticipate that permanganate phantoms will be very useful for testing HP (13)C coils and methods designed for human studies. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Antigen detection of rabies virus in brain smear using direct Rapid Immunohistochemistry Test

    Directory of Open Access Journals (Sweden)

    Damayanti R

    2014-03-01

    Full Text Available Rabies is zoonotic disease caused by a fatal, neurotropic virus. Rabies virus is classified into the Genus of Lyssavirus under the yang family of Rhabdoviridae. Rabies affecting hot- blooded animals, as well as human. Dogs, cats, monkeys are the vectors or reservoirs for rabies and the virus was transmitted through the saliva after infected animal’s bites. The aim of this study was to conduct rapid diagnosis to detect rabies viral antigen in brain smear using immunohistochemical (IHC method namely direct Rapid Immunohistochemical Test (dRIT. A total number of 119 brain samples were achieved from Bukittinggi Veterinary Laboratory, West Sumatra. Standardisation and validation of the method were compared to Fluorescent Antibody Test (FAT as a golden standard for rabies diagnosis. Results show that dRIT was a very good method, it can be performed within two hours without the need of fluorescent microscope. The samples were tested using FAT and from 119 samples tested, 80 (67.23% samples were positive for rabies and 39 (32.77% samples were negative for rabies whereas using dRIT showed that 78 (65.54% samples were positive for rabies and 41 (34.45% samples were negative for rabies. The dRIT results were validated by comparing them with FAT results as a golden standard for rabies. The relative sensitivity of dRIT to FAT was 97.5% and the relative specificity to FAT was 100% (with Kappa value of 0.976, stated as excellent. The achievement showed that dRIT is very potential diagnostic tool and is highly recommended to be used widely as a rapid diagnosis tool for rabies.

  1. Micro-Spec: an Integrated, Direct-Detection Spectrometer for Far-Infrared and Submillimeter Astronomy

    Science.gov (United States)

    Cataldo, Giuseppe

    2014-01-01

    The far-infrared and submillimeter portions of the electromagnetic spectrum provide a unique view of the astrophysical processes present in the early universe. Our ability to fully explore this rich spectral region has been limited, however, by the size and cost of the cryogenic spectrometers required to carry out such measurements. Micro-Spec (u-Spec) is a high-sensitivity, direct-detection spectrometer concept working in the 450-1000 micromillimeter wavelength range which will enable a wide range of flight missions that would otherwise be challenging due to the large size of current instruments with the required spectral resolution and sensitivity. The spectrometer design utilizes two internal antenna arrays, one for transmitting and one for receiving, superconducting microstrip transmission lines for power division and phase delay, and an array of microwave kinetic inductance detectors (MKIDs) to achieve these goals. The instrument will be integrated on a approximately 10 square cm silicon chip and can therefore become an important capability under the low background conditions accessible via space and high-altitude borne platforms. In this paper, an optical design methodology for Micro-Spec is presented, with particular attention given to its twodimensional diffractive region, where the light of different wavelengths is focused on the different detectors. The method is based on the maximization of the instrument resolving power and minimization of the RMS phase error on the instrument focal plane. This two-step optimization can generate geometrical configurations given specific requirements on spectrometer size, operating spectral range and performance. A point design with resolving power of 257, an RMS phase error less than 0.1 radians and four stigmatic points was developed for initial demonstration and will be the basis of future instruments with resolving power up to about 1200.

  2. First Extragalactic Direct Detection of Large-Scale Molecular Hydrogen in the Disk of NGC 891

    Science.gov (United States)

    Valentijn, Edwin A.; van der Werf, Paul P.

    1999-09-01

    We present direct observations of molecular hydrogen in the disk of the nearby edge-on spiral galaxy NGC 891. With Infrared Space Observatory's Short-Wavelength Spectrometer (SWS) it has been possible, for the first time, to observe the lowest pure rotational lines of H2 [S(0) at 28.2 μm and S(1) at 17.0 μm] at eight positions throughout the stellar disk of NGC 891. Both lines have been detected at all the surveyed positions out to 11 kpc north of the center of the galaxy. An H2 rotation curve is derived, and we compare H2 radial profiles with CO and H I data. The observed line ratios indicate relatively warm (T=150-230 K) molecular clouds scattered throughout the disk in addition to a massive cooler (T=80-90 K) component which dominates the signal in the outer regions. For H2 ortho/para ratios of 2-3, the cool gas has typical edge-on column densities (1-3)×1023 cm-2 (or ~3000 Msolar pc-2), in which case it outweighs the H I by a factor of 5-15. This factor matches well the mass required to resolve the problem of the missing matter of spiral galaxies within at least the optical disk. The newly discovered cool H2 component would be less massive in the case in which its dominant ortho/para ratio is near unity. We address the thermal balance of this component by a comparison with [C II] 158 μm data. When combining the new coolish molecular gas results with recent SCUBA cold dust observations of NGC 891, the total gas-to-dust ratio at rISO, an ESA project with instruments funded by ESA member states (especially the PI countries: France, Germany, the Netherlands, and the United Kingdom) and with the participation of ISAS and NASA.

  3. Recent Advances in Solution NMR: Fast Methods and Heteronuclear Direct Detection

    Energy Technology Data Exchange (ETDEWEB)

    Felli, I.C. [CERM and Depatment of Chemistry, University of Florence, 50019 (Italy); Brutscher, B. [DSV-IBS, 38027 Grenoble (France)

    2009-07-01

    Today, NMR spectroscopy is the technique of choice to investigate molecular structure, dynamics, and interactions in solution at atomic resolution. A major limitation of NMR spectroscopy for the study of biological macromolecules such as proteins, nucleic acids, and their complexes, has always been its low sensitivity, a consequence of the weak magnetic spin interactions. Therefore many efforts have been invested in the last decade to improve NMR instrumentation in terms of experimental sensitivity. As a result of these efforts, the availability of high-field magnets, cryogenically cooled probes, and probably in the near future hyper-polarization techniques, the intrinsic NMR sensitivity has increased by at least one order of magnitude. Stimulated by new challenges in the life sciences, these technical improvements have triggered the development of new NMR methods for the study of molecular systems of increasing size and complexity. Herein, we focus on two examples of recently developed NMR methodologies. First, advanced multidimensional data acquisition schemes provide a speed increase of several orders of magnitude. Second, NMR methods based on the direct detection of low-gamma nuclei present a new spectroscopic tool, highly complementary to conventional NMR techniques. These new methods provide powerful new NMR tools for the study of short-lived molecules, large and intrinsically unstructured proteins, paramagnetic systems, as well as for the characterization of molecular kinetic processes at atomic resolution. These examples illustrate how NMR is continuously adapting to the new challenges in the life sciences, with the focus shifting from the characterization of single biomolecules to an integrated view of interacting molecular networks observed at varying levels of biological organization. (authors)

  4. Molecular detection of Streptococcus agalactiae in bovine raw milk samples obtained directly from bulk tanks.

    Science.gov (United States)

    Elias, Acácia Orieth; Cortez, Adriana; Brandão, Paulo Eduardo; da Silva, Rodrigo Costa; Langoni, Helio

    2012-08-01

    Mastitis is the most common infectious disease affecting dairy cattle; in addition, it remains the most economically important disease of dairy industries around the world. Streptococcus agalactiae, a contagious pathogen associated with subclinical mastitis, is highly infectious. This bacterium can cause an increase in bulk tank bacterial counts (BTBC) and bulk tank somatic cell counts (BTSCC). The microbiological identification of S. agalactiae in samples from bulk tanks is an auxiliary method to control contagious mastitis. Thus, there are some limitations for time-consuming cultures or identification methods and additional concerns about the conservation and transport of samples. Bulk tank samples from 247 dairy farms were cultured and compared through polymerase chain reaction (PCR), directed to 16S rRNA genes of S. agalactiae, followed by BTBC and S. agalactiae isolation. The mean value of BTBC was 1.08×10(6) CFU mL(-1) and the bacterium was identified through the microbiological method in 98 (39.7%; CI(95%)=33.8-45.9%) and through PCR in 110 (44.5%; CI(95%)=38.5-50.8%) samples. Results indicated sensitivity of 0.8571±0.0353 (CI(95%)=0.7719-0.9196) and specificity of 0.8255±0.0311 (CI(95%)=0.7549-0.8827). The lack of significant difference between microbiological and molecular results (κ=0.6686±0.0477 and CI(95%)=0.5752-0.7620) indicated substantial agreement between the methods. This suggests that PCR can be used for bulk tank samples to detect contagious mastitis caused by S. agalactiae.

  5. Automatic Detection of Cortical Bones Haversian Osteonal Boundaries

    Directory of Open Access Journals (Sweden)

    Ilige Hage

    2015-10-01

    Full Text Available This work aims to automatically detect cement lines in decalcified cortical bone sections stained with H&E. Employed is a methodology developed previously by the authors and proven to successfully count and disambiguate the micro-architectural features (namely Haversian canals, canaliculi, and osteocyte lacunae present in the secondary osteons/Haversian system (osteon of cortical bone. This methodology combines methods typically considered separately, namely pulse coupled neural networks (PCNN, particle swarm optimization (PSO, and adaptive threshold (AT. In lieu of human bone, slides (at 20× magnification from bovid cortical bone are used in this study as proxy of human bone. Having been characterized, features with same orientation are used to detect the cement line viewed as the next coaxial layer adjacent to the outermost lamella of the osteon. Employed for this purpose are three attributes for each and every micro-sized feature identified in the osteon lamellar system: (1 orientation, (2 size (ellipse perimeter and (3 Euler number (a topological measure. From a training image, automated parameters for the PCNN network are obtained by forming fitness functions extracted from these attributes. It is found that a 3-way combination of these features attributes yields good representations of the overall osteon boundary (cement line. Near-unity values of classical metrics of quality (precision, sensitivity, specificity, accuracy, and dice suggest that the segments obtained automatically by the optimized artificial intelligent methodology are of high fidelity as compared with manual tracing. For bench marking, cement lines segmented by k-means did not fare as well. An analysis based on the modified Hausdorff distance (MHD of the segmented cement lines also testified to the quality of the detected cement lines vis-a-vis the k-means method.

  6. Isolation of human minisatellite loci detected by synthetic tandem repeat probes: direct comparison with cloned DNA fingerprinting probes.

    Science.gov (United States)

    Armour, J A; Vergnaud, G; Crosier, M; Jeffreys, A J

    1992-08-01

    As a direct comparison with cloned 'DNA fingerprinting' probes, we present the results of screening an ordered array Charomid library for hypervariable human loci using synthetic tandem repeat (STR) probes. By recording the coordinates of positive hybridization signals, the subset of clones within the library detected by each STR probe can be defined, and directly compared with the set of clones detected by naturally occurring (cloned) DNA fingerprinting probes. The STR probes vary in the efficiency of detection of polymorphic minisatellite loci; among the more efficient probes, there is a strong overlap with the sets of clones detected by the DNA fingerprinting probes. Four new polymorphic loci were detected by one or more of the STR probes but not by any of the naturally occurring repeats. Sequence comparisons with the probe(s) used to detect the locus suggest that a relatively poor match, for example 10 out of 14 bases in a limited region of each repeat, is sufficient for the positive detection of tandem repeats in a clone in this type of library screening by hybridization. These results not only provide a detailed evaluation of the usefulness of STR probes in the isolation of highly variable loci, but also suggest strategies for the use of these multi-locus probes in screening libraries for clones from hypervariable loci.

  7. Evaluation of new transport medium for detection of herpes simplex virus by culture and direct enzyme-linked immunosorbent assay.

    Science.gov (United States)

    Ogburn, J R; Hoffpauir, J T; Cole, E; Hood, K; Michael, D; Nguyen, T; Raden, S; Raju, B; Reisinger, V; Oefinger, P E

    1994-12-01

    The transport medium Multi-Microbe Media (M4) was evaluated prospectively by culture and direct enzyme-linked immunosorbent assay (ELISA) for detection of herpes simplex virus from 473 specimens. In addition, 377 specimens in Bartels Viral Transport Medium were evaluated. By using culture as a "gold standard," the ELISA sensitivity was approximately 85%, while the specificities exceeded 96% for both media.

  8. EVALUATION OF THE USE OF DIFFERENT ANTIBIOTICS IN THE DIRECT VIABLE COUNT METHOD TO DETECT FECAL ENTEROCOCCI

    Science.gov (United States)

    The detection of fecal pollution is performed via culturing methods in spite of the fact that culturable counts can severely underestimate the densities of fecal microorganisms. One approach that has been used to enumerate bacteria is the direct viable count method (DVC). The ob...

  9. Label-Free Direct Detection of miRNAs with Poly-Silicon Nanowire Biosensors

    Science.gov (United States)

    Gong, Changguo; Qi, Jiming; Xiao, Han; Jiang, Bin; Zhao, Yulan

    2015-01-01

    Background The diagnostic and prognostic value of microRNAs (miRNAs) in a variety of diseases is promising. The novel silicon nanowire (SiNW) biosensors have advantages in molecular detection because of their high sensitivity and fast response. In this study, poly-crystalline silicon nanowire field-effect transistor (poly-SiNW FET) device was developed to achieve specific and ultrasensitive detection of miRNAs without labeling and amplification. Methods The poly-SiNW FET was fabricated by a top–down Complementary Metal Oxide Semiconductor (CMOS) wafer fabrication based technique. Single strand DNA (ssDNA) probe was bind to the surface of the poly-SiNW device which was silanated and aldehyde-modified. By comparing the difference of resistance value before and after ssDNA and miRNA hybridization, poly-SiNW device can be used to detect standard and real miRNA samples. Results Poly-SiNW device with different structures (different line width and different pitch) was applied to detect standard Let-7b sample with a detection limitation of 1 fM. One-base mismatched sequence could be distinguished meanwhile. Furthermore, these poly-SiNW arrays can detect snRNA U6 in total RNA samples extracted from HepG2 cells with a detection limitation of 0.2 μg/mL. In general, structures with pitch showed better results than those without pitch in detection of both Let-7b and snRNA U6. Moreover, structures with smaller pitch showed better detection efficacy. Conclusion Our findings suggest that poly-SiNW arrays could detect standard and real miRNA sample without labeling or amplification. Poly-SiNW biosensor device is promising for miRNA detection. PMID:26709827

  10. First Direct-Detection Constraints on eV-Scale Hidden-Photon Dark Matter with DAMIC at SNOLAB

    Energy Technology Data Exchange (ETDEWEB)

    Aguilar-Arevalo, A.; Amidei, D.; Bertou, X.; Butner, M.; Cancelo, G.; Castañeda Vázquez, A.; Cervantes Vergara, B. A.; Chavarria, A. E.; Chavez, C. R.; de Mello Neto, J. R. T.; D’Olivo, J. C.; Estrada, J.; Fernandez Moroni, G.; Gaïor, R.; Guardincerri, Y.; Hernández Torres, K. P.; Izraelevitch, F.; Kavner, A.; Kilminster, B.; Lawson, I.; Letessier-Selvon, A.; Liao, J.; Matalon, A.; Mello, V. B. B.; Molina, J.; Privitera, P.; Ramanathan, K.; Sarkis, Y.; Schwarz, T.; Settimo, M.; Sofo Haro, M.; Thomas, R.; Tiffenberg, J.; Tiouchichine, E.; Torres Machado, D.; Trillaud, F.; You, X.; Zhou, J.

    2017-04-05

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30 eV$c^{-2}$ with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter $\\kappa$ is competitive with constraints from solar emission, reaching a minimum value of 2.2$\\times$$10^{-14}$ at 17 eV$c^{-2}$. These results are the most stringent direct detection constraints on hidden-photon dark matter with masses 3-12 eV$c^{-2}$ and the first demonstration of direct experimental sensitivity to ionization signals $<$12 eV from dark matter interactions.

  11. First direct detection constraints on eV-scale hidden-photon dark matter with DAMIC at SNOLAB

    CERN Document Server

    Aguilar-Arevalo, A; Bertou, X; Butner, M; Cancelo, G; Vázquez, A Castañeda; Vergara, B A Cervantes; Chavarria, A E; Chavez, C R; Neto, J R T de Mello; D'Olivo, J C; Estrada, J; Moroni, G Fernandez; Gaïor, R; Guardincerri, Y; Torres, K P Hernández; Izraelevitch, F; Kavner, A; Kilminster, B; Lawson, I; Letessier-Selvon, A; Liao, J; Matalon, A; Mello, V B B; Molina, J; Privitera, P; Ramanathan, K; Sarkis, Y; Schwarz, T; Settimo, M; Haro, M Sofo; Thomas, R; Tiffenberg, J; Tiouchichine, E; Machado, D Torres; Trillaud, F; You, X; Zhou, J

    2016-01-01

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30 eV$c^{-2}$ with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter $\\kappa$ is competitive with constraints from solar emission, reaching a minimum value of 2.2$\\times$$10^{-14}$ at 17 eV$c^{-2}$. These results are the most stringent direct detection constraints on hidden-photon dark matter with masses 3-12 eV$c^{-2}$ and the first demonstration of direct experimental sensitivity to ionization signals $<$12 eV from dark matter interactions.

  12. Upward- directed charged particle flux detection in the MSL/RAD instrument

    Science.gov (United States)

    Appel, Jan Kristoffer; Zeitlin, Cary; Koehler, Jan; Hassler, Donald M.; Rafkin, Scot; Guo, Jingnan; Ehresmann, Bent; Wimmer-Schweingruber, Robert; Matthiä, Daniel; Lohf, Henning

    2016-07-01

    The Mars Science Laboratory rover Curiosity, operating on the surface of Mars, is exposed to radiation fluxes from above and below. Galactic Cosmic Rays travel through the Martian atmosphere, producing a modified spectrum consisting of both primary and secondary particles at ground level. These particles produce an upward- directed secondary particle spectrum as they interact with the Martian soil.These upward- directed particles then pass through the rover and enter the Radiation Assessment Detector onboard the rover from below. Here, we characterize the upward- and downward- directed spectra measured by the detector through a combination of GEANT4 and Planetocosmics simulations. We develop and demonstrate a method to discriminate between upward- and downward- directed particle fluxes during the MSL cruise phase to Mars and the surface science phase. This method enables us to extend the energy range and directionality of RAD beyond its design limits.

  13. An assessment of independent component analysis for detection of military targets from hyperspectral images

    Science.gov (United States)

    Tiwari, K. C.; Arora, M. K.; Singh, D.

    2011-10-01

    Hyperspectral data acquired over hundreds of narrow contiguous wavelength bands are extremely suitable for target detection due to their high spectral resolution. Though spectral response of every material is expected to be unique, but in practice, it exhibits variations, which is known as spectral variability. Most target detection algorithms depend on spectral modelling using a priori available target spectra In practice, target spectra is, however, seldom available a priori. Independent component analysis (ICA) is a new evolving technique that aims at finding out components which are statistically independent or as independent as possible. The technique therefore has the potential of being used for target detection applications. A assessment of target detection from hyperspectral images using ICA and other algorithms based on spectral modelling may be of immense interest, since ICA does not require a priori target information. The aim of this paper is, thus, to assess the potential of ICA based algorithm vis a vis other prevailing algorithms for military target detection. Four spectral matching algorithms namely Orthogonal Subspace Projection (OSP), Constrained Energy Minimisation (CEM), Spectral Angle Mapper (SAM) and Spectral Correlation Mapper (SCM), and four anomaly detection algorithms namely OSP anomaly detector (OSPAD), Reed-Xiaoli anomaly detector (RXD), Uniform Target Detector (UTD) and a combination of Reed-Xiaoli anomaly detector and Uniform Target Detector (RXD-UTD) were considered. The experiments were conducted using a set of synthetic and AVIRIS hyperspectral images containing aircrafts as military targets. A comparison of true positive and false positive rates of target detections obtained from ICA and other algorithms plotted on a receiver operating curves (ROC) space indicates the superior performance of the ICA over other algorithms.

  14. Unregulated use of antibiotics in Siliguri city vis-a-vis occurrence of MAR bacteria in community waste water and river Mahananda, and their potential for resistance gene transfer.

    Science.gov (United States)

    Mukherjee, Shriparna; Bhadra, Bhaskar; Chakraborty, Ratna; Gurung, Anirudra; Some, Sudip; Chakraborty, Ranadhir

    2005-04-01

    The unregulated use of antibiotics, including therapeutic and prophylactic prescribing, in the fastest growing city of West Bengal, Siliguri, was studied indirectly from a random survey conducted on retail medicine sellers at their counters. Ciprofloxacin, ampicillin, norfioxacin and amoxycillin were the highest retailed antibiotics and 58% of the city pharmacies sold antibiotics even without prescriptions. To understand the influence of the extent of antibiotic use by the community on the collective bacterial flora in the aquatic environment, we have determined the fraction(s) of Standard Plate Count (SPC) bacteria resistant to different antibiotics and multiple antibiotic resistance (MAR) profile of resistant SPC isolates from two municipal open drains and Mahananda river water samples of Siliguri. Within the MAR groups of Drain I and Drain II samples, 37.44% and 77.43% respectively were resistant to all seven antibiotics (ampicillin, chloramphenicol, ciprofloxacin, kanamycin, netilmicin, streptomycin and tetracycline) used in the study. Twenty Gram-negative SPC MAR isolates were examined for the presence of plasmids. Antibiotic resistance was shown to be associated with a carriage of a 47 kb (D1QN - 9), 48 kb (D2QN - 14) and 49.4 and 3.6 kb (MR - 1) plasmids, which were transmissible to the Escherichia coli DH5alpha recipient. The rapid spread of antibiotic resistance genes in bacterial population as a consequence of indiscriminate use of antibiotics, which can be partly attributed to plasmid-mediated horizontal transfer was discussed.

  15. Production of 2-hydroxy-4-methoxybenzaldehyde in roots of tissue culture raised and acclimatized plants of Decalepis hamiltonii Wight & Arn., an endangered shrub endemic to Southern India and evaluation of its performance vis-a-vis plants from natural habitat.

    Science.gov (United States)

    Giridhar, P; Rajasekaran, T; Nagarajan, S; Ravishankar, G A

    2004-01-01

    Axillary buds obtained from field grown plants of D. hamiltonii were used to initiate multiple shoots on Murashige and Skoog's medium (MS) supplemented with 2 mg L(-1) 6-benzyl aminopurine (BA) and 0.5 mg L(-1) indole-3-acetic acid (IAA). Profuse rooting was achieved when the actively growing shoots were cultured on MS medium supplemented with 1.0 mg l(-1) indole-3-butyric acid (IBA). Regenerated plants were grown successfully in the plains, in contrast to wild growth in high altitudes and rocky crevices of hilly regions. Roots of different sizes from one-year-old tissue culture raised field grown plants had the same profile of 2-hydroxy-4-methoxybenzaldehyde as that of wild plants. A maximum of 0.14% and 0.12% 2-hydroxy-4-methoxybenzaldehyde was produced in roots of one year old tissue culture derived plants and greenhouse grown plants respectively.

  16. Reflection on the efficiency criteria for a long duration disposal with respect to temporary abandonment situations; Reflexion sur les criteres de performance d'un entreposage de longue duree (ELD) vis-a-vis des situations de delaissement temporaire

    Energy Technology Data Exchange (ETDEWEB)

    Heriard-Dubreuil, G.; Gadbois, S. [Mutadis, 75 - Paris (France); Chieber, C.; Schneider, Th. [Centre d' Etude sur l' Evaluation de la Protection dans le Domaine Nucleaire, 92 - Fontenay aux Roses (France)

    2002-08-15

    A study carried out by Mutadis and CEPN, on request of the CEA, aimed at supplying some elements allowing to elaborate some performance criteria for a long-term management system in front of situations of temporary abandonment of radioactive waste disposal facilities. The first part of the study has been the identification of case studies illustrating situations of loss of maintenance or temporary abandonment. The second phase has been the selection and analysis of 4 case studies (the ancient underground cavities in Ile-de-France, the regulation relative to new underground quarries, the abandoned mines in Loraine basin, and Unesco's approach for the protection of mankind world patrimony). These cases have been analysed with respect to various aspects: actors involved, construction management and memory preservation, liabilities in time and space, prevention means, scheduling, and resumption strategies. The concepts of abandonment, scheduling and resumption have been precised and analysed in a third part according to the case studies. Three goals - avoiding abandonment, encouraging scheduling and resumption - and eight characteristics are drawn from this analysis, which are indicators of the robustness of the system implemented to fulfill these 3 goals. These characteristics appear as strongly interdependent. (J.S.)

  17. Direct visual detection of DNA based on the light scattering of silica nanoparticles on a human papillomavirus DNA chip.

    Science.gov (United States)

    Piao, Jing Yu; Park, Eun Hee; Choi, Kihwan; Quan, Bo; Kang, Dong Ho; Park, Pan Yun; Kim, Dai Sik; Chung, Doo Soo

    2009-12-15

    A detection system for a human papillomavirus (HPV) DNA chip based on the light scattering of aggregated silica nanoparticle probes is presented. In the assay, a target HPV DNA is sandwiched between the capture DNA immobilized on the chip and the probe DNA immobilized on the plain silica nanoparticle. The spot where the sandwich reaction occurs appears bright white and is readily distinguishable to the naked eye. Scanning electron microscopy images clearly show the aggregation of the silica nanoparticle probes. When three different sized (55 nm, 137 nm, 286 nm) plain silica nanoparticles were compared, probes of the larger silica nanoparticles showed a higher scattering intensity. Using 286-nm silica nanoparticles, the spots obtained with 200 pM of target DNA were visually detectable. The demonstrated capability to detect a disease related target DNA with direct visualization without using a complex detection instrument provides the prerequisite for the development of portable testing kits for genotyping.

  18. Machine Learning Techniques for Optical Performance Monitoring from Directly Detected PDM-QAM Signals

    DEFF Research Database (Denmark)

    Thrane, Jakob; Wass, Jesper; Piels, Molly

    2017-01-01

    Linear signal processing algorithms are effective in dealing with linear transmission channel and linear signal detection, while the nonlinear signal processing algorithms, from the machine learning community, are effective in dealing with nonlinear transmission channel and nonlinear signal...... detection. In this paper, a brief overview of the various machine learning methods and their application in optical communication is presented and discussed. Moreover, supervised machine learning methods, such as neural networks and support vector machine, are experimentally demonstrated for in-band optical...

  19. Direct and Sensitive Detection of CWA Simulants by Active Capillary Plasma Ionization Coupled to a Handheld Ion Trap Mass Spectrometer

    Science.gov (United States)

    Wolf, Jan-Christoph; Etter, Raphael; Schaer, Martin; Siegenthaler, Peter; Zenobi, Renato

    2016-07-01

    An active capillary plasma ionization (ACI) source was coupled to a handheld mass spectrometer (Mini 10.5; Aston Labs, West Lafayette, IN, USA) and applied to the direct gas-phase detection and quantification of chemical warfare agent (CWA) related chemicals. Complementing the discontinuous atmospheric pressure interface (DAPI) of the Mini 10.5 mass spectrometer with an additional membrane pump, a quasi-continuous sample introduction through the ACI source was achieved. Nerve agent simulants (three dialkyl alkylphosphonates, a dialkyl phosporamidate, and the pesticide dichlorvos) were detected at low gas-phase concentrations with limits of detection ranging from 1.0 μg/m3 to 6.3 μg/m3. Our results demonstrate a sensitivity enhancement for portable MS-instrumentation by using an ACI source, enabling direct, quantitative measurements of volatile organic compounds. Due to its high sensitivity, selectivity, low power consumption (<80 W) and weight (<13 kg), this instrumentation has the potential for direct on-site CWA detection as required by military or civil protection.

  20. Direct and Sensitive Detection of CWA Simulants by Active Capillary Plasma Ionization Coupled to a Handheld Ion Trap Mass Spectrometer.

    Science.gov (United States)

    Wolf, Jan-Christoph; Etter, Raphael; Schaer, Martin; Siegenthaler, Peter; Zenobi, Renato

    2016-07-01

    An active capillary plasma ionization (ACI) source was coupled to a handheld mass spectrometer (Mini 10.5; Aston Labs, West Lafayette, IN, USA) and applied to the direct gas-phase detection and quantification of chemical warfare agent (CWA) related chemicals. Complementing the discontinuous atmospheric pressure interface (DAPI) of the Mini 10.5 mass spectrometer with an additional membrane pump, a quasi-continuous sample introduction through the ACI source was achieved. Nerve agent simulants (three dialkyl alkylphosphonates, a dialkyl phosporamidate, and the pesticide dichlorvos) were detected at low gas-phase concentrations with limits of detection ranging from 1.0 μg/m(3) to 6.3 μg/m(3). Our results demonstrate a sensitivity enhancement for portable MS-instrumentation by using an ACI source, enabling direct, quantitative measurements of volatile organic compounds. Due to its high sensitivity, selectivity, low power consumption (<80 W) and weight (<13 kg), this instrumentation has the potential for direct on-site CWA detection as required by military or civil protection. Graphical Abstract ᅟ.