WorldWideScience

Sample records for direct detection signals

  1. The median recoil direction as a WIMP directional detection signal

    OpenAIRE

    Green, Anne M; MORGAN, BEN

    2010-01-01

    Direct detection experiments have reached the sensitivity required to detect dark matter WIMPs. Demonstrating that a putative signal is due to WIMPs, and not backgrounds, is a major challenge however. The direction dependence of the WIMP scattering rate provides a potential WIMP `smoking gun'. If the WIMP distribution is predominantly smooth, the Galactic recoil distribution is peaked in the direction opposite to the direction of Solar motion. Previous studies have found that, for an ideal de...

  2. The median recoil direction as a WIMP directional detection signal

    CERN Document Server

    Green, Anne M

    2010-01-01

    Direct detection experiments have reached the sensitivity required to detect dark matter WIMPs. Demonstrating that a putative signal is due to WIMPs, and not backgrounds, is a major challenge however. The direction dependence of the WIMP scattering rate provides a potential WIMP `smoking gun'. If the WIMP distribution is predominantly smooth, the Galactic recoil distribution is peaked in the direction opposite to the direction of Solar motion. Previous studies have found that, for an ideal detector, of order 10 WIMP events would be sufficient to reject isotropy, and rule out an isotropic background. We examine how the median recoil direction could be used to confirm the WIMP origin of an anisotropic recoil signal. Specifically we determine the number of events required to reject the null hypothesis that the median direction is random (corresponding to an isotropic Galactic recoil distribution) at 95% confidence. We find that for zero background 31 events are required, a factor of roughly 2 more than are requi...

  3. Machine Learning Techniques for Optical Performance Monitoring from Directly Detected PDM-QAM Signals

    DEFF Research Database (Denmark)

    Thrane, Jakob; Wass, Jesper; Piels, Molly

    2017-01-01

    Linear signal processing algorithms are effective in dealing with linear transmission channel and linear signal detection, while the nonlinear signal processing algorithms, from the machine learning community, are effective in dealing with nonlinear transmission channel and nonlinear signal...... detection. In this paper, a brief overview of the various machine learning methods and their application in optical communication is presented and discussed. Moreover, supervised machine learning methods, such as neural networks and support vector machine, are experimentally demonstrated for in-band optical...

  4. Nonlinear impairment compensation for DFT-S OFDM signal transmission with directly modulated laser and direct detection

    Science.gov (United States)

    Gou, Pengqi; Wang, Kaihui; Qin, Chaoyi; Yu, Jianjun

    2017-03-01

    We experimentally demonstrate a 16-ary quadrature amplitude modulation (16QAM) DFT-spread optical orthogonal frequency division multiplexing (OFDM) transmission system utilizing a cost-effective directly modulated laser (DML) and direct detection. For 20-Gbaud 16QAM-OFDM signal, with the aid of nonlinear equalization (NLE) algorithm, we respectively provide 6.2-dB and 5.2-dB receiver sensitivity improvement under the hard-decision forward-error-correction (HD-FEC) threshold of 3.8×10-3 for the back-to-back (BTB) case and after transmission over 10-km standard single mode fiber (SSMF) case, related to only adopt post-equalization scheme. To our knowledge, this is the first time to use dynamic nonlinear equalizer (NLE) based on the summation of the square of the difference between samples in one IM/DD OFDM system with DML to mitigate nonlinear distortion.

  5. Electronic polarization-division demultiplexing based on digital signal processing in intensity-modulation direct-detection optical communication systems.

    Science.gov (United States)

    Kikuchi, Kazuro

    2014-01-27

    We propose a novel configuration of optical receivers for intensity-modulation direct-detection (IM · DD) systems, which can cope with dual-polarization (DP) optical signals electrically. Using a Stokes analyzer and a newly-developed digital signal-processing (DSP) algorithm, we can achieve polarization tracking and demultiplexing in the digital domain after direct detection. Simulation results show that the power penalty stemming from digital polarization manipulations is negligibly small.

  6. Loop-induced dark matter direct detection signals from gamma-ray lines

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Haisch, Ulrich; Kahlhoefer, Felix

    2012-01-01

    Improved limits as well as tentative claims for dark matter annihilation into gamma-ray lines have been presented recently. We study the direct detection cross section induced from dark matter annihilation into two photons in a model-independent fashion, assuming no additional couplings between...... dark matter and nuclei. We find a striking non-standard recoil spectrum due to different destructively interfering contributions to the dark matter nucleus scattering cross section. While in the case of s-wave annihilation the current sensitivity of direct detection experiments is insufficient...... to compete with indirect detection searches, for p-wave annihilation the constraints from direct searches are comparable. This will allow to test dark matter scenarios with p-wave annihilation that predict a large di-photon annihilation cross section in the next generation of experiments....

  7. Raman Spectra of Nanodiamonds: New Treatment Procedure Directed for Improved Raman Signal Marker Detection

    Directory of Open Access Journals (Sweden)

    Raoul R. Nigmatullin

    2013-01-01

    Full Text Available Detonation nanodiamonds (NDs have shown to be promising agents in several industries, ranging from electronic to biomedical applications. These NDs are characterized by small particle size ranging from 3 to 6 nm, while having a reactive surface and a stable inert core. Nanodiamonds can exhibit novel intrinsic properties such as fluorescence, high refractive index, and unique Raman signal making them very attractive imaging agents. In this work, we used several nanodiamond preparations for Raman spectroscopic studies. We exposed these nanodiamonds to increasing temperature treatments at constant heating rates (425–575°C aiding graphite release. We wanted to correlate changes in the nanodiamond surface and properties with Raman signal which could be used as a detection marker. These observations would hold potential utility in biomedical imaging applications. First, the procedure of optimal linear smoothing was applied successfully to eliminate the high-frequency fluctuations and to extract the smoothed Raman spectra. After that we applied the secondary Fourier transform as the fitting function based on some significant set of frequencies. The remnant noise was described in terms of the beta-distribution function. We expect this data treatment to provide better results in biomolecule tracking using nanodiamond base Raman labeling.

  8. Receiver Signal to Noise Ratios for IPDA Lidars Using Sine-wave and Pulsed Laser Modulation and Direct Detections

    Science.gov (United States)

    Sun, Xiaoli; Abshire, James B.

    2011-01-01

    Integrated path differential absorption (IPDA) lidar can be used to remotely measure the column density of gases in the path to a scattering target [1]. The total column gas molecular density can be derived from the ratio of the laser echo signal power with the laser wavelength on the gas absorption line (on-line) to that off the line (off-line). 80th coherent detection and direct detection IPDA lidar have been used successfully in the past in horizontal path and airborne remote sensing measurements. However, for space based measurements, the signal propagation losses are often orders of magnitude higher and it is important to use the most efficient laser modulation and detection technique to minimize the average laser power and the electrical power from the spacecraft. This paper gives an analysis the receiver signal to noise ratio (SNR) of several laser modulation and detection techniques versus the average received laser power under similar operation environments. Coherent detection [2] can give the best receiver performance when the local oscillator laser is relatively strong and the heterodyne mixing losses are negligible. Coherent detection has a high signal gain and a very narrow bandwidth for the background light and detector dark noise. However, coherent detection must maintain a high degree of coherence between the local oscillator laser and the received signal in both temporal and spatial modes. This often results in a high system complexity and low overall measurement efficiency. For measurements through atmosphere the coherence diameter of the received signal also limits the useful size of the receiver telescope. Direct detection IPDA lidars are simpler to build and have fewer constraints on the transmitter and receiver components. They can use much larger size 'photon-bucket' type telescopes to reduce the demands on the laser transmitter. Here we consider the two most widely used direct detection IPDA lidar techniques. The first technique uses two CW

  9. A novel SNP analysis method to detect copy number alterations with an unbiased reference signal directly from tumor samples

    Directory of Open Access Journals (Sweden)

    LaFramboise William A

    2011-01-01

    Full Text Available Abstract Background Genomic instability in cancer leads to abnormal genome copy number alterations (CNA as a mechanism underlying tumorigenesis. Using microarrays and other technologies, tumor CNA are detected by comparing tumor sample CN to normal reference sample CN. While advances in microarray technology have improved detection of copy number alterations, the increase in the number of measured signals, noise from array probes, variations in signal-to-noise ratio across batches and disparity across laboratories leads to significant limitations for the accurate identification of CNA regions when comparing tumor and normal samples. Methods To address these limitations, we designed a novel "Virtual Normal" algorithm (VN, which allowed for construction of an unbiased reference signal directly from test samples within an experiment using any publicly available normal reference set as a baseline thus eliminating the need for an in-lab normal reference set. Results The algorithm was tested using an optimal, paired tumor/normal data set as well as previously uncharacterized pediatric malignant gliomas for which a normal reference set was not available. Using Affymetrix 250K Sty microarrays, we demonstrated improved signal-to-noise ratio and detected significant copy number alterations using the VN algorithm that were validated by independent PCR analysis of the target CNA regions. Conclusions We developed and validated an algorithm to provide a virtual normal reference signal directly from tumor samples and minimize noise in the derivation of the raw CN signal. The algorithm reduces the variability of assays performed across different reagent and array batches, methods of sample preservation, multiple personnel, and among different laboratories. This approach may be valuable when matched normal samples are unavailable or the paired normal specimens have been subjected to variations in methods of preservation.

  10. Signal-signal beat interference cancellation in spectrally-efficient WDM direct-detection Nyquist-pulse-shaped 16-QAM subcarrier modulation.

    Science.gov (United States)

    Li, Zhe; Erkılınç, M Sezer; Pachnicke, Stephan; Griesser, Helmut; Bouziane, Rachid; Thomsen, Benn C; Bayvel, Polina; Killey, Robert I

    2015-09-01

    An experimental demonstration of direct-detection single-sideband Nyquist-pulse-shaped 16-QAM subcarrier modulated (Nyquist-SCM) transmission implementing a receiver-based signal-signal beat interference (SSBI) cancellation technique is described. The performance improvement with SSBI mitigation, which compensates for the nonlinear distortion caused by square-law detection, was quantified by simulations and experiments for a 7 × 25 Gb/s WDM Nyquist-SCM signal with a net optical information spectral density (ISD) of 2.0 (b/s)/Hz. A reduction of 3.6 dB in the back-to-back required OSNR at the HD-FEC threshold was achieved. The resulting reductions in BER in single channel and WDM transmission over distances of up to 800 km of uncompensated standard single-mode fiber (SSMF) achieved are presented.

  11. Machine Learning for Optical Performance Monitoring from Directly Detected PDM-QAM Signals

    DEFF Research Database (Denmark)

    Wass, J.; Thrane, Jakob; Piels, Molly

    2016-01-01

    Supervised machine learning methods are applied and demonstrated experimentally for inband OSNR estimation and modulation format classification in optical communication systems. The proposed methods accurately evaluate coherent signals up to 64QAM using only intensity information....

  12. A direct test of the unequal-variance signal detection model of recognition memory.

    Science.gov (United States)

    Mickes, Laura; Wixted, John T; Wais, Peter E

    2007-10-01

    Analyses of the receiver operating characteristic (ROC) almost invariably suggest that, on a recognition memory test, the standard deviation of memory strengths associated with the lures (sigma(lure)) is smaller than that of the targets (sigma(target)). Often, sigma(lure)/ sigma(target) approximately = 0.80. However, that conclusion is based on a model that assumes that the memory strength distributions are Gaussian in form. In two experiments, we investigated this issue in a more direct way by asking subjects to simply rate the memory strengths of targets and lures using a 20-point or a 99-point strength scale. The results showed that the standard deviation of the ratings made to the targets (S(target)) was, indeed, larger than the standard deviation of the ratings made to the lures (S(lure)). Moreover, across subjects, the ratio S(lure)/ S(target) correlated highly with the estimate of sigma(lure)/ sigma(target) obtained from ROC analysis, and both estimates were, on average, approximately equal to 0.80.

  13. A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling

    Directory of Open Access Journals (Sweden)

    Hammond Richard

    2010-02-01

    Full Text Available Abstract Background Nucleic acid based recognition of viral sequences can be used together with label-free biosensors to provide rapid, accurate confirmation of viral infection. To enhance detection sensitivity, gold nanoparticles can be employed with mass-sensitive acoustic biosensors (such as a quartz crystal microbalance by either hybridising nanoparticle-oligonucleotide conjugates to complimentary surface-immobilised ssDNA probes on the sensor, or by using biotin-tagged target oligonucleotides bound to avidin-modified nanoparticles on the sensor. We have evaluated and refined these signal amplification assays for the detection from specific DNA sequences of Herpes Simplex Virus (HSV type 1 and defined detection limits with a 16.5 MHz fundamental frequency thickness shear mode acoustic biosensor. Results In the study the performance of semi-homogeneous and homogeneous assay formats (suited to rapid, single step tests were evaluated utilising different diameter gold nanoparticles at varying DNA concentrations. Mathematical models were built to understand the effects of mass transport in the flow cell, the binding kinetics of targets to nanoparticles in solution, the packing geometries of targets on the nanoparticle, the packing of nanoparticles on the sensor surface and the effect of surface shear stiffness on the response of the acoustic sensor. This lead to the selection of optimised 15 nm nanoparticles that could be used with a 6 minute total assay time to achieve a limit of detection sensitivity of 5.2 × 10-12 M. Larger diameter nanoparticles gave poorer limits of detection than smaller particles. The limit of detection was three orders of magnitude lower than that observed using a hybridisation assay without nanoparticle signal amplification. Conclusions An analytical model was developed to determine optimal nanoparticle diameter, concentration and probe density, which allowed efficient and rapid optimisation of assay parameters

  14. Astrophysical limitations to the identification of dark matter: indirect neutrino signals vis-a-vis direct detection recoil rates

    CERN Document Server

    Serpico, Pasquale D

    2010-01-01

    A convincing identification of dark matter (DM) particles can probably be achieved only through a combined analysis of different detections strategies, which provides an effective way of removing degeneracies in the parameter space of DM models. In practice, however, this program is made complicated by the fact that different strategies depend on different physical quantities, or on the same quantities but in a different way, making the treatment of systematic errors rather tricky. We discuss here the uncertainties on the recoil rate in direct detection experiments and on the muon rate induced by neutrinos from dark matter annihilations in the Sun, and we show that, contrarily to the local DM density or overall cross section scale, irreducible astrophysical uncertainties affect the two rates in a different fashion, therefore limiting our ability to reconstruct the parameters of the dark matter particle. By varying within their respective errors astrophysical parameters such as the escape velocity and the velo...

  15. Reducing the influence of direct reflection on return signal detection in a 3D imaging lidar system by rotating the polarizing beam splitter.

    Science.gov (United States)

    Wang, Chunhui; Lee, Xiaobao; Cui, Tianxiang; Qu, Yang; Li, Yunxi; Li, Hailong; Wang, Qi

    2016-03-01

    The direction rule of the laser beam traveling through a deflected polarizing beam splitter (PBS) cube is derived. It reveals that, due to the influence of end-face reflection of the PBS at the detector side, the emergent beam coming from the incident beam parallels the direction of the original case without rotation, with only a very small translation interval between them. The formula of the translation interval is also given. Meanwhile, the emergent beam from the return signal at the detector side deflects at an angle twice that of the PBS rotation angle. The correctness has been verified by an experiment. The intensity transmittance of the emergent beam when propagating in the PBS is changes very little if the rotation angle is less than 35 deg. In a 3D imaging lidar system, by rotating the PBS cube by an angle, the direction of the return signal optical axis is separated from that of the origin, which can decrease or eliminate the influence of direct reflection caused by the prism end face on target return signal detection. This has been checked by experiment.

  16. Parametric Amplification For Detecting Weak Optical Signals

    Science.gov (United States)

    Hemmati, Hamid; Chen, Chien; Chakravarthi, Prakash

    1996-01-01

    Optical-communication receivers of proposed type implement high-sensitivity scheme of optical parametric amplification followed by direct detection for reception of extremely weak signals. Incorporates both optical parametric amplification and direct detection into optimized design enhancing effective signal-to-noise ratios during reception in photon-starved (photon-counting) regime. Eliminates need for complexity of heterodyne detection scheme and partly overcomes limitations imposed on older direct-detection schemes by noise generated in receivers and by limits on quantum efficiencies of photodetectors.

  17. Detection of signals in noise

    CERN Document Server

    Whalen, Anthony D; Declaris, Nicholas

    1971-01-01

    Detection of Signals in Noise serves as an introduction to the principles and applications of the statistical theory of signal detection. The book discusses probability and random processes; narrowband signals, their complex representation, and their properties described with the aid of the Hilbert transform; and Gaussian-derived processes. The text also describes the application of hypothesis testing for the detection of signals and the fundamentals required for statistical detection of signals in noise. Problem exercises, references, and a supplementary bibliography are included after each c

  18. Demonstration of 48-Gb/s 16-QAM signal transmission using half cycle sub-carrier modulation in intensity modulation/direct detection system

    Science.gov (United States)

    Tang, Jin; He, Jing; Chen, Ming; Li, Danyu; Chen, Lin

    2015-01-01

    A simple spectral-efficiency intensity modulation/direct detection (IM/DD) system based on half cycle sub-carrier modulation (SCM) signal is proposed for short reach fiber communications in this paper. The signal impairment of frequency selective fading due to fiber chromatics dispersion (CD) is mathematically analyzed. To reduce the performance deterioration caused by the non-flat transfer function, digital pre- and post-equalization is applied in the system. The peak to average power ratio (PAPR) of the signal is also discussed in comparison with that of orthogonal frequency division multiplexing (OFDM). The transmission of 16-QAM half cycle SCM signal with a sub-carrier frequency of half the symbol rate and Nyquist pulse shaping is experimentally demonstrated. The bit-error rate (BER) of 48 Gb/s polarization multiplexing division (PDM) 16 QAM half cycle SCM signal is less than 7% forward-error-correction (FEC) threshold of 3.8 ×10-3 after transmission over 83 km standard single-mode fiber (SSMF).

  19. Directional Antineutrino Detection

    CERN Document Server

    Safdi, Benjamin R

    2014-01-01

    We propose the first truly directional antineutrino detector for antineutrinos above the hydrogen inverse beta decay (IBD) threshold, with potential applications including monitoring for nuclear nonproliferation, spatially mapping geo-neutrinos, characterizing the diffuse supernova neutrino background, and searching for new physics in the neutrino sector. The detector consists of adjacent and separated target and capture scintillator planes. IBD events take place in the target layers, which are thin enough to allow the neutrons to escape without scattering elastically. The neutrons are detected in the thicker, boron-loaded capture layers. The location of the IBD event and the momentum of the positron are determined by tracking the positron's trajectory through the detector. Our design is a straightforward modification of existing antineutrino detectors; a prototype could be built with existing technology.

  20. Directional Antineutrino Detection

    Science.gov (United States)

    Safdi, B. R.; Suerfu, J.

    2014-12-01

    We propose the first truly directional antineutrino detector for antineutrinos near the threshold for the inverse beta decay (IBD) of hydrogen, with potential applications including the spatial mapping of geo-neutrinos, searches for stellar antineutrinos, and the monitoring of nuclear reactors. The detector consists of adjacent and separated target and neutron-capture layers. The IBD events, which result in a neutron and a positron, take place in the target layers. These layers are thin enough so that the neutrons escape without scattering elastically. The neutrons are detected in the thicker neutron-capture layers. The location of the IBD event is determined from the energy deposited by the positron as it slows in the medium and from the two gamma rays that come from the positron annihilation. Since the neutron recoils in the direction of the antineutrino's motion, a line may then be drawn between the IBD event location and the neutron-capture location to approximate the antineutrino's velocity. In some events, we may even measure the positron's velocity, which further increases our ability to reconstruct the antineutrino's direction of motion. Our method significantly improves upon previous methods by allowing the neutron to freely travel a long distance before diffusing and being captured. Moreover, our design is a straightforward modification of existing antineutrino detectors; a prototype could easily be built with existing technology. We verify our design through Monte Carlo simulations in Geant4, using commercially-available boron-loaded plastic scintillators for the target and neutron-capture layer materials. We are able to discriminate from background using multiple coincidence signatures within a short, ~microsecond time interval. We conclude that the detector could likely operate above ground with minimal shielding.

  1. Statistical theory of signal detection

    CERN Document Server

    Helstrom, Carl Wilhelm; Costrell, L; Kandiah, K

    1968-01-01

    Statistical Theory of Signal Detection, Second Edition provides an elementary introduction to the theory of statistical testing of hypotheses that is related to the detection of signals in radar and communications technology. This book presents a comprehensive survey of digital communication systems. Organized into 11 chapters, this edition begins with an overview of the theory of signal detection and the typical detection problem. This text then examines the goals of the detection system, which are defined through an analogy with the testing of statistical hypotheses. Other chapters consider

  2. Towards 400GBASE 4-lane Solution Using Direct Detection of MultiCAP Signal in 14 GHz Bandwidth per Lane

    DEFF Research Database (Denmark)

    Iglesias Olmedo, Miguel; Tianjian, Zuo; Jensen, Jesper Bevensee;

    2013-01-01

    We report on an experimental demonstration of 102 Gbit/s transmission over a 15km single wavelength and polarization fiber link with 14GHz 3dB bandwidth. Novel multiband CAP signaling allows for a 4-lane 400GBASE long reach solution....

  3. Seizure detection algorithms based on EMG signals

    DEFF Research Database (Denmark)

    Conradsen, Isa

    Background: the currently used non-invasive seizure detection methods are not reliable. Muscle fibers are directly connected to the nerves, whereby electric signals are generated during activity. Therefore, an alarm system on electromyography (EMG) signals is a theoretical possibility. Objective......: to show whether medical signal processing of EMG data is feasible for detection of epileptic seizures. Methods: EMG signals during generalised seizures were recorded from 3 patients (with 20 seizures in total). Two possible medical signal processing algorithms were tested. The first algorithm was based...... on the amplitude of the signal. The other algorithm was based on information of the signal in the frequency domain, and it focused on synchronisation of the electrical activity in a single muscle during the seizure. Results: The amplitude-based algorithm reliably detected seizures in 2 of the patients, while...

  4. Improving signal to noise in labeled biological specimens using energy-filtered TEM of sections with a drift correction strategy and a direct detection device.

    Science.gov (United States)

    Ramachandra, Ranjan; Bouwer, James C; Mackey, Mason R; Bushong, Eric; Peltier, Steven T; Xuong, Nguyen-Huu; Ellisman, Mark H

    2014-06-01

    Energy filtered transmission electron microscopy techniques are regularly used to build elemental maps of spatially distributed nanoparticles in materials and biological specimens. When working with thick biological sections, electron energy loss spectroscopy techniques involving core-loss electrons often require exposures exceeding several minutes to provide sufficient signal to noise. Image quality with these long exposures is often compromised by specimen drift, which results in blurring and reduced resolution. To mitigate drift artifacts, a series of short exposure images can be acquired, aligned, and merged to form a single image. For samples where the target elements have extremely low signal yields, the use of charge coupled device (CCD)-based detectors for this purpose can be problematic. At short acquisition times, the images produced by CCDs can be noisy and may contain fixed pattern artifacts that impact subsequent correlative alignment. Here we report on the use of direct electron detection devices (DDD's) to increase the signal to noise as compared with CCD's. A 3× improvement in signal is reported with a DDD versus a comparably formatted CCD, with equivalent dose on each detector. With the fast rolling-readout design of the DDD, the duty cycle provides a major benefit, as there is no dead time between successive frames.

  5. Direct electrochemical DNA detection originated from the self-redox signal of sulfonated polyaniline enhanced by graphene oxide in neutral solution.

    Science.gov (United States)

    Yang, Tao; Meng, Le; Wang, Xinxing; Wang, Longlong; Jiao, Kui

    2013-11-13

    In this paper, a type of direct DNA impedance detection using the self-redox signal change of sulfonated polyaniline (SPAN) enhanced by graphene oxide (GNO) was reported, here SPAN is a copolymer obtained from aniline and m-aminobenzenesulfonic acid. The resulting nanocomposite was characterized by scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The π-π planar structure of GNO and the carboxyl groups on the surface of GNO ensured it could act as an excellent substrate for adsorption and polymerization of aniline monomer. Because of the existence of GNO, the electrochemical activities of SPAN were enhanced obviously. Because of abundant sulfonic acid groups, the resulting nanocomposite showed obvious self-redox signal even at physiological pH, which is beneficial for biosensing field. DNA probes with amine groups could be covalently attached to the modified electrode surface through the acyl chloride cross-linking reaction of sulfonic groups and amines. When the flexible probe DNA was successfully grafted, the electrode was coated and electron transfer between electrode and buffer was restrained. Thus, the inner impedance value of SPAN (rather than using outer classic EIS probe, [Fe(CN)6](3-/4-)) increased significantly. After hybridization, the rigid helix opened the electron channel, which induced impedance value decreased dramatically. As an initial application of this system, the PML/RARA fusion gene sequence formed from promyelocytic leukemia (PML) and retinoic acid receptor alpha (RARA) was successfully detected.

  6. Direct dark matter detection: The diurnal variation in directional experiments

    CERN Document Server

    Vergados, J D

    2011-01-01

    We present some theoretical results relevant to the direct dark matter detection experiments, paying particular attention to directional experiments, i.e. experiments in which, not only the energy but the direction of the recoiling nucleus is observed. In directional experiments the detection rate depends on the angle between the line observation and the sun's direction of motion. Since, however, the direction of observation is fixed with respect the earth, while the Earth is rotating around its axis, in a directional experiment the angle between the direction of observation and the Sun's direction of motion will change during the day. So the observed signal in such experiments will exhibit a very interesting and characteristic periodic diurnal variation.

  7. Experimental demonstration of 608Gbit/s short reach transmission employing half-cycle 16QAM Nyquist-SCM signal and direct detection with 25Gbps EML.

    Science.gov (United States)

    Zhong, Kangping; Zhou, Xian; Wang, Yiguang; Wang, Liang; Yuan, Jinhui; Yu, Changyuan; Lau, Alan Pak Tao; Lu, Chao

    2016-10-31

    In this paper, we experimentally demonstrated an IM/DD short reach transmission system with a total capacity of 608Gbit/s (net capacity of 565.4Gbit/s exclude 7% FEC overhead) employing half-cycle 16QAM Nyquist-SCM signal and 25Gbps EML at O band. Direct detection-faster than Nyquist (DD-FTN) technique was employed to compensate channel impairments. Number of taps of DD-LMS and tap coefficient of post filter in DD-FTN were experimentally studied for different baud rates. Single-lane 152Gbit/s transmission over 10km of SSMF was experimentally demonstrated. Employing a 4-lanes LAN-WDM architecture, a total capacity of 608Gbit/s transmission over 2km was successfully achieved with a receiver sensitivity lower than -4dBm. To the best of authors' knowledge, this is the highest reported baud rate of half-cycle 16QAM Nyquist-SCM signal and the highest bit rate employing IM/DD and 25Gbps EML in a four lanes LAN-WDM architecture for short reach systems in the O band.

  8. EUROmediCAT signal detection

    DEFF Research Database (Denmark)

    Given, Joanne E; Loane, Maria; Luteijn, Johannes Michiel

    2016-01-01

    AIMS: To evaluate congenital anomaly (CA)-medication exposure associations produced by the new EUROmediCAT signal detection system and determine which require further investigation. METHODS: Data from 15 EUROCAT registries (1995-2011) with medication exposures at the chemical substance (5th level......, and independent evidence sought to confirm the remaining signals. Some chance associations are expected and confounding by indication is possible.......AIMS: To evaluate congenital anomaly (CA)-medication exposure associations produced by the new EUROmediCAT signal detection system and determine which require further investigation. METHODS: Data from 15 EUROCAT registries (1995-2011) with medication exposures at the chemical substance (5th level...... of Anatomic Therapeutic Chemical classification) and chemical subgroup (4th level) were analysed using a 50% false detection rate. After excluding antiepileptics, antidiabetics, antiasthmatics and SSRIs/psycholeptics already under investigation, 27 associations were evaluated. If evidence for a signal...

  9. Detection of signals in noise

    CERN Document Server

    McDonough, Robert N

    1995-01-01

    The Second Edition is an updated revision to the authors highly successful and widely used introduction to the principles and application of the statistical theory of signal detection. This book emphasizes those theories that have been found to be particularly useful in practice including principles applied to detection problems encountered in digital communications, radar, and sonar.Detection processing based upon the fast Fourier transform

  10. Direct Path Detection Method in Indoor Location

    Institute of Scientific and Technical Information of China (English)

    HUA Hu; LI Zheng

    2006-01-01

    A search algorithm for the detection of a direct path signal in the presence of dense multipath in indoor environment using UWB is Proposed. This algorithm is based on signal correlation and differential coefficient. Statistical analysis of the algorithm is given out and computer simulation results are presented to validate the effectiveness of the algorithm.The results based on the algorithm proposed are compared with those based on Maximum Likelihood Estimator(MLE)and Peak Tracking(PT)in the simulation which shows that this algorithm achieves the highest accuracy in most cases and gives out relatively stable results in different Signal Noise Ratio(SNR).

  11. Intelligent Signal Processing for Detection System Optimization

    Energy Technology Data Exchange (ETDEWEB)

    Fu, C Y; Petrich, L I; Daley, P F; Burnham, A K

    2004-12-05

    A wavelet-neural network signal processing method has demonstrated approximately tenfold improvement over traditional signal-processing methods for the detection limit of various nitrogen and phosphorus compounds from the output of a thermionic detector attached to a gas chromatograph. A blind test was conducted to validate the lower detection limit. All fourteen of the compound spikes were detected when above the estimated threshold, including all three within a factor of two above the threshold. In addition, two of six spikes were detected at levels of 1/2 the concentration of the nominal threshold. Another two of the six would have been detected correctly if we had allowed human intervention to examine the processed data. One apparent false positive in five nulls was traced to a solvent impurity, whose presence was subsequently identified by analyzing a solvent aliquot evaporated to 1% residual volume, while the other four nulls were properly classified. We view this signal processing method as broadly applicable in analytical chemistry, and we advocate that advanced signal processing methods should be applied as directly as possible to the raw detector output so that less discriminating preprocessing and post-processing does not throw away valuable signal.

  12. Subgraph detection using graph signals

    KAUST Repository

    Chepuri, Sundeep Prabhakar

    2017-03-06

    In this paper we develop statistical detection theory for graph signals. In particular, given two graphs, namely, a background graph that represents an usual activity and an alternative graph that represents some unusual activity, we are interested in answering the following question: To which of the two graphs does the observed graph signal fit the best? To begin with, we assume both the graphs are known, and derive an optimal Neyman-Pearson detector. Next, we derive a suboptimal detector for the case when the alternative graph is not known. The developed theory is illustrated with numerical experiments.

  13. Intelligent Signal Processing for Detection System Optimization

    Energy Technology Data Exchange (ETDEWEB)

    Fu, C Y; Petrich, L I; Daley, P F; Burnham, A K

    2004-06-18

    A wavelet-neural network signal processing method has demonstrated approximately tenfold improvement in the detection limit of various nitrogen and phosphorus compounds over traditional signal-processing methods in analyzing the output of a thermionic detector attached to the output of a gas chromatograph. A blind test was conducted to validate the lower detection limit. All fourteen of the compound spikes were detected when above the estimated threshold, including all three within a factor of two above. In addition, two of six were detected at levels 1/2 the concentration of the nominal threshold. We would have had another two correct hits if we had allowed human intervention to examine the processed data. One apparent false positive in five nulls was traced to a solvent impurity, whose presence was identified by running a solvent aliquot evaporated to 1% residual volume, while the other four nulls were properly classified. We view this signal processing method as broadly applicable in analytical chemistry, and we advocate that advanced signal processing methods be applied as directly as possible to the raw detector output so that less discriminating preprocessing and post-processing does not throw away valuable signal.

  14. EUROmediCAT signal detection

    DEFF Research Database (Denmark)

    Luteijn, Johannes Michiel; Morris, Joan K; Garne, Ester

    2016-01-01

    AIMS: Information about medication safety in pregnancy is inadequate. We aimed to develop a signal detection methodology to routinely identify unusual associations between medications and congenital anomalies using data collected by 15 European congenital anomaly registries. METHODS: EUROmedi....... The methodology was evaluated by considering the detection of well-known teratogens. RESULTS: The most common exposures were genitourinary system medications and sex hormones (35.2%), nervous system medications (28.0%) and anti-infectives for systemic use (25.7%). Fifty-two specific medication anomaly......). CONCLUSIONS: Medication exposure data in the EUROmediCAT central database can be analyzed systematically to determine a manageable set of associations for validation and then testing in independent datasets. Detection of teratogens depends on frequency of exposure, level of risk and teratogenic specificity....

  15. Disentangling Dark Matter Dynamics with Directional Detection

    Energy Technology Data Exchange (ETDEWEB)

    Lisanti, Mariangela; Wacker, Jay G.; /SLAC

    2009-12-16

    Inelastic dark matter reconciles the DAMA anomaly with other null direct detection experiments and points to a non-minimal structure in the dark matter sector. In addition to the dominant inelastic interaction, dark matter scattering may have a subdominant elastic component. If these elastic interactions are suppressed at low momentum transfer, they will have similar nuclear recoil spectra to inelastic scattering events. While upcoming direct detection experiments will see strong signals from such models, they may not be able to unambiguously determine the presence of the subdominant elastic scattering from the recoil spectra alone. We show that directional detection experiments can separate elastic and inelastic scattering events and discover the underlying dynamics of dark matter models.

  16. Reconfigurable intensity modulation and direct detection optical transceivers for variable-rate wavelength-division-multiplexing passive optical networks utilizing digital signal processing-based symbol mapper

    Science.gov (United States)

    Zhang, Zhiguo; Zhang, Bingbing; Chen, Yanxu; Chen, Xue

    2017-01-01

    Variable-rate intensity modulation and direct detection-based optical transceivers with software-controllable reconfigurability and transmission performance adaptability are experimentally demonstrated, utilizing M-QAM symbol mapping implemented in MATLAB® programs. A frequency division multiplexing-based symbol demapping and wavelength management method is proposed for the symbol demapper and tunable laser management used in colorless optical network unit.

  17. Microgels for multiplex and direct fluorescence detection

    Science.gov (United States)

    Causa, Filippo; Aliberti, Anna; Cusano, Angela M.; Battista, Edmondo; Netti, Paolo A.

    2015-05-01

    Blood borne oligonucleotides fragments contain useful clinical information whose detection and monitoring represent the new frontier in liquid biopsy as they can transform the current diagnosis procedure. For instance, recent studies have identified a new class of circulating biomarkers such as s miRNAs, and demonstrated that changes in their concentration are closely associated with the development of cancer and other pathologies. However, direct detection of miRNAs in body fluids is particularly challenging and demands high sensitivity -concentration range between atto to femtomolarspecificity, and multiplexing Here we report on engineered multifunctional microgels and innovative probe design for a direct and multiplex detection of relevant clinical miRNAs in fluorescence by single particle assay. Polyethyleneglycol-based microgels have a coreshell architecture with two spectrally encoded fluorescent dyes for multiplex analyses and are endowed with fluorescent probes for miRNA detection. Encoding and detection fluorescence signals are distinguishable by not overlapping emission spectra. Tuneable fluorescence probe conjugation and corresponding emission confinement on single microgel allows for enhanced target detection. Such suspension array has indeed high selectivity and sensitivity with a detection limit of 10-15 M and a dynamic range from 10-9 to 10-15 M. We believe that sensitivity in the fM concentration range, signal background minimization, multiplexed capability and direct measurement of such microgels will translate into diagnostic benefits opening up new roots toward liquid biopsy in the context of point-of-care testing through an easy and fast detection of sensitive diagnostic biomarkers directly in serum.

  18. Dark matter directional detection with MIMAC

    CERN Document Server

    Grignon, C; Bosson, G; Bourrion, O; Guillaudin, O; Koumeir, C; Mayet, F; Santos, D; Colas, P; Ferrer, E; Giomataris, Yu

    2009-01-01

    MiMac is a project of micro-TPC matrix of gaseous (He3, CF4) chambers for direct detection of non-baryonic dark matter. Measurement of both track and ionization energy will allow the electron-recoil discrimination, while access to the directionnality of the tracks will open a unique way to distinguish a geniune WIMP signal from any background. First reconstructed tracks of 5.9 keV electrons are presented as a proof of concept.

  19. Direct detection of dark matter axions with directional sensitivity

    CERN Document Server

    Irastorza, Igor G

    2012-01-01

    We study the directional effect of the expected axion dark matter signal in a resonant cavity of an axion haloscope detector, for cavity geometries not satisfying the condition that the axion de Broglie wavelength is much larger than the cavity dimensions. We focus on long thin cavities immersed in dipole magnets and find, for appropriately chosen cavity lengths, an O(1) modulation of the signal with the cavity orientation with respect the momentum distribution of the relic axion background predicted by the isothermal sphere model for the galactic dark matter halo. This effect can be exploited to design directional axion dark matter detectors, providing an unmistakable signature of the extraterrestrial origin of a possible positive detection. Moreover, the precise shape of the modulation may give information of the galactic halo distribution and, for specific halo models, give extra sensitivity for higher axion masses.

  20. Plasma dark matter direct detection

    CERN Document Server

    Clarke, Jackson D

    2015-01-01

    Dark matter in spiral galaxies like the Milky Way may take the form of a dark plasma. Hidden sector dark matter charged under an unbroken $U(1)'$ gauge interaction provides a simple and well defined particle physics model realising this possibility. The assumed $U(1)'$ neutrality of the Universe then implies (at least) two oppositely charged dark matter components with self-interactions mediated via a massless "dark photon" (the $U(1)'$ gauge boson). In addition to nuclear recoils such dark matter can give rise to keV electron recoils in direct detection experiments. In this context, the detailed physical properties of the dark matter plasma interacting with the Earth is required. This is a complex system, which is here modelled as a fluid governed by the magnetohydrodynamic equations. These equations are numerically solved for some illustrative examples, and implications for direct detection experiments discussed. In particular, the analysis presented here leaves open the intriguing possibility that the DAMA...

  1. Dark matter direct-detection experiments

    Science.gov (United States)

    Marrodán Undagoitia, Teresa; Rauch, Ludwig

    2016-01-01

    In recent decades, several detector technologies have been developed with the quest to directly detect dark matter interactions and to test one of the most important unsolved questions in modern physics. The sensitivity of these experiments has improved with a tremendous speed due to a constant development of the detectors and analysis methods, proving uniquely suited devices to solve the dark matter puzzle, as all other discovery strategies can only indirectly infer its existence. Despite the overwhelming evidence for dark matter from cosmological indications at small and large scales, clear evidence for a particle explaining these observations remains absent. This review summarises the status of direct dark matter searches, focusing on the detector technologies used to directly detect a dark matter particle producing recoil energies in the keV energy scale. The phenomenological signal expectations, main background sources, statistical treatment of data and calibration strategies are discussed.

  2. Dark matter direct-detection experiments

    CERN Document Server

    Undagoitia, Teresa Marrodan

    2015-01-01

    In the past decades, several detector technologies have been developed with the quest to directly detect dark matter interactions and to test one of the most important unsolved questions in modern physics. The sensitivity of these experiments has improved with a tremendous speed due to a constant development of the detectors and analysis methods, proving uniquely suited devices to solve the dark matter puzzle, as all other discovery strategies can only indirectly infer its existence. Despite the overwhelming evidence for dark matter from cosmological indications at small and large scales, a clear evidence for a particle explaining these observations remains absent. This review summarises the status of direct dark matter searches, focussing on the detector technologies used to directly detect a dark matter particle producing recoil energies in the keV energy scale. The phenomenological signal expectations, main background sources, statistical treatment of data and calibration strategies are discussed.

  3. Detecting the cosmological recombination signal from space

    CERN Document Server

    Desjacques, Vincent; Silk, Joseph; de Bernardis, Francesco; Doré, Olivier

    2015-01-01

    Spectral distortions of the CMB have recently experienced an increased interest. One of the inevitable distortion signals of our cosmological concordance model is created by the cosmological recombination process, just a little before photons last scatter at redshift $z\\simeq 1100$. These cosmological recombination lines, emitted by the hydrogen and helium plasma, should still be observable as tiny deviation from the CMB blackbody spectrum in the cm--dm spectral bands. In this paper, we present a forecast for the detectability of the recombination signal with future satellite experiments. We argue that serious consideration for future CMB experiments in space should be given to probing spectral distortions and, in particular, the recombination line signals. The cosmological recombination radiation not only allows determination of standard cosmological parameters, but also provides a direct observational confirmation for one of the key ingredients of our cosmological model: the cosmological recombination histo...

  4. Dendritic spikes amplify the synaptic signal to enhance detection of motion in a simulation of the direction-selective ganglion cell.

    Directory of Open Access Journals (Sweden)

    Michael J Schachter

    Full Text Available The On-Off direction-selective ganglion cell (DSGC in mammalian retinas responds most strongly to a stimulus moving in a specific direction. The DSGC initiates spikes in its dendritic tree, which are thought to propagate to the soma with high probability. Both dendritic and somatic spikes in the DSGC display strong directional tuning, whereas somatic PSPs (postsynaptic potentials are only weakly directional, indicating that spike generation includes marked enhancement of the directional signal. We used a realistic computational model based on anatomical and physiological measurements to determine the source of the enhancement. Our results indicate that the DSGC dendritic tree is partitioned into separate electrotonic regions, each summing its local excitatory and inhibitory synaptic inputs to initiate spikes. Within each local region the local spike threshold nonlinearly amplifies the preferred response over the null response on the basis of PSP amplitude. Using inhibitory conductances previously measured in DSGCs, the simulation results showed that inhibition is only sufficient to prevent spike initiation and cannot affect spike propagation. Therefore, inhibition will only act locally within the dendritic arbor. We identified the role of three mechanisms that generate directional selectivity (DS in the local dendritic regions. First, a mechanism for DS intrinsic to the dendritic structure of the DSGC enhances DS on the null side of the cell's dendritic tree and weakens it on the preferred side. Second, spatially offset postsynaptic inhibition generates robust DS in the isolated dendritic tips but weak DS near the soma. Third, presynaptic DS is apparently necessary because it is more robust across the dendritic tree. The pre- and postsynaptic mechanisms together can overcome the local intrinsic DS. These local dendritic mechanisms can perform independent nonlinear computations to make a decision, and there could be analogous mechanisms within

  5. Intensity and directionality of bat echolocation signals

    DEFF Research Database (Denmark)

    Jakobsen, Lasse; Brinkløv, Signe; Surlykke, Annemarie

    2013-01-01

    , duration, intensity, and directionality of echolocation signals) in unison define the search volume probed by bats and in turn how bats perceive their surroundings. Small changes to individual parameters can, in combination, drastically change the bat's perception, facilitating successful navigation......The paper reviews current knowledge of intensity and directionality of bat echolocation signals. Recent studies have revealed that echolocating bats can be much louder than previously believed. Bats previously dubbed "whispering" can emit calls with source levels up to 110 dB SPL at 10 cm...... will increase signal directionality in the field along with intensity thus increasing sonar range. During the last phase of prey pursuit, vespertilionid bats broaden their echolocation beam considerably, probably to counter evasive maneuvers of eared prey. We highlight how multiple call parameters (frequency...

  6. Direct and indirect signal detection of 122 keV photons with a novel detector combining a pnCCD and a CsI(Tl) scintillator

    Energy Technology Data Exchange (ETDEWEB)

    Schlosser, D.M., E-mail: dieter.schlosser@pnsensor.de [PNSensor GmbH, Sckellstraße 3, 81667 München (Germany); Huth, M.; Hartmann, R. [PNSensor GmbH, Sckellstraße 3, 81667 München (Germany); Abboud, A.; Send, S. [Universität Siegen, Walter-Flex-Straße 3, 57072 Siegen (Germany); Conka-Nurdan, T. [Türkisch-Deutsche Universität, Sakinkaya Cad. 86, Beykoz, 34820 Istanbul (Turkey); Shokr, M.; Pietsch, U. [Universität Siegen, Walter-Flex-Straße 3, 57072 Siegen (Germany); Strüder, L. [PNSensor GmbH, Sckellstraße 3, 81667 München (Germany); Universität Siegen, Walter-Flex-Straße 3, 57072 Siegen (Germany)

    2016-01-01

    By combining a low noise fully depleted pnCCD detector with a CsI(Tl) scintillator, an energy-dispersive area detector can be realized with a high quantum efficiency (QE) in the range from below 1 keV to above 100 keV. In direct detection mode the pnCCD exhibits a relative energy resolution of 1% at 122 keV and spatial resolution of less than 75 µm, the pixel size of the pnCCD. In the indirect detection mode, i.e. conversion of the incoming X-rays in the scintillator, the measured energy resolution was about 9–13% at 122 keV, depending on the depth of interaction in the scintillator, while the position resolution, extracted with the help of simulations, was 30 µm only. We show simulated data for incident photons of 122 keV and compare the various interaction processes and relevant physical parameters to experimental results obtained with a radioactive {sup 57}Co source. - Highlights: • Position and energy resolving pnCCD+CsI(Tl) detector for energies from 1-150 keV • Detection in the pnCCD (122keV): 1% energy and <75µm spatial resolution • Detection in the scintillator (122keV): 9-12% energy and ~30µm spatial resolution.

  7. Heart Beat Detection in Noisy ECG Signals Using Statistical Analysis of the Automatically Detected Annotations

    Directory of Open Access Journals (Sweden)

    Andrius Gudiškis

    2015-07-01

    Full Text Available This paper proposes an algorithm to reduce the noise distortion influence in heartbeat annotation detection in electrocardiogram (ECG signals. Boundary estimation module is based on energy detector. Heartbeat detection is usually performed by QRS detectors that are able to find QRS regions in a ECG signal that are a direct representation of a heartbeat. However, QRS performs as intended only in cases where ECG signals have high signal to noise ratio, when there are more noticeable signal distortion detectors accuracy decreases. Proposed algorithm uses additional data, taken from arterial blood pressure signal which was recorded in parallel to ECG signal, and uses it to support the QRS detection process in distorted signal areas. Proposed algorithm performs as well as classical QRS detectors in cases where signal to noise ratio is high, compared to the heartbeat annotations provided by experts. In signals with considerably lower signal to noise ratio proposed algorithm improved the detection accuracy to up to 6%.

  8. Model Independent Direct Detection Analyses

    CERN Document Server

    Fitzpatrick, A Liam; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2012-01-01

    Following the construction of the general effective theory for dark matter direct detection in 1203.3542, we perform an analysis of the experimental constraints on the full parameter space of elastically scattering dark matter. We review the prescription for calculating event rates in the general effective theory and discuss the sensitivity of various experiments to additional nuclear responses beyond the spin-independent (SI) and spin-dependent (SD) couplings: an angular-momentum-dependent (LD) and spin-and-angular-momentum-dependent (LSD) response, as well as a distinction between transverse and longitudinal spin-dependent responses. We consider the effect of interference between different operators and in particular look at directions in parameter space where such cancellations lead to holes in the sensitivity of individual experiments. We explore the complementarity of different experiments by looking at the improvement of bounds when experiments are combined. Finally, our scan through parameter space sho...

  9. Coaxial direct-detection lidar-system

    DEFF Research Database (Denmark)

    2014-01-01

    The invention relates to a coaxial direct-detection LIDAR system for measuring velocity, temperature and/or particulate density. The system comprises a laser source for emitting a laser light beam having a lasing center frequency along an emission path. The system further comprises an optical...... frequency and/or the center filter frequency may be scanned. The invention further relates to an aircraft airspeed measurement device, and a wind turbine airspeed measurement device comprising the LIDAR system....... delivery system arranged in the emission path of the laser source, the optical delivery system being arranged for delivering the laser light beam in a measuring direction, the optical delivery system further being configured for collecting a return signal backscattered along the measuring direction...

  10. Detection of Transient Signals in Doppler Spectra

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Signal processing is used to detect transient signals in the presence of noise. Two embodiments are disclosed. In both embodiments, the time series from a remote...

  11. The detection of signals buried in noise

    CERN Document Server

    Bergamaschi, Luigi; Giordani, Laura; Mana, Giovanni; Oddone, Massimo

    2013-01-01

    This paper examines signal detection in the presence of noise, with a particular emphasis to the nuclear activation analysis. The problem is to decide what between the signal-plus-background and no-signal hypotheses fits better the data and to quantify the relevant signal amplitude or detection limit. Our solution is based on the use of Bayesian inferences to test the different hypotheses.

  12. Direct and indirect signal detection of 122 keV photons with a novel detector combining a pnCCD and a CsI(Tl) scintillator

    Science.gov (United States)

    Schlosser, D. M.; Huth, M.; Hartmann, R.; Abboud, A.; Send, S.; Conka-Nurdan, T.; Shokr, M.; Pietsch, U.; Strüder, L.

    2016-01-01

    By combining a low noise fully depleted pnCCD detector with a CsI(Tl) scintillator, an energy-dispersive area detector can be realized with a high quantum efficiency (QE) in the range from below 1 keV to above 100 keV. In direct detection mode the pnCCD exhibits a relative energy resolution of 1% at 122 keV and spatial resolution of less than 75 μm, the pixel size of the pnCCD. In the indirect detection mode, i.e. conversion of the incoming X-rays in the scintillator, the measured energy resolution was about 9-13% at 122 keV, depending on the depth of interaction in the scintillator, while the position resolution, extracted with the help of simulations, was 30 μm only. We show simulated data for incident photons of 122 keV and compare the various interaction processes and relevant physical parameters to experimental results obtained with a radioactive 57Co source.

  13. Directional growth of Ag nanorod from polymeric silver cyanide: A potential substrate for concentration dependent SERS signal enhancement leading to melamine detection

    Science.gov (United States)

    Roy, Anindita; Sahoo, Ramkrishna; Chowdhury, Joydeep; Bhattacharya, Tara Shankar; Agarwal, Ratnesh; Pal, Tarasankar

    2017-08-01

    Attention has been directed to prepare exclusive one-dimensional silver nanostructure from the linear inorganic polymer AgCN. Successive color change from yellow to orange, to red and finally to green reflects the evolution of high yielding Ag nanorods (NRs) from well-known -[Ag-CN]- chains of polymeric AgCN at room temperature. The parental 1D morphology of AgCN is retained within the as-synthesized Ag NRs. So we could successfully exploit the Ag NR for surface-enhanced Raman scattering (SERS) studies for sensing a popular milk adulterant melamine down to picomolar level. We observed interesting concentration dependent selective SERS band enhancement of melamine. The enhanced 1327 cm- 1 SERS signal intensity at lower concentration (10- 9 and 10- 12 M) of melamine speaks for the preferential participation of -C-N of melamine molecule with Ag surface. On the other hand, '-NH2' group together with ring 'N' participation of melamine molecule onto Ag surface suggested an adsorptive stance at higher (10- 3-10- 7 M) concentration range. Thus the binding modes of the molecule at the Ag surface justify its fluxional behavior.

  14. Direct current modulation of a photomixing signal

    Science.gov (United States)

    Constantin, Florin L.

    2016-04-01

    Direct modulation of the bias voltage of a LTG-GaAs photomixer is exploited to modulate the signal generated at the frequency of the optical beat between two diode lasers at 820 nm. The photomixing signal is calculated from an expansion in power series of the amplitude of the modulation voltage and displays amplitude modulation sidebands equidistantly spaced to the frequency of the optical beat by integer multiples of the modulation frequency. Modulation at harmonics of the modulation frequency is allowed by the electrical nonlinear response of the photomixer, driven at low voltage by the saturation of the electron drift velocity. Coupling of an alternative voltage to the photomixer operated at zero-bias leads to bifrequency operation. Modulation of the photomixing signal and bifrequency operation of the photomixer are observed experimentally with an optical beat in the microwave regime.

  15. Direct 13C NMR Detection in HPLC Hyphenation Mode

    DEFF Research Database (Denmark)

    Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils

    2012-01-01

    Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments......, and an acquisition time of 13 h resulted in spectra with adequate signal-to-noise ratios to detect all C-13 signals....

  16. Direct Position Determination of Multiple Radio Signals

    Directory of Open Access Journals (Sweden)

    Weiss Anthony J

    2005-01-01

    Full Text Available The most common methods for position determination of radio signal emitters such as communications or radar transmitters are based on measuring a specified parameter such as angle of arrival (AOA or time of arrival (TOA of the signal. The measured parameters are then used to estimate the transmitter's location. Since the measurements are done at each base station independently, without using the constraint that the AOA/TOA estimates at different base stations should correspond to the same transmitter's location, this is a suboptimal location determination technique. Further, if the number of array elements at each base station is , and the signal waveforms are unknown, the number of cochannel simultaneous transmitters that can be localized by AOA is limited to . Also, most AOA algorithms fail when the sources are not well angularly separated. We propose a technique that uses exactly the same data as the common AOA methods but the position determination is direct. The proposed method can handle more than cochannel simultaneous signals. Although there are many stray parameters, only a two-dimensional search is required for a planar geometry. The technique provides a natural solution to the measurements sources association problem that is encountered in AOA-based location systems. In addition to new algorithms, we provide analytical performance analysis, Cramér-Rao bounds and Monte Carlo simulations. We demonstrate that the proposed approach frequently outperforms the traditional AOA methods for unknown as well as known signal waveforms.

  17. Bayesian analysis of multiple direct detection experiments

    CERN Document Server

    Arina, Chiara

    2013-01-01

    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the classical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for th...

  18. Measurement Design for Detecting Sparse Signals

    OpenAIRE

    Zahedi, Ramin; Pezeshki, Ali; Chong, Edwin K. P.

    2011-01-01

    We consider the problem of testing for the presence (or detection) of an unknown sparse signal in additive white noise. Given a fixed measurement budget, much smaller than the dimension of the signal, we consider the general problem of designing compressive measurements to maximize the measurement signal-to-noise ratio (SNR), as increasing SNR improves the detection performance in a large class of detectors. We use a lexicographic optimization approach, where the optimal measurement design fo...

  19. Sensitive Infrared Signal Detection by Upconversion Technique

    Science.gov (United States)

    Wong, Teh-Hwa; Yu, Jirong; Bai, Yingxin; Johnson, William; Chen, Songsheng; Petros, Mulugeta; Singh, Upendra N.

    2014-01-01

    We demonstrated upconversion assisted detection of a 2.05-micron signal by sum frequency generation to generate a 700-nm light using a bulk periodically poled lithium niobate crystal. The achieved 94% intrinsic upconversion efficiency and 22.58% overall detection efficiency at a pW level of 2.05 micron pave the path to detect extremely weak infrared (IR) signals for remote sensing applications.

  20. Detecting hydrosonic signal using a polarization technique

    Institute of Scientific and Technical Information of China (English)

    孟克; 潘玉衡; 安翠珍; 王东红

    2004-01-01

    Some optical fiber hydrophones, such as PGC Mach-Zehnder Interferometer, have a birefringence of single mode optical fibers which induce signal fading. Especially, if two optical beams from the optical arms are orthogonal, the interferomic signal can' t be detected at all. Here a new method is introduced. This is to translate the detected phase difference into a linearly polarized angle, then detect it, so that polarization inducing signal fading will be avoided. In theory, this problem is solved. Furthermore, the effect on measurement results from optical source fluctuation becomes little when using the polarization technique.

  1. Accumulation of amplified target DNAs using thiol/biotin labeling, S1 nuclease, and ferrocene–streptavidin–magnetic system and a direct detection of specific DNA signals with screen printed gold electrode

    Directory of Open Access Journals (Sweden)

    Piyasak Chaumpluk et al

    2007-01-01

    Full Text Available Combinations of PCR-based amplification platform using 5' thiolated and biotinylated specific primers, S1 nuclease–PCR products treatment, ferrocene–streptavidin (Fc–Stv–magnetic binding for DNA accumulation, and screen printed gold electrode for the DNA allocation, were applied to Hoechst 33258-induced DNA aggregation and signals induction system for direct signals detection and DNA quantification in food samples. Thiolated and biotinylated at each 5' terminus enabled DNA purification through S1 nuclease treatment for primers and non-specific DNA elimination and enabled DNA trapping with a ferrocene–streptavidin–magnetic system. This facilitated the accumulation of target DNAs at higher concentration, resulting in enhanced signals. After allocation of DNA on the surface of gold electrode via thiol binding, intensity of DNA signals through these treatments could be measured directly after being induced by Hoechst 33258. Wider amplitude changes in anodic current peaks between negative and positive samples (increasing from 3.70 to 10.10 μA compared with those applied with no treatment combinations (decreasing from 3.92 to 1.23 μA were observed. This enhancement of the signals allowed a greater efficiency of DNA quantification. When this combination was used for GMOs content estimation in reference samples, results revealed an improved accuracy from 66% to 96%. The combined biosensor system, although more costly than the standard Hoechst 33258/carbon electrode system, provided an alternative choice for DNA quantification, offering labor-free immobilization of probe onto electrode surface, easy test administration, and efficient semi-quantitative test without expensive instruments.

  2. Dark Matter Direct Detection with Accelerometers

    CERN Document Server

    Graham, Peter W; Mardon, Jeremy; Rajendran, Surjeet; Terrano, William A

    2015-01-01

    The mass of the dark matter particle is unknown, and may be as low as ~$10^{-22}$ eV. The lighter part of this range, below ~eV, is relatively unexplored both theoretically and experimentally but contains an array of natural dark matter candidates. An example is the relaxion, a light boson predicted by cosmological solutions to the hierarchy problem. One of the few generic signals such light dark matter can produce is a time-oscillating, EP-violating force. We propose searches for this using accelerometers, and consider in detail the examples of torsion balances, atom interferometry, and pulsar timing. These approaches have the potential to probe large parts of unexplored parameter space in the next several years. Thus such accelerometers provide radically new avenues for the direct detection of dark matter.

  3. Bayesian analysis of multiple direct detection experiments

    Science.gov (United States)

    Arina, Chiara

    2014-12-01

    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the frequentist statistical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for their excessive complexity. Secondly, we confront several coherent scattering models to determine the current best physical scenario compatible with the experimental hints. We find that exothermic and inelastic dark matter are moderatly disfavored against the elastic scenario, while the isospin violating model has a similar evidence. Lastly the Bayes' factor gives inconclusive evidence for an incompatibility between the data sets of XENON100 and the hints of detection. The same question assessed with goodness of fit would indicate a 2 σ discrepancy. This suggests that more data are therefore needed to settle this question.

  4. [Weak signal detection in every heart cycle].

    Science.gov (United States)

    Yuan, J; Xu, X; Gao, D; Shi, G

    2001-12-01

    In this article, a new approach is introduced to lowering the myo-electronic noise in weak ECG signals. We use artificial neural network to make the noise be white, and then we adopt an adaptive filter of which the reference signal is achieved by extracting from other ECG cycle. The outcome is the reduction of both white noise and non-white noise in ECG signal. Satisfactory results have been achieved by using this method in the experiment of late potential detection.

  5. Directional detection of galactic dark matter

    CERN Document Server

    Mayet, F; Santos, D

    2012-01-01

    Directional detection is a promising Dark Matter search strategy. Taking advantage on the rotation of the Solar system around the galactic center through the Dark Matter halo, it allows to show a direction dependence of WIMP events that may be a powerful tool to identify genuine WIMP events as such. Directional detection strategy requires the simultaneous measurement of the energy and the 3D track of low energy recoils, which is a common challenge for all current projects of directional detectors.

  6. Theoretical prospects for directional WIMP detection

    CERN Document Server

    O'Hare, Ciaran A J

    2015-01-01

    Direct detection of dark matter with directional sensitivity is a promising concept for improving the search for weakly interacting massive particles. With information on the direction of WIMP induced nuclear recoils one has access to the full 3-dimensional velocity distribution of the local dark matter halo and thus a potential avenue for studying WIMP astrophysics. Furthermore the unique angular signature of the WIMP recoil distribution provides a crucial discriminant from neutrinos which currently represent the ultimate background to direct detection experiments.

  7. Infrared Signal Detection by Upconversion Technique

    Science.gov (United States)

    Wong, Teh-Hwa; Yu, Jirong; Bai, Yingxin; Johnson, William E.

    2014-01-01

    We demonstrated up-conversion assisted detection of a 2.05-micron signal by using a bulk periodically poled Lithium niobate crystal. The 94% intrinsic up-conversion efficiency and 22.58% overall detection efficiency at pW level of 2.05-micron was achieved.

  8. Signal classification for acoustic neutrino detection

    Energy Technology Data Exchange (ETDEWEB)

    Neff, M., E-mail: max.neff@physik.uni-erlangen.de [Friedrich-Alexander-Universitaet Erlangen-Nuernberg, Erlangen Centre for Astroparticle Physics, Erwin-Rommel-Str. 1, 91058 Erlangen (Germany); Anton, G.; Enzenhoefer, A.; Graf, K.; Hoessl, J.; Katz, U.; Lahmann, R.; Richardt, C. [Friedrich-Alexander-Universitaet Erlangen-Nuernberg, Erlangen Centre for Astroparticle Physics, Erwin-Rommel-Str. 1, 91058 Erlangen (Germany)

    2012-01-11

    This article focuses on signal classification for deep-sea acoustic neutrino detection. In the deep sea, the background of transient signals is very diverse. Approaches like matched filtering are not sufficient to distinguish between neutrino-like signals and other transient signals with similar signature, which are forming the acoustic background for neutrino detection in the deep-sea environment. A classification system based on machine learning algorithms is analysed with the goal to find a robust and effective way to perform this task. For a well-trained model, a testing error on the level of 1% is achieved for strong classifiers like Random Forest and Boosting Trees using the extracted features of the signal as input and utilising dense clusters of sensors instead of single sensors.

  9. Signal Classification for Acoustic Neutrino Detection

    CERN Document Server

    Neff, M; Enzenhöfer, A; Graf, K; Hößl, J; Katz, U; Lahmann, R; Richardt, C

    2011-01-01

    This article focuses on signal classification for deep-sea acoustic neutrino detection. In the deep sea, the background of transient signals is very diverse. Approaches like matched filtering are not sufficient to distinguish between neutrino-like signals and other transient signals with similar signature, which are forming the acoustic background for neutrino detection in the deep-sea environment. A classification system based on machine learning algorithms is analysed with the goal to find a robust and effective way to perform this task. For a well-trained model, a testing error on the level of one percent is achieved for strong classifiers like Random Forest and Boosting Trees using the extracted features of the signal as input and utilising dense clusters of sensors instead of single sensors.

  10. 利用FB-MAPES算法估计Tomography SAR高度维信号源数%On Detection of Number of Tomography SAR Signals in the Elevation Direction Using the FB-MAPES Method

    Institute of Scientific and Technical Information of China (English)

    任笑真; 杨汝良

    2009-01-01

    When using Tomography SAR combined with spatial spectrum estimation to solve layover effect, the number of signals should be estimated in the elevation direction first. The accuracy of number of signals is directly related to the following estimation performance. The conventional Information Theoretic Criteria (ITC) methods are usually influenced by multiplicative noise of the data, consequently, the performance of the estimation decreases. In this paper, a new method, FB-MAPES, is proposed to detect the number of signals. Then the performance of General Minimum Descriplion Length (GMDL) and FB-MAPES is compared via the Monte Carlo simulation. The experimental results confirm the validity of the FB-MAPES method. Moreover, the proposed method is prior to conventional ITC in detecting the number of tomography SAR signals in the elevation direction.%层析成像合成孔径雷达(Tomography SAR)结合空间谱估计技术解决层叠效应时,首先要估计出高度维信号源数目,信号源数估计得正确与否直接关系到后续处理的估计性能.用传统的信息论方法估计时,由于数据受乘性噪声影响,估计性能下降.该文提出一种新的信号源数估计方法:双向平滑多视幅相估计(FB-MAPES)滤波器算法.通过Monte Carlo仿真对信息论方法中的GMDL算法和FB-MAPES方法的估计性能进行了比较,试验结果表明该文提出的方法能够更好地适应乘性噪声的影响,因而在估计Tomography SAR高度维信号源数时性能优于传统的信息论方法.

  11. Gaze Direction Detection in Autism Spectrum Disorder

    Science.gov (United States)

    Forgeot d'Arc, Baudouin; Delorme, Richard; Zalla, Tiziana; Lefebvre, Aline; Amsellem, Frédérique; Moukawane, Sanaa; Letellier, Laurence; Leboyer, Marion; Mouren, Marie-Christine; Ramus, Franck

    2017-01-01

    Detecting where our partners direct their gaze is an important aspect of social interaction. An atypical gaze processing has been reported in autism. However, it remains controversial whether children and adults with autism spectrum disorder interpret indirect gaze direction with typical accuracy. This study investigated whether the detection of…

  12. Wideband Array Signal Detection Algorithm Based on Power Focusing

    Directory of Open Access Journals (Sweden)

    Gong Bin

    2012-09-01

    Full Text Available Aiming at the requirement of real-time signal detection in the passive surveillance system, a wideband array signal detection algorithm is proposed based on the concept of power focusing. By making use of the phase difference of the signal received by a uniform linear array, the algorithm makes the power of the received signal focused in the Direction Of Arrival (DOA with improved cascade FFT. Subsequently, the probability density function of the output noise at each angle is derived. Furthermore, a Constant False Alarm Rate (CFAR test statistic and the corresponding detection threshold are constructed. The theoretical probability of detection is also derived for different false alarm rate and Signal-to-Noise Ratio (SNR. The proposed algorithm is computationally efficient, and the detection process is independent of the prior information. Meanwhile, the results can act as the initial value for other algorithms with higher precision. Simulation results show that the proposed algorithm achieves good performance for weak signal detection.

  13. Asymptotic Performance of Sparse Signal Detection Using Convex Programming Method

    Institute of Scientific and Technical Information of China (English)

    LEI Chuan; ZHANG Jun

    2012-01-01

    The detection of sparse signals against background noise is considered.Detecting signals of such kind is difficult since only a small portion of the signal carries information.Prior knowledge is usually assumed to ease detection.In this paper,we consider the general unknown and arbitrary sparse signal detection problem when no prior knowledge is available.Under a Neyman-Pearson hypothesis-testing framework,a new detection scheme is proposed by combining a generalized likelihood ratio test (GLRT)-like test statistic and convex programming methods which directly exploit sparsity in an underdetermined system of linear equations.We characterize large sample behavior of the proposed method by analyzing its asymptotic performance.Specifically,we give the condition for the Chernoff-consistent detection which shows that the proposed method is very sensitive to the (e)2 norm energy of the sparse signals.Both the false alarm rate and the miss rate tend to zero at vanishing signal-to-noise ratio (SNR),as long as the signal energy grows at least logarithmically with the problem dimension.Next we give a large deviation analysis to characterize the error exponent for the Neyman-Pearson detection.We derive the oracle error exponent assuming signal knowledge.Then we explicitly derive the error exponent of the proposed scheme and compare it with the oracle exponent.We complement our study with numerical experiments,showing that the proposed method performs in the vicinity of the likelihood ratio test (LRT) method in the finite sample scenario and the error probability degrades exponentially with the number of observations.

  14. Direct and indirect detection of supersymmetric dark matter; Detection directe et indirecte de matiere sombre supersymetrique

    Energy Technology Data Exchange (ETDEWEB)

    Mayet, F

    2001-09-01

    A substantial body of astrophysical evidence supports the existence of non-baryonic dark matter in the universe. One of the leading dark matter candidates is the neutralino predicted by the supersymmetric extensions of the standard model of particle physics. Different detectors have been designed for the detection, either indirect or direct, of the neutralino. Related to indirect detection, the present work has been performed in the context of the AMS experiment. A precursor version of the spectrometer was flown on the space shuttle Discovery in June 1998. The detector included an Aerogel Threshold Cherenkov counter (ATC) to identify antiprotons, whose spectrum may be used to infer a neutralino signal. The analysis of the ATC data is presented including an evaluation of the flight performance and a description of the optimization of the antiproton selection. An antiproton analysis is also reported. A phenomenological study allows us to investigate the discovery potential of this indirect method. This thesis also includes the development of a new detector (MACHe3) designed for direct neutralino search using a superfluid {sup 3}He bolometer operated at ultra low temperatures. The data analysis of the prototype cell is presented. A Monte Carlo simulation has been developed, in order to optimize the detector design for direct neutralino search. These results are compared with theoretical predictions of supersymmetric models, thus highlighting the discovery potential of this detector and its complementarity with existing devices. (author)

  15. Directional detection of galactic Dark Matter

    CERN Document Server

    Mayet, F; Bernard, G; Bosson, G; Bourrion, O; Grignon, C; Guillaudin, O; Koumeir, C; Richer, J P; Santos, D; Colas, P; Ferer, E; Giomataris, I; Allaoua, A; Lebreton, L

    2010-01-01

    Directional detection of galactic Dark Matter is a promising search strategy for discriminating geniune WIMP events from background ones. We present technical progress on gaseous detectors as well as recent phenomenological studies, allowing the design and construction of competitive experiments.

  16. High Throughput Direct Detection Doppler Lidar Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Lite Cycles, Inc. (LCI) proposes to develop a direct-detection Doppler lidar (D3L) technology called ELITE that improves the system optical throughput by more than...

  17. Detection and frequency tracking of chirping signals

    Energy Technology Data Exchange (ETDEWEB)

    Elliott, G.R.; Stearns, S.D.

    1990-08-01

    This paper discusses several methods to detect the presence of and track the frequency of a chirping signal in broadband noise. The dynamic behavior of each of the methods is described and tracking error bounds are investigated in terms of the chirp rate. Frequency tracking and behavior in the presence of varying levels of noise are illustrated in examples. 11 refs., 29 figs.

  18. Detecting Impulses in Mechanical Signals by Wavelets

    Directory of Open Access Journals (Sweden)

    Yang W-X

    2004-01-01

    Full Text Available The presence of periodical or nonperiodical impulses in vibration signals often indicates the occurrence of machine faults. This knowledge is applied to the fault diagnosis of such machines as engines, gearboxes, rolling element bearings, and so on. The development of an effective impulse detection technique is necessary and significant for evaluating the working condition of these machines, diagnosing their malfunctions, and keeping them running normally over prolong periods. With the aid of wavelet transforms, a wavelet-based envelope analysis method is proposed. In order to suppress any undesired information and highlight the features of interest, an improved soft threshold method has been designed so that the inspected signal is analyzed in a more exact way. Furthermore, an impulse detection technique is developed based on the aforementioned methods. The effectiveness of the proposed technique on the extraction of impulsive features of mechanical signals has been proved by both simulated and practical experiments.

  19. The Maximum Patch Method for Directional Dark Matter Detection

    CERN Document Server

    Henderson, Shawn; Fisher, Peter

    2008-01-01

    Present and planned dark matter detection experiments search for WIMP-induced nuclear recoils in poorly known background conditions. In this environment, the maximum gap statistical method provides a way of setting more sensitive cross section upper limits by incorporating known signal information. We give a recipe for the numerical calculation of upper limits for planned directional dark matter detection experiments, that will measure both recoil energy and angle, based on the gaps between events in two-dimensional phase space.

  20. Measurement Design for Detecting Sparse Signals

    CERN Document Server

    Zahedi, Ramin; Chong, Edwin K P

    2011-01-01

    We consider the problem of testing for the presence (or detection) of an unknown sparse signal in additive white noise. Given a fixed measurement budget, much smaller than the dimension of the signal, we consider the general problem of designing compressive measurements to maximize the measurement signal-to-noise ratio (SNR), as increasing SNR improves the detection performance in a large class of detectors. We use a lexicographic optimization approach, where the optimal measurement design for sparsity level $k$ is sought only among the set of measurement matrices that satisfy the optimality conditions for sparsity level k-1. We consider optimizing two different SNR criteria, namely a worst-case SNR measure, over all possible realizations of a k-sparse signal, and an average SNR measure with respect to a uniform distribution on the locations of the up to k nonzero entries in the signal. We establish connections between these two criteria and certain classes of tight frames. We constrain our measurement matric...

  1. Direct Detection of Dynamical Dark Matter

    CERN Document Server

    Dienes, Keith R; Thomas, Brooks

    2012-01-01

    Dynamical dark matter (DDM) is an alternative framework for dark-matter physics in which the dark-matter candidate is an ensemble of constituent fields with differing masses, lifetimes, and cosmological abundances. In this framework, it is the balancing of these quantities against each other across the ensemble as a whole which ensures phenomenological viability. In this paper, we examine the prospects for the direct detection of a DDM ensemble. In particular, we study the constraints imposed by current limits from direct-detection experiments on the parameter space of DDM models, and we assess the prospects for detecting such an ensemble and distinguishing it from traditional dark-matter candidates on the basis of data from the next generation of direct-detection experiments. For concreteness, we focus primarily on the case in which elastic scattering via spin-independent interactions dominates the interaction rate between atomic nuclei and the constituent particles of the ensemble. We also briefly discuss t...

  2. Direct Detection of Sub-GeV Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Essig, Rouven; Mardon, Jeremy; Volansky, Tomer

    2012-03-20

    Direct detection strategies are proposed for dark matter particles with MeV to GeV mass. In this largely unexplored mass range, dark matter scattering with electrons can cause single-electron ionization signals, which are detectable with current technology. Ultraviolet photons, individual ions, and heat are interesting alternative signals. Focusing on ionization, we calculate the expected dark matter scattering rates and estimate the sensitivity of possible experiments. Backgrounds that may be relevant are discussed. Theoretically interesting models can be probed with existing technologies, and may even be within reach using ongoing direct detection experiments. Significant improvements in sensitivity should be possible with dedicated experiments, opening up a window to new regions in dark matter parameter space.

  3. Reliable detection of directional couplings using rank statistics.

    Science.gov (United States)

    Chicharro, Daniel; Andrzejak, Ralph G

    2009-08-01

    To detect directional couplings from time series various measures based on distances in reconstructed state spaces were introduced. These measures can, however, be biased by asymmetries in the dynamics' structure, noise color, or noise level, which are ubiquitous in experimental signals. Using theoretical reasoning and results from model systems we identify the various sources of bias and show that most of them can be eliminated by an appropriate normalization. We furthermore diminish the remaining biases by introducing a measure based on ranks of distances. This rank-based measure outperforms existing distance-based measures concerning both sensitivity and specificity for directional couplings. Therefore, our findings are relevant for a reliable detection of directional couplings from experimental signals.

  4. Acoustic signal detection of manatee calls

    Science.gov (United States)

    Niezrecki, Christopher; Phillips, Richard; Meyer, Michael; Beusse, Diedrich O.

    2003-04-01

    The West Indian manatee (trichechus manatus latirostris) has become endangered partly because of a growing number of collisions with boats. A system to warn boaters of the presence of manatees, that can signal to boaters that manatees are present in the immediate vicinity, could potentially reduce these boat collisions. In order to identify the presence of manatees, acoustic methods are employed. Within this paper, three different detection algorithms are used to detect the calls of the West Indian manatee. The detection systems are tested in the laboratory using simulated manatee vocalizations from an audio compact disc. The detection method that provides the best overall performance is able to correctly identify ~=96% of the manatee vocalizations. However the system also results in a false positive rate of ~=16%. The results of this work may ultimately lead to the development of a manatee warning system that can warn boaters of the presence of manatees.

  5. Automatic Smoker Detection from Telephone Speech Signals

    DEFF Research Database (Denmark)

    Alavijeh, Amir Hossein Poorjam; Hesaraki, Soheila; Safavi, Saeid

    2017-01-01

    on Gaussian mixture model means and weights respectively. Each framework is evaluated using different classification algorithms to detect the smoker speakers. Finally, score-level fusion of the i-vector-based and the NFA-based recognizers is considered to improve the classification accuracy. The proposed......This paper proposes an automatic smoking habit detection from spontaneous telephone speech signals. In this method, each utterance is modeled using i-vector and non-negative factor analysis (NFA) frameworks, which yield low-dimensional representation of utterances by applying factor analysis...... method is evaluated on telephone speech signals of speakers whose smoking habits are known drawn from the National Institute of Standards and Technology (NIST) 2008 and 2010 Speaker Recognition Evaluation databases. Experimental results over 1194 utterances show the effectiveness of the proposed approach...

  6. Enhanced Propagating Surface Plasmon Signal Detection

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Y.; Joly, Alan G.; El-Khoury, Patrick Z.; Hess, Wayne P.

    2016-12-21

    Overcoming the dissipative nature of propagating surface plasmons (PSPs) is pre-requisite to realizing functional plasmonic circuitry, in which large bandwidth signals can be manipulated over length scales far-below the diffraction limit of light. To this end, we report on a novel PSP enhanced signal detection technique achieved in an all-metallic substrate. We take advantage of two strategically spatio-temporally separated phase-locked femtosecond laser pulses, incident onto lithographically patterned PSP coupling structures. We follow PSP propagation with joint femtosecond temporal and nanometer spatial resolution in a time-resolved non-linear photoemission electron microscopy scheme. Initially, a PSP signal wave packet is launched from a hole etched into the silver surface from where it propagates through an open trench structure and is decoded through the use of a timed probe pulse. FDTD calculations demonstrate that PSP signal waves may traverse open trenches in excess of 10 microns in diameter, thereby allowing remote detection even through vacuum regions. This arrangement results in a 10X enhancement in photoemission relative to readout from the bare metal surface. The enhancement is attributed to an all-optical homodyne detection technique that mixes signal and reference PSP waves in a non-linear scheme. Larger readout trenches achieve higher readout levels, however reduced transmission through the trench limits the trench size to 6 microns for maximum readout levels. However, the use of an array of trenches increases the maximum enhancement to near 30X. The attainable enhancement factor may be harnessed to achieve extended coherent PSP propagation in ultrafast plasmonic circuitry.

  7. Edge detection based on directional space

    Institute of Scientific and Technical Information of China (English)

    YUAN Wei-qi; LI De-sheng

    2006-01-01

    A new method for edge detection based on directional space is proposed.The principle is that:firstly,the directional differential space is set up in which the ridge edge pixels and valley edge pixels are abstracted with the help of the method of logical judgments along the direction of differential function,forming a directional roof edge map;secondly,step edge pixels are abstracted between the neighboring directional ridge edge and directional valley edge along the direction of differential function;finally,the ridge edge map,valley edge map and step edge map gained along different directions are combined into corresponding ridge edge map,valley edge map and step edge map.This method is different from classical algorithms in which the gray differential values of the mutual vertical direction are combined into one gradient value.The experiment of edge detection is made for the images of nature scenery,human body and accumulative raw material,whose result is compared with the one of classical algorithms and showing the robustness of the proposed method.

  8. Signal Detection for Pareto Renewal Processes.

    Science.gov (United States)

    1982-10-01

    SThe Pareto distribution itself was, of course, introduced by Vilfredo Pareto (1648 - 1923). (See Reference [221). This distribution has been used and...Bull. Calcutta Statist. Assoc., 7, 115-123. 22. Pareto , Vilfredo (1897). Cours d’Economie Politique. Lausanne and Paris: Rouge and Cie. 23. Park, C...STANDARDS-193-A 0 .1 / - r- ,---------------,- 8-82 SERIES IN STATISTICS AND BIOSTATISTICS SIGNAL DETECTION FOR PARETO RENEWAL PROCESSES C.B. BELL, R

  9. Community detection by signaling on complex networks

    Science.gov (United States)

    Hu, Yanqing; Li, Menghui; Zhang, Peng; Fan, Ying; di, Zengru

    2008-07-01

    Based on a signaling process of complex networks, a method for identification of community structure is proposed. For a network with n nodes, every node is assumed to be a system which can send, receive, and record signals. Each node is taken as the initial signal source to excite the whole network one time. Then the source node is associated with an n -dimensional vector which records the effects of the signaling process. By this process, the topological relationship of nodes on the network could be transferred into a geometrical structure of vectors in n -dimensional Euclidean space. Then the best partition of groups is determined by F statistics and the final community structure is given by the K -means clustering method. This method can detect community structure both in unweighted and weighted networks. It has been applied to ad hoc networks and some real networks such as the Zachary karate club network and football team network. The results indicate that the algorithm based on the signaling process works well.

  10. Systematic aspects of direct extrasolar planet detection

    Science.gov (United States)

    Brown, Robert A.

    1988-01-01

    Using the first optical observatory in space, the Hubble Space Telescope, images of possible extrasolar planets will have poor contrast against the background of diffracted and scattered starlight. The very long exposure time required to achieve an adequate signal-to-noise ratio will make their detection infeasible. For a future telescope, a 16-fold increase in either the smoothness of the collecting area of the optics would reduce the exposure time to a tolerable value, but the contrast would remain low and the required photometric precision high. In this situation, the feasibility of detection would be contingent on the careful identification and control of systematic errors.

  11. Detection and Localization of Random Signals

    DEFF Research Database (Denmark)

    Sporring, Jon; Olsen, Niels Holm; Nielsen, Mads

    2003-01-01

    Object detection and localization are common tasks in image analysis. Correlation based detection algorithms are known to work well, when dealing with objects with known geometry in Gaussianly distributed additive noise. In the Bayes’ view, correlation is linearly related to the logarithm...... of the probability density, and optimal object detection is obtained by the integral of the exponentiated squared correlation under appropriate normalization. Correlation with a model is linear in the input image, and can be computed effectively for all possible positions of the model using Fourier based linear...... filtering techniques. It is therefore interesting to extend the application to objects with many but small degrees of freedom in their geometry. These geometric variations deteriorate the linear correlation signal, both regarding its strength and localization with multiple peaks from a single object...

  12. Halo Independent Direct Detection of Momentum-Dependent Dark Matter

    CERN Document Server

    Cherry, John F; Shoemaker, Ian M

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be $\\lesssim 10$ MeV for DM in the 20-1000 GeV range in a halo-independent manner.

  13. Multiple Antenna Cognitive Receivers and Signal Detection

    CERN Document Server

    Couillet, Romain

    2008-01-01

    A Bayesian inference learning process for cognitive receivers is provided in this paper. We focus on the particular case of signal detectionas an explanatory example to the learning framework. Under any prior state of knowledge on the communication channel, an information theoretic criterion is presented to decide on the presence of informative data in a noisy wireless MIMO communication. We detail the particular cases of knowledge, or absence of knowledge at the receiver, of the number of transmit antennas and noise power. The provided method is instrumental to provide intelligence to the receiver and gives birth to a novel Bayesian signal detector. The detector is compared to the classical power detector and provides detection performance upper bounds. Simulations corroborate the theoretical results and quantify the gain achieved using the proposed Bayesian framework.

  14. Detection and Classification of Whale Acoustic Signals

    Science.gov (United States)

    Xian, Yin

    This dissertation focuses on two vital challenges in relation to whale acoustic signals: detection and classification. In detection, we evaluated the influence of the uncertain ocean environment on the spectrogram-based detector, and derived the likelihood ratio of the proposed Short Time Fourier Transform detector. Experimental results showed that the proposed detector outperforms detectors based on the spectrogram. The proposed detector is more sensitive to environmental changes because it includes phase information. In classification, our focus is on finding a robust and sparse representation of whale vocalizations. Because whale vocalizations can be modeled as polynomial phase signals, we can represent the whale calls by their polynomial phase coefficients. In this dissertation, we used the Weyl transform to capture chirp rate information, and used a two dimensional feature set to represent whale vocalizations globally. Experimental results showed that our Weyl feature set outperforms chirplet coefficients and MFCC (Mel Frequency Cepstral Coefficients) when applied to our collected data. Since whale vocalizations can be represented by polynomial phase coefficients, it is plausible that the signals lie on a manifold parameterized by these coefficients. We also studied the intrinsic structure of high dimensional whale data by exploiting its geometry. Experimental results showed that nonlinear mappings such as Laplacian Eigenmap and ISOMAP outperform linear mappings such as PCA and MDS, suggesting that the whale acoustic data is nonlinear. We also explored deep learning algorithms on whale acoustic data. We built each layer as convolutions with either a PCA filter bank (PCANet) or a DCT filter bank (DCTNet). With the DCT filter bank, each layer has different a time-frequency scale representation, and from this, one can extract different physical information. Experimental results showed that our PCANet and DCTNet achieve high classification rate on the whale

  15. Model identification for dose response signal detection

    OpenAIRE

    Bretz, Frank; Dette, Holger; Titoff, Stefanie; Volgushev, Stanislav

    2012-01-01

    We consider the problem of detecting a dose response signal if several competing regression models are available to describe the dose response relationship. In particular, we re-analyze the MCP-Mod approach from Bretz et al. (2005), which has become a very popular tool for this problem in recent years. We propose an improvement based on likelihood ratio tests and prove that in linear models this approach is always at least as powerful as the MCP-Mod method. This result remains ...

  16. Compressive Detection of Random Subspace Signals

    Science.gov (United States)

    Razavi, Alireza; Valkama, Mikko; Cabric, Danijela

    2016-08-01

    The problem of compressive detection of random subspace signals is studied. We consider signals modeled as $\\mathbf{s} = \\mathbf{H} \\mathbf{x}$ where $\\mathbf{H}$ is an $N \\times K$ matrix with $K \\le N$ and $\\mathbf{x} \\sim \\mathcal{N}(\\mathbf{0}_{K,1},\\sigma_x^2 \\mathbf{I}_K)$. We say that signal $\\mathbf{s}$ lies in or leans toward a subspace if the largest eigenvalue of $\\mathbf{H} \\mathbf{H}^T$ is strictly greater than its smallest eigenvalue. We first design a measurement matrix $\\mathbf{\\Phi}=[\\mathbf{\\Phi}_s^T,\\mathbf{\\Phi}_o^T]^T$ comprising of two sub-matrices $\\mathbf{\\Phi}_s$ and $\\mathbf{\\Phi}_o$ where $\\mathbf{\\Phi}_s$ projects the signals to the strongest left-singular vectors, i.e., the left-singular vectors corresponding to the largest singular values, of subspace matrix $\\mathbf{H}$ and $\\mathbf{\\Phi}_o$ projects it to the weakest left-singular vectors. We then propose two detectors which work based on the difference in energies of the samples measured by two sub-matrices $\\mathbf{\\Phi}_s$ and $\\mathbf{\\Phi}_o$ and prove their optimality. Simplified versions of the proposed detectors for the case when the variance of noise is known are also provided. Furthermore, we study the performance of the detector when measurements are imprecise and show how imprecision can be compensated by employing more measurement devices. The problem is then re-formulated for the case when the signal lies in the union of a finite number of linear subspaces instead of a single linear subspace. Finally, we study the performance of the proposed methods by simulation examples.

  17. Detecting double compression of audio signal

    Science.gov (United States)

    Yang, Rui; Shi, Yun Q.; Huang, Jiwu

    2010-01-01

    MP3 is the most popular audio format nowadays in our daily life, for example music downloaded from the Internet and file saved in the digital recorder are often in MP3 format. However, low bitrate MP3s are often transcoded to high bitrate since high bitrate ones are of high commercial value. Also audio recording in digital recorder can be doctored easily by pervasive audio editing software. This paper presents two methods for the detection of double MP3 compression. The methods are essential for finding out fake-quality MP3 and audio forensics. The proposed methods use support vector machine classifiers with feature vectors formed by the distributions of the first digits of the quantized MDCT (modified discrete cosine transform) coefficients. Extensive experiments demonstrate the effectiveness of the proposed methods. To the best of our knowledge, this piece of work is the first one to detect double compression of audio signal.

  18. Scalar Dark Matter: Direct vs. Indirect Detection

    CERN Document Server

    Duerr, Michael; Smirnov, Juri

    2015-01-01

    We revisit the simplest model for dark matter. In this context the dark matter candidate is a real scalar field which interacts with the Standard Model particles through the Higgs portal. We discuss the relic density constraints as well as the predictions for direct and indirect detection. The final state radiation processes are investigated in order to understand the visibility of the gamma lines from dark matter annihilation. We find two regions where one could observe the gamma lines at gamma-ray telescopes. We point out that the region where the dark matter mass is between 100 and 300 GeV can be tested in the near future at direct and indirect detection experiments.

  19. Direct optical nanoscopy with axially localized detection

    CERN Document Server

    Bourg, N; Dupuis, G; Barroca, T; Bon, P; Lécart, S; Fort, E; Lévêque-Fort, S

    2014-01-01

    Evanescent light excitation is widely used in super-resolution fluorescence microscopy to confine light and reduce background noise. Herein we propose a method of exploiting evanescent light in the context of emission. When a fluorophore is located in close proximity to a medium with a higher refractive index, its near-field component is converted into light that propagates beyond the critical angle. This so-called Supercritical Angle Fluorescence (SAF) can be captured using a hig-NA objective and used to determine the axial position of the fluorophore with nanometer precision. We introduce a new technique for 3D nanoscopy that combines direct STochastic Optical Reconstruction Microscopy (dSTORM) imaging with dedicated detection of SAF emission. We demonstrate that our approach of a Direct Optical Nanoscopy with Axially Localized Detection (DONALD) yields a typical isotropic 3D localization precision of 20 nm.

  20. Automatic detection of service initiation signals used in bars

    Directory of Open Access Journals (Sweden)

    Sebastian eLoth

    2013-08-01

    Full Text Available Recognising the intention of others is important in all social interactions, especially in the service domain. Enabling a bartending robot to serve customers is particularly challenging as the system has to recognise the social signals produced by customers and respond appropriately. Detecting whether a customer would like to order is essential for the service encounter to succeed. This detection is particularly challenging in a noisy environment with multiple customers. Thus, a bartending robot has to be able to distinguish between customers intending to order, chatting with friends or just passing by. In order to study which signals customers use to initiate a service interaction in a bar, we recorded real-life customer-staff interactions in several German bars. These recordings were used to generate initial hypotheses about the signals customers produce when bidding for the attention of bar staff. Two experiments using snapshots and short video sequences then tested the validity of these hypothesised candidate signals. The results revealed that bar staff responded to a set of two non-verbal signals: first, customers position themselves directly at the bar counter and, secondly, they look at a member of staff. Both signals were necessary and, when occurring together, sufficient. The participants also showed a strong agreement about when these cues occurred in the videos. Finally, a signal detection analysis revealed that ignoring a potential order is deemed worse than erroneously inviting customers to order. We conclude that a these two easily recognisable actions are sufficient for recognising the intention of customers to initiate a service interaction, but other actions such as gestures and speech were not necessary, and b the use of reaction time experiments using natural materials is feasible and provides ecologically valid results.

  1. On the direct detection of gravitational waves

    Science.gov (United States)

    Pustovoit, V. I.

    2016-10-01

    Different types of gravitational wave (GW) detectors are considered. It is noted that interferometric techniques offer the greatest prospects for GW registration due to their high sensitivity and extremely wide frequency band. Using laser interferometers, proposed as far back as 1962 in the work by M E Gertsenshtein and V I Pustovoit published in Russian (Zh. Eksp. Teor. Fiz., vol. 43, p. 605, 1962) and in English translation (Sov. Phys. JETP, vol. 16, p. 433, 1963), it proved possible for the first time to directly detect GW emission from a merger of two black holes. It is noted that the assertion that Gertsen-shtein-Pustovoit's work was unknown to some of those experts involved in direct GW detection is inconsistent with reality. The problems of high-power laser radiation affecting the electrostatic polarization of free-mass mirrors are discussed. It is shown that mirror polarization can lead to additional links with electrically conducting elements of the design resulting in the interferometer's reduced sensitivity. Some new prospects for developing high reflection structures are discussed and heat extraction problems are considered. This article is the revised and extended version of the report “On the first direct detection of gravitational waves” delivered by V I Pustovoit at the Scientific Session of the Physical Sciences Division of the Russian Academy of Sciences (March 2, 2016). All other reports presented at the session were published in the preceding issue of Physics-Uspekhi (September 2016) (see Refs [108, 111-113]). (Editorial note)

  2. Detecting Volcanic Ash Plumes with GNSS Signals

    Science.gov (United States)

    Rainville, N.; Larson, K. M.; Palo, S. E.; Mattia, M.; Rossi, M.; Coltelli, M.; Roesler, C.; Fee, D.

    2016-12-01

    Global Navigation Satellite Systems (GNSS) receivers are commonly placed near volcanic sites to measure ground deformation. In addition to the carrier phase data used to measure ground position, these receivers also record Signal to Noise ratio (SNR) data. Larson (2013) showed that attenuations in SNR data strongly correlate with ash emissions at a series of eruptions of Redoubt Volcano. This finding has been confirmed at eruptions for Tongariro, Mt Etna, Mt Shindake, and Sakurajima. In each of these detections, very expensive geodetic quality GNSS receivers were used. If low-cost GNSS instruments could be used instead, a networked array could be deployed and optimized for plume detection and tomography. The outputs of this sensor array could then be used by both local volcanic observatories and Volcano Ash Advisory Centers. Here we will describe progress in developing such an array. The sensors we are working with are intended for navigation use, and thus lack the supporting power and communications equipment necessary for a networked system. Reliably providing those features is major challenge for the overall sensor design. We have built prototypes of our Volcano Ash Plume Receiver (VAPR), with solar panels, lithium-ion batteries and onboard data storage for preliminary testing. We will present results of our field tests of both receivers and antennas. A second critical need for our array is a reliable detection algorithm. We have tested our algorithm on data from recent eruptions and have incorporated the noise characteristics of the low-cost GNSS receiver. We have also developed a simulation capability so that the receivers can be deployed to optimize vent crossing GNSS signals.

  3. Effect of consumer reporting on signal detection: using disproportionality analysis.

    Science.gov (United States)

    Hammond, Isaac W; Rich, Donna S; Gibbs, Trevor G

    2007-11-01

    adverse event reports submitted directly to pharmaceutical companies by consumers can help significantly in the early detection of safety signals.

  4. Multilevel electrochemical signal detections of metalloprotein heterolayers for bioelectronic device

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Yong-Ho; Yoo, Si-Youl; Lee, Taek [Department of Chemical and Biomolecular Engineering, Sogang University, 35 Baekbeom-ro(Sinsu-dong), Mapo-gu, Seoul 121-742 (Korea, Republic of); Lee, Hun Joo [Interdisciplinary Program of Integrated Biotechnology, Sogang University, 35 Baekbeomro(Sinsu-dong), Mapo-gu, Seoul 121-742 (Korea, Republic of); Min, Junhong [School of Integrative Engineering, Chung-Ang University, Heukseok-dong, Dongjak-gu, Seoul 156-756 (Korea, Republic of); Choi, Jeong-Woo, E-mail: jwchoi@sogang.ac.kr [Department of Chemical and Biomolecular Engineering, Sogang University, 35 Baekbeom-ro(Sinsu-dong), Mapo-gu, Seoul 121-742 (Korea, Republic of); Interdisciplinary Program of Integrated Biotechnology, Sogang University, 35 Baekbeomro(Sinsu-dong), Mapo-gu, Seoul 121-742 (Korea, Republic of)

    2014-01-31

    In the present study, we investigated the simultaneous detection of multilevel electrochemical signals from various metalloprotein heterolayers for the bioelectronic devices. A layer-by-layer assembly method based on simple electrostatic interaction was introduced to form protein bilayers. The gold substrate was modified with poly (ethylene glycol) thiol acid as the precursor, which introduced negative charges to the surface. Based on the isoelectric point, net-charge controlled metalloproteins by pH adjustment were sequentially immobilized on this negatively charged substrate. The degree of protein immobilization on the gold substrate was confirmed by surface plasmon resonance spectroscopy, and the surface topology changes due to the protein immobilization were confirmed by atomic force microscopy. Redox signals in the protein layers were measured by cyclic voltammetry. As a result, various redox signals generated from different metalloproteins on a single electrode were monitored. This proposed method for the detection of multi-level electrochemical signals can be directly applied to bioelectronic devices that store multi-information in a single electrode. - Highlights: • We fabricated heterolayers composed of various metalloproteins. • Metalloproteins were immobilized by layer-by-layer assembly. • The degree of immobilization was controlled by the net charge of metalloproteins. • Various redox signals generated from heterolayers were well monitored.

  5. Confidence Measurement in the Light of Signal Detection Theory

    Directory of Open Access Journals (Sweden)

    Sébastien eMassoni

    2014-12-01

    Full Text Available We compare three alternative methods for eliciting retrospective confidence in the context of a simple perceptual task: the Simple Confidence Rating (a direct report on a numerical scale, the Quadratic Scoring Rule (a post-wagering procedure and the Matching Probability (a generalization of the no-loss gambling method. We systematically compare the results obtained with these three rules to the theoretical confidence levels that can be inferred from performance in the perceptual task using Signal Detection Theory. We find that the Matching Probability provides better results in that respect. We conclude that Matching Probability is particularly well suited for studies of confidence that use Signal Detection Theory as a theoretical framework.

  6. Complementarity between collider, direct detection, and indirect detection experiments

    CERN Document Server

    Cahill-Rowley, Matthew

    2014-01-01

    We examine the capabilities of planned direct detection, indirect detection, and collider experiments in exploring the 19-parameter p(henomenological)MSSM, focusing on the complementarity between the different search techniques. In particular, we consider dark matter searches at the 7, 8 (and eventually 14) TeV LHC, \\Fermi, CTA, IceCube/DeepCore, and LZ. We see that the search sensitivities depend strongly on the WIMP mass and annihilation mechanism, with the result that different search techniques explore orthogonal territory. We also show that advances in each technique are necessary to fully explore the space of Supersymmetric WIMPs.

  7. Ultrasound perfusion signal processing for tumor detection

    Science.gov (United States)

    Kim, MinWoo; Abbey, Craig K.; Insana, Michael F.

    2016-04-01

    Enhanced blood perfusion in a tissue mass is an indication of neo-vascularity and a sign of a potential malignancy. Ultrasonic pulsed-Doppler imaging is a preferred modality for noninvasive monitoring of blood flow. However, the weak blood echoes and disorganized slow flow make it difficult to detect perfusion using standard methods without the expense and risk of contrast enhancement. Our research measures the efficiency of conventional power-Doppler (PD) methods at discriminating flow states by comparing measurement performance to that of an ideal discriminator. ROC analysis applied to the experimental results shows that power Doppler methods are just 30-50 % efficient at perfusion flows less than 1ml/min, suggesting an opportunity to improve perfusion assessment through signal processing. A new perfusion estimator is proposed by extending the statistical discriminator approach. We show that 2-D perfusion color imaging may be enhanced using this approach.

  8. Hall Sensor Output Signal Fault-Detection & Safety Implementation Logic

    Directory of Open Access Journals (Sweden)

    Lee SangHun

    2016-01-01

    Full Text Available Recently BLDC motors have been popular in various industrial applications and electric mobility. Recently BLDC motors have been popular in various industrial applications and electric mobility. In most brushless direct current (BLDC motor drives, there are three hall sensors as a position reference. Low resolution hall effect sensor is popularly used to estimate the rotor position because of its good comprehensive performance such as low cost, high reliability and sufficient precision. Various possible faults may happen in a hall effect sensor. This paper presents a fault-tolerant operation method that allows the control of a BLDC motor with one faulty hall sensor and presents the hall sensor output fault-tolerant control strategy. The situations considered are when the output from a hall sensor stays continuously at low or high levels, or a short-time pulse appears on a hall sensor signal. For fault detection, identification of a faulty signal and generating a substitute signal, this method only needs the information from the hall sensors. There are a few research work on hall effect sensor failure of BLDC motor. The conventional fault diagnosis methods are signal analysis, model based analysis and knowledge based analysis. The proposed method is signal based analysis using a compensation signal for reconfiguration and therefore fault diagnosis can be fast. The proposed method is validated to execute the simulation using PSIM.

  9. Assessing Alternatives for Directional Detection of a WIMP Halo

    CERN Document Server

    Copi, C J; Simmons-Duffin, D; Stroiney, S R; Copi, Craig J.; Krauss, Lawrence M.; Simmons-Duffin, David; Stroiney, Steven R.

    2005-01-01

    The future of direct terrestrial WIMP detection lies on two fronts: new, much larger low background detectors sensitive to energy deposition, and detectors with directional sensitivity. The former can large range of WIMP parameter space using well tested technology while the latter may be necessary if one is to disentangle particle physics parameters from astrophysical halo parameters. Because directional detectors will be quite difficult to construct it is worthwhile exploring in advance generally which experimental features will yield the greatest benefits at the lowest costs. We examine the sensitivity of directional detectors with varying angular tracking resolution with and without the ability to distinguish forward versus backward recoils, and compare these to the sensitivity of a detector where the track is projected onto a two-dimensional plane. The latter detector regardless of where it is placed on the Earth, can be oriented to produce a significantly better discrimination signal than a 3D detector ...

  10. Detectability of ranking hierarchies in directed networks

    CERN Document Server

    Letizia, Elisa; Lillo, Fabrizio

    2016-01-01

    Identifying hierarchies and rankings of nodes in directed graphs is fundamental in many applications such as social network analysis, biology, economics, and finance. A recently proposed method identifies the hierarchy by finding the ordered partition of nodes which minimizes a score function, termed agony. This function penalizes the links violating the hierarchy in a way depending on the strength of the violation. To investigate the detectability of ranking hierarchies we introduce an ensemble of random graphs, the Hierarchical Stochastic Block Model. We find that agony may fail to identify hierarchies when the structure is not strong enough and the size of the classes is small with respect to the whole network. We analytically characterize the detectability threshold and we show that an iterated version of agony can partly overcome this resolution limit.

  11. Dark Matter directional detection with MIMAC

    CERN Document Server

    Riffard, Q; Bosson, G; Bourrion, O; Guillaudin, O; Lamblin, J; Mayet, F; Muraz, J -F; Richer, J -P; Santos, D; Lebreton, L; Maire, D; Busto, J; Brunner, J; Fouchez, D

    2013-01-01

    Directional detection is a promising direct Dark Matter (DM) search strategy. The angular distribution of the nuclear recoil tracks from WIMP events should present an anisotropy in galactic coordinates. This strategy requires both a measurement of the recoil energy with a threshold of about 5 keV and 3D recoil tracks down to few millimeters. The MIMAC project, based on a \\textmu-TPC matrix, with $CF_4$ and $CHF_3$, is being developed. In June 2012, a bi-chamber prototype was installed at the LSM (Laboratoire Souterrain de Modane). A preliminary analysis of the first four months data taking allowed, for the first time, the observation of recoils from the $\\mathrm{^{222}Rn}$ progeny.

  12. Direct dark matter detection: the next decade

    CERN Document Server

    Baudis, Laura

    2012-01-01

    Direct dark matter searches are promising techniques to identify the nature of dark matter particles. I describe the future of this field of research, focussing on the question of what can be achieved in the next decade. I will present the main techniques and R&D projects that will allow to build so-called ultimate WIMP detectors, capable of probing spin-independent interactions down to the unimaginably low cross section of 1e-48 cm2, before the irreducible neutrino background takes over. If a discovery is within the reach of a near-future dark matter experiment, these detectors will be able to constrain WIMP properties such as its mass, scattering cross section and possibly spin. With input from the LHC and from indirect searches, direct detection experiments will hopefully allow to determine the local density and to constrain the local phase-space structure of our dark matter halo.

  13. Superconducting Nuclear Recoil Sensor for Directional Dark Matter Detection

    Science.gov (United States)

    Junghans, Ann; Baldwin, Kevin; Hehlen, Markus; Lafler, Randy; Loomba, Dinesh; Phan, Nguyen; Weisse-Bernstein, Nina

    The Universe consists of 72% dark energy, 23% dark matter and only 5% of ordinary matter. One of the greatest challenges of the scientific community is to understand the nature of dark matter. Current models suggest that dark matter is made up of slowly moving, weakly interacting massive particles (WIMPs). But detecting WIMPs is challenging, as their expected signals are small and rare compared to the large background that can mimic the signal. The largest and most robust unique signature that sets them apart from other particles is the day-night variation of the directionality of dark matter on Earth. This modulation could be observed with a direction-sensitive detector and hence, would provide an unambiguous signature for the galactic origin of WIMPs. There are many studies underway to attempt to detect WIMPs both directly and indirectly, but solid-state WIMP detectors are widely unexplored although they would present many advantages to prevalent detectors that use large volumes of low pressure gas. We present first results of a novel multi-layered architecture, in which WIMPs would interact primarily with solid layers to produce nuclear recoils that then induce measureable voltage pulses in adjacent superconductor layers. This work was supported by the U.S. Department of Energy through the LANL Laboratory Directed Research and Development Program.

  14. (In)Direct detection of boosted dark matter

    Science.gov (United States)

    Agashe, Kaustubh; Cui, Yanou; Necib, Lina; Thaler, Jesse

    2016-05-01

    We present a new multi-component dark matter model with a novel experimental signature that mimics neutral current interactions at neutrino detectors. In our model, the dark matter is composed of two particles, a heavier dominant component that annihilates to produce a boosted lighter component that we refer to as boosted dark matter. The lighter component is relativistic and scatters off electrons in neutrino experiments to produce Cherenkov light. This model combines the indirect detection of the dominant component with the direct detection of the boosted dark matter. Directionality can be used to distinguish the dark matter signal from the atmospheric neutrino background. We discuss the viable region of parameter space in current and future experiments.

  15. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeno, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, Priscilla B.; Daal, M.; Di Stefano, P. C.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, Jeter C.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, W.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-01

    We examine the consequences of the effective eld theory (EFT) of dark matter-nucleon scattering or current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral di*erences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  16. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. Here. we demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. In conclusion, we discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  17. Dark matter effective field theory scattering in direct detection experiments

    CERN Document Server

    Schneck, K; Cerdeno, D G; Mandic, V; Rogers, H E; Agnese, R; Anderson, A J; Asai, M; Balakishiyeva, D; Barker, D; Thakur, R Basu; Bauer, D A; Billard, J; Borgland, A; Brandt, D; Brink, P L; Bunker, R; Caldwell, D O; Calkins, R; Chagani, H; Chen, Y; Cooley, J; Cornell, B; Crewdson, C H; Cushman, P; Daal, M; Di Stefano, P C F; Doughty, T; Esteban, L; Fallows, S; Figueroa-Feliciano, E; Godfrey, G L; Golwala, S R; Hall, J; Harris, H R; Hofer, T; Holmgren, D; Hsu, L; Huber, M E; Jardin, D M; Jastram, A; Kamaev, O; Kara, B; Kelsey, M H; Kennedy, A; Leder, A; Loer, B; Asamar, E Lopez; Lukens, P; Mahapatra, R; McCarthy, K A; Mirabolfathi, N; Moffatt, R A; Mendoza, J D Morales; Oser, S M; Page, K; Page, W A; Partridge, R; Pepin, M; Phipps, A; Prasad, K; Pyle, M; Qiu, H; Rau, W; Redl, P; Reisetter, A; Ricci, Y; Roberts, A; Saab, T; Sadoulet, B; Sander, J; Schnee, R W; Scorza, S; Serfass, B; Shank, B; Speller, D; Toback, D; Upadhyayula, S; Villano, A N; Welliver, B; Wilson, J S; Wright, D H; Yang, X; Yellin, S; Yen, J J; Young, B A; Zhang, J

    2015-01-01

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  18. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  19. Unstable gravitino dark matter prospects for indirect and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Grefe, Michael

    2011-11-15

    We confront the signals expected from unstable gravitino dark matter with observations of indirect dark matter detection experiments in all possible cosmic-ray channels. For this purpose we calculate in detail the gravitino decay widths in theories with bilinear violation of R parity, particularly focusing on decay channels with three particles in the final state. Based on these calculations we predict the fluxes of gamma rays, charged cosmic rays and neutrinos expected from decays of gravitino dark matter. Although the predicted spectra could in principal explain the anomalies observed in the cosmic ray positron and electron fluxes as measured by PAMELA and Fermi LAT, we find that this possibility is ruled out by strong constraints from gamma-ray and antiproton observations. Therefore, we employ current data of indirect detection experiments to place strong constraints on the gravitino lifetime and the strength of R-parity violation. In addition, we discuss the prospects of forthcoming searches for a gravitino signal in the spectrum of cosmic-ray antideuterons, finding that they are in particular sensitive to rather low gravitino masses. Finally, we discuss in detail the prospects for detecting a neutrino signal from gravitino dark matter decays, finding that the sensitivity of neutrino telescopes like IceCube is competitive to observations in other cosmic ray channels, especially for rather heavy gravitinos. Moreover, we discuss the prospects for a direct detection of gravitino dark matter via R-parity violating inelastic scatterings off nucleons. We find that, although the scattering cross section is considerably enhanced compared to the case of elastic gravitino scattering, the expected signal is many orders of magnitude too small in order to hope for a detection in underground detectors. (orig.)

  20. Direct optical nanoscopy with axially localized detection

    Science.gov (United States)

    Bourg, N.; Mayet, C.; Dupuis, G.; Barroca, T.; Bon, P.; Lécart, S.; Fort, E.; Lévêque-Fort, S.

    2015-09-01

    Evanescent light excitation is widely used in super-resolution fluorescence microscopy to confine light and reduce background noise. Here, we propose a method of exploiting evanescent light in the context of emission. When a fluorophore is located in close proximity to a medium with a higher refractive index, its near-field component is converted into light that propagates beyond the critical angle. This so-called supercritical-angle fluorescence can be captured using a high-numerical-aperture objective and used to determine the axial position of the fluorophore with nanometre precision. We introduce a new technique for three-dimensional nanoscopy that combines direct stochastic optical reconstruction microscopy (dSTORM) with dedicated detection of supercritical-angle fluorescence emission. We demonstrate that our approach of direct optical nanoscopy with axially localized detection (DONALD) typically yields an isotropic three-dimensional localization precision of 20 nm within an axial range of ∼150 nm above the coverslip.

  1. Confidence measurement in the light of signal detection theory.

    Science.gov (United States)

    Massoni, Sébastien; Gajdos, Thibault; Vergnaud, Jean-Christophe

    2014-01-01

    We compare three alternative methods for eliciting retrospective confidence in the context of a simple perceptual task: the Simple Confidence Rating (a direct report on a numerical scale), the Quadratic Scoring Rule (a post-wagering procedure), and the Matching Probability (MP; a generalization of the no-loss gambling method). We systematically compare the results obtained with these three rules to the theoretical confidence levels that can be inferred from performance in the perceptual task using Signal Detection Theory (SDT). We find that the MP provides better results in that respect. We conclude that MP is particularly well suited for studies of confidence that use SDT as a theoretical framework.

  2. Confidence measurement in the light of signal detection theory

    Science.gov (United States)

    Massoni, Sébastien; Gajdos, Thibault; Vergnaud, Jean-Christophe

    2014-01-01

    We compare three alternative methods for eliciting retrospective confidence in the context of a simple perceptual task: the Simple Confidence Rating (a direct report on a numerical scale), the Quadratic Scoring Rule (a post-wagering procedure), and the Matching Probability (MP; a generalization of the no-loss gambling method). We systematically compare the results obtained with these three rules to the theoretical confidence levels that can be inferred from performance in the perceptual task using Signal Detection Theory (SDT). We find that the MP provides better results in that respect. We conclude that MP is particularly well suited for studies of confidence that use SDT as a theoretical framework. PMID:25566135

  3. Stokes-vector direct detection for optical communications

    Science.gov (United States)

    Shieh, William; Li, An; Che, Di; Yuan, Feng; Khodakarami, Hamid

    2017-01-01

    To cope with the exponential growth of the Internet traffic, optical communications has advanced by leaps and bounds. For several decades, Intensity modulation with direct detection (IM-DD) dominates the commercial short-reach optical communications. However, when upgrading the data-rate distance product to 1000 Gb/s·km per wavelength and beyond, IM-DD faces severe performance barrier. Aiming to improve the electrical SE and extend the transmission distance, advanced DD modulation formats have been proposed through a so-called self-coherent (SCOH) approach, where a carrier is transmitted together with the signal to achieve a linear mapping between the electrical baseband signal and the optical field. In that way, the impact of the CD can be removed from the received signal, greatly extending the transmission distance of the DD system. Particularly, Stokes-vector direct detection (SV-DD) has been proposed to realize linear complex optical channels as well as enhance the electrical spectral efficiency and transmission reach. In this talk, we present the principle and discuss the performance of SV-DD systems.

  4. Optimal BLS: Optimizing transit-signal detection for Keplerian dynamics

    Science.gov (United States)

    Ofir, Aviv

    2015-08-01

    Transit surveys, both ground- and space-based, have already accumulated a large number of light curves that span several years. We optimize the search for transit signals for both detection and computational efficiencies by assuming that the searched systems can be described by Keplerian, and propagating the effects of different system parameters to the detection parameters. Importnantly, we mainly consider the information content of the transit signal and not any specific algorithm - and use BLS (Kovács, Zucker, & Mazeh 2002) just as a specific example.We show that the frequency information content of the light curve is primarily determined by the duty cycle of the transit signal, and thus the optimal frequency sampling is found to be cubic and not linear. Further optimization is achieved by considering duty-cycle dependent binning of the phased light curve. By using the (standard) BLS, one is either fairly insensitive to long-period planets or less sensitive to short-period planets and computationally slower by a significant factor of ~330 (for a 3 yr long dataset). We also show how the physical system parameters, such as the host star's size and mass, directly affect transit detection. This understanding can then be used to optimize the search for every star individually.By considering Keplerian dynamics explicitly rather than implicitly one can optimally search the transit signal parameter space. The presented Optimal BLS enhances the detectability of both very short and very long period planets, while allowing such searches to be done with much reduced resources and time. The Matlab/Octave source code for Optimal BLS is made available.

  5. Detection of phase randomly distributed weak transient signal using chaos

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    In practical communication and radar system s, the phase of the received signal is random, the arrival time is unknown, the lasting time is limited and the SNR is often very low. In order to realize the detection of the signal, the method of using a group of nonlinear differential equations is presented. The theory of this chaos-based detection is analyzed. Computer simulation indicates that the shortest lasting time of the transient signal that can be detected out is 12 periods, the detection error of arrival time is less than 7/8 signal's period, the detection characteristics are got using Monte-Carlo simulation.

  6. (In)direct detection of boosted dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Agashe, Kaustubh; Cui, Yanou [Maryland Center for Fundamental Physics, University of Maryland, College Park, MD 20742 (United States); Necib, Lina; Thaler, Jesse, E-mail: kagashe@umd.edu, E-mail: cuiyo@umd.edu, E-mail: lnecib@mit.edu, E-mail: jthaler@mit.edu [Center for Theoretical Physics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States)

    2014-10-01

    We initiate the study of novel thermal dark matter (DM) scenarios where present-day annihilation of DM in the galactic center produces boosted stable particles in the dark sector. These stable particles are typically a subdominant DM component, but because they are produced with a large Lorentz boost in this process, they can be detected in large volume terrestrial experiments via neutral-current-like interactions with electrons or nuclei. This novel DM signal thus combines the production mechanism associated with indirect detection experiments (i.e. galactic DM annihilation) with the detection mechanism associated with direct detection experiments (i.e. DM scattering off terrestrial targets). Such processes are generically present in multi-component DM scenarios or those with non-minimal DM stabilization symmetries. As a proof of concept, we present a model of two-component thermal relic DM, where the dominant heavy DM species has no tree-level interactions with the standard model and thus largely evades direct and indirect DM bounds. Instead, its thermal relic abundance is set by annihilation into a subdominant lighter DM species, and the latter can be detected in the boosted channel via the same annihilation process occurring today. Especially for dark sector masses in the 10 MeV–10 GeV range, the most promising signals are electron scattering events pointing toward the galactic center. These can be detected in experiments designed for neutrino physics or proton decay, in particular Super-K and its upgrade Hyper-K, as well as the PINGU/MICA extensions of IceCube. This boosted DM phenomenon highlights the distinctive signatures possible from non-minimal dark sectors.

  7. RFLP analysis in rice by using ECL direct nucleic acid labeling and detection system

    Institute of Scientific and Technical Information of China (English)

    ZHANGShanhong; LIUBin; LUOLin; ZHUXiaoyuan; YANGQiyun; WUShangzhong

    1998-01-01

    ECL (Enhanced Chemiluminescence) direct nu cleic acid labeling and detection syslem were used for RFLP analysis in rice. The system involved directly labeling DNA probe with the enzyme horseradish peroxidase (HRP), and the detection of non-radioactive signal based on chemiluminescence, that was the generation of light via enzyme (HRP)-catalyzed reactions. It was a simple, safe,

  8. Implementation of directional Doppler techniques using a digital signal processor.

    Science.gov (United States)

    Aydin, N; Evans, D H

    1994-07-01

    Three methods of deriving directional signals from phase quadrature Doppler signals, using digital techniques, are described. These are the phasing-filter technique, the Weaver receiver technique and the complex FFT. The basic theory behind the three methods is presented, together with the results of digital simulations. Each of the methods has been implemented in real time using a commercially available digital signal-processing board, and their relative processing times are compared. All the methods work well, and the decision to implement one or other in a specific application is likely to rest on secondary factors, such as the need to tape-record the time domain output.

  9. Silicon avalanche photodiodes for direct detection of X-rays.

    Science.gov (United States)

    Baron, Alfred Q R; Kishimoto, Shunji; Morse, John; Rigal, Jean Marie

    2006-03-01

    Silicon avalanche photodiodes (APDs) are discussed as fast X-ray detectors for synchrotron radiation. The emphasis is on ;direct' detection, where the X-ray is absorbed within the silicon APD itself, and, therefore, on use with medium-energy X-rays, <30 keV. The impact of APD structure on device performance is examined, and representative data from many different commercial devices are presented. Specific areas discussed include signal shapes, high-rate behavior, time resolution and pulse-height response. Data from several APD arrays are also presented, as is a detailed description of an integrated package system. Tables are included comparing commercially available devices, including arrays.

  10. Embolic Doppler ultrasound signal detection via fractional Fourier transform.

    Science.gov (United States)

    Gençer, Merve; Bilgin, Gökhan; Aydın, Nizamettin

    2013-01-01

    Computerized analysis of Doppler ultrasound signals can aid early detection of asymptomatic circulating emboli. For analysis, physicians use informative features extracted from Doppler ultrasound signals. Time -frequency analysis methods are useful tools to exploit the transient like signals such as Embolic signals. Detection of discriminative features would be the first step toward automated analysis of embolic Doppler ultrasound signals. The most problematic part of setting up emboli detection system is to differentiate embolic signals from confusing similar wave-like patterns such as Doppler speckle and artifacts caused by tissue movement, probe tapping, speaking etc. In this study, discrete version of fractional Fourier transform is presented as a solution in the detection of emboli in digitized Doppler ultrasound signals. An accurate set of parameters are extracted using short time Fourier transform and fractional Fourier transform and the results are compared to reveal detection quality. Experimental results prove the efficiency of fractional Fourier transform in which discriminative features becomes more evident.

  11. The Earth's velocity for direct detection experiments

    CERN Document Server

    McCabe, Christopher

    2013-01-01

    The Earth's velocity relative to the Sun in galactic coordinates is required in the rate calculation for direct detection experiments. We provide a rigorous derivation of this quantity to first order in the eccentricity of the Earth's orbit. We also discuss the effect of the precession of the equinoxes, which has previously been ignored. Comparing with other expressions in the literature, we confirm that the expression of Lee, Lisanti and Safdi is correct, while the expression of Lewin and Smith, the de facto standard expression, contains an error. For calculations of the absolute event rate, the leading order expression is sufficient while for modulation searches, an expression with the eccentricity is required for accurate predictions of the modulation phase.

  12. System and Method for Multi-Wavelength Optical Signal Detection

    Science.gov (United States)

    McGlone, Thomas D. (Inventor)

    2017-01-01

    The system and method for multi-wavelength optical signal detection enables the detection of optical signal levels significantly below those processed at the discrete circuit level by the use of mixed-signal processing methods implemented with integrated circuit technologies. The present invention is configured to detect and process small signals, which enables the reduction of the optical power required to stimulate detection networks, and lowers the required laser power to make specific measurements. The present invention provides an adaptation of active pixel networks combined with mixed-signal processing methods to provide an integer representation of the received signal as an output. The present invention also provides multi-wavelength laser detection circuits for use in various systems, such as a differential absorption light detection and ranging system.

  13. Subaperture clutter filter with CFAR signal detection

    Energy Technology Data Exchange (ETDEWEB)

    Ormesher, Richard C.; Naething, Richard M.

    2016-08-30

    The various technologies presented herein relate to the determination of whether a received signal comprising radar clutter further comprises a communication signal. The communication signal can comprise of a preamble, a data symbol, communication data, etc. A first portion of the radar clutter is analyzed to determine a radar signature of the first portion of the radar clutter. A second portion of the radar clutter can be extracted based on the radar signature of the first portion. Following extraction, any residual signal can be analyzed to retrieve preamble data, etc. The received signal can be based upon a linear frequency modulation (e.g., a chirp modulation) whereby the chirp frequency can be determined and the frequency of transmission of the communication signal can be based accordingly thereon. The duration and/or bandwidth of the communication signal can be a portion of the duration and/or the bandwidth of the radar clutter.

  14. Direct Detection of Dark Matter Debris Flows

    CERN Document Server

    Kuhlen, Michael; Spergel, David N

    2012-01-01

    Tidal stripping of dark matter from subhalos falling into the Milky Way produces narrow, cold tidal streams as well as more spatially extended "debris flows" in the form of shells, sheets, and plumes. Here we focus on the debris flow in the Via Lactea II simulation, and show that this incompletely phase-mixed material exhibits distinctive high-velocity behavior. Unlike tidal streams, which may not necessarily intersect the Earth's location, debris flow is spatially uniform at 8 kpc and thus guaranteed to be present in the dark matter flux incident on direct detection experiments. At Earth-frame velocities greater than 450 km/s, debris flow comprises more than half of the dark matter at the Sun's location, and up to 80% at even higher velocities. Therefore, debris flow is most important for experiments that are particularly sensitive to the high velocity tail of the dark matter distribution, such as searches for light or inelastic dark matter or experiments with directional sensitivity. We show that debris flo...

  15. APPLICATION OF FRACTAL THEORY IN TRANSIENT CHAOTIC SIGNAL DETECTION

    Institute of Scientific and Technical Information of China (English)

    何万迅; 施文康

    2002-01-01

    According to the definition of correlation dimension in fractal theory, this paper presented a method to determine and assess noise part in detected transient signal. Such work is essential to decrease the noise part in the detected signal. It is proved that heart period signal (HPS) is one typical sort of transient chaotic signal. Through experiment and simulation, the analysis of chaotic HPS in the detected signal was done. In the end, we deepen the researches on attractor dimension of HPS for persons who are different in age.

  16. Anatomical Directional Dissimilarities in Tri-axial Swallowing Accelerometry Signals.

    Science.gov (United States)

    Movahedi, Faezeh; Kurosu, Atsuko; Coyle, James L; Perera, Subashan; Sejdic, Ervin

    2017-05-01

    Swallowing accelerometry is a noninvasive approach currently under consideration as an instrumental screening test for swallowing difficulties, with most current studies focusing on the swallowing vibrations in the anterior-posterior (A-P) and superior-inferior (S-I) directions. However, the displacement of the hyolaryngeal structure during the act of swallowing in patients with dysphagia involves declination of the medial-lateral (M-L), which suggests that the swallowing vibrations in the M-L direction have the ability to reveal additional details about the swallowing function. With this motivation, we performed a broad comparison of the swallowing vibrations in all three anatomical directions. Tri-axial swallowing accelerometry signals were concurrently collected from 72 dysphagic patients undergoing videofluoroscopic evaluation of swallowing (mean age: 63.94 ± 12.58 years period). Participants swallowed one or more thickened liquids with different consistencies including thin-thick liquids, nectar-thick liquids, and pudding-thick liquids with either a comfortable self-selected volume from a cup or a controlled volume by the examiner from a 5-ml spoon. Swallows were grouped based on the viscosity of swallows and the participant's stroke history. Then, a comprehensive set of features was extracted in multiple signal domains from 881 swallows. The results highlighted inter-axis dissimilarities among tri-axial swallowing vibrations including the extent of variability in the amplitude of signals, the degree of predictability of signals, and the extent of disordered behavior of signals in time-frequency domain. First, the upward movement of the hyolaryngeal structure, representing the S-I signals, were actually more variable in amplitude and showed less predictable behavior than the sideways and forward movements, representing the A-P and M-L signals, during swallowing. Second, the S-I signals, which represent the upward movement of the hyolaryngeal structure

  17. Analysis of a kind of Duffing oscillator system used to detect weak signals

    Institute of Scientific and Technical Information of China (English)

    Li Yue; Yang Bao-Jun; Yuan Ye; Liu Xiao-Hua

    2007-01-01

    The stability of the periodic solution of the Duffing oscillator system in the periodic phase state is proved by using the Yoshizaw theorem, which establishes a theoretical basis for using this kind of chaotic oscillator system to detect weak signals. The restoring force term of the system affects the weak-signal detection ability of the system directly,the quantitative relationship between the coefficients of the linear and nonlinear items of the restoring force of the Duffing oscillator system and the SNR in the detection of weak signals is obtained through a large number of simulation experiments, then a new restoring force function with better detection results is established.

  18. Detecting the Nonlinearity of Fish Acoustic Signals

    Institute of Scientific and Technical Information of China (English)

    REN Xinmin; YIN Li

    2006-01-01

    This paper discusses the nonlinearity of fish acoustic signals by using the surrogate data method.We compare the difference of three test statistics - time-irreversibility Trey, correlation dimension D2 and auto mutual information function Ⅰbetween the original data and the surrogate data.We come to the conclusion that there exists nonlinearity in the fish acoustic signals and there exist deterministic nonlinear components; therefore nonlinear dynamic theory can be used to analyze fish acoustic signals.

  19. A directional analysis of environmental signals in gravitational wave detectors

    Science.gov (United States)

    Gonzalez, Gabriela

    2001-04-01

    In gravitational wave detectors such as LIGO, there are many environmental signals and some interferometer signals that have directional information. We develop a method ("beam analysis") to discover such information, and apply it to seismic noise at the LIGO Hanford site. Using this method, we can find out the direction of approach, as well as the transverse or longitudinal characteristics of the seismic waves. We show the application of these results to the analysis of gravitational gradients influencing the interferometer. We also propose the use of this method in some of the interferometric signals. This work was supported by The Pennsylvania State University and by the National Science Foundation awards PHY-9973783 and PHY-9870032.

  20. A Signal Detection Theory Approach to Evaluating Oculometer Data Quality

    Science.gov (United States)

    Latorella, Kara; Lynn, William, III; Barry, John S.; Kelly, Lon; Shih, Ming-Yun

    2013-01-01

    Currently, data quality is described in terms of spatial and temporal accuracy and precision [Holmqvist et al. in press]. While this approach provides precise errors in pixels, or visual angle, often experiments are more concerned with whether subjects'points of gaze can be said to be reliable with respect to experimentally-relevant areas of interest. This paper proposes a method to characterize oculometer data quality using Signal Detection Theory (SDT) [Marcum 1947]. SDT classification results in four cases: Hit (correct report of a signal), Miss (failure to report a ), False Alarm (a signal falsely reported), Correct Reject (absence of a signal correctly reported). A technique is proposed where subjects' are directed to look at points in and outside of an AOI, and the resulting Points of Gaze (POG) are classified as Hits (points known to be internal to an AOI are classified as such), Misses (AOI points are not indicated as such), False Alarms (points external to AOIs are indicated as in the AOI), or Correct Rejects (points external to the AOI are indicated as such). SDT metrics describe performance in terms of discriminability, sensitivity, and specificity. This paper presentation will provide the procedure for conducting this assessment and an example of data collected for AOIs in a simulated flightdeck environment.

  1. Weak Signal Frequency Detection Method Based on Generalized Duffing Oscillator

    Institute of Scientific and Technical Information of China (English)

    SHI Si-Hong; YUAN Yong; WANG Hui-Qi; LUO Mao-Kang

    2011-01-01

    @@ The sensitive characteristic to the initial value of chaos system sufficiently demonstrates the superiority in weak signal parameters detection.Analyzing the current chaos-based frequency detection method, a novel generalized Duffing equation is proposed to detect weak signal frequency.By choosing a suitable adjusting factor, when the outside driving force frequency is equal to that of the detected signal, the generalized Duffing oscillator is in great period state, which can obtain the frequency information of the detected signal.The simulation results indicate this method is rapidly convenient and shows better accuracy.%The sensitive characteristic to the initial value of chaos system sufficiently demonstrates the superiority in weak signal parameters detection. Analyzing the current chaos-based frequency detection method, a novel generalized Duffing equation is proposed to detect weak signal frequency. By choosing a suitable adjusting factor, when the outside driving force frequency is equal to that of the detected signal, the generalized Duffing oscillator is in great period state, which can obtain the frequency information of the detected signal. The simulation results indicate this method is rapidly convenient and shows better accuracy.

  2. A Digital Method for the Detection of Blood Flow Direction in Ultrasonic Doppler Systems

    Directory of Open Access Journals (Sweden)

    P. Acevedo–Contla.

    2010-01-01

    Full Text Available Doppler ultrasound systems are widely used to study blood flow and diagnosis of vascular diseases. An important characteristic of these systems is the ability to detect the direction of the blood flow. Most Doppler ultrasound systems apply a quadrature demodulation technique on the ultrasonic transducer output signal. Therefore additional treatment is necessary to separate forward and reverse flow signals. This work presents a digital method to convert signals in quadrature into directional signals using a Fast Fourier Transform (FFT approach. Validation of the method has been achieved using simulated Doppler ultrasound signals.

  3. Dual readout 3D direct/induced-signals pixel systems

    CERN Document Server

    Parker, Sherwood; Deile, Mario; Hansen, Thor-Erik; Hasi, Jasmine; Kenney, Christopher; Kok, Angela; Watts, Stephen

    2008-01-01

    In this paper, 3D-electrode pixel detectors are described, in which the bias electrode systems have additional elements. Adding resistors between the bias supply line and each bias electrode together with a signal electrode readout that can measure pulse heights of both polarities could simultaneously provide lower capacitance and improved spatial resolution in both directions. A separate paper (“Dual-readout—strip/pixel systems”) covers an alternative—pixels with an added strip readout in one direction which could be used with either planar or 3D-electrodes, and could simultaneously provide a fast trigger and significantly increase the spatial resolution in both directions.

  4. PERIODIC SIGNAL DETECTION WITH USING DUFFING SYSTEM POINCARE MAP ANALYSIS

    Directory of Open Access Journals (Sweden)

    Valeriy Martynyuk

    2014-06-01

    Full Text Available In this article the periodic signal detection method on the base of Duffing system chaotic oscillations analysis is presented. This work is a development of the chaos-based signal detection technique. Generally, chaos-based signal detection is the detection of chaotic-to-periodic state transition under input periodic component influence. If the input periodic component reaches certain threshold value, the system transforms from chaotic state to periodic state. The Duffing-type chaotic systems are often used for such a signal detection purpose because of their ability to work in chaotic state for a long time and relatively simple realization. The main advantage of chaos-based signal detection methods is the utilization of chaotic system sensitivity to weak signals. But such methods are not used in practice because of the chaotic system state control problems. The method presented does not require an exact system state control. The Duffing system works continuously in chaotic state and the periodic signal detection process is based on the analysis of Duffing system Poincare map fractal structure. This structure does not depend on noise, and therefore the minimum input signal-to-noise ratio required for periodic signal detection is not limited by chaotic system state control tolerance.

  5. A signal detection theory analysis of an unconscious perception effect.

    Science.gov (United States)

    Haase, S J; Theios, J; Jenison, R

    1999-07-01

    The independent observation model (Macmillan & Creelman, 1991) is fitted to detection-identification data collected under conditions of heavy masking. The model accurately predicts a quantitative relationship between stimulus detection and stimulus identification over a wide range of detection performance. This model can also be used to offer a signal detection interpretation of the common finding of above-chance identification following a missed signal. While our finding is not a new one, the stimuli used in this experiment (redundant three-letter strings) differ slightly from those used in traditional signal detection work. Also, the stimuli were presented very briefly and heavily masked, conditions typical in the study of unconscious perception effects.

  6. Effect of directional speech warnings on road hazard detection.

    Science.gov (United States)

    Serrano, Jesús; Di Stasi, Leandro L; Megías, Alberto; Catena, Andrés

    2011-12-01

    In the last 2 decades, cognitive science and the transportation psychology field have dedicated a lot of effort to designing advanced driver support systems. Verbal warning systems are increasingly being implemented in modern automobiles in an effort to increase road safety. The study presented here investigated the impact of directional speech alert messages on the participants' speed to judge whether or not naturalistic road scenes depicted a situation of impending danger. Thirty-eight volunteers performed a computer-based key-press reaction time task. Findings indicated that semantic content of verbal warning signals can be used for increasing driving safety and improving hazard detection. Furthermore, the classical result regarding signal accuracy is confirmed: directional informative speech messages lead to faster hazard detection compared to drivers who received a high rate of false alarms. Notwithstanding some study limitations (lack of driver experience and low ecological validity), this evidence could provide important information for the specification of future Human-Machine-interaction (HMI) design guidelines.

  7. Research on Portable Fatigue Signal Detection System

    Directory of Open Access Journals (Sweden)

    Bowen Li

    2013-07-01

    Full Text Available According to the characteristics of human pulse wave signals, the acquisition system acquisition system with excellent performance is designed, 16 bit MCU MSP430 with ultralow power is used to record, process and transmit the collected pulse wave signals. In order to make the hardware part satisfy acquisition requirements of pulse wave, the paper focuses on discussing composition, operating principle, analysis method and performance parameter of analog circuit. The software part makes use of the design tools of Matlab graphical user interface (GUI for designing pulse wave signal measurement system. The trial on intelligent fatigue test signal adopts relatively unique methods no matter in hardware circuit design or software algorithm process, which provides important and meaningful reference for objective and quantitative research on fatigue signal.

  8. The Past and Future of Light Dark Matter Direct Detection

    CERN Document Server

    Davis, Jonathan H

    2015-01-01

    We review the status and future of direct searches for light dark matter. We start by answering the question: `Whatever happened to the light dark matter anomalies?' i.e. the fate of the potential dark matter signals observed by the CoGeNT, CRESST-II, CDMS-Si and DAMA/LIBRA experiments. We discuss how the excess events in the first two of these experiments have been explained by previously underestimated backgrounds. For DAMA we summarise the progress and future of mundane explanations for the annual modulation reported in its event rate. Concerning the future of direct detection we focus on the irreducible background from solar neutrinos. We explain broadly how it will affect future searches and summarise efforts to mitigate its effects.

  9. Switching direction in electric-signal-induced cell migration by cyclic guanosine monophosphate and phosphatidylinositol signaling.

    Science.gov (United States)

    Sato, Masayuki J; Kuwayama, Hidekazu; van Egmond, Wouter N; Takayama, Airi L K; Takagi, Hiroaki; van Haastert, Peter J M; Yanagida, Toshio; Ueda, Masahiro

    2009-04-21

    Switching between attractive and repulsive migration in cell movement in response to extracellular guidance cues has been found in various cell types and is an important cellular function for translocation during cellular and developmental processes. Here we show that the preferential direction of migration during electrotaxis in Dictyostelium cells can be reversed by genetically modulating both guanylyl cyclases (GCases) and the cyclic guanosine monophosphate (cGMP)-binding protein C (GbpC) in combination with the inhibition of phosphatidylinositol-3-OH kinases (PI3Ks). The PI3K-dependent pathway is involved in cathode-directed migration under a direct-current electric field. The catalytic domains of soluble GCase (sGC) and GbpC also mediate cathode-directed signaling via cGMP, whereas the N-terminal domain of sGC mediates anode-directed signaling in conjunction with both the inhibition of PI3Ks and cGMP production. These observations provide an identification of the genes required for directional switching in electrotaxis and suggest that a parallel processing of electric signals, in which multiple-signaling pathways act to bias cell movement toward the cathode or anode, is used to determine the direction of migration.

  10. Direct detection of soil-bound prions.

    Directory of Open Access Journals (Sweden)

    Sacha Genovesi

    Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.

  11. Singularity Detection of Signals Based on their Wavelet Transform

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    This paper introduces a multiresolution decomposition of signals based on their wavelet transform. The different behaviors of the wavelet transform between the signal and the noise are compared. An algorithm of singularity detection and processing in signals is proposed by the modulus maximum of the wavelet transform.

  12. A Dynamic Stimulus-Driven Model of Signal Detection

    Science.gov (United States)

    Turner, Brandon M.; Van Zandt, Trisha; Brown, Scott

    2011-01-01

    Signal detection theory forms the core of many current models of cognition, including memory, choice, and categorization. However, the classic signal detection model presumes the a priori existence of fixed stimulus representations--usually Gaussian distributions--even when the observer has no experience with the task. Furthermore, the classic…

  13. Signal processing in cryogenic particle detection

    Energy Technology Data Exchange (ETDEWEB)

    Yuryev, Y.N. [Department of Physics and Astronomy, Seoul National University, Seoul (Korea, Republic of); Korea Research Institute of Standards and Science (KRISS), Daejeon (Korea, Republic of); Jang, Y.S. [Korea Research Institute of Standards and Science (KRISS), Daejeon (Korea, Republic of); Kim, S.K. [Department of Physics and Astronomy, Seoul National University, Seoul (Korea, Republic of); Lee, K.B.; Lee, M.K. [Korea Research Institute of Standards and Science (KRISS), Daejeon (Korea, Republic of); Lee, S.J. [Department of Physics and Astronomy, Seoul National University, Seoul (Korea, Republic of); Korea Research Institute of Standards and Science (KRISS), Daejeon (Korea, Republic of); Yoon, W.S. [Korea Research Institute of Standards and Science (KRISS), Daejeon (Korea, Republic of); Kim, Y.H., E-mail: yhkim@kriss.re.k [Korea Research Institute of Standards and Science (KRISS), Daejeon (Korea, Republic of)

    2011-04-11

    We describe a signal-processing program for a data acquisition system for cryogenic particle detectors. The program is based on an optimal-filtering method for high-resolution measurement of calorimetric signals with a significant amount of noise of unknown origin and non-stationary behavior. The program was applied to improve the energy resolution of the alpha particle spectrum of an {sup 241}Am source.

  14. The bifurcation threshold value of the chaos detection system for a weak signal

    Institute of Scientific and Technical Information of China (English)

    李月; 杨宝俊; 杜立志; 袁野

    2003-01-01

    Recently, it has become an important problem to confirm the bifurcation threshold value of a chaos detectionsystem for a weak signal in the fields of chaos detection. It is directly related to whether the results of chaos detectionare correct or not. In this paper, the discrimination system for the dynamic behaviour of a chaos detection system fora weak signal is established by using the theory of linear differential equation with periodic coefficients and computingthe Lyapunov exponents of the chaos detection system; and then, the movement state of the chaos detection system isdefined. The simulation experiments show that this method can exactly confirm the bifurcation threshold value of thechaos detection system.

  15. Research on Life Signals Detection Based on Higher Order Statistics

    Directory of Open Access Journals (Sweden)

    Jian-Jun Li

    2012-10-01

    Full Text Available The life signals are built on harmonic mode for their low frequency, quasi-periodicity, low SNR, and the easy submerged in strong clutter noise. The method for detecting life signal based on adaptive filter and high order statistics is presented, in which neither the Gaussian supposition of the observed signal, nor a prior information about the waveform and arrival time of the observed signal is necessary. The principle of method is to  separate the spectrum of input signal into many narrow frequency bands, whose Sub-band signal  is followed by a short-time estimation of higher-order statistics so as to suppress Gaussian noises. Simulated results show that the method can effectively detect life signals from noise with good convergence speed and stability, and greatly improve the signal quality with respect to LMS method.

  16. Enabling Technologies for Direct Detection Optical Phase Modulation Formats

    Science.gov (United States)

    Xu, Xian

    signal. We found that PDf ratio, defined as PDf/FSR, plays a predominant role in determining the performance of the demodulator. We further investigate on the PDf induced penalty for a 40-GHz DPSK demodulator on a 40-Gb/s return-to-zero (RZ)-DPSK signal to study PDf incurred optical filtering effect and spectrum distortion. Degradation for the RZ signal has been found in the presence the PDf. The third challenge is fiber dispersion induced inter-symbol interference for the phase modulated signals. Traditionally the dispersion is compensated using dispersion compensation fibers (DCF). Recently emerged electronic dispersion compensation (EDC) not only avoids the attenuation that would be introduced by DCF, but also is capable of simultaneously compensating the chromatic dispersion (CD) and polarization mode dispersion (PMD). We investigate on EDC's CD and PMD compensation capabilities for the direct detection return-to-zero (NRZ)-DPSK signal. The simulation results show that around 300-ps/nm CD and 10-ps differential group delay (DGD) can be compensated by employing EDC. However, compared with the on-off keying (OOK) signal, the EDC is actually less effective with the DPSK signal. The investigation is extended to the RZ-DPSK signal and found out the decision feedback equalizer (DFE) exhibits better performance with the RZ-DPSK signal.

  17. GNSS Spoofing Detection Based on Signal Power Measurements: Statistical Analysis

    Directory of Open Access Journals (Sweden)

    V. Dehghanian

    2012-01-01

    Full Text Available A threat to GNSS receivers is posed by a spoofing transmitter that emulates authentic signals but with randomized code phase and Doppler values over a small range. Such spoofing signals can result in large navigational solution errors that are passed onto the unsuspecting user with potentially dire consequences. An effective spoofing detection technique is developed in this paper, based on signal power measurements and that can be readily applied to present consumer grade GNSS receivers with minimal firmware changes. An extensive statistical analysis is carried out based on formulating a multihypothesis detection problem. Expressions are developed to devise a set of thresholds required for signal detection and identification. The detection processing methods developed are further manipulated to exploit incidental antenna motion arising from user interaction with a GNSS handheld receiver to further enhance the detection performance of the proposed algorithm. The statistical analysis supports the effectiveness of the proposed spoofing detection technique under various multipath conditions.

  18. Advanced Statistical Signal Processing Techniques for Landmine Detection Using GPR

    Science.gov (United States)

    2014-07-12

    Processing Techniques for Landmine Detection Using GPR The views, opinions and/or findings contained in this report are those of the author(s) and should not...AGENCY NAME(S) AND ADDRESS (ES) U.S. Army Research Office P.O. Box 12211 Research Triangle Park, NC 27709-2211 landmine Detection, Signal...310 Jesse Hall Columbia, MO 65211 -1230 654808 633606 ABSTRACT Advanced Statistical Signal Processing Techniques for Landmine Detection Using GPR Report

  19. Response inhibition signals and miscoding of direction in dorsomedial striatum

    Directory of Open Access Journals (Sweden)

    Daniel W Bryden

    2012-09-01

    Full Text Available The ability to inhibit action is critical for everyday behavior and is affected by a variety of disorders. Behavioral control and response inhibition is thought to depend on a neural circuit that includes the dorsal striatum, yet the neural signals that lead to response inhibition and its failure are unclear. To address this issue, we recorded from neurons in rat dorsomedial striatum (mDS in a novel task in which rats responded to a spatial cue that signaled that reward would be delivered either to the left or to the right. On 80% of trials rats were instructed to respond in the direction cued by the light (GO. On 20% of trials a second light illuminated instructing the rat to refrain from making the cued movement and move in the opposite direction (STOP. Many neurons in mDS encoded direction, firing more or less strongly for GO movements made ipsilateral or contralateral to the recording electrode. Neurons that fired more strongly for contralateral GO responses were more active when rats were faster, showed reduced activity on STOP trials, and miscoded direction on errors, suggesting that when these neurons were overly active, response inhibition failed. Neurons that decreased firing for contralateral movement were excited during trials in which the rat was required to stop the ipsilateral movement. For these neurons activity was reduced when errors were made and was negatively correlated with movement time suggesting that when these neurons were less active on STOP trials, response inhibition failed. Finally, the activity of a significant number of neurons represented a global inhibitory signal, firing more strongly during response inhibition regardless of response direction. Breakdown by cell type suggests that putative medium spiny neurons tended to fire more strongly under STOP trials, whereas putative interneurons exhibited both activity patterns. 

  20. Response inhibition signals and miscoding of direction in dorsomedial striatum

    Science.gov (United States)

    Bryden, Daniel W.; Burton, Amanda C.; Kashtelyan, Vadim; Barnett, Brian R.; Roesch, Matthew R.

    2012-01-01

    The ability to inhibit action is critical for everyday behavior and is affected by a variety of disorders. Behavioral control and response inhibition is thought to depend on a neural circuit that includes the dorsal striatum, yet the neural signals that lead to response inhibition and its failure are unclear. To address this issue, we recorded from neurons in rat dorsomedial striatum (mDS) in a novel task in which rats responded to a spatial cue that signaled that reward would be delivered either to the left or to the right. On 80% of trials rats were instructed to respond in the direction cued by the light (GO). On 20% of trials a second light illuminated instructing the rat to refrain from making the cued movement and move in the opposite direction (STOP). Many neurons in mDS encoded direction, firing more or less strongly for GO movements made ipsilateral or contralateral to the recording electrode. Neurons that fired more strongly for contralateral GO responses were more active when rats were faster, showed reduced activity on STOP trials, and miscoded direction on errors, suggesting that when these neurons were overly active, response inhibition failed. Neurons that decreased firing for contralateral movement were excited during trials in which the rat was required to stop the ipsilateral movement. For these neurons activity was reduced when errors were made and was negatively correlated with movement time suggesting that when these neurons were less active on STOP trials, response inhibition failed. Finally, the activity of a significant number of neurons represented a global inhibitory signal, firing more strongly during response inhibition regardless of response direction. Breakdown by cell type suggests that putative medium spiny neurons (MSNs) tended to fire more strongly under STOP trials, whereas putative interneurons exhibited both activity patterns. PMID:22973206

  1. Detection and Localization of Random Signals

    DEFF Research Database (Denmark)

    Sporring, Jon; Olsen, Niels Holm; Nielsen, Mads

    2003-01-01

    filtering techniques. It is therefore interesting to extend the application to objects with many but small degrees of freedom in their geometry. These geometric variations deteriorate the linear correlation signal, both regarding its strength and localization with multiple peaks from a single object...

  2. Sample size cognizant detection of signals in white noise

    CERN Document Server

    Rao, N Raj

    2007-01-01

    The detection and estimation of signals in noisy, limited data is a problem of interest to many scientific and engineering communities. We present a computationally simple, sample eigenvalue based procedure for estimating the number of high-dimensional signals in white noise when there are relatively few samples. We highlight a fundamental asymptotic limit of sample eigenvalue based detection of weak high-dimensional signals from a limited sample size and discuss its implication for the detection of two closely spaced signals. This motivates our heuristic definition of the 'effective number of identifiable signals.' Numerical simulations are used to demonstrate the consistency of the algorithm with respect to the effective number of signals and the superior performance of the algorithm with respect to Wax and Kailath's "asymptotically consistent" MDL based estimator.

  3. Decision Processes in Discrimination: Fundamental Misrepresentations of Signal Detection Theory

    Science.gov (United States)

    Balakrishnan, J. D.

    1998-01-01

    In the first part of this article, I describe a new approach to studying decision making in discrimination tasks that does not depend on the technical assumptions of signal detection theory (e.g., normality of the encoding distributions). Applying these new distribution-free tests to data from three experiments, I show that base rate and payoff manipulations had substantial effects on the participants' encoding distributions but no effect on their decision rules, which were uniformly unbiased in equal and unequal base rate conditions and in symmetric and asymmetric payoff conditions. In the second part of the article, I show that this seemingly paradoxical result is readily explained by the sequential sampling models of discrimination. I then propose a new, "model-free" test for response bias that seems to more properly identify both the nature and direction of the biases induced by the classical bias manipulations.

  4. Removal of pedestals and directional ambiguity of optical anemometer signals.

    Science.gov (United States)

    Durst, F; Zaré, M

    1974-11-01

    Laser Doppler anemometry permits, in principle, the measurement of both magnitude and direction of components of a particle's velocity vector. Most exiting anemometers, however, permit measurements only with a directional ambiguity of 180 degrees , resulting in errors in certain flow fields. Available methods of eliminating the directional ambiguity of Laser Doppler anemometers are reviewed, covering frequency shifting of the incident and scattered light beams, the use of beams with different polarization properties, and employment of multicolor laser beams. The advantages and disadvantages of existing methods are summarized, and suggestions for alterations are made. Different techniques used to remove the pedestal of laser Doppler anemometer signals are also reviewed. Optical techniques should be employed in any advanced optical anemometer system to avoid dynamic range limitations by electronic bandpass filters. Suggestions are made for advanced optical anemometers employing multielement avalanche photodiodes that can be used for simultaneous measurements of two velocity components. These anemometers incorporate devices to sense the direction of the velocity components and to eliminate optically the pedestal of laser Doppler signals.

  5. Continuous emotion detection using EEG signals and facial expressions

    NARCIS (Netherlands)

    Soleymani, Mohammad; Asghari-Esfeden, Sadjad; Pantic, Maja; Fu, Yun

    Emotions play an important role in how we select and consume multimedia. Recent advances on affect detection are focused on detecting emotions continuously. In this paper, for the first time, we continuously detect valence from electroencephalogram (EEG) signals and facial expressions in response to

  6. Dark Matter: Connecting LHC searches to direct detection

    CERN Document Server

    Crivellin, Andreas; Procura, Massimiliano; Tunstall, Lewis C

    2015-01-01

    In these proceedings we review the interplay between LHC searches for dark matter and direct detection experiments. For this purpose we consider two prime examples: the effective field theory (EFT) approach and the minimal supersymmetric standard model (MSSM). In the EFT scenario we show that for operators which do not enter directly direct detection at tree-level, but only via loop effects, LHC searches give complementary constraints. In the MSSM stop and Higgs exchange contribute to the direct detection amplitude. Therefore, LHC searches for supersymmetric particles and heavy Higgses place constraints on the same parameter space as direct detection.

  7. Detectability of CO2 Flux Signals by a Space-Based Lidar Mission

    Science.gov (United States)

    Hammerling, Dorit M.; Kawa, S. Randolph; Schaefer, Kevin; Doney, Scott; Michalak, Anna M.

    2015-01-01

    Satellite observations of carbon dioxide (CO2) offer novel and distinctive opportunities for improving our quantitative understanding of the carbon cycle. Prospective observations include those from space-based lidar such as the Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) mission. Here we explore the ability of such a mission to detect regional changes in CO2 fluxes. We investigate these using three prototypical case studies, namely the thawing of permafrost in the Northern High Latitudes, the shifting of fossil fuel emissions from Europe to China, and changes in the source-sink characteristics of the Southern Ocean. These three scenarios were used to design signal detection studies to investigate the ability to detect the unfolding of these scenarios compared to a baseline scenario. Results indicate that the ASCENDS mission could detect the types of signals investigated in this study, with the caveat that the study is based on some simplifying assumptions. The permafrost thawing flux perturbation is readily detectable at a high level of significance. The fossil fuel emission detectability is directly related to the strength of the signal and the level of measurement noise. For a nominal (lower) fossil fuel emission signal, only the idealized noise-free instrument test case produces a clearly detectable signal, while experiments with more realistic noise levels capture the signal only in the higher (exaggerated) signal case. For the Southern Ocean scenario, differences due to the natural variability in the ENSO climatic mode are primarily detectable as a zonal increase.

  8. Directional eye fixation sensor using birefringence-based foveal detection

    Science.gov (United States)

    Gramatikov, Boris I.; Zalloum, Othman H. Y.; Wu, Yi Kai; Hunter, David G.; Guyton, David L.

    2007-04-01

    We recently developed and reported an eye fixation monitor that detects the fovea by its radial orientation of birefringent nerve fibers. The instrument used a four-quadrant photodetector and a normalized difference function to check for a best match between the detector quadrants and the arms of the bow-tie pattern of polarization states surrounding the fovea. This function had a maximum during central fixation but could not tell where the subject was looking relative to the center. We propose a linear transformation to obtain horizontal and vertical eye position coordinates from the four photodetector signals, followed by correction based on a priori calibration information. The method was verified on both a computer model and on human eyes. The major advantage of this new eye-tracking method is that it uses true information coming from the fovea, rather than reflections from other structures, to identify the direction of foveal gaze.

  9. Detection of Doppler Microembolic Signals Using High Order Statistics

    Directory of Open Access Journals (Sweden)

    Maroun Geryes

    2016-01-01

    Full Text Available Robust detection of the smallest circulating cerebral microemboli is an efficient way of preventing strokes, which is second cause of mortality worldwide. Transcranial Doppler ultrasound is widely considered the most convenient system for the detection of microemboli. The most common standard detection is achieved through the Doppler energy signal and depends on an empirically set constant threshold. On the other hand, in the past few years, higher order statistics have been an extensive field of research as they represent descriptive statistics that can be used to detect signal outliers. In this study, we propose new types of microembolic detectors based on the windowed calculation of the third moment skewness and fourth moment kurtosis of the energy signal. During energy embolus-free periods the distribution of the energy is not altered and the skewness and kurtosis signals do not exhibit any peak values. In the presence of emboli, the energy distribution is distorted and the skewness and kurtosis signals exhibit peaks, corresponding to the latter emboli. Applied on real signals, the detection of microemboli through the skewness and kurtosis signals outperformed the detection through standard methods. The sensitivities and specificities reached 78% and 91% and 80% and 90% for the skewness and kurtosis detectors, respectively.

  10. Noise Separation from the Weak Signal Chaotic Detection System

    Directory of Open Access Journals (Sweden)

    Hanjie Gu

    2014-11-01

    Full Text Available The traditional weak signal chaotic detection system still restricts some technical issues in the situation of the signal with noise, such as poor denoising ability and low detection precision. In this paper, we propose a novel weak signal chaotic detection system based on an improved wavelet transform algorithm. First, the traditional wavelet transform algorithm domain variables have been transformed and discretized to eliminate the redundant transform. Then, based on the discrete optimization, the wavelet coefficients have been optimized by threshold compromise strategy. The improved wavelet transform algorithm is applied in the weak signal chaotic detection system. The noise signal after finite discrete processing is treated as a perturbation of cycle power and put into a chaotic system for detecting weak signal under the noise conditions. The simulation experiments show that the proposed improved wavelet transform algorithm has a better denoising effect than the traditional wavelet transform algorithm. Moreover, the improved algorithm shows better accuracy and higher robustness in the weak signal chaotic detection system.

  11. On the Direct Detection of Dark Matter Annihilation

    DEFF Research Database (Denmark)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2015-01-01

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection...... cross sections has already been reached in a class of models. Moreover, the compatibility of dark matter direct detection experiments can be compared directly in $E_{{\\rm min}}$ space without making assumptions about DM astrophysics, mass, or scattering form factors. Lastly, when DM has direct couplings...

  12. Chaotic oscillator detection system about weak signals in spot welding

    Institute of Scientific and Technical Information of China (English)

    Kai-lei SONG; Zhen LUO; Feng YE; Xin-xin TANG; Shu-xian YUAN

    2009-01-01

    Spot welding is an efficient and shortcut processing method used in plate, and its quality detection is very important. However, there are many factors affecting the spot welding quality. Because of the low precision of traditional detection methods, spot welding has seldom been used in the aerospace industry which requires high welding quality. In this article, we give a new weak signal detection model based on chaotic oscillators. Using Melnikov methods and Lyapunov exponent, we can determine the critical values when the system enters in and out of chaos. Through lots of numerical simulations, it can be found that the lowest value of the weak sinusoidal signal the system can detect reach 10-11, and its signal-to-noise ratio (SNR) is = 126 dB. Compared with other detection methods, chaos oscillator detection system not only has a lower threshold value, but also is easy to implement in practice. This model thus has good application prospects.

  13. Simulating Radar Signals for Detection Performance Evaluation.

    Science.gov (United States)

    1981-02-01

    constant false alarm rate (CFAR) processing, and non- linear operations. The detection performance is determined by Monte Carlo sampling techniques...AND DSIH. 0213 r C21.c FROtRAW By NCRPAN FRENK ~R FROM TI-E BASIC ALGOVITI4 BY EH9RLES 01 C RADER (BOTH OF vfIT LINCOLN LAPORATCRYi. MAY 1967. THE

  14. ECG Signal Analysis and Arrhythmia Detection using Wavelet Transform

    Science.gov (United States)

    Kaur, Inderbir; Rajni, Rajni; Marwaha, Anupma

    2016-12-01

    Electrocardiogram (ECG) is used to record the electrical activity of the heart. The ECG signal being non-stationary in nature, makes the analysis and interpretation of the signal very difficult. Hence accurate analysis of ECG signal with a powerful tool like discrete wavelet transform (DWT) becomes imperative. In this paper, ECG signal is denoised to remove the artifacts and analyzed using Wavelet Transform to detect the QRS complex and arrhythmia. This work is implemented in MATLAB software for MIT/BIH Arrhythmia database and yields the sensitivity of 99.85 %, positive predictivity of 99.92 % and detection error rate of 0.221 % with wavelet transform. It is also inferred that DWT outperforms principle component analysis technique in detection of ECG signal.

  15. X-ray pulsar signal detection using photon interarrival time

    Institute of Scientific and Technical Information of China (English)

    Qiang Xie; Luping Xu; Hua Zhang

    2013-01-01

    The distribution probability of the photon interarrival time (PIT) without signal initial phases is derived based on the Poisson model of X-ray pulsar signals, and a pulsar signal detec-tion algorithm employing the PIT sequence is put forward. The joint probability of the PIT sequence is regarded as a function of the distribution probability and used to compare a constant radiation intensity model with the nonhomogeneous Poisson model for the signal detection. The relationship between the number of detected photons and the probabilities of false negative and positive is stu-died, and the success rate and mean detection time are estimated based on the number of the given photons. For the spacecraft ve-locity data detection, the changes of time of photon arrival (TOPA) and PIT caused by spacecraft motion are presented first, then the influences on detection are analyzed respectively. By using the analytical pulse profile of PSR B0531+21, the simulation of the X-ray pulsar signal detection is implemented. The simulation results verify the effectiveness of the proposed method, and the contrast tests show that the proposed method is suitable for the spacecraft velocity data detection.

  16. Calculating the probability of detecting radio signals from alien civilizations

    CERN Document Server

    Horvat, Marko

    2006-01-01

    Although it might not be self-evident, it is in fact entirely possible to calculate the probability of detecting alien radio signals by understanding what types of extraterrestrial radio emissions can be expected and what properties these emissions can have. Using the Drake equation as the obvious starting point, and logically identifying and enumerating constraints of interstellar radio communications can yield the probability of detecting a genuine alien radio signal.

  17. Signal Detection Framework Using Semantic Text Mining Techniques

    Science.gov (United States)

    Sudarsan, Sithu D.

    2009-01-01

    Signal detection is a challenging task for regulatory and intelligence agencies. Subject matter experts in those agencies analyze documents, generally containing narrative text in a time bound manner for signals by identification, evaluation and confirmation, leading to follow-up action e.g., recalling a defective product or public advisory for…

  18. Detection and estimation of pulsar signals for navigation

    NARCIS (Netherlands)

    Kabakchiev, Chr.; Behar, V.; Buist, P.; Heusdens, R.; Garvanov, I.; Kabakchieva, D.; Gaubitch, N.; Bentum, M.J.

    2015-01-01

    The paper focuses on scientific issues related to new application of pulsar signals for airplane-based navigation. A possible algorithm for processing of pulsar signals that consists of epoch-folding, matched filtering and detection is proposed and evaluated in this paper. The algorithm proposed is

  19. The Sensitive Infrared Signal Detection by Sum Frequency Generation

    Science.gov (United States)

    Wong, Teh-Hwa; Yu, Jirong; Bai, Yingxin

    2013-01-01

    An up-conversion device that converts 2.05-micron light to 700 nm signal by sum frequency generation using a periodically poled lithium niobate crystal is demonstrated. The achieved 92% up-conversion efficiency paves the path to detect extremely weak 2.05-micron signal with well established silicon avalanche photodiode detector for sensitive lidar applications.

  20. Signal Detection Framework Using Semantic Text Mining Techniques

    Science.gov (United States)

    Sudarsan, Sithu D.

    2009-01-01

    Signal detection is a challenging task for regulatory and intelligence agencies. Subject matter experts in those agencies analyze documents, generally containing narrative text in a time bound manner for signals by identification, evaluation and confirmation, leading to follow-up action e.g., recalling a defective product or public advisory for…

  1. Demodulating Subsampled Direct Sequence Spread Spectrum Signals using Compressive Signal Processing

    DEFF Research Database (Denmark)

    Fyhn, Karsten; Arildsen, Thomas; Larsen, Torben

    2012-01-01

    We show that to lower the sampling rate in a spread spectrum communication system using Direct Sequence Spread Spectrum (DSSS), compressive signal processing can be applied to demodulate the received signal. This may lead to a decrease in the power consumption or the manufacturing price of wireless...... theoretical work is exemplified with a numerical experiment using the IEEE 802.15.4 standard’s 2.4GHz band specification. The numerical results support our theoretical indings and indicate that compressive sensing may be used successfully in spread spectrum communication systems. The results obtained here may...

  2. Waveform Fingerprinting for Efficient Seismic Signal Detection

    Science.gov (United States)

    Yoon, C. E.; OReilly, O. J.; Beroza, G. C.

    2013-12-01

    Cross-correlating an earthquake waveform template with continuous waveform data has proven a powerful approach for detecting events missing from earthquake catalogs. If templates do not exist, it is possible to divide the waveform data into short overlapping time windows, then identify window pairs with similar waveforms. Applying these approaches to earthquake monitoring in seismic networks has tremendous potential to improve the completeness of earthquake catalogs, but because effort scales quadratically with time, it rapidly becomes computationally infeasible. We develop a fingerprinting technique to identify similar waveforms, using only a few compact features of the original data. The concept is similar to human fingerprints, which utilize key diagnostic features to identify people uniquely. Analogous audio-fingerprinting approaches have accurately and efficiently found similar audio clips within large databases; example applications include identifying songs and finding copyrighted content within YouTube videos. In order to fingerprint waveforms, we compute a spectrogram of the time series, and segment it into multiple overlapping windows (spectral images). For each spectral image, we apply a wavelet transform, and retain only the sign of the maximum magnitude wavelet coefficients. This procedure retains just the large-scale structure of the data, providing both robustness to noise and significant dimensionality reduction. Each fingerprint is a high-dimensional, sparse, binary data object that can be stored in a database without significant storage costs. Similar fingerprints within the database are efficiently searched using locality-sensitive hashing. We test this technique on waveform data from the Northern California Seismic Network that contains events not detected in the catalog. We show that this algorithm successfully identifies similar waveforms and detects uncataloged low magnitude events in addition to cataloged events, while running to completion

  3. Decoding Onset and Direction of Movements Using Electrocorticographic (ECoG Signals in Humans

    Directory of Open Access Journals (Sweden)

    Zuoguan eWang

    2012-08-01

    Full Text Available Communication of intent usually requires motor function. This requirement can be limiting when a person is engaged in a task, or prohibitive for some people suffering from neuromuscular disorders. Determining a person's intent, e.g., where and when to move, from brain signals rather than from muscles would have important applications in clinical or other domains. For example, detection of the onset and direction of intended movements may provide the basis for restoration of simple grasping function in people with chronic stroke, or could be used to optimize a user's interaction with the surrounding environment. Detecting the onset and direction of actual movements are a first step in this direction. In this study, we demonstrate that we can detect the onset of intended movements and their direction using electrocorticographic (ECoG signals recorded from the surface of the cortex in humans. We also demonstrate in a simulation that the information encoded in ECoG about these movements may improve performance in a targeting task. In summary, the results in this paper suggest that detection of intended movement is possible, and may serve useful functions.

  4. An Improved Direction Relation Detection Model for Spatial Objects

    Institute of Scientific and Technical Information of China (English)

    FENG Yucai; YI Baolin

    2004-01-01

    Direction is a common spatial concept that is used in our daily life. It is frequently used as a selection condition in spatial queries. As a result, it is important for spatial databases to provide a mechanism for modeling and processing direction queries and reasoning. Depending on the direction relation matrix, an inverted direction relation matrix and the concept of direction pre- dominance are proposed to improve the detection of direction relation between objects. Direction predicates of spatial systems are also extended. These techniques can improve the veracity of direction queries and reasoning. Experiments show excellent efficiency and performance in view of direction queries.

  5. Detection of Mycobacterium avium subsp. paratuberculosis by a Direct In Situ PCR Method

    Directory of Open Access Journals (Sweden)

    Fernando Delgado

    2011-01-01

    Full Text Available In situ detection of Mycobacterium avium subsp. paratuberculosis is useful for diagnosis and research of paratuberculosis. The aim of this paper was to detect this agent in formalin-fixed, paraffin-embedded tissue samples by a direct in situ PCR. The technique was performed on ileum or ileocaecal lymph node samples from 8 naturally infected cattle and 1 healthy calf, by using p89 and p92 primers for amplification of IS900 sequence. Moderate positive signal was detected in all positive samples and not in negative control, but tissues resulted were affected in many cases due to the enzymatic treatment and the high temperature exposition. Although the technique was useful for Map detection, the signal was lower than immunohistochemistry probably because of the fixation process. In one case, signal was higher, which might be due to the detection of spheroplasts. Thus, the described method should be recommended when others resulted negative or for spheroplasts detection.

  6. Noise Correlation Effect on Detection: Signals in Equicorrelated or Autoregressive(1) Gaussian.

    Science.gov (United States)

    Kasasbeh, Hadi; Viswanathan, Ramanarayanan; Cao, Lei

    2017-07-01

    In this letter, we consider the effect of noise correlation on the error performance of binary hypothesis signal detection, when one of two deterministic signals is received in correlated Gaussian noise. For the likelihood ratio detection scheme, analytical performance results are derived for equicorrelated and autoregressive order one models. Although it is known previously that the best signal lies in the direction of eigenvector corresponding to the minimum eigenvalue of the noise covariance matrix, our investigation of the variation of mean signal-to-noise power ratio as a function of correlation parameter (i) shows how correlation leads to increased probability of error up to a point, beyond which monotonic decrease in error probability with increasing correlation is possible and (ii) provides a max-min signal design solution for the unknown correlation parameter case. Numerical results are also included for some specific signals.

  7. Signal coverage approach to the detection probability of hypothetical extraterrestrial emitters in the Milky Way

    Science.gov (United States)

    Grimaldi, Claudio

    2017-04-01

    The lack of evidence for the existence of extraterrestrial life, even the simplest forms of animal life, makes it is difficult to decide whether the search for extraterrestrial intelligence (SETI) is more a high-risk, high-payoff endeavor than a futile attempt. Here we insist that even if extraterrestrial civilizations do exist and communicate, the likelihood of detecting their signals crucially depends on whether the Earth lies within a region of the galaxy covered by such signals. By considering possible populations of independent emitters in the galaxy, we build a statistical model of the domain covered by hypothetical extraterrestrial signals to derive the detection probability that the Earth is within such a domain. We show that for general distributions of the signal longevity and directionality, the mean number of detectable emitters is less than one even for detection probabilities as large as 50%, regardless of the number of emitters in the galaxy.

  8. Direct reconstruction of enhanced signal in computed tomography perfusion

    Science.gov (United States)

    Li, Bin; Lyu, Qingwen; Ma, Jianhua; Wang, Jing

    2016-04-01

    High imaging dose has been a concern in computed tomography perfusion (CTP) as repeated scans are performed at the same location of a patient. On the other hand, signal changes only occur at limited regions in CT acquired at different time points. In this work, we propose a new reconstruction strategy by effectively utilizing the initial phase high-quality CT to reconstruct the later phase CT acquired with a low-dose protocol. In the proposed strategy, initial high-quality CT is considered as a base image and enhanced signal (ES) is reconstructed directly by minimizing the penalized weighted least-square (PWLS) criterion. The proposed PWLS-ES strategy converts the conventional CT reconstruction into a sparse signal reconstruction problem. Digital and anthropomorphic phantom studies were performed to evaluate the performance of the proposed PWLS-ES strategy. Both phantom studies show that the proposed PWLS-ES method outperforms the standard iterative CT reconstruction algorithm based on the same PWLS criterion according to various quantitative metrics including root mean squared error (RMSE) and the universal quality index (UQI).

  9. Inverted dipole feature in directional detection of exothermic dark matter

    CERN Document Server

    Bozorgnia, Nassim; Gondolo, Paolo

    2016-01-01

    Directional dark matter detection attempts to measure the direction of motion of nuclei recoiling after having interacted with dark matter particles in the halo of our Galaxy. Due to Earth's motion with respect to the Galaxy, the dark matter flux is concentrated around a preferential direction. An anisotropy in the recoil direction rate is expected as an unmistakable signature of dark matter. The average nuclear recoil direction is expected to coincide with the average direction of dark matter particles arriving to Earth. Here we point out that for a particular type of dark matter, inelastic exothermic dark matter, the mean recoil direction as well as a secondary feature, a ring of maximum recoil rate around the mean recoil direction, could instead be opposite to the average dark matter arrival direction. Thus, the detection of an average nuclear recoil direction opposite to the usually expected direction would constitute a spectacular experimental confirmation of this type of dark matter.

  10. Halo-independent direct detection of momentum-dependent dark matter

    DEFF Research Database (Denmark)

    Cherry, J. F.; Frandsen, M. T.; Shoemaker, I. M.

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given...... a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can...

  11. Ultrasonic flaw detection using EMD-based signal processing

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The precise detection of flaw echoes buried in backscattering noise caused by material microstructure is a problem of great importance in ultrasonic non-destructive testing (NDT). In this work, empirical mode decomposition (EMD) is proposed to deal with ultrasonic signal. A time-frequency filtering method based on EMD is designed to suppress noise and enhance flaw signals. Simulated results are presented,showing that the proposed method has an excellent performance even for a very low signal-to-noise ratio(SNR). The improvement in flaw detection was experimentally verified using stainless steel pipe sample with artificial flaws.

  12. Bayesian hierarchical modeling for detecting safety signals in clinical trials.

    Science.gov (United States)

    Xia, H Amy; Ma, Haijun; Carlin, Bradley P

    2011-09-01

    Detection of safety signals from clinical trial adverse event data is critical in drug development, but carries a challenging statistical multiplicity problem. Bayesian hierarchical mixture modeling is appealing for its ability to borrow strength across subgroups in the data, as well as moderate extreme findings most likely due merely to chance. We implement such a model for subject incidence (Berry and Berry, 2004 ) using a binomial likelihood, and extend it to subject-year adjusted incidence rate estimation under a Poisson likelihood. We use simulation to choose a signal detection threshold, and illustrate some effective graphics for displaying the flagged signals.

  13. Frequency Sensitivity of Signal Detection in Scale-Free Networks

    Institute of Scientific and Technical Information of China (English)

    LU Fa-Ming; LIU Zong-Hua

    2009-01-01

    @@ It has been recently reported that scale-free topology favors the detection of a weak signal because of the higher amplification at the hub node than that at other nodes [Phys. Ref. E 78 (2008)046111]. We investigate the corresponding synchronization behaviors and find that the favorite detection depends not only on the coupling and noise strengths but also on the frequency of the external signal. We reveal theoretically and numerically that the amplification effect of the hub node will decrease monotonously with the externai frequency, which is useful to understand the high sensitivity of animal visual and auditory systems to weak external signals.

  14. Direct detection of light anapole and magnetic dipole DM

    Energy Technology Data Exchange (ETDEWEB)

    Nobile, Eugenio Del; Gelmini, Graciela B.; Huh, Ji-Haeng [Department of Physics and Astronomy, UCLA, 475 Portola Plaza, Los Angeles, CA 90095 (United States); Gondolo, Paolo, E-mail: delnobile@physics.ucla.edu, E-mail: gelmini@physics.ucla.edu, E-mail: paolo.gondolo@utah.edu, E-mail: jhhuh@physics.ucla.edu [Department of Physics and Astronomy, University of Utah, 115 South 1400 East #201, Salt Lake City, UT 84112 (United States)

    2014-06-01

    We present comparisons of direct detection data for ''light WIMPs'' with an anapole moment interaction (ADM) and a magnetic dipole moment interaction (MDM), both assuming the Standard Halo Model (SHM) for the dark halo of our galaxy and in a halo-independent manner. In the SHM analysis we find that a combination of the 90% CL LUX and CDMSlite limits or the new 90% CL SuperCDMS limit by itself exclude the parameter space regions allowed by DAMA, CoGeNT and CDMS-II-Si data for both ADM and MDM. In our halo-independent analysis the new LUX bound excludes the same potential signal regions as the previous XENON100 bound. Much of the remaining signal regions is now excluded by SuperCDMS, while the CDMSlite limit is much above them. The situation is of strong tension between the positive and negative search results both for ADM and MDM. We also clarify the confusion in the literature about the ADM scattering cross section.

  15. Subsurface Event Detection and Classification Using Wireless Signal Networks

    Directory of Open Access Journals (Sweden)

    Muhannad T. Suleiman

    2012-11-01

    Full Text Available Subsurface environment sensing and monitoring applications such as detection of water intrusion or a landslide, which could significantly change the physical properties of the host soil, can be accomplished using a novel concept, Wireless Signal Networks (WSiNs. The wireless signal networks take advantage of the variations of radio signal strength on the distributed underground sensor nodes of WSiNs to monitor and characterize the sensed area. To characterize subsurface environments for event detection and classification, this paper provides a detailed list and experimental data of soil properties on how radio propagation is affected by soil properties in subsurface communication environments. Experiments demonstrated that calibrated wireless signal strength variations can be used as indicators to sense changes in the subsurface environment. The concept of WSiNs for the subsurface event detection is evaluated with applications such as detection of water intrusion, relative density change, and relative motion using actual underground sensor nodes. To classify geo-events using the measured signal strength as a main indicator of geo-events, we propose a window-based minimum distance classifier based on Bayesian decision theory. The window-based classifier for wireless signal networks has two steps: event detection and event classification. With the event detection, the window-based classifier classifies geo-events on the event occurring regions that are called a classification window. The proposed window-based classification method is evaluated with a water leakage experiment in which the data has been measured in laboratory experiments. In these experiments, the proposed detection and classification method based on wireless signal network can detect and classify subsurface events.

  16. Optical intensity modulation direct detection versus heterodyne detection: A high-SNR capacity comparison

    KAUST Repository

    Chaaban, Anas

    2016-09-15

    An optical wireless communications system which employs either intensity-modulation and direct-detection (IM-DD) or heterodyne detection (HD) is considered. IM-DD has lower complexity and cost than HD, but on the other hand, has lower capacity. It is therefore interesting to investigate the capacity gap between the two systems. The main focus of this paper is to investigate this gap at high SNR. Bounds on this gap are established for two cases: between IM-DD and HD, and between IM-DD and an HD-PAM which is an HD system employing pulse-amplitude modulation (PAM). While the gap between IM-DD and HD increases as the signal-to-noise ratio (SNR) increases, the gap between IM-DD and an HD-PAM is upper bounded by a constant at high SNR. © 2015 IEEE.

  17. Spectral Correlation of Multicarrier Modulated Signals and Its Application for Signal Detection

    Science.gov (United States)

    Zhang, Haijian; Le Ruyet (Eurasipmember), Didier; Terré, Michel

    2009-12-01

    Spectral correlation theory for cyclostationary time-series signals has been studied for decades. Explicit formulas of spectral correlation function for various types of analog-modulated and digital-modulated signals are already derived. In this paper, we investigate and exploit the cyclostationarity characteristics for two kinds of multicarrier modulated (MCM) signals: conventional OFDM and filter bank based multicarrier (FBMC) signals. The spectral correlation characterization of MCM signal can be described by a special linear periodic time-variant (LPTV) system. Using this LPTV description, we have derived the explicit theoretical formulas of nonconjugate and conjugate cyclic autocorrelation function (CAF) and spectral correlation function (SCF) for OFDM and FBMC signals. According to theoretical spectral analysis, Cyclostationary Signatures (CS) are artificially embedded into MCM signal and a low-complexity signature detector is, therefore, presented for detecting MCM signal. Theoretical analysis and simulation results demonstrate the efficiency and robustness of this CS detector compared to traditionary energy detector.

  18. Spectral Correlation of Multicarrier Modulated Signals and Its Application for Signal Detection

    Directory of Open Access Journals (Sweden)

    Zhang Haijian

    2010-01-01

    Full Text Available Spectral correlation theory for cyclostationary time-series signals has been studied for decades. Explicit formulas of spectral correlation function for various types of analog-modulated and digital-modulated signals are already derived. In this paper, we investigate and exploit the cyclostationarity characteristics for two kinds of multicarrier modulated (MCM signals: conventional OFDM and filter bank based multicarrier (FBMC signals. The spectral correlation characterization of MCM signal can be described by a special linear periodic time-variant (LPTV system. Using this LPTV description, we have derived the explicit theoretical formulas of nonconjugate and conjugate cyclic autocorrelation function (CAF and spectral correlation function (SCF for OFDM and FBMC signals. According to theoretical spectral analysis, Cyclostationary Signatures (CS are artificially embedded into MCM signal and a low-complexity signature detector is, therefore, presented for detecting MCM signal. Theoretical analysis and simulation results demonstrate the efficiency and robustness of this CS detector compared to traditionary energy detector.

  19. Detection of buried objects using reflected GNSS signals

    Science.gov (United States)

    Notarpietro, Riccardo; De Mattia, Salvatore; Campanella, Maurizio; Pei, Yuekun; Savi, Patrizia

    2014-12-01

    The use of reflected Global Navigation Satellite System (GNSS) signals for sensing the Earth has been growing rapidly in recent years. This technique is founded on the basic principle of detecting GNSS signals after they have been reflected off the Earth's surface and using them to determine the properties of the reflecting surface remotely. This is the so-called GNSS reflectometry (GNSS-R) technique. In this paper, a new application regarding the detection of metallic buried objects is analyzed and it is validated through several experimental campaigns. Although the penetration depth of GNSS signals into the ground is not optimal and depends on the soil moisture, GNSS signals can likely interact approximately with the first 10 cm of the ground and therefore can be reflected back by any metallic object buried on the first terrain layer. A very light and low-cost GNSS receiver prototype based on a software-defined radio approach was developed. This receiver can be used as a payload on board small drones or unmanned aerial systems to detect metallic objects (mines or other explosive devices). A signal processing tool based on an open-loop GNSS signal acquisition strategy was developed. The results of two experiments which show the possibility of using GNSS-R signals to detect buried metallic objects and to provide an estimate of their dimensions are discussed.

  20. Dark Atoms: Asymmetry and Direct Detection

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, David E. [Johns Hopkins Univ., Baltimore, MD (United States); Krnjaic, Gordan Z. [Fermi National Accelerator Laboratory (FNAL), Batavia, IL (United States); Rehermann, Keith R. [Massachusetts Institute of Technology, Cambridge, MA (United States); Wells, Christopher M. [Houghton College, NY (United States)

    2011-10-01

    We present a simple UV completion of Atomic Dark Matter (aDM) in which heavy right-handed neutrinos decay to induce both dark and lepton number densities. This model addresses several outstanding cosmological problems: the matter/anti-matter asymmetry, the dark matter abundance, the number of light degrees of freedom in the early universe, and the smoothing of small-scale structure. Additionally, this realization of aDM may reconcile the CoGeNT excess with recently published null results and predicts a signal in the CRESST Oxygen band. We also find that, due to unscreened long-range interactions, the residual un recombined dark ions settle into a diffuse isothermal halo.

  1. Detection of Polyphase Codes Radar Signals in Low SNR

    Directory of Open Access Journals (Sweden)

    Runlan Tian

    2016-01-01

    Full Text Available A novel effective detection method is proposed for electronic intelligence (ELINT systems detecting polyphase codes radar signal in the low signal-to-noise ratio (SNR scenario. The core idea of the proposed method is first to calculate the time-frequency distribution of polyphase codes radar signals via Wigner-Ville distribution (WVD; then the modified Hough transform (HT is employed to cumulate all the energy of WVD’s ridges effectively to achieve signal detection. Compared with the generalised Wigner Hough transform (GWHT method, the proposed method has a superior performance in low SNR and is not sensitive to the code type. Simulation results verify the validity of the proposed method.

  2. Detecting Urban Warming Signals in Climate Records

    Institute of Scientific and Technical Information of China (English)

    HE Yuting; JIA Gensuo; HU Yonghong; ZHOU Zijiang

    2013-01-01

    Determining whether air temperatures recorded at meteorological stations have been contaminated by the urbanization process is still a controversial issue at the global scale.With support of historical remote sensing data,this study examined the impacts of urban expansion on the trends of air temperature at 69 meteorological stations in Beijing,Tianjin,and Hebei Province over the last three decades.There were significant positive relations between the two factors at all stations.Stronger warming was detected at the meteorological stations that experienced greater urbanization,i.e.,those with a higher urbanization rate.While the total urban area affects the absolute temperature values,the change of the urban area (urbanization rate) likely affects the temperature trend.Increases of approximately 10% in urban area around the meteorological stations likely contributed to the 0.13℃ rise in air temperature records in addition to regional climate warming.This study also provides a new approach to selecting reference stations based on remotely sensed urban fractions.Generally,the urbanization-induced warming contributed to approximately 44.1% of the overall warming trends in the plain region of study area during the past 30 years,and the regional climate warming was 0.30℃ (10 yr)-1 in the last three decades.

  3. Stochastic resonance with colored noise for neural signal detection.

    Science.gov (United States)

    Duan, Fabing; Chapeau-Blondeau, François; Abbott, Derek

    2014-01-01

    We analyze signal detection with nonlinear test statistics in the presence of colored noise. In the limits of small signal and weak noise correlation, the optimal test statistic and its performance are derived under general conditions, especially concerning the type of noise. We also analyze, for a threshold nonlinearity-a key component of a neural model, the conditions for noise-enhanced performance, establishing that colored noise is superior to white noise for detection. For a parallel array of nonlinear elements, approximating neurons, we demonstrate even broader conditions allowing noise-enhanced detection, via a form of suprathreshold stochastic resonance.

  4. Stochastic resonance with colored noise for neural signal detection.

    Directory of Open Access Journals (Sweden)

    Fabing Duan

    Full Text Available We analyze signal detection with nonlinear test statistics in the presence of colored noise. In the limits of small signal and weak noise correlation, the optimal test statistic and its performance are derived under general conditions, especially concerning the type of noise. We also analyze, for a threshold nonlinearity-a key component of a neural model, the conditions for noise-enhanced performance, establishing that colored noise is superior to white noise for detection. For a parallel array of nonlinear elements, approximating neurons, we demonstrate even broader conditions allowing noise-enhanced detection, via a form of suprathreshold stochastic resonance.

  5. Study of dual-polarization OQAM-OFDM PON with direct detection

    Science.gov (United States)

    Luo, Qing-long; Feng, Min; Bai, Cheng-lin; Hu, Wei-sheng

    2016-01-01

    An offset quadrature amplitude modulation orthogonal frequency-division multiplexing (OQAM-OFDM) passive optical network (PON) architecture with direct detection is brought up to increase the transmission range and improve the system performance. In optical line terminal (OLT), OQAM-OFDM signals at 40 Gbit/s are transmitted as downstream. At each optical network unit (ONU), the optical OQAM-OFDM signal is demodulated with direct detection. The results show that the transmission distance can exceed 20 km with negligible penalty under the experimental conditions.

  6. The bifurcation threshold value of the chaos detection system for a weak signal

    Institute of Scientific and Technical Information of China (English)

    李月; 杨宝俊; 杜立志; 袁野

    2003-01-01

    Recently, it has become an important problem to confirm the bifurcation threshold value of a chaos detection system for a weak signal in the fields of chaos detection. It is directly related to whether the results of chaos detection are correct or not. In this paper, the discrimination system for the dynamic behaviour of a chaos detection system for a weak signal is established by using the theory of linear differential equation with periodic coefficients and computing the Lyapunov exponents of the chaos detection system; and then, the movement state of the chaos detection system is defined. The simulation experiments show that this method can exactly confirm the bifurcation threshold value of the chaos detection system.

  7. Compressive Detection Using Sub-Nyquist Radars for Sparse Signals

    Directory of Open Access Journals (Sweden)

    Ying Sun

    2016-01-01

    Full Text Available This paper investigates the compression detection problem using sub-Nyquist radars, which is well suited to the scenario of high bandwidths in real-time processing because it would significantly reduce the computational burden and save power consumption and computation time. A compressive generalized likelihood ratio test (GLRT detector for sparse signals is proposed for sub-Nyquist radars without ever reconstructing the signal involved. The performance of the compressive GLRT detector is analyzed and the theoretical bounds are presented. The compressive GLRT detection performance of sub-Nyquist radars is also compared to the traditional GLRT detection performance of conventional radars, which employ traditional analog-to-digital conversion (ADC at Nyquist sampling rates. Simulation results demonstrate that the former can perform almost as well as the latter with a very small fraction of the number of measurements required by traditional detection in relatively high signal-to-noise ratio (SNR cases.

  8. A threshold-based approach for muscle contraction detection from surface EMG signals

    Science.gov (United States)

    Morantes, Gaudi; Fernández, Gerardo; Altuve, Miguel

    2013-11-01

    Surface electromyographic (SEMG) signals are commonly used as control signals in prosthetic and orthotic devices. Super cial electrodes are placed on the skin of the subject to acquire its muscular activity through this signal. The muscle contraction episode is then in charge of activating and deactivating these devices. Nevertheless, there is no gold standard" to detect muscle contraction, leading to delayed responses and false and missed detections. This fact motivated us to propose a new approach that compares a smoothed version of the SEMG signal with a xed threshold, in order to detect muscle contraction episodes. After preprocessing the SEMG signal, the smoothed version is obtained using a moving average lter, where three di erent window lengths has been evaluated. The detector was tuned by maximizing sensitivity and speci city and evaluated using SEMG signals obtained from the anterior tibial and gastrocnemius muscles, taken during the walking of ve subjects. Compared with traditional detection methods, we obtain a reduction of 3 ms in the detection delay, an increase of 8% in sensitivity but a decrease of 15% in speci city. Future work is directed to the inclusion of a temporal threshold (a double-threshold approach) to minimize false detections and reduce detection delays.

  9. Direct-Y: Fast Acquisition of the GPS PPS Signal

    Science.gov (United States)

    Namoos, Omar M.; DiEsposti, Raymond S.

    1996-01-01

    The NAVSTAR Global Positioning System (GPS) provides positioning and time information to military users via the Precise Positioning Service (PPS) which typically allows users a significant margin of precision over the commercially available Standard Positioning Service (SPS), Military sets that rely on first acquiring the SPS Coarse Acquisition (C/A) code, read from the data message the handover word (HOW) that provides the time-of-signal transmission needed to acquire and lock onto the PPS Y-code. Under extreme battlefield conditions, the use of GPS would be denied to the warfighter who cannot pick up the un-encrypted C/A code. Studies are underway at the GPS Joint Program Office (JPO) at the Space and Missile Center, Los Angeles Air Force Base that are aimed at developing the capability to directly acquire Y-code without first acquiring C/A code. This paper briefly outlines efforts to develop 'direct-Y' acquisition, and various approaches to solving this problem. The potential ramifications of direct-Y to military users are also discussed.

  10. Direct and Indirect Dark Matter Detection in Gauge Theories

    Energy Technology Data Exchange (ETDEWEB)

    Queiroz, Farinaldo [Federal Univ. of Paraba (Brazil)

    2013-01-01

    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.

  11. Indirect detection of radiation sources through direct detection of radiolysis products

    Energy Technology Data Exchange (ETDEWEB)

    Farmer, Joseph C [Tracy, CA; Fischer, Larry E [Los Gatos, CA; Felter, Thomas E [Livermore, CA

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  12. Techniques of EMG signal analysis: detection, processing, classification and applications

    Science.gov (United States)

    Hussain, M.S.; Mohd-Yasin, F.

    2006-01-01

    Electromyography (EMG) signals can be used for clinical/biomedical applications, Evolvable Hardware Chip (EHW) development, and modern human computer interaction. EMG signals acquired from muscles require advanced methods for detection, decomposition, processing, and classification. The purpose of this paper is to illustrate the various methodologies and algorithms for EMG signal analysis to provide efficient and effective ways of understanding the signal and its nature. We further point up some of the hardware implementations using EMG focusing on applications related to prosthetic hand control, grasp recognition, and human computer interaction. A comparison study is also given to show performance of various EMG signal analysis methods. This paper provides researchers a good understanding of EMG signal and its analysis procedures. This knowledge will help them develop more powerful, flexible, and efficient applications. PMID:16799694

  13. Sparse representation-based ECG signal enhancement and QRS detection.

    Science.gov (United States)

    Zhou, Yichao; Hu, Xiyuan; Tang, Zhenmin; Ahn, Andrew C

    2016-12-01

    Electrocardiogram (ECG) signal enhancement and QRS complex detection is a critical preprocessing step for further heart disease analysis and diagnosis. In this paper, we propose a sparse representation-based ECG signal enhancement and QRS complex detection algorithm. Unlike traditional Fourier or wavelet transform-based methods, which use fixed bases, the proposed algorithm models the ECG signal as the superposition of a few inner structures plus additive random noise, where these structures (referred to here as atoms) can be learned from the input signal or a training set. Using these atoms and their properties, we can accurately approximate the original ECG signal and remove the noise and other artifacts such as baseline wandering. Additionally, some of the atoms with larger kurtosis values can be modified and used as an indication function to detect and locate the QRS complexes in the enhanced ECG signals. To demonstrate the robustness and efficacy of the proposed algorithm, we compare it with several state-of-the-art ECG enhancement and QRS detection algorithms using both simulated and real-life ECG recordings.

  14. Influenza NS1 directly modulates Hedgehog signaling during infection.

    Directory of Open Access Journals (Sweden)

    Margery G Smelkinson

    2017-08-01

    Full Text Available The multifunctional NS1 protein of influenza A viruses suppresses host cellular defense mechanisms and subverts other cellular functions. We report here on a new role for NS1 in modifying cell-cell signaling via the Hedgehog (Hh pathway. Genetic epistasis experiments and FRET-FLIM assays in Drosophila suggest that NS1 interacts directly with the transcriptional mediator, Ci/Gli1. We further confirmed that Hh target genes are activated cell-autonomously in transfected human lung epithelial cells expressing NS1, and in infected mouse lungs. We identified a point mutation in NS1, A122V, that modulates this activity in a context-dependent fashion. When the A122V mutation was incorporated into a mouse-adapted influenza A virus, it cell-autonomously enhanced expression of some Hh targets in the mouse lung, including IL6, and hastened lethality. These results indicate that, in addition to its multiple intracellular functions, NS1 also modifies a highly conserved signaling pathway, at least in part via cell autonomous activities. We discuss how this new Hh modulating function of NS1 may influence host lethality, possibly through controlling cytokine production, and how these new insights provide potential strategies for combating infection.

  15. Velocity and directionality of the electrohysterographic signal propagation.

    Directory of Open Access Journals (Sweden)

    Lasse Lange

    Full Text Available OBJECTIVE: The initiation of treatment for women with threatening preterm labor requires effective distinction between true and false labor. The electrohysterogram (EHG has shown great promise in estimating and classifying uterine activity. However, key issues remain unresolved and no clinically usable method has yet been presented using EHG. Recent studies have focused on the propagation velocity of the EHG signals as a potential discriminator between true and false labor. These studies have estimated the propagation velocity of individual spikes of the EHG signals. We therefore focus on estimating the propagation velocity of the entire EHG burst recorded during a contraction in two dimensions. STUDY DESIGN: EHG measurements were performed on six women in active labor at term, and a total of 35 contractions were used for the estimation of propagation velocity. The measurements were performed using a 16-channel two-dimensional electrode grid. The estimates were calculated with a maximum-likelihood approach. RESULTS: The estimated average propagation velocity was 2.18 (±0.68 cm/s. No single preferred direction of propagation was found. CONCLUSION: The propagation velocities estimated in this study are similar to those reported in other studies but with a smaller intra- and inter-patient variation. Thus a potential tool has been established for further studies on true and false labor contractions.

  16. Assessing Astrophysical Uncertainties in Direct Detection with Galaxy Simulations

    Science.gov (United States)

    Sloane, Jonathan D.; Buckley, Matthew R.; Brooks, Alyson M.; Governato, Fabio

    2016-11-01

    We study the local dark matter velocity distribution in simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The gravitational potential due to the presence of a baryonic disk increases the amount of high velocity dark matter, resulting in velocity distributions that are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Furthermore, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulations. We show that the impact on the direct detection experiments LUX, DAMA/Libra, and CoGeNT using our simulated velocity distributions, and explore how resolution and halo mass within the Milky Way’s estimated mass range impact the results. A Maxwellian fit to the velocity distribution tends to overpredict the amount of dark matter in the high velocity tail, even with baryons, and thus leads to overly optimistic direct detection bounds on models that are dependent on this region of phase space for an experimental signal. Our work further demonstrates that it is critical to transform simulated velocity distributions to the lab frame of reference, due to the fact that velocity structure in the solar neighborhood appears when baryons are included. There is more velocity structure present when baryons are included than in dark matter-only simulations. Even when baryons are included, the importance of the velocity structure is not as apparent in the Galactic frame of reference as in the Earth frame.

  17. Review of dark matter direct detection experiments

    Indian Academy of Sciences (India)

    Rupak Mahapatra

    2012-11-01

    Matter, as we know it, makes up less than 5% of the Universe. Various astrophysical observations have confirmed that one quarter of the Universe and most of the matter content in the Universe is made up of dark matter. The nature of dark matter is yet to be discovered and is one of the biggest questions in physics. Particle physics combined with astrophysical measurements of the abundance gives rise to a dark matter candidate called weakly interacting massive particle (WIMP). The low density of WIMPs in the galaxies and the extremely weak nature of the interaction with ordinary matter make detection of the WIMP an extraordinarily challenging task, with abundant fakes from various radioactive and cosmogenic backgrounds with much stronger electromagnetic interaction. The extremely weak nature of the WIMP interaction dictates detectors that have extremely low naturally occurring radioactive background, a large active volume (mass) of sensitive detector material to maximize statistics, a highly efficient detector-based rejection mechanism for the dominant electromagnetic background and sophisticated analysis techniques to reject any residual background. This paper reviews currently available major technologies being pursued by various collaborations, with special emphasis on the cryogenic Ge detector technology used by the Cryogenic Dark Matter Search Collaboration (CDMS).

  18. Detecting Blackholes and Volcanoes in Directed Networks

    CERN Document Server

    Li, Zhongmou; Liu, Yanchi

    2010-01-01

    In this paper, we formulate a novel problem for finding blackhole and volcano patterns in a large directed graph. Specifically, a blackhole pattern is a group which is made of a set of nodes in a way such that there are only inlinks to this group from the rest nodes in the graph. In contrast, a volcano pattern is a group which only has outlinks to the rest nodes in the graph. Both patterns can be observed in real world. For instance, in a trading network, a blackhole pattern may represent a group of traders who are manipulating the market. In the paper, we first prove that the blackhole mining problem is a dual problem of finding volcanoes. Therefore, we focus on finding the blackhole patterns. Along this line, we design two pruning schemes to guide the blackhole finding process. In the first pruning scheme, we strategically prune the search space based on a set of pattern-size-independent pruning rules and develop an iBlackhole algorithm. The second pruning scheme follows a divide-and-conquer strategy to fur...

  19. Colorless ONU implementation for WDM-PON using direct-detection optical OFDM

    Science.gov (United States)

    Feng, Min; Luo, Qing-long; Bai, Cheng-lin

    2013-03-01

    A novel architecture for the colorless optical network unit (ONU) is proposed and experimentally demonstrated with direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM). In this architecture, polarization-division multiplexing is used to reduce the cost at ONU. In optical line terminal (OLT), quadrature amplitude modulation (QAM) intensity-modulated OFDM signal with x-polarization at 10 Gbit/s is transmitted as downstream. At each ONU, the optical OFDM signal is demodulated with direct detection, and γ-polarization signal is modulated for upstream on-off keying (OOK) data at 5 Gbit/s. Simulation results show that the power penalty is negligible for both optical OFDM downstream and the on-off keying upstream signals after over 50 km single-mode fiber (SMF) transmission.

  20. Efficient signal processing for time-resolved fluorescence detection of nitrogen-vacancy spins in diamond

    Science.gov (United States)

    Gupta, A.; Hacquebard, L.; Childress, L.

    2016-03-01

    Room-temperature fluorescence detection of the nitrogen-vacancy center electronic spin typically has low signal to noise, requiring long experiments to reveal an averaged signal. Here, we present a simple approach to analysis of time-resolved fluorescence data that permits an improvement in measurement precision through signal processing alone. Applying our technique to experimental data reveals an improvement in signal to noise equivalent to a 14% increase in photon collection efficiency. We further explore the dependence of the signal to noise ratio on excitation power, and analyze our results using a rate equation model. Our results provide a rubric for optimizing fluorescence spin detection, which has direct implications for improving precision of nitrogen-vacancy-based sensors.

  1. Escape Time of Josephson Junctions for Signal Detection

    CERN Document Server

    Addesso, P; Pierro, V

    2014-01-01

    In this Chapter we investigate with the methods of signal detection the response of a Josephson junction to a perturbation to decide if the perturbation contains a coherent oscillation embedded in the background noise. When a Josephson Junction is irradiated by an external noisy source, it eventually leaves the static state and reaches a steady voltage state. The appearance of a voltage step allows to measure the time spent in the metastable state before the transition to the running state, thus defining an escape time. The distribution of the escape times depends upon the characteristics of the noise and the Josephson junction. Moreover, the properties of the distribution depends on the features of the signal (amplitude, frequency and phase), which can be therefore inferred through the appropriate signal processing methods. Signal detection with JJ is interesting for practical purposes, inasmuch as the superconductive elements can be (in principle) cooled to the absolute zero and therefore can add (in practi...

  2. Clinical detection and movement recognition of neuro signals

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xiao-wen; YANG Yu-pu; XU Xiao-ming; HU Tian-pei; GAO Zhong-hua; ZHANG Jian; CHEN Tong-yi; CHEN Zhong-wei

    2005-01-01

    Neuro signal has many more advantages than myoelectricity in providing information for prosthesis control, and can be an ideal source for developing new prosthesis. In this work, by implanting intrafascicular electrode clinically in the amputee's upper extremity, collective signals from fascicules of three main nerves (radial nerve, ulnar nerve and medium nerve) were successfully detected with sufficient fidelity and without infection. Initial analysis of features under different actions was performed and movement recognition of detected samples was attempted. Singular value decomposition features (SVD) extracted from wavelet coefficients were used as inputs for neural network classifier to predict amputee's movement intentions. The whole training rate was up to 80.94% and the test rate was 56.87% without over-training. This result gives inspiring prospect that collective signals from fascicules of the three main nerves are feasible sources for controlling prosthesis. Ways for improving accuracy in developing prosthesis controlled by neuro signals are discussed in the end.

  3. Tuning positive feedback for signal detection in noisy dynamic environments.

    Science.gov (United States)

    Johansson, Anders; Ramsch, Kai; Middendorf, Martin; Sumpter, David J T

    2012-09-21

    Learning from previous actions is a key feature of decision-making. Diverse biological systems, from neuronal assemblies to insect societies, use a combination of positive feedback and forgetting of stored memories to process and respond to input signals. Here we look how these systems deal with a dynamic two-armed bandit problem of detecting a very weak signal in the presence of a high degree of noise. We show that by tuning the form of positive feedback and the decay rate to appropriate values, a single tracking variable can effectively detect dynamic inputs even in the presence of a large degree of noise. In particular, we show that when tuned appropriately a simple positive feedback algorithm is Fisher efficient, in that it can track changes in a signal on a time of order L(h)=(|h|/σ)(-2), where |h| is the magnitude of the signal and σ the magnitude of the noise.

  4. 47 CFR 1.4000 - Restrictions impairing reception of television broadcast signals, direct broadcast satellite...

    Science.gov (United States)

    2010-10-01

    ... broadcast signals, direct broadcast satellite services or multichannel multipoint distribution services. 1... Broadcast Satellite Services, or Multichannel Multipoint Distribution Services or the Ability To Receive or... broadcast signals, direct broadcast satellite services or multichannel multipoint distribution services....

  5. Clinical Detection and Feature Analysis on Neuro Signals

    Institute of Scientific and Technical Information of China (English)

    张晓文; 杨煜普; 许晓鸣; 胡天培; 高忠华; 张键; 陈中伟; 陈统一

    2004-01-01

    Research on neuro signals is challenging and significative in modern natural science. By clinical experiment, signals from three main nerves (median nerve, radial nerve and ulnar nerve) are successfully detected and recorded without any infection. Further analysis on their features under different movements, their mechanics and correlations in dominating actions are also performed. The original discovery and first-hand materials make it possible for developing practical neuro-prosthesis.

  6. Energy Detection of Multilevel PAM Signals with Systematic Threshold Mismatch

    Directory of Open Access Journals (Sweden)

    Antti Anttonen

    2009-01-01

    Full Text Available We address a symbol decision problem with spectrally efficient energy detected multilevel pulse amplitude modulated (PAM signals. First, we analytically quantify the relationship between a systematic threshold mismatch and the required increase of the average signal-to-noise ratio to preserve a desired symbol error rate. For the case in which such an increase is not tolerable, we present a novel near-optimal multilevel threshold selection scheme, which is accurate for a wide range of system parameters.

  7. QRS complex detection in ECG signal for wearable devices.

    Science.gov (United States)

    Arefin, M Riadh; Tavakolian, Kouhyar; Fazel-Rezai, Reza

    2015-01-01

    This paper presents QRS complex detection algorithm based on dual slope technique, which is suitable for wearable electrocardiogram (ECG) applications. For cardiac patients of different arrhythmias, ECG signals are needed to be monitored over an extensive period of time. Thus, the wearable heart monitoring system needs computationally efficient QRS detection technique with good accuracy. In this paper, a method of QRS detection based on two slopes on both sides of an R peak is presented which is computationally efficient. Based on the slopes, first, a variable measuring steepness is developed, then by introducing an adjustable R-R interval based window and adaptive thresholding techniques, depending on the number of peaks detected in such window, R peaks are detected. The algorithm was evaluated against MIT/BIH arrhythmia database and achieved 99.16% detection rate with sensitivity of 0.9935 and positive predictivity of 0.9981. The method was compared with two widely used R peaks detection algorithms.

  8. Correlation of calculated CNR and signal detectability on MR images

    Energy Technology Data Exchange (ETDEWEB)

    Ogura, Akio [Kyoto City Hospital (Japan); Higashida, Mitsuji; Yamazaki, Masaru; Inoue, Hiroshi

    1998-06-01

    To calculate the contrast-to-noise ratio (CNR) on magnetic resonance images, an equation selected to match each study is commonly used. The CNR values calculated using these equations may have their own characteristics. Therefore, the characteristics of four commonly calculated CNRs were evaluated in comparison with signal detectability. For the calculation of CNR, a phantom with five different solutions of CuSO{sub 4} was imaged using various scan sequences with different TR and NEX. These images, which had different levels of noise and contrast, were measured for averaged signal intensity and standard deviation of noise in the same ROIs (regions of interest). To define signal detectability, Burger`s phantom soaked in the CuSO{sub 4} solution was imaged with the same pulse sequences used to evaluate CNR. Burger`s phantom images were evaluated by five observers with a 50% confidence level. The characteristics of each CNR value were evaluated by correlating them with signal detectability. The results showed that some calculated CNRs indicated the noise element, but contrast element. From the point of view of signal detectability, the equation using the average of local variance and global variance with respect to coarse pixels was superior to others. (author)

  9. Sensitive Method for Biomolecule Detection Utilizing Signal Amplification with Porphyrin Nanoparticles.

    Science.gov (United States)

    Gibson, Lauren E; Wright, David W

    2016-06-07

    Disease diagnosis requires identification of biomarkers that occur in small quantities, making detection a difficult task. Effective diagnosis is an even greater challenge in low-resource areas of the world. Methods must be simple, stable, and sensitive so that tests can be easily administered and withstand uncontrolled environmental conditions. One approach to this issue is development of stable signal amplification strategies. In this work, we applied the nanocrystal-based signal amplification method to tetra(4-carboxyphenyl)porphyrin nanoparticles (TCPP NPs). The dissolution of the nanoparticle into thousands of porphyrin molecules results in amplified detection of the biomarker. By using nanoparticles as the signal-generating moiety, stability of the detection method is increased relative to commonly used enzyme-based assays. Additionally, the inherent fluorescent signal of TCPP molecules can be measured after nanoparticle dissolution. The ability to directly read the TCPP fluorescent signal increases assay simplicity by reducing the steps required for the test. This detection method was optimized by detecting rabbit IgG and then was applied to the detection of the malarial biomarker Plasmodium falciparum histidine-rich protein II (pfHRPII) from a complex matrix. The results for both biomarkers were assays with low picomolar limits of detection.

  10. A Duffing oscillator algorithm to detect the weak chromatographic signal.

    Science.gov (United States)

    Zhang, Wei; Xiang, Bing-Ren

    2007-02-28

    Based on the Duffing equation, a Duffing oscillator algorithm (DOA) to improve the signal-to-noise ratio (SNR) was presented. By simulated and experimental data sets, it was proven that the signal-to-noise ratio (SNR) of the weak signal could be greatly enhanced by this method. Using signal enhancement by DOA, this method extends the SNR of low concentrations of methylbenzene from 2.662 to 29.90 and the method can be used for quantitative analysis of methylbenzene, which are lower than detection limit of an analytical system. The Duffing oscillator algorithm (DOA) might be a promising tool to extend instrumental linear range and to improve the accuracy of trace analysis. The research enlarged the application scope of Duffing equation to chromatographic signal processing.

  11. Advanced radar detection schemes under mismatched signal models

    CERN Document Server

    Bandiera, Francesco

    2009-01-01

    Adaptive detection of signals embedded in correlated Gaussian noise has been an active field of research in the last decades. This topic is important in many areas of signal processing such as, just to give some examples, radar, sonar, communications, and hyperspectral imaging. Most of the existing adaptive algorithms have been designed following the lead of the derivation of Kelly's detector which assumes perfect knowledge of the target steering vector. However, in realistic scenarios, mismatches are likely to occur due to both environmental and instrumental factors. When a mismatched signal

  12. Universal Collaboration Strategies for Signal Detection: A Sparse Learning Approach

    Science.gov (United States)

    Khanduri, Prashant; Kailkhura, Bhavya; Thiagarajan, Jayaraman J.; Varshney, Pramod K.

    2016-10-01

    This paper considers the problem of high dimensional signal detection in a large distributed network whose nodes can collaborate with their one-hop neighboring nodes (spatial collaboration). We assume that only a small subset of nodes communicate with the Fusion Center (FC). We design optimal collaboration strategies which are universal for a class of deterministic signals. By establishing the equivalence between the collaboration strategy design problem and sparse PCA, we solve the problem efficiently and evaluate the impact of collaboration on detection performance.

  13. Readout technologies for directional WIMP Dark Matter detection

    CERN Document Server

    Battat, J B R; Aleksandrov, A; Guler, M Ali; Asada, T; Baracchini, E; Billard, J; Bosson, G; Bourrion, O; Bouvier, J; Buonaura, A; Burdge, K; Cebrian, S; Colas, P; Consiglio, L; Dafni, T; D'Ambrosio, N; Deaconu, C; De Lellis, G; Descombes, T; Di Crescenzo, A; Di Marco, N; Druitt, G; Eggleston, R; Ferrer-Ribas, E; Fusayasu, T; Galan, J; Galati, G; Garcia, J A; Garza, J G; Gentile, V; Garcia-Sciveres, M; Giomataris, Y; Guerrero, N; Guillaudin, O; Harton, J; Hashimoto, T; Hedges, M T; Iguaz, F; Ikeda, T; Jaegle, I; Kadyk, J A; Katsuragawa, T; Komura, S; Kubo, H; Kuge, K; Lamblin, J; Lauria, A; Lee, E R; Lewis, P; Leyton, M; Loomba, D; Lopez, J P; Luzon, G; Mayet, F; Mirallas, H; Miuchi, K; Mizumoto, T; Mizumura, Y; Monacelli, P; Monroe, J; Montesi, M C; Naka, T; Nakamura, K; Nishimura, H; Ochi, A; Papevangelou, T; Parker, J D; Phan, N S; Pupilli, F; Richer, J P; Riffard, Q; Rosa, G; Santos, D; Sawano, T; Sekiya, H; Seong, I S; Snowden-Ifft, D P; Spooner, N J C; Sugiyama, A; Taishaku, R; Takada, A; Takeda, A; Tanaka, M; Tanimori, T; Thorpe, T N; Tioukov, V; Tomita, H; Umemoto, A; Vahsen, S E; Yamaguchi, Y; Yoshimoto, M; Zayas, E

    2016-01-01

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  14. Readout technologies for directional WIMP Dark Matter detection

    Science.gov (United States)

    Battat, J. B. R.; Irastorza, I. G.; Aleksandrov, A.; Asada, T.; Baracchini, E.; Billard, J.; Bosson, G.; Bourrion, O.; Bouvier, J.; Buonaura, A.; Burdge, K.; Cebrián, S.; Colas, P.; Consiglio, L.; Dafni, T.; D'Ambrosio, N.; Deaconu, C.; De Lellis, G.; Descombes, T.; Di Crescenzo, A.; Di Marco, N.; Druitt, G.; Eggleston, R.; Ferrer-Ribas, E.; Fusayasu, T.; Galán, J.; Galati, G.; García, J. A.; Garza, J. G.; Gentile, V.; Garcia-Sciveres, M.; Giomataris, Y.; Guerrero, N.; Guillaudin, O.; Guler, A. M.; Harton, J.; Hashimoto, T.; Hedges, M. T.; Iguaz, F. J.; Ikeda, T.; Jaegle, I.; Kadyk, J. A.; Katsuragawa, T.; Komura, S.; Kubo, H.; Kuge, K.; Lamblin, J.; Lauria, A.; Lee, E. R.; Lewis, P.; Leyton, M.; Loomba, D.; Lopez, J. P.; Luzón, G.; Mayet, F.; Mirallas, H.; Miuchi, K.; Mizumoto, T.; Mizumura, Y.; Monacelli, P.; Monroe, J.; Montesi, M. C.; Naka, T.; Nakamura, K.; Nishimura, H.; Ochi, A.; Papevangelou, T.; Parker, J. D.; Phan, N. S.; Pupilli, F.; Richer, J. P.; Riffard, Q.; Rosa, G.; Santos, D.; Sawano, T.; Sekiya, H.; Seong, I. S.; Snowden-Ifft, D. P.; Spooner, N. J. C.; Sugiyama, A.; Taishaku, R.; Takada, A.; Takeda, A.; Tanaka, M.; Tanimori, T.; Thorpe, T. N.; Tioukov, V.; Tomita, H.; Umemoto, A.; Vahsen, S. E.; Yamaguchi, Y.; Yoshimoto, M.; Zayas, E.

    2016-11-01

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  15. Cophylogenetic signal is detectable in pollination interactions across ecological scales.

    Science.gov (United States)

    Hutchinson, Matthew C; Cagua, Edgar Fernando; Stouffer, Daniel B

    2017-07-22

    That evolutionary history can influence the way that species interact is a basic tenet of evolutionary ecology. However, when the role of evolution in determining ecological interactions is investigated, focus typically centers on just one side of the interaction. A cophylogenetic signal, the congruence of evolutionary history across both sides of an ecological interaction, extends these previous explorations and provides a more complete picture of how evolutionary patterns influence the way species interact. To date, cophylogenetic signal has most typically been studied in interactions that occur between fine taxonomic clades that show high intimacy. In this study, we took an alternative approach and made an exhaustive assessment of cophylogeny in pollination interactions. To do so, we assessed the strength of cophylogenetic signal at four distinct scales of pollination interaction: (1) across plant-pollinator associations globally, (2) in local pollination communities, (3) within the modular structure of those communities, and (4) in individual modules. We did so using a globally distributed dataset comprised of 54 pollination networks, over 4000 species, and over 12,000 interactions. Within these data, we detected cophylogenetic signal at all four scales. Cophylogenetic signal was found at the level of plant-pollinator interactions on a global scale and in the majority of pollination communities. At the scale defined by the modular structure within those communities, however, we observed a much weaker cophylogenetic signal. Cophylogenetic signal was detectable in a significant proportion of individual modules and most typically when within-module phylogenetic diversity was low. In sum, the detection of cophylogenetic signal in pollination interactions across scales provides a new dimension to the story of how past evolution shapes extant pollinator-angiosperm interactions. © 2017 by the Ecological Society of America.

  16. Probing WIMP particle physics and astrophysics with direct detection and neutrino telescope data

    NARCIS (Netherlands)

    Kavanagh, B.J.; Fornasa, M.; Green, A.M.

    2015-01-01

    With positive signals from multiple direct detection experiments, it will, in principle, be possible to measure the mass and cross sections of weakly interacting massive particle (WIMP) dark matter. Recent work has shown that, with a polynomial parametrization of the WIMP speed distribution, it is p

  17. Direct imaging Raman microscope based on tunable wavelength excitation and narrow band emission detection

    NARCIS (Netherlands)

    Puppels, G.J.; Grond, M.; Greve, J.

    1993-01-01

    A new type of imaging Raman microscope is described. First the advantages and disadvantages of the two possible approaches to Raman microscopy based on signal detection by means of a charge-coupled-device camera (i.e., direct imaging and image reconstruction) are discussed. Arguments are given to sh

  18. Direct detection of brown dwarf companions of nearby stars

    Science.gov (United States)

    Oppenheimer, Ben R.

    This thesis presents the first direct detection of a substellar companion of a star other than the Sun. This object, a brown dwarf called Gliese 229B, presented a unique opportunity to characterize low-temperature brown dwarfs for the first time. The discovery and initial spectrum of Gliese 229B show that the object must be substellar based on its intrinsic luminosity of 6.4×10-6Lsolar and its cool surface temperature, 900 K. Detailed study of Gliese 229B includes extensive photometric measurements from 0.5 to 12 μm, high signal-to-noise ratio spectroscopy from 0.84 to 5.0 μm and the detection of 0'' t; yr-1 of orbital motion. These results are presented in Chapters 2 and 3. A detailed review of brown dwarf science leads to a complete and scientifically meaningful definition of the classes ``planet'' and ``brown dwarf''' in Chapter 1. After the discovery of Gliese 229B, which was found in a survey for companions of young stars, we began an extensive search for brown dwarf companions in orbit about all known stars within 8 pc of the Sun and with δ > -35°. The search includes optical coronagraphic and infrared direct imaging of these stars, conducted on the Palomar 60' and 200' telescopes respectively. The search was designed to find companions of each star without color bias. While the search revealed no other brown dwarf companions of these stars, it did uncover 6 new stellar companions. The sensitivity limits of the survey permit the detection of brown dwarfs up to four magnitudes fainter than Gliese 229B around 90% of the stars. The sensitivity is, however, not uniform spatially or from star to star. This limits our ability to make strong statements about the prevalence of brown dwarf companions of nearby stars. The survey does have sensitivity to all stellar companions between 3 and 30' from the survey stars, however. Chapter 5 describes related work on very low-mass stars in the Pleiades star cluster. This optical spectroscopy involved trying to find a

  19. Compressive Sensing of Roller Bearing Faults via Harmonic Detection from Under-Sampled Vibration Signals.

    Science.gov (United States)

    Tang, Gang; Hou, Wei; Wang, Huaqing; Luo, Ganggang; Ma, Jianwei

    2015-10-09

    The Shannon sampling principle requires substantial amounts of data to ensure the accuracy of on-line monitoring of roller bearing fault signals. Challenges are often encountered as a result of the cumbersome data monitoring, thus a novel method focused on compressed vibration signals for detecting roller bearing faults is developed in this study. Considering that harmonics often represent the fault characteristic frequencies in vibration signals, a compressive sensing frame of characteristic harmonics is proposed to detect bearing faults. A compressed vibration signal is first acquired from a sensing matrix with information preserved through a well-designed sampling strategy. A reconstruction process of the under-sampled vibration signal is then pursued as attempts are conducted to detect the characteristic harmonics from sparse measurements through a compressive matching pursuit strategy. In the proposed method bearing fault features depend on the existence of characteristic harmonics, as typically detected directly from compressed data far before reconstruction completion. The process of sampling and detection may then be performed simultaneously without complete recovery of the under-sampled signals. The effectiveness of the proposed method is validated by simulations and experiments.

  20. Detection of essential hypertension with physiological signals from wearable devices.

    Science.gov (United States)

    Ghosh, Arindam; Torres, Juan Manuel Mayor; Danieli, Morena; Riccardi, Giuseppe

    2015-08-01

    Early detection of essential hypertension can support the prevention of cardiovascular disease, a leading cause of death. The traditional method of identification of hypertension involves periodic blood pressure measurement using brachial cuff-based measurement devices. While these devices are non-invasive, they require manual setup for each measurement and they are not suitable for continuous monitoring. Research has shown that physiological signals such as Heart Rate Variability, which is a measure of the cardiac autonomic activity, is correlated with blood pressure. Wearable devices capable of measuring physiological signals such as Heart Rate, Galvanic Skin Response, Skin Temperature have recently become ubiquitous. However, these signals are not accurate and are prone to noise due to different artifacts. In this paper a) we present a data collection protocol for continuous non-invasive monitoring of physiological signals from wearable devices; b) we implement signal processing techniques for signal estimation; c) we explore how the continuous monitoring of these physiological signals can be used to identify hypertensive patients; d) We conduct a pilot study with a group of normotensive and hypertensive patients to test our techniques. We show that physiological signals extracted from wearable devices can distinguish between these two groups with high accuracy.

  1. RMOD: a tool for regulatory motif detection in signaling network.

    Directory of Open Access Journals (Sweden)

    Jinki Kim

    Full Text Available Regulatory motifs are patterns of activation and inhibition that appear repeatedly in various signaling networks and that show specific regulatory properties. However, the network structures of regulatory motifs are highly diverse and complex, rendering their identification difficult. Here, we present a RMOD, a web-based system for the identification of regulatory motifs and their properties in signaling networks. RMOD finds various network structures of regulatory motifs by compressing the signaling network and detecting the compressed forms of regulatory motifs. To apply it into a large-scale signaling network, it adopts a new subgraph search algorithm using a novel data structure called path-tree, which is a tree structure composed of isomorphic graphs of query regulatory motifs. This algorithm was evaluated using various sizes of signaling networks generated from the integration of various human signaling pathways and it showed that the speed and scalability of this algorithm outperforms those of other algorithms. RMOD includes interactive analysis and auxiliary tools that make it possible to manipulate the whole processes from building signaling network and query regulatory motifs to analyzing regulatory motifs with graphical illustration and summarized descriptions. As a result, RMOD provides an integrated view of the regulatory motifs and mechanism underlying their regulatory motif activities within the signaling network. RMOD is freely accessible online at the following URL: http://pks.kaist.ac.kr/rmod.

  2. Direct detection of exothermic dark matter with light mediator

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Chao-Qiang [Chongqing University of Posts & Telecommunications,Chongqing, 400065 (China); Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Huang, Da; Lee, Chun-Hao [Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Wang, Qing [Department of Physics, Tsinghua University,Beijing, 100084 (China); Collaborative Innovation Center of Quantum Matter,Beijing, 100084 (China)

    2016-08-05

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  3. Direct detection of exothermic dark matter with light mediator

    Science.gov (United States)

    Geng, Chao-Qiang; Huang, Da; Lee, Chun-Hao; Wang, Qing

    2016-08-01

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  4. Direct Detection of Exothermic Dark Matter with Light Mediator

    CERN Document Server

    Geng, Chao-Qiang; Lee, Chun-Hao; Wang, Qing

    2016-01-01

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  5. Current Status and Future Directions of Research in Complex Signaling

    Institute of Scientific and Technical Information of China (English)

    Eileen A. HEBETS

    2011-01-01

    @@ 1 Introduction The term'complex signaling'reflects a recent scientific focus on the multiple elements frequently incorporated into animal signals(reviewed in Candolin,2003; Hebets and Papaj,2005;Partan and Marler,2005;Bro-Jorgensen,2010).

  6. Snowmass CF1 Summary: WIMP Dark Matter Direct Detection

    OpenAIRE

    Cushman, P.; Galbiati,C; McKinsey, DN; Robertson, H; Tait, TMP; Bauer, D.; Borgland, A.; Cabrera, B; Calaprice, F.; Cooley, J.; Empl, T; Essig, R.; Figueroa-Feliciano, E.; Gaitskell, R.; Golwala, S

    2017-01-01

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of exp...

  7. Assessing the discovery potential of directional detection of Dark Matter

    CERN Document Server

    Billard, J; Santos, D

    2011-01-01

    There is a worldwide effort toward the development of a large TPC (Time Projection Chamber) devoted to directional Dark Matter detection. All current projects are being designed to fulfill a unique goal : identifying weakly interacting massive particle (WIMP) as such by taking advantage of the expected direction dependence of WIMP-induced events toward the constellation Cygnus. However such proof of discovery requires a careful statistical data treatment. In this paper, the discovery potential of forthcoming directional detectors is adressed by using a frequentist approach based on the profile likelihood ratio test statistic. This allows us to estimate the expected significance of a Dark Matter detection. Moreover, using this powerful test statistic, it is possible to propagate astrophysical and experimental uncertainties in the determination of the discovery potential of a given directional detection experiment. This way, we found that a 30 kg.year CF$_4$ directional experiment could reach a 3$\\sigma$ sensit...

  8. Detectability of CO2 flux signals by a space-based lidar mission

    Science.gov (United States)

    Hammerling, Dorit M.; Kawa, S. Randolph; Schaefer, Kevin; Doney, Scott; Michalak, Anna M.

    2015-03-01

    Satellite observations of carbon dioxide (CO2) offer novel and distinctive opportunities for improving our quantitative understanding of the carbon cycle. Prospective observations include those from space-based lidar such as the active sensing of CO2 emissions over nights, days, and seasons (ASCENDS) mission. Here we explore the ability of such a mission to detect regional changes in CO2 fluxes. We investigate these using three prototypical case studies, namely, the thawing of permafrost in the northern high latitudes, the shifting of fossil fuel emissions from Europe to China, and changes in the source/sink characteristics of the Southern Ocean. These three scenarios were used to design signal detection studies to investigate the ability to detect the unfolding of these scenarios compared to a baseline scenario. Results indicate that the ASCENDS mission could detect the types of signals investigated in this study, with the caveat that the study is based on some simplifying assumptions. The permafrost thawing flux perturbation is readily detectable at a high level of significance. The fossil fuel emission detectability is directly related to the strength of the signal and the level of measurement noise. For a nominal (lower) fossil fuel emission signal, only the idealized noise-free instrument test case produces a clearly detectable signal, while experiments with more realistic noise levels capture the signal only in the higher (exaggerated) signal case. For the Southern Ocean scenario, differences due to the natural variability in the El Niño-Southern Oscillation climatic mode are primarily detectable as a zonal increase.

  9. Detection of visual signals by rats: A computational model

    Science.gov (United States)

    We applied a neural network model of classical conditioning proposed by Schmajuk, Lam, and Gray (1996) to visual signal detection and discrimination tasks designed to assess sustained attention in rats (Bushnell, 1999). The model describes the animals’ expectation of receiving fo...

  10. Joint Iterative Carrier Synchronization and Signal Detection Employing Expectation Maximization

    DEFF Research Database (Denmark)

    Zibar, Darko; de Carvalho, Luis Henrique Hecker; Estaran Tolosa, Jose Manuel

    2014-01-01

    In this paper, joint estimation of carrier frequency, phase, signal means and noise variance, in a maximum likelihood sense, is performed iteratively by employing expectation maximization. The parameter estimation is soft decision driven and allows joint carrier synchronization and data detection...

  11. Safety signal detection: the relevance of literature review.

    Science.gov (United States)

    Pontes, Helena; Clément, Mallorie; Rollason, Victoria

    2014-07-01

    Adverse drug reactions (ADRs) represent an important risk for patients and have a significant economic impact on health systems. ADRs are the fifth most common cause of hospital death, with a burden estimated at 197,000 deaths per year in the EU. This has a societal cost of 79 billion per year. Because of this strong impact in public health, regulatory authorities (RAs) worldwide are implementing new pharmacovigilance legislation to promote and protect public health by reducing the burden of ADRs through the detection of safety signals. Although, traditionally, signal detection activities have mainly been performed based on spontaneous reporting from healthcare professionals and national health RAs, the new pharmacovigilance legislation underlines the relevance of other sources of information (such as scientific literature) for the evaluation of the benefit-risk balance of a certain product. This review aims to highlight the relevance of periodic scientific literature screening in the safety signal detection process. The authors present four practical examples where a safety signal that was detected from a literature report had an impact on the lifecycle of a drug. In addition, based on practical experience of the screening of medical and scientific literature for safety purposes, this article analyses the requirements of the new pharmacovigilance guidelines on literature screening and highlights the need for the implementation of a literature review procedure and the main challenges encountered when performing literature screening for safety aspects.

  12. Signal to cut-off (S/CO ratio and detection of HCV genotype 1 by real-time PCR one-step method: is there any direct relationship?

    Directory of Open Access Journals (Sweden)

    Guilherme Albertoni

    2010-04-01

    Full Text Available BACKGROUND: Polymerase chain reaction (PCR methods play an essential role in providing data related to diagnosis, monitoring and treatment of hepatitis C virus (HCV infection. EIA results are reported as ''reactive'' or ''non reactive'' and EIA S/CO ratio may also be reported as ''high'' or ''low.'' This study aimed to evaluate the performance of a real-time RT-PCR and assess whether there is relationship between S/CO and PCR results. STUDY DESIGN AND METHODS: Sera from blood donors were analyzed by Enzyme-Linked Immunosorbent Assay (ELISA and RT-PCR assay to detect HCV infection. RESULTS: The RT-PCR assay to genotypes 1a/b showed an acceptable linear response in serial dilutions. The samples were divided into two groups based on their serological results: group A - S/CO ratio 3 (41 samples. Viral loads were confirmed positive in group B samples in 90%, and in group A samples were confirmed positive in only 13% by RT-PCR. CONCLUSION: The methodology used was able to detect the presence of RNA-HCV genotype I in 90% of the samples serologically positive in group B. All negative samples were sent to search for other genotypes of HCV (genotypes 2-6 and were confirmed as negative. These data suggests that these negative samples may have HCV RNA viral load below the detection limit of our test (310 IU/ mL, or a false positive result in serological test, or spontaneous viral clearance occurred.

  13. Signal to cut-off (S/CO ratio and detection of HCV genotype 1 by real-time PCR one-step method: is there any direct relationship?

    Directory of Open Access Journals (Sweden)

    Guilherme Albertoni

    Full Text Available BACKGROUND: Polymerase chain reaction (PCR methods play an essential role in providing data related to diagnosis, monitoring and treatment of hepatitis C virus (HCV infection. EIA results are reported as ''reactive'' or ''non reactive'' and EIA S/CO ratio may also be reported as ''high'' or ''low.'' This study aimed to evaluate the performance of a real-time RT-PCR and assess whether there is relationship between S/CO and PCR results. STUDY DESIGN AND METHODS: Sera from blood donors were analyzed by Enzyme-Linked Immunosorbent Assay (ELISA and RT-PCR assay to detect HCV infection. RESULTS: The RT-PCR assay to genotypes 1a/b showed an acceptable linear response in serial dilutions. The samples were divided into two groups based on their serological results: group A - S/CO ratio 3 (41 samples. Viral loads were confirmed positive in group B samples in 90%, and in group A samples were confirmed positive in only 13% by RT-PCR. CONCLUSION: The methodology used was able to detect the presence of RNA-HCV genotype I in 90% of the samples serologically positive in group B. All negative samples were sent to search for other genotypes of HCV (genotypes 2-6 and were confirmed as negative. These data suggests that these negative samples may have HCV RNA viral load below the detection limit of our test (310 IU/ mL, or a false positive result in serological test, or spontaneous viral clearance occurred.

  14. Coherent stochastic oscillations enhance signal detection in spiking neurons.

    Science.gov (United States)

    Engel, Tatiana A; Helbig, Brian; Russell, David F; Schimansky-Geier, Lutz; Neiman, Alexander B

    2009-08-01

    We study the effect of noisy oscillatory input on the signal discrimination by spontaneously firing neurons. Using analytically tractable model, we contrast signal detection in two situations: (i) when the neuron is driven by coherent oscillations and (ii) when the coherence of oscillations is destroyed. Analytical calculations revealed a region in the parameter space of the model where oscillations act to reduce the variability of neuronal firing and to enhance the discriminability of weak signals. These analytical results are employed to unveil a possible role of coherent oscillations in peripheral electrosensory system of paddlefish in improvement of detection of weak stimuli. The proposed mechanism may be relevant to a wide range of phenomena involving coherently driven oscillators.

  15. Signal processing techniques for atrial fibrillation source detection.

    Science.gov (United States)

    Ambadkar, Minal; Leonelli, Fabio M; Sankar, Ravi

    2014-01-01

    In clinical practice, Atrial Fibrillation (AF) is the most common and critical cardiac arrhythmia encountered. The treatment that can ensure permanent AF removal is catheter ablation, where cardiologists destroy the affected cardiac muscle cells with RF or Laser. In this procedure it is necessary to know exactly from which part of the heart AF triggers are originated. Various signal processing algorithms provide a strong tool to track AF sources. This study proposes, signal processing techniques that can be exploited for characterization, analysis and source detection of AF signals. These algorithms are implemented on Electrocardiogram (ECG) and intracardiac signals which contain important information that allows the analysis of anatomic and physiologic aspects of the whole cardiac muscle.

  16. Direction finding antenna system for spark detection and localization

    Science.gov (United States)

    Topor, Raluca E.; Bucuci, Stefania C.; Tamas, Razvan D.; Danisor, Alin; Dumitrascu, Ana; Berescu, Serban

    2015-02-01

    This paper proposes a novel UWB antenna system for spark detection and localization by using the amplitude comparison direction finding (DF) method. The proposed design consists of two identical axially crossed "padlock" shaped UWB antennas, with unbalanced feeding. Simulation results show that such radiating systems can be used for assessing the direction of arrival for short pulses.

  17. SIDRA: a blind algorithm for signal detection in photometric surveys

    CERN Document Server

    Mislis, D; Alsubai, K A; Bramich, D M; Parley, N

    2015-01-01

    We present the Signal Detection using Random-Forest Algorithm (SIDRA). SIDRA is a detection and classification algorithm based on the Machine Learning technique (Random Forest). The goal of this paper is to show the power of SIDRA for quick and accurate signal detection and classification. We first diagnose the power of the method with simulated light curves and try it on a subset of the Kepler space mission catalogue. We use five classes of simulated light curves (CONSTANT, TRANSIT, VARIABLE, MLENS and EB for constant light curves, transiting exoplanet, variable, microlensing events and eclipsing binaries, respectively) to analyse the power of the method. The algorithm uses four features in order to classify the light curves. The training sample contains 5000 light curves (1000 from each class) and 50000 random light curves for testing. The total SIDRA success ratio is $\\geq 90\\%$. Furthermore, the success ratio reaches 95 - 100$\\%$ for the CONSTANT, VARIABLE, EB, and MLENS classes and 92$\\%$ for the TRANSIT...

  18. Auxiliary signal design in fault detection and diagnosis

    Science.gov (United States)

    Zhang, Xue Jun

    Fault-detection and diagnosis schemes for systems represented by linear MIMO stochastic models are developed analytically, with a focus on on the design and application of auxiliary signals. The basic principles of optimal-input design are reviewed, and consideration is given to the sequential probability ratio test (SPRT), auxiliary signals for improving SPRT fault detection, and the extension of the SPRT to multiple-hypothesis testing. Two chapters are devoted to the application of the SPRT to a model chemical plant (producing anhydrous caustic soda), including model derivation, model identification, detection of type I and type II faults, and the fault-diagnosis decision-making mechanism. Numerical results are presented in graphs and briefly characterized.

  19. Measuring time-varying information flow in scalp EEG signals: orthogonalized partial directed coherence.

    Science.gov (United States)

    Omidvarnia, Amir; Azemi, Ghasem; Boashash, Boualem; O'Toole, John M; Colditz, Paul B; Vanhatalo, Sampsa

    2014-03-01

    This study aimed to develop a time-frequency method for measuring directional interactions over time and frequency from scalp-recorded electroencephalographic (EEG) signals in a way that is less affected by volume conduction and amplitude scaling. We modified the time-varying generalized partial directed coherence (tv-gPDC) method, by orthogonalization of the strictly causal multivariate autoregressive model coefficients, to minimize the effect of mutual sources. The novel measure, generalized orthogonalized PDC (gOPDC), was tested first using two simulated models with feature dimensions relevant to EEG activities. We then used the method for assessing event-related directional information flow from flash-evoked responses in neonatal EEG. For testing statistical significance of the findings, we followed a thresholding procedure driven by baseline periods in the same EEG activity. The results suggest that the gOPDC method 1) is able to remove common components akin to volume conduction effect in the scalp EEG, 2) handles the potential challenge with different amplitude scaling within multichannel signals, and 3) can detect directed information flow within a subsecond time scale in nonstationary multichannel EEG datasets. This method holds promise for estimating directed interactions between scalp EEG channels that are commonly affected by the confounding impact of mutual cortical sources.

  20. Coherence specific signal detection via chiral pump-probe spectroscopy

    CERN Document Server

    Holdaway, David I H; Olaya-Castro, Alexandra

    2016-01-01

    We examine the transient circular dichroism as a technique to investigate exciton coherence signatures in structured vibrational environments. We consider multiple beam configurations, in terms of both direction and polarization, which provide independent contributions to the signal. We develop a formalism in terms of chiral doorway and windows contributions. Using this formalism we show that signals which beat during the population time can be isolated by comparing signals from configurations in which the angle between the pump and probe pulses is varied. The chiral doorway signal has only a weak ground state contribution, which can generally be neglected if a short pump pulse is used, allowing for unambiguous identification of quantum superpositions of exciton states.

  1. A novel modulation and direct detection scheme of optical phase shift keying

    Institute of Scientific and Technical Information of China (English)

    Yongcai Yang(杨永才); Wolfgang Vogel

    2004-01-01

    This paper introduces a new modulation and direct detection scheme of optical phase shift keying (PSK)which is simple and practical in fiber optical communication. A phase modulator is used to modulate a continuous wave (CW) laser source and return-to-zero (RZ) signal that is changed from the initial transmitting information is used to control a phase modulator to form a optical PSK signal. In the receiver terminal, just add a signal delayed a half of one bit to itself so that the initial information can be restored.

  2. Direct 13C NMR Detection in HPLC Hyphenation Mode

    DEFF Research Database (Denmark)

    Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils

    2012-01-01

    Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments...... application of HPLC-SPE-NMR analysis using direct-detected (13)C NMR spectra. HPLC column loading, accumulative SPE trappings, and the effect of different elution solvents were evaluated and optimized. A column loading of approximately 600 mug of a prefractionated triterpenoid mixture, six trappings...

  3. Pulsed laser noise analysis and pump-probe signal detection with a data acquisition card.

    Science.gov (United States)

    Werley, Christopher A; Teo, Stephanie M; Nelson, Keith A

    2011-12-01

    A photodiode and data acquisition card whose sampling clock is synchronized to the repetition rate of a laser are used to measure the energy of each laser pulse. Simple analysis of the data yields the noise spectrum from very low frequencies up to half the repetition rate and quantifies the pulse energy distribution. When two photodiodes for balanced detection are used in combination with an optical modulator, the technique is capable of detecting very weak pump-probe signals (ΔI/I(0) ~ 10(-5) at 1 kHz), with a sensitivity that is competitive with a lock-in amplifier. Detection with the data acquisition card is versatile and offers many advantages including full quantification of noise during each stage of signal processing, arbitrary digital filtering in silico after data collection is complete, direct readout of percent signal modulation, and easy adaptation for fast scanning of delay between pump and probe.

  4. EGF receptor signalling is essential for electric-field-directed migration of breast cancer cells.

    Science.gov (United States)

    Pu, Jin; McCaig, Colin D; Cao, Lin; Zhao, Zhiqiang; Segall, Jeffrey E; Zhao, Min

    2007-10-01

    The mechanisms by which cancer cells migrate to metastasise are not fully understood. Breast cancers are accompanied by electrical depolarisation of tumour epithelial cells. The electrical changes can be detected on the skin and are used to differentiate malignant from benign breast tumours. Could the electrical signals play a role in metastasis by promoting tumour cell migration? We report that electric fields stimulate and direct migration of human breast cancer cells. Importantly, these effects were more significant in highly metastatic tumour cells than in low metastatic tumour cells. Electric-field-enhanced directional migration correlates well with the expression level of EGF receptor (EGFR/ErbB1). To confirm this, we transfected low metastatic clone MTC cells with human ErbB1, which significantly increased the electrotactic response. Inhibition of ErbB1 completely abolished the directional response of MTLn3 cells to an electric field. Transfection of MTLn3 cells and MDA-MB-435 cells with expression vectors for ErbB family members ErbB1, ErbB2 and ErbB3 also significantly enhanced EF-induced migration. These results suggest that electric signals might play a role in metastasis of breast cancers by enhancing cell migration through the ErbB-signalling pathway.

  5. High speed all optical Nyquist signal generation and full-band coherent detection.

    Science.gov (United States)

    Zhang, Junwen; Yu, Jianjun; Fang, Yuan; Chi, Nan

    2014-08-21

    Spectrum efficient data transmission is of key interest for high capacity optical communication systems considering the limited available bandwidth. Transmission of the high speed signal with higher-order modulation formats within the Nyquist bandwidth using coherent detection brings attractive performance advantages. However, high speed Nyquist signal generation with high order modulation formats is challenging. Electrical Nyquist pulse generation is restricted by the limited sampling rate and processor capacities of digital-to-analog convertor devices, while the optical Nyquist signals can provide a much higher symbol rate using time domain multiplexing method. However, most optical Nyquist signals are based on direct detection with simple modulation formats. Here we report the first experimental demonstration of high speed all optical Nyquist signal generation based on Sinc-shaped pulse generation and time-division multiplexing with high level modulation format and full-band coherent detection. Our experiments demonstrate a highly flexible and compatible all optical high speed Nyquist signal generation and detection scheme for future fiber communication systems.

  6. Overlapping Communities Detection Based on Link Partition in Directed Networks

    Directory of Open Access Journals (Sweden)

    Qingyu Zou

    2013-09-01

    Full Text Available Many complex systems can be described as networks to comprehend both the structure and the function. Community structure is one of the most important properties of complex networks. Detecting overlapping communities in networks have been more attention in recent years, but the most of approaches to this problem have been applied to the undirected networks. This paper presents a novel approach based on link partition to detect overlapping communities structure in directed networks. In contrast to previous researches focused on grouping nodes, our algorithm defines communities as groups of directed links rather than nodes with the purpose of nodes naturally belong to more than one community. This approach can identify a suitable number of overlapping communities without any prior knowledge about the community in directed networks. We evaluate our algorithm on a simple artificial network and several real-networks. Experimental results demonstrate that the algorithm proposed is efficient for detecting overlapping communities in directed networks.  

  7. The signal detection for the levitated rotor micro gyroscope

    Energy Technology Data Exchange (ETDEWEB)

    Huang Xiaogang; Chen Wenyuan; Liu Wu; Zhang Weiping; Wu Xiaosheng [National Key Laboratory of Nano/Micro Fabrication Technology, Key Laboratory for Thin Film and Microfabrication Technology of Ministry of Education, Institute of Micro/Nano Science and Technology, Shanghai Jiao Tong University, Shanghai, 200030 (China)

    2006-04-01

    In the novel prototype of micro gyroscope structure, the new configured capacitance sensing scheme for the micro gyroscope is analyzed and the virtual instrument based detection scheme is implemented. The digital lock-in amplifier is employed in the capacitance detection to restrain the noise interference. The capacitance analysis shows that 1000aF capacitance variation corresponds to 0.1 degree of the turn angle. The differential capacitance bridge and the charge integral amplifier are used as the front signal input interface. In the implementation of digital lock-in amplifier, a new routine which warranted the exactly matching of the reference phase to signal phase was proposed. The result of the experiment shows that digital lock-in amplifier can greatly eliminate the noise in the output signal. The linearity of the turn angle output is 2.3% and the minimum resolution of turn angle is 0.04 degree. The application of the digital lock-in amplifier in the field of micro-electro-mechanical-system (MEMS) device signal detection is a new attempt, and it shows the prospective for a high-performance application.

  8. Weak signal detection using multiscale morphology in microseismic monitoring

    Science.gov (United States)

    Li, Huijian; Wang, Runqiu; Cao, Siyuan; Chen, Yangkang; Tian, Nan; Chen, Xiaoqing

    2016-10-01

    Microseismic events caused by hydraulic fracturing are usually very weak. The magnitude range of microseismic signals is usually from - 3 to 1 Mw. Processing techniques such as band-pass filtering, are widely adopted to improve the signal-to-noise (S/N) ratio of microseismic data, while with a degradation of signal quality. We propose a multi-scale morphological method to detect weak micro-seismic signals. This approach decomposes data set into multi-scale components based on the mathematical morphology theory using structuring element that is similar to the wavelet basis in the well-known wavelet decomposition. The method can help us obtain more information by detecting more waves, like P-wave, S-wave and their reflections, which can be much more valuable in processing and interpretation of microseismic data during microseismic monitoring. The proposed approach is not amplitude preserving and not mathematically reversible. It can offer enhancement of arrivals for picking (and thus can subsequently offer benefits for event detection and location) but at the expense of estimates of magnitude or moment-tensor inversion.

  9. Evidence-Based Filters for Signal Detection: Application to Evoked Brain Responses

    CERN Document Server

    Mubeen, M Asim

    2011-01-01

    Template-based signal detection most often relies on computing a correlation, or a dot product, between an incoming data stream and a signal template. Such a correlation results in an ongoing estimate of the magnitude of the signal in the data stream. However, it does not directly indicate the presence or absence of the signal. The problem is really one of model-testing, and the relevant quantity is the Bayesian evidence (marginal likelihood) of the signal model. Given a signal template and an ongoing data stream, we have developed an evidence-based filter that computes the Bayesian evidence that a signal is present in the data. We demonstrate this algorithm by applying it to brain-machine interface (BMI) data obtained by recording human brain electrical activity, or electroencephalography (EEG). A very popular and effective paradigm in EEG-based BMI is based on the detection of the P300 evoked brain response which is generated in response to particular sensory stimuli. The goal is to detect the presence of a...

  10. On the Direct Detection of Dark Matter Annihilation

    CERN Document Server

    Cherry, John F; Shoemaker, Ian M

    2015-01-01

    We investigate the direct detection phenomenology of a class of dark matter (DM) models in which DM does not directly interact with nuclei, {but rather} the products of its annihilation do. When these annihilation products are very light compared to the DM mass, the scattering in direct detection experiments is controlled by relativistic kinematics. This results in a distinctive recoil spectrum, a non-standard and or even {\\it absent} annual modulation, and the ability to probe DM masses as low as a $\\sim$10 MeV. We use current LUX data to show that experimental sensitivity to thermal relic annihilation cross sections has already been reached in a class of models. Moreover, the compatibility of dark matter direct detection experiments can be compared directly in $E_{min}$ space without making assumptions about DM astrophysics. Lastly, when DM has direct couplings to nuclei, the limit from annihilation to relativistic particles in the Sun can be stronger than that of conventional non-relativistic direct detect...

  11. Detection and processing of phase modulated optical signals at 40 Gbit/s and beyond

    DEFF Research Database (Denmark)

    Geng, Yan

    This thesis addresses demodulation in direct detection systems and signal processing of high speed phase modulated signals in future all-optical wavelength division multiplexing (WDM) communication systems where differential phase shift keying (DPSK) or differential quadrature phase shift keying...... labeling has been proposed as an efficient way to implement packet routing and forwarding functionalities in future IP-over-WDM networks. An in-band subcarrier multiplexing (SCM) labeled signal using 40 Gbit/s DSPK payload and 25 Mbit/s non return-to-zero(NRZ) SCM label, is successfully transmitted over 80...... noise, and consequently degrade the performance of systems making use of RZ-DPSK format. All-optical signal regeneration avoiding O-E-O conversion is desired to improve signal quality in ultra long-haul transmission systems. Proof-of-principle numerical simulation results are provided, that suggest...

  12. Vismodegib, an antagonist of hedgehog signaling, directly alters taste molecular signaling in taste buds.

    Science.gov (United States)

    Yang, Hyekyung; Cong, Wei-Na; Yoon, Jeong Seon; Egan, Josephine M

    2015-02-01

    Vismodegib, a highly selective inhibitor of hedgehog (Hh) pathway, is an approved treatment for basal-cell carcinoma. Patients on treatment with vismodegib often report profound alterations in taste sensation. The cellular mechanisms underlying the alterations have not been studied. Sonic Hh (Shh) signaling is required for cell growth and differentiation. In taste buds, Shh is exclusively expressed in type IV taste cells, which are undifferentiated basal cells and the precursors of the three types of taste sensing cells. Thus, we investigated if vismodegib has an inhibitory effect on taste cell turnover because of its known effects on Hh signaling. We gavaged C57BL/6J male mice daily with either vehicle or 30 mg/kg vismodegib for 15 weeks. The gustatory behavior and immunohistochemical profile of taste cells were examined. Vismodegib-treated mice showed decreased growth rate and behavioral responsivity to sweet and bitter stimuli, compared to vehicle-treated mice. We found that vismodegib-treated mice had significant reductions in taste bud size and numbers of taste cells per taste bud. Additionally, vismodegib treatment resulted in decreased numbers of Ki67- and Shh-expressing cells in taste buds. The numbers of phospholipase Cβ2- and α-gustducin-expressing cells, which contain biochemical machinery for sweet and bitter sensing, were reduced in vismodegib-treated mice. Furthermore, vismodegib treatment resulted in reduction in numbers of T1R3, glucagon-like peptide-1, and glucagon-expressing cells, which are known to modulate sweet taste sensitivity. These results suggest that inhibition of Shh signaling by vismodegib treatment directly results in alteration of taste due to local effects in taste buds.

  13. Sound Event Detection for Music Signals Using Gaussian Processes

    OpenAIRE

    Pablo A. Alvarado-Durán; Mauricio A. Álvarez-López; Álvaro A. Orozco-Gutiérrez

    2013-01-01

    In this paper we present a new methodology for detecting sound events in music signals using Gaussian Processes. Our method firstly takes a time-frequency representation, i.e. the spectrogram, of the input audio signal. Secondly the spectrogram dimension is reduced translating the linear Hertz frequency scale into the logarithmic Mel frequency scale using a triangular filter bank. Finally every short-time spectrum, i.e. every Mel spectrogram column, is classified as “Event” or “Not Event” by ...

  14. Signal Detection and Monitoring Based on Longitudinal Healthcare Data

    Directory of Open Access Journals (Sweden)

    Iris Pigeot

    2012-12-01

    Full Text Available Post-marketing detection and surveillance of potential safety hazards are crucial tasks in pharmacovigilance. To uncover such safety risks, a wide set of techniques has been developed for spontaneous reporting data and, more recently, for longitudinal data. This paper gives a broad overview of the signal detection process and introduces some types of data sources typically used. The most commonly applied signal detection algorithms are presented, covering simple frequentistic methods like the proportional reporting rate or the reporting odds ratio, more advanced Bayesian techniques for spontaneous and longitudinal data, e.g., the Bayesian Confidence Propagation Neural Network or the Multi-item Gamma-Poisson Shrinker and methods developed for longitudinal data only, like the IC temporal pattern detection. Additionally, the problem of adjustment for underlying confounding is discussed and the most common strategies to automatically identify false-positive signals are addressed. A drug monitoring technique based on Wald’s sequential probability ratio test is presented. For each method, a real-life application is given, and a wide set of literature for further reading is referenced.

  15. Development of an Ontology-Directed Signal Processing Toolbox

    Energy Technology Data Exchange (ETDEWEB)

    Stephen W. Lang

    2011-05-27

    This project was focused on the development of tools for the automatic configuration of signal processing systems. The goal is to develop tools that will be useful in a variety of Government and commercial areas and useable by people who are not signal processing experts. In order to get the most benefit from signal processing techniques, deep technical expertise is often required in order to select appropriate algorithms, combine them into a processing chain, and tune algorithm parameters for best performance on a specific problem. Therefore a significant benefit would result from the assembly of a toolbox of processing algorithms that has been selected for their effectiveness in a group of related problem areas, along with the means to allow people who are not signal processing experts to reliably select, combine, and tune these algorithms to solve specific problems. Defining a vocabulary for problem domain experts that is sufficiently expressive to drive the configuration of signal processing functions will allow the expertise of signal processing experts to be captured in rules for automated configuration. In order to test the feasibility of this approach, we addressed a lightning classification problem, which was proposed by DOE as a surrogate for problems encountered in nuclear nonproliferation data processing. We coded a toolbox of low-level signal processing algorithms for extracting features of RF waveforms, and demonstrated a prototype tool for screening data. We showed examples of using the tool for expediting the generation of ground-truth metadata, for training a signal recognizer, and for searching for signals with particular characteristics. The public benefits of this approach, if successful, will accrue to Government and commercial activities that face the same general problem - the development of sensor systems for complex environments. It will enable problem domain experts (e.g. analysts) to construct signal and image processing chains without

  16. Improving Signal to Noise in the Direct Imaging of Exoplanets and Circumstellar Disks

    CERN Document Server

    Wahhaj, Zahed; Mawet, Dimitri; Yang, Bin; Canovas, Hector; De Boer, Jos; Casassus, Simon; Menard, Francois; Schreiber, Matthias R; Liu, Michael C; Biller, Beth A; Nielsen, Eric L; Hayward, Thomas L

    2015-01-01

    We present a new algorithm designed to improve the signal to noise ratio (SNR) of point and extended source detections in direct imaging data. The novel part of our method is that it finds the linear combination of the science images that best match counterpart images with signal removed from suspected source regions. The algorithm, based on the Locally Optimized Combination of Images (LOCI) method, is called Matched LOCI or MLOCI. We show using data obtained with the Gemini Planet Imager (GPI) and Near-Infrared Coronagraphic Imager (NICI) that the new algorithm can improve the SNR of point source detections by 30-400% over past methods. We also find no increase in false detections rates. No prior knowledge of candidate companion locations is required to use MLOCI. While non-blind applications may yield linear combinations of science images which seem to increase the SNR of true sources by a factor > 2, they can also yield false detections at high rates. This is a potential pitfall when trying to confirm marg...

  17. Trade-offs and noise tolerance in signal detection by genetic circuits.

    Directory of Open Access Journals (Sweden)

    Raúl Guantes

    Full Text Available Genetic circuits can implement elaborated tasks of amplitude or frequency signal detection. What type of constraints could circuits experience in the performance of these tasks, and how are they affected by molecular noise? Here, we consider a simple detection process-a signal acting on a two-component module-to analyze these issues. We show that the presence of a feedback interaction in the detection module imposes a trade-off on amplitude and frequency detection, whose intensity depends on feedback strength. A direct interaction between the signal and the output species, in a type of feed-forward loop architecture, greatly modifies these trade-offs. Indeed, we observe that coherent feed-forward loops can act simultaneously as good frequency and amplitude noise-tolerant detectors. Alternatively, incoherent feed-forward loop structures can work as high-pass filters improving high frequency detection, and reaching noise tolerance by means of noise filtering. Analysis of experimental data from several specific coherent and incoherent feed-forward loops shows that these properties can be realized in a natural context. Overall, our results emphasize the limits imposed by circuit structure on its characteristic stimulus response, the functional plasticity of coherent feed-forward loops, and the seemingly paradoxical advantage of improving signal detection with noisy circuit components.

  18. Heartbeat detection in multimodal physiological signals using signal quality assessment based on sample entropy.

    Science.gov (United States)

    Singh, Omkar; Sunkaria, Ramesh Kumar

    2017-09-08

    This paper presents a novel technique to identify heartbeats in multimodal data using electrocardiogram (ECG) and arterial blood pressure (ABP) signals. Multiple physiological signals such as ECG, ABP, and Respiration are often recorded in parallel from the activity of heart. These signals generally possess related information as they are generated by the same physical system. The ECG and ABP correspond to the same phenomenon of contraction and relaxation activity of heart. Multiple signals acquired from various sensors are generally processed independently, thus discarding the information from other measurements. In the estimation of heart rate and heart rate variability, the R peaks are generally identified from ECG signal. Efficient detection of R-peaks in electrocardiogram (ECG) is a key component in the estimation of clinically relevant parameters from ECG. However, when the signal is severely affected by undesired artifacts, this becomes a challenging task. Sometimes in clinical environment, other physiological signals reflecting the cardiac activity such as ABP signal are also acquired simultaneously. Under the availability of such multimodal signals, the accuracy of R peak detection methods can be improved using sensor-fusion techniques. In the proposed method, the sample entropy (SampEn) is used as a metric for assessing the noise content in the physiological signal and the R peaks in ECG and the systolic peaks in ABP signals are fused together to enhance the efficiency of heartbeat detection. The proposed method was evaluated on the 100 records from the computing in cardiology challenge 2014 training data set. The performance parameters are: sensitivity (Se) and positive predictivity (PPV). The unimodal R peaks detector achieved: Se gross = 99.40%, PPV gross = 99.29%, Se average = 99.37%, PPV average = 99.29%. Similarly unimodal BP delineator achieved Se gross = 99.93%, PPV gross = 99.99%, Se average = 99.93%, PPV average = 99.99% whereas, the proposed

  19. Edge Detection Operators: Peak Signal to Noise Ratio Based Comparison

    Directory of Open Access Journals (Sweden)

    D. Poobathy

    2014-09-01

    Full Text Available Edge detection is the vital task in digital image processing. It makes the image segmentation and pattern recognition more comfort. It also helps for object detection. There are many edge detectors available for pre-processing in computer vision. But, Canny, Sobel, Laplacian of Gaussian (LoG, Robert’s and Prewitt are most applied algorithms. This paper compares each of these operators by the manner of checking Peak signal to Noise Ratio (PSNR and Mean Squared Error (MSE of resultant image. It evaluates the performance of each algorithm with Matlab and Java. The set of four universally standardized test images are used for the experimentation. The PSNR and MSE results are numeric values, based on that, performance of algorithms identified. The time required for each algorithm to detect edges is also documented. After the Experimentation, Canny operator found as the best among others in edge detection accuracy.

  20. Identifying the theory of dark matter with direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Gluscevic, Vera [School of Natural Sciences, Institute for Advanced Study,Einstein Drive, Princeton NJ 08540 (United States); Gresham, Moira I. [Whitman College,Walla Walla, WA 99362 (United States); McDermott, Samuel D. [C.N. Yang Institute for Theoretical Physics,Stony Brook, NY 11794 (United States); Peter, Annika H.G. [CCAPP and Department of Physics, The Ohio State University,191 W. Woodruff Ave., Columbus, OH 43210 (United States); Department of Astronomy, The Ohio State University,140 W. 18th Ave., Columbus, OH 43210 (United States); Zurek, Kathryn M. [Theoretical Physics Group, Lawrence Berkeley National Laboratory,Berkeley, CA 94720 (United States); Berkeley Center for Theoretical Physics, University of California,erkeley, CA 94720 (United States)

    2015-12-29

    Identifying the true theory of dark matter depends crucially on accurately characterizing interactions of dark matter (DM) with other species. In the context of DM direct detection, we present a study of the prospects for correctly identifying the low-energy effective DM-nucleus scattering operators connected to UV-complete models of DM-quark interactions. We take a census of plausible UV-complete interaction models with different low-energy leading-order DM-nuclear responses. For each model (corresponding to different spin–, momentum–, and velocity-dependent responses), we create a large number of realizations of recoil-energy spectra, and use Bayesian methods to investigate the probability that experiments will be able to select the correct scattering model within a broad set of competing scattering hypotheses. We conclude that agnostic analysis of a strong signal (such as Generation-2 would see if cross sections are just below the current limits) seen on xenon and germanium experiments is likely to correctly identify momentum dependence of the dominant response, ruling out models with either “heavy” or “light” mediators, and enabling downselection of allowed models. However, a unique determination of the correct UV completion will critically depend on the availability of measurements from a wider variety of nuclear targets, including iodine or fluorine. We investigate how model-selection prospects depend on the energy window available for the analysis. In addition, we discuss accuracy of the DM particle mass determination under a wide variety of scattering models, and investigate impact of the specific types of particle-physics uncertainties on prospects for model selection.

  1. AN EFFICIENT APPROXIMATE MAXIMUM LIKELIHOOD SIGNAL DETECTION FOR MIMO SYSTEMS

    Institute of Scientific and Technical Information of China (English)

    Cao Xuehong

    2007-01-01

    This paper proposes an efficient approximate Maximum Likelihood (ML) detection method for Multiple-Input Multiple-Output (MIMO) systems, which searches local area instead of exhaustive search and selects valid search points in each transmit antenna signal constellation instead of all hyperplane. Both of the selection and search complexity can be reduced significantly. The method performs the tradeoff between computational complexity and system performance by adjusting the neighborhood size to select the valid search points. Simulation results show that the performance is comparable to that of the ML detection while the complexity is only as the small fraction of ML.

  2. Characterization of escape times of Josephson junctions for signal detection.

    Science.gov (United States)

    Addesso, Paolo; Filatrella, Giovanni; Pierro, Vincenzo

    2012-01-01

    The measurement of the escape time of a Josephson junction might be used to detect the presence of a sinusoidal signal embedded in noise when use of standard signal processing tools can be prohibitive due to the extreme weakness of the source or to the huge amount of data. In this paper we show that the prescriptions for the experimental setup and some physical behaviors depend on the detection strategy. More specifically, by exploitation of the sample mean of escape times to perform detection, two resonant regions are identified. At low frequencies there is a stochastic resonance or activation phenomenon, while near the plasma frequency a geometric resonance appears. Furthermore, detection performance in the geometric resonance region is maximized at the prescribed value of the bias current. The naive sample mean detector is outperformed, in terms of error probability, by the optimal likelihood ratio test. The latter exhibits only geometric resonance, showing monotonically increasing performance as the bias current approaches the junction critical current. In this regime the escape times are vanishingly small and therefore performance is essentially limited by measurement electronics. The behavior of the likelihood ratio and sample mean detector for different values of incoming signal to noise ratio is discussed, and a relationship with the error probability is found. Detectors based on the likelihood ratio test could be employed also to estimate unknown parameters in the applied input signal. As a prototypical example we study the phase estimation problem of a sinusoidal current, which is accomplished by using the filter bank approach. Finally we show that for a physically feasible detector the performances are found to be very close to the Cramer-Rao theoretical bound. Applications might be found, for example, in some astronomical detection problems (where the all-sky gravitational and/or radio wave search for pulsars requires the analysis of nearly sinusoidal

  3. Sound Event Detection for Music Signals Using Gaussian Processes

    Directory of Open Access Journals (Sweden)

    Pablo A. Alvarado-Durán

    2013-11-01

    Full Text Available In this paper we present a new methodology for detecting sound events in music signals using Gaussian Processes. Our method firstly takes a time-frequency representation, i.e. the spectrogram, of the input audio signal. Secondly the spectrogram dimension is reduced translating the linear Hertz frequency scale into the logarithmic Mel frequency scale using a triangular filter bank. Finally every short-time spectrum, i.e. every Mel spectrogram column, is classified as “Event” or “Not Event” by a Gaussian Processes Classifier. We compare our method with other event detection techniques widely used. To do so, we use MATLAB® to program each technique and test them using two datasets of music with different levels of complexity. Results show that the new methodology outperforms the standard approaches, getting an improvement by about 1.66 % on the dataset one and 0.45 % on the dataset two in terms of F-measure.

  4. Cavitating vortex characterization based on acoustic signal detection

    Science.gov (United States)

    Digulescu, A.; Murgan, I.; Candel, I.; Bunea, F.; Ciocan, G.; Bucur, D. M.; Dunca, G.; Ioana, C.; Vasile, G.; Serbanescu, A.

    2016-11-01

    In hydraulic turbines operating at part loads, a cavitating vortex structure appears at runner outlet. This helical vortex, called vortex rope, can be cavitating in its core if the local pressure is lower that the vaporization pressure. An actual concern is the detection of the cavitation apparition and the characterization of its level. This paper presents a potentially innovative method for the detection of the cavitating vortex presence based on acoustic methods. The method is tested on a reduced scale facility using two acoustic transceivers positioned in ”V” configuration. The received signals were continuously recorded and their frequency content was chosen to fit the flow and the cavitating vortex. Experimental results showed that due to the increasing flow rate, the signal - vortex interaction is observed as modifications on the received signal's high order statistics and bandwidth. Also, the signal processing results were correlated with the data measured with a pressure sensor mounted in the cavitating vortex section. Finally it is shown that this non-intrusive acoustic approach can indicate the apparition, development and the damping of the cavitating vortex. For real scale facilities, applying this method is a work in progress.

  5. Directional microphone arrays: Reducing wind noise without killing your signal or filling up your disk

    Science.gov (United States)

    Zumberge, M. A.; Walker, K. T.; Dewolf, S.; Hedlin, M. A.; Shearer, P. M.; Berger, J.

    2008-12-01

    The bane of infrasound signal detection is the noise generated by the wind. While the physics of the noise is still a subject of investigation, it is clear that sampling pressure at many points over a length scale larger than the spatial coherence length of wind turbulence attenuates the noise. A dense array of microphones can exploit this approach, but this presents different challenges. Two mechanical wind filters using this approach are commonly employed by the nuclear monitoring community (rosette pipe and porous-hoses networks) and attach to a central microphone. To get large wind noise reduction and a low signal detection threshold in the frequency band of interest, these filters require large apertures. However, these wind filters with such large apertures have a poor omnidirectional instrument response for typical infrasound signals because the pressure signal propagates at the speed of sound through the pipes/hoses to the central microphone. A simple, but improved averaging approach would be to instantaneously sample a long length of the infrasound signal wavefront. Optical fiber infrasound sensors (OFIS) are an implementation of this idea. These sensors are compliant sealed tubes wrapped with two optical fibers that integrate pressure change instantaneously along the length of the tube with laser interferometery. Infrasound arrays typically consist of several microbarometers with wind filters separated by distances that provide predictable signal time separations, forming the basis for processing techniques that estimate the phase velocity direction. An analogous approach is to form an array of OFIS arms. The OFIS instrument response is a predictable function of the orientation of the arm with respect to the signal wavefront. An array of many OFIS arms with different azimuths permits at least one OFIS to record any signal without the signal attenuation inherent in equivalently-sized onmi-directional mechanical filters. OFIS arms that are wavefront

  6. Diversity among other worlds: characterization of exoplanets by direct detection

    CERN Document Server

    Schneider, J; Aylward, A; Baudoz, P; Beuzit, J L; Brown, R; Cho, J; Dohlen, K; Ferrari, M; Galicher, R; Grasset, O; Grenfell, L; Guyon, O; Hough, J; Kasper, M; Keller, Ch; Longmore, A; López, B; Martin, E; Mawet, D; Ménard, F; Merin, B; Palle, E; Perrin, G; Pinfield, D; Sein, E; Shore, P; Sotin, Ch; Sozzetti, A; Stam, D; Surdej, J; Tamburini, F; Tinetti, G; Udry, S; Verinaud, C; Walker, D

    2008-01-01

    The physical characterization of exoplanets will require to take spectra at several orbital positions. For that purpose, a direct imaging capability is necessary. Direct imaging requires an efficient stellar suppression mechanism, associated with an ultrasmooth telescope. We show that before future large space missions (interferometer, 4-8 m class coronograph, external occulter or Fresnel imager), direct imaging of giant planets and close-by super-Earth are at the cross-road of a high scientific interest and a reasonable feasibility. The scientific interest lies in the fact that super-Earths share common geophysical attributes with Earths. They already begin to be detected by radial velocity (RV) and, together with giant planets, they have a larger area than Earths, making them detectable with a 1.5-2 m class telescope in reflected light. We propose such a (space) telescope be a first step before large direct imaging missions.

  7. Snowmass CF1 Summary: WIMP Dark Matter Direct Detection

    CERN Document Server

    Cushman, P; McKinsey, D N; Robertson, H; Tate, T M P; Bauer, D; Borgland, A; Cabrera, B; Calaprice, F; Cooley, J; Empl, T; Essig, R; Figueroa-Feliciano, E; Gaitskell, R; Golwala, S; Hall, J; Hill, R; Hime, A; Hoppe, E; Hsu, L; Hungerford, E; Jacobsen, R; Kelsey, M; Lang, R F; Lippincott, W H; Loer, B; Luitz, S; Mandic, V; Mardon, J; Maricic, J; Maruyama, R; Mohapatra, R; Nelson, H; Orrell, J; Palladino, K; Pantic, E; Partridge, R; Ryd, A; Saab, T; Sadoulet, B; Schnee, R; Shepherd, W; Sonnenschein, A; Sorensen, P; Szydagis, M; Volansky, T; Witherell, M; Wright, D; Zurek, K

    2013-01-01

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  8. Working Group Report: WIMP Dark Matter Direct Detection

    Energy Technology Data Exchange (ETDEWEB)

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-10-30

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  9. Evading Direct Dark Matter Detection in Higgs Portal Models

    CERN Document Server

    Arcadi, Giorgio; Lebedev, Oleg; Pokorski, Stefan; Toma, Takashi

    2016-01-01

    Many models of Higgs portal Dark Matter (DM) find themselves under pressure from increasingly tight direct detection constraints. In the framework of gauge field DM, we study how such bounds can be relaxed while retaining the thermal WIMP paradigm. When the hidden sector gauge symmetry is broken via the Higgs mechanism, the hidden sector generally contains unstable states which are lighter than dark matter. These states provide DM with an efficient annihilation channel. As a result, the DM relic abundance and the direct detection limits are controlled by different parameters, and the two can easily be reconciled. This simple setup realizes the idea of `secluded' dark matter naturally.

  10. Prospectives on Direct Detection of the Cosmic Neutrino Background

    Science.gov (United States)

    Li, Yu-Feng

    2017-09-01

    The cosmic neutrino background (CνB) is a fundamental prediction of the hot Big Bang cosmology. Although cosmological observations provide indirect evidence for the existence of the CνB, we still lack a direct detection in a laboratory. In this work we present the current possible detection methods of the CνB. The method of CνB captures on the radioactive decaying nuclei is particularly emphasized in light of the PTOLEMY project. We stress that such direct measurements might not be hopeless in the long term.

  11. An Introduction to Dark Matter Direct Detection Searches & Techniques

    CERN Document Server

    Saab, Tarek

    2012-01-01

    Weakly Interacting Massive Particles (WIMPs), are a leading candidate for the dark matter that is observed to constitute ~25% of the total mass-energy density of the Universe. The direct detection of relic WIMPs (those produced during the early moments of the Universe's expansion) is at the forefront of active research areas in particle astrophysics with a numerous international experimental collaborations pursuing this goal. This paper presents an overview of the theoretical and practical considerations common to the design and operation of direct detection experiments, as well as their unique features and capabilities.

  12. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    Science.gov (United States)

    2015-01-01

    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  13. SIDRA: a blind algorithm for signal detection in photometric surveys

    Science.gov (United States)

    Mislis, D.; Bachelet, E.; Alsubai, K. A.; Bramich, D. M.; Parley, N.

    2016-01-01

    We present the Signal Detection using Random-Forest Algorithm (SIDRA). SIDRA is a detection and classification algorithm based on the Machine Learning technique (Random Forest). The goal of this paper is to show the power of SIDRA for quick and accurate signal detection and classification. We first diagnose the power of the method with simulated light curves and try it on a subset of the Kepler space mission catalogue. We use five classes of simulated light curves (CONSTANT, TRANSIT, VARIABLE, MLENS and EB for constant light curves, transiting exoplanet, variable, microlensing events and eclipsing binaries, respectively) to analyse the power of the method. The algorithm uses four features in order to classify the light curves. The training sample contains 5000 light curves (1000 from each class) and 50 000 random light curves for testing. The total SIDRA success ratio is ≥90 per cent. Furthermore, the success ratio reaches 95-100 per cent for the CONSTANT, VARIABLE, EB and MLENS classes and 92 per cent for the TRANSIT class with a decision probability of 60 per cent. Because the TRANSIT class is the one which fails the most, we run a simultaneous fit using SIDRA and a Box Least Square (BLS)-based algorithm for searching for transiting exoplanets. As a result, our algorithm detects 7.5 per cent more planets than a classic BLS algorithm, with better results for lower signal-to-noise light curves. SIDRA succeeds to catch 98 per cent of the planet candidates in the Kepler sample and fails for 7 per cent of the false alarms subset. SIDRA promises to be useful for developing a detection algorithm and/or classifier for large photometric surveys such as TESS and PLATO exoplanet future space missions.

  14. Fission signal detection using helium-4 gas fast neutron scintillation detectors

    Science.gov (United States)

    Lewis, J. M.; Kelley, R. P.; Murer, D.; Jordan, K. A.

    2014-07-01

    We demonstrate the unambiguous detection of the fission neutron signal produced in natural uranium during active neutron interrogation using a deuterium-deuterium fusion neutron generator and a high pressure 4He gas fast neutron scintillation detector. The energy deposition by individual neutrons is quantified, and energy discrimination is used to differentiate the induced fission neutrons from the mono-energetic interrogation neutrons. The detector can discriminate between different incident neutron energies using pulse height discrimination of the slow scintillation component of the elastic scattering interaction between a neutron and the 4He atom. Energy histograms resulting from this data show the buildup of a detected fission neutron signal at higher energies. The detector is shown here to detect a unique fission neutron signal from a natural uranium sample during active interrogation with a (d, d) neutron generator. This signal path has a direct application to the detection of shielded nuclear material in cargo and air containers. It allows for continuous interrogation and detection while greatly minimizing the potential for false alarms.

  15. Model observer design for multi-signal detection in the presence of anatomical noise

    Science.gov (United States)

    Wen, Gezheng; Markey, Mia K.; Park, Subok

    2017-02-01

    As psychophysical studies are resource-intensive to conduct, model observers are commonly used to assess and optimize medical imaging quality. Model observers are typically designed to detect at most one signal. However, in clinical practice, there may be multiple abnormalities in a single image set (e.g. multifocal multicentric (MFMC) breast cancer), which can impact treatment planning. Prevalence of signals can be different across anatomical regions, and human observers do not know the number or location of signals a priori. As new imaging techniques have the potential to improve multiple-signal detection (e.g. digital breast tomosynthesis may be more effective for diagnosis of MFMC than mammography), image quality assessment approaches addressing such tasks are needed. In this study, we present a model observer to detect multiple signals in an image dataset. A novel implementation of partial least squares (PLS) was developed to estimate different sets of efficient channels directly from the images. The PLS channels are adaptive to the characteristics of signals and the background, and they capture the interactions among signal locations. Corresponding linear decision templates are employed to generate both image-level and location-specific scores on the presence of signals. Our results show that: (1) the model observer can achieve high performance with a reasonably small number of channels; (2) the model observer with PLS channels outperforms that with benchmark modified Laguerre–Gauss channels, especially when realistic signal shapes and complex background statistics are involved; (3) the tasks of clinical interest, and other constraints such as sample size would alter the optimal design of the model observer.

  16. Current perspectives of the signaling pathways directing neural crest induction.

    Science.gov (United States)

    Stuhlmiller, Timothy J; García-Castro, Martín I

    2012-11-01

    The neural crest is a migratory population of embryonic cells with a tremendous potential to differentiate and contribute to nearly every organ system in the adult body. Over the past two decades, an incredible amount of research has given us a reasonable understanding of how these cells are generated. Neural crest induction involves the combinatorial input of multiple signaling pathways and transcription factors, and is thought to occur in two phases from gastrulation to neurulation. In the first phase, FGF and Wnt signaling induce NC progenitors at the border of the neural plate, activating the expression of members of the Msx, Pax, and Zic families, among others. In the second phase, BMP, Wnt, and Notch signaling maintain these progenitors and bring about the expression of definitive NC markers including Snail2, FoxD3, and Sox9/10. In recent years, additional signaling molecules and modulators of these pathways have been uncovered, creating an increasingly complex regulatory network. In this work, we provide a comprehensive review of the major signaling pathways that participate in neural crest induction, with a focus on recent developments and current perspectives. We provide a simplified model of early neural crest development and stress similarities and differences between four major model organisms: Xenopus, chick, zebrafish, and mouse.

  17. Optimal Noise Enhanced Signal Detection in a Unified Framework

    Directory of Open Access Journals (Sweden)

    Ting Yang

    2016-06-01

    Full Text Available In this paper, a new framework for variable detectors is formulated in order to solve different noise enhanced signal detection optimal problems, where six different disjoint sets of detector and discrete vector pairs are defined according to the two inequality-constraints on detection and false-alarm probabilities. Then theorems and algorithms constructed based on the new framework are presented to search the optimal noise enhanced solutions to maximize the relative improvements of the detection and the false-alarm probabilities, respectively. Further, the optimal noise enhanced solution of the maximum overall improvement is obtained based on the new framework and the relationship among the three maximums is presented. In addition, the sufficient conditions for improvability or non-improvability under the two certain constraints are given. Finally, numerous examples are presented to illustrate the theoretical results and the proofs of the main theorems are given in the Appendix.

  18. On the importance of loop-induced spin-independent interactions for dark matter direct detection

    CERN Document Server

    Haisch, Ulrich

    2013-01-01

    The latest results from LHC searches for jets in association with missing transverse energy place strong bounds on the scattering cross section of dark matter. For the case of spin-dependent or momentum suppressed interactions these limits seem to be superior to the bounds from direct detection experiments. In this article, we show that loop contributions can significantly alter this conclusion and boost direct detection bounds, whenever they induce spin-independent interactions. This effect is most striking for tensor and pseudotensor interactions, which induce magnetic and electric dipole moments at loop level. For axialvector and anapole interactions a relevant contribution to direct detection signals arises from loop-induced Yukawa-like couplings between dark matter and quarks. We furthermore compare the resulting bounds to additional constraints on these effective operators arising from indirect searches and relic density requirements.

  19. Halo-independent direct detection of momentum-dependent dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Cherry, John F. [Theoretical Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Frandsen, Mads T.; Shoemaker, Ian M., E-mail: jcherry@lanl.gov, E-mail: frandsen@cp3-origins.net, E-mail: shoemaker@cp3-origins.net [CP3-Origins and the Danish Institute for Advanced Study, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark)

    2014-10-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can be constrained to be ∼< 10 MeV for DM in the 20-1000 GeV range in a halo-independent manner.

  20. Cellular Cholesterol Directly Activates Smoothened in Hedgehog Signaling

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Pengxiang; Nedelcu, Daniel; Watanabe, Miyako; Jao, Cindy; Kim, Youngchang; Liu, Jing; Salic, Adrian

    2016-08-01

    In vertebrates, sterols are necessary for Hedgehog signaling, a pathway critical in embryogenesis and cancer. Sterols activate the membrane protein Smoothened by binding its extracellular, cysteine-rich domain (CRD). Major unanswered questions concern the nature of the endogenous, activating sterol and the mechanism by which it regulates Smoothened. We report crystal structures of CRD complexed with sterols and alone, revealing that sterols induce a dramatic conformational change of the binding site, which is sufficient for Smoothened activation and is unique among CRD-containing receptors. We demonstrate that Hedgehog signaling requires sterol binding to Smoothened and define key residues for sterol recognition and activity. We also show that cholesterol itself binds and activates Smoothened. Furthermore, the effect of oxysterols is abolished in Smoothened mutants that retain activation by cholesterol and Hedgehog. We propose that the endogenous Smoothened activator is cholesterol, not oxysterols, and that vertebrate Hedgehog signaling controls Smoothened by regulating its access to cholesterol.

  1. Multiple Signal Classification for Determining Direction of Arrival of Frequency Hopping Spread Spectrum Signals

    Science.gov (United States)

    2014-03-27

    Acronym Definition SNR signal to noise ratio SST signal subspace transformation SVD singular value decomposition xii MULTIPLE SIGNAL CLASSIFICATION FOR... SVD ) to elevate spectral resolution and decrease required computation time [17] . Simulation results show that MTM outperforms conventional energy...noise, how to determine the null space (noise subspace) of Rxx, how to accurately obtain the signal power spectra and prior knowledge of the source

  2. Detailed noise statistics for an optically preamplified direct detection receiver

    DEFF Research Database (Denmark)

    Danielsen, Søren Lykke; Mikkelsen, Benny; Durhuus, Terji

    1995-01-01

    We describe the exact statistics of an optically preamplified direct detection receiver by means of the moment generating function. The theory allows an arbitrary shaped electrical filter in the receiver circuit. The moment generating function (MGF) allows for a precise calculation of the error...

  3. Sol-gel matrices for direct colorimetric detection of analytes

    Science.gov (United States)

    Charych, Deborah H.; Sasaki, Darryl; Yamanaka, Stacey

    2000-01-01

    The present invention relates to methods and compositions for the direct detection of analytes using color changes that occur in immobilized biopolymeric material in response to selective binding of analytes to their surface. In particular, the present invention provides methods and compositions related to the encapsulation of biopolymeric material into metal oxide glass using the sol-gel method.

  4. Micromegas detector developments for Dark Matter directional detection with MIMAC

    CERN Document Server

    Iguaz, F J; Calvet, D; Colas, P; Druillole, F; Ferrer-Ribas, E; Giomataris, I; Mols, J P; Pancin, J; Papaevangelou, T; Billard, J; Bosson, G; Bouly, J L; Bourrion, O; Fourel, Ch; Grignon, C; Guillaudin, O; Mayet, F; Richer, J P; Santos, D; Golabek, C; Lebreton, L

    2011-01-01

    The aim of the MIMAC project is to detect non-baryonic Dark Matter with a directional TPC using a high precision Micromegas readout plane. We will describe in detail the recent developments done with bulk Micromegas detectors as well as the characterisation measurements performed in an Argon(95%)-Isobutane(5%) mixture. Track measurements with alpha particles will be shown.

  5. Micromegas detector developments for Dark Matter directional detection with MIMAC

    Energy Technology Data Exchange (ETDEWEB)

    Iguaz, F J; Attie, D; Calvet, D; Colas, P; Druillole, F; Ferrer-Ribas, E; Giomataris, I; Mols, J P; Papaevangelou, T [CEA/DSM/IRFU, CEA, 91191 Gif sur Yvette (France); Pancin, J [GANIL, Bvd H. Becquerel, Caen (France); Billard, J; Bosson, G; Bouly, J L; Bourrion, O; Fourel, Ch; Grignon, C; Guillaudin, O; Mayet, F; Richer, J P; Santos, D, E-mail: esther.ferrer.ribas@cea.fr [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble (France)

    2011-07-15

    The aim of the MIMAC project is to detect non-baryonic Dark Matter with a directional TPC using a high precision Micromegas readout plane. We will describe in detail the recent developments done with bulk Micromegas detectors as well as the characterisation measurements performed in an Argon(95%)-Isobutane(5%) mixture. Track measurements with alpha particles will be shown.

  6. Fundamental statistical limitations of future dark matter direct detection experiments

    NARCIS (Netherlands)

    Strege, C.; Trotta, F.; Bertone, G.; Peter, A.H.G.; Scott, P.

    2012-01-01

    We discuss irreducible statistical limitations of future ton-scale dark matter direct detection experiments. We focus in particular on the coverage of confidence intervals, which quantifies the reliability of the statistical method used to reconstruct the dark matter parameters and the bias of the r

  7. Direct detection of the Enceladus water torus with Herschel

    NARCIS (Netherlands)

    Hartogh, P.; Lellouch, E.; Moreno, R.; Bockelee-Morvan, D.; Biver, N.; Cassidy, T.; Rengel, M.; Jarchow, C.; Cavalie, T.; Crovisier, J.; Helmich, F. P.; Kidger, M.

    Cryovolcanic activity near the south pole of Saturn's moon Enceladus produces plumes of H2O-dominated gases and ice particles, which escape and populate a torus-shaped cloud. Using submillimeter spectroscopy with Herschel, we report the direct detection of the Enceladus water vapor torus in four

  8. Direct detection of the Enceladus water torus with Herschel

    NARCIS (Netherlands)

    Hartogh, P.; Lellouch, E.; Moreno, R.; Bockelee-Morvan, D.; Biver, N.; Cassidy, T.; Rengel, M.; Jarchow, C.; Cavalie, T.; Crovisier, J.; Helmich, F. P.; Kidger, M.

    2011-01-01

    Cryovolcanic activity near the south pole of Saturn's moon Enceladus produces plumes of H2O-dominated gases and ice particles, which escape and populate a torus-shaped cloud. Using submillimeter spectroscopy with Herschel, we report the direct detection of the Enceladus water vapor torus in four rot

  9. Coherent detection and digital signal processing for fiber optic communications

    Science.gov (United States)

    Ip, Ezra

    The drive towards higher spectral efficiency in optical fiber systems has generated renewed interest in coherent detection. We review different detection methods, including noncoherent, differentially coherent, and coherent detection, as well as hybrid detection methods. We compare the modulation methods that are enabled and their respective performances in a linear regime. An important system parameter is the number of degrees of freedom (DOF) utilized in transmission. Polarization-multiplexed quadrature-amplitude modulation maximizes spectral efficiency and power efficiency as it uses all four available DOF contained in the two field quadratures in the two polarizations. Dual-polarization homodyne or heterodyne downconversion are linear processes that can fully recover the received signal field in these four DOF. When downconverted signals are sampled at the Nyquist rate, compensation of transmission impairments can be performed using digital signal processing (DSP). Software based receivers benefit from the robustness of DSP, flexibility in design, and ease of adaptation to time-varying channels. Linear impairments, including chromatic dispersion (CD) and polarization-mode dispersion (PMD), can be compensated quasi-exactly using finite impulse response filters. In practical systems, sampling the received signal at 3/2 times the symbol rate is sufficient to enable an arbitrary amount of CD and PMD to be compensated for a sufficiently long equalizer whose tap length scales linearly with transmission distance. Depending on the transmitted constellation and the target bit error rate, the analog-to-digital converter (ADC) should have around 5 to 6 bits of resolution. Digital coherent receivers are naturally suited for the implementation of feedforward carrier recovery, which has superior linewidth tolerance than phase-locked loops, and does not suffer from feedback delay constraints. Differential bit encoding can be used to prevent catastrophic receiver failure due

  10. Asynchronous detection of SSB-SC data signals

    Science.gov (United States)

    Sommerville, T. R.; Hanson, J. V.

    Single sideband (SSB) modulation is a special case of combined amplitude and phase modulation that results in suppresion of either the upper or lower sideband of the modulated signal. A study was carried out to combine the bandwidth efficiency of single sideband suppressed carrier transmission with the simplicity of detection offered by envelope detection as proposed by Hanson (1968). In the case of an analog message waveform this has been shown to be impossible, however for a digital data signal it is required only that the envelope have correct value at the sampling instant. Given this weaker constraint a data precoding/predistortion algorithm is proposed that may be applied in order to obtain a solution. The algorithm measures the squared error between the desired and predicted received levels for a given choice of transmitter inputs and determines a correction to the inputs based on the error gradient. The adaptive processor was able to achieve eye openings of up to 60 percent for single sideband suppressed carrier data signals. The best result used a table lookup to generate the initial input estimates, used two input streams, required knowledge of all data values affected by the block under optimization and considered error in the bits preceding and following the block under adaptation.

  11. Advanced signal processing technique for damage detection in steel tubes

    Science.gov (United States)

    Amjad, Umar; Yadav, Susheel Kumar; Dao, Cac Minh; Dao, Kiet; Kundu, Tribikram

    2016-04-01

    In recent years, ultrasonic guided waves gained attention for reliable testing and characterization of metals and composites. Guided wave modes are excited and detected by PZT (Lead Zirconate Titanate) transducers either in transmission or reflection mode. In this study guided waves are excited and detected in the transmission mode and the phase change of the propagating wave modes are recorded. In most of the other studies reported in the literature, the change in the received signal strength (amplitude) is investigated with varying degrees of damage while in this study the change in phase is correlated with the extent of damage. Feature extraction techniques are used for extracting phase and time-frequency information. The main advantage of this approach is that the bonding condition between the transducer and the specimen does not affect the phase while it can affect the strength of recorded signal. Therefore, if the specimen is not damaged but the transducer-specimen bonding is deteriorated then the received signal strength is altered but the phase remains same and thus false positive predictions for damage can be avoided.

  12. Increasing signal amplitude in fiber Bragg grating detection of Lamb waves using remote bonding.

    Science.gov (United States)

    Wee, Junghyun; Wells, Brian; Hackney, Drew; Bradford, Philip; Peters, Kara

    2016-07-20

    Networks of fiber Bragg grating (FBG) sensors can serve as structural health monitoring systems for large-scale structures based on the collection of ultrasonic waves. The demodulation of structural Lamb waves using FBG sensors requires a high signal-to-noise ratio because the Lamb waves are of low amplitudes. This paper compares the signal transfer amplitudes between two adhesive mounting configurations for an FBG to detect Lamb waves propagating in an aluminum plate: a directly bonded FBG and a remotely bonded FBG. In the directly bonded FBG case, the Lamb waves create in-plane and out-of-plane displacements, which are transferred through the adhesive bond and detected by the FBG sensor. In the remotely bonded FBG case, the Lamb waves are converted into longitudinal and flexural traveling waves in the optical fiber at the adhesive bond, which propagate through the optical fiber and are detected by the FBG sensor. A theoretical prediction of overall signal attenuation also is performed, which is the combination of material attenuation in the plate and optical fiber and attenuation due to wave spreading in the plate. The experimental results demonstrate that remote bonding of the FBG significantly increases the signal amplitude measured by the FBG.

  13. Discovery potential for directional dark matter detection with nuclear emulsions

    Science.gov (United States)

    Guler, A. M.; NEWSdm Collaboration

    2017-06-01

    Direct Dark Matter searches are nowadays one of the most exciting research topics. Several Experimental efforts are concentrated on the development, construction, and operation of detectors looking for the scattering of target nuclei with Weakly Interactive Massive Particles (WIMPs). In this field a new frontier can be opened by directional detectors able to reconstruct the direction of the WIMP-recoiled nucleus thus allowing to extend dark matter searches beyond the neutrino floor. Exploiting directionality would also give a proof of the galactic origin of dark matter making it possible to have a clear and unambiguous signal to background separation. The angular distribution of WIPM-scattered nuclei is indeed expected to be peaked in the direction of the motion of the Solar System in the Galaxy, i.e. toward the Cygnus constellation, while the background distribution is expected to be isotropic. Current directional experiments are based on the use of gas TPC whose sensitivity is limited by the small achievable detector mass. In this paper we show the potentiality in terms of exclusion limit of a directional experiment based on the use of a solid target made by newly developed nuclear emulsions and read-out systems reaching sub-micrometric resolution.

  14. The Direct Detectability of Giant Exoplanets in the Optical

    CERN Document Server

    Greco, Johnny P

    2015-01-01

    (abridged) Motivated by the possibility that an optical coronagraph will be put on WFIRST/AFTA, we present an exploration of the general character of the direct detectability of extrasolar giant planets (EGPs) in the optical. We quantify a planet's direct detectability by the fraction of its orbit for which it is in an observable configuration--defined to be its observability fraction ($f_{obs}$). Using a suite of Monte Carlo experiments, we study the dependence of $f_{obs}$ upon various technological and astrophysical parameters, including the inner working angle (IWA) and minimum achievable contrast ($C_{min}$) of the direct-imaging observatory; the planet's scattering phase function, geometric albedo, single-scattering albedo, radius, and distance from Earth; and the semi-major axis distribution of EGPs. We assume cloud-free, homogeneous atmospheres and calculate phase functions for a given geometric or single-scattering albedo, assuming various scattering mechanisms. We find that the often-assumed Lambert...

  15. An Antenna for Directional Detection of WISPy Dark Matter

    CERN Document Server

    Jaeckel, Joerg

    2013-01-01

    It is an intriguing possibility that the cold dark matter of the Universe may consist of very light and very weakly interacting particles such as axion(-like particles) and hidden photons. This opens up (but also requires) new techniques for direct detection. One possibility is to use reflecting surfaces to facilitate the conversion of dark matter into photons, which can be concentrated in a detector with a suitable geometry. In this note we show that this technique also allows for directional detection and inference of the full vectorial velocity spectrum of the dark matter particles. We also note that the non-vanishing velocity of dark matter particles is relevant for the conception of (non-directional) discovery experiments and outline relevant features.

  16. Directional Detection of Dark Matter with 2D Targets

    CERN Document Server

    Hochberg, Yonit; Lisanti, Mariangela; Tully, Christopher G; Zurek, Kathryn M

    2016-01-01

    We propose two-dimensional materials as targets for direct detection of dark matter. Using graphene as an example, we focus on the case where dark matter scattering deposits sufficient energy on a valence-band electron to eject it from the target. We show that the sensitivity of graphene to dark matter of MeV to GeV mass can be comparable, for similar exposure and background levels, to that of semiconductor targets such as silicon and germanium. Moreover, a two-dimensional target is an excellent directional detector, as the ejected electron retains information about the angular dependence of the incident dark matter particle. This proposal can be implemented by the PTOLEMY experiment, presenting for the first time an opportunity for directional detection of sub-GeV dark matter.

  17. Dark matter directional detection in non-relativistic effective theories

    CERN Document Server

    Catena, Riccardo

    2015-01-01

    We extend the formalism of dark matter directional detection to arbitrary one-body dark matter-nucleon interactions. The new theoretical framework generalizes the one currently used, which is based on 2 types of dark matter-nucleon interaction only. It includes 14 dark matter-nucleon interaction operators, 8 isotope-dependent nuclear response functions, and the Radon transform of the first 2 moments of the dark matter velocity distribution. We calculate the recoil energy spectra at dark matter directional detectors made of CF$_4$, CS$_2$ and $^{3}$He for the 14 dark matter-nucleon interactions, using nuclear response functions recently obtained through numerical nuclear structure calculations. We highlight the new features of the proposed theoretical framework, and present our results for a spherical dark matter halo and for a stream of dark matter particles. This study lays the foundations for model independent analyses of dark matter directional detection experiments.

  18. Direct Detection of Dark Matter Bound to the Earth

    CERN Document Server

    Catena, Riccardo

    2016-01-01

    We study the properties and direct detection prospects of an as of yet neglected population of dark matter (DM) particles moving in orbits gravitationally bound to the Earth. This DM population is expected to form via scattering by nuclei in the Earth's interior. We compute fluxes and nuclear recoil energy spectra expected at direct detection experiments for the new DM population considering detectors with and without directional sensitivity, and different types of target materials and DM-nucleon interactions. DM particles bound to the Earth manifest as a prominent rise in the low-energy part of the observed nuclear recoil energy spectrum. Ultra-low threshold energies of about 1 eV are needed to resolve this effect. Its shape is independent of the DM-nucleus scattering cross-section normalisation.

  19. An automated approach to detecting signals in electroantennogram data

    Science.gov (United States)

    Slone, D.H.; Sullivan, B.T.

    2007-01-01

    Coupled gas chromatography/electroantennographic detection (GC-EAD) is a widely used method for identifying insect olfactory stimulants present in mixtures of volatiles, and it can greatly accelerate the identification of insect semiochemicals. In GC-EAD, voltage changes across an insect's antenna are measured while the antenna is exposed to compounds eluting from a gas chromatograph. The antenna thus serves as a selective GC detector whose output can be compared to that of a "general" GC detector, commonly a flame ionization detector. Appropriate interpretation of GC-EAD results requires that olfaction-related voltage changes in the antenna be distinguishable from background noise that arises inevitably from antennal preparations and the GC-EAD-associated hardware. In this paper, we describe and compare mathematical algorithms for discriminating olfaction-generated signals in an EAD trace from background noise. The algorithms amplify signals by recognizing their characteristic shape and wavelength while suppressing unstructured noise. We have found these algorithms to be both powerful and highly discriminatory even when applied to noisy traces where the signals would be difficult to discriminate by eye. This new methodology removes operator bias as a factor in signal identification, can improve realized sensitivity of the EAD system, and reduces the number of runs required to confirm the identity of an olfactory stimulant. ?? 2007 Springer Science+Business Media, LLC.

  20. Pinning down inelastic dark matter in the Sun and in direct detection

    CERN Document Server

    Blennow, Mattias; Herrero-Garcia, Juan

    2015-01-01

    We study the solar capture rate of inelastic dark matter with endothermic and/or exothermic interactions. By assuming that an inelastic dark matter signal will be observed in next generation direct detection experiments we can set a lower bound on the capture rate that is independent of the local dark matter density, the velocity distribution, the galactic escape velocity as well as the scattering cross section. In combination with upper limits from neutrino observatories we can place upper bounds on the annihilation channels leading to neutrinos. We find that, while endothermic scattering limits are weak in the isospin-conserving case, strong bounds may be set for exothermic interactions, in particular in the spin-dependent case. Furthermore, we study the implications of observing two direct detection signals, in which case one can halo-independently obtain the dark matter mass and the mass splitting, and disentangle the endothermic/exothermic nature of the scattering. Finally we discuss isospin violation.

  1. Active Sonar Detection in Reverberation via Signal Subspace Extraction Algorithm

    Directory of Open Access Journals (Sweden)

    Ma Xiaochuan

    2010-01-01

    Full Text Available This paper presents a new algorithm called Signal Subspace Extraction (SSE for detecting and estimating target echoes in reverberation. The new algorithm can be taken as an extension of the Principal Component Inverse (PCI and maintains the benefit of PCI algorithm and moreover shows better performance due to a more reasonable reverberation model. In the SSE approach, a best low-rank estimate of a target echo is extracted by decomposing the returns into short duration subintervals and by invoking the Eckart-Young theorem twice. It was assumed that CW is less efficiency in lower Doppler than broadband waveforms in spectrum methods; however, the subspace methods show good performance in detection whatever the respective Doppler is. Hence, the signal emitted by active sonar is CW in the new algorithm which performs well in detection and estimation even when low Doppler is low. Further, a block forward matrix is proposed to extend the algorithm to the sensor array problem. The comparison among the block forward matrix, the conventional matrix, and the three-mode array is discussed. Echo separation is also provided by the new algorithm. Examples are presented using both real, active-sonar data and simulated data.

  2. Application of clan member signal method in structural damage detection

    Institute of Scientific and Technical Information of China (English)

    Guo Xun; B.F. Spencer; Lu Shunan

    2007-01-01

    It is well known that in most cases, a reference is necessary for structural health diagnosis, and it is very difficult to obtain such a reference for a given structure. In this paper, a clan member signal method (CMSM) is proposed for use in structures consisting of groups (or clans) that have the same geometry, i.e., the same cross section and length, and identical boundary conditions. It is expected that signals measured on any undamaged member in a clan after an event could be used as a reference for any other members in the clan. To verify the applicability of the proposed method, a steel truss model is tested and the results show that the CMSM is very effective in detecting local damage in structures composed of identical slender members.

  3. Detection of low-contrast signals in low optical density. Effects of film contrast and noise on signal detection

    Energy Technology Data Exchange (ETDEWEB)

    Kondoh, Yasufumi; Hamada, Tomohiro; Mochizuki, Yuji; Yoshida, Yukito; Murakami, Yasunori [Oita Medical Univ., Hasama (Japan). Hospital; Higashida, Yoshiharu

    1998-04-01

    Observer performance tests were conducted to establish the effects of the noise and film contrast of screen-film systems on the detection of low-contrast signals. Three screen-film systems with different noise levels and film contrast were used in the experiments. The observer performance tests were carried out by the contrast-detail (C-D) diagram method and receiver operating characteristic (ROC) analysis. The results of observer performance tests with the C-D diagram method and ROC analysis indicated that the screen-film system with low noise level and high film contrast provided higher detectability than the system with low noise and low contrast. The screen-film system with high contrast showed greater improvement in detectability than the system with low contrast and low noise at low optical densities, despite the increase in noise. (author)

  4. Digital Signal Processing Based Real Time Vehicular Detection System

    Institute of Scientific and Technical Information of China (English)

    YANG Zhaoxuan; LIN Tao; LI Xiangping; LIU Chunyi; GAO Jian

    2005-01-01

    Traffic monitoring is of major importance for enforcing traffic management policies.To accomplish this task,the detection of vehicle can be achieved by exploiting image analysis techniques.In this paper,a solution is presented to obtain various traffic parameters through vehicular video detection system(VVDS).VVDS exploits the algorithm based on virtual loops to detect moving vehicle in real time.This algorithm uses the background differencing method,and vehicles can be detected through luminance difference of pixels between background image and current image.Furthermore a novel technology named as spatio-temporal image sequences analysis is applied to background differencing to improve detection accuracy.Then a hardware implementation of a digital signal processing (DSP) based board is described in detail and the board can simultaneously process four-channel video from different cameras. The benefit of usage of DSP is that images of a roadway can be processed at frame rate due to DSP′s high performance.In the end,VVDS is tested on real-world scenes and experiment results show that the system is both fast and robust to the surveillance of transportation.

  5. Theoretical and experimental investigation of direct detection optical OFDM transmission using beat interference cancellation receiver.

    Science.gov (United States)

    Nezamalhosseini, S Alireza; Chen, Lawrence R; Zhuge, Qunbi; Malekiha, Mahdi; Marvasti, Farokh; Plant, David V

    2013-07-01

    We theoretically and experimentally evaluate a beat interference cancellation receiver (BICR) for direct detection optical orthogonal frequency-division multiplexing (DD-OFDM) systems that improves the spectral efficiency (SE) by reducing the guard band between the optical carrier and the optical OFDM signal while mitigating the impact of signal-signal mixing interference (SSMI). Experimental results show that the bit-error-rate (BER) is improved by about three orders of magnitude compared to the conventional receiver after 320 km single-mode fiber (SMF) transmission for 10 Gb/s data with a 4-QAM modulation using reduced guard band single-sideband OFDM (RSSB-OFDM) signal with 1.67 bits/s/Hz SE.

  6. Simplified polarization demultiplexing based on Stokes vector analysis for intensity-modulation direct-detection systems

    Science.gov (United States)

    Zhou, Xinyu; Yan, Lianshan; Chen, Zhiyu; Yi, Anlin; Pan, Yan; Jiang, Lin; Pan, Wei; Luo, Bin

    2016-10-01

    A simple and effective polarization demultiplexing method is proposed based on the improved Stokes vector analysis and digital signal processor algorithm for the intensity-modulation direct-detection optical communication systems. Such a scheme could significantly simplify optical receivers with low system cost. The experimental results demonstrate the feasibility of our proposed method and show that only 1- and 1.7-dB power penalties are measured for 10- and 25-km transmissions compared to back-to-back case.

  7. The sensing of bacteria: emerging principles for the detection of signal sequences by formyl peptide receptors.

    Science.gov (United States)

    Bufe, Bernd; Zufall, Frank

    2016-06-01

    The ability to detect specific chemical signatures released by bacteria and other microorganisms is a fundamental feature of immune defense against pathogens. There is increasing evidence that chemodetection of such microorganism-associated molecular patterns (MAMPs) occurs at many places in the body including specific sets of chemosensory neurons in the mammalian nose. Formyl peptide receptors (FPRs) are a unique family of G protein-coupled receptors (GPCRs) that can detect the presence of bacteria and function as chemotactic receptors. Here, we highlight the recent discovery of a vast family of natural FPR agonists, the bacterial signal peptides (or signal sequences), thus providing new insight into the molecular mechanisms of bacterial sensing by human and mouse FPRs. Signal peptides in bacteria are formylated, N-terminal protein signatures required for directing the transfer of proteins through the plasma membrane. After their cleavage and release, signal peptides are available for FPR detection and thus provide a previously unrecognized MAMP. With over 170 000 predicted sequences, bacterial signal peptides represent one of the largest families of GPCR ligands and one of the most complex classes of natural activators of the innate immune system. By recognizing a conserved three-dimensional peptide motif, FPRs employ an unusual detection mechanism that combines structural promiscuity with high specificity and sensitivity, thus solving the problem of detecting thousands of distinct sequences yet maintaining selectivity. How signal peptides are released by bacteria and sensed by GPCRs and how these processes shape the responses of other cells and whole organisms represents an important topic for future research.

  8. Acoustic Aspects of Photoacoustic Signal Generation and Detection in Gases

    Science.gov (United States)

    Miklós, A.

    2015-09-01

    In this paper photoacoustic signal generation and detection in gases is investigated and discussed from the standpoint of acoustics. Four topics are considered: the effect of the absorption-desorption process of modulated and pulsed light on the heat power density released in the gas; the generation of the primary sound by the released heat in an unbounded medium; the excitation of an acoustic resonator by the primary sound; and finally, the generation of the measurable PA signal by a microphone. When light is absorbed by a molecule and the excess energy is relaxed by collisions with the surrounding molecules, the average kinetic energy, thus also the temperature of an ensemble of molecules (called "particle" in acoustics) will increase. In other words heat energy is added to the energy of the particle. The rate of the energy transfer is characterized by the heat power density. A simple two-level model of absorption-desorption is applied for describing the heat power generation process for modulated and pulsed illumination. Sound generation by a laser beam in an unbounded medium is discussed by means of the Green's function technique. It is shown that the duration of the generated sound pulse depends mostly on beam geometry. A photoacoustic signal is mostly detected in a photoacoustic cell composed of acoustic resonators, buffers, filters, etc. It is not easy to interpret the measured PA signal in such a complicated acoustic system. The acoustic response of a PA detector to different kinds of excitations (modulated cw, pulsed, periodic pulse train) is discussed. It is shown that acoustic resonators respond very differently to modulated cw excitation and to excitation by a pulse train. The microphone for detecting the PA signal is also a part of the acoustic system; its properties have to be taken into account by the design of a PA detector. The moving membrane of the microphone absorbs acoustic energy; thus, it may influence the resonance frequency and

  9. Passive in-vehicle driver breath alcohol detection using advanced sensor signal acquisition and fusion.

    Science.gov (United States)

    Ljungblad, Jonas; Hök, Bertil; Allalou, Amin; Pettersson, Håkan

    2017-04-03

    The research objective of the present investigation is to demonstrate the present status of passive in-vehicle driver breath alcohol detection and highlighting the necessary conditions for large scale implementation of such a system. Completely passive detection has remained a challenge mainly because of the requirements on signal resolution combined with the constraints of vehicle integration. The work is part of the DADSS (driver alcohol detection system for safety) program aiming at massive deployment of alcohol sensing systems which could potentially save thousands of American lives annually. The work reported here builds on earlier investigations, in which it has been shown that detection of alcohol vapor in the proximity of a human subject may be traced to that subject by means of simultaneous recording of carbon dioxide (CO2) at the same location. Sensors based on infrared spectroscopy were developed to detect and quantify low concentrations of alcohol and CO2. In the present investigation, alcohol and CO2 were recorded at various locations in a vehicle cabin while human subjects were performing normal in-step procedures and driving preparations. A video camera directed to the driver position was recording images of the driver's upper body parts including the face, and the images were analyzed with respect to features of significance to the breathing behavior and breath detection, such as mouth opening and head direction. Improvement of the sensor system with respect to signal resolution including algorithm and software development, and fusion of the sensor and camera signals was successfully implemented and tested before starting the human study. In addition, experimental tests and simulations were performed with the purpose of connecting human subject data with repeatable experimental conditions. The results include occurrence statistics of detected breaths by signal peaks of CO2 and alcohol. From the statistical data, the accuracy of breath alcohol

  10. Direct exoplanet detection and characterization using the ANDROMEDA method: Performance on VLT/NaCo data

    CERN Document Server

    Cantalloube, F; Mugnier, L M; Milli, J; Absil, O; Gonzalez, C A Gomez; Chauvin, G; Beuzit, J -L; Cornia, A

    2015-01-01

    Context. The direct detection of exoplanets with high-contrast imaging requires advanced data processing methods to disentangle potential planetary signals from bright quasi-static speckles. Among them, angular differential imaging (ADI) permits potential planetary signals with a known rotation rate to be separated from instrumental speckles that are either statics or slowly variable. The method presented in this paper, called ANDROMEDA for ANgular Differential OptiMal Exoplanet Detection Algorithm is based on a maximum likelihood approach to ADI and is used to estimate the position and the flux of any point source present in the field of view. Aims. In order to optimize and experimentally validate this previously proposed method, we applied ANDROMEDA to real VLT/NaCo data. In addition to its pure detection capability, we investigated the possibility of defining simple and efficient criteria for automatic point source extraction able to support the processing of large surveys. Methods. To assess the performan...

  11. Direct detection of expanded trinucleotide repeats using DNA hybridization techniques

    Energy Technology Data Exchange (ETDEWEB)

    Petronis, A.; Tatuch, Y.; Kennedy, J.L. [Univ. of Toronto (Canada)] [and others

    1994-09-01

    Recently, unstable trinucleotide repeats have been shown to be the etiologic factor in several neuropsychiatric diseases, and they may play a similar role in other disorders. To our knowledge, a method that detects expanded trinucleotide sequences with the opportunity for direct localization and cloning has not been achieved. We have developed a set of hybridization-based methods for direct detection of unstable DNA expansion. Our analysis of myotonic dystrophy patients that possess different degrees of (CTG){sub n} expansion, versus unaffected controls, has demonstrated the identification of the trinucleotide instability site without any prior information regarding genetic map location. High stringency modified Southern blot hybridization with a PCR-generated trinucleotide repeat probe allowed us to detect the DNA fragment containing the expansion in myotonic dystrophy patients. The same probe was used for fluorescent in situ hybridization and several regions of (CTG){sub n}/(CAG){sub n} repeats in the human genome were detected, including the myotonic dystrophy locus on chromosome 19q. These strategies can be applied to directly clone genes involved in disorders caused by unstable DNA.

  12. Searching for Dark Absorption with Direct Detection Experiments

    CERN Document Server

    Bloch, Itay M; Tobioka, Kohsaku; Volansky, Tomer; Yu, Tien-Tien

    2016-01-01

    We consider the absorption by bound electrons of dark matter in the form of dark photons and axion-like particles, as well as of dark photons from the Sun, in current and next-generation direct detection experiments. Experiments sensitive to electron recoils can detect such particles with masses between a few eV to more than 10 keV. For dark photon dark matter, we update a previous bound based on XENON10 data and derive new bounds based on data from XENON100 and CDMSlite. We find these experiments to disfavor previously allowed parameter space. Moreover, we derive sensitivity projections for SuperCDMS at SNOLAB for silicon and germanium targets, as well as for various possible experiments with scintillating targets (cesium iodide, sodium iodide, and gallium arsenide). The projected sensitivity can probe large new regions of parameter space. For axion-like particles, the same current direction detection data improves on previously known direct-detection constraints but does not bound new parameter space beyond...

  13. Direct versus indirect detection of supersymmetric dark matter

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    This document gathers the slides that were presented during the workshop 'direct versus indirect detection of supersymmetric dark matter'(about 30 contributions). This workshop intended to bring together people from the particle theory community, astrophysicists and cosmologists, as well as experimentalists involved in the detection of dark matter. The aim is to generate a discussion about current and future strategies for detection of SUSY dark matter (with focus, but not exclusively, on neutralinos). Complementarities between accelerator, direct and indirect searches as well as a comparison between the uncertainties in direct and indirect searches of dark matter, are supposed to be discussed. Among the issues which will be addressed are: -) the crucial questions related to the structure of galaxies (local dark matter density, clumping, anomalous velocity distributions, etc.) ; -) the possibilities offered by the present and future experimental facilities for direct and indirect (photon, neutrino) searches; -) the potential for the discovery of SUSY at LHC and beyond; and -) the parameterization of the SUSY breaking models beyond the minimal versions.

  14. Application of head flexion detection for enhancing eye gaze direction classification.

    Science.gov (United States)

    Al-Rahayfeh, Amer; Faezipour, Miad

    2014-01-01

    Extensive research has been conducted on the tracking and detection of the eye gaze and head movement detection as these aspects of technology can be applied as alternative approaches for various interfacing devices. This paper proposes enhancements to the classification of the eye gaze direction. Viola Jones face detector is applied to first declare the region of the eye. Circular Hough Transform is then used to detect the iris location. Support Vector Machine (SVM) is applied to classify the eye gaze direction. Accuracy of the system is enhanced by calculating the flexion angle of the head through the utilization of a microcontroller and flex sensors. In case of rotated face images, the face can be rotated back to zero degrees through the flexion angle calculation. This is while Viola Jones face detector is limited to face images with very little or no rotation angle. Accuracy is initiated by enhancing the effectiveness of the system in the overall procedure of classifying the direction of the eye gaze. Therefore, the head direction is a main determinant in enhancing the control method. Different control signals are enhanced by the eye gaze direction classification and the head direction detection.

  15. Derivation of the respiratory rate from directly and indirectly measured respiratory signals using autocorrelation

    Directory of Open Access Journals (Sweden)

    Schrumpf Fabian

    2016-09-01

    Full Text Available The estimation of respiratory rates from contineous respiratory signals is commonly done using either fourier transformation or the zero-crossing method. This paper introduces another method which is based on the autocorrelation function of the respiratory signal. The respiratory signals can be measured either directly using a flow sensor or chest strap or indirectly on the basis of the electrocardiogram (ECG. We compare our method against other established methods on the basis of real-world ECG signals and use a respiration-based breathing frequency as a reference. Our method achieved the best agreement between respiration rates derived from directly and indirectly measured respiratory signals.

  16. Modeling inter-signal arrival times for accurate detection of CAN bus signal injection attacks

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Michael Roy [ORNL; Bridges, Robert A [ORNL; Combs, Frank L [ORNL; Starr, Michael S [ORNL; Prowell, Stacy J [ORNL

    2017-01-01

    Modern vehicles rely on hundreds of on-board electronic control units (ECUs) communicating over in-vehicle networks. As external interfaces to the car control networks (such as the on-board diagnostic (OBD) port, auxiliary media ports, etc.) become common, and vehicle-to-vehicle / vehicle-to-infrastructure technology is in the near future, the attack surface for vehicles grows, exposing control networks to potentially life-critical attacks. This paper addresses the need for securing the CAN bus by detecting anomalous traffic patterns via unusual refresh rates of certain commands. While previous works have identified signal frequency as an important feature for CAN bus intrusion detection, this paper provides the first such algorithm with experiments on five attack scenarios. Our data-driven anomaly detection algorithm requires only five seconds of training time (on normal data) and achieves true positive / false discovery rates of 0.9998/0.00298, respectively (micro-averaged across the five experimental tests).

  17. Direct detection of sub-GeV dark matter with semiconductor targets

    Science.gov (United States)

    Essig, Rouven; Fernández-Serra, Marivi; Mardon, Jeremy; Soto, Adrián; Volansky, Tomer; Yu, Tien-Tien

    2016-05-01

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their {O} (1 eV) band gaps allow for ionization signals from dark matter particles as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcoming several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the reach for these upcoming experiments has the potential to be orders of magnitude beyond current direct detection constraints and that sub-GeV dark matter has a sizable modulation signal. We also give the first direct detection limits on sub-GeV dark matter from its scattering off electrons in a semiconductor target (silicon) based on published results from DAMIC. We make available publicly our code, QEdark URL"/> , with which we calculate our results. Our results can be used by experimental collaborations to calculate their own sensitivities based on their specific setup. The searches we propose will probe vast new regions of unexplored dark matter model and parameter space.

  18. How to detect a cuckoo egg : A signal-detection theory model for recognition and learning

    NARCIS (Netherlands)

    Rodriguez-Girones, MA; Lotem, A

    1999-01-01

    This article presents a model of egg rejection in cases of brood parasitism. The model is developed in three stages in the framework of signal-detection theory. We first assume that the behavior of host females is adapted to the relevant parameters concerning the appearance of the eggs they lay. In

  19. Simple hybrid wire-wireless fiber laser sensor by direct photonic generation of beat signal.

    Science.gov (United States)

    Liu, Shengchun; Gao, Liang; Yin, Zuowei; Shi, Yuechun; Zhang, Liang; Chen, Xiangfei; Cheng, Jianchun

    2011-04-20

    Based on direct photonic generation of a beat signal, a simple hybrid wire-wireless fiber laser sensor is proposed. In the sensor, an improved multilongitudinal modes fiber laser cavity is set up by only a fiber Bragg grating, a section of erbium-doped fiber, and a broadband reflector. A photodetector is used to detect the electrical beat signal. Next, the beat signal including the sensor information can access the wireless network through the wireless transmission. At last, a frequency spectrum analyzer is used to demodulate the sensing information. With this method, the long-distance real-time monitor of the fiber sensor can be realized. The proposed technique offers a simple and cheap way for sensing information of the fiber sensor to access the wireless sensor network. An experiment was implemented to measure the strain and the corresponding root mean square deviation is about -5.7 με at 916 MHz and -3.8 με at 1713 MHz after wireless transmission.

  20. Consideration of Direct Bit-Rate Measuring Method based on Extracting Envelope Signal

    Science.gov (United States)

    Otani, Akihito; Tsuda, Yukio; Igawa, Koji; Shida, Katsunori

    We previously developed an optical sampling oscilloscope (EDT-OSO) based on an envelope detection triggering method. This EDT-OSO can stably measure eye-diagram waveforms of signals exceeding 100Gbps without an external high-frequency clock signal. However far-end waveform measurements during a long distance place could not be realized. Because the EDT-OSO requires to link 10-MHz time bases in the EDT-OSO and a light under test (LUT) generator for synchrinizing. To overcom this drawbak, we developed a direct bit-rate measureing method for synchronizing both 10-MHz time bases vartually and a self-synchronized EDT-OSO (SSEDT-OSO) based on this method simulteniously. We confirmed that a bit-rate measurement repetability of the SSEDT-OSO was from 10-9 to 10-8 by evaluating a standard deviation and the SSEDT-OSO could measure an eye-diagram without linking 10-MHz time bases. This paper explains the basic principle for measuring the bit-rate of the LUT directly. Furthermore, we describe a configuration of the SSEDT-OSO and evalluation results.

  1. Time-frequency analysis and detecting method research on milling force token signal in spindle current signal

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    The vast majority of tool condition monitoring systems use the motor current instead of the cutting force as the predictor signal. The measured motor current signal is time-dependant and instable. It is difficult to detect the cutting force token signal from such motor current signal. This paper presents a method that uses the wavelet transforms to reconstruct the cutting force token signal from the current signal based on the time frequency analysis of the cutting force signal. The result of the cutting force measurement experiment shows that the proposed reconstruct method could be used to analyze the spindle current and monitor the time-varying cutting force.

  2. Directional detection of dark matter in universal bound states

    CERN Document Server

    Laha, Ranjan

    2015-01-01

    It has been suggested that several small-scale structure anomalies in $\\Lambda$CDM cosmology can be solved by strong self-interaction between dark matter particles. It was shown by Braaten and Hammer that the presence of a near threshold S-wave resonance can make the scattering cross section at nonrelativistic speeds come close to saturating the unitarity bound. This can result in the formation of a stable bound state of two asymmetric dark matter particles (which we call darkonium). Laha and Braaten studied the nuclear recoil energy spectrum in dark matter direct detection experiments due to this incident bound state. Here we study the angular recoil spectrum, and show that it is uniquely determined up to normalization by the S-wave scattering length. Observing this angular recoil spectrum in a dark matter directional detection experiment will uniquely determine many of the low-energy properties of dark matter independent of the underlying dark matter microphysics.

  3. An Automated Directed Spectral Search Methodology for Small Target Detection

    Science.gov (United States)

    Grossman, Stanley I.

    Much of the current efforts in remote sensing tackle macro-level problems such as determining the extent of wheat in a field, the general health of vegetation or the extent of mineral deposits in an area. However, for many of the remaining remote sensing challenges being studied currently, such as border protection, drug smuggling, treaty verification, and the war on terror, most targets are very small in nature - a vehicle or even a person. While in typical macro-level problems the objective vegetation is in the scene, for small target detection problems it is not usually known if the desired small target even exists in the scene, never mind finding it in abundance. The ability to find specific small targets, such as vehicles, typifies this problem. Complicating the analyst's life, the growing number of available sensors is generating mountains of imagery outstripping the analysts' ability to visually peruse them. This work presents the important factors influencing spectral exploitation using multispectral data and suggests a different approach to small target detection. The methodology of directed search is presented, including the use of scene-modeled spectral libraries, various search algorithms, and traditional statistical and ROC curve analysis. The work suggests a new metric to calibrate analysis labeled the analytic sweet spot as well as an estimation method for identifying the sweet spot threshold for an image. It also suggests a new visualization aid for highlighting the target in its entirety called nearest neighbor inflation (NNI). It brings these all together to propose that these additions to the target detection arena allow for the construction of a fully automated target detection scheme. This dissertation next details experiments to support the hypothesis that the optimum detection threshold is the analytic sweet spot and that the estimation method adequately predicts it. Experimental results and analysis are presented for the proposed directed

  4. Coherence specific signal detection via chiral pump-probe spectroscopy.

    Science.gov (United States)

    Holdaway, David I H; Collini, Elisabetta; Olaya-Castro, Alexandra

    2016-05-21

    We examine transient circular dichroism (TRCD) spectroscopy as a technique to investigate signatures of exciton coherence dynamics under the influence of structured vibrational environments. We consider a pump-probe configuration with a linearly polarized pump and a circularly polarized probe, with a variable angle θ between the two directions of propagation. In our theoretical formalism the signal is decomposed in chiral and achiral doorway and window functions. Using this formalism, we show that the chiral doorway component, which beats during the population time, can be isolated by comparing signals with different values of θ. As in the majority of time-resolved pump-probe spectroscopy, the overall TRCD response shows signatures of both excited and ground state dynamics. However, we demonstrate that the chiral doorway function has only a weak ground state contribution, which can generally be neglected if an impulsive pump pulse is used. These findings suggest that the pump-probe configuration of optical TRCD in the impulsive limit has the potential to unambiguously probe quantum coherence beating in the excited state. We present numerical results for theoretical signals in an example dimer system.

  5. Testing keV sterile neutrino dark matter in future direct detection experiments

    CERN Document Server

    Campos, Miguel D

    2016-01-01

    We determine constraints on sterile neutrino warm dark matter through direct detection experiments, taking XENON100 and its future stages as example. If keV-scale sterile neutrinos scatter inelastically with bound electrons of the target material, an electron recoil signal is generated. This can be used to set limits on the sterile neutrino mass and its mixing with the active sector. While not competitive with astrophysical constraints from X-ray data, the constraints are the first direct laboratory bounds on sterile neutrino warm dark matter, and will be in some parts of parameter space the strongest limits on keV-scale neutrinos.

  6. Using the PLUM procedure of SPSS to fit unequal variance and generalized signal detection models.

    Science.gov (United States)

    DeCarlo, Lawrence T

    2003-02-01

    The recent addition of aprocedure in SPSS for the analysis of ordinal regression models offers a simple means for researchers to fit the unequal variance normal signal detection model and other extended signal detection models. The present article shows how to implement the analysis and how to interpret the SPSS output. Examples of fitting the unequal variance normal model and other generalized signal detection models are given. The approach offers a convenient means for applying signal detection theory to a variety of research.

  7. The Detection of the Multi-source LFM Signal by Fractional Fourier Transform in Low SNR

    Institute of Scientific and Technical Information of China (English)

    WEI Yu; QIN Yuan-qing; SUN De-bao

    2004-01-01

    The Linear Frequency-Modulated signal (LFM) has been used widely in radar signals. Using the characteristics of the linear frequency-modulated signal in fractional domain, three kinds of algorithms based on fractional domain have been put forward, that is, the maximum value detection, the energy concentration detection and the signal kurtosis detection. What's more, the detection performance of each algorithm has been analyzed qualitatively.

  8. Direct gastroscopy for detecting gastric cancer in the elderly

    Institute of Scientific and Technical Information of China (English)

    张子其; 万军; 朱成; 王孟薇; 赵东海; 付永和; 张建萍; 王亚红; 吴本俨

    2002-01-01

    Objective To evaluate the safety and effectiveness of direct gastroscopy for detecting gastric cancer. Methods Clinical screening by direct gastroscopy was performed for gastric cancer (GC) from September 1985 to July 1998. 3048 elderly people were screened. Their age ranged from 60 to 93 years, and 2034 of the 3084 were followed up. Results Ninety-two patients with gastric cancer were discovered by gastroscopy, representing 3.02% of the screened population. The rate of early gastric cancer (EGC) was 63.04% (58/92) of all gastric cancers detected. The rate was up to 79.59% (39/49) on follow-up, and was 74.14% (43/51) in asymptomatic patients with gastric cancer. The excision rate was 88.89% for patients with gastric cancer, and 100% for patients with early gastric cancer. The 5-year survival rate was 91.89% for patients with gastric cancer, and 96.30% for patients with early gastric cancer. Conclusion Clinical screening and follow-up by direct gastroscopy in persons over 60 years of age are a safe and effective method for raising the 5-year survival and detection rate of gastric cancer, especially early gastric cancer.

  9. Detection of Signals from Cosmic Reionization using Radio Interferometric Signal Processing

    CERN Document Server

    Datta, A; Carilli, C L

    2009-01-01

    Observations of the HI 21cm transition line promises to be an important probe into the cosmic dark ages and epoch of reionization. One of the challenges for the detection of this signal is the accuracy of the foreground source removal. This paper investigates the extragalactic point source contamination and how accurately the bright sources ($\\gtrsim 1$ ~Jy) should be removed in order to reach the desired RMS noise and be able to detect the 21cm transition line. Here, we consider position and flux errors in the global sky-model for these bright sources as well as the frequency independent residual calibration errors. The synthesized beam is the only frequency dependent term included here. This work determines the level of accuracy for the calibration and source removal schemes and puts forward constraints for the design of the cosmic reionization data reduction scheme for the upcoming low frequency arrays like MWA,PAPER, etc. We show that in order to detect the reionization signal the bright sources need to b...

  10. Deep Direct Reinforcement Learning for Financial Signal Representation and Trading.

    Science.gov (United States)

    Deng, Yue; Bao, Feng; Kong, Youyong; Ren, Zhiquan; Dai, Qionghai

    2017-03-01

    Can we train the computer to beat experienced traders for financial assert trading? In this paper, we try to address this challenge by introducing a recurrent deep neural network (NN) for real-time financial signal representation and trading. Our model is inspired by two biological-related learning concepts of deep learning (DL) and reinforcement learning (RL). In the framework, the DL part automatically senses the dynamic market condition for informative feature learning. Then, the RL module interacts with deep representations and makes trading decisions to accumulate the ultimate rewards in an unknown environment. The learning system is implemented in a complex NN that exhibits both the deep and recurrent structures. Hence, we propose a task-aware backpropagation through time method to cope with the gradient vanishing issue in deep training. The robustness of the neural system is verified on both the stock and the commodity future markets under broad testing conditions.

  11. Sensitivity of Quantitative Signal Detection in Regards to Pharmacological Neuroenhancement

    Directory of Open Access Journals (Sweden)

    Maximilian Gahr

    2017-01-01

    Full Text Available Pharmacological neuroenhancement (PNE is a form of abuse and has not yet been addressed by methods of pharmacovigilance. In the present study, we tested if quantitative signal detection may be sensitive in regards to PNE. We evaluated the risk of drug abuse and dependence (DAAD related to substances that are known to be used for PNE and divided this group into agents with (methylphenidate and without a known abuse potential outside the field of PNE (atomoxetine, modafinil, acetylcholine esterase inhibitors, and memantine. Reporting odds ratios (RORs were calculated using a case/non-case approach based on global and country-specific drug safety data from the Uppsala Monitoring Centre (UMC. Both control substances (diazepam and lorazepam and methylphenidate were statistically associated with DAAD in all datasets (except methylphenidate in Italy. Modafinil was associated with DAAD in the total dataset (ROR, 2.7 (95% confidence interval (CI, 2.2–3.3, Germany (ROR, 4.6 (95% CI, 1.8–11.5, and the USA (ROR, 2.0 (95% CI, 1.6–2.5. Atomoxetine was associated with DAAD in the total dataset (ROR, 1.3 (95% CI, 1.2–1.5 and in the UK (ROR, 3.3 (95% CI, 1.8–6.1. Apart from memantine, which was associated with DAAD in Germany (ROR, 1.8 (95% CI, 1.0–3.2, no other antidementia drug was associated with DAAD. Quantitative signal detection is suitable to detect agents with a risk for DAAD. Its sensitivity regarding PNE is limited, although atomoxetine and modafinil, which do not have a known abuse potential outside PNE, and no antidementia drugs, whose use in PNE is presumably low, were associated with DAAD in our analysis.

  12. Sensitivity of Quantitative Signal Detection in Regards to Pharmacological Neuroenhancement

    Science.gov (United States)

    Gahr, Maximilian; Connemann, Bernhard J.; Schönfeldt-Lecuona, Carlos; Zeiss, René

    2017-01-01

    Pharmacological neuroenhancement (PNE) is a form of abuse and has not yet been addressed by methods of pharmacovigilance. In the present study, we tested if quantitative signal detection may be sensitive in regards to PNE. We evaluated the risk of drug abuse and dependence (DAAD) related to substances that are known to be used for PNE and divided this group into agents with (methylphenidate) and without a known abuse potential outside the field of PNE (atomoxetine, modafinil, acetylcholine esterase inhibitors, and memantine). Reporting odds ratios (RORs) were calculated using a case/non-case approach based on global and country-specific drug safety data from the Uppsala Monitoring Centre (UMC). Both control substances (diazepam and lorazepam) and methylphenidate were statistically associated with DAAD in all datasets (except methylphenidate in Italy). Modafinil was associated with DAAD in the total dataset (ROR, 2.7 (95% confidence interval (CI), 2.2–3.3)), Germany (ROR, 4.6 (95% CI, 1.8–11.5)), and the USA (ROR, 2.0 (95% CI, 1.6–2.5)). Atomoxetine was associated with DAAD in the total dataset (ROR, 1.3 (95% CI, 1.2–1.5)) and in the UK (ROR, 3.3 (95% CI, 1.8–6.1)). Apart from memantine, which was associated with DAAD in Germany (ROR, 1.8 (95% CI, 1.0–3.2)), no other antidementia drug was associated with DAAD. Quantitative signal detection is suitable to detect agents with a risk for DAAD. Its sensitivity regarding PNE is limited, although atomoxetine and modafinil, which do not have a known abuse potential outside PNE, and no antidementia drugs, whose use in PNE is presumably low, were associated with DAAD in our analysis. PMID:28067776

  13. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Garny, Mathias [Deutsches Elektronen-Synchrotron DESY, Notkestraße 85, 22603 Hamburg (Germany); Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan, E-mail: mathias.garny@desy.de, E-mail: ibarra@tum.de, E-mail: miguel.pato@tum.de, E-mail: stefan.vogl@tum.de [Physik-Department T30d, Technische Universität München, James-Franck-Straße, 85748 Garching (Germany)

    2012-11-01

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  14. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Garny, Mathias [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan [Technische Univ. Muenchen, Garching (Germany). Physik-Department

    2012-07-15

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  15. Three-dimensional track reconstruction for directional Dark Matter detection

    CERN Document Server

    Billard, J; Santos, D

    2012-01-01

    Directional detection of Dark Matter is a promising search strategy. However, to perform such detection, a given set of parameters has to be retrieved from the recoiling tracks : direction, sense and position in the detector volume. In order to optimize the track reconstruction and to fully exploit the data of forthcoming directional detectors, we present a likelihood method dedicated to 3D track reconstruction. This new analysis method is applied to the MIMAC detector. It requires a full simulation of track measurements in order to compare real tracks to simulated ones. We conclude that a good spatial resolution can be achieved, i.e. sub-mm in the anode plane and cm along the drift axis. This opens the possibility to perform a fiducialization of directional detectors. The angular resolution is shown to range between 20$^\\circ$ to 80$^\\circ$, depending on the recoil energy, which is however enough to achieve a high significance discovery of Dark Matter. On the contrary, we show that sense recognition capabili...

  16. Highly sensitive detection of Staphylococcus aureus directly from patient blood.

    Directory of Open Access Journals (Sweden)

    Padmapriya P Banada

    Full Text Available BACKGROUND: Rapid detection of bloodstream infections (BSIs can be lifesaving. We investigated the sample processing and assay parameters necessary for highly-sensitive detection of bloodstream bacteria, using Staphylococcus aureus as a model pathogen and an automated fluidic sample processing-polymerase chain reaction (PCR platform as a model diagnostic system. METHODOLOGY/PRINCIPAL FINDINGS: We compared a short 128 bp amplicon hemi-nested PCR and a relatively shorter 79 bp amplicon nested PCR targeting the S. aureus nuc and sodA genes, respectively. The sodA nested assay showed an enhanced limit of detection (LOD of 5 genomic copies per reaction or 10 colony forming units (CFU per ml blood over 50 copies per reaction or 50 CFU/ml for the nuc assay. To establish optimal extraction protocols, we investigated the relative abundance of the bacteria in different components of the blood (white blood cells (WBCs, plasma or whole blood, using the above assays. The blood samples were obtained from the patients who were culture positive for S. aureus. Whole blood resulted in maximum PCR positives with sodA assay (90% positive as opposed to cell-associated bacteria (in WBCs (71% samples positive or free bacterial DNA in plasma (62.5% samples positive. Both the assays were further tested for direct detection of S. aureus in patient whole blood samples that were contemporaneous culture positive. S. aureus was detected in 40/45 of culture-positive patients (sensitivity 89%, 95% CI 0.75-0.96 and 0/59 negative controls with the sodA assay (specificity 100%, 95% CI 0.92-1. CONCLUSIONS: We have demonstrated a highly sensitive two-hour assay for detection of sepsis causing bacteria like S. aureus directly in 1 ml of whole blood, without the need for blood culture.

  17. A new real-time algorithm of wavelet transform for detection of sudden-changing signals of power systems

    Institute of Scientific and Technical Information of China (English)

    何建军; 任震; 黄雯莹; 周宏; 林涛

    1999-01-01

    With a complex wavelet function, a new real-time recursive algorithm of wavelet transform (WT) is analyzed in detail. Compared with the existing recursive algorithm in two directions, the computing time is greatly redueed in response to faults signals in power systems, and the same recursive algorithm can be generalized to other wavelet functions. With the phases and magnitudes of complex WT coefficients under the fast recursive algorithm, a method to detect faults signals of power systems is presented. Lastly, the analyzing results of some signals show that it is effective and practical for the complex wavelet and its real-time recursive algorithm to detect faults of power systems.

  18. An Approach to High-Order Cumulants Used to Detect Multifrequency Signals in Telephone Networks

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    In accordance with the detecting process of multi-frequency signals between the offices in telephone networks, and in contrast with the autocorrelation method used to handle the multi-frequency signals, a fast,inexpensive and unbiased of cumulants estimation method is adopted in detecting signals. This detecting method is better for resisting noise performance and more practical than the autocorrelation method.

  19. Acoustic signal detection through the cross-correlation method in experiments with different signal to noise ratio and reverberation conditions

    CERN Document Server

    Adrián-Martínez, S; Bou-Cabo, M; Felis, I; Llorens, C; Martínez-Mora, J A; Saldaña, M

    2015-01-01

    The study and application of signal detection techniques based on cross-correlation method for acoustic transient signals in noisy and reverberant environments are presented. These techniques are shown to provide high signal to noise ratio, good signal discernment from very close echoes and accurate detection of signal arrival time. The proposed methodology has been tested on real data collected in environments and conditions where its benefits can be shown. This work focuses on the acoustic detection applied to tasks of positioning in underwater structures and calibration such those as ANTARES and KM3NeT deep-sea neutrino telescopes, as well as, in particle detection through acoustic events for the COUPP/PICO detectors. Moreover, a method for obtaining the real amplitude of the signal in time (voltage) by using cross correlation has been developed and tested and is described in this work.

  20. A center frequency adjustable narrow band filter for the detection of weak single frequency signal.

    Science.gov (United States)

    Xin, Yunhong; Xiang, ZhenMing; Dong, LeMing; Zhu, Bing; Cao, Hui; Fang, Yu

    2014-04-01

    We describe and implement a center frequency adjustable narrow band filter based on the crystal filter for the detection of weak single frequency signal. It is formed by a multiplier, a direct digital frequency synthesizer, a multi-stage crystal bandpass filter, and a micro control unit which is used to set the center frequency of the filter. A theoretical study is proposed and experimentally validated. The test results show that the 3 db and 20 db bandwidths are 0.84 Hz and 2.73 Hz, respectively, and the filter system can effectively detect the signal with amplitude below 1 μV and a frequency which ranges from 10 Hz to the frequency that is mainly limited by the components applied.

  1. Visual signal detection in structured backgrounds. I. Effect of number of possible spatial locations and signal contrast.

    Science.gov (United States)

    Eckstein, M P; Whiting, J S

    1996-09-01

    Several studies have investigated the effect of signal location uncertainty on the detectability of simple visual signals in uncorrelated Gaussian noise with a deterministic background. For this case, human performance in locating a signal in a forced-choice experiment has been successfully predicted for 2-1800 alternative locations with the use of signal detection theory and the usual assumption that the observer's internal response is Gaussian distributed. Gaussian uncorrelated noise is far from realistic medical image noise, which includes not only fluctuations in intensity of quantum origin but also other anatomical objects lying in the x-ray path (structured backgrounds). Our goal is to determine whether signal detection theory with the Gaussian assumption is adequate for the case of structured backgrounds, or whether other more complex models need to be developed to predict human performance as a function of the number of possible signal locations in structured backgrounds. We present experimental data suggesting that an assumed Gaussian internal response accurately predicts the decrease in observer performance as the number of alternative locations is increased. The one exception is a lower-than-predicted performance for the detection of low-contrast signals for two alternative locations. Performance as measured by the index of detectability d' is also found to be linear with signal contrast. Together these findings extend the applicability of signal detection theory with Gaussian internal response functions to the case of complex structured backgrounds.

  2. Signaling by bone morphogenetic proteins directs formation of an ectodermal signaling center that regulates craniofacial development.

    Science.gov (United States)

    Foppiano, Silvia; Hu, Diane; Marcucio, Ralph S

    2007-12-01

    We previously described a signaling center, the Frontonasal Ectodermal Zone (FEZ) that regulates growth and patterning of the frontonasal process (FNP). The FEZ is comprised of FNP ectoderm flanking a boundary between Sonic hedgehog (Shh) and Fibroblast growth factor 8 (Fgf8) expression domains. Our objective was to examine BMP signaling during formation of the FEZ. We blocked BMP signaling throughout the FNP prior to FEZ formation by infecting chick embryos at stage 10 (HH10) with a replication-competent avian retrovirus encoding the BMP antagonist Noggin. We assessed gene expression patterns in the FNP 72 h after infection (approximately HH22) and observed that Shh expression was reduced or absent. In the mesenchyme, we observed that Bmp2 transcripts were absent while the Bmp4 expression domain was expanded proximally. In addition to the molecular changes, infected embryos also exhibited facial malformations at 72 and 96 h after infection suggesting that the FEZ did not form. Our data indicate that reduced cell proliferation, but not apoptosis, in the mesenchyme contributed to the phenotype that we observed. Additionally, adding exogenous SHH into the mesenchyme of RCAS-Noggin-infected embryos did not restore Bmp2 and Bmp4 to a normal pattern of expression. These data indicate that BMP signaling mediates interactions between tissues in the FNP that regulate FEZ formation; and that the correct pattern of Bmp2 and Bmp4, but not Bmp7, expression in the FNP mesenchyme requires signaling by the BMP pathway.

  3. Clustering and community detection in directed networks: A survey

    Science.gov (United States)

    Malliaros, Fragkiskos D.; Vazirgiannis, Michalis

    2013-12-01

    Networks (or graphs) appear as dominant structures in diverse domains, including sociology, biology, neuroscience and computer science. In most of the aforementioned cases graphs are directed - in the sense that there is directionality on the edges, making the semantics of the edges nonsymmetric as the source node transmits some property to the target one but not vice versa. An interesting feature that real networks present is the clustering or community structure property, under which the graph topology is organized into modules commonly called communities or clusters. The essence here is that nodes of the same community are highly similar while on the contrary, nodes across communities present low similarity. Revealing the underlying community structure of directed complex networks has become a crucial and interdisciplinary topic with a plethora of relevant application domains. Therefore, naturally there is a recent wealth of research production in the area of mining directed graphs - with clustering being the primary method sought and the primary tool for community detection and evaluation. The goal of this paper is to offer an in-depth comparative review of the methods presented so far for clustering directed networks along with the relevant necessary methodological background and also related applications. The survey commences by offering a concise review of the fundamental concepts and methodological base on which graph clustering algorithms capitalize on. Then we present the relevant work along two orthogonal classifications. The first one is mostly concerned with the methodological principles of the clustering algorithms, while the second one approaches the methods from the viewpoint regarding the properties of a good cluster in a directed network. Further, we present methods and metrics for evaluating graph clustering results, demonstrate interesting application domains and provide promising future research directions.

  4. FARADAY CUP AWARD: High Sensitivity Tune Measurement using Direct Diode Detection

    CERN Document Server

    Gasior, M

    2012-01-01

    Direct Diode Detection (3D) is a technique developed at CERN initially for the LHC tune measurement system, to reach a sensitivity allowing observation of beam betatron oscillations with amplitudes below a micrometre. In this technique simple peak diode detectors are used to convert short beam pulses from a beam position pick-up into slowly varying signals. Their DC components, constituting a large background related to beam offsets, are suppressed by series capacitors, while the small signals related to beam oscillations are passed to the subsequent stages for amplification and filtering. As the demodulated beam oscillation signals are already in the kHz range, their processing is simple and they can be digitised with high resolution audio ADCs. This paper presents the history as well as the adventures of the 3D development and prototyping, along with some technical details. It documents a very efficient collaboration between CERN and Brookhaven National Laboratory (BNL), with contributions from other labora...

  5. Observer detection and discrimination performance as a function of clutter: a signal detection approach

    Science.gov (United States)

    Bora, Archana; Aggarwal, Tarun; Lakshminarayanan, Vasudevan

    2011-11-01

    In this paper we investigate the use of signal detection theory (SDT) in predicting target detection and discrimination in disorganized clutter. Two normal observers performed monocular visual search experiments at 25 cm, in the dark. They detected Gabor gratings on an achromatic background cluttered with 2000 or 500 random dots. The targets were displayed at pseudorandom locations from 0-20° and 20-47°, by method of constant stimuli. A contrast-based detection and orientation-based discrimination task was completed in a yes/no or 2-alternative-forced-choice (2AFC) task. The hit rate, false alarm rate, detectability, criterion and bias were analysed. The psychometric function indicated low detection and discrimination thresholds in low clutter that increased in high clutter. Increased clutter showed high hit rates and a false alarm rate that increased with low detectability and liberal criterion. In the detection task, low clutter showed high hit rates and low false alarm rates in the central field. Therefore, SDT proves useful to predict observer performance in visual scenes with disorganized clutter.

  6. DESIGN OF DPSK MODULATOR AND DIRECT DETECTION RECEIVER FOR DWDM BASED OPTICAL COMMUNICATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Gurjit Kaur

    2016-06-01

    Full Text Available In this paper a 16-bit differential phase shift keying (DPSK modulator is designed for 32 dense wavelength division multiplexing (DWDM channels. The DWDM channels are designed with 0.8nm separation in wavelength and operated at 4dBm input power. In the DWDM system, these 32 multiplexed signals propagate through a fiber length of 100 km followed by an erbium-doped fiber amplifier (EDFA inline. The channel is equipped with pre-amplifier and a dispersion compensating fiber for better performance. Also, a threshold detector is designed for both in-phase and quadrature components to detect the input amplitude and provide a quantized output amplitude level. The result shows that, a 16-bit DPSK optical signal is demodulated successfully using direct detection receiver.

  7. Halo-Independent Direct Detection Analyses Without Mass Assumptions

    CERN Document Server

    Anderson, Adam J; Kahn, Yonatan; McCullough, Matthew

    2015-01-01

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the $m_\\chi-\\sigma_n$ plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the $v_{min}-\\tilde{g}$ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from $v_{min}$ to nuclear recoil momentum ($p_R$), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call $\\tilde{h}(p_R)$. The entire family of conventional halo-independent $\\tilde{g}(v_{min})$ plots for all DM masses are directly found from the single $\\tilde{h}(p_R)$ plot through a simple re...

  8. Order restricted inference for oscillatory systems for detecting rhythmic signals.

    Science.gov (United States)

    Larriba, Yolanda; Rueda, Cristina; Fernández, Miguel A; Peddada, Shyamal D

    2016-12-15

    Many biological processes, such as cell cycle, circadian clock, menstrual cycles, are governed by oscillatory systems consisting of numerous components that exhibit rhythmic patterns over time. It is not always easy to identify such rhythmic components. For example, it is a challenging problem to identify circadian genes in a given tissue using time-course gene expression data. There is a great potential for misclassifying non-rhythmic as rhythmic genes and vice versa. This has been a problem of considerable interest in recent years. In this article we develop a constrained inference based methodology called Order Restricted Inference for Oscillatory Systems (ORIOS) to detect rhythmic signals. Instead of using mathematical functions (e.g. sinusoidal) to describe shape of rhythmic signals, ORIOS uses mathematical inequalities. Consequently, it is robust and not limited by the biologist's choice of the mathematical model. We studied the performance of ORIOS using simulated as well as real data obtained from mouse liver, pituitary gland and data from NIH3T3, U2OS cell lines. Our results suggest that, for a broad collection of patterns of gene expression, ORIOS has substantially higher power to detect true rhythmic genes in comparison to some popular methods, while also declaring substantially fewer non-rhythmic genes as rhythmic. A user friendly code implemented in R language can be downloaded from http://www.niehs.nih.gov/research/atniehs/labs/bb/staff/peddada/index.cfm CONTACT: peddada@niehs.nih.gov. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  9. Direct and indirect signals of natural composite Higgs models

    CERN Document Server

    Niehoff, Christoph; Straub, David M

    2015-01-01

    We present a comprehensive numerical analysis of a four-dimensional model with the Higgs as a composite pseudo-Nambu-Goldstone boson that features a calculable Higgs potential and protective custodial and flavour symmetries to reduce electroweak fine-tuning. We employ a novel numerical technique that allows us for the first time to study constraints from radiative electroweak symmetry breaking, Higgs physics, electroweak precision tests, flavour physics, and direct LHC bounds on fermion and vector boson resonances in a single framework. We consider four different flavour symmetries in the composite sector, one of which we show to not be viable anymore in view of strong precision constraints. In the other cases, all constraints can be passed with a sub-percent electroweak fine-tuning. The models can explain the excesses recently observed in $WW$, $WZ$, $Wh$ and $\\ell^+\\ell^-$ resonance searches by ATLAS and CMS and the anomalies in angular observables and branching ratios of rare semi-leptonic $B$ decays obser...

  10. DETECT: a MATLAB toolbox for event detection and identification in time series, with applications to artifact detection in EEG signals.

    Directory of Open Access Journals (Sweden)

    Vernon Lawhern

    Full Text Available Recent advances in sensor and recording technology have allowed scientists to acquire very large time-series datasets. Researchers often analyze these datasets in the context of events, which are intervals of time where the properties of the signal change relative to a baseline signal. We have developed DETECT, a MATLAB toolbox for detecting event time intervals in long, multi-channel time series. Our primary goal is to produce a toolbox that is simple for researchers to use, allowing them to quickly train a model on multiple classes of events, assess the accuracy of the model, and determine how closely the results agree with their own manual identification of events without requiring extensive programming knowledge or machine learning experience. As an illustration, we discuss application of the DETECT toolbox for detecting signal artifacts found in continuous multi-channel EEG recordings and show the functionality of the tools found in the toolbox. We also discuss the application of DETECT for identifying irregular heartbeat waveforms found in electrocardiogram (ECG data as an additional illustration.

  11. Congratulations on the direct detection of gravitational waves

    CERN Multimedia

    2016-01-01

    This week saw the announcement of an extraordinary physics result: the first direct detection of gravitational waves by the LIGO Scientific Collaboration, which includes the GEO team, and the Virgo Collaboration, using the twin Laser Interferometer Gravitational-wave Observatory (LIGO) detectors located in Livingston, Louisiana, and Hanford, Washington, USA.   Albert Einstein predicted gravitational waves in a paper published 100 years ago in 1916. They are a natural consequence of the theory of general relativity, which describes the workings of gravity and was published a few months earlier. Until now, they have remained elusive. Gravitational waves are tiny ripples in space-time produced by violent gravitational phenomena. Because the fractional change in the space-time geometry can be at the level of 10-21 or smaller, extremely sophisticated, high-sensitivity instruments are needed to detect them. Recently, the Advanced LIGO detector increased its sensitivity by alm...

  12. Theoretical Antineutrino Detection, Direction and Ranging at Long Distances

    CERN Document Server

    Jocher, G R; Dobbs, B M; Dye, S T; Learned, J A Georges III J G; Mulliss, C L; Usman, S

    2013-01-01

    In this paper we introduce the concept of what we call "NUDAR" (NeUtrino Direction and Ranging), making the point that measurements of the observed energy and direction vectors can be employed to passively deduce the exact three-dimensional location and thermal power of geophysical and anthropogenic neutrino sources from even a single detector. We present the most precise background estimates to date, all handled in full three dimensions, as functions of depth and geographical location. For the present calculations, we consider a hypothetical 138 kiloton detector which can be transported to an ocean site and deployed to an operational depth. We present a Bayesian estimation framework to incorporate any a priori knowledge of the reactor that we are trying to detect, as well as the estimated uncertainty in the background and the oscillation parameters. Most importantly, we fully employ the knowledge of the reactor spectrum and the distance-dependent effects of neutrino oscillations on such spectra. The latter, ...

  13. Direct detection experiments explained with mirror dark matter

    Science.gov (United States)

    Foot, R.

    2014-01-01

    Recently, the CDMS/Si experiment has observed a low energy excess of events in their dark matter search. In light of this new result we update the mirror dark matter explanation of the direction detection experiments. We find that the DAMA, CoGeNT, CRESST-II and CDMS/Si data can be simultaneously explained by halo ∼Fe‧ interactions provided that vrot≈200 km/s. Other parameter space is also possible. Forthcoming experiments, including CDMSlite, CDEX, COUPP, LUX, C-4, … should be able to further scrutinize mirror dark matter and closely related hidden sector models in the near future.

  14. Direct detection experiments explained with mirror dark matter

    CERN Document Server

    Foot, R

    2014-01-01

    Recently, the CDMS/Si experiment has observed a low energy excess of events in their dark matter search. In light of this new result we update the mirror dark matter explanation of the direction detection experiments. We find that the DAMA, CoGeNT, CRESST-II and CDMS/Si data can be simultaneously explained by halo $\\sim Fe'$ interactions provided that $v_{rot} \\approx 200$ km/s. Other parameter space is also possible. Forthcoming experiments, including CDMSlite, CDEX, COUPP, LUX, C-4,... should be able to further scrutinize mirror dark matter and closely related hidden sector models in the near future.

  15. Simultaneous mass detection for direct inlet mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Gordon, R.L.

    1979-05-01

    The evolution of analytical techniques for application in trace analysis has led to interest in practical methods for real-time monitoring. Direct inlet mass spectrometry (DIMS) has been the subject of considerable activity in recent years. A DIMS instrument is described which consists of an inlet system designed to permit particles entrained in the inlet air stream to strike a hot, oxidized rhenium filament which serves as a surface ionization source. A mass analyzer and detection system then permits identification of the elemental composition of particulates which strike the filament.

  16. Self-interacting Dark Matter Without Direct Detection Constraints

    OpenAIRE

    Zhang, Yue

    2016-01-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the d...

  17. Efficient Underground Object Detection for Ground Penetrating Radar Signals

    Directory of Open Access Journals (Sweden)

    Ibrahim Mesecan

    2016-12-01

    Full Text Available Ground penetrating radar (GPR is one of the common sensor system for underground inspection. GPR emits electromagnetic waves which can pass through objects. The reflecting waves are recorded and digitised, and then, the B-scan images are formed. According to the properties of scanning object, GPR creates higher or lower intensity values on the object regions. Thus, these changes in signal represent the properties of scanning object. This paper proposes a 3-step method to detect and discriminate landmines: n-row average-subtraction (NRAS; Min-max normalisation; and image scaling. Proposed method has been tested using 3 common algorithms from the literature. According to the results, it has increased object detection ratio and positive object discrimination (POD significantly. For artificial neural networks (ANN, POD has increased from 77.4 per cent to 87.7 per cent. And, it has increased from 37.8 per cent to 80.2 per cent, for support vector machines (SVM.

  18. Effects from Spatial Cues on Detectability of Alarm Signals in Car Environments

    OpenAIRE

    Kuroda, Naoki; Li, Junfeng; Iwaya, Yukio; Unoki, Masashi; Akagi, Masato

    2009-01-01

    It is crucial to correctly detect alarm signals in noise conditions, for instance, especially in car environments. However, alarm signals are possibly masked by noises from engine, friction between tires and road, etc., in car environments. To design the alarm signals that can be easily detected,it is necessary to first understand the perceptual characteristics of alarm signals in noisy environments. In this paper, the masked thresholds of alarm signals in the presence of car noise were measu...

  19. Three different signal amplification strategies for the impedimetric sandwich detection of thrombin

    Energy Technology Data Exchange (ETDEWEB)

    Ocaña, Cristina; Valle, Manel del, E-mail: manel.delvalle@uab.cat

    2016-03-17

    In this work, we report a comparative study on three highly specific amplification strategies for the ultrasensitive detection of thrombin with the use of aptamer sandwich protocol. The protocol consisted on the use of a first thrombin aptamer immobilized on the electrode surface, the recognition of thrombin protein, and the reaction with a second biotinylated thrombin aptamer forming the sandwich. Through the exposed biotin end, three variants have been tested to amplify the electrochemical impedance signal. The strategies included (a) silver enhancement treatment, (b) gold enhancement treatment and (c) insoluble product produced by the combination of the enzyme horseradish peroxidase (HRP) and 3-amino-9-ethylcarbazole (AEC). The properties of the sensing surface were probed by electrochemical impedance measurements in the presence of the ferrocyanide/ferricyanide redox marker. Insoluble product strategy and silver enhancement treatment resulted in the lowest detection limit (0.3 pM), while gold enhancement method resulted in the highest reproducibility, 8.8% RSD at the pM thrombin concentration levels. Results of silver and gold enhancement treatment also permitted direct inspection by scanning electron microscopy (SEM). - Highlights: • Aptasensor to detect thrombin reaching the femtomolar level. • Biosensing protocol employs two thrombin aptamers in a sandwich capture scheme. • Use of second biotinylated aptamer allows many amplification and detection variants. • Precipitation reaction provides the highest signal amplification of ca. 3 times. • Double recognition event improves remarkably selectivity for thrombin detection.

  20. Direct UV written Michelson interferometer for RZ signal generation using phase-to-intensity modulation conversion

    DEFF Research Database (Denmark)

    Peucheret, Christophe; Geng, Yan; Zsigri, Beata

    2005-01-01

    An integrated Michelson delay interferometer structure making use of waveguide gratings as reflective elements is proposed and fabricated by direct ultraviolet writing. Successful return-to-zero alternate-mark-inversion signal generation using phase-to-intensity modulation conversion...

  1. A new approach based on the median filter to T-wave detection in ECG signal.

    Science.gov (United States)

    Kholkhal, Mourad; Bereksi Reguig, Fethi

    2014-07-01

    The electrocardiogram (ECG) is one of the most used signals in the diagnosis of heart disease. It contains different waves which directly correlate to heart activity. Different methods have been used in order to detect these waves and consequently lead to heart activity diagnosis. This paper is interested more particularly to the detection of the T-wave. Such a wave represents the re-polarization state of the heart activity. The proposed approach is based on the algorithm procedure which allows the detection of the T-wave using a lot of filter including mean and median filter. The proposed algorithm is implemented and tested on a set of ECG recordings taken from, respectively, the European STT, MITBIH and MITBIH ST databases. The results are found to be very satisfactory in terms of sensitivity, predictivity and error compared to other works in the field.

  2. A manifold learning method to detect respiratory signal from liver ultrasound images.

    Science.gov (United States)

    Wu, Jiaze; Gogna, Apoorva; Tan, Bien Soo; Ooi, London Lucien; Tian, Qi; Liu, Feng; Liu, Jimin

    2015-03-01

    Respiratory gating has been widely applied for respiratory correction or compensation in image acquisition and image-guided interventions. A novel image-based method is proposed to extract respiratory signal directly from 2D ultrasound liver images. The proposed method utilizes a typical manifold learning method, based on local tangent space alignment based technique, to detect principal respiratory motion from a sequence of ultrasound images. This technique assumes all the images lying on a low-dimensional manifold embedding into the high-dimensional image space, constructs an approximate tangent space of each point to represent its local geometry on the manifold, and then aligns the local tangent spaces to form the global coordinate system, where the respiratory signal is extracted. The experimental results show that the proposed method can detect relatively accurate respiratory signal with high correlation coefficient (0.9775) with respect to the ground-truth signal by tracking external markers, and achieve satisfactory computing performance (2.3s for an image sequence of 256 frames). The proposed method is also used to create breathing-corrected 3D ultrasound images to demonstrate its potential application values.

  3. Vismodegib, an antagonist of hedgehog signaling, directly alters taste molecular signaling in taste buds

    OpenAIRE

    Yang, Hyekyung; Cong, Wei-Na; Yoon, Jeong Seon; Egan, Josephine M.

    2014-01-01

    Vismodegib, a highly selective inhibitor of hedgehog (Hh) pathway, is an approved treatment for basal-cell carcinoma. Patients on treatment with vismodegib often report profound alterations in taste sensation. The cellular mechanisms underlying the alterations have not been studied. Sonic Hh (Shh) signaling is required for cell growth and differentiation. In taste buds, Shh is exclusively expressed in type IV taste cells, which are undifferentiated basal cells and the precursors of the three ...

  4. Directed Design of Experiments for Validating Probability of Detection Capability of Nde Systems (doepod)

    Science.gov (United States)

    Generazio, E. R.

    2008-02-01

    The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Directed design of experiments for probability of detection (DOEPOD) has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit-Miss or signal amplitude testing. Specifically, DOEPOD demands utilization of observance of occurrences. Directed DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required.

  5. Direct detection of fourth generation Majorana neutrino dark matter

    CERN Document Server

    Zhou, Yu-Feng

    2012-01-01

    Heavy stable fourth generation Majorana neutrinos contribute to a small fraction of the relic density of dark matter (DM) in the Universe. Due to its relatively strong coupling to the standard model particles, it can be probed by the current direct and indirect DM detection experiments even it is a subdominant component of the halo DM. We show that the current Xenon100 data constrain the mass of the stable Majorana neutrino to be greater than the mass of the top quark. The effective spin-independent cross section for the neutrino elastic scattering off nucleon is predicted to be $\\sim 1.5\\times 10^{-44} cm^2$, which is insensitive to the neutrino mass and mixing and can be reached by the direct DM detection experiments in the near future. In the same mass region the predicted effective spin-dependent cross section for the heavy neutrino scattering off proton is in the range of $2\\times 10^{-40} cm^2\\sim 2\\times 10^{-39} cm^2$, which is within the reach of the ongoing DM indirect search experiments. We demonst...

  6. Physics from solar neutrinos in dark matter direct detection experiments

    CERN Document Server

    Cerdeño, David G; Jubb, Thomas; Machado, Pedro A N; Vincent, Aaron C; hm, Céline Bøe

    2016-01-01

    The next generation of dark matter direct detection experiments will be sensitive to both coherent neutrino-nucleus and neutrino-electron scattering. This will enable them to explore aspects of solar physics, perform the lowest energy measurement of the weak angle to date, and probe contributions from new theories with light mediators. In this article, we compute the projected nuclear and electron recoil rates expected in several dark matter direct detection experiments due to solar neutrinos, and use these estimates to infer errors on future measurements of the neutrino fluxes, weak mixing angle and solar observables, as well as to constrain new physics in the neutrino sector. The combined rates of solar neutrino events in second generation experiments (SuperCDMS and LZ) can yield a measurement of the pp flux to 2.5% accuracy via electron recoil, and slightly improve the boron-8 flux determination. Assuming a low-mass argon phase, projected tonne-scale experiments like DARWIN can reduce the uncertainty on bo...

  7. Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzed signal amplification.

    Science.gov (United States)

    Zhang, Lisha; Huang, Ru; Liu, Weipeng; Liu, Hongxing; Zhou, Xiaoming; Xing, Da

    2016-12-15

    Foodborne pathogens pose a significant threat to human health worldwide. The identification of foodborne pathogens needs to be rapid, accurate and convenient. Here, we constructed a nanoparticle cluster (NPC) catalyzed signal amplification biosensor for foodborne pathogens visual detection. In this work, vancomycin (Van), a glycopeptide antibiotic for Gram-positive bacteria, was used as the first molecular recognition agent to capture Listeria monocytogenes (L. monocytogenes). Fe3O4 NPC modified aptamer, was used as the signal amplification nanoprobe, specifically recognize to the cell wall of L. monocytogenes. As vancomycin and aptamer recognize L. monocytogenes at different sites, the sandwich recognition showed satisfied specificity. Compared to individual Fe3O4 nanoparticle (NP), NPC exhibit collective effect-enhanced catalytic activity for the color reaction of chromogenic substrate. The change in absorbance or color could represent the concentration of target. Using the Fe3O4 NPC-based signal amplification method, L. monocytogenes whole cells could be directly assayed within a linear range of 5.4×10(3)-10(8) cfu/mL and a visual limit of detection of 5.4×10(3) cfu/mL. Fe3O4 NPC-based method was more sensitive than the Fe3O4 NP-based method. All these attractive characteristics of highly sensitivity, visual and labor-saving, make the biosensor possess a potential application for foodborne pathogenic bacteria detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. You've found a safety signal--now what?: regulatory implications of industry signal detection activities.

    Science.gov (United States)

    Kahn, Sidney N

    2007-01-01

    Signals detected by measuring disproportionality of drug-event combinations are only statistical indicators of possible real safety issues, and are not per se necessarily medically important. Nevertheless, once a signal is observed, sponsors are obligated by regulations and ethical considerations to determine whether it represents a new product-associated risk by additional analysis, validation and evaluation of its clinical relevance. Signal strength does not necessarily correlate with medical significance. Strong signals most often represent known, expected and/or medically trivial adverse reactions or confounding by treatment indication, common co-morbidities or other common concomitant treatments. Conversely, any product with reasonably extensive clinical use and reporting of suspected adverse reactions is likely to manifest many weak but clinically unimportant signals, creating significant background 'noise'. Since relatively rare, medically important adverse drug reactions are often likely to manifest as weak signals, sponsors face a potentially onerous burden of evaluating multiple signals in order to distinguish true, clinically important events of concern from spurious signals. This paper discusses the regulatory, clinical and potential legal liability issues that confront industry as a consequence of signal identification activities, including: current and anticipated regulatory requirements for detection, assessment and reporting; the reliability of the data used for signal generation; assessment of clinical relevance; organisational approaches and responses to observed signals; targeted clinical and scientific responses to observed signals; and potential regulatory, legal and commercial impact.

  9. An image sensor capable of detecting nano-ampere transient signals with strong background illumination

    Energy Technology Data Exchange (ETDEWEB)

    Chu, D.D.; Dixon, D.A. [Sandia National Labs., Albuquerque, NM (United States); Thelen, D.C. Jr. [New Mexico Univ., Albuquerque, NM (United States). Microelectronics Research Center

    1995-10-01

    A readout detector integrated circuit (IC) has been developed which is capable of detecting nano-ampere photo-current signals of interest in a high (micro-ampere) background illumination or DC noise level (SNR=92dB). The readout detector sensor IC processes transient signals of interest from a separate photodiode array chip. Low noise signal conditioning, filtering, and signal thresholding implement smart sensor detection of only ``active pixels.`` This detector circuit can also be used to perform signal conditioning for other sensor applications that require detection of very small signals in a high background noise environment.

  10. Integration System of Head, Eye, and Retinal Position Signals for Perceptual Direction

    Science.gov (United States)

    Yamaguchi, Masashi; Kaneko, Hirohiko

    2007-11-01

    This study investigates the integration system of head (-to-trunk), eye (-to-head), and retinal position signals for hand pointing. In experiment 1, subjects changed their head and eye positions and pointed at a fixated visual stimulus by using an unseen pointer. In experiment 2, subjects fixated a visual stimulus and pointed at another visual stimulus. The results show that the head and eye position signals contributed linearly to perceptual direction (experiments 1 and 2), and that the coefficients of these signals decrease with peripheral vision and are smaller than the coefficient of the retinal position signal (experiment 2). These results collectively suggest that the integration algorithm of the position signals might be described by the linear summation equation and that the retinal position signal serves a more important role than the other position signals in the visual system.

  11. Leptophilic Dark Matter in Direct Detection Experiments and in the Sun

    Energy Technology Data Exchange (ETDEWEB)

    Kopp, Joachim; Niro, Viviana; Schwetz, Thomas; Zupan, Jure

    2010-11-01

    Dark matter interacting predominantly with leptons instead of nuclear matter has received a lot of interest recently. In this talk, we investigate the signals expected from such 'leptophilic Dark Matter' in direct detection experiments and in experiments looking for Dark Matter annihilation into neutrinos in the Sun. In a model-independent framework, we calculate the expected interaction rates for different scattering processes, including elastic and inelastic scattering off atomic electron shells, as well as loop-induced scattering off atomic nuclei. In those cases where the last effect dominates, leptophilic Dark Matter cannot be distinguished from conventional WIMPs. On the other hand, if inelastic scattering off the electron shell dominates, the expected event spectrum in direct detection experiments is different and would provide a distinct signal. However, we find that the signals in DAMA and/or CoGeNT cannot be explained by invoking leptophilic DM because the predicted and observed energy spectra do not match, and because of neutrino bounds from the Sun.

  12. A method based on stochastic resonance for the detection of weak analytical signal.

    Science.gov (United States)

    Wu, Xiaojing; Guo, Weiming; Cai, Wensheng; Shao, Xueguang; Pan, Zhongxiao

    2003-12-23

    An effective method for detection of weak analytical signals with strong noise background is proposed based on the theory of stochastic resonance (SR). Compared with the conventional SR-based algorithms, the proposed algorithm is simplified by changing only one parameter to realize the weak signal detection. Simulation studies revealed that the method performs well in detection of analytical signals in very high level of noise background and is suitable for detecting signals with the different noise level by changing the parameter. Applications of the method to experimental weak signals of X-ray diffraction and Raman spectrum are also investigated. It is found that reliable results can be obtained.

  13. Development of a novel gamma probe for detecting radiation direction

    Science.gov (United States)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  14. Detection of Human Head Direction Based on Facial Normal Algorithm

    Directory of Open Access Journals (Sweden)

    Lam Thanh Hien

    2015-01-01

    Full Text Available Many scholars worldwide have paid special efforts in searching for advance approaches to efficiently estimate human head direction which has been successfully applied in numerous applications such as human-computer interaction, teleconferencing, virtual reality, and 3D audio rendering. However, one of the existing shortcomings in the current literature is the violation of some ideal assumptions in practice. Hence, this paper aims at proposing a novel algorithm based on the normal of human face to recognize human head direction by optimizing a 3D face model combined with the facial normal model. In our experiments, a computational program was also developed based on the proposed algorithm and integrated with the surveillance system to alert the driver drowsiness. The program intakes data from either video or webcam, and then automatically identify the critical points of facial features based on the analysis of major components on the faces; and it keeps monitoring the slant angle of the head closely and makes alarming signal whenever the driver dozes off. From our empirical experiments, we found that our proposed algorithm effectively works in real-time basis and provides highly accurate results

  15. International law implications of the detection of extraterrestrial intelligent signals

    Science.gov (United States)

    Kopal, Vladimir

    This paper first considers whether the present law of outer space, as it has been enshrined in five United Nations treaties and other legal documents concerning outer space, provides a satisfactory basis for SETI/CETI activities. In the author's opinion, these activities may serve "the common interest of all mankind in the progress of the exploration and use of outer space for peaceful purposes," as recognized in the 1967 Outer Space Treaty. The use of the radio frequency spectrum for SETI/CETI purposes should be in conformity with the legal principles governing this valuable natural resource, as expressed in the International Telecommunication Convention and related documents, and with allocations of the relevant segments of the spectrum by the competent bodies of the International Telecommunication Union. In the second part the author examines the impact that the detection of extraterrestrial intelligent signals may have on the present body of space law. A possible role for the United Nations in this respect is also explored and a timely interest of the world body in discussing questions relating to this subject is recommended. Consideration of these questions could become a tool helping to concentrate the attention of the world community on problems of common concern and thus to strengthen international cooperation. However, the author believes that a law-making process that would aim at elaborating a special regulation of activities in this field would be premature at this stage. It should be initiated only when the boundary between possibilities and realities is crossed. Finally, the paper outlines some likely transformation in our space law thinking that would be the consequence of the detection of extraterrestrial intelligent signals. Elaboration of the principles and norms to govern relations between the international community of our own planet and other intelligent communities in the universe would add a new dimension to the present body of outer space

  16. The impact of signal normalization on seizure detection using line length features.

    Science.gov (United States)

    Logesparan, Lojini; Rodriguez-Villegas, Esther; Casson, Alexander J

    2015-10-01

    Accurate automated seizure detection remains a desirable but elusive target for many neural monitoring systems. While much attention has been given to the different feature extractions that can be used to highlight seizure activity in the EEG, very little formal attention has been given to the normalization that these features are routinely paired with. This normalization is essential in patient-independent algorithms to correct for broad-level differences in the EEG amplitude between people, and in patient-dependent algorithms to correct for amplitude variations over time. It is crucial, however, that the normalization used does not have a detrimental effect on the seizure detection process. This paper presents the first formal investigation into the impact of signal normalization techniques on seizure discrimination performance when using the line length feature to emphasize seizure activity. Comparing five normalization methods, based upon the mean, median, standard deviation, signal peak and signal range, we demonstrate differences in seizure detection accuracy (assessed as the area under a sensitivity-specificity ROC curve) of up to 52 %. This is despite the same analysis feature being used in all cases. Further, changes in performance of up to 22 % are present depending on whether the normalization is applied to the raw EEG itself or directly to the line length feature. Our results highlight the median decaying memory as the best current approach for providing normalization when using line length features, and they quantify the under-appreciated challenge of providing signal normalization that does not impair seizure detection algorithm performance.

  17. A signal processing method for the friction-based endpoint detection system of a CMP process

    Energy Technology Data Exchange (ETDEWEB)

    Xu Chi; Guo Dongming; Jin Zhuji; Kang Renke, E-mail: xuchi_dut@163.com [Key Laboratory for Precision and Non-Traditional Machining Technology of Ministry of Education, Dalian University of Technology, Dalian 116024 (China)

    2010-12-15

    A signal processing method for the friction-based endpoint detection system of a chemical mechanical polishing (CMP) process is presented. The signal process method uses the wavelet threshold denoising method to reduce the noise contained in the measured original signal, extracts the Kalman filter innovation from the denoised signal as the feature signal, and judges the CMP endpoint based on the feature of the Kalman filter innovation sequence during the CMP process. Applying the signal processing method, the endpoint detection experiments of the Cu CMP process were carried out. The results show that the signal processing method can judge the endpoint of the Cu CMP process. (semiconductor technology)

  18. Switching direction in electric-signal-induced cell migration by cyclic guanosine monophosphate and phosphatidylinositol signaling

    NARCIS (Netherlands)

    Sato, Masayuki J.; Kuwayama, Hidekazu; van Egmond, Wouter N.; Takayama, Airi L. K.; Takagi, Hiroaki; van Haastert, Peter J. M.; Yanagida, Toshio; Ueda, Masahiro

    2009-01-01

    Switching between attractive and repulsive migration in cell movement in response to extracellular guidance cues has been found in various cell types and is an important cellular function for translocation during cellular and developmental processes. Here we show that the preferential direction of m

  19. Direct Write Protein Patterns for Multiplexed Cytokine Detection From Live Cells Using Electron Beam Lithography

    Science.gov (United States)

    Lau, Uland Y.; Saxer, Sina S.; Lee, Juneyoung; Bat, Erhan; Maynard, Heather D.

    2016-01-01

    Simultaneous detection of multiple biomarkers, such as extracellular signaling molecules, is a critical aspect in disease profiling and diagnostics. Precise positioning of antibodies on surfaces, especially at the micro- and nano- scale, is important for the improvement of assays, biosensors, and diagnostics on the molecular level, and therefore, the pursuit of device miniaturization for parallel, fast, low-volume assays is a continuing challenge. Here, we describe a multiplexed cytokine immunoassay utilizing electron beam lithography and a trehalose glycopolymer as a resist for the direct writing of antibodies on silicon substrates allowing for micro- and nano-scale precision of protein immobilization. Specifically, anti-interleukin 6 (IL-6) and anti-tumor necrosis factor alpha (TNFα) antibodies were directly patterned. Retention of the specific binding properties of the patterned antibodies was shown by the capture of secreted cytokines from stimulated RAW 264.7 macrophages. A sandwich immunoassay was employed using gold nanoparticles and enhancement with silver for the detection and visualization of bound cytokines to the patterns by localized surface plasmon resonance detected with dark field microscopy. Multiplexing with both IL-6 and TNFα on a single chip was also successfully demonstrated with high specificity and in relevant cell culture conditions and at different times after cell stimulation. The direct fabrication of capture antibody patterns for cytokine detection described here could be useful for biosensing applications. PMID:26679368

  20. Direct Write Protein Patterns for Multiplexed Cytokine Detection from Live Cells Using Electron Beam Lithography.

    Science.gov (United States)

    Lau, Uland Y; Saxer, Sina S; Lee, Juneyoung; Bat, Erhan; Maynard, Heather D

    2016-01-26

    Simultaneous detection of multiple biomarkers, such as extracellular signaling molecules, is a critical aspect in disease profiling and diagnostics. Precise positioning of antibodies on surfaces, especially at the micro- and nanoscale, is important for the improvement of assays, biosensors, and diagnostics on the molecular level, and therefore, the pursuit of device miniaturization for parallel, fast, low-volume assays is a continuing challenge. Here, we describe a multiplexed cytokine immunoassay utilizing electron beam lithography and a trehalose glycopolymer as a resist for the direct writing of antibodies on silicon substrates, allowing for micro- and nanoscale precision of protein immobilization. Specifically, anti-interleukin 6 (IL-6) and antitumor necrosis factor alpha (TNFα) antibodies were directly patterned. Retention of the specific binding properties of the patterned antibodies was shown by the capture of secreted cytokines from stimulated RAW 264.7 macrophages. A sandwich immunoassay was employed using gold nanoparticles and enhancement with silver for the detection and visualization of bound cytokines to the patterns by localized surface plasmon resonance detected with dark-field microscopy. Multiplexing with both IL-6 and TNFα on a single chip was also successfully demonstrated with high specificity and in relevant cell culture conditions and at different times after cell stimulation. The direct fabrication of capture antibody patterns for cytokine detection described here could be useful for biosensing applications.

  1. Magnetic resonance pulmonary angiography and direct imaging of embolus for the detection of pulmonary emboli.

    Science.gov (United States)

    Moody, A R; Liddicoat, A; Krarup, K

    1997-08-01

    The authors developed a two-dimensional breathhold magnetic resonance (MR) technique for the direct imaging of pulmonary emboli. In vitro MR imaging was performed to demonstrate the potential generation of clot-blood contrast by in vivo pulmonary embolism (PE). A two-dimensional magnetization prepared gradient-echo (turbo-FLASH) breathhold technique was designed to directly image intravascular emboli by the selective nulling of the blood signal. A turbo-FLASH pulmonary angiographic breathhold sequence was used to provide spatial localization of detected emboli. Thirteen patients with suspected PE were studied; 6 patients underwent conventional pulmonary angiography (CPA) and the remaining 7 had diagnoses based on findings from other studies. In vitro study of blood clot demonstrated an initial rise and then fall in T1 sufficient to generate clot-blood contrast after eight days of clot formation. All patients with CPA or alternative study evidence of PE were diagnosed as positive with direct embolus imaging MR. There were no false-positive diagnoses. Three additional emboli were detected using the MR technique compared with CPA. The MR pulmonary angiographic sequence provided a useful road map for localization of intravascular emboli but was less sensitive for PE detection than the embolus imaging technique. The direct imaging of PE is feasible using a simple two-dimensional breathhold technique.

  2. Direct Detection of sub-GeV Dark Matter with Semiconductor Targets

    CERN Document Server

    Essig, Rouven; Mardon, Jeremy; Soto, Adrian; Volansky, Tomer; Yu, Tien-Tien

    2015-01-01

    Dark matter in the sub-GeV mass range is a theoretically motivated but largely unexplored paradigm. Such light masses are out of reach for conventional nuclear recoil direct detection experiments, but may be detected through the small ionization signals caused by dark matter-electron scattering. Semiconductors are well-studied and are particularly promising target materials because their ${\\cal O}(1~\\rm{eV})$ band gaps allow for ionization signals from dark matter as light as a few hundred keV. Current direct detection technologies are being adapted for dark matter-electron scattering. In this paper, we provide the theoretical calculations for dark matter-electron scattering rate in semiconductors, overcoming several complications that stem from the many-body nature of the problem. We use density functional theory to numerically calculate the rates for dark matter-electron scattering in silicon and germanium, and estimate the sensitivity for upcoming experiments such as DAMIC and SuperCDMS. We find that the r...

  3. Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

    Science.gov (United States)

    Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

    2016-01-25

    We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

  4. Dual Electrophoresis Detection System for Rapid and Sensitive Immunoassays with Nanoparticle Signal Amplification

    Science.gov (United States)

    Zhang, Fangfang; Ma, Junjie; Watanabe, Junji; Tang, Jinlong; Liu, Huiyu; Shen, Heyun

    2017-02-01

    An electrophoretic technique was combined with an enzyme-linked immunosorbent assay (ELISA) system to achieve a rapid and sensitive immunoassay. A cellulose acetate filter modified with polyelectrolyte multilayer (PEM) was used as a solid substrate for three-dimensional antigen-antibody reactions. A dual electrophoresis process was used to induce directional migration and local condensation of antigens and antibodies at the solid substrate, avoiding the long diffusion times associated with antigen-antibody reactions in conventional ELISAs. The electrophoretic forces drove two steps in the ELISA process, namely the adsorption of antigen, and secondary antibody-labelled polystyrene nanoparticles (NP-Ab). The total time needed for dual electrophoresis-driven detection was just 4 min, nearly 2 h faster than a conventional ELISA system. Moreover, the rapid NP-Ab electrophoresis system simultaneously achieved amplification of the specific signal and a reduction in noise, leading to a more sensitive NP-Ab immunoassay with a limit of detection (LOD) of 130 fM, and wide range of detectable concentrations from 0.13 to 130 pM. These results suggest that the combination of dual electrophoresis detection and NP-Ab signal amplification has great potential for future immunoassay systems.

  5. Detecting the Intention to Move Upper Limbs from Electroencephalographic Brain Signals

    Science.gov (United States)

    Gudiño-Mendoza, Berenice; Sanchez-Ante, Gildardo; Antelis, Javier M.

    2016-01-01

    Early decoding of motor states directly from the brain activity is essential to develop brain-machine interfaces (BMI) for natural motor control of neuroprosthetic devices. Hence, this study aimed to investigate the detection of movement information before the actual movement occurs. This information piece could be useful to provide early control signals to drive BMI-based rehabilitation and motor assisted devices, thus providing a natural and active rehabilitation therapy. In this work, electroencephalographic (EEG) brain signals from six healthy right-handed participants were recorded during self-initiated reaching movements of the upper limbs. The analysis of these EEG traces showed that significant event-related desynchronization is present before and during the execution of the movements, predominantly in the motor-related α and β frequency bands and in electrodes placed above the motor cortex. This oscillatory brain activity was used to continuously detect the intention to move the limbs, that is, to identify the motor phase prior to the actual execution of the reaching movement. The results showed, first, significant classification between relax and movement intention and, second, significant detection of movement intention prior to the onset of the executed movement. On the basis of these results, detection of movement intention could be used in BMI settings to reduce the gap between mental motor processes and the actual movement performed by an assisted or rehabilitation robotic device. PMID:27217826

  6. Measuring Social Motivation Using Signal Detection and Reward Responsiveness

    Science.gov (United States)

    Chevallier, Coralie; Tonge, Natasha; Safra, Lou; Kahn, David; Kohls, Gregor; Miller, Judith; Schultz, Robert T.

    2016-01-01

    Background Recent trends in psychiatry have emphasized the need for a shift from categorical to dimensional approaches. Of critical importance to this transformation is the availability of tools to objectively quantify behaviors dimensionally. The present study focuses on social motivation, a dimension of behavior that is central to a range of psychiatric conditions but for which a particularly small number of assays currently exist. Methods In Study 1 (N = 48), healthy adults completed a monetary reward task and a social reward task, followed by completion of the Chapman Physical and Social Anhedonia Scales. In Study 2 (N = 26), an independent sample was recruited to assess the robustness of Study 1’s findings. Results The reward tasks were analyzed using signal detection theory to quantify how much reward cues bias participants’ responses. In both Study 1 and Study 2, social anhedonia scores were negatively correlated with change in response bias in the social reward task but not in the monetary reward task. A median split on social anhedonia scores confirmed that participants with high social anhedonia showed less change in response bias in the social reward task compared to participants with low social anhedonia. Conclusions This study confirms that social anhedonia selectively affects how much an individual changes their behavior based on the presence of socially rewarding cues and establishes a tool to quantify social reward responsiveness dimensionally. PMID:27907025

  7. Analysis of short circuit transfer behavior using acoustic signal detection

    Directory of Open Access Journals (Sweden)

    Eakkachai Warinsiriruk

    2013-06-01

    Full Text Available The stability of a short circuiting period is important to obtain the desired weld quality. The objective of this research is to analyze the uniformity of liquid bridge disruption period during short circuit mode affected by various shielding gas compositions. The shielding gas compositions of 100% CO2 and 84%Ar+2%O2+14%CO2 were used in this study. Short circuiting period was detected by using acoustic signals emitting from the arc. Acoustic data were recorded by using multimedia function of XP windows audio card through a high sensitivity microphone. The results of short circuit acoustic data were analyzed by using continuous wavelet transformation for classifying the difference of acoustic emitting mechanism of electrode tip touching with base metal and pinching cut-off. For 84%Ar+2%O2+14%CO2 shielding gas, it clearly showed smoothershort circuit transfer than that of CO2 shielding gas. CO2 shielding gas gave large variation in disruption period comparing with that of 84%Ar+2%O2+14%CO2 gas mixture.

  8. Direct detection of dark matter in models with a light Z'

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Sarkar, Subir

    2011-01-01

    We discuss the direct detection signatures of dark matter interacting with nuclei via a Z' mediator, focussing on the case where both the dark matter and the $Z'$ have mass of a few GeV. Isospin violation (i.e. different couplings to protons and neutrons) arises naturally in this scenario....... In particular it is possible to reconcile the preferred parameter regions inferred from the observed DAMA and CoGeNT modulations with the bounds from XENON100, which requires f_n/f_p = -0.7. Moreover, the Z' mediator can also yield a large spin-dependent cross-section which could contribute to the DAMA signal...

  9. Nuclear recoil energy scale in liquid xenon with application to the direct detection of dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Sorensen, P; Dahl, C E

    2011-02-14

    We show for the first time that the quenching of electronic excitation from nuclear recoils in liquid xenon is well-described by Lindhard theory, if the nuclear recoil energy is reconstructed using the combined (scintillation and ionization) energy scale proposed by Shutt et al.. We argue for the adoption of this perspective in favor of the existing preference for reconstructing nuclear recoil energy solely from primary scintillation. We show that signal partitioning into scintillation and ionization is well-described by the Thomas-Imel box model. We discuss the implications for liquid xenon detectors aimed at the direct detection of dark matter.

  10. Flipped-Exponential Nyquist Pulse Technique to Optimize PAPR in Optical Direct-Detection OFDM Systems

    Institute of Scientific and Technical Information of China (English)

    Jiangnan Xiao; Zizheng Cao; Fan Li; Jin Tang; Lin Chen

    2012-01-01

    In this paper, we describe a novel technique based on the flipped-exponential (FE) Nyquist pulse method for reducing peak-to-average power ratio (PAPR) in an optical direct-detection orthogonal frequency-division multiplexing (DD-QFDM) system, The technique involves proper selection of the FE Nyquist pulses for shaping the different subcarriers of the OFDM. We apply this technique to a DD-OFDM transmission system to significantly reduce PAPR. We also investigate the sensitivity of a received OFDM signal with strong nonlinearity in a standard single-mode fiber (SMF).

  11. Improving signal-to-noise in the direct imaging of exoplanets and circumstellar disks with MLOCI

    Science.gov (United States)

    Wahhaj, Zahed; Cieza, Lucas A.; Mawet, Dimitri; Yang, Bin; Canovas, Hector; de Boer, Jozua; Casassus, Simon; Ménard, François; Schreiber, Matthias R.; Liu, Michael C.; Biller, Beth A.; Nielsen, Eric L.; Hayward, Thomas L.

    2015-09-01

    We present a new algorithm designed to improve the signal-to-noise ratio (S/N) of point and extended source detections around bright stars in direct imaging data.One of our innovations is that we insert simulated point sources into the science images, which we then try to recover with maximum S/N. This improves the S/N of real point sources elsewhere in the field. The algorithm, based on the locally optimized combination of images (LOCI) method, is called Matched LOCI or MLOCI. We show with Gemini Planet Imager (GPI) data on HD 135344 B and Near-Infrared Coronagraphic Imager (NICI) data on several stars that the new algorithm can improve the S/N of point source detections by 30-400% over past methods. We also find no increase in false detections rates. No prior knowledge of candidate companion locations is required to use MLOCI. On the other hand, while non-blind applications may yield linear combinations of science images that seem to increase the S/N of true sources by a factor >2, they can also yield false detections at high rates. This is a potential pitfall when trying to confirm marginal detections or to redetect point sources found in previous epochs. These findings are relevant to any method where the coefficients of the linear combination are considered tunable, e.g., LOCI and principal component analysis (PCA). Thus we recommend that false detection rates be analyzed when using these techniques. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (USA), the Science and Technology Facilities Council (UK), the National Research Council (Canada), CONICYT (Chile), the Australian Research Council (Australia), Ministério da Ciência e Tecnologia (Brazil) and Ministerio de Ciencia, Tecnología e Innovación Productiva (Argentina).

  12. Direct Detection of Stealth Dark Matter through Electromagnetic Polarizability

    CERN Document Server

    Appelquist, Thomas; Brower, Richard C; Buchoff, Michael I; Fleming, George T; Jin, Xiao-Yong; Kiskis, Joe; Kribs, Graham D; Neil, Ethan T; Osborn, James C; Rebbi, Claudio; Rinaldi, Enrico; Schaich, David; Schroeder, Chris; Syritsyn, Sergey; Vranas, Pavlos; Weinberg, Evan; Witzel, Oliver

    2015-01-01

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar baryon dark matter candidate -- "Stealth Dark Matter", that is based on a dark SU(4) confining gauge theory. In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest baryons in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to...

  13. Assessing Astrophysical Uncertainties in Direct Detection with Galaxy Simulations

    CERN Document Server

    Sloane, Jonathan D; Brooks, Alyson M; Governato, Fabio

    2016-01-01

    We study the local dark matter velocity distribution in four simulated Milky Way-mass galaxies, generated at high resolution with both dark matter and baryons. We find that the dark matter in the Solar neighborhood is influenced appreciably by the inclusion of baryons, increasing the speed of dark matter particles compared to dark matter-only simulations. The baryonic effects responsible for the transfer of energy to the dark matter component increase the amount of high velocity dark matter, resulting in velocity distributions which are more similar to the Maxwellian Standard Halo Model than predicted from dark matter-only simulations. Further, the velocity structures present in baryonic simulations possess a greater diversity than expected from dark matter-only simulation. We show the impact on the direct detection experiments LUX, DAMA/Libra, and CoGent using our simulated velocity distributions. Our results indicate that the Standard Halo Model overpredicts the amount of dark matter in the high velocity ta...

  14. Self-interacting Dark Matter Without Direct Detection Constraints

    CERN Document Server

    Zhang, Yue

    2016-01-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the dark matter self-interaction strength. We derive the new parameter space of a pseudo-Dirac self-interacting dark matter. Interestingly, with increasing mass splitting, a weak scale dark matter mass window survives that could be probed by the LHC and future colliders.

  15. Light Magnetic Dark Matter in Direct Detection Searches

    DEFF Research Database (Denmark)

    Del Nobile, Eugenio; Kouvaris, Christoforos; Panci, Paolo

    2012-01-01

    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out...... by the CDMS, XENON and PICASSO experiments. We offer an analytic understanding of how the long-range interaction modifies the experimental allowed regions, in the cross section versus Dark Matter mass parameter space, with respect to the typically assumed contact interaction. Finally, in the context...... of a symmetric Dark Matter sector, we determine the associated thermal relic density, and further provide relevant constraints imposed by indirect searches and colliders....

  16. Self-interacting dark matter without direct detection constraints

    Science.gov (United States)

    Zhang, Yue

    2017-03-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the dark matter self-interaction strength. We derive the new parameter space of a pseudo-Dirac self-interacting dark matter. Interestingly, with increasing mass splitting, a weak scale dark matter mass window survives that could be probed by the LHC and future colliders.

  17. New Completeness Methods for Estimating Exoplanet Discoveries by Direct Detection

    CERN Document Server

    Brown, Robert A

    2010-01-01

    We report new methods for evaluating realistic observing programs that search stars for planets by direct imaging, where observations are selected from an optimized star list, and where stars can be observed multiple times. We show how these methods bring critical insight into the design of the mission & its instruments. These methods provide an estimate of the outcome of the observing program: the probability distribution of discoveries (detection and/or characterization), & an estimate of the occurrence rate of planets (eta). We show that these parameters can be accurately estimated from a single mission simulation, without the need for a complete Monte Carlo mission simulation, & we prove the accuracy of this new approach. Our methods provide the tools to define a mission for a particular science goal, for example defined by the expected number of discoveries and its confidence level. We detail how an optimized star list can be built & how successive observations can be selected. Our approa...

  18. The Earth's velocity for direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    McCabe, Christopher, E-mail: christopher.mccabe@durham.ac.uk [Institute for Particle Physics Phenomenology, Durham University, South Road, Durham, DH1 3LE (United Kingdom)

    2014-02-01

    The Earth's velocity relative to the Sun in galactic coordinates is required in the rate calculation for direct detection experiments. We provide a rigorous derivation of this quantity to first order in the eccentricity of the Earth's orbit. We also discuss the effect of the precession of the equinoxes, which has hitherto received little explicit discussion. Comparing with other expressions in the literature, we confirm that the expression of Lee, Lisanti and Safdi is correct, while the expression of Lewin and Smith, the de facto standard expression, contains an error. For calculations of the absolute event rate, the leading order expression is sufficient while for modulation searches, an expression with the eccentricity is required for accurate predictions of the modulation phase.

  19. Directivity of hearing of auditory danger signal emitted by overhead crane

    Directory of Open Access Journals (Sweden)

    Rafał Młyński

    2016-10-01

    Full Text Available Background: The objective of the research has been to provide an answer to the question of what the possibilities of determining the direction of approach of the auditory danger signal emitted by an overhead crane appropriately are. Cases of use and no use of earmuffs (in the passive mode and level-dependent ones were all taken into consideration. Material and Methods: The auditory danger signal and ambient noise were recorded in an industrial hall. Signals were reproduced at an experimental set-up, using a large number of speakers. Eight speakers for reproduction of the auditory danger signal were placed above a subject’s head. The study participants would indicate the direction from which, according to them, the auditory danger signal was being emitted. Results: The average percentage rate of the correct localization amounted to 75.8% when the overhead crane’s signal wasn’t masked. The presence of ambient noise caused a reduction of the number of correctly identified localization to 66.6%. The use of earmuffs in the passive mode resulted in the worst results (44.5%. There is some improvement when level-dependent earmuffs are used (57.3%. Conclusions: In situations where it is important to identify the direction from which the auditory danger signal generated by the crane’s signaling device is approaching, it is beneficial to use level-dependent earmuffs rather than earmuffs in the passive mode. Correct identification of whether the auditory danger signal generated by the crane’s signaling device is approaching from the left or right side is almost perfect, however correct identification of whether the signal is approaching from the front or back of a person is not always possible. Med Pr 2016;67(5:589–597

  20. Readout strategies for directional dark matter detection beyond the neutrino background

    CERN Document Server

    O'Hare, Ciaran A J; Billard, Julien; Figueroa-Feliciano, Enectali; Strigari, Louis E

    2015-01-01

    The search for weakly interacting massive particles (WIMPs) by direct detection faces an encroaching background due to coherent neutrino-nucleus scattering. As the sensitivity of these experiments improves, the question of how to best distinguish a dark matter signal from neutrinos will become increasingly important. A proposed method of overcoming this so-called 'neutrino floor' is to utilize the directional signature that both neutrino and dark matter induced recoils possess. We show that directional experiments can indeed probe WIMP-nucleon cross-sections below the neutrino floor with little loss in sensitivity due to the neutrino background. In particular we find at low WIMP masses (around 6 GeV) the discovery limits for directional detectors penetrate below the non-directional limit by several orders of magnitude. For high WIMP masses (around 100 GeV), the non-directional limit is overcome by a factor of a few. Furthermore we show that even for directional detectors which can only measure 1- or 2-dimensi...

  1. Twin signal signature sensing: Application to shorted winding monitoring, detection and localization

    Energy Technology Data Exchange (ETDEWEB)

    Streifel, R.J.; Marks, R.J.; El-Sharkawi, A.E.; Kerszenbaum, I. [Univ. of Washington, Seattle, WA (United States)

    1995-12-31

    Using twin signal sensing we propose a method to monitor, detect and localize shorts in power system devices with windings: including rotors, transformers and motors. There has, to date, been no effective way to do so. The most obvious approach, time domain reflectometry, fails due to the reactive coupling of the windings. Twin signal signature sensing of shorts results from identical signals being simultaneously injected in both sides of the windings. The reflected signals are measured and the difference amplified to produce the signature signal. The signature signal characterizes the current state of the windings. When winding shorts are present, the electrical characteristics of the device will be different and thus the signature signal will also change. The changes in the signature signal can be monitored to detect shorted windings. While a device is in operation, the signature signals can be monitored and the development of winding shorts can be diagnosed through the process of novelty detection. After a device is cleaned or otherwise known to be functioning correctly (no winding shorts), signature signals can be collected which represent the healthy device. If a sufficient number of signals can be collected, the signal space representing healthy windings can be characterized. A detection surface can be placed around the healthy signature signals to provide a partition of the signal space into two regions: healthy and faulty. Any signature signal which is not within the healthy signature partition will indicate a faulted device.

  2. Lenslet array to further suppress starlight for direct exoplanet detection

    Science.gov (United States)

    Gong, Qian; McElwain, Michael; Shiri, Ron

    2016-07-01

    Direct imaging plays a key role in the detection and characterization of exoplanets orbiting within its host star's habitable zone. Many innovative ideas for starlight suppression and wavefront control have been proposed and developed over the past decade. However, several technological challenges still lie ahead to achieve the required contrast, including controlling the observatory pointing performance, fabricating occulting masks with tight optical tolerances, developing wavefront control algorithms, controlling stray light, advancing single photon detecting detectors, and integrated system-level issues. This paper explores how a lenslet array and pinhole mask may be implemented to further suppress uncorrected starlight that leaks through the occulting mask. An external occulter, or star shade, is simulated to demonstrate this concept, although this approach can be implemented for internal coronagraphs as well. We describe how to use simple relay optics to control the scene near the inner working angle and the level of the suppression expected. Furthermore, if the lenslet array is the input to an integral field spectrograph, as planned for the WFIRST mission, the spectral content of the exoplanet atmospheres can be obtained to determine if the observed planet is habitable and ultimately, if it is inhabited.

  3. Note: On-line weak signal detection via adaptive stochastic resonance.

    Science.gov (United States)

    Lu, Siliang; He, Qingbo; Kong, Fanrang

    2014-06-01

    We design an instrument with a novel embedded adaptive stochastic resonance (SR) algorithm that consists of a SR module and a digital zero crossing detection module for on-line weak signal detection in digital signal processing applications. The two modules are responsible for noise filtering and adaptive parameter configuration, respectively. The on-line weak signal detection can be stably achieved in seconds. The prototype instrument exhibits an advance of 20 dB averaged signal-to-noise ratio and 5 times averaged adjust R-square as compared to the input noisy signal, in considering different driving frequencies and noise levels.

  4. Fiber-optic Michelson interferometer fixed in a tilted tube for direction-dependent ultrasonic detection

    Science.gov (United States)

    Gang, Tingting; Hu, Manli; Qiao, Xueguang; Li, JiaCheng; Shao, Zhihua; Tong, Rongxin; Rong, Qiangzhou

    2017-01-01

    A fiber-optic interferometer is proposed and demonstrated experimentally for ultrasonic detection. The sensor consists of a compact Michelson interferometer (MI), which is fixed in a tilted-tube end-face (45°). Thin gold films are used for the reflective coatings of two arms and one of the interference arms is etched serving as the sensing arm. The spectral sideband filter technique is used to interrogate the continuous and pulse ultrasonic signals (with frequency of 300 KHz). Furthermore, because of the asymmetrical structure of the sensor, it presents strong direction-dependent ultrasonic sensitivity, such that the sensor can be considered a vector detector. The experimental results show that the sensor is highly sensitive to ultrasonic signals, and thus it can be a candidate for ultrasonic imaging of seismic physical models.

  5. Directional detection of Dark Matter with the MIcro-tpc MAtrix of Chambers

    CERN Document Server

    Couturier, C; Naraghi, F; Riffard, Q; Santos, D; Sauzet, N; Colas, P; Ribas, E Ferrer; Giomataris, I; Busto, J; Fouchez, D; Tao, C; Zhou, N

    2016-01-01

    Particles weakly interacting with ordinary matter, with an associated mass of the order of an atomic nucleus (WIMPs), are plausible candidates for Dark Matter. The direct detection of an elastic collision of a target nuclei induced by one of these WIMPs has to be discriminated from the signal produced by the neutrons, which leaves the same signal in a detector. The MIMAC (MIcro-tpc MAtrix of Chambers) collaboration has developed an original prototype detector which combines a large pixelated Micromegas coupled with a fast, self-triggering, electronics. Aspects of the two-chamber module in operation in the Modane Underground Laboratory are presented: calibration, characterization of the $^{222}$Rn progeny. A new test bench combining a MIMAC chamber with the COMIMAC portable quenching line has been set up to characterize the 3D tracks of low energy ions in the MIMAC gas mixture: the preliminary results thereof are presented. Future steps are briefly discussed.

  6. A first report on meteor-generated seismic signals as detected by the SANSN

    Directory of Open Access Journals (Sweden)

    Frederick Roelofse

    2013-05-01

    Full Text Available A bright meteor with an apparent magnitude of -18 was seen over large parts of southern Africa at ~23:00 South African Standard Time on 21 November 2009. Here we discuss the eye-witness accounts related to the meteor as well as the seismic signals generated by the meteor's passage through the atmosphere as detected by the Mussina seismograph station forming part of the South African National Seismograph Network. Two signals were identified on the seismogram; the first arrival is interpreted as a precursor coupled seismic wave and the second, which arrived ~138 s after the first, as a directly coupled airwave. The meteor is thought to have entered the atmosphere close to Mussina shortly before 22:55.06 local time, from where it proceeded in a westerly to northwesterly direction with an elevation angle not exceeding 43°. Our results presented here dispel the beliefs of many observers who thought that the meteor must have made landfall very close to their localities. In addition, this contribution documents the first instance of meteor-related seismic signals recorded by the South African National Seismograph Network.

  7. Signal waveform design to detect an underwater high-speed small target

    Institute of Scientific and Technical Information of China (English)

    YANG Chonglin; YAO Lan

    2002-01-01

    The problem of sonar signal waveform design to detect a high-speed small target in an underwater environment is discussed. From theoretical analysis, time-frequency hop signal is regarded as the most suitable signal waveform in this application. To get precise target parameter estimation ability, the signal should have high range-Doppler resolution performance.The results of signal analysis show that hop signal with frequency serial coding as Costas array has sharp ambiguity characteristic, so it can be used in an active sonar system to detect a high speed small target. A scheme of frequency coding is also presented.

  8. Detection and Cancellation of Jamming Signal Noise Using Digital Filters for Radar Applications

    OpenAIRE

    2013-01-01

    This paper considers the problem of detecting and classifying a radar target signal from a jamming signal produced from a target jammer source. Jamming is intentional emission of radio frequency signals to interfere with the operation of a radar by saturating its receiver with noise or false information. In order to distill the features of radar echo-signal affected by strong jamming noise, the adaptive filters are used to remove the noise and recover the radar echo-signal. An Adaptive filter...

  9. LOPES-3D, an antenna array for full signal detection of air-shower radio emission

    CERN Document Server

    Apel, W D; Bähren, L; Bekk, K; Bertaina, M; Biermann, P L; Blümer, J; Bozdog, H; Brancus, I M; Buchholz, P; Cantoni, E; Chiavassa, A; Daumiller, K; de Souza, V; Di Pierro, F; Doll, P; Engel, R; Falcke, H; Finger, M; Fuchs, B; Fuhrmann, D; Gemmeke, H; Grupen, C; Haungs, A; Heck, D; Hörandel, J R; Horneffer, A; Huber, D; Huege, T; Isar, P G; Kampert, K -H; Kang, D; Krömer, O; Kuijpers, J; Link, K; Luczak, P; Ludwig, M; Mathes, H J; Melissas, M; Morello, C; Oehlschläger, J; Palmieri, N; Pierog, T; Rautenberg, J; Rebel, H; Roth, M; Rühle, C; Saftoiu, A; Schieler, H; Schmidt, A; Schröder, F G; Sima, O; Toma, G; Trinchero, G C; Weindl, A; Wochele, J; Wommer, M; Zabierowski, J; Zensus, J A; 10.1016/j.nima.2012.08.082

    2013-01-01

    To better understand the radio signal emitted by extensive air-showers and to further develop the radio detection technique of high-energy cosmic rays, the LOPES experiment was reconfigured to LOPES-3D. LOPES-3D is able to measure all three vectorial components of the electric field of radio emission from cosmic ray air showers. The additional measurement of the vertical component ought to increase the reconstruction accuracy of primary cosmic ray parameters like direction and energy, provides an improved sensitivity to inclined showers, and will help to validate simulation of the emission mechanisms in the atmosphere. LOPES-3D will evaluate the feasibility of vectorial measurements for large scale applications. In order to measure all three electric field components directly, a tailor-made antenna type (tripoles) was deployed. The change of the antenna type necessitated new pre-amplifiers and an overall recalibration. The reconfiguration and the recalibration procedure are presented and the operationality of...

  10. Preliminary evaluation of second harmonic direct detection scheme for low-dose range in alanine/EPR dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Felipe [Departamento de Fisica e Matematica, FFCLRP, Universidade de Sao Paulo, Ribeirao Preto, SP (Brazil); Departamento de Fisica, Facultad de Ciencias Naturales, Exactas y Tecnologia, Universidad de Panama (Panama); Departamento de Salud Radiologica, Caja de Seguro Social (Panama); Graeff, Carlos F.O.; Baffa, Oswaldo [Departamento de Fisica e Matematica, FFCLRP, Universidade de Sao Paulo, Ribeirao Preto, SP (Brazil)]. E-mail: baffa@ffclrp.usp.br

    2002-04-21

    The usefulness of a direct detection scheme of the second harmonic (2h) overmodulated signal from irradiated alanine in EPR dosimetry was studied. For this purpose, a group of DL-alanine/paraffin cylindrical pellets was produced. The dosimeters were irradiated with a {sup 60}Co radiotherapy gamma source with doses of 0.05, 0.1, 0.5, 1 and 5 Gy. The EPR measurements were carried out in a VARIAN-E4 spectrometer operating in X-band with optimized parameters to obtain highest amplitude signals of both harmonics. The 2h signal was detected directly at twice the modulation frequency. In preliminary results, the 2h showed some advantages over the 1h such as better resolution for doses below 1 Gy, better repeatability results and better linear behaviour in the dose range indicated. (author)

  11. Analysis of weak signal detection based on tri-stable system under Levy noise

    Science.gov (United States)

    Li-Fang, He; Ying-Ying, Cui; Tian-Qi, Zhang; Gang, Zhang; Ying, Song

    2016-06-01

    Stochastic resonance system is an effective method to extract weak signal. However, system output is directly influenced by system parameters. Aiming at this, the Levy noise is combined with a tri-stable stochastic resonance system. The average signal-to-noise ratio gain is regarded as an index to measure the stochastic resonance phenomenon. The characteristics of tri-stable stochastic resonance under Levy noise is analyzed in depth. First, the method of generating Levy noise, the effect of tri-stable system parameters on the potential function and corresponding potential force are presented in detail. Then, the effects of tri-stable system parameters w, a, b, and Levy noise intensity amplification factor D on the resonant output can be explored with different Levy noises. Finally, the tri-stable stochastic resonance system is applied to the bearing fault detection. Simulation results show that the stochastic resonance phenomenon can be induced by tuning the system parameters w, a, and b under different distributions of Levy noise, then the weak signal can be detected. The parameter intervals which can induce stochastic resonances are approximately equal. Moreover, by adjusting the intensity amplification factor D of Levy noise, the stochastic resonances can happen similarly. In bearing fault detection, the detection effect of the tri-stable stochastic resonance system is superior to the bistable stochastic resonance system. Project supported by the National Natural Science Foundation of China (Grant No. 61371164), the Chongqing Municipal Distinguished Youth Foundation, China (Grant No. CSTC2011jjjq40002), and the Research Project of Chongqing Municipal Educational Commission, China (Grant No. KJ130524).

  12. Enhancing the Detection of BOLD Signal in fMRI by Reducing the Partial Volume Effect

    Directory of Open Access Journals (Sweden)

    Yiping P. Du

    2014-01-01

    Full Text Available Purpose. To investigate the advantages of reducing the partial volume effect (PVE to enhance the detection of the BOLD signal in fMRI. Methods. A linear phase term was added in k-space to obtain half-voxel shifting of 64 × 64 T2*-weighted echo-planar images. Three sets of image data shifted in the x, y, and diagonal direction, respectively, are combined with the original 64 × 64 data to form the 128 × 128 voxel-shifted interpolated data. Results. A simulation of a synthetic fMRI dataset shows that the voxel-shifted interpolation (VSI can increase the t-score up to 50% in single-voxel activations. An fMRI study (n=7 demonstrates that 20.4% of the interpolated voxels have higher t-scores than their nearest neighboring voxels in the original maps. The average increase of the t-score in these interpolated voxels is 13.3%. Conclusion. VSI yields increased sensitivity in detecting voxel-size BOLD activations, improved spatial accuracy of activated regions, and improved detection of the peak BOLD signal of an activated region. VSI can potentially be used as an alternative to the high-resolution fMRI studies in which reduction in SNR and increase in imaging time become prohibitive.

  13. Baseline Signal Reconstruction for Temperature Compensation in Lamb Wave-Based Damage Detection.

    Science.gov (United States)

    Liu, Guoqiang; Xiao, Yingchun; Zhang, Hua; Ren, Gexue

    2016-08-11

    Temperature variations have significant effects on propagation of Lamb wave and therefore can severely limit the damage detection for Lamb wave. In order to mitigate the temperature effect, a temperature compensation method based on baseline signal reconstruction is developed for Lamb wave-based damage detection. The method is a reconstruction of a baseline signal at the temperature of current signal. In other words, it compensates the baseline signal to the temperature of current signal. The Hilbert transform is used to compensate the phase of baseline signal. The Orthogonal matching pursuit (OMP) is used to compensate the amplitude of baseline signal. Experiments were conducted on two composite panels to validate the effectiveness of the proposed method. Results show that the proposed method could effectively work for temperature intervals of at least 18 °C with the baseline signal temperature as the center, and can be applied to the actual damage detection.

  14. Baseline Signal Reconstruction for Temperature Compensation in Lamb Wave-Based Damage Detection

    Directory of Open Access Journals (Sweden)

    Guoqiang Liu

    2016-08-01

    Full Text Available Temperature variations have significant effects on propagation of Lamb wave and therefore can severely limit the damage detection for Lamb wave. In order to mitigate the temperature effect, a temperature compensation method based on baseline signal reconstruction is developed for Lamb wave-based damage detection. The method is a reconstruction of a baseline signal at the temperature of current signal. In other words, it compensates the baseline signal to the temperature of current signal. The Hilbert transform is used to compensate the phase of baseline signal. The Orthogonal matching pursuit (OMP is used to compensate the amplitude of baseline signal. Experiments were conducted on two composite panels to validate the effectiveness of the proposed method. Results show that the proposed method could effectively work for temperature intervals of at least 18 °C with the baseline signal temperature as the center, and can be applied to the actual damage detection.

  15. Noise Reduction of MEMS Gyroscope Based on Direct Modeling for an Angular Rate Signal

    OpenAIRE

    Liang Xue; Chengyu Jiang; Lixin Wang; Jieyu Liu; Weizheng Yuan

    2015-01-01

    In this paper, a novel approach for processing the outputs signal of the microelectromechanical systems (MEMS) gyroscopes was presented to reduce the bias drift and noise. The principle for the noise reduction was presented, and an optimal Kalman filter (KF) was designed by a steady-state filter gain obtained from the analysis of KF observability. In particular, the true angular rate signal was directly modeled to obtain an optimal estimate and make a self-compensation for the gyroscope witho...

  16. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    Science.gov (United States)

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  17. Design of the signal detecting device for the laser system of the shipboard theodoliten

    Science.gov (United States)

    Zou, Hui-hui; Chen, Di; Wu, Hong-bing; Ou, Lin

    2014-07-01

    A laser signal detecting device is designed for detecting the laser system signal of the shipborne calibration theodolite (hereinafter refers to as theodolite) in the dynamic environment on the sea. The device consists of target board, testing module and data processing module, in which the testing module is fixed in the middle of the target board. A laser beam collimation and expanding lens is designed with ZEMAX, and the theodolite self-stabilization system is adopted to prevent the loss of signal during the test. It is proved that the detection device can meet the detecting requirements with its high detecting precision, easy operation and strong expansibility.

  18. Direct detection of oxygen free radicals produced in theviscera of burned rats using electron paramagneticresonance spectroscopy

    Institute of Scientific and Technical Information of China (English)

    路卫; 陈玉琳; 夏照帆

    2002-01-01

    Objective: To detect superoxide anion (O-2) signalsin the heart, liver, lung and kidney tissues after burns.Methods: Twenty-four male rats were randomizedinto 4 groups. The rats of experimental groups wereimmersed in 100℃ water for 15 seconds and 25% third-degree burn was created. Thoracotomy or laparotomy wasperformed at 5, 10, 15, 20 and 30 minutes after burn, andspecimens of the heart, lung, liver kidney were obtained forburned rats. The specimens were then preserved in liquidnitrogen for cryo-preservation and detected immediatelyusing EPR.Results: The signals of superoxide O radicalappeared in the heart, lung, liver and kidney specimens10-15 minutes after burn.Conclusions: There is a direct evidence of oxygen freeradicals (OFRs) injury to viscera of burned rats between10-15 minutes after burn.

  19. DETECTING TECHNIQUE OF WEAK PERIODIC PULSE SIGNAL VIA SYNTHESIS OF CROSS-CORRELATION AND CHAOTIC SYSTEM

    Institute of Scientific and Technical Information of China (English)

    Li Yue; Yang Baojun; Lu Peng; Li Shizhe

    2003-01-01

    In this letter, with the synthesis of usual cross-correlation detecting method andchaotic detecting method, a new detecting system for the weak periodic pulse signal is constituted,in which the two methods can play respective preponderance. Theoretical analyses and simulationstudies have shown that the detecting system is very sensitive to the periodic pulse signal understrong noise background and has exceedingly powerful capability of suppressing complex noise.

  20. Direct detection of dark matter with noble liquid detectors

    Science.gov (United States)

    Spaans, Jason

    The search for non-baryonic, non-luminous dark matter that comprises approximately 23% of our universe is an exciting endeavor. However, detecting this matter has proved difficult as it does not interact through the electromagnetic force but only by scattering elastically off of target nuclei on the weak scale; therefore evidence of dark matter must be demonstrated through the observation of nuclear recoils induced by dark matter candidates. Because nuclear recoils can be caused by any type of elastic scattering reactions induced by radiogenic and cosmogenic processes, a dark matter detector must have an extremely low background. Moreover, the low energy signal of a dark matter event requires building detectors with large volumes of target material with low background. Noble liquids provide a promising target for the detection of dark matter. Of the noble elements, argon and xenon have been shown to be ideal targets in dark matter searches as they have excellent scintillation yield and are relatively inexpensive and scalable. However, natural argon contains a radioactive isotope, 39Ar, that must be reduced in order to observe a rare dark matter event. Several technologies exist that can be utilized to reduce the concentration of this element including thermal diffusion, underground water sources and laser isotope separation. Thermal diffusion employs a temperature gradient in order to separate gaseous argon isotopes along the length of a cylindrical column. A test bench thermal diffusion column has been constructed which resulted in the significant depletion of 36Ar in a natural argon sample. Underground water sources have also been evaluated in the pursuit of natural argon depleted of the 39Ar isotope. Since the water in these sources has not been in contact with atmospheric air for several thousand years that 39Ar should have decayed away. A water source at Wall, SD has been obtained and evaluated for depleted argon using a water degassing apparatus and a

  1. Detection of Wideband Signal Number Based on Bootstrap Resampling

    Directory of Open Access Journals (Sweden)

    Jiaqi Zhen

    2016-01-01

    Full Text Available Knowing source number correctly is the precondition for most spatial spectrum estimation methods; however, many snapshots are needed when we determine number of wideband signals. Therefore, a new method based on Bootstrap resampling is proposed in this paper. First, signals are divided into some nonoverlapping subbands; apply coherent signal methods (CSM to focus them on the single frequency. Then, fuse the eigenvalues with the corresponding eigenvectors of the focused covariance matrix. Subsequently, use Bootstrap to construct the new resampling matrix. Finally, the number of wideband signals can be calculated with obtained vector sequences according to clustering technique. The method has a high probability of success under low signal to noise ratio (SNR and small number of snapshots.

  2. Signal Quality Enhancement of Directly- Modulated VCSELs Using a Micro-Ring Resonator Transfer Function

    DEFF Research Database (Denmark)

    An, Yi; Muller, M.; Estaran Tolosa, Jose Manuel

    2013-01-01

    A micro-ring resonator transfer function is used to enhance the quality of signals generated using directly modulated VCSELs. The scheme is demonstrated up to 25 Gbit/s with a 17.6-GHz VCSEL, with up to 10 dB sensitivity improvement.......A micro-ring resonator transfer function is used to enhance the quality of signals generated using directly modulated VCSELs. The scheme is demonstrated up to 25 Gbit/s with a 17.6-GHz VCSEL, with up to 10 dB sensitivity improvement....

  3. Transmission Property of Directly Modulated Signals Enhanced by a Micro-ring Resonator

    DEFF Research Database (Denmark)

    An, Yi; Lorences Riesgo, Abel; Seoane, Jorge;

    2012-01-01

    A silicon micro-ring resonator is used to enhance the modulation speed of a 10-Gbit/s directly modulated laser to 40 Gbit/s. The generated signal is transmitted error free over 4.5 km SSMF. Dispersion tolerance is also studied.......A silicon micro-ring resonator is used to enhance the modulation speed of a 10-Gbit/s directly modulated laser to 40 Gbit/s. The generated signal is transmitted error free over 4.5 km SSMF. Dispersion tolerance is also studied....

  4. Reporter Gene-Facilitated Detection of Compounds in Arabidopsis Leaf Extracts that Activate the Karrikin Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Yueming Kelly Sun

    2016-12-01

    Full Text Available Karrikins are potent germination stimulants generated by the combustion of plant matter. Treatment of Arabidopsis with karrikins triggers a signalling process that is dependent upon a putative receptor protein KARRIKIN INSENSITIVE 2 (KAI2. KAI2 is a homologue of DWARF 14 (D14, the receptor for endogenous strigolactone hormones. Genetic analyses suggest that KAI2 also perceives endogenous signal(s that are not strigolactones. Activation of KAI2 by addition of karrikins to Arabidopsis plants induces expression of transcripts including D14-LIKE 2 (DLK2. We constructed the synthetic reporter gene DLK2:LUC in Arabidopsis, which comprises the firefly luciferase gene (LUC driven by the DLK2 promoter. Here we describe a luminescence-based reporter assay with Arabidopsis seeds to detect chemical signals that can activate the KAI2 signalling pathway. We demonstrate that the DLK2:LUC assay can selectively and sensitively detect karrikins and a functionally similar synthetic strigolactone analogue. Crucially we show that crude extracts from Arabidopsis leaves can also activate DLK2:LUC in a KAI2-dependent manner. Our work provides the first direct evidence for the existence of endogenous chemical signals that can activate the KAI2-mediated signalling pathway in Arabidopsis. This sensitive reporter system can now be used for the bioassay-guided purification and identification of putative endogenous KAI2 ligands or their precursors, and endogenous compounds that might modulate the KAI2 signalling pathway.

  5. Spectroscopic direct detection of reflected light from extra-solar planets

    CERN Document Server

    Martins, Jorge H C; Santos, Nuno; Lovis, Christophe

    2013-01-01

    At optical wavelengths, an exoplanet's signature is essentially reflected light from the host star - several orders of magnitude fainter. Since it is superimposed on the star spectrum its detection has been a difficult observational challenge. However, the development of a new generation of instruments like ESPRESSO and next generation telescopes like the E-ELT put us in a privileged position to detect these planets' reflected light as we will have access to extremely high signal-to-noise ratio spectra. With this work, we propose an alternative approach for the direct detection of the reflected light of an exoplanet. We simulated observations with ESPRESSO@VLT and HIRES@E-ELT of several star+planet systems, encompassing 10h of the most favourable orbital phases. To the simulated spectra we applied the Cross Correlation Function to operate in a much higher signal-to-noise ratio domain than when compared with the spectra. The use of the Cross-Correlation Function permitted us to recover the simulated the planet...

  6. The effective field theory of dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Fitzpatrick, A. Liam; Haxton, Wick; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2013-02-01

    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  7. SUSY under siege from direct and indirect WIMP detection experiments

    Science.gov (United States)

    Baer, Howard; Barger, Vernon; Serce, Hasan

    2016-12-01

    We examine updated prospects for detecting WIMPs in supersymmetric models via direct and indirect dark matter search experiments. We examine several historical and also still viable scenarios: projections for well-tempered neutralinos (WTN), projections from the MasterCode (MC), BayesFits (BF) and Fittino (FO) collaborations, nonthermal wino dark matter (NThW) and finally mixed axion-Higgsino dark matter from SUSY with radiatively driven naturalness (RNS). The WTN is ruled out by recent limits from XENON and LUX collaborations. The NThW scenario, previously on tenuous ground due to gamma-line searches, appears also ruled out by recent combined Fermi-LAT/MAGIC limits combined with new HESS results from continuum gamma rays. Substantial portions of MC parameter space and 1 TeV Higgsino parameter space from BF group are ruled out. The 100-300 GeV Higgsino-like WIMP from RNS survives due to its possible depleted local abundance (where the axion may make up the bulk of dark matter). Projections from ton-scale noble liquid detectors should discover or rule out WIMPs from the remaining parameter space of these surviving models.

  8. SUSY under siege from direct and indirect WIMP detection experiments

    CERN Document Server

    Baer, Howard; Serce, Hasan

    2016-01-01

    We examine updated prospects for detecting WIMPs in supersymmetric models via direct and indirect dark matter search experiments. We examine several historical and also still viable scenarios: projections for well-tempered neutralinos (WTN), projections from the MasterCode (MC) collaboration, projections from the BayesFits (BF) collaboration, non-thermal wino dark matter (NThW) and finally mixed axion-higgsino dark matter from SUSY with radiatively-driven naturalness (RNS). The WTN is ruled out by recent limits from XENON and LUX collaborations. The NThW scenario, previously on tenuous ground due to gamma-line searches, appears also ruled out by recent combined Fermi-LAT/MAGIC limits combined with new HESS results from continuum gamma rays. Substantial portions of MC parameter space and 1 TeV higgsino parameter space from BF group are ruled out. The 100-300 GeV higgsino-like WIMP from RNS survives due to its possible depleted local abundance (where the axion may make up the bulk of dark matter). Projections f...

  9. Detection of directivity in seismic site response from microtremor spectral analysis

    Directory of Open Access Journals (Sweden)

    V. Del Gaudio

    2008-07-01

    Full Text Available Recent observations have shown that slope response to seismic shaking can be characterised by directional variations of a factor of 2–3 or larger, with maxima oriented along local topography features (e.g. maximum slope direction. This phenomenon appears influenced by slope material properties and has occasionally been detected on landslide-prone slopes, where a down-slope directed amplification could enhance susceptibility to seismically-induced landsliding. The exact conditions for the occurrence of directional amplification remain still unclear and the implementation of investigation techniques capable to reveal the presence of such phenomena is desirable. To this purpose we tested the applicability of a method commonly used to evaluate site resonance properties (Horizontal to Vertical Noise Ratio – HVNR or Nakamura's method as reconnaissance technique for the identification of site response directivity. Measurements of the azimuthal variation of H/V spectral ratios (i.e. between horizontal and vertical component of ambient microtremors were conducted in a landslide-prone study area of central Italy where a local accelerometric network had previously provided evidence of directivity phenomena on some slopes. The test results were compared with average H/V spectral ratios obtained for low-to-moderate earthquakes recorded by the accelerometric stations. In general, noise and seismic recordings provided different amplitudes of spectral ratios at similar frequencies, likely because of differences in signal and instrument characteristics. Nevertheless, both kinds of recordings showed that at sites affected by site response directivity major H/V peaks have orientations consistent (within 20°–30° with the direction of maximum shaking energy. Therefore, HVNR appears to be a promising technique for identifying seismic response directivity. Furthermore, in a comparative test conducted on a slope mantled in part by a deep-seated landslide

  10. Simulation of intramuscular EMG signals detected using implantable myoelectric sensors (IMES).

    Science.gov (United States)

    Lowery, Madeleine M; Weir, Richard F ff; Kuiken, Todd A

    2006-10-01

    The purpose of this study was to test the feasibility of recording independent electromyographic (EMG) signals from the forearm using implantable myoelectric sensors (IMES), for myoelectric prosthetic control. Action potentials were simulated using two different volume conductor models: a finite-element (FE) model that was used to explore the influence of the electrical properties of the surrounding inhomogeneous tissues and an analytical infinite volume conductor model that was used to estimate the approximate detection volume of the implanted sensors. Action potential amplitude increased progressively as conducting electrodes, the ceramic electrode casing and high resistivity encapsulation tissue were added to the model. For the muscle fiber locations examined, the mean increase in EMG root mean square amplitude when the full range of material properties was included in the model was 18.2% (+/-8.1%). Changing the orientation of the electrode with respect to the fiber direction altered the shape of the electrode detection volume and reduced the electrode selectivity. The estimated detection radius of the IMES electrode, assuming a cylindrical muscle cross section, was 4.8, 6.2, and 7.5 mm for electrode orientations of 0 degree, 22.5 degrees, and 45 degrees with respect to the muscle fiber direction.

  11. Directional dark matter by polar angle direct detection and application of columnar recombination

    CERN Document Server

    Li, Jin

    2015-01-01

    We report a systematic study on the directional sensitivity of a direct dark matter detector that detects the polar angle of a recoiling nucleus. A WIMP-mass independent method is used to obtain the sensitivity of a general detector in an isothermal galactic dark matter halo. By using two-dimensional distributions of energy and polar angle, a detector without head-tail information with 6.3 times the statistics is found to achieve the same performance level as a full three-dimensional tracking dark matter detector. Optimum operation orientations are obtained for various experimental configurations, with detectors that are space- or Earth-fixed, have head-tail capability or not, and use energy information or not. Earth-fixed detectors are found to have best sensitivity when the polar axis is oriented at a 45 degree angle from the Earth's pole. The WIMP-mass dependence of the performance of a detector with a 3 keV energy threshold that uses xenon as target material is reported. We apply realistic experimental re...

  12. Direct detection of trimethylamine in meat food products using ion mobility spectrometry.

    Science.gov (United States)

    Bota, Gheorghe M; Harrington, Peter B

    2006-01-15

    Biogenic amines are degradation products generated by bacteria in meat products. These amines can indicate bacterial contamination or have a carcinogenic effect to humans consuming spoiled meats; therefore, their rapid detection is essential. Trimethylamine (TMA) is a good target for the detection of biogenic amines because its volatility. TMA was directly detected in meat food products using ion mobility spectrometry (IMS). TMA concentrations were measured in chicken meat juice for a quantitative evaluation of the meat decaying process. The lowest detected TMA concentration in chicken juice was 0.6+/-0.2 ng and the lowest detected signal for TMA in a standard aqueous solution was 0.6 ng. IMS data were processed using partial least squares (PLS) and Fuzzy rule-building expert system (FuRES). Using these two chemometric methods, trimethylamine concentrations of different days of meat spoilage can be separated, indicating the decaying of meat products. Comparing the two methods, FuRES provided a better classification of different days of meat spoilage.

  13. Detecting PTEN and PI3K signaling in brain

    Science.gov (United States)

    Zhu, Guo; Baker, Suzanne J.

    2016-01-01

    Summary The central nervous system is comprised of multiple cell types including neurons, glia and other supporting cells that may differ dramatically in levels of signaling pathway activation. Immunohistochemistry in conjunction with drug interference are powerful tools that allow evaluation of signaling pathways in different cell types of the mouse central nervous system in vivo. Here we provide detailed protocols for immunohistochemistry to evaluate three essential components in the PI3K pathway in mouse brain: Pten, p-Akt and p-4ebp1, and for rapamycin treatment to modulate mTOR signaling in vivo. PMID:27033070

  14. Detection of transient disturbing signals on PC boards

    Directory of Open Access Journals (Sweden)

    S. Korte

    2008-05-01

    Full Text Available This paper shows a possibility to visualize signal propagation in electronic circuits. Instead of using various galvanic measurement points all over the circuit, a test method is shown which measures the radiated field of the printed circuit board. By use of a 2-dimensional positionable field probe it is possible to get an overview over the signals running on the different parts of the PCB. In order to measure transient disturbing signals and distinguish them from normal device operation, problems of probe design and triggering need to be discussed.

  15. Optimization of Generation and Detection of WDM Signals with Advanced Modulation Formats

    Institute of Scientific and Technical Information of China (English)

    Sarah; Dods

    2003-01-01

    This paper presents optimal generation and detection of wavelength division multiplexed (WDM) signals with advanced modulation formats. We investigate the relative phase alignment between phase modulation and data bits for chirped return-to-zero (CRZ) signals, and the frequency offset between the RZ carrier and various optical filters for vestigial side band (VSB)-RZ signals.

  16. Quantum secure direct communication of digital and analog signals using continuum coherent states

    Science.gov (United States)

    Guerra, Antônio Geovan de Araújo Holanda; Rios, Francisco Franklin Sousa; Ramos, Rubens Viana

    2016-11-01

    In this work, we present optical schemes for secure direct quantum communication of digital and analog signals using continuum coherent states and frequency-dependent phase modulation. The main advantages of the proposed schemes are that they do not use entangled states and they can be implemented with today technology. The theory of quantum interference of continuum coherent state is described, and the optical setups for secure direct communication are presented and their securities are discussed.

  17. Quantum secure direct communication of digital and analog signals using continuum coherent states

    Science.gov (United States)

    Guerra, Antônio Geovan de Araújo Holanda; Rios, Francisco Franklin Sousa; Ramos, Rubens Viana

    2016-08-01

    In this work, we present optical schemes for secure direct quantum communication of digital and analog signals using continuum coherent states and frequency-dependent phase modulation. The main advantages of the proposed schemes are that they do not use entangled states and they can be implemented with today technology. The theory of quantum interference of continuum coherent state is described, and the optical setups for secure direct communication are presented and their securities are discussed.

  18. A Root-MUSIC-Like Direction Finding Method for Cyclostationary Signals

    Directory of Open Access Journals (Sweden)

    Yide Wang

    2005-01-01

    Full Text Available We propose a new root-MUSIC-like direction finding algorithm that exploits cyclostationarity in order to improve the direction-of-arrival estimation. The proposed cyclic method is signal selective, it allows to increase the resolution power and the noise robustness significantly, and it is also able to handle more sources than the number of sensors. Computer simulations are used to show the performance of the algorithm.

  19. Chaotic signal detection and estimation based on attractor sets: applications to secure communications.

    Science.gov (United States)

    Rohde, G K; Nichols, J M; Bucholtz, F

    2008-03-01

    We consider the problem of detection and estimation of chaotic signals in the presence of white Gaussian noise. Traditionally this has been a difficult problem since generalized likelihood ratio tests are difficult to implement due to the chaotic nature of the signals of interest. Based on Poincare's recurrence theorem we derive an algorithm for approximating a chaotic time series with unknown initial conditions. The algorithm approximates signals using elements carefully chosen from a dictionary constructed based on the chaotic signal's attractor. We derive a detection approach based on the signal estimation algorithm and show, with simulated data, that the new approach can outperform other methods for chaotic signal detection. Finally, we describe how the attractor based detection scheme can be used in a secure binary digital communications protocol.

  20. Chaotic signal detection and estimation based on attractor sets: Applications to secure communications

    Science.gov (United States)

    Rohde, G. K.; Nichols, J. M.; Bucholtz, F.

    2008-03-01

    We consider the problem of detection and estimation of chaotic signals in the presence of white Gaussian noise. Traditionally this has been a difficult problem since generalized likelihood ratio tests are difficult to implement due to the chaotic nature of the signals of interest. Based on Poincare's recurrence theorem we derive an algorithm for approximating a chaotic time series with unknown initial conditions. The algorithm approximates signals using elements carefully chosen from a dictionary constructed based on the chaotic signal's attractor. We derive a detection approach based on the signal estimation algorithm and show, with simulated data, that the new approach can outperform other methods for chaotic signal detection. Finally, we describe how the attractor based detection scheme can be used in a secure binary digital communications protocol.

  1. Measurement of Rank and Other Properties of Direct and Scattered Signals

    Directory of Open Access Journals (Sweden)

    Svante Björklund

    2016-01-01

    Full Text Available We have designed an experiment for low-cost indoor measurements of rank and other properties of direct and scattered signals with radar interference suppression in mind. The signal rank is important also in many other applications, for example, DOA (Direction of Arrival estimation, estimation of the number of and location of transmitters in electronic warfare, and increasing the capacity in wireless communications. In real radar applications, such measurements can be very expensive, for example, involving airborne radars with array antennas. We have performed the measurements in an anechoic chamber with several transmitters, a receiving array antenna, and a moving reflector. Our experiment takes several aspects into account: transmitted signals with different correlation, decorrelation of the signals during the acquisition interval, covariance matrix estimation, noise eigenvalue spread, calibration, near-field compensation, scattering in a rough surface, and good control of the influencing factors. With our measurements we have observed rank, DOA spectrum, and eigenpatterns of direct and scattered signals. The agreement of our measured properties with theoretic and simulated results in the literature shows that our experiment is realistic and sound. The detailed description of our experiment could serve as help for conducting other well-controlled experiments.

  2. Noise Immunity of Duffing Oscillator And Its Applications in Weak UWB Signal Detection

    Directory of Open Access Journals (Sweden)

    Liyun Su

    2012-03-01

    Full Text Available Weak signal detection based on Duffing oscillator, which is sensitive to certain signals and immune to noise, has become a hit of academic research. But most of researches and applications are just in data numerical simulations. This paper gives a statistically theoretical investigation according to noise equivalent transformation and experimental simulation for this very important weak signal detection technique. Then this immunity to noise of Duffing oscillator is applied in weak UWB signal detection. The theoretical analysis and data simulation results show that Duffing oscillator is immune to the white noise in statistical sense. Furthermore, the applications in weak UWB signal detection also demonstrate that the immunity to noise of Duffing oscillator is effective in detecting the weak received UWB information of long distance.

  3. Fabrication of SERS swab for direct detection of trace explosives in fingerprints.

    Science.gov (United States)

    Gong, Zhengjun; Du, Hongjie; Cheng, Fansheng; Wang, Cong; Wang, Canchen; Fan, Meikun

    2014-12-24

    Swab sampling is of great importance in surface contamination analysis. A cotton swab (cotton Q-tip) was successfully transformed into surface-enhanced Raman scattering (SERS) substrate (SERS Q-tip) through a bottom-up strategy, where Ag NPs were first self-assembled onto the Q-tip followed by in situ growing. The capability for direct swab detection of Raman probe Nile Blue A (NBA) and a primary explosive marker 2,4-dinitrotoluene (2,4-DNT) using the SERS Q-tip was explored. It was found that at optimum conditions, a femotogram of NBA on glass surface could be swab-detected. The lowest detectable amount for 2,4-DNT is only ∼1.2 ng/cm(2) (total amount of 5 ng) on glass surface, 2 orders of magnitude more sensitive than similar surface analysis achieved with infrared technique, and comparable even with that obtained by ion mobility spectrometry-mass spectrometry. Finally, 2,4-DNT left on fingerprints was also analyzed. It was found that SERS signal of 2,4-DNT from 27th fingerprint after touching 2,4-DNT powder can still be clearly identified by swabbing with the SERS Q-tip. We believe this is the first direct SERS swabbing test of explosives on fingerprint on glass. Considering its relative long shelf life (>30 d), the SERS Q-tip may find great potential in future homeland security applications when combined with portable Raman spectrometers.

  4. DETECTION OF POTENTIAL TRANSIT SIGNALS IN THE FIRST 12 QUARTERS OF KEPLER MISSION DATA

    Energy Technology Data Exchange (ETDEWEB)

    Tenenbaum, Peter; Jenkins, Jon M.; Seader, Shawn; Burke, Christopher J.; Christiansen, Jessie L.; Rowe, Jason F.; Caldwell, Douglas A.; Clarke, Bruce D.; Li, Jie; Quintana, Elisa V.; Smith, Jeffrey C.; Thompson, Susan E.; Twicken, Joseph D. [SETI Institute/NASA Ames Research Center, Moffett Field, CA 94305 (United States); Borucki, William J.; Batalha, Natalie M.; Cote, Miles T.; Haas, Michael R.; Hunter, Roger C.; Sanderfer, Dwight T. [NASA Ames Research Center, Moffett Field, CA 94305 (United States); Girouard, Forrest R., E-mail: peter.tenenbaum@nasa.gov [Orbital Sciences Corporation/NASA Ames Research Center, Moffett Field, CA 94305 (United States); and others

    2013-05-01

    We present the results of a search for potential transit signals in the first three years of photometry data acquired by the Kepler mission. The targets of the search include 112,321 targets that were observed over the full interval and an additional 79,992 targets that were observed for a subset of the full interval. From this set of targets we find a total of 11,087 targets that contain at least one signal that meets the Kepler detection criteria: periodicity of the signal, an acceptable signal-to-noise ratio, and three tests that reject false positives. Each target containing at least one detected signal is then searched repeatedly for additional signals, which represent multi-planet systems of transiting planets. When targets with multiple detections are considered, a total of 18,406 potential transiting planet signals are found in the Kepler mission data set. The detected signals are dominated by events with relatively low signal-to-noise ratios and by events with relatively short periods. The distribution of estimated transit depths appears to peak in the range between 20 and 30 parts per million, with a few detections down to fewer than 10 parts per million. The detections exhibit signal-to-noise ratios from 7.1{sigma}, which is the lower cutoff for detections, to over 10,000{sigma}, and periods ranging from 0.5 days, which is the shortest period searched, to 525 days, which is the upper limit of achievable periods given the length of the data set and the requirement that all detections include at least three transits. The detected signals are compared to a set of known transit events in the Kepler field of view, many of which were identified by alternative methods; the comparison shows that the current search recovery rate for targets with known transit events is 98.3%.

  5. Detection of multiple AE signal by triaxial hodogram analysis; Sanjiku hodogram ho ni yoru taju acoustic emission no kenshutsu

    Energy Technology Data Exchange (ETDEWEB)

    Nagano, K.; Yamashita, T. [Muroran Institute of Technology, Hokkaido (Japan)

    1997-05-27

    In order to evaluate dynamic behavior of underground cracks, analysis and detection were attempted on multiple acoustic emission (AE) events. The multiple AE is a phenomenon in which multiple AE signals generated by underground cracks developed in an extremely short time interval are superimposed, and observed as one AE event. The multiple AE signal consists of two AE signals, whereas the second P-wave is supposed to have been inputted before the first S-wave is inputted. The first P-wave is inputted first, where linear three-dimensional particle movements are observed, but the movements are made random due to scattering and sensor characteristics. When the second P-wave is inputted, the linear particle movements are observed again, but are superimposed with the existing input signals and become multiple AE, which creates poor S/N ratio. The multiple AE detection determines it a multiple AE event when three conditions are met, i. e. a condition of equivalent time interval of a maximum value in a scalogram analysis, a condition of P-wave vibrating direction, and a condition of the linear particle movement. Seventy AE signals observed in the Kakkonda geothermal field were analyzed and AE signals that satisfy the multiple AE were detected. However, further development is required on an analysis method with high resolution for the time. 4 refs., 4 figs.

  6. A Universal Fast Colorimetric Method for DNA Signal Detection with DNA Strand Displacement and Gold Nanoparticles

    Directory of Open Access Journals (Sweden)

    Xin Li

    2015-01-01

    Full Text Available DNA or gene signal detection is of great significance in many fields including medical examination, intracellular molecular monitoring, and gene disease signal diagnosis, but detection of DNA or gene signals in a low concentration with instant visual results remains a challenge. In this work, a universal fast and visual colorimetric detection method for DNA signals is proposed. Specifically, a DNA signal amplification “circuit” based on DNA strand displacement is firstly designed to amplify the target DNA signals, and then thiol modified hairpin DNA strands and gold nanoparticles are used to make signal detection results visualized in a colorimetric manner. If the target DNA signal exists, the gold nanoparticles aggregate and settle down with color changing from dark red to grey quickly; otherwise, the gold nanoparticles’ colloids remain stable in dark red. The proposed method provides a novel way to detect quickly DNA or gene signals in low concentrations with instant visual results. When applied in real-life, it may provide a universal colorimetric method for gene disease signal diagnosis.

  7. Optimal Precoding Design and Power Allocation for Decentralized Detection of Deterministic Signals

    CERN Document Server

    Fang, Jun; Chen, Zhi; Li, Shaoqian

    2011-01-01

    We consider a decentralized detection problem in a power-constrained wireless sensor networks (WSNs), in which a number of sensor nodes collaborate to detect the presence of a deterministic vector signal. The signal to be detected is assumed known \\emph{a priori}. Given a constraint on the total amount of transmit power, we investigate the optimal linear precoding design for each sensor node. More specifically, in order to achieve the best detection performance, shall sensor nodes transmit their raw data to the fusion center (FC), or transmit compressed versions of their original data? The optimal power allocation among sensors is studied as well. Also, assuming a fixed total transmit power, we examine how the detection performance behaves with the number of sensors in the network. A new concept "detection outage" is proposed to quantify the reliability of the overall detection system. Finally, decentralized detection with unknown signals is studied. Numerical results are conducted to corroborate our theoreti...

  8. DETECTION OF POTENTIAL TRANSIT SIGNALS IN 16 QUARTERS OF KEPLER MISSION DATA

    Energy Technology Data Exchange (ETDEWEB)

    Tenenbaum, Peter; Jenkins, Jon M.; Seader, Shawn; Burke, Christopher J.; Christiansen, Jessie L.; Rowe, Jason F.; Caldwell, Douglas A.; Clarke, Bruce D.; Coughlin, Jeffrey L.; Li, Jie; Quintana, Elisa V.; Smith, Jeffrey C.; Thompson, Susan E.; Twicken, Joseph D. [SETI Institute/NASA Ames Research Center, Moffett Field, CA 94305 (United States); Haas, Michael R.; Henze, Christopher E.; Hunter, Roger C.; Sanderfer, Dwight T. [NASA Ames Research Center, Moffett Field, CA 94305 (United States); Campbell, Jennifer R.; Girouard, Forrest R., E-mail: peter.tenenbaum@nasa.gov [Orbital Sciences Corporation/NASA Ames Research Center, Moffett Field, CA 94305 (United States); and others

    2014-03-01

    We present the results of a search for potential transit signals in 4 yr of photometry data acquired by the Kepler mission. The targets of the search include 111,800 stars which were observed for the entire interval and 85,522 stars which were observed for a subset of the interval. We found that 9743 targets contained at least one signal consistent with the signature of a transiting or eclipsing object where the criteria for detection are periodicity of the detected transits, adequate signal-to-noise ratio, and acceptance by a number of tests which reject false positive detections. When targets that had produced a signal were searched repeatedly, an additional 6542 signals were detected on 3223 target stars, for a total of 16,285 potential detections. Comparison of the set of detected signals with a set of known and vetted transit events in the Kepler field of view shows that the recovery rate for these signals is 96.9%. The ensemble properties of the detected signals are reviewed.

  9. Direct detection of orchid viruses using nanorod-based fiber optic particle plasmon resonance immunosensor.

    Science.gov (United States)

    Lin, Hsing-Ying; Huang, Chen-Han; Lu, Sin-Hong; Kuo, I-Ting; Chau, Lai-Kwan

    2014-01-15

    A fiber optic particle plasmon resonance (FOPPR) immunosensor is developed for label-free detection of orchid viruses that use gold nanorods (AuNRs) as the sensing material. The AuNRs are employed to create a near-infrared sensing window to solve the color interference problem of sample matrix for direct sensing of target analyte. This work cannot be achieved using gold nanospheres (AuNSs) because the signal of sample color absorption largely overlaps the signal of molecular recognition events in the visible spectrum, making the signal interpretation much more difficult. The AuNRs are immobilized on the unclad fiber core surface, and functionalized by antibodies which can specifically recognize the corresponding Cymbidium mosaic virus (CymMV) or Odontoglossum ringspot virus (ORSV) for rapid viral infection diagnosis. The refractive index resolution of the AuNR-FOPPR sensor is estimated to be 8×10(-6) RIU. The limits of detection (LODs) for CymMV and ORSV in leaf saps are 48 and 42 pg/mL, respectively, which are better than the LODs of 1200 pg/mL for both viruses obtained by enzyme-linked immunosorbent assay (ELISA). Exploiting the AuNR-FOPPR sensing strategy not only solves the color interference problem encountered by using AuNSs, but provides faster analysis, better reproducibility, and lower detection limit than ELISA. The sensor can distinguish between healthy and infected orchids in 10 min, and can further provide the quantitative analysis of infection level. It is potentially applicable to the quality control of orchid cultivation industry, but not limited to this, especially for creating special spectral sensing window for particular samples. © 2013 Elsevier B.V. All rights reserved.

  10. Direct detection of sub-GeV dark matter with scintillating targets

    Science.gov (United States)

    Derenzo, Stephen; Essig, Rouven; Massari, Andrea; Soto, Adrián; Yu, Tien-Tien

    2017-07-01

    We suggest a novel experimental concept for detecting MeV-to-GeV-mass dark matter, in which the dark matter scatters off electrons in a scintillating target and produces a signal of one or a few photons. New large-area photodetectors are needed to measure the photon signal with negligible dark counts, which could be constructed from transition edge sensor (TES) or microwave kinetic inductance detector (MKID) technology. Alternatively, detecting two photons in coincidence may allow the use of conventional photodetectors like photomultiplier tubes. We describe why scintillators may have distinct advantages over other experiments searching for a low ionization signal from sub-GeV dark matter, as there are fewer potential sources of spurious backgrounds. We discuss various target choices, but focus on calculating the expected dark matter-electron scattering rates in three scintillating crystals: sodium iodide (NaI), cesium iodide (CsI), and gallium arsenide (GaAs). Among these, GaAs has the lowest band gap (1.52 eV) compared to NaI (5.9 eV) or CsI (6.4 eV), which in principle allows it to probe dark matter masses as low as ˜0.5 MeV , compared to ˜1.5 MeV with NaI or CsI. We compare these scattering rates with those expected in silicon (Si) and germanium (Ge). The proposed experimental concept presents an important complementary path to existing efforts, and its potential advantages may make it the most sensitive direct-detection probe of dark matter down to MeV masses.

  11. Study of the Method of Multi-Frequency Signal Detection Based on the Adaptive Stochastic Resonance

    Directory of Open Access Journals (Sweden)

    Zhenyu Lu

    2013-01-01

    Full Text Available Recently, the stochastic resonance effect has been widely used by the method of discovering and extracting weak periodic signals from strong noise through the stochastic resonance effect. The detection of the single-frequency weak signals by using stochastic resonance effect is widely used. However, the detection methods of the multifrequency weak signals need to be researched. According to the different frequency input signals of a given system, this paper puts forward a detection method of multifrequency signal by using adaptive stochastic resonance, which analyzed the frequency characteristics and the parallel number of the input signals, adjusted system parameters automatically to the low frequency signals in the fixed step size, and then measured the stochastic resonance phenomenon based on the frequency of the periodic signals to select the most appropriate indicators in the middle or high frequency. Finally, the optimized system parameters are founded and the frequency of the given signals is extracted in the frequency domain of the stochastic resonance output signals. Compared with the traditional detection methods, the method in this paper not only improves the work efficiency but also makes it more accurate by using the color noise, the frequency is more accurate being extracted from the measured signal. The consistency between the simulation results and analysis shows that this method is effective and feasible.

  12. Detection of an Alpha Rhythm of EEG Signal Based On EEGLAB

    Directory of Open Access Journals (Sweden)

    Samaneh Valipour,

    2014-01-01

    Full Text Available The EEG (Electroencephalogram is the electrical activity of brain that can be detected and measured by putting electrodes according to international 10-20 system on the scalp. There are four major frequency rhythms in EEG. Alpha is one of the frequency bands. This rhythm is very important because of its application in seizure suppression and for treatment of depression in biofeedback method. Hence detection of alpha band’s place and patient state has importance. However EEG waves contain useful information of brain, but we cannot see these information by observing in time domain directly. Hence we have to analyze these waveforms by signal processing techniques. In this paper, EEGLAB is used for processing and taking power spectrum density (PSD, which explains how the power of a signal is distributed with frequency. PSD of different subjects with open and closed eyes is shown in this paper. EEG data are downloaded from free database physionet in MIT/BIH database. It is observed that alpha rhythm in back of head and with closed eyes has dominant power in periodgram.

  13. Performance benchmarking and incentive regulation. Considerations of directing signals for electricity distribution companies

    Energy Technology Data Exchange (ETDEWEB)

    Honkapuro, S.

    2008-07-01

    After the restructuring process of the power supply industry, which for instance in Finland took place in the mid-1990s, free competition was introduced for the production and sale of electricity. Nevertheless, natural monopolies are found to be the most efficient form of production in the transmission and distribution of electricity, and therefore such companies remained franchised monopolies. To prevent the misuse of the monopoly position and to guarantee the rights of the customers, regulation of these monopoly companies is required. One of the main objectives of the restructuring process has been to increase the cost efficiency of the industry. Simultaneously, demands for the service quality are increasing. Therefore, many regulatory frameworks are being, or have been, reshaped so that companies are provided with stronger incentives for efficiency and quality improvements. Performance benchmarking has in many cases a central role in the practical implementation of such incentive schemes. Economic regulation with performance benchmarking attached to it provides companies with directing signals that tend to affect their investment and maintenance strategies. Since the asset lifetimes in the electricity distribution are typically many decades, investment decisions have far-reaching technical and economic effects. This doctoral thesis addresses the directing signals of incentive regulation and performance benchmarking in the field of electricity distribution. The theory of efficiency measurement and the most common regulation models are presented. The chief contributions of this work are (1) a new kind of analysis of the regulatory framework, so that the actual directing signals of the regulation and benchmarking for the electricity distribution companies are evaluated, (2) developing the methodology and a software tool for analysing the directing signals of the regulation and benchmarking in the electricity distribution sector, and (3) analysing the real

  14. Digital encoding and detection of voiceband data signals

    Science.gov (United States)

    Koneru, R. R.

    1980-12-01

    The codecs considered for investigation are Pulse Code Modulation (PCM), Differential PCM, and Delta Modulation operating at bit rates from 16 to 64 kb/sec. A central result of this study was the identification and evaluation of sampling phase differential effect present in a digital encoding system when sampling clock is not synchronous with an integral multiple of the data modern bit clock. PSK voiceband data signals are allowed to pass through these codecs that are designed for speech or data input signals. Digital encoders considered for investigation are ranked using the above performance metrics. Performance results of these coders are fully discussed and analyzed. Recognition algorithm for voiceband data, speech, and silence signals is developed for complete automation in digital channel efficiency models to achieve the optimum system performance. Pattern recognition approaches are sought to formulate and solve this problem. Maximum likelihood estimation procedure with recursive implementation of algorithm is developed.

  15. What can(not) be measured with ton-scale dark matter direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Pato, Miguel, E-mail: migpato@physik.uzh.ch [Institute for Theoretical Physics, University of Zürich, Winterthurerstrasse 190, CH-8057 (Switzerland)

    2011-10-01

    Direct searches for dark matter have prompted in recent years a great deal of excitement within the astroparticle physics community, but the compatibility between signal claims and null results of different experiments is far from being a settled issue. In this context, we study here the prospects for constraining the dark matter parameter space with the next generation of ton-scale detectors. Using realistic experimental capabilities for a wide range of targets (including fluorine, sodium, argon, germanium, iodine and xenon), the role of target complementarity is analysed in detail while including the impact of astrophysical uncertainties in a self-consistent manner. We show explicitly that a multi-target signal in future direct detection facilities can determine the sign of the ratio of scalar couplings f{sub n}/f{sub p}, but not its scale. This implies that the scalar-proton cross-section is left essentially unconstrained if the assumption f{sub p} ∼ f{sub n} is relaxed. Instead, we find that both the axial-proton cross-section and the ratio of axial couplings a{sub n}/a{sub p} can be measured with fair accuracy if multi-ton instruments using sodium and iodine will eventually come online. Moreover, it turns out that future direct detection data can easily discriminate between elastic and inelastic scatterings. Finally, we argue that, with weak assumptions regarding the WIMP couplings and the astrophysics, only the dark matter mass and the inelastic parameter (i.e. mass splitting) may be inferred from the recoil spectra — specifically, we anticipate an accuracy of tens of GeV (tens of keV) in the measurement of the dark matter mass (inelastic parameter)

  16. GEM-based TPC with CCD imaging for directional dark matter detection

    Science.gov (United States)

    Phan, N. S.; Lauer, R. J.; Lee, E. R.; Loomba, D.; Matthews, J. A. J.; Miller, E. H.

    2016-11-01

    The most mature directional dark matter experiments at present all utilize low-pressure gas Time Projection Chamber (TPC) technologies. We discuss some of the challenges for this technology, for which balancing the goal of achieving the best sensitivity with that of cost effective scale-up requires optimization over a large parameter space. Critical for this are the precision measurements of the fundamental properties of both electron and nuclear recoil tracks down to the lowest detectable energies. Such measurements are necessary to provide a benchmark for background discrimination and directional sensitivity that could be used for future optimization studies for directional dark matter experiments. In this paper we describe a small, high resolution, high signal-to-noise GEM-based TPC with a 2D CCD readout designed for this goal. The performance of the detector was characterized using alpha particles, X-rays, gamma-rays, and neutrons, enabling detailed measurements of electron and nuclear recoil tracks. Stable effective gas gains of greater than 1 × 105 were obtained in 100 Torr of pure CF4 by a cascade of three standard CERN GEMs each with a 140 μm pitch. The high signal-to-noise and sub-millimeter spatial resolution of the GEM amplification and CCD readout, together with low diffusion, allow for excellent background discrimination between electron and nuclear recoils down below ∼10 keVee (∼23 keVr fluorine recoil). Even lower thresholds, necessary for the detection of low mass WIMPs for example, might be achieved by lowering the pressure and utilizing full 3D track reconstruction. These and other paths for improvements are discussed, as are possible fundamental limitations imposed by the physics of energy loss.

  17. Differential and directional estrogenic signaling pathways induced by enterolignans and their precursors

    Science.gov (United States)

    Zhu, Yun; Kawaguchi, Kayoko; Kiyama, Ryoiti

    2017-01-01

    Mammalian lignans or enterolignans are metabolites of plant lignans, an important category of phytochemicals. Although they are known to be associated with estrogenic activity, cell signaling pathways leading to specific cell functions, and especially the differences among lignans, have not been explored. We examined the estrogenic activity of enterolignans and their precursor plant lignans and cell signaling pathways for some cell functions, cell cycle and chemokine secretion. We used DNA microarray-based gene expression profiling in human breast cancer MCF-7 cells to examine the similarities, as well as the differences, among enterolignans, enterolactone and enterodiol, and their precursors, matairesinol, pinoresinol and sesamin. The profiles showed moderate to high levels of correlation (R values: 0.44 to 0.81) with that of estrogen (17β-estradiol or E2). Significant correlations were observed among lignans (R values: 0.77 to 0.97), and the correlations were higher for cell functions related to enzymes, signaling, proliferation and transport. All the enterolignans/precursors examined showed activation of the Erk1/2 and PI3K/Akt pathways, indicating the involvement of rapid signaling through the non-genomic estrogen signaling pathway. However, when their effects on specific cell functions, cell cycle progression and chemokine (MCP-1) secretion were examined, positive effects were observed only for enterolactone, suggesting that signals are given in certain directions at a position closer to cell functions. We hypothesized that, while estrogen signaling is initiated by the enterolignans/precursors examined, their signals are differentially and directionally modulated later in the pathways, resulting in the differences at the cell function level. PMID:28152041

  18. Delay Pressure Detection Method to Eliminate Pump Pressure Interference on the Downhole Mud Pressure Signals

    OpenAIRE

    Yue Shen; Ling-Tan Zhang; Shi-Li Cui; Li-Min Sheng; Lin Li; Yi-Nao Su

    2013-01-01

    The feasibility of applying delay pressure detection method to eliminate mud pump pressure interference on the downhole mud pressure signals is studied. Two pressure sensors mounted on the mud pipe in some distance apart are provided to detect the downhole mud continuous pressure wave signals on the surface according to the delayed time produced by mud pressure wave transmitting between the two sensors. A mathematical model of delay pressure detection is built by analysis of transmission path...

  19. Mesodiencephalic dopaminergic neuronal differentiation does not involve GLI2A-mediated SHH-signaling and is under the direct influence of canonical WNT signaling.

    Science.gov (United States)

    Mesman, Simone; von Oerthel, Lars; Smidt, Marten P

    2014-01-01

    Sonic Hedgehog (SHH) and WNT proteins are key regulators in many developmental processes, like embryonic patterning and brain development. In the brain, SHH is expressed in a gradient starting in the floor plate (FP) progressing ventrally in the midbrain, where it is thought to be involved in the development and specification of mesodiencephalic dopaminergic (mdDA) neurons. GLI2A-mediated SHH-signaling induces the expression of Gli1, which is inhibited when cells start expressing SHH themselves. To determine whether mdDA neurons receive GLI2A-mediated SHH-signaling during differentiation, we used a BAC-transgenic mouse model expressing eGFP under the control of the Gli1 promoter. This mouse-model allowed for mapping of GLI2A-mediated SHH-signaling temporal and spatial in the mouse midbrain. Since mdDA neurons are born from E10.5, peaking at E11.0-E12.0, we examined Gli1-eGFP embryos at E11.5, E12.5, and E13.5, indicating whether Gli1 was induced before or during mdDA development and differentiation. Our data indicate that GLI2A-mediated SHH-signaling is not involved in mdDA neuronal differentiation. However, it appears to be involved in the differentiation of neurons which make up a subset of the red nucleus (RN). In order to detect whether mdDA neuronal differentiation may be under the control of canonical WNT-signaling, we used a transgenic mouse-line expressing LacZ under the influence of stable β-catenin. Here, we show that TH+ neurons of the midbrain receive canonical WNT-signaling during differentiation. Therefore, we suggest that early SHH-signaling is indirectly involved in mdDA development through early patterning of the midbrain area, whereas canonical WNT-signaling is directly involved in the differentiation of the mdDA neuronal population.

  20. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    Science.gov (United States)

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  1. An implementation of anger detection in speech signals

    NARCIS (Netherlands)

    Mohamoud, A.A.; Maris, M.G.

    2008-01-01

    In this paper, an emotion classification system based on speech signals is presented. The classifier can identify the most common emotions, namely anger, neutral, happiness and fear. The algorithm computes a number of acoustic features which are fed into the classifier based on a pattern recognition

  2. Detecting Fleeting MRI Signals with Frequency-Modulated Pulses

    Science.gov (United States)

    Kobayashi, Naoharu; Idiyatullin, Djaudat; Corum, Curtis; Moeller, Steen; Chamberlain, Ryan; O'Connell, Robert; Nixdorf, Donald R.; Garwood, Michael

    2012-01-01

    We describe a fundamentally different approach to MRI referred to as SWIFT (sweep imaging with Fourier transformation). SWIFT exploits time-shared RF excitation and signal acquisition, allowing capture of signal from spins with extremely short transverse relaxation time, T2*. The MR signal is acquired in gaps inserted into a broadband frequency-swept excitation pulse, which results in acquisition delays of only 1 – 2 microseconds. In SWIFT, 3D k-space is sampled in a radial manner, whereby one projection of the object is acquired in the gaps of each frequency-swept pulse, allowing a repetition time (TR) on the order of the pulse length (typically 1 – 3 milliseconds). Since the orientation of consecutive projections varies in a smooth manner (i.e., only small increments in the values of the x, y, z gradients occur from view to view), SWIFT scanning is close to inaudible and is insensitive to gradient timing errors and eddy currents. SWIFT images can be acquired in scan times similar to and sometimes faster than conventional 3D gradient echo techniques. With its ability to capture signals from ultrashort T2* spins, SWIFT promises to expand the role of MRI in areas of research where MRI previously played no or negligible role. In this article, we show wood and tooth images obtained with SWIFT as examples of materials with ultrashort T2*. Early experience suggests SWIFT can play a role in materials science and porous media research. PMID:22661791

  3. An implementation of anger detection in speech signals

    NARCIS (Netherlands)

    Mohamoud, A.A.; Maris, M.G.

    2008-01-01

    In this paper, an emotion classification system based on speech signals is presented. The classifier can identify the most common emotions, namely anger, neutral, happiness and fear. The algorithm computes a number of acoustic features which are fed into the classifier based on a pattern recognition

  4. Layered ACO-OFDM for intensity-modulated direct-detection optical wireless transmission.

    Science.gov (United States)

    Wang, Qi; Qian, Chen; Guo, Xuhan; Wang, Zhaocheng; Cunningham, David G; White, Ian H

    2015-05-04

    Layered asymmetrically clipped optical orthogonal frequency division multiplexing (ACO-OFDM) with high spectral efficiency is proposed in this paper for optical wireless transmission employing intensity modulation with direct detection. In contrast to the conventional ACO-OFDM, which only utilizes odd subcarriers for modulation, leading to an obvious spectral efficiency loss, in layered ACO-OFDM, the subcarriers are divided into different layers and modulated by different kinds of ACO-OFDM, which are combined for simultaneous transmission. In this way, more subcarriers are used for data transmission and the spectral efficiency is improved. An iterative receiver is also proposed for layered ACO-OFDM, where the negative clipping distortion of each layer is subtracted once it is detected so that the signals from different layers can be recovered. Theoretical analysis shows that the proposed scheme can improve the spectral efficiency by up to 2 times compared with conventional ACO-OFDM approaches with the same modulation order. Meanwhile, simulation results confirm a considerable signal-to-noise ratio gain over ACO-OFDM at the same spectral efficiency.

  5. Detection of Potential Transit Signals in Sixteen Quarters of Kepler Mission Data

    CERN Document Server

    Tenenbaum, Peter; Seader, Shawn; Burke, Christopher J; Christiansen, Jessie L; Rowe, Jason F; Caldwell, Douglas A; Clarke, Bruce D; Coughlin, Jeffrey L; Li, Jie; Quintana, Elisa V; Smith, Jeffrey C; Thompson, Susan E; Twicken, Joseph D; Haas, Michael R; Henze, Christopher E; Hunter, Roger C; Sanderfer, Dwight T; Campbell, Jennifer R; Girouard, Forrest R; Klaus, Todd C; McCauliff, Sean D; Middour, Christopher K; Sabale, Anima; Uddin, Akm Kamal; Wohler, Bill; Barclay, Thomas; Still, Martin

    2013-01-01

    We present the results of a search for potential transit signals in four years of photometry data acquired by the Kepler Mission. The targets of the search include 111,800 stars which were observed for the entire interval and 85,522 stars which were observed for a subset of the interval. We observed that 9,743 targets contained at least one signal consistent with the signature of a transiting planet, where the criteria for detection are periodicity of the detected transits, adequate signal-to-noise ratio, and acceptance by a number of tests which reject false positive detections. When targets that had produced a signal were searched repeatedly, an additional 6,542 signals were detected on 3,223 target stars, for a total of 16,285 potential transiting planet signatures. Comparison of the set of detected signals with a set of known and vetted transit events in the Kepler field of view shows that the recovery rate for these signals is 97.0%. The ensemble properties of the detected signals are reviewed.

  6. Direction of visual apparent motion driven by perceptual organization of cross-modal signals.

    Science.gov (United States)

    Roseboom, Warrick; Kawabe, Takahiro; Nishida, Shin'ya

    2013-01-04

    A critical function of the human brain is to determine the relationship between sensory signals. In the case of signals originating from different sensory modalities, such as audition and vision, several processes have been proposed that may facilitate perception of correspondence between two signals despite any temporal discrepancies in physical or neural transmission. One proposal, temporal ventriloquism, suggests that audio-visual temporal discrepancies can be resolved with a capture of visual event timing by that of nearby auditory events. Such an account implies a fundamental change in the timing representations of the involved events. Here we examine if such changes are necessary to account for a recently demonstrated effect, the modulation of visual apparent motion direction by audition. By contrast, we propose that the effect is driven by segmentation of the visual sequence on the basis of perceptual organization in the cross-modal sequence. Using different sequences of cross-modal (auditory and tactile) events, we found that the direction of visual apparent motion was not consistent with a temporal capture explanation. Rather, reports of visual apparent motion direction were dictated by perceptual organization within cross-modal sequences, determined on the basis of apparent relatedness. This result adds to the growing literature indicating the importance of apparent relatedness and sequence segmentation in apparent timing. Moreover, it demonstrates that, contrary to previous findings, cross-modal interaction can play a critical role in determining organization of signals within a single sensory modality.

  7. DETECTION OF POTENTIAL TRANSIT SIGNALS IN THE FIRST THREE QUARTERS OF Kepler MISSION DATA

    Energy Technology Data Exchange (ETDEWEB)

    Tenenbaum, Peter; Christiansen, Jessie L.; Jenkins, Jon M.; Rowe, Jason F.; Seader, Shawn; Caldwell, Douglas A.; Clarke, Bruce D.; Li, Jie; Quintana, Elisa V.; Smith, Jeffrey C.; Stumpe, Martin C.; Thompson, Susan E.; Twicken, Joseph D.; Van Cleve, Jeffrey [SETI Institute/NASA Ames Research Center, Moffett Field, CA 94305 (United States); Borucki, William J.; Cote, Miles T.; Haas, Michael R.; Sanderfer, Dwight T. [NASA Ames Research Center, Moffett Field, CA 94305 (United States); Girouard, Forrest R.; Klaus, Todd C., E-mail: peter.tenenbaum@nasa.gov [Orbital Sciences Corporation/NASA Ames Research Center, Moffett Field, CA 94305 (United States); and others

    2012-03-01

    We present the results of a search for potential transit signals in the first three quarters of photometry data acquired by the Kepler mission. The targets of the search include 151,722 stars which were observed over the full interval and an additional 19,132 stars which were observed for only one or two quarters. From this set of targets we find a total of 5392 detections which meet the Kepler detection criteria: those criteria are periodicity of signal, an acceptable signal-to-noise ratio, and a composition test which rejects spurious detections which contain non-physical combinations of events. The detected signals are dominated by events with relatively low signal-to-noise ratio and by events with relatively short periods. The distribution of estimated transit depths appears to peak in the range between 40 and 100 parts per million, with a few detections down to fewer than 10 parts per million. The detections exhibit signal-to-noise ratios from 7.1{sigma}, which is the lower cutoff for detections, to over 10,000{sigma}, and periods ranging from 0.5 days, which is the lower cutoff used in the procedure, to 109 days, which is the upper limit of achievable periods given the length of the data set and the criteria used for detections. The detected signals are compared to a set of known transit events in the Kepler field of view which were derived by a different method using a longer data interval; the comparison shows that the current search correctly identified 88.1% of the known events. A tabulation of the detected transit signals, examples which illustrate the analysis and detection process, a discussion of future plans and open, potentially fruitful, areas of further research are included.

  8. Demonstration of DFT-spread 256QAM-OFDM signal transmission with cost-effective directly modulated laser.

    Science.gov (United States)

    Li, Fan; Yu, Jianjun; Fang, Yuan; Dong, Ze; Li, Xinying; Chen, Lin

    2014-04-07

    We experimentally demonstrated a 256-ary quadrature amplitude modulation (256QAM) direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) transmission system utilizing a cost-effective directly modulated laser (DML). Intra-symbol frequency-domain averaging (ISFA) is applied to suppress in-band noise while the channel response estimation and Discrete Fourier Transform-spread (DFT-spread) is used to reduce the peak-to-average power ratio (PAPR) of the transmitted OFDM signal. The bit-error ratio (BER) of 15-Gbit/s 256QAM-OFDM signal has been measured after 20-km SSMF transmission that is less than 7% forward-error-correction (FEC) threshold of 3.8 × 10(-3) as the launch power into fiber is set at 6dBm. For 11.85-Gbit/s 256QAM-OFDM signal, with the aid of ISFA-based channel estimation and PAPR reduction enabled by DFT-spread, the BER after 20-km SSMF transmission can be improved from 6.4 × 10(-3) to 6.8 × 10(-4) when the received optical power is -6dBm.

  9. Dissociation between judgments and outcome-expectancy measures in covariation learning: a signal detection theory approach.

    Science.gov (United States)

    Perales, José C; Catena, Andrés; Shanks, David R; González, José A

    2005-09-01

    A number of studies using trial-by-trial learning tasks have shown that judgments of covariation between a cue c and an outcome o deviate from normative metrics. Parameters based on trial-by-trial predictions were estimated from signal detection theory (SDT) in a standard causal learning task. Results showed that manipulations of P(c) when contingency (deltaP) was held constant did not affect participants' ability to predict the appearance of the outcome (d') but had a significant effect on response criterion (c) and numerical causal judgments. The association between criterion c and judgment was further demonstrated in 2 experiments in which the criterion was directly manipulated by linking payoffs to the predictive responses made by learners. In all cases, the more liberal the criterion c was, the higher judgments were. The results imply that the mechanisms underlying the elaboration of judgments and those involved in the elaboration of predictive responses are partially dissociable.

  10. A detection method of laser doppler signal based on topo-logical contravariance

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yu-cun; LIU Hai-bin

    2009-01-01

    To detect the laser doppler signal, the unknown signal is tracked by the known signal using the concept of topological contravarisnce. The unknown topological space U and known space Mare founded, and then the unknown signal's trans-formation is tracked dynamically according to this mapping relationship between the two spaces. The system equation is obtained by gradient-descent method, and the conditions of stability are given by Poincare mapping. The proposed method is applied to measure the in-plane displacement signal of the solid 50 m away using laser doppler, signal The result proves that the method can detect laser doppler, signal accurately, its relative error is less than 0.7%.

  11. Detection of Chondromalacia Patellae by Analysis of Intrinsic Mode Functions in Knee-Joint Vibration Signals

    Institute of Scientific and Technical Information of China (English)

    WU Yun-feng; CAI Su-xian; XU Fang; SHI Lei; Sridhar Krishnan

    2014-01-01

    This paper presents the knee-joint vibration signal processing and pathological localization procedures using the empirical mode decomposition for patients with chondromalacia patellae. The artifacts of baseline wander and random noise were identified in the decomposed monotonic trend and intrinsic mode functions (IMF) using the modeling method of probability density function and the confidence limit criterion. Then, the fluctuation parts in the signal were detected by the signal method turning for count. The results demonstrated that the quality of reconstructed signal can be greatly improved, with the removal of the baseline wander (adaptive trend) and the Gaussian distributed random noise. By detecting the turn signals in the artifact-free signal, the pathological segments related to chondromalacia patellae can be effectively localized with the beginning and ending points of the span of turn signals.

  12. Direct Detection of Extra-Solar Comets is Possible

    OpenAIRE

    Jura, M.

    2005-01-01

    The dust tails of comets similar to Hale-Bopp can scatter as much optical light as does the Earth. Space-based observatories such as the Terrestrial Planet Finder or Darwin that will detect extra-solar terrestrial planets also will be able to detect extra-solar comets.

  13. NLOS Signal Detection Based on Single Orthogonal Dual-Polarized GNSS Antenna

    Directory of Open Access Journals (Sweden)

    Ke Zhang

    2017-01-01

    Full Text Available Nowadays users have a high demand for the accuracy of position and velocity, but errors caused by non-line-of-sight (NLOS signals cannot be removed effectively. Since the GNSS signal is right-hand circular polarized (RHCP, the axial ratio of the strong NLOS signal is larger than that of the Line-of-Sight (LOS signal. Based on the difference of the axial ratio, a method for NLOS signal detection using single orthogonal dual-polarized antenna is proposed. The antenna has two channels to receive two orthogonal linear polarized components of the incoming signals. Parallel cross-cancellation is used to remove the LOS signal while maintaining most of the NLOS signals from the receiving signals. The residual NLOS signals are then detected by conventional GNSS digital processor in real time without any prior knowledge of their characteristics. The proposed method makes use of the polarization and spatial information and can detect long delay NLOS signal by miniature and inexpensive receiver GNSS. The effectiveness of the proposed method is confirmed by simulation data.

  14. Nonlinear real-life signal detection with a supervised principal components analysis.

    Science.gov (United States)

    Zhou, C T; Cai, T X; Cai, T F

    2007-03-01

    A novel strategy named supervised principal components analysis for the detection of a target signal of interest embedded in an unknown noisy environment has been investigated. There are two channels in our detection scheme. Each channel consists of a nonlinear phase-space reconstructor (for embedding a data matrix using the received time series) and a principal components analyzer (for feature extraction), respectively. The output error time series, which results from the difference of both eigenvectors of the correlation data matrices from these two channels, is then analyzed using time-frequency tools, for example, frequency spectrum or Wigner-Ville distribution. Experimental results based on real-life electromagnetic data are presented to demonstrate the detection performance of our algorithm. It is found that weak signals hidden beneath the noise floor can be detected. Furthermore, the robustness of the detection performance clearly illustrated that signal frequencies can be extracted when the signal power is not too low.

  15. Surface-wave-enabled darkfield aperture for background suppression during weak signal detection.

    Science.gov (United States)

    Zheng, Guoan; Cui, Xiquan; Yang, Changhuei

    2010-05-18

    Sensitive optical signal detection can often be confounded by the presence of a significant background, and, as such, predetection background suppression is substantively important for weak signal detection. In this paper, we present a novel optical structure design, termed surface-wave-enabled darkfield aperture (SWEDA), which can be directly incorporated onto optical sensors to accomplish predetection background suppression. This SWEDA structure consists of a central hole and a set of groove pattern that channels incident light to the central hole via surface plasmon wave and surface-scattered wave coupling. We show that the surface wave component can mutually cancel the direct transmission component, resulting in near-zero net transmission under uniform normal incidence illumination. Here, we report the implementation of two SWEDA structures. The first structure, circular-groove-based SWEDA, is able to provide polarization-independent suppression of uniform illumination with a suppression factor of 1230. The second structure, linear-groove-based SWEDA, is able to provide a suppression factor of 5080 for transverse-magnetic wave and can serve as a highly compact (5.5 micrometer length) polarization sensor (the measured transmission ratio of two orthogonal polarizations is 6100). Because the exact destructive interference balance is highly delicate and can be easily disrupted by the nonuniformity of the localized light field or light field deviation from normal incidence, the SWEDA can therefore be used to suppress a bright background and allow for sensitive darkfield sensing and imaging (observed image contrast enhancement of 27 dB for the first SWEDA).

  16. Vestibular and Attractor Network Basis of the Head Direction Cell Signal in Subcortical Circuits

    Directory of Open Access Journals (Sweden)

    Benjamin J Clark

    2012-03-01

    Full Text Available Accurate navigation depends on a network of neural systems that encode the moment-to-moment changes in an animal’s directional orientation and location in space. Within this navigation system are head direction (HD cells, which fire persistently when an animal’s head is pointed in a particular direction (Sharp et al., 2001a; Taube, 2007. HD cells are widely thought to underlie an animal’s sense of spatial orientation, and research over the last 25+ years has revealed that this robust spatial signal is widely distributed across subcortical and cortical limbic areas. Much of this work has been directed at understanding the functional organization of the HD cell circuitry, and precisely how this signal is generated from sensory and motor systems. The purpose of the present review is to summarize some of the recent studies arguing that the HD cell circuit is largely processed in a hierarchical fashion, following a pathway involving the dorsal tegmental nuclei → lateral mammillary nuclei → anterior thalamus → parahippocampal and retrosplenial cortical regions. We also review recent work identifying bursting cellular activity in the HD cell circuit after lesions of the vestibular system, and relate these observations to the long held view that attractor network mechanisms underlie HD signal generation. Finally, we summarize the work to date suggesting that this network architecture may reside within the tegmento-mammillary circuit.

  17. Colorless detection of NRZ-DPSK signals using electro-optic clock re-modulation

    DEFF Research Database (Denmark)

    Zsigri, Beata; Tokle, Torger; Peucheret, Christophe

    2010-01-01

    Wavelength-independent detection of NRZ-DPSK signals is proposed and demonstrated at 43 Gbit/s. The scheme relies on re-modulation of the incoming NRZ-DPSK signal with a recovered electrical clock. Good performance is obtained after dispersion managed transmission.......Wavelength-independent detection of NRZ-DPSK signals is proposed and demonstrated at 43 Gbit/s. The scheme relies on re-modulation of the incoming NRZ-DPSK signal with a recovered electrical clock. Good performance is obtained after dispersion managed transmission....

  18. Fisher-information condition for enhanced signal detection via stochastic resonance.

    Science.gov (United States)

    Duan, Fabing; Chapeau-Blondeau, François; Abbott, Derek

    2011-11-01

    Various situations where a signal is enhanced by noise through stochastic resonance are now known. This paper contributes to determining general conditions under which improvement by noise can be a priori decided as feasible or not. We focus on the detection of a known signal in additive white noise. Under the assumptions of a weak signal and a sufficiently large sample size, it is proved, with an inequality based on the Fisher information, that improvement by adding noise is never possible, generically, in these conditions. However, under less restrictive conditions, an example of signal detection is shown with favorable action of adding noise.

  19. Detection and Parameter Estimation of Multicomponent LFM Signal Based on the Cubic Phase Function

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Jiang

    2008-05-01

    Full Text Available A new algorithm for the detection and parameters estimation of LFM signal is presented in this paper. By the computation of the cubic phase function (CPF of the signal, it is shown that the CPF is concentrated along the frequency rate law of the signal, and the peak of the CPF yields the estimate of the frequency rate. The initial frequency and amplitude can be obtained by the dechirp technique and fast Fourier transform. And for multicomponent signal, the CLEAN technique combined with the CPF is proposed to detect the weak components submerged by the stronger components. The statistical performance is analyzed and the simulation results are shown simultaneously.

  20. The impact of baryons on the direct detection of dark matter

    Science.gov (United States)

    Kelso, Chris; Savage, Christopher; Valluri, Monica; Freese, Katherine; Stinson, Gregory S.; Bailin, Jeremy

    2016-08-01

    The spatial and velocity distributions of dark matter particles in the Milky Way Halo affect the signals expected to be observed in searches for dark matter. Results from direct detection experiments are often analyzed assuming a simple isothermal distribution of dark matter, the Standard Halo Model (SHM). Yet there has been skepticism regarding the validity of this simple model due to the complicated gravitational collapse and merger history of actual galaxies. In this paper we compare the SHM to the results of cosmological hydrodynamical simulations of galaxy formation to investigate whether or not the SHM is a good representation of the true WIMP distribution in the analysis of direct detection data. We examine two Milky Way-like galaxies from the MaGICC cosmological simulations (a) with dark matter only and (b) with baryonic physics included. The inclusion of baryons drives the shape of the DM halo to become more spherical and makes the velocity distribution of dark matter particles less anisotropic especially at large heliocentric velocities, thereby making the SHM a better fit. We also note that we do not find a significant disk-like rotating dark matter component in either of the two galaxy halos with baryons that we examine, suggesting that dark disks are not a generic prediction of cosmological hydrodynamical simulations. We conclude that in the Solar neighborhood, the SHM is in fact a good approximation to the true dark matter distribution in these cosmological simulations (with baryons) which are reasonable representations of the Milky Way, and hence can also be used for the purpose of dark matter direct detection calculations.