WorldWideScience

Sample records for direct detection constraints

  1. Direct detection constraints on dark photon dark matter

    Directory of Open Access Journals (Sweden)

    Haipeng An

    2015-07-01

    Full Text Available Dark matter detectors built primarily to probe elastic scattering of WIMPs on nuclei are also precise probes of light, weakly coupled, particles that may be absorbed by the detector material. In this paper, we derive constraints on the minimal model of dark matter comprised of long-lived vector states V (dark photons in the 0.01–100 keV mass range. The absence of an ionization signal in direct detection experiments such as XENON10 and XENON100 places a very strong constraint on the dark photon mixing angle, down to O(10−15, assuming that dark photons comprise the dominant fraction of dark matter. This sensitivity to dark photon dark matter exceeds the indirect bounds derived from stellar energy loss considerations over a significant fraction of the available mass range. We also revisit indirect constraints from V→3γ decay and show that limits from modifications to the cosmological ionization history are comparable to the updated limits from the diffuse γ-ray flux.

  2. Self-interacting dark matter without direct detection constraints

    Science.gov (United States)

    Zhang, Yue

    2017-03-01

    We explore the self-interacting dark matter scenario in a simple dark sector model where the dark matter interacts through a dark photon. Splitting a Dirac fermion dark matter into two levels using a small Majorana mass can evade strong direct detection constraints on the kinetic mixing between the dark and normal photons, thus allowing the dark sector to be more visible at high intensity and/or high energy experiments. It is pointed out that such a mass splitting has a strong impact on the dark matter self-interaction strength. We derive the new parameter space of a pseudo-Dirac self-interacting dark matter. Interestingly, with increasing mass splitting, a weak scale dark matter mass window survives that could be probed by the LHC and future colliders.

  3. First Direct-Detection Constraints on eV-Scale Hidden-Photon Dark Matter with DAMIC at SNOLAB

    Energy Technology Data Exchange (ETDEWEB)

    Aguilar-Arevalo, A.; Amidei, D.; Bertou, X.; Butner, M.; Cancelo, G.; Castañeda Vázquez, A.; Cervantes Vergara, B. A.; Chavarria, A. E.; Chavez, C. R.; de Mello Neto, J. R. T.; D’Olivo, J. C.; Estrada, J.; Fernandez Moroni, G.; Gaïor, R.; Guardincerri, Y.; Hernández Torres, K. P.; Izraelevitch, F.; Kavner, A.; Kilminster, B.; Lawson, I.; Letessier-Selvon, A.; Liao, J.; Matalon, A.; Mello, V. B. B.; Molina, J.; Privitera, P.; Ramanathan, K.; Sarkis, Y.; Schwarz, T.; Settimo, M.; Sofo Haro, M.; Thomas, R.; Tiffenberg, J.; Tiouchichine, E.; Torres Machado, D.; Trillaud, F.; You, X.; Zhou, J.

    2017-04-05

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30 eV$c^{-2}$ with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter $\\kappa$ is competitive with constraints from solar emission, reaching a minimum value of 2.2$\\times$$10^{-14}$ at 17 eV$c^{-2}$. These results are the most stringent direct detection constraints on hidden-photon dark matter with masses 3-12 eV$c^{-2}$ and the first demonstration of direct experimental sensitivity to ionization signals $<$12 eV from dark matter interactions.

  4. First Direct-Detection Constraints on eV-Scale Hidden-Photon Dark Matter with DAMIC at SNOLAB.

    Science.gov (United States)

    Aguilar-Arevalo, A; Amidei, D; Bertou, X; Butner, M; Cancelo, G; Castañeda Vázquez, A; Cervantes Vergara, B A; Chavarria, A E; Chavez, C R; de Mello Neto, J R T; D'Olivo, J C; Estrada, J; Fernandez Moroni, G; Gaïor, R; Guardincerri, Y; Hernández Torres, K P; Izraelevitch, F; Kavner, A; Kilminster, B; Lawson, I; Letessier-Selvon, A; Liao, J; Matalon, A; Mello, V B B; Molina, J; Privitera, P; Ramanathan, K; Sarkis, Y; Schwarz, T; Settimo, M; Sofo Haro, M; Thomas, R; Tiffenberg, J; Tiouchichine, E; Torres Machado, D; Trillaud, F; You, X; Zhou, J

    2017-04-07

    We present direct detection constraints on the absorption of hidden-photon dark matter with particle masses in the range 1.2-30  eV c^{-2} with the DAMIC experiment at SNOLAB. Under the assumption that the local dark matter is entirely constituted of hidden photons, the sensitivity to the kinetic mixing parameter κ is competitive with constraints from solar emission, reaching a minimum value of 2.2×10^{-14} at 17  eV c^{-2}. These results are the most stringent direct detection constraints on hidden-photon dark matter in the galactic halo with masses 3-12  eV c^{-2} and the first demonstration of direct experimental sensitivity to ionization signals dark matter interactions.

  5. Reliance on constraints means detection of information

    NARCIS (Netherlands)

    Jacobs, D.M.; Runeson, S.; Andersson, I.E.K.

    2001-01-01

    We argue four points. First, perception always relies on environmental constraints, not only in special cases. Second, constraints are taken advantage of by detecting information granted by the constraints rather than by internalizing them. Third, apparent motion phenomena reveal reliance on

  6. Detecting Cliques Using Degree and Connectivity Constraints

    OpenAIRE

    Abhay Avinash Bhamaikar; Pralhad Ramchandra Rao

    2012-01-01

    In graph mining determining clique is np complete problem. This paper introduces pruning strategies, by which linear time algorithm for detecting clique is obtained. Clique determination is widely applicable in social network analysis. In social network analysis cliques signifies that each person in the network knows every other person in the group. Here pruning is done using edge connectivity and degree constraints. Initially the graph (g) is checked for a bridge, if it is detected, then g...

  7. Direct energy functional minimization under orthogonality constraints

    Science.gov (United States)

    Weber, Valéry; VandeVondele, Joost; Hutter, Jürg; Niklasson, Anders M. N.

    2008-02-01

    The direct energy functional minimization problem in electronic structure theory, where the single-particle orbitals are optimized under the constraint of orthogonality, is explored. We present an orbital transformation based on an efficient expansion of the inverse factorization of the overlap matrix that keeps orbitals orthonormal. The orbital transformation maps the orthogonality constrained energy functional to an approximate unconstrained functional, which is correct to some order in a neighborhood of an orthogonal but approximate solution. A conjugate gradient scheme can then be used to find the ground state orbitals from the minimization of a sequence of transformed unconstrained electronic energy functionals. The technique provides an efficient, robust, and numerically stable approach to direct total energy minimization in first principles electronic structure theory based on tight-binding, Hartree-Fock, or density functional theory. For sparse problems, where both the orbitals and the effective single-particle Hamiltonians have sparse matrix representations, the effort scales linearly with the number of basis functions N in each iteration. For problems where only the overlap and Hamiltonian matrices are sparse the computational cost scales as O(M2N ), where M is the number of occupied orbitals. We report a single point density functional energy calculation of a DNA decamer hydrated with 4003 water molecules under periodic boundary conditions. The DNA fragment containing a cis-syn thymine dimer is composed of 634 atoms and the whole system contains a total of 12 661 atoms and 103 333 spherical Gaussian basis functions.

  8. Directive deficiencies: How resource constraints direct opportunity identification in SMEs

    NARCIS (Netherlands)

    Burg, van J.C.; Podoynitsyna, K.S.; Beck, Lien; Lommelen, T.

    2012-01-01

    Previous studies show that resource constraints have mixed effects on innovation and opportunity identification by entrepreneurs. Sometimes, resource constraints lead to identifying more opportunities, whereas in other cases entrepreneurs rather see fewer opportunities. This study explores a new

  9. Automatic Constraint Detection for 2D Layout Regularization.

    Science.gov (United States)

    Jiang, Haiyong; Nan, Liangliang; Yan, Dong-Ming; Dong, Weiming; Zhang, Xiaopeng; Wonka, Peter

    2016-08-01

    In this paper, we address the problem of constraint detection for layout regularization. The layout we consider is a set of two-dimensional elements where each element is represented by its bounding box. Layout regularization is important in digitizing plans or images, such as floor plans and facade images, and in the improvement of user-created contents, such as architectural drawings and slide layouts. To regularize a layout, we aim to improve the input by detecting and subsequently enforcing alignment, size, and distance constraints between layout elements. Similar to previous work, we formulate layout regularization as a quadratic programming problem. In addition, we propose a novel optimization algorithm that automatically detects constraints. We evaluate the proposed framework using a variety of input layouts from different applications. Our results demonstrate that our method has superior performance to the state of the art.

  10. Automatic Constraint Detection for 2D Layout Regularization

    KAUST Repository

    Jiang, Haiyong

    2015-09-18

    In this paper, we address the problem of constraint detection for layout regularization. As layout we consider a set of two-dimensional elements where each element is represented by its bounding box. Layout regularization is important for digitizing plans or images, such as floor plans and facade images, and for the improvement of user created contents, such as architectural drawings and slide layouts. To regularize a layout, we aim to improve the input by detecting and subsequently enforcing alignment, size, and distance constraints between layout elements. Similar to previous work, we formulate the layout regularization as a quadratic programming problem. In addition, we propose a novel optimization algorithm to automatically detect constraints. In our results, we evaluate the proposed framework on a variety of input layouts from different applications, which demonstrates our method has superior performance to the state of the art.

  11. Direct constraints on GIA motion in North America using GPS

    Science.gov (United States)

    Sella, G. F.; Stein, S.; Wdowinski, S.; Dixon, T. H.; Craymer, M.; James, T.

    2004-05-01

    We use continuous and episodic Global Positioning System (GPS) data to measure the movement caused by glacial isostatic adjustment (GIA) due to glacial unloading in eastern North America. At present it is challenging to quantify GIA motion in North American due to the limited number of continuous GPS sites (CGPS) in and around Hudson Bay, the area of maximum glacial loading. Episodic GPS (EGPS) sites provide a low cost and higher density alternative, but often have large errors, especially in the vertical. However, the large vertical signal due to GIA (>10mm/yr) in the area of maximum uplift permits this motion to be resolved, even with EGPS data. We present data from 130 CGPS sites throughout North America and almost 100 EGPS sites of the Canadian Base Network (CBN). The CBN sites are located across central and southern Canada and have been episodically occupied between 1994 and 2002. We detect a coherent pattern of vertical motions around the area of maximum glacial loading, Hudson Bay. The observed velocities are initially large and upward, and decrease southward from Hudson Bay to zero, delineating the hinge line near the Great Lakes. The position of the hinge line is in agreement with some numerical GIA predictions. The horizontal residual velocities after removing the motion of the rigid North American plate also show a consistent, but more complex pattern than the vertical velocities. In particular we observe larger than expected motions on the east side of the Canadian Rocky Mountains, possibly reflecting larger ice loads and/or changes in mantle viscosity. We believe that this velocity field provides the first comprehensive direct description of GIA motion and can be used to constrain GIA model predictions.

  12. Constraints on the detection of cryovolcanic plumes on Europa

    Science.gov (United States)

    Quick, Lynnae C.; Barnouin, Olivier S.; Prockter, Louise M.; Patterson, G. Wesley

    2013-09-01

    Surface venting is a common occurrence on several outer solar system satellites. Spacecraft have observed plumes erupting from the geologically young surfaces of Io, Triton and Enceladus. Europa also has a relatively young surface and previous studies have suggested that cryovolcanic eruptions may be responsible for the production of low-albedo deposits surrounding lenticulae and along triple band margins and lineae. Here, we have used the projected thicknesses of these deposits as constraints to determine the lifetimes of detectable cryovolcanic plumes that may have emplaced them. In an effort to explore the feasibility of detection of the particle component of plumes by spacecraft cameras operating at visible wavelengths, we present a conservative model to estimate plume characteristics such as height, eruption velocity, and optical depth under a variety of conditions. We find that cryovolcanic plumes on Europa are likely to be fairly small in stature with heights between 2.5 and 26 km, and eruption velocities between 81 and 261 m/s, respectively. Under these conditions and assuming that plumes are products of steady eruptions with particle radii of 0.5 μm, our model suggests that easily detectable plumes will have optical depths, τ, greater than or equal to 0.04, and that their lifetimes may be no more than 300,000 years. Plume detection may be possible if high phase angle limb observations and/or stereo imaging of the surface are undertaken in areas where eruptive activity is likely to occur. Cameras with imaging resolutions greater than 50 m/pixel should be used to make all observations. Future missions could employ the results of our model in searches for plume activity at Europa.

  13. Evading direct dark matter detection in Higgs portal models

    Energy Technology Data Exchange (ETDEWEB)

    Arcadi, Giorgio [Max Planck Institut für Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); Gross, Christian, E-mail: christian.gross@helsinki.fi [Department of Physics and Helsinki Institute of Physics, Gustaf Hällströmin katu 2, FI-00014 Helsinki (Finland); Lebedev, Oleg [Department of Physics and Helsinki Institute of Physics, Gustaf Hällströmin katu 2, FI-00014 Helsinki (Finland); Pokorski, Stefan [Institute of Theoretical Physics, University of Warsaw, Pasteura 5, PL-02-093 Warsaw (Poland); Toma, Takashi [Physik-Department T30d, Technische Universität München, James-Franck-Straße, D-85748 Garching (Germany)

    2017-06-10

    Many models of Higgs portal Dark Matter (DM) find themselves under pressure from increasingly tight direct detection constraints. In the framework of gauge field DM, we study how such bounds can be relaxed while retaining the thermal WIMP paradigm. When the hidden sector gauge symmetry is broken via the Higgs mechanism, the hidden sector generally contains unstable states which are lighter than dark matter. These states provide DM with an efficient annihilation channel. As a result, the DM relic abundance and the direct detection limits are controlled by different parameters, and the two can easily be reconciled. This simple setup realizes the idea of “secluded” dark matter naturally.

  14. Evading direct dark matter detection in Higgs portal models

    Directory of Open Access Journals (Sweden)

    Giorgio Arcadi

    2017-06-01

    Full Text Available Many models of Higgs portal Dark Matter (DM find themselves under pressure from increasingly tight direct detection constraints. In the framework of gauge field DM, we study how such bounds can be relaxed while retaining the thermal WIMP paradigm. When the hidden sector gauge symmetry is broken via the Higgs mechanism, the hidden sector generally contains unstable states which are lighter than dark matter. These states provide DM with an efficient annihilation channel. As a result, the DM relic abundance and the direct detection limits are controlled by different parameters, and the two can easily be reconciled. This simple setup realizes the idea of “secluded” dark matter naturally.

  15. Evading direct dark matter detection in Higgs portal models

    Science.gov (United States)

    Arcadi, Giorgio; Gross, Christian; Lebedev, Oleg; Pokorski, Stefan; Toma, Takashi

    2017-06-01

    Many models of Higgs portal Dark Matter (DM) find themselves under pressure from increasingly tight direct detection constraints. In the framework of gauge field DM, we study how such bounds can be relaxed while retaining the thermal WIMP paradigm. When the hidden sector gauge symmetry is broken via the Higgs mechanism, the hidden sector generally contains unstable states which are lighter than dark matter. These states provide DM with an efficient annihilation channel. As a result, the DM relic abundance and the direct detection limits are controlled by different parameters, and the two can easily be reconciled. This simple setup realizes the idea of ;secluded; dark matter naturally.

  16. Direct detection of dark matter with resonant annihilation

    OpenAIRE

    Li, Bo; Zhou, Yu-Feng

    2015-01-01

    In the scenario where the dark matter (DM) particles $\\chi\\bar\\chi$ pair annihilate through a resonance particle $R$, the constraint from DM relic density makes the corresponding cross section for DM-nuclei elastic scattering extremely small, and can be below the neutrino background induced by the coherent neutrino-nuclei scattering, which makes the DM particle beyond the reach of the conventional DM direct detection experiments. We present an improved analytical calculation of the DM relic d...

  17. Object Detection: Current and Future Directions

    Directory of Open Access Journals (Sweden)

    Rodrigo eVerschae

    2015-11-01

    Full Text Available Object detection is a key ability required by most computer and robot vision systems. The latest research on this area has been making great progress in many directions. In the current manuscript we give an overview of past research on object detection, outline the current main research directions, and discuss open problems and possible future directions.

  18. Constraints on direction-dependent cosmic birefringence from Planck polarization data

    Science.gov (United States)

    Contreras, Dagoberto; Boubel, Paula; Scott, Douglas

    2017-12-01

    Cosmic birefringence is the process that rotates the plane of polarization by an amount, α, as photons propagate through free space. Such an effect arises in parity-violating extensions to the electromagnetic sector, such as the Chern-Simons term common in axion models, quintessence models, or Lorentz-violating extensions to the standard model. Most studies consider the monopole of this rotation, but it is also possible for the effect to have spatial anisotropies. Paying particular attention to large scales, we implement a novel pixel-based method to extract the spherical harmonics for L 30. Our results are consistent with no detection and we set 95 % upper limits on the amplitude of a scale-invariant power spectrum of L(L+1)CL/2π<[2.2 (stat.)±0.7 (syst.)]×10-5=[0.07 (stat.)±0.02 (syst.)] deg2, on par with previous constraints. This implies specific limits on the dipole and quadrupole amplitudes to be √C1/4π lesssim 0.o2 and √C2/4π lesssim 0.o1, at 95 % CL, respectively, improving previous constraints by an order of magnitude. We further constrain a model independent M=0 quadrupole in an arbitrary direction to be α20 = 0.o02 ± 0.o21, with an unconstrained direction. However, we find an excess of dipolar power with an amplitude √3C1/4π = 0.o32±0.o10 (stat.)±0.o08 (syst.)], in the direction (l,b)=(295o,17o)±(22o,17o) (stat.)±(5o,16o) (syst.), larger than 1.4 % of simulations with no birefringence. We attribute part of this signal to the contamination of residual foregrounds not accounted for in our simulations, although this should be further investigated.

  19. Closing supersymmetric resonance regions with direct detection experiments

    Science.gov (United States)

    Kelso, Chris

    2014-06-01

    One of the few remaining ways that neutralinos could potentially evade constraints from direct detection experiments is if they annihilate through a resonance, as can occur if 2mχ0 falls within about ˜10% of either mA/H, mh, or mZ. Assuming a future rate of progress among direct detection experiments that is similar to that obtained over the past decade, we project that within 7 years the light Higgs and Z pole regions will be entirely closed, while the remaining parameter space near the A/H resonance will require that 2mχ0 be matched to the central value (near mA) to within less than 4%. At this rate of progress, it will be a little over a decade before multi-ton direct detection experiments will be able to close the remaining, highly-tuned, regions of the A/H resonance parameter space.

  20. Neutron-star Radius Constraints from GW170817 and Future Detections

    Science.gov (United States)

    Bauswein, Andreas; Just, Oliver; Janka, Hans-Thomas; Stergioulas, Nikolaos

    2017-12-01

    We introduce a new, powerful method to constrain properties of neutron stars (NSs). We show that the total mass of GW170817 provides a reliable constraint on the stellar radius if the merger did not result in a prompt collapse as suggested by the interpretation of associated electromagnetic emission. The radius {R}1.6 of nonrotating NSs with a mass of 1.6 {M}⊙ can be constrained to be larger than {10.68}-0.04+0.15 km, and the radius R max of the nonrotating maximum-mass configuration must be larger than {9.60}-0.03+0.14 km. We point out that detections of future events will further improve these constraints. Moreover, we show that a future event with a signature of a prompt collapse of the merger remnant will establish even stronger constraints on the NS radius from above and the maximum mass M max of NSs from above. These constraints are particularly robust because they only require a measurement of the chirp mass and a distinction between prompt and delayed collapse of the merger remnant, which may be inferred from the electromagnetic signal or even from the presence/absence of a ringdown gravitational-wave (GW) signal. This prospect strengthens the case of our novel method of constraining NS properties, which is directly applicable to future GW events with accompanying electromagnetic counterpart observations. We emphasize that this procedure is a new way of constraining NS radii from GW detections independent of existing efforts to infer radius information from the late inspiral phase or post-merger oscillations, and it does not require particularly loud GW events.

  1. Gaze Direction Detection in Autism Spectrum Disorder

    Science.gov (United States)

    Forgeot d'Arc, Baudouin; Delorme, Richard; Zalla, Tiziana; Lefebvre, Aline; Amsellem, Frédérique; Moukawane, Sanaa; Letellier, Laurence; Leboyer, Marion; Mouren, Marie-Christine; Ramus, Franck

    2017-01-01

    Detecting where our partners direct their gaze is an important aspect of social interaction. An atypical gaze processing has been reported in autism. However, it remains controversial whether children and adults with autism spectrum disorder interpret indirect gaze direction with typical accuracy. This study investigated whether the detection of…

  2. High Throughput Direct Detection Doppler Lidar Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Lite Cycles, Inc. (LCI) proposes to develop a direct-detection Doppler lidar (D3L) technology called ELITE that improves the system optical throughput by more than...

  3. Speed and direction response profiles of neurons in macaque MT and MST show modest constraint line tuning.

    Science.gov (United States)

    Duijnhouwer, Jacob; Noest, André J; Lankheet, Martin J M; van den Berg, Albert V; van Wezel, Richard J A

    2013-01-01

    Several models of heading detection during smooth pursuit rely on the assumption of local constraint line tuning to exist in large scale motion detection templates. A motion detector that exhibits pure constraint line tuning responds maximally to any 2D-velocity in the set of vectors that can be decomposed into the central, or classic, preferred velocity (the shortest vector that still yields the maximum response) and any vector orthogonal to that. To test this assumption, we measured the firing rates of isolated middle temporal (MT) and medial superior temporal (MST) neurons to random dot stimuli moving in a range of directions and speeds. We found that as a function of 2D velocity, the pooled responses were best fit with a 2D Gaussian profile with a factor of elongation, orthogonal to the central preferred velocity, of roughly 1.5 for MST and 1.7 for MT. This means that MT and MST cells are more sharply tuned for speed than they are for direction; and that they indeed show some level of constraint line tuning. However, we argue that the observed elongation is insufficient to achieve behavioral heading discrimination accuracy on the order of 1-2 degrees as reported before.

  4. Kaluza-Klein Dark Matter: Direct Detection vis-a-vis LHC (2013 update)

    Energy Technology Data Exchange (ETDEWEB)

    Arrenberg, Sebastian [Zurich U.; Baudis, Laura [Zurich U.; Kong, Kyoungchul [Kansas U.; Matchev, Konstantin T. [Florida U.; Yoo, Jonghee [Fermilab

    2013-07-24

    We present updated results on the complementarity between high-energy colliders and dark matter direct detection experiments in the context of Universal Extra Dimensions (UED). In models with relatively small mass splittings between the dark matter candidate and the rest of the (colored) spectrum, the collider sensitivity is diminished, but direct detection rates are enhanced. UED provide a natural framework to study such mass degeneracies. We discuss the detection prospects for the KK photon $\\gamma_1$ and the KK $Z$-boson $Z_1$, combining the expected LHC reach with cosmological constraints from WMAP/Planck, and the sensitivity of current or planned direct detection experiments. Allowing for general mass splittings, neither colliders, nor direct detection experiments by themselves can explore all of the relevant KK dark matter parameter space. Nevertheless, they probe different parameter space regions, and the combination of the two types of constraints can be quite powerful.

  5. Recent results in dark matter direct detection experiments

    Science.gov (United States)

    Kelso, Christopher Michael

    Three dark matter direct detection experiments (DAMA/LIBRA, CoGeNT, and CRESST-II) have each reported signals which resemble that predicted for a dark matter particle with a mass of roughly 10 GeV. We review the theoretical background for direct detection experiments as well as these particular detectors and their reported signals over the last few years. We also compare the signals of these experiments and discuss whether they can be explained by a single species of dark matter particle, without conflicting with the constraints of other experiments. We show that the spectrum of events reported by CoGeNT and CRESST-II are consistent with each other and with the constraints from CDMS-II, although some tension with xenon- based experiments remains. Similarly, the modulation signals reported by DAMA/LIBRA and CoGeNT appear to be compatible, although the corresponding amplitude of the observed modulations are a factor of at least a few higher than would be naively expected, based on the event spectra reported by CoGeNT and CRESST-II. We also discuss some ways that this apparent discrepancy could potentially be resolved.

  6. Formalization of taxon-based constraints to detect inconsistencies in annotation and ontology development

    Directory of Open Access Journals (Sweden)

    Mungall Christopher J

    2010-10-01

    Full Text Available Abstract Background The Gene Ontology project supports categorization of gene products according to their location of action, the molecular functions that they carry out, and the processes that they are involved in. Although the ontologies are intentionally developed to be taxon neutral, and to cover all species, there are inherent taxon specificities in some branches. For example, the process 'lactation' is specific to mammals and the location 'mitochondrion' is specific to eukaryotes. The lack of an explicit formalization of these constraints can lead to errors and inconsistencies in automated and manual annotation. Results We have formalized the taxonomic constraints implicit in some GO classes, and specified these at various levels in the ontology. We have also developed an inference system that can be used to check for violations of these constraints in annotations. Using the constraints in conjunction with the inference system, we have detected and removed errors in annotations and improved the structure of the ontology. Conclusions Detection of inconsistencies in taxon-specificity enables gradual improvement of the ontologies, the annotations, and the formalized constraints. This is progressively improving the quality of our data. The full system is available for download, and new constraints or proposed changes to constraints can be submitted online at https://sourceforge.net/tracker/?atid=605890&group_id=36855.

  7. Closing supersymmetric resonance regions with direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kelso, Chris [Department of Physics and Astronomy, University of Utah, Salt Lake City, Utah 84112 (United States)

    2014-01-01

    One of the few remaining ways that neutralinos could potentially evade constraints from direct detection experiments is if they annihilate through a resonance, as can occur if 2m{sub χ⁰} falls within about ~10% of either m{sub A/H}, m{sub h}, or m{sub Z}. Assuming a future rate of progress among direct detection experiments that is similar to that obtained over the past decade, we project that within 7 years the light Higgs and Z pole regions will be entirely closed, while the remaining parameter space near the A/H resonance will require that 2m{sub χ₀} be matched to the central value (near m{sub A}) to within less than 4%. At this rate of progress, it will be a little over a decade before multi-ton direct detection experiments will be able to close the remaining, highly-tuned, regions of the A/H resonance parameter space.

  8. Rejuvenating direct modulation and direct detection for modern optical communications

    Science.gov (United States)

    Che, Di; Li, An; Chen, Xi; Hu, Qian; Shieh, William

    2018-02-01

    High-speed transoceanic optical fiber transmission using direct modulation (DM) and direct detection (DD) was one of the most stirring breakthroughs for telecommunication in 1990s, which drove the internet as a global phenomenon. However, the later evolution of optical coherent communications in 2000s gradually took over the long-haul applications, due to its superior optical spectral efficiency. Nowadays, DM-DD systems are dominant mainly in cost- and power-sensitive short-reach applications, because of its natural characteristics-the simplicity. This paper reviews the recent advances of DM-DD transceivers from both hardware and signal processing perspectives. It introduces a variety of modified DM and/or DD systems for 3 application scenarios: very-short-reach interconnect with little fiber channel impact; single or a few spans of fiber transmission up to several hundred km; and distance beyond the 2nd scenario. Besides the DM-DD and multi-dimension DM-DD with polarization diversity, this paper focuses on how to rejuvenate traditional DM and DD technologies in order to bridge the transmission application gap between DM-DD and coherent transceivers, using technologies such as dispersion compensation, signal field recovery from the intensity-only DD receiver, and complex direct modulation with coherent detection. More than 30 years since the birth, DM and DD still hold indispensable roles in modern optical communications.

  9. Unstable gravitino dark matter prospects for indirect and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Grefe, Michael

    2011-11-15

    We confront the signals expected from unstable gravitino dark matter with observations of indirect dark matter detection experiments in all possible cosmic-ray channels. For this purpose we calculate in detail the gravitino decay widths in theories with bilinear violation of R parity, particularly focusing on decay channels with three particles in the final state. Based on these calculations we predict the fluxes of gamma rays, charged cosmic rays and neutrinos expected from decays of gravitino dark matter. Although the predicted spectra could in principal explain the anomalies observed in the cosmic ray positron and electron fluxes as measured by PAMELA and Fermi LAT, we find that this possibility is ruled out by strong constraints from gamma-ray and antiproton observations. Therefore, we employ current data of indirect detection experiments to place strong constraints on the gravitino lifetime and the strength of R-parity violation. In addition, we discuss the prospects of forthcoming searches for a gravitino signal in the spectrum of cosmic-ray antideuterons, finding that they are in particular sensitive to rather low gravitino masses. Finally, we discuss in detail the prospects for detecting a neutrino signal from gravitino dark matter decays, finding that the sensitivity of neutrino telescopes like IceCube is competitive to observations in other cosmic ray channels, especially for rather heavy gravitinos. Moreover, we discuss the prospects for a direct detection of gravitino dark matter via R-parity violating inelastic scatterings off nucleons. We find that, although the scattering cross section is considerably enhanced compared to the case of elastic gravitino scattering, the expected signal is many orders of magnitude too small in order to hope for a detection in underground detectors. (orig.)

  10. Surrogate Models for Direct Dark Matter Detection

    OpenAIRE

    Cerdeno, D. G.; Cheek, A.; Reid, E.; Schulz, H.

    2018-01-01

    In this work we introduce RAPIDD, a surrogate model that speeds up the computation of the expected spectrum of dark matter particles in direct detection experiments. RAPIDD replaces the exact calculation of the dark matter differential rate (which in general involves up to three nested integrals) with a much faster parametrization in terms of ordinary polynomials of the dark matter mass and couplings, obtained in an initial training phase. In this article, we validate our surrogate model on t...

  11. Directly detecting Isospin-Violating Dark Matter

    OpenAIRE

    Kelso, Chris; Kumar, Jason; Marfatia, Danny; Sandick, Pearl

    2017-01-01

    We consider the prospects for multiple dark matter direct detection experiments to determine if the interactions of a dark matter candidate are isospin-violating. We focus on theoretically well-motivated examples of isospin-violating dark matter (IVDM), including models in which dark matter interactions with nuclei are mediated by a dark photon, a Z, or a squark. We determine that the best prospects for distinguishing IVDM from the isospin-invariant scenario arise in the cases of dark photon-...

  12. Secure Distributed Detection under Energy Constraint in IoT-Oriented Sensor Networks

    Directory of Open Access Journals (Sweden)

    Guomei Zhang

    2016-12-01

    Full Text Available We study the secure distributed detection problems under energy constraint for IoT-oriented sensor networks. The conventional channel-aware encryption (CAE is an efficient physical-layer secure distributed detection scheme in light of its energy efficiency, good scalability and robustness over diverse eavesdropping scenarios. However, in the CAE scheme, it remains an open problem of how to optimize the key thresholds for the estimated channel gain, which are used to determine the sensor’s reporting action. Moreover, the CAE scheme does not jointly consider the accuracy of local detection results in determining whether to stay dormant for a sensor. To solve these problems, we first analyze the error probability and derive the optimal thresholds in the CAE scheme under a specified energy constraint. These results build a convenient mathematic framework for our further innovative design. Under this framework, we propose a hybrid secure distributed detection scheme. Our proposal can satisfy the energy constraint by keeping some sensors inactive according to the local detection confidence level, which is characterized by likelihood ratio. In the meanwhile, the security is guaranteed through randomly flipping the local decisions forwarded to the fusion center based on the channel amplitude. We further optimize the key parameters of our hybrid scheme, including two local decision thresholds and one channel comparison threshold. Performance evaluation results demonstrate that our hybrid scheme outperforms the CAE under stringent energy constraints, especially in the high signal-to-noise ratio scenario, while the security is still assured.

  13. Secure Distributed Detection under Energy Constraint in IoT-Oriented Sensor Networks.

    Science.gov (United States)

    Zhang, Guomei; Sun, Hao

    2016-12-16

    We study the secure distributed detection problems under energy constraint for IoT-oriented sensor networks. The conventional channel-aware encryption (CAE) is an efficient physical-layer secure distributed detection scheme in light of its energy efficiency, good scalability and robustness over diverse eavesdropping scenarios. However, in the CAE scheme, it remains an open problem of how to optimize the key thresholds for the estimated channel gain, which are used to determine the sensor's reporting action. Moreover, the CAE scheme does not jointly consider the accuracy of local detection results in determining whether to stay dormant for a sensor. To solve these problems, we first analyze the error probability and derive the optimal thresholds in the CAE scheme under a specified energy constraint. These results build a convenient mathematic framework for our further innovative design. Under this framework, we propose a hybrid secure distributed detection scheme. Our proposal can satisfy the energy constraint by keeping some sensors inactive according to the local detection confidence level, which is characterized by likelihood ratio. In the meanwhile, the security is guaranteed through randomly flipping the local decisions forwarded to the fusion center based on the channel amplitude. We further optimize the key parameters of our hybrid scheme, including two local decision thresholds and one channel comparison threshold. Performance evaluation results demonstrate that our hybrid scheme outperforms the CAE under stringent energy constraints, especially in the high signal-to-noise ratio scenario, while the security is still assured.

  14. Dark matter spin determination with directional direct detection experiments

    Science.gov (United States)

    Catena, Riccardo; Conrad, Jan; Döring, Christian; Ferella, Alfredo Davide; Krauss, Martin B.

    2018-01-01

    If dark matter has spin 0, only two WIMP-nucleon interaction operators can arise as leading operators from the nonrelativistic reduction of renormalizable single-mediator models for dark matter-quark interactions. Based on this crucial observation, we show that about 100 signal events at next generation directional detection experiments can be enough to enable a 2 σ rejection of the spin 0 dark matter hypothesis in favor of alternative hypotheses where the dark matter particle has spin 1 /2 or 1. In this context, directional sensitivity is crucial since anisotropy patterns in the sphere of nuclear recoil directions depend on the spin of the dark matter particle. For comparison, about 100 signal events are expected in a CF4 detector operating at a pressure of 30 torr with an exposure of approximately 26,000 cubic-meter-detector days for WIMPs of 100 GeV mass and a WIMP-fluorine scattering cross section of 0.25 pb. Comparable exposures require an array of cubic meter time projection chamber detectors.

  15. Light magnetic dark matter in direct detection searches

    Science.gov (United States)

    Del Nobile, Eugenio; Kouvaris, Chris; Panci, Paolo; Sannino, Francesco; Virkajärvi, Jussi

    2012-08-01

    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out by the CDMS, XENON and PICASSO experiments. We offer an analytic understanding of how the long-range interaction modifies the experimental allowed regions, in the cross section versus Dark Matter mass parameter space, with respect to the typically assumed contact interaction. Finally, in the context of a symmetric Dark Matter sector, we determine the associated thermal relic density, and further provide relevant constraints imposed by indirect searches and colliders.

  16. Light Magnetic Dark Matter in Direct Detection Searches

    DEFF Research Database (Denmark)

    Del Nobile, Eugenio; Kouvaris, Christoforos; Panci, Paolo

    2012-01-01

    We study a fermionic Dark Matter particle carrying magnetic dipole moment and analyze its impact on direct detection experiments. In particular we show that it can accommodate the DAMA, CoGeNT and CRESST experimental results. Assuming conservative bounds, this candidate is shown not to be ruled out...... by the CDMS, XENON and PICASSO experiments. We offer an analytic understanding of how the long-range interaction modifies the experimental allowed regions, in the cross section versus Dark Matter mass parameter space, with respect to the typically assumed contact interaction. Finally, in the context...... of a symmetric Dark Matter sector, we determine the associated thermal relic density, and further provide relevant constraints imposed by indirect searches and colliders....

  17. Dark matter repulsion could thwart direct detection

    Science.gov (United States)

    Davoudiasl, Hooman

    2017-11-01

    We consider a feeble repulsive interaction between ordinary matter and dark matter, with a range similar to or larger than the size of the Earth. Dark matter can thus be repelled from the Earth, leading to null results in direct detection experiments, regardless of the strength of the short-distance interactions of dark matter with atoms. Generically, such a repulsive force would not allow trapping of dark matter inside astronomical bodies. In this scenario, accelerator-based experiments may furnish the only robust signals of asymmetric dark matter models, which typically lack indirect signals from self-annihilation. Some of the variants of our hypothesis are also briefly discussed.

  18. Bayesian analysis of multiple direct detection experiments

    Science.gov (United States)

    Arina, Chiara

    2014-12-01

    Bayesian methods offer a coherent and efficient framework for implementing uncertainties into induction problems. In this article, we review how this approach applies to the analysis of dark matter direct detection experiments. In particular we discuss the exclusion limit of XENON100 and the debated hints of detection under the hypothesis of a WIMP signal. Within parameter inference, marginalizing consistently over uncertainties to extract robust posterior probability distributions, we find that the claimed tension between XENON100 and the other experiments can be partially alleviated in isospin violating scenario, while elastic scattering model appears to be compatible with the frequentist statistical approach. We then move to model comparison, for which Bayesian methods are particularly well suited. Firstly, we investigate the annual modulation seen in CoGeNT data, finding that there is weak evidence for a modulation. Modulation models due to other physics compare unfavorably with the WIMP models, paying the price for their excessive complexity. Secondly, we confront several coherent scattering models to determine the current best physical scenario compatible with the experimental hints. We find that exothermic and inelastic dark matter are moderatly disfavored against the elastic scenario, while the isospin violating model has a similar evidence. Lastly the Bayes' factor gives inconclusive evidence for an incompatibility between the data sets of XENON100 and the hints of detection. The same question assessed with goodness of fit would indicate a 2 σ discrepancy. This suggests that more data are therefore needed to settle this question.

  19. Loop Closing Detection in RGB-D SLAM Combining Appearance and Geometric Constraints

    Directory of Open Access Journals (Sweden)

    Heng Zhang

    2015-06-01

    Full Text Available A kind of multi feature points matching algorithm fusing local geometric constraints is proposed for the purpose of quickly loop closing detection in RGB-D Simultaneous Localization and Mapping (SLAM. The visual feature is encoded with BRAND (binary robust appearance and normals descriptor, which efficiently combines appearance and geometric shape information from RGB-D images. Furthermore, the feature descriptors are stored using the Locality-Sensitive-Hashing (LSH technique and hierarchical clustering trees are used to search for these binary features. Finally, the algorithm for matching of multi feature points using local geometric constraints is provided, which can effectively reject the possible false closure hypotheses. We demonstrate the efficiency of our algorithms by real-time RGB-D SLAM with loop closing detection in indoor image sequences taken with a handheld Kinect camera and comparative experiments using other algorithms in RTAB-Map dealing with a benchmark dataset.

  20. Loop Closing Detection in RGB-D SLAM Combining Appearance and Geometric Constraints.

    Science.gov (United States)

    Zhang, Heng; Liu, Yanli; Tan, Jindong

    2015-06-19

    A kind of multi feature points matching algorithm fusing local geometric constraints is proposed for the purpose of quickly loop closing detection in RGB-D Simultaneous Localization and Mapping (SLAM). The visual feature is encoded with BRAND (binary robust appearance and normals descriptor), which efficiently combines appearance and geometric shape information from RGB-D images. Furthermore, the feature descriptors are stored using the Locality-Sensitive-Hashing (LSH) technique and hierarchical clustering trees are used to search for these binary features. Finally, the algorithm for matching of multi feature points using local geometric constraints is provided, which can effectively reject the possible false closure hypotheses. We demonstrate the efficiency of our algorithms by real-time RGB-D SLAM with loop closing detection in indoor image sequences taken with a handheld Kinect camera and comparative experiments using other algorithms in RTAB-Map dealing with a benchmark dataset.

  1. Direct detection of soil-bound prions.

    Directory of Open Access Journals (Sweden)

    Sacha Genovesi

    Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.

  2. Direct diffusion tensor estimation using a model-based method with spatial and parametric constraints.

    Science.gov (United States)

    Zhu, Yanjie; Peng, Xi; Wu, Yin; Wu, Ed X; Ying, Leslie; Liu, Xin; Zheng, Hairong; Liang, Dong

    2017-02-01

    To develop a new model-based method with spatial and parametric constraints (MB-SPC) aimed at accelerating diffusion tensor imaging (DTI) by directly estimating the diffusion tensor from highly undersampled k-space data. The MB-SPC method effectively incorporates the prior information on the joint sparsity of different diffusion-weighted images using an L1-L2 norm and the smoothness of the diffusion tensor using a total variation seminorm. The undersampled k-space datasets were obtained from fully sampled DTI datasets of a simulated phantom and an ex-vivo experimental rat heart with acceleration factors ranging from 2 to 4. The diffusion tensor was directly reconstructed by solving a minimization problem with a nonlinear conjugate gradient descent algorithm. The reconstruction performance was quantitatively assessed using the normalized root mean square error (nRMSE) of the DTI indices. The MB-SPC method achieves acceptable DTI measures at an acceleration factor up to 4. Experimental results demonstrate that the proposed method can estimate the diffusion tensor more accurately than most existing methods operating at higher net acceleration factors. The proposed method can significantly reduce artifact, particularly at higher acceleration factors or lower SNRs. This method can easily be adapted to MR relaxometry parameter mapping and is thus useful in the characterization of biological tissue such as nerves, muscle, and heart tissue. © 2016 American Association of Physicists in Medicine.

  3. Detecting and Diagnosing Grammatical Errors for Beginning Learners of German: From Learner Corpus Annotation to Constraint Satisfaction Problems

    Science.gov (United States)

    Boyd, Adriane

    2012-01-01

    This thesis presents a corpus of beginning learner German with a reliable error annotation scheme and an approach for detecting and diagnosing grammatical errors in learner language. A constraint-based dependency parser provides the foundation for a flexible and modular analysis of German by representing parsing as a constraint satisfaction…

  4. Analyzing of singlet fermionic dark matter via the updated direct detection data

    Energy Technology Data Exchange (ETDEWEB)

    Ettefaghi, M.M.; Moazzemi, R. [University of Qom, Department of Physics, Qom (Iran, Islamic Republic of)

    2017-05-15

    We revisit the parameter space of singlet fermionic cold dark matter model in order to determine the role of the mixing angle between the standard model Higgs and a new singlet one. Furthermore, we restudy the direct detection constraints with the updated and new experimental data. As an important conclusion, this model is completely excluded by recent XENON100, PandaX II and LUX data. (orig.)

  5. Closing in on mass-degenerate dark matter scenarios with antiprotons and direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Garny, Mathias [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ibarra, Alejandro; Pato, Miguel; Vogl, Stefan [Technische Univ. Muenchen, Garching (Germany). Physik-Department

    2012-07-15

    Over the last years both cosmic-ray antiproton measurements and direct dark matter searches have proved particularly effective in constraining the nature of dark matter candidates. The present work focusses on these two types of constraints in a minimal framework which features a Majorana fermion as the dark matter particle and a scalar that mediates the coupling to quarks. Considering a wide range of coupling schemes, we derive antiproton and direct detection constraints using the latest data and paying close attention to astrophysical and nuclear uncertainties. Both signals are strongly enhanced in the presence of degenerate dark matter and scalar masses, but we show that the effect is especially dramatic in direct detection. Accordingly, the latest direct detection limits take the lead over antiprotons. We find that antiproton and direct detection data set stringent lower limits on the mass splitting, reaching 19% at a 300 GeV dark matter mass for a unity coupling. Interestingly, these limits are orthogonal to ongoing collider searches at the Large Hadron Collider, making it feasible to close in on degenerate dark matter scenarios within the next years.

  6. Remote sensing constraints on aerosol sources, physical properties and direct radiative forcing

    Science.gov (United States)

    Henze, D. K.; Meland, B. S.; Xu, X.; Wang, J.; Akhtar, F.; Hemming, B.; Pinder, R. W.; Loughlin, D.

    2012-12-01

    Aerosols contribute to air pollution and climate change, yet their origins, physical properties and fates in the atmosphere are often uncertain. Here we present constraints on aerosol sources and their physical properties that may be obtained from remote sensing observations through application of an adjoint chemical transport model (GEOS-Chem) for sensitivity and data assimilation applications. We first consider the information content of remote sensing of light scattering intensity, such as from MODIS, and compare this to the value of hypothetical polarimetric measurements from an instrument such as APS. The degree to which these types of observations are capable of constraining sources, or sources versus microphysical properties such as aerosol size and refractive index, are considered. Model-derived source attributions of aerosol direct radiative forcing from individual aerosol and aerosol precursor emissions are presented next. These are combined with metrics of absolute regional temperature potentials to map the relationship between aerosol sources and global surface temperature. This mapping quantifies the potential of future assimilation and measurement studies to reduce uncertainty in understanding aerosol impacts on climate.

  7. Direct and indirect detection of supersymmetric dark matter; Detection directe et indirecte de matiere sombre supersymetrique

    Energy Technology Data Exchange (ETDEWEB)

    Mayet, F

    2001-09-01

    A substantial body of astrophysical evidence supports the existence of non-baryonic dark matter in the universe. One of the leading dark matter candidates is the neutralino predicted by the supersymmetric extensions of the standard model of particle physics. Different detectors have been designed for the detection, either indirect or direct, of the neutralino. Related to indirect detection, the present work has been performed in the context of the AMS experiment. A precursor version of the spectrometer was flown on the space shuttle Discovery in June 1998. The detector included an Aerogel Threshold Cherenkov counter (ATC) to identify antiprotons, whose spectrum may be used to infer a neutralino signal. The analysis of the ATC data is presented including an evaluation of the flight performance and a description of the optimization of the antiproton selection. An antiproton analysis is also reported. A phenomenological study allows us to investigate the discovery potential of this indirect method. This thesis also includes the development of a new detector (MACHe3) designed for direct neutralino search using a superfluid {sup 3}He bolometer operated at ultra low temperatures. The data analysis of the prototype cell is presented. A Monte Carlo simulation has been developed, in order to optimize the detector design for direct neutralino search. These results are compared with theoretical predictions of supersymmetric models, thus highlighting the discovery potential of this detector and its complementarity with existing devices. (author)

  8. Detecting Stealth Dark Matter Directly through Electromagnetic Polarizability.

    Science.gov (United States)

    Appelquist, T; Berkowitz, E; Brower, R C; Buchoff, M I; Fleming, G T; Jin, X-Y; Kiskis, J; Kribs, G D; Neil, E T; Osborn, J C; Rebbi, C; Rinaldi, E; Schaich, D; Schroeder, C; Syritsyn, S; Vranas, P; Weinberg, E; Witzel, O

    2015-10-23

    We calculate the spin-independent scattering cross section for direct detection that results from the electromagnetic polarizability of a composite scalar "stealth baryon" dark matter candidate, arising from a dark SU(4) confining gauge theory-"stealth dark matter." In the nonrelativistic limit, electromagnetic polarizability proceeds through a dimension-7 interaction leading to a very small scattering cross section for dark matter with weak-scale masses. This represents a lower bound on the scattering cross section for composite dark matter theories with electromagnetically charged constituents. We carry out lattice calculations of the polarizability for the lightest "baryon" states in SU(3) and SU(4) gauge theories using the background field method on quenched configurations. We find the polarizabilities of SU(3) and SU(4) to be comparable (within about 50%) normalized to the stealth baryon mass, which is suggestive for extensions to larger SU(N) groups. The resulting scattering cross sections with a xenon target are shown to be potentially detectable in the dark matter mass range of about 200-700 GeV, where the lower bound is from the existing LUX constraint while the upper bound is the coherent neutrino background. Significant uncertainties in the cross section remain due to the more complicated interaction of the polarizablity operator with nuclear structure; however, the steep dependence on the dark matter mass, 1/m(B)(6), suggests the observable dark matter mass range is not appreciably modified. We briefly highlight collider searches for the mesons in the theory as well as the indirect astrophysical effects that may also provide excellent probes of stealth dark matter.

  9. Preliminary studies of pest constraints to cotton seedlings in a direct seeding mulch-based system in Cameroon

    NARCIS (Netherlands)

    Brevault, T.; Guibert, H.; Naudin, K.

    2009-01-01

    The present study evaluated the pest constraints of an innovative crop management system in Cameroon involving conservation tillage and direct seeding mulch-based strategies. We hypothesized that the presence of mulch (i) would support a higher density of phytophagous arthropods particularly

  10. Model-independent indirect detection constraints on hidden sector dark matter

    Energy Technology Data Exchange (ETDEWEB)

    Elor, Gilly; Rodd, Nicholas L.; Slatyer, Tracy R.; Xue, Wei [Center for Theoretical Physics, Massachusetts Institute of Technology,77 Massachusetts Ave, Cambridge, MA 02139 (United States)

    2016-06-10

    If dark matter inhabits an expanded “hidden sector”, annihilations may proceed through sequential decays or multi-body final states. We map out the potential signals and current constraints on such a framework in indirect searches, using a model-independent setup based on multi-step hierarchical cascade decays. While remaining agnostic to the details of the hidden sector model, our framework captures the generic broadening of the spectrum of secondary particles (photons, neutrinos, e{sup +}e{sup −} and p-barp) relative to the case of direct annihilation to Standard Model particles. We explore how indirect constraints on dark matter annihilation limit the parameter space for such cascade/multi-particle decays. We investigate limits from the cosmic microwave background by Planck, the Fermi measurement of photons from the dwarf galaxies, and positron data from AMS-02. The presence of a hidden sector can change the constraints on the dark matter by up to an order of magnitude in either direction (although the effect can be much smaller). We find that generally the bound from the Fermi dwarfs is most constraining for annihilations to photon-rich final states, while AMS-02 is most constraining for electron and muon final states; however in certain instances the CMB bounds overtake both, due to their approximate independence on the details of the hidden sector cascade. We provide the full set of cascade spectra considered here as publicly available code with examples at http://web.mit.edu/lns/research/CascadeSpectra.html.

  11. Ignimbrites of Armenia - Paleomagnetic constraints on flow direction and stratigraphy of pyroclastic activity of Mount Aragats

    Science.gov (United States)

    Kirscher, Uwe; Meliksetian, Khachatur; Gevorgyan, Hripsime; Navasardyan, Gevorg; Bachtadse, Valerian

    2017-04-01

    The Aragats volcano is one of the largest stratovolcanoes within the Turkish-Armenian-Iranian orogenic plateau. It is located close to the Armenian capital Yerevan, and only 30 km from the only nuclear power plant within the country. Additional to numerous lava flows, Mount Aragats is thought to be the source of at least two large pyroclastic eruptions leading to a huge number of ignimbrite outcrops, which are located surrounding Mount Aragats with an evaluated eruption radius of 50 km. The age of several ignimbrite outcrops has recently been determined to be 0.65 Ma (Meliksetian et al., 2014). The different ignimbrite flows are characterized by huge diversity of colors, degree of welding and textures. Due to that reason some disagreement exist on how these outcrops can be linked and how the eruption process actually happened in terms of different eruption phases and mixing mechanism of magmas during the eruption. To add constraints to this debate we carried out an intensive paleomagnetic investigation on most of the ignimbrite outcrops (32 sites) in terms of directional and anisotropy measurements. Paleomagnetic directional measurements yield basically two polarities: (1) a well grouped normal polarity is present in the majority of the studied sites including 3 sites which have supposedly originated from a different vent located on Turkish territory in the west; (2) a reversed polarity of the remaining sites with a somewhat increased scatter. Based on secular variation arguments and considering the high quality of the data we suggest that at least all young outcrops represent a single eruption phase in the area at 0.65 Ma, which is in agreement with an occurrence during the Brunhes geomagnetic chron. Additional to that, at least one earlier phase of pyroclastic activity took place prior to the Brunhes-Matuyama boundary (0.781 Ma). Anisotropy of magnetic susceptibility (AMS) suggests initial radial flow directions, which shortly after the eruption become

  12. Pulmonary nodule detection in CT images based on shape constraint CV model

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bing; Tian, Xuedong [College of Mathematics and Computer Science, Hebei University, Baoding 071002 (China); Wang, Qian [Hebei Geological Laboratory, Baoding 071000, China and Multi-disciplinary Research Center, Hebei University, Baoding 071002 (China); Yang, Ying [Hebei University Affiliated Hospital, Baoding 071002 (China); Xie, Hongzhi, E-mail: gulixu@sjtu.edu.cn, E-mail: xiehongzhi@medmail.com.cn; Zhang, Shuyang [Department of Cardiology, Peking Union Medical College Hospital, Peking 100005 (China); Gu, Lixu, E-mail: gulixu@sjtu.edu.cn, E-mail: xiehongzhi@medmail.com.cn [Multi-disciplinary Research Center, Hebei University, Baoding 071002, China and School of Biomedical Engineering, Shanghai Jiao Tong University, Shanghai 200030 (China)

    2015-03-15

    Purpose: Accurate detection of pulmonary nodules remains a technical challenge in computer-aided diagnosis systems because some nodules may adhere to the blood vessels or the lung wall, which have low contrast compared to the surrounding tissues. In this paper, the analysis of typical shape features of candidate nodules based on a shape constraint Chan–Vese (CV) model combined with calculation of the number of blood branches adhered to nodule candidates is proposed to reduce false positive (FP) nodules from candidate nodules. Methods: The proposed scheme consists of three major stages: (1) Segmentation of lung parenchyma from computed tomography images. (2) Extraction of candidate nodules. (3) Reduction of FP nodules. A gray level enhancement combined with a spherical shape enhancement filter is introduced to extract the candidate nodules and their sphere-like contour regions. FPs are removed by analysis of the typical shape features of nodule candidates based on the CV model using spherical constraint and by investigating the number of blood branches adhered to the candidate nodules. The constrained shapes of CV model are automatically achieved from the extracted candidate nodules. Results: The detection performance was evaluated on 127 nodules of 103 cases including three types of challenging nodules, which are juxta-pleural nodules, juxta-vascular nodules, and ground glass opacity nodules. The free-receiver operating characteristic (FROC) curve shows that the proposed method is able to detect 88% of all the nodules in the data set with 4 FPs per case. Conclusions: Evaluation shows that the authors’ method is feasible and effective for detection of three types of nodules in this study.

  13. Pulmonary nodule detection in CT images based on shape constraint CV model.

    Science.gov (United States)

    Wang, Bing; Tian, Xuedong; Wang, Qian; Yang, Ying; Xie, Hongzhi; Zhang, Shuyang; Gu, Lixu

    2015-03-01

    Accurate detection of pulmonary nodules remains a technical challenge in computer-aided diagnosis systems because some nodules may adhere to the blood vessels or the lung wall, which have low contrast compared to the surrounding tissues. In this paper, the analysis of typical shape features of candidate nodules based on a shape constraint Chan-Vese (CV) model combined with calculation of the number of blood branches adhered to nodule candidates is proposed to reduce false positive (FP) nodules from candidate nodules. The proposed scheme consists of three major stages: (1) Segmentation of lung parenchyma from computed tomography images. (2) Extraction of candidate nodules. (3) Reduction of FP nodules. A gray level enhancement combined with a spherical shape enhancement filter is introduced to extract the candidate nodules and their sphere-like contour regions. FPs are removed by analysis of the typical shape features of nodule candidates based on the CV model using spherical constraint and by investigating the number of blood branches adhered to the candidate nodules. The constrained shapes of CV model are automatically achieved from the extracted candidate nodules. The detection performance was evaluated on 127 nodules of 103 cases including three types of challenging nodules, which are juxta-pleural nodules, juxta-vascular nodules, and ground glass opacity nodules. The free-receiver operating characteristic (FROC) curve shows that the proposed method is able to detect 88% of all the nodules in the data set with 4 FPs per case. Evaluation shows that the authors' method is feasible and effective for detection of three types of nodules in this study.

  14. Loop-induced dark matter direct detection signals from gamma-ray lines

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Haisch, Ulrich; Kahlhoefer, Felix

    2012-01-01

    dark matter and nuclei. We find a striking non-standard recoil spectrum due to different destructively interfering contributions to the dark matter nucleus scattering cross section. While in the case of s-wave annihilation the current sensitivity of direct detection experiments is insufficient......Improved limits as well as tentative claims for dark matter annihilation into gamma-ray lines have been presented recently. We study the direct detection cross section induced from dark matter annihilation into two photons in a model-independent fashion, assuming no additional couplings between...... to compete with indirect detection searches, for p-wave annihilation the constraints from direct searches are comparable. This will allow to test dark matter scenarios with p-wave annihilation that predict a large di-photon annihilation cross section in the next generation of experiments....

  15. Genome evolution is driven by gene expression-generated biophysical constraints through RNA-directed genetic variation: A hypothesis.

    Science.gov (United States)

    Auboeuf, Didier

    2017-10-01

    The biogenesis of RNAs and proteins is a threat to the cell. Indeed, the act of transcription and nascent RNAs challenge DNA stability. Both RNAs and nascent proteins can also initiate the formation of toxic aggregates because of their physicochemical properties. In reviewing the literature, I show that co-transcriptional and co-translational biophysical constraints can trigger DNA instability that in turn increases the likelihood that sequences that alleviate the constraints emerge over evolutionary time. These directed genetic variations rely on the biogenesis of small RNAs that are transcribed directly from challenged DNA regions or processed from the transcripts that directly or indirectly generate constraints or aggregates. These small RNAs can then target the genomic regions from which they initially originate and increase the local mutation rate of the targeted loci. This mechanism is based on molecular pathways involved in anti-parasite genome defence systems, and implies that gene expression-related biophysical constraints represent a driving force of genome evolution. © 2017 The Authors. BioEssays Published by Wiley Periodicals, Inc.

  16. Direct detection of methylation in genomic DNA

    NARCIS (Netherlands)

    Bart, A.; van Passel, M. W. J.; van Amsterdam, K.; van der Ende, A.

    2005-01-01

    The identification of methylated sites on bacterial genomic DNA would be a useful tool to study the major roles of DNA methylation in prokaryotes: distinction of self and nonself DNA, direction of post-replicative mismatch repair, control of DNA replication and cell cycle, and regulation of gene

  17. Indirect detection of radiation sources through direct detection of radiolysis products

    Science.gov (United States)

    Farmer, Joseph C [Tracy, CA; Fischer, Larry E [Los Gatos, CA; Felter, Thomas E [Livermore, CA

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  18. Experiences and directions for Abduction and Induction using Constraint Handling Rules

    DEFF Research Database (Denmark)

    Christiansen, Henning

    2005-01-01

    Techniques for doing abduction in a combination of Prolog and Constraint Handling Rules (CHR) are reviewed, and the possible extension to combine with induction is considered. While the indicated implementation for abduction is very efficient, the ideas for induction are at a much more experiment...... stage. However, experimentation within CHR indicates a logical semantics for the induction mechanisms under consideration and their offset in abductive logic programming.......Techniques for doing abduction in a combination of Prolog and Constraint Handling Rules (CHR) are reviewed, and the possible extension to combine with induction is considered. While the indicated implementation for abduction is very efficient, the ideas for induction are at a much more experimental...

  19. Greek timber industries and wood product markets over the last century: development constraints and future directions

    OpenAIRE

    Panagiotis P. Koulelis

    2011-01-01

    This paper examines the Greek forestry sector after 1930. According to the past literature, the sector was entirely degraded and reliable data are not available. The study analyses critical historical data about timber sector and timber companies; the main objective is the specification of the factors that kept the Greek forest sector underdevelopment. The factors and the development constraints, including the indigenous characteristics of the Greek forests, the inhibitory policy for timber p...

  20. Readout technologies for directional WIMP Dark Matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Battat, J.B.R., E-mail: jbattat@wellesley.edu [Department of Physics, Wellesley College, 106 Central Street, Wellesley, MA 02481 (United States); Irastorza, I.G. [Grupo de Física Nuclear y Astropartículas, Departamento de Física Teórica, Universidad de Zaragoza, 50009 Zaragoza (Spain); Aleksandrov, A. [Istituto Nazionale di Fisica Nucleare, Sezione di Napoli, Naples (Italy); Asada, T. [Nagoya University, J-464-8602 Nagoya (Japan); Baracchini, E. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Frascati, Frascati (Italy); Billard, J. [Laboratoire de Physique Subatomique et de Cosmologie, Université Grenoble Alpes, CNRS/IN2P3, 53, avenue des Martyrs, Grenoble (France); IPNL, Université de Lyon, Université Lyon 1, CNRS/IN2P3, 4 rue E. Fermi 69622 Villeurbanne cedex (France); Bosson, G.; Bourrion, O.; Bouvier, J. [Laboratoire de Physique Subatomique et de Cosmologie, Université Grenoble Alpes, CNRS/IN2P3, 53, avenue des Martyrs, Grenoble (France); Buonaura, A. [Istituto Nazionale di Fisica Nucleare, Sezione di Napoli, Naples (Italy); Dipartimento di Fisica, Università Federico II, Napoli, I-80125 Napoli (Italy); Burdge, K. [Laboratory for Nuclear Science, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Caltech Division of Physics, Mathematics, and Astronomy, Pasadena, CA (United States); Cebrián, S. [Grupo de Física Nuclear y Astropartículas, Departamento de Física Teórica, Universidad de Zaragoza, 50009 Zaragoza (Spain); and others

    2016-11-29

    The measurement of the direction of WIMP-induced nuclear recoils is a compelling but technologically challenging strategy to provide an unambiguous signature of the detection of Galactic dark matter. Most directional detectors aim to reconstruct the dark-matter-induced nuclear recoil tracks, either in gas or solid targets. The main challenge with directional detection is the need for high spatial resolution over large volumes, which puts strong requirements on the readout technologies. In this paper we review the various detector readout technologies used by directional detectors. In particular, we summarize the challenges, advantages and drawbacks of each approach, and discuss future prospects for these technologies.

  1. Effective theory approach to direct detection of dark matter

    OpenAIRE

    Hisano, Junji

    2017-01-01

    An effective field theory approach is presented for evaluation of the dark matter direct detection rate in this lecture note. This is prepared for the Les Houches Summer School Effective Field Theory in Particle Physics and Cosmology, July 2017.

  2. Direct 13C NMR Detection in HPLC Hyphenation Mode

    DEFF Research Database (Denmark)

    Wubshet, Sileshi Gizachew; Johansen, Kenneth; Nyberg, Nils

    2012-01-01

    is indubitable in simplifying structural elucidations. In the current study, we demonstrated direct (13)C NMR detection of triterpenoids from a Ganoderma lucidum extract in hyphenation mode. The combined advantage of a cryogenically cooled probe, miniaturization, and multiple trapping enabled the first reported......Solid phase extraction (SPE) was introduced as a crucial step in the HPLC-SPE-NMR technique to enable online analyte enrichment from which proton-detected NMR experiments on submicrogram amounts from complex mixtures were possible. However, the significance of direct-detected (13)C NMR experiments...... application of HPLC-SPE-NMR analysis using direct-detected (13)C NMR spectra. HPLC column loading, accumulative SPE trappings, and the effect of different elution solvents were evaluated and optimized. A column loading of approximately 600 mug of a prefractionated triterpenoid mixture, six trappings...

  3. Direct updating of an RNA base-pairing probability matrix with marginal probability constraints.

    Science.gov (United States)

    Hamada, Michiaki

    2012-12-01

    A base-pairing probability matrix (BPPM) stores the probabilities for every possible base pair in an RNA sequence and has been used in many algorithms in RNA informatics (e.g., RNA secondary structure prediction and motif search). In this study, we propose a novel algorithm to perform iterative updates of a given BPPM, satisfying marginal probability constraints that are (approximately) given by recently developed biochemical experiments, such as SHAPE, PAR, and FragSeq. The method is easily implemented and is applicable to common models for RNA secondary structures, such as energy-based or machine-learning-based models. In this article, we focus mainly on the details of the algorithms, although preliminary computational experiments will also be presented.

  4. Glue detection based on teaching points constraint and tracking model of pixel convolution

    Science.gov (United States)

    Geng, Lei; Ma, Xiao; Xiao, Zhitao; Wang, Wen

    2018-01-01

    On-line glue detection based on machine version is significant for rust protection and strengthening in car production. Shadow stripes caused by reflect light and unevenness of inside front cover of car reduce the accuracy of glue detection. In this paper, we propose an effective algorithm to distinguish the edges of the glue and shadow stripes. Teaching points are utilized to calculate slope between the two adjacent points. Then a tracking model based on pixel convolution along motion direction is designed to segment several local rectangular regions using distance. The distance is the height of rectangular region. The pixel convolution along the motion direction is proposed to extract edges of gules in local rectangular region. A dataset with different illumination and complexity shape stripes are used to evaluate proposed method, which include 500 thousand images captured from the camera of glue gun machine. Experimental results demonstrate that the proposed method can detect the edges of glue accurately. The shadow stripes are distinguished and removed effectively. Our method achieves the 99.9% accuracies for the image dataset.

  5. Time-integrated directional detection of dark matter

    Science.gov (United States)

    O'Hare, Ciaran A. J.; Kavanagh, Bradley J.; Green, Anne M.

    2017-10-01

    The analysis of signals in directional dark matter (DM) detectors typically assumes that the directions of nuclear recoils can be measured in the Galactic rest frame. However, this is not possible with all directional detection technologies. In nuclear emulsions, for example, the recoil events must be detected and measured after the exposure time of the experiment. Unless the entire detector is mounted and rotated with the sidereal day, the recoils cannot be reoriented in the Galactic rest frame. We examine the effect of this "time integration" on the primary goals of directional detection, namely: (1) confirming that the recoils are anisotropic; (2) measuring the median recoil direction to confirm their Galactic origin; and (3) probing below the neutrino floor. We show that after time integration the DM recoil distribution retains a preferred direction and is distinct from that of Solar neutrino-induced recoils. Many of the advantages of directional detection are therefore preserved and it is not crucial to mount and rotate the detector. Rejecting isotropic backgrounds requires a factor of 2 more signal events compared with an experiment with event time information, whereas a factor of 1.5-3 more events are needed to measure a median direction in agreement with the expectation for DM. We also find that there is still effectively no neutrino floor in a time-integrated directional experiment. However to reach a cross section an order of magnitude below the floor, a factor of ˜8 larger exposure is required than with a conventional directional experiment. We also examine how the sensitivity is affected for detectors with only 2D recoil track readout, and/or no head-tail measurement. As for non-time-integrated experiments, 2D readout is not a major disadvantage, though a lack of head-tail sensitivity is.

  6. Tactile direction discrimination and vibration detection in diabetic neuropathy.

    Science.gov (United States)

    Löken, Linda S; Lundblad, L C; Elam, M; Olausson, H W

    2010-05-01

    To evaluate the clinical usefulness of quantitative testing of tactile direction discrimination (TDD) in patients with diabetic neuropathy. TDD and vibration detection were examined on the dorsum of the feet in 43 patients with type 1 diabetes mellitus and clinical signs and symptoms indicating mild neuropathy, and abnormal results for neurography, temperature detection, or heart rate variability. Test-retest examination of TDD was performed in nine of the patients. Twenty-six of the patients had abnormal TDD (sensitivity 0.60) and 20 had abnormal vibration detection (sensitivity 0.46). Ten of the patients had abnormal TDD and normal vibration detection. Four of the patients had abnormal vibration detection and normal TDD. Test-retest examination of TDD showed a high degree of reproducibility (r = 0.87). TDD seems more useful than vibration detection in examination of diabetic neuropathy.

  7. Direct detection of antihydrogen atoms using a BGO crystal

    Energy Technology Data Exchange (ETDEWEB)

    Nagata, Y. [Department of Applied Physics, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei-shi, 184-8588 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Kuroda, N., E-mail: kuroda@phys.c.u-tokyo.ac.jp [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Ohtsuka, M. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Leali, M.; Lodi-Rizzini, E.; Mascagna, V. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Tajima, M.; Torii, H.A. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Zurlo, N. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Matsuda, Y. [Institute of Physics, University of Tokyo, 3-8-1 Komaba, Meguro-ku, 153-8902 Tokyo (Japan); Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan); Venturelli, L. [Dipartimento di Ingegneria dell' Informazione, Universitá di Brescia, Brescia 25133 (Italy); Istituto Nazionale di Fisica Nucleare, Gruppo Collegato di Brescia, Brescia 25133 (Italy); Yamazaki, Y. [Atomic Physics Research Unit, RIKEN, 2-1 Hirosawa, Wako-shi, 351-0198 Saitama (Japan)

    2016-12-21

    The ASACUSA collaboration has developed a detector consisting of a large size BGO crystal to detect an atomic antihydrogen beam, and performed the direct detection of antihydrogen atoms. Energy spectra from antihydrogen annihilation on the BGO crystal are discussed in comparison to simulation results from the GEANT4 toolkit. Background mainly originating from cosmic rays were strongly suppressed by analyzing the energy deposited in the BGO and requiring a multiplicity of charged pions. Thus antihydrogen events were identified.

  8. Wafer Defect Detection Using Directional Morphological Gradient Techniques

    Directory of Open Access Journals (Sweden)

    Gongyuan Qu

    2002-07-01

    Full Text Available Accurate detection and classification of wafer defects constitute an important component of the IC production process because together they can immediately improve the yield and also provide information needed for future process improvements. One class of inspection procedures involves analyzing surface images. Because of the characteristics of the design patterns and the irregular size and shape of the defects, linear processing methods, such as Fourier transform domain filtering or Sobel edge detection, are not as well suited as morphological methods for detecting these defects. In this paper, a newly developed morphological gradient technique using directional components is applied to the detection and isolation of wafer defects. The new methods are computationally efficient and do not rely on a priori knowledge of the specific design pattern to detect particles, scratches, stains, or missing pattern areas. The directional components of the morphological gradient technique allow direction specific edge suppression and reduce the noise sensitivity. Theoretical analysis and several examples are used to demonstrate the performance of the directional morphological gradient methods.

  9. Direct Detection of Biotinylated Proteins by Mass Spectrometry

    Science.gov (United States)

    2015-01-01

    Mass spectrometric strategies to identify protein subpopulations involved in specific biological functions rely on covalently tagging biotin to proteins using various chemical modification methods. The biotin tag is primarily used for enrichment of the targeted subpopulation for subsequent mass spectrometry (MS) analysis. A limitation of these strategies is that MS analysis does not easily discriminate unlabeled contaminants from the labeled protein subpopulation under study. To solve this problem, we developed a flexible method that only relies on direct MS detection of biotin-tagged proteins called “Direct Detection of Biotin-containing Tags” (DiDBiT). Compared with conventional targeted proteomic strategies, DiDBiT improves direct detection of biotinylated proteins ∼200 fold. We show that DiDBiT is applicable to several protein labeling protocols in cell culture and in vivo using cell permeable NHS-biotin and incorporation of the noncanonical amino acid, azidohomoalanine (AHA), into newly synthesized proteins, followed by click chemistry tagging with biotin. We demonstrate that DiDBiT improves the direct detection of biotin-tagged newly synthesized peptides more than 20-fold compared to conventional methods. With the increased sensitivity afforded by DiDBiT, we demonstrate the MS detection of newly synthesized proteins labeled in vivo in the rodent nervous system with unprecedented temporal resolution as short as 3 h. PMID:25117199

  10. Working Group Report: WIMP Dark Matter Direct Detection

    Energy Technology Data Exchange (ETDEWEB)

    Cushman, P.; Galbiati, C.; McKinsey, D. N.; Robertson, H.; Tait, T. M.P.

    2013-10-30

    As part of the Snowmass process, the Cosmic Frontier WIMP Direct Detection subgroup (CF1) has drawn on input from the Cosmic Frontier and the broader Particle Physics community to produce this document. The charge to CF1 was (a) to summarize the current status and projected sensitivity of WIMP direct detection experiments worldwide, (b) motivate WIMP dark matter searches over a broad parameter space by examining a spectrum of WIMP models, (c) establish a community consensus on the type of experimental program required to explore that parameter space, and (d) identify the common infrastructure required to practically meet those goals.

  11. Prospectives on Direct Detection of the Cosmic Neutrino Background

    Science.gov (United States)

    Li, Yu-Feng

    2017-09-01

    The cosmic neutrino background (CνB) is a fundamental prediction of the hot Big Bang cosmology. Although cosmological observations provide indirect evidence for the existence of the CνB, we still lack a direct detection in a laboratory. In this work we present the current possible detection methods of the CνB. The method of CνB captures on the radioactive decaying nuclei is particularly emphasized in light of the PTOLEMY project. We stress that such direct measurements might not be hopeless in the long term.

  12. Greek timber industries and wood product markets over the last century: development constraints and future directions

    Directory of Open Access Journals (Sweden)

    Panagiotis P. Koulelis

    2011-01-01

    Full Text Available This paper examines the Greek forestry sector after 1930. According to the past literature, the sector was entirely degraded and reliable data are not available. The study analyses critical historical data about timber sector and timber companies; the main objective is the specification of the factors that kept the Greek forest sector underdevelopment. The factors and the development constraints, including the indigenous characteristics of the Greek forests, the inhibitory policy for timber production investments, especially in the state industries, lack of market research, unorthodox procedures for sale of the wood, bad quality and high cost of production and periods of general economic recession are analyzed farther. Conclusively, the need for producing official forest maps, forest data recording, rapid adaptation to EU specifications, investments, deep changes in to the managership of the state industries, permanent and specialized personnel and promotion of national programs for the development of the small-scale wood elaboration and wood selling industrial units are some of the solutions for the above problems that could be suggested.

  13. Greek timber industries and wood product markets over the last century: development constraints and future directions

    Directory of Open Access Journals (Sweden)

    Panagiotis P. Koulelis

    2013-12-01

    Full Text Available This paper examines the Greek forestry sector after 1930. According to the past literature, the sector was entirely degraded and reliable data are not available. The study analyses critical historical data about timber sector and timber companies; the main objective is the specification of the factors that kept the Greek forest sector underdevelopment. The factors and the development constraints, including the indigenous characteristics of the Greek forests, the inhibitory policy for timber production investments, especially in the state industries, lack of market research, unorthodox procedures for sale of the wood, bad quality and high cost of production and periods of general economic recession are analyzed farther. Conclusively, the need for producing official forest maps, forest data recording, rapid adaptation to EU specifications, investments, deep changes in to the managership of the state industries, permanent and specialized personnel and promotion of national programs for the development of the small-scale wood elaboration and wood selling industrial units are some of the solutions for the above problems that could be suggested.

  14. Direct detection of dark matter bound to the Earth

    DEFF Research Database (Denmark)

    Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    We study the properties and direct detection prospects of an as of yet neglected population of dark matter (DM) particles moving in orbits gravitationally bound to the Earth. This DM population is expected to form via scattering by nuclei in the Earth's interior. We compute fluxes and nuclear...

  15. Direct detection of the Enceladus water torus with Herschel

    NARCIS (Netherlands)

    Hartogh, P.; Lellouch, E.; Moreno, R.; Bockelee-Morvan, D.; Biver, N.; Cassidy, T.; Rengel, M.; Jarchow, C.; Cavalie, T.; Crovisier, J.; Helmich, F. P.; Kidger, M.

    Cryovolcanic activity near the south pole of Saturn's moon Enceladus produces plumes of H2O-dominated gases and ice particles, which escape and populate a torus-shaped cloud. Using submillimeter spectroscopy with Herschel, we report the direct detection of the Enceladus water vapor torus in four

  16. Fundamental statistical limitations of future dark matter direct detection experiments

    NARCIS (Netherlands)

    Strege, C.; Trotta, F.; Bertone, G.; Peter, A.H.G.; Scott, P.

    2012-01-01

    We discuss irreducible statistical limitations of future ton-scale dark matter direct detection experiments. We focus in particular on the coverage of confidence intervals, which quantifies the reliability of the statistical method used to reconstruct the dark matter parameters and the bias of the

  17. Direct Detection Of Triterpenoid Saponins In Medicinal Plants ...

    African Journals Online (AJOL)

    Direct detection of saponins in medicinal plants using Fourier Transform Infrared (FTIR) spectroscopy is reported in this paper. Crude dry plant powders were mixed with potassium bromide (KBr) powder and compressed to a thin pellet for infrared examination. FTIR spectra of the test samples showed –OH, -C=O, C-H, and ...

  18. Analysis of the theoretical bias in dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Catena, Riccardo, E-mail: riccardo.catena@theorie.physik.uni-goettingen.de [Institut für Theoretische Physik, Friedrich-Hund-Platz 1, 37077 Göttingen (Germany)

    2014-09-01

    Fitting the model ''A'' to dark matter direct detection data, when the model that underlies the data is ''B'', introduces a theoretical bias in the fit. We perform a quantitative study of the theoretical bias in dark matter direct detection, with a focus on assumptions regarding the dark matter interactions, and velocity distribution. We address this problem within the effective theory of isoscalar dark matter-nucleon interactions mediated by a heavy spin-1 or spin-0 particle. We analyze 24 benchmark points in the parameter space of the theory, using frequentist and Bayesian statistical methods. First, we simulate the data of future direct detection experiments assuming a momentum/velocity dependent dark matter-nucleon interaction, and an anisotropic dark matter velocity distribution. Then, we fit a constant scattering cross section, and an isotropic Maxwell-Boltzmann velocity distribution to the simulated data, thereby introducing a bias in the analysis. The best fit values of the dark matter particle mass differ from their benchmark values up to 2 standard deviations. The best fit values of the dark matter-nucleon coupling constant differ from their benchmark values up to several standard deviations. We conclude that common assumptions in dark matter direct detection are a source of potentially significant bias.

  19. Evaluation of a direct colorimetric assay for rapid detection of ...

    African Journals Online (AJOL)

    Yemane Berhane

    bromide (MTT) for a rapid detection of rifampicin resistance. Methods: Sputum was inoculated directly into 7H9 .... a loopful of the corresponding broth on nutrient agar and incubating it at 370C for 24 hours before performing the .... and Training in Tropical Diseases (TDR). This study was part of the MSc thesis of DW at Addis ...

  20. Detection of Common Problems in Real-Time and Multicore Systems Using Model-Based Constraints

    Directory of Open Access Journals (Sweden)

    Raphaël Beamonte

    2016-01-01

    Full Text Available Multicore systems are complex in that multiple processes are running concurrently and can interfere with each other. Real-time systems add on top of that time constraints, making results invalid as soon as a deadline has been missed. Tracing is often the most reliable and accurate tool available to study and understand those systems. However, tracing requires that users understand the kernel events and their meaning. It is therefore not very accessible. Using modeling to generate source code or represent applications’ workflow is handy for developers and has emerged as part of the model-driven development methodology. In this paper, we propose a new approach to system analysis using model-based constraints, on top of userspace and kernel traces. We introduce the constraints representation and how traces can be used to follow the application’s workflow and check the constraints we set on the model. We then present a number of common problems that we encountered in real-time and multicore systems and describe how our model-based constraints could have helped to save time by automatically identifying the unwanted behavior.

  1. Direct Detection of Sub-GeV Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Essig, Rouven; Mardon, Jeremy; Volansky, Tomer

    2012-03-20

    Direct detection strategies are proposed for dark matter particles with MeV to GeV mass. In this largely unexplored mass range, dark matter scattering with electrons can cause single-electron ionization signals, which are detectable with current technology. Ultraviolet photons, individual ions, and heat are interesting alternative signals. Focusing on ionization, we calculate the expected dark matter scattering rates and estimate the sensitivity of possible experiments. Backgrounds that may be relevant are discussed. Theoretically interesting models can be probed with existing technologies, and may even be within reach using ongoing direct detection experiments. Significant improvements in sensitivity should be possible with dedicated experiments, opening up a window to new regions in dark matter parameter space.

  2. Directional detection of dark matter with two-dimensional targets

    Directory of Open Access Journals (Sweden)

    Yonit Hochberg

    2017-09-01

    Full Text Available We propose two-dimensional materials as targets for direct detection of dark matter. Using graphene as an example, we focus on the case where dark matter scattering deposits sufficient energy on a valence-band electron to eject it from the target. We show that the sensitivity of graphene to dark matter of MeV to GeV mass can be comparable, for similar exposure and background levels, to that of semiconductor targets such as silicon and germanium. Moreover, a two-dimensional target is an excellent directional detector, as the ejected electron retains information about the angular dependence of the incident dark matter particle. This proposal can be implemented by the PTOLEMY experiment, presenting for the first time an opportunity for directional detection of sub-GeV dark matter.

  3. Boundary Detection Method for Large-Scale Coverage Holes in Wireless Sensor Network Based on Minimum Critical Threshold Constraint

    Directory of Open Access Journals (Sweden)

    Rong Jing

    2014-01-01

    Full Text Available The existing coverage hole boundary detection methods cannot detect large-scale coverage hole boundary in wireless sensor network quickly and efficiently. Aiming at this problem, a boundary detection method for large-scale coverage holes in wireless sensor network based on minimum critical threshold constraint is proposed. Firstly, the optimization problem of minimum critical threshold is highlighted, and its formulaic description is constructed according to probabilistic sensing model. On the basis of this, the distributed gradient information is used to approximately solve the optimization problem. After that, local-scale rough boundary detection algorithm incorporating the minimum critical threshold and its iterative thinning algorithm are proposed according to blocking flow theory. The experimental results show that the proposed method has low computational complexity and network overhead when detecting large-scale coverage hole boundary in wireless sensor network.

  4. Implications of direct dark matter constraints for minimal supersymmetric standard model Higgs boson searches at the Tevatron.

    Science.gov (United States)

    Carena, Marcela; Hooper, Dan; Skands, Peter

    2006-08-04

    In regions of large tanbeta and small mAlpha, searches for heavy neutral minimal supersymmetric standard model (MSSM) Higgs bosons at the Tevatron are promising. At the same time, rates in direct dark matter experiments, such as CDMS, are enhanced in the case of large tanbeta and small mAlpha. As a result, there is a natural interplay between the heavy, neutral Higgs searches at the Tevatron and the region of parameter space explored by CDMS. We show that if the lightest neutralino makes up the dark matter of our universe, current limits from CDMS strongly constrain the prospects of heavy, neutral MSSM Higgs discovery at the Tevatron unless |mu| greater or approximately 400 GeV. The limits of CDMS projected for 2007 will increase this constraint to |mu| greater or approximately 800 GeV. If CDMS does observe neutralinos in the near future, however, it will make the discovery of Higgs bosons at the Tevatron far more likely.

  5. Direct versus indirect detection of supersymmetric dark matter

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-07-01

    This document gathers the slides that were presented during the workshop 'direct versus indirect detection of supersymmetric dark matter'(about 30 contributions). This workshop intended to bring together people from the particle theory community, astrophysicists and cosmologists, as well as experimentalists involved in the detection of dark matter. The aim is to generate a discussion about current and future strategies for detection of SUSY dark matter (with focus, but not exclusively, on neutralinos). Complementarities between accelerator, direct and indirect searches as well as a comparison between the uncertainties in direct and indirect searches of dark matter, are supposed to be discussed. Among the issues which will be addressed are: -) the crucial questions related to the structure of galaxies (local dark matter density, clumping, anomalous velocity distributions, etc.) ; -) the possibilities offered by the present and future experimental facilities for direct and indirect (photon, neutrino) searches; -) the potential for the discovery of SUSY at LHC and beyond; and -) the parameterization of the SUSY breaking models beyond the minimal versions.

  6. Direct Detection of Ultralight Dark Matter via Astronomical Ephemeris

    OpenAIRE

    Fukuda, Hajime; Matsumoto, Shigeki; Yanagida, Tsutomu T.

    2018-01-01

    A novel idea of the direct detection to search for a ultralight dark matter based on the interaction between the dark matter and a nucleon is proposed. Solar system bodies feel the dark matter wind and it acts as a resistant force opposing their motions. The astronomical ephemeris of solar system bodies is so precise that it has a strong capability to detect a dark matter whose mass is much lighter than O(1) eV. We have estimated the resistant force based on the calculation of the elastic sca...

  7. An Automated Directed Spectral Search Methodology for Small Target Detection

    Science.gov (United States)

    Grossman, Stanley I.

    Much of the current efforts in remote sensing tackle macro-level problems such as determining the extent of wheat in a field, the general health of vegetation or the extent of mineral deposits in an area. However, for many of the remaining remote sensing challenges being studied currently, such as border protection, drug smuggling, treaty verification, and the war on terror, most targets are very small in nature - a vehicle or even a person. While in typical macro-level problems the objective vegetation is in the scene, for small target detection problems it is not usually known if the desired small target even exists in the scene, never mind finding it in abundance. The ability to find specific small targets, such as vehicles, typifies this problem. Complicating the analyst's life, the growing number of available sensors is generating mountains of imagery outstripping the analysts' ability to visually peruse them. This work presents the important factors influencing spectral exploitation using multispectral data and suggests a different approach to small target detection. The methodology of directed search is presented, including the use of scene-modeled spectral libraries, various search algorithms, and traditional statistical and ROC curve analysis. The work suggests a new metric to calibrate analysis labeled the analytic sweet spot as well as an estimation method for identifying the sweet spot threshold for an image. It also suggests a new visualization aid for highlighting the target in its entirety called nearest neighbor inflation (NNI). It brings these all together to propose that these additions to the target detection arena allow for the construction of a fully automated target detection scheme. This dissertation next details experiments to support the hypothesis that the optimum detection threshold is the analytic sweet spot and that the estimation method adequately predicts it. Experimental results and analysis are presented for the proposed directed

  8. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeno, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, Priscilla B.; Daal, M.; Di Stefano, P. C.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, Jeter C.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, W.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-01

    We examine the consequences of the effective eld theory (EFT) of dark matter-nucleon scattering or current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral di*erences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  9. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter-nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. Here. we demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. In conclusion, we discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  10. Dark matter effective field theory scattering in direct detection experiments

    Energy Technology Data Exchange (ETDEWEB)

    Schneck, K.; Cabrera, B.; Cerdeño, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, P.; Daal, M.; Di Stefano, P. C. F.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, J.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, P.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-18

    We examine the consequences of the effective field theory (EFT) of dark matter–nucleon scattering for current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral differences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  11. Highly sensitive detection of Staphylococcus aureus directly from patient blood.

    Directory of Open Access Journals (Sweden)

    Padmapriya P Banada

    Full Text Available Rapid detection of bloodstream infections (BSIs can be lifesaving. We investigated the sample processing and assay parameters necessary for highly-sensitive detection of bloodstream bacteria, using Staphylococcus aureus as a model pathogen and an automated fluidic sample processing-polymerase chain reaction (PCR platform as a model diagnostic system.We compared a short 128 bp amplicon hemi-nested PCR and a relatively shorter 79 bp amplicon nested PCR targeting the S. aureus nuc and sodA genes, respectively. The sodA nested assay showed an enhanced limit of detection (LOD of 5 genomic copies per reaction or 10 colony forming units (CFU per ml blood over 50 copies per reaction or 50 CFU/ml for the nuc assay. To establish optimal extraction protocols, we investigated the relative abundance of the bacteria in different components of the blood (white blood cells (WBCs, plasma or whole blood, using the above assays. The blood samples were obtained from the patients who were culture positive for S. aureus. Whole blood resulted in maximum PCR positives with sodA assay (90% positive as opposed to cell-associated bacteria (in WBCs (71% samples positive or free bacterial DNA in plasma (62.5% samples positive. Both the assays were further tested for direct detection of S. aureus in patient whole blood samples that were contemporaneous culture positive. S. aureus was detected in 40/45 of culture-positive patients (sensitivity 89%, 95% CI 0.75-0.96 and 0/59 negative controls with the sodA assay (specificity 100%, 95% CI 0.92-1.We have demonstrated a highly sensitive two-hour assay for detection of sepsis causing bacteria like S. aureus directly in 1 ml of whole blood, without the need for blood culture.

  12. Direct detection of momentum flux in atomic and molecular beams

    Science.gov (United States)

    Choi, J. G.; Hayden, J. S.; O'Connor, M. T.; Diebold, G. J.

    1981-10-01

    We describe the use of a microphone for detection of atomic and molecular beams in a high-vacuum environment. Two experiments were carried out to demonstrate this detection method. Pulsed beams of argon were detected using a conventional electret microphone where the output of the microphone was displayed directly on an oscilloscope or processed with a boxcar averager to remove the transient oscillations of the microphone diaphragm. Amplitude modulated, continuous beams of atomic argon were also detected using a lock-in amplifier. The microphone possesses a response to the pressure or momentum flux in the beam that appears to be unique among beam detectors. We use the classical equipartition theorem to calculate the magnitude of the random fluctuations in the output voltage of the microphone that is used to give an expression for the minimum detectable momentum flux in the beam. For a typical microphone we find this to be 3×10-8 Pa, (in a 1-Hz bandwidth), which corresponds to a minimum number density of 1×106 cm-3 for an effusive argon beam at 300 K.

  13. Direct detection of incidental asymptomatic aneurysm by computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Asari, S.; Sakurai, M.; Yamamoto, Y.; Suzuki, K. (Matsuyama Shimin Hospital, Ehime (Japan)); Sadamoto, K.

    1981-02-01

    Incidental asymptomatic aneurysms were found in 9 of 52 patients with intracranial aneurysms from February, 1978 to March, 1980. They had only mild initial symptoms, namely, headache, dysarthria, aphasis, light hemiparesis and others. No patients had severe neurological deficits. In eight of 9 patients with asymptomatic aneurysm, except one case of hypertensive intracerebral hematoma, 9 aneurysms (8 patients) were directly detected by high resolution CT (GE CT/T 8800) and confirmed by angiography. Location of these aneurysms as follows: three at the middle cerebral artery trifurcation, two at the internal carotisposterior communicans junction, one at anterior communication artery, one at the basilar top, one at the basilaris artery-superior cerebelli artery junction and one at the posterior cerebral artery. The smallest aneurysm detected by CT as 5 x 4 x 4 mm in size on angiography. The aneurysm may be suggested by small round or oval defect in the Sylvian fissure or suprasellar cistern, defect of the edge of the so called ''pentagon'' in the plain CT and then if its density is highly and homogeneously increased after contrast-enhanced (CE) scan. As the circle of Willis and other major cerebral arteries can often be demonstrated on CE.CT images, the aneurysm is frequently seen on these cerebral arteries. Limiting factors to direct CT detection of intracranial aneurysms are seemed to be size and location of aneurysm, anatomic location of circle of Willis and motion of patients etc. It may be considered, in our experiences, that the CT is useful in diagnosis of asymptomatic aneurysm and the higher direct CT detection rate to aneurysms, small or medium sized as well as giant aneurysms, will be obtained by devising scanning method, namely, multiprojection scans, multiple overlapping method and improvement of enhanced method.

  14. Direct object detection from field-of-view multiplexed measurements

    Science.gov (United States)

    Shilling, Richard Z.; Muise, Robert R.

    2017-04-01

    A compressive imaging model is proposed that multiplexes segments of the field of view (FOV) onto an infrared focal plane array (FPA). Similar to compound imaging, our model is based on combining pixels from a surface comprising of the different parts of the FOV. We formalize this superposition of pixels in a global multiplexing process reducing the number of detectors required for the FPA. We present an analysis of the signal-to-noise ratio for the full rank and compressive collection paradigms for a target detection and tracking scenario. We then apply automated target detection algorithms directly on the measurement sequence for this multiplexing model. We extend the target training and detection processes for the application directly on the encoded measurements. Optimal measurement codes for this application may imply abandoning the ability to reconstruct the actual scene in favor of reconstructing the locations of interesting objects. We present a simulated case study as well as real data results from a visible FOV multiplexing camera.

  15. Clustering and community detection in directed networks: A survey

    Science.gov (United States)

    Malliaros, Fragkiskos D.; Vazirgiannis, Michalis

    2013-12-01

    Networks (or graphs) appear as dominant structures in diverse domains, including sociology, biology, neuroscience and computer science. In most of the aforementioned cases graphs are directed - in the sense that there is directionality on the edges, making the semantics of the edges nonsymmetric as the source node transmits some property to the target one but not vice versa. An interesting feature that real networks present is the clustering or community structure property, under which the graph topology is organized into modules commonly called communities or clusters. The essence here is that nodes of the same community are highly similar while on the contrary, nodes across communities present low similarity. Revealing the underlying community structure of directed complex networks has become a crucial and interdisciplinary topic with a plethora of relevant application domains. Therefore, naturally there is a recent wealth of research production in the area of mining directed graphs - with clustering being the primary method sought and the primary tool for community detection and evaluation. The goal of this paper is to offer an in-depth comparative review of the methods presented so far for clustering directed networks along with the relevant necessary methodological background and also related applications. The survey commences by offering a concise review of the fundamental concepts and methodological base on which graph clustering algorithms capitalize on. Then we present the relevant work along two orthogonal classifications. The first one is mostly concerned with the methodological principles of the clustering algorithms, while the second one approaches the methods from the viewpoint regarding the properties of a good cluster in a directed network. Further, we present methods and metrics for evaluating graph clustering results, demonstrate interesting application domains and provide promising future research directions.

  16. Halo-Independent Direct Detection Analyses Without Mass Assumptions

    CERN Document Server

    Anderson, Adam J.; Kahn, Yonatan; McCullough, Matthew

    2015-10-06

    Results from direct detection experiments are typically interpreted by employing an assumption about the dark matter velocity distribution, with results presented in the $m_\\chi-\\sigma_n$ plane. Recently methods which are independent of the DM halo velocity distribution have been developed which present results in the $v_{min}-\\tilde{g}$ plane, but these in turn require an assumption on the dark matter mass. Here we present an extension of these halo-independent methods for dark matter direct detection which does not require a fiducial choice of the dark matter mass. With a change of variables from $v_{min}$ to nuclear recoil momentum ($p_R$), the full halo-independent content of an experimental result for any dark matter mass can be condensed into a single plot as a function of a new halo integral variable, which we call $\\tilde{h}(p_R)$. The entire family of conventional halo-independent $\\tilde{g}(v_{min})$ plots for all DM masses are directly found from the single $\\tilde{h}(p_R)$ plot through a simple re...

  17. Congratulations on the direct detection of gravitational waves

    CERN Multimedia

    2016-01-01

    This week saw the announcement of an extraordinary physics result: the first direct detection of gravitational waves by the LIGO Scientific Collaboration, which includes the GEO team, and the Virgo Collaboration, using the twin Laser Interferometer Gravitational-wave Observatory (LIGO) detectors located in Livingston, Louisiana, and Hanford, Washington, USA.   Albert Einstein predicted gravitational waves in a paper published 100 years ago in 1916. They are a natural consequence of the theory of general relativity, which describes the workings of gravity and was published a few months earlier. Until now, they have remained elusive. Gravitational waves are tiny ripples in space-time produced by violent gravitational phenomena. Because the fractional change in the space-time geometry can be at the level of 10-21 or smaller, extremely sophisticated, high-sensitivity instruments are needed to detect them. Recently, the Advanced LIGO detector increased its sensitivity by alm...

  18. Ultrabroadband direct detection of nonclassical photon statistics at telecom wavelength.

    Science.gov (United States)

    Wakui, Kentaro; Eto, Yujiro; Benichi, Hugo; Izumi, Shuro; Yanagida, Tetsufumi; Ema, Kazuhiro; Numata, Takayuki; Fukuda, Daiji; Takeoka, Masahiro; Sasaki, Masahide

    2014-04-03

    Broadband light sources play essential roles in diverse fields, such as high-capacity optical communications, optical coherence tomography, optical spectroscopy, and spectrograph calibration. Although a nonclassical state from spontaneous parametric down-conversion may serve as a quantum counterpart, its detection and characterization have been a challenging task. Here we demonstrate the direct detection of photon numbers of an ultrabroadband (110 nm FWHM) squeezed state in the telecom band centred at 1535 nm wavelength, using a superconducting transition-edge sensor. The observed photon-number distributions violate Klyshko's criterion for the nonclassicality. From the observed photon-number distribution, we evaluate the second- and third-order correlation functions, and characterize a multimode structure, which implies that several tens of orthonormal modes of squeezing exist in the single optical pulse. Our results and techniques open up a new possibility to generate and characterize frequency-multiplexed nonclassical light sources for quantum info-communications technology.

  19. On the direct detection of {sup 229m}Th

    Energy Technology Data Exchange (ETDEWEB)

    Wense, Lars von der

    2017-02-03

    The measurement of time has always been an important tool in science and society. Today's most precise time and frequency measurements are performed with optical atomic clocks. However, these clocks could potentially be outperformed by a ''nuclear clock'', which employs a nuclear transition instead of an atomic shell transition for time measurement. Among the 176 000 known nuclear excited states, there is only one nuclear state that would allow for the development of a nuclear clock using currently available technology. This is the isomeric first excited state of {sup 229}Th, denoted as {sup 229m}Th. Despite 40 years of past research, no direct decay detection of this nuclear state has so far been achieved. In this thesis, measurements are described that have led to the first direct detection of the ground-state decay of {sup 229m}Th. Two decay channels (radiative decay and internal conversion) are experimentally investigated. Only the investigation of the internal conversion decay channel has led to the successful observation of the first excited isomeric nuclear state of {sup 229}Th. Based on this direct detection, a new nuclear laser excitation scheme for {sup 229m}Th is proposed. This excitation scheme circumvents the general assumed requirement of a better knowledge of the isomeric energy value, thereby paving the way for nuclear laser spectroscopy of {sup 229m}Th. Many of the presented results have so far been unpublished. This includes results of the investigation of a potential radiative decay channel of {sup 229m}Th, a negative result in the search for an isomeric decay during extraction of {sup 229}Th{sup 1+}, investigation of the isomeric decay in thorium molecules and on an MgF{sub 2}-coated surface, as well as a first report of the isomeric half-life for neutral {sup 229}Th.

  20. Edge-detect interpolation for direct digital periapical images

    Energy Technology Data Exchange (ETDEWEB)

    Song, Nam Kyu; Koh, Kwang Joon [Dept. of Oral and Maxillofacial Radiology, College of Dentistry, Chonbuk National University, Chonju (Korea, Republic of)

    1998-02-15

    The purpose of this study was to aid in the use of the digital images by edge-detect interpolation for direct digital periapical images using edge-deted interpolation. This study was performed by image processing of 20 digital periapical images; pixel replication, linear non-interpolation, linear interpolation, and edge-sensitive interpolation. The obtained results were as follows: 1. Pixel replication showed blocking artifact and serious image distortion. 2. Linear interpolation showed smoothing effect on the edge. 3. Edge-sensitive interpolation overcame the smoothing effect on the edge and showed better image.

  1. Direct detection of gaps in Saturn's A ring

    Science.gov (United States)

    Rehnberg, Morgan E.; Brown, Zarah L.; Esposito, Larry W.; Albers, Nicole

    2017-11-01

    Indirect observations spanning decades have indicated that Saturn's A ring is populated with a plethora of self-gravity wakes, small wavelike structures that arise from the gravitational attraction between ring particles. We present the direct detection of the gaps that represent the minima between the denser wakes. Through a statistical test, we analyze a series of seven high-resolution stellar occultations observed by the Cassini Ultraviolet Imaging Spectrograph to identify nearly half a million discrete regions with an optical depth less than a quarter of the surrounding ring. These gaps correlate strongly with previous observations of the A-ring brightness asymmetry.

  2. Simultaneous mass detection for direct inlet mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Gordon, R.L.

    1979-05-01

    The evolution of analytical techniques for application in trace analysis has led to interest in practical methods for real-time monitoring. Direct inlet mass spectrometry (DIMS) has been the subject of considerable activity in recent years. A DIMS instrument is described which consists of an inlet system designed to permit particles entrained in the inlet air stream to strike a hot, oxidized rhenium filament which serves as a surface ionization source. A mass analyzer and detection system then permits identification of the elemental composition of particulates which strike the filament.

  3. Measurements of direct CP violation and constraints on the CKM triangle in B → K*π decays

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, Andrew Phillips [Stanford Univ., CA (United States)

    2010-02-01

    We constrain the apex of the Cabibbo-Kobayashi-Maskawa unitarity triangle with measurements of B → K*π amplitudes from analyses of B0 → K+π-π0 and B0 → KSπ+π- decays. This constraint is consistent with the world average. The B0 → K+π-π0 decay mode is reconstructed from a sample of 454 million B0$\\bar{B}$ 0 events collected by the BABAR detector at SLAC. We measure direct CP violation in B0 → K*+π- decays at the level of 3σ when measurements from both B0 → K+π-π0 and B0 → KSπ+π- decays are combined.

  4. Stokes-vector direct detection for optical communications

    Science.gov (United States)

    Shieh, William; Li, An; Che, Di; Yuan, Feng; Khodakarami, Hamid

    2017-01-01

    To cope with the exponential growth of the Internet traffic, optical communications has advanced by leaps and bounds. For several decades, Intensity modulation with direct detection (IM-DD) dominates the commercial short-reach optical communications. However, when upgrading the data-rate distance product to 1000 Gb/s·km per wavelength and beyond, IM-DD faces severe performance barrier. Aiming to improve the electrical SE and extend the transmission distance, advanced DD modulation formats have been proposed through a so-called self-coherent (SCOH) approach, where a carrier is transmitted together with the signal to achieve a linear mapping between the electrical baseband signal and the optical field. In that way, the impact of the CD can be removed from the received signal, greatly extending the transmission distance of the DD system. Particularly, Stokes-vector direct detection (SV-DD) has been proposed to realize linear complex optical channels as well as enhance the electrical spectral efficiency and transmission reach. In this talk, we present the principle and discuss the performance of SV-DD systems.

  5. On the Existence of Low-Mass Dark Matter and its Direct Detection

    Science.gov (United States)

    Bateman, James; McHardy, Ian; Merle, Alexander; Morris, Tim R.; Ulbricht, Hendrik

    2015-01-01

    Dark Matter (DM) is an elusive form of matter which has been postulated to explain astronomical observations through its gravitational effects on stars and galaxies, gravitational lensing of light around these, and through its imprint on the Cosmic Microwave Background (CMB). This indirect evidence implies that DM accounts for as much as 84.5% of all matter in our Universe, yet it has so far evaded all attempts at direct detection, leaving such confirmation and the consequent discovery of its nature as one of the biggest challenges in modern physics. Here we present a novel form of low-mass DM χ that would have been missed by all experiments so far. While its large interaction strength might at first seem unlikely, neither constraints from particle physics nor cosmological/astronomical observations are sufficient to rule out this type of DM, and it motivates our proposal for direct detection by optomechanics technology which should soon be within reach, namely, through the precise position measurement of a levitated mesoscopic particle which will be perturbed by elastic collisions with χ particles. We show that a recently proposed nanoparticle matter-wave interferometer, originally conceived for tests of the quantum superposition principle, is sensitive to these collisions, too. PMID:25622565

  6. Detailed noise statistics for an optically preamplified direct detection receiver

    DEFF Research Database (Denmark)

    Danielsen, Søren Lykke; Mikkelsen, Benny; Durhuus, Terji

    1995-01-01

    We describe the exact statistics of an optically preamplified direct detection receiver by means of the moment generating function. The theory allows an arbitrary shaped electrical filter in the receiver circuit. The moment generating function (MGF) allows for a precise calculation of the error...... rate by using the inverse Fast Fourier transform (FFT). The exact results are compared with the usual Gaussian approximation (GA), the saddlepoint approximation (SAP) and the modified Chernoff bound (MCB). This comparison shows that the noise is not Gaussian distributed for all values of the optical...... amplifier gain. In the region from 20-30 dB gain, calculations show that the GA underestimates the receiver sensitivity while the SAP is very close to the results of our exact model. Using the MGF derived in the article we then find the optimal bandwidth of the electrical filter in the receiver circuit...

  7. Prospects for indirect MeV dark matter detection with gamma rays in light of cosmic microwave background constraints

    Science.gov (United States)

    González-Morales, Alma X.; Profumo, Stefano; Reynoso-Cordova, Javier

    2017-09-01

    The self-annihilation of dark matter particles with mass in the MeV range can produce gamma rays via prompt or secondary radiation. The annihilation rate for such light dark matter particles is however tightly constrained by cosmic microwave background (CMB) data. Here we explore the possibility of discovering MeV dark matter annihilation with future MeV gamma-ray telescopes taking into account the latest and future CMB constraints. We study the optimal energy window as a function of the dominant annihilation final state. We consider both the (conservative) case of the dwarf spheroidal galaxy Draco and the (more optimistic) case of the Galactic center. We find that for certain channels, including those with one or two monochromatic photon(s) and one or two neutral pion(s), a detectable gamma-ray signal is possible for both targets under consideration and compatible with CMB constraints. For other annihilation channels, however, including all leptonic annihilation channels and two charged pions, CMB data rule out any significant signal of dark matter annihilation at future MeV gamma-ray telescopes from dwarf galaxies, but possibly not for the Galactic center.

  8. Direct and Indirect Dark Matter Detection in Gauge Theories

    Energy Technology Data Exchange (ETDEWEB)

    Queiroz, Farinaldo [Federal Univ. of Paraba (Brazil)

    2013-01-01

    The Dark matter (DM) problem constitutes a key question at the interface among Particle Physics, Astrophysics and Cosmology. The observational data which have been accumulated in the last years point to an existence of non baryonic amount of DM. Since the Standard Model (SM) does not provide any candidate for such non-baryonic DM, the evidence of DM is a major indication for new physics beyond the SM. We will study in this work one of the most popular DM candidates, the so called WIMPs (Weakly Interacting Massive Particles) from a direct and indirect detection perspective. In order to approach the direct and indirect dection of DM in the context of Particle Physics in a more pedagogic way, we will begin our discussion talking about a minimal extension of the SM. Later we will work on the subject in a 3-3-1 model. Next, we will study the role of WIMPs in the Big Bang Nucleosynthesis. Lastly, we will look for indirect DM signals in the center of our galaxy using the NASA Satellite, called Fermi-LAT. Through a comprehensive analysis of the data events observed by Fermi-LAT and some background models, we will constrain the dark matter annihilation cross section for several annihilation channels and dark matter halo profiles.

  9. A systematic halo-independent analysis of direct detection data within the framework of Inelastic Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Scopel, Stefano; Yoon, Kook-Hyun, E-mail: scopel@sogang.ac.kr, E-mail: koreasds@naver.com [Department of Physics, Sogang University, Seoul 121-742 (Korea, Republic of)

    2014-08-01

    We present a systematic halo-independent analysis of available Weakly Interacting Massive Particles (WIMP) direct detection data within the framework of Inelastic Dark Matter (IDM). We show that, when the smallest number of assumptions is made on the WIMP velocity distribution in the halo of our Galaxy, it is possible to find values of the WIMP mass and the IDM mass splitting for which compatibility between present constraints and any of the three experiments claiming to see a WIMP excess among DAMA, CDMS-Si and CRESST can be achieved.

  10. Beyond the CMSSM without an accelerator: proton decay and direct dark matter detection.

    Science.gov (United States)

    Ellis, John; Evans, Jason L; Luo, Feng; Nagata, Natsumi; Olive, Keith A; Sandick, Pearl

    We consider two potential non-accelerator signatures of generalizations of the well-studied constrained minimal supersymmetric standard model (CMSSM). In one generalization, the universality constraints on soft supersymmetry-breaking parameters are applied at some input scale [Formula: see text]below the grand unification (GUT) scale [Formula: see text], a scenario referred to as 'sub-GUT'. The other generalization we consider is to retain GUT-scale universality for the squark and slepton masses, but to relax universality for the soft supersymmetry-breaking contributions to the masses of the Higgs doublets. As with other CMSSM-like models, the measured Higgs mass requires supersymmetric particle masses near or beyond the TeV scale. Because of these rather heavy sparticle masses, the embedding of these CMSSM-like models in a minimal SU(5) model of grand unification can yield a proton lifetime consistent with current experimental limits, and may be accessible in existing and future proton decay experiments. Another possible signature of these CMSSM-like models is direct detection of supersymmetric dark matter. The direct dark matter scattering rate is typically below the reach of the LUX-ZEPLIN (LZ) experiment if [Formula: see text] is close to [Formula: see text], but it may lie within its reach if [Formula: see text] GeV. Likewise, generalizing the CMSSM to allow non-universal supersymmetry-breaking contributions to the Higgs offers extensive possibilities for models within reach of the LZ experiment that have long proton lifetimes.

  11. Transcranial direct current stimulation accelerates allocentric target detection.

    Science.gov (United States)

    Medina, Jared; Beauvais, Jacques; Datta, Abhishek; Bikson, Marom; Coslett, H Branch; Hamilton, Roy H

    2013-05-01

    Previous research on hemispatial neglect has provided evidence for dissociable mechanisms for egocentric and allocentric processing. Although a few studies have examined whether tDCS to posterior parietal cortex can be beneficial for attentional processing in neurologically intact individuals, none have examined the potential effect of tDCS on allocentric and/or egocentric processing. Our objective was to examine whether transcranial direct current stimulation (tDCS), a noninvasive brain stimulation technique that can increase (anodal) or decrease (cathodal) cortical activity, can affect visuospatial processing in an allocentric and/or egocentric frame of reference. We tested healthy individuals on a target detection task in which the target--a circle with a gap--was either to the right or left of the viewer (egocentric), or contained a gap on the right or left side of the circle (allocentric). Individuals performed the task before, during, and after tDCS to the posterior parietal cortex in one of three stimulation conditions--right anodal/left cathodal, right cathodal/left anodal, and sham. We found an allocentric hemispatial effect both during and after tDCS, such that right anodal/left cathodal tDCS resulted in faster reaction times for detecting stimuli with left-sided gaps compared to right-sided gaps. Our study suggests that right anodal/left cathodal tDCS has a facilitatory effect on allocentric visuospatial processing, and might be useful as a therapeutic technique for individuals suffering from allocentric neglect. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. DaMaSCUS: the impact of underground scatterings on direct detection of light dark matter

    Science.gov (United States)

    Emken, Timon; Kouvaris, Chris

    2017-10-01

    Conventional dark matter direct detection experiments set stringent constraints on dark matter by looking for elastic scattering events between dark matter particles and nuclei in underground detectors. However these constraints weaken significantly in the sub-GeV mass region, simply because light dark matter does not have enough energy to trigger detectors regardless of the dark matter-nucleon scattering cross section. Even if future experiments lower their energy thresholds, they will still be blind to parameter space where dark matter particles interact with nuclei strongly enough that they lose enough energy and become unable to cause a signal above the experimental threshold by the time they reach the underground detector. Therefore in case dark matter is in the sub-GeV region and strongly interacting, possible underground scatterings of dark matter with terrestrial nuclei must be taken into account because they affect significantly the recoil spectra and event rates, regardless of whether the experiment probes DM via DM-nucleus or DM-electron interaction. To quantify this effect we present the publicly available Dark Matter Simulation Code for Underground Scatterings (DaMaSCUS), a Monte Carlo simulator of DM trajectories through the Earth taking underground scatterings into account. Our simulation allows the precise calculation of the density and velocity distribution of dark matter at any detector of given depth and location on Earth. The simulation can also provide the accurate recoil spectrum in underground detectors as well as the phase and amplitude of the diurnal modulation caused by this shadowing effect of the Earth, ultimately relating the modulations expected in different detectors, which is important to decisively conclude if a diurnal modulation is due to dark matter or an irrelevant background.

  13. Direct detection of exothermic dark matter with light mediator

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Chao-Qiang [Chongqing University of Posts & Telecommunications,Chongqing, 400065 (China); Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Huang, Da; Lee, Chun-Hao [Department of Physics, National Tsing Hua University,Hsinchu, Taiwan (China); Wang, Qing [Department of Physics, Tsinghua University,Beijing, 100084 (China); Collaborative Innovation Center of Quantum Matter,Beijing, 100084 (China)

    2016-08-05

    We study the dark matter (DM) direct detection for the models with the effects of the isospin-violating couplings, exothermic scatterings, and/or the lightness of the mediator, proposed to relax the tension between the CDMS-Si signals and null experiments. In the light of the new updates of the LUX and CDMSlite data, we find that many of the previous proposals are now ruled out, including the Ge-phobic exothermic DM model and the Xe-phobic DM one with a light mediator. We also examine the exothermic DM models with a light mediator but without the isospin violation, and we are unable to identify any available parameter space that could simultaneously satisfy all the experiments. The only models that can partially relax the inconsistencies are the Xe-phobic exothermic DM models with or without a light mediator. But even in this case, a large portion of the CDMS-Si regions of interest has been constrained by the LUX and SuperCDMS data.

  14. The effective field theory of dark matter direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Fitzpatrick, A. Liam; Haxton, Wick; Katz, Emanuel; Lubbers, Nicholas; Xu, Yiming

    2013-02-01

    We extend and explore the general non-relativistic effective theory of dark matter (DM) direct detection. We describe the basic non-relativistic building blocks of operators and discuss their symmetry properties, writing down all Galilean-invariant operators up to quadratic order in momentum transfer arising from exchange of particles of spin 1 or less. Any DM particle theory can be translated into the coefficients of an effective operator and any effective operator can be simply related to most general description of the nuclear response. We find several operators which lead to novel nuclear responses. These responses differ significantly from the standard minimal WIMP cases in their relative coupling strengths to various elements, changing how the results from different experiments should be compared against each other. Response functions are evaluated for common DM targets — F, Na, Ge, I, and Xe — using standard shell model techniques. We point out that each of the nuclear responses is familiar from past studies of semi-leptonic electroweak interactions, and thus potentially testable in weak interaction studies. We provide tables of the full set of required matrix elements at finite momentum transfer for a range of common elements, making a careful and fully model-independent analysis possible. Finally, we discuss embedding non-relativistic effective theory operators into UV models of dark matter.

  15. Synergistic effect of combined transcranial direct current stimulation/constraint-induced movement therapy in children and young adults with hemiparesis: study protocol

    OpenAIRE

    Gillick, Bernadette; Menk, Jeremiah; Mueller, Bryon; Meekins, Gregg; Krach, Linda E.; Feyma, Timothy; Rudser, Kyle

    2015-01-01

    Background Perinatal stroke occurs in more than 1 in 2,500 live births and resultant congenital hemiparesis necessitates investigation into interventions which may improve long-term function and decreased burden of care beyond current therapies (http://www.cdc.gov/ncbddd/cp/data.html). Constraint-Induced Movement Therapy (CIMT) is recognized as an effective hemiparesis rehabilitation intervention . Transcranial direct current stimulation as an adjunct treatment to CIMT may potentiate neuropla...

  16. An Analysis of Mechanical Constraints when Using Superconducting Gravimeters for Far-Field Pre-Seismic Anomaly Detection

    Directory of Open Access Journals (Sweden)

    Shyh-Chin Lan

    2011-01-01

    Full Text Available Pre-seismic gravity anomalies from records obtained at a 1 Hz sampling rate from superconducting gravimeters (SG around East Asia are analyzed. A comparison of gravity anomalies to the source parameters of associated earthquakes shows that the detection of pre-seismic gravity anomalies is constrained by several mechanical conditions of the seismic fault plane. The constraints of the far-field pre-seismic gravity amplitude perturbation were examined and the critical spatial relationship between the SG station and the epicenter precursory signal for detection was determined. The results show that: (1 the pre-seismic amplitude perturbation of gravity is inversely proportional to distance; (2 the transfer path from the epicenter to the SG station that crosses a tectonic boundary has a relatively low pre-seismic gravity anomaly amplitude; (3 the pre-seismic gravity perturbation amplitude is also affected by the attitude between the location of an SG station and the strike of the ruptured fault plane. The removal of typhoon effects and the selection of SG stations within a certain intersection angle to the strike of the fault plane are essential for obtaining reliable pre-seismic gravity anomaly results.

  17. Optical intensity modulation direct detection versus heterodyne detection: A high-SNR capacity comparison

    KAUST Repository

    Chaaban, Anas

    2016-09-15

    An optical wireless communications system which employs either intensity-modulation and direct-detection (IM-DD) or heterodyne detection (HD) is considered. IM-DD has lower complexity and cost than HD, but on the other hand, has lower capacity. It is therefore interesting to investigate the capacity gap between the two systems. The main focus of this paper is to investigate this gap at high SNR. Bounds on this gap are established for two cases: between IM-DD and HD, and between IM-DD and an HD-PAM which is an HD system employing pulse-amplitude modulation (PAM). While the gap between IM-DD and HD increases as the signal-to-noise ratio (SNR) increases, the gap between IM-DD and an HD-PAM is upper bounded by a constant at high SNR. © 2015 IEEE.

  18. Constraint-Induced Movement Therapy Combined with Transcranial Direct Current Stimulation over Premotor Cortex Improves Motor Function in Severe Stroke: A Pilot Randomized Controlled Trial

    Directory of Open Access Journals (Sweden)

    Suellen M. Andrade

    2017-01-01

    Full Text Available Objective. We compared the effects of transcranial direct current stimulation at different cortical sites (premotor and motor primary cortex combined with constraint-induced movement therapy for treatment of stroke patients. Design. Sixty patients were randomly distributed into 3 groups: Group A, anodal stimulation on premotor cortex and constraint-induced movement therapy; Group B, anodal stimulation on primary motor cortex and constraint-induced movement therapy; Group C, sham stimulation and constraint-induced movement therapy. Evaluations involved analysis of functional independence, motor recovery, spasticity, gross motor function, and muscle strength. Results. A significant improvement in primary outcome (functional independence after treatment in the premotor group followed by primary motor group and sham group was observed. The same pattern of improvement was highlighted among all secondary outcome measures regarding the superior performance of the premotor group over primary motor and sham groups. Conclusions. Premotor cortex can contribute to motor function in patients with severe functional disabilities in early stages of stroke. This study was registered in ClinicalTrials.gov database (NCT 02628561.

  19. On the Capacity Region of the Intensity-Modulation Direct-Detection Optical Broadcast Channel

    KAUST Repository

    Chaaban, Anas

    2015-08-11

    The capacity of the intensity-modulation direct-detection free-space optical broadcast channel (OBC) is investigated. The Gaussian model with input-independent Gaussian noise is used, with both average and peak intensity constraints. An outer bound on the capacity region is derived by adapting Bergmans\\' approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian distributions or discrete distributions. While the discrete input distribution achieves higher rates than the truncated-Gaussian distribution, the latter allows expressing the achievable rate region in a closed form. At high signal-to-noise ratio (SNR), it is shown that the truncated-Gaussian distribution is nearly optimal. It achieves the symmetric-capacity within a constant gap (independent of SNR), which approaches half a bit as the number of users grows large. It also achieves the capacity region within a constant gap, which depends on the number of users. At low SNR, it is shown that on-off keying with time-division multiple-access (TDMA) is optimal, as it achieves any point on the boundary of the developed outer bound. This is interesting in practice since both OOK and TDMA have low complexity. At moderate SNR (typically [0,8] dB), a discrete distribution with a small alphabet size achieves a fairly good performance in terms of symmetric rate.

  20. Synchrotron Emission from Dark Matter Annihilation: Predictions for Constraints from Non-detections of Galaxy Clusters with New Radio Surveys

    Science.gov (United States)

    Storm, Emma; Jeltema, Tesla E.; Splettstoesser, Megan; Profumo, Stefano

    2017-04-01

    The annihilation of dark matter particles is expected to yield a broad radiation spectrum via the production of Standard Model particles in astrophysical environments. In particular, electrons and positrons from dark matter annihilation produce synchrotron radiation in the presence of magnetic fields. Galaxy clusters are the most massive collapsed structures in the universe, and are known to host ˜μG-scale magnetic fields. They are therefore ideal targets to search for, or to constrain the synchrotron signal from dark matter annihilation. In this work, we use the expected sensitivities of several planned surveys from the next generation of radio telescopes to predict the constraints on dark matter annihilation models which will be achieved in the case of non-detections of diffuse radio emission from galaxy clusters. Specifically, we consider the Tier 1 survey planned for the Low Frequency Array (LOFAR) at 120 MHz, the Evolutionary Map of the Universe (EMU) survey planned for the Australian Square Kilometre Array Pathfinder (ASKAP) at 1.4 GHz, and planned surveys for Aperture Tile in Focus (APERTIF) at 1.4 GHz. We find that, for massive clusters and dark matter masses ≲ 100 {GeV}, the predicted limits on the annihilation cross section would rule out vanilla thermal relic models for even the shallow LOFAR Tier 1, ASKAP, and APERTIF surveys.

  1. Tests of WIMP Dark Matter Candidates with Direct Dark Matter Detection Experiments

    Science.gov (United States)

    Georgescu, Andreea Irina

    by CDMS-II-Si is compatible with the constraints imposed by all other experiments with null results. We also find a similar compatibility for exothermic inelastic spin-independent interactions with ƒn/ƒ p = --0.8. Finally, we reexamine the interpretation of the annual modulation signal observed by the DAMA experiment as due to WIMPs with a spin-dependent coupling mostly to protons. We consider both axial-vector and pseudo-scalar couplings, and elastic as well as endothermic and exothermic inelastic scattering. We conclude that the DAMA signal is in strong tension with null results of other direct detection experiments, particularly PICASSO and KIMS.

  2. The Higgs boson in the Standard Model theoretical constraints and a direct search in the wh channel at the Tevatron

    Energy Technology Data Exchange (ETDEWEB)

    Huske, Nils Kristian [Pierre and Marie Curie Univ., Paris (France); Bielefeld Univ. (Germany)

    2010-09-10

    We have presented results in two different yet strongly linked aspects of Higgs boson physics. We have learned about the importance of the Higgs boson for the fate of the Standard Model, being either only a theory limited to explaining phenomena at the electroweak scale or, if the Higgs boson lies within a mass range of 130 < mH < 160 GeV the SM would remain a self consistent theory up to highest energy scales O(mPl). This could have direct implications on theories of cosmological inflation using the Higgs boson as the particle giving rise to inflation in the very early Universe, if it couples non-minimally to gravity, an effect that would only become significant at very high energies. After understanding the immense meaning of proving whether the Higgs boson exists and if so, at which mass, we have presented a direct search for a Higgs boson in associated production with a W boson in a mass range 100 < mH < 150 GeV. A light Higgs boson is favored regarding constraints from electroweak precision measurements. As a single analysis is not yet sensitive for an observation of the Higgs boson using 5.3 fb-1 of Tevatron data, we set limits on the production cross section times branching ratio. At the Tevatron, however, we are able to combine the sensitivity of our analyses not only across channels or analyses at a single experiment but also across both experiments, namely CDF and D0. This yields to the so-called Tevatron Higgs combination which, in total, combines 129 analyses from both experiments with luminosities of up to 6.7 fb-1. The results of a previous Tevatron combination led to the first exclusion of possible Higgs boson masses since the LEP exclusion in 2001. The latest Tevatron combination from July 2010 can be seen in Fig. 111 and limits compared to the Standard Model expectation are listed in Table 23. It excludes a SM Higgs boson in the regions of 100 < mH < 109 GeV as well as 158 < m

  3. Recent Results in Dark Matter Direct Detection Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kelso, Christopher Michael [Univ. of Chicago, IL (United States)

    2012-08-01

    In this dissertation, we study the original excess of low energy events observed by the Co- GeNT collaboration and the annual modulation reported by the DAMA/LIBRA collaboration, and discuss whether these signals could both be the result of the same elastically scattering dark matter particle. We find that, without channeling but when taking into account uncertainties in the relevant quenching factors, a dark matter candidate with a mass of approximately ~7.0 GeV and a cross section with nucleons of σDM-N ~2 x 10-40 cm2 could account for both of these observations. We also compare the region of parameter space favored by DAMA/LIBRA and CoGeNT to the constraints from XENON 10, XENON 100, and CDMS (Si).

  4. When does female multiple mating evolve to adjust inbreeding? Effects of inbreeding depression, direct costs, mating constraints, and polyandry as a threshold trait.

    Science.gov (United States)

    Duthie, A Bradley; Bocedi, Greta; Reid, Jane M

    2016-09-01

    Polyandry is often hypothesized to evolve to allow females to adjust the degree to which they inbreed. Multiple factors might affect such evolution, including inbreeding depression, direct costs, constraints on male availability, and the nature of polyandry as a threshold trait. Complex models are required to evaluate when evolution of polyandry to adjust inbreeding is predicted to arise. We used a genetically explicit individual-based model to track the joint evolution of inbreeding strategy and polyandry defined as a polygenic threshold trait. Evolution of polyandry to avoid inbreeding only occurred given strong inbreeding depression, low direct costs, and severe restrictions on initial versus additional male availability. Evolution of polyandry to prefer inbreeding only occurred given zero inbreeding depression and direct costs, and given similarly severe restrictions on male availability. However, due to its threshold nature, phenotypic polyandry was frequently expressed even when strongly selected against and hence maladaptive. Further, the degree to which females adjusted inbreeding through polyandry was typically very small, and often reflected constraints on male availability rather than adaptive reproductive strategy. Evolution of polyandry solely to adjust inbreeding might consequently be highly restricted in nature, and such evolution cannot necessarily be directly inferred from observed magnitudes of inbreeding adjustment. © 2016 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  5. EARLY-PHASE PHOTOMETRY AND SPECTROSCOPY OF TRANSITIONAL TYPE Ia SN 2012ht: DIRECT CONSTRAINT ON THE RISE TIME

    Energy Technology Data Exchange (ETDEWEB)

    Yamanaka, Masayuki; Nogami, Daisaku [Kwasan Observatory, Kyoto University, 17-1 Kitakazan-ohmine-cho, Yamashina-ku, Kyoto 607-8471 (Japan); Maeda, Keiichi [Department of Astronomy, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Kawabata, Miho; Masumoto, Kazunari; Matsumoto, Katsura [Astronomical Institute, Osaka Kyoiku University, Asahigaoka, Kashiwara, Osaka 582-8582 (Japan); Tanaka, Masaomi [National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo 181-8588 (Japan); Takaki, Katsutoshi; Ueno, Issei; Itoh, Ryosuke [Department of Physical Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan); Kawabata, Koji S.; Moritani, Yuki; Akitaya, Hiroshi; Yoshida, Michitoshi [Hiroshima Astrophysical Science Center, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Arai, Akira; Honda, Satoshi [Center for Astronomy, University of Hyogo, 407-2 Nishigaichi, Sayo-cho, Sayo, Hyogo 679-5313 (Japan); Nishiyama, Koichi [Kurume, Fukuoka-ken (Japan); Kabashima, Fujio, E-mail: yamanaka@kwasan.kyoto-u.ac.jp [Miyaki-cho, Saga-ken (Japan)

    2014-02-20

    We report photometric and spectroscopic observations of the nearby Type Ia Supernova (SN Ia) 2012ht from –15.8 days to +49.1 days after B-band maximum. The decline rate of the light curve is Δm {sub 15}(B) = 1.39 ± 0.05 mag, which is intermediate between normal and subluminous SNe Ia, and similar to that of the ''transitional'' Type Ia SN 2004eo. The spectral line profiles also closely resemble those of SN 2004eo. We were able to observe SN 2012ht at a very early phase, when it was still rising and was about three magnitudes fainter than at the peak. The rise time to the B-band maximum is estimated to be 17.6 ± 0.5 days and the time of the explosion is MJD 56277.98 ± 0.13. SN 2012ht is the first transitional SN Ia whose rise time is directly measured without using light curve templates, and the fifth SN Ia overall. This rise time is consistent with those of the other four SNe within the measurement error, even including the extremely early detection of SN 2013dy. The rising part of the light curve can be fitted by a quadratic function, and shows no sign of a shock-heating component due to the interaction of the ejecta with a companion star. The rise time is significantly longer than that inferred for subluminous SNe such as SN 1991bg, which suggests that a progenitor and/or explosion mechanism of transitional SNe Ia are more similar to normal SNe Ia rather than to subluminous SNe Ia.

  6. Direct link paths detection for observed teleconnections in climate networks

    Science.gov (United States)

    Zhou, Dong; Gozolchiani, Avi; Ashkenazy, Yosef; Havlin, Shlomo

    2015-04-01

    Climate networks have been used to describe certain kind of relations between the climate time series of each pair of nodes. However, all these observed relations should include both the direct relation between these nodes and the indirect effects through other nodes, and the direct link patterns of climate networks are still unclear. In this work, we use the normalized cross-correlation to define both positive and negative link strengths, and for this definition we develop a method based on partial correlation to remove the indirect effect from the observed global air temperature network and obtain the direct positive and negative links. The strong direct links can illustrate how a certain climatic mechanism is propagating step by step in both time and space. Particularly, for the observed teleconnections, we can find the dominant paths of direct links between two nodes by finding the directed shortest paths in the direct link network. The spatial and temporal properties of these paths can help us better understand the origin of such teleconnections.

  7. Constraint Differentiation

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander; Basin, David; Viganò, Luca

    2010-01-01

    We introduce constraint differentiation, a powerful technique for reducing search when model-checking security protocols using constraint-based methods. Constraint differentiation works by eliminating certain kinds of redundancies that arise in the search space when using constraints to represent...

  8. Chasing a consistent picture for dark matter direct detection searches

    NARCIS (Netherlands)

    Arina, C.

    2012-01-01

    In this paper we assess the present status of dark matter direct searches by means of Bayesian statistics. We consider three particle physics models for spin-independent dark matter interaction with nuclei: elastic, inelastic and isospin violating scattering. We briefly present the state of the art

  9. The detection of transient directional couplings based on phase synchronization

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, T; Fell, J; Lehnertz, K, E-mail: twagner@uni-bonn.d [Department of Epileptology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn (Germany)

    2010-05-15

    We extend recent approaches based on the concept of phase synchronization to enable the time-resolved investigation of directional relationships between coupled dynamical systems from short and transient noisy time series. For our approach, we consider an observed ensemble of a sufficiently large number of time series as multiple realizations of a process. We derive an index that quantifies the direction of transient interactions and assess its statistical significance using surrogate techniques. Analysing time series from noisy and chaotic systems, we demonstrate numerically the applicability and limitations of our approach. Our findings from an exemplary application to event-related brain activities underline the importance of our method for improving knowledge about the mechanisms underlying memory formation in humans.

  10. Direct detection of a single photon by humans

    Science.gov (United States)

    Tinsley, Jonathan N.; Molodtsov, Maxim I.; Prevedel, Robert; Wartmann, David; Espigulé-Pons, Jofre; Lauwers, Mattias; Vaziri, Alipasha

    2016-01-01

    Despite investigations for over 70 years, the absolute limits of human vision have remained unclear. Rod cells respond to individual photons, yet whether a single-photon incident on the eye can be perceived by a human subject has remained a fundamental open question. Here we report that humans can detect a single-photon incident on the cornea with a probability significantly above chance. This was achieved by implementing a combination of a psychophysics procedure with a quantum light source that can generate single-photon states of light. We further discover that the probability of reporting a single photon is modulated by the presence of an earlier photon, suggesting a priming process that temporarily enhances the effective gain of the visual system on the timescale of seconds. PMID:27434854

  11. Theoretical interpretation of experimental data from direct dark matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Shan Chung-Lin

    2007-10-15

    I derive expressions that allow to reconstruct the normalized one-dimensional velocity distribution function of halo WIMPs and to determine its moments from the recoil energy spectrum as well as from experimental data directly. The reconstruction of the velocity distribution function is further extended to take into account the annual modulation of the event rate. All these expressions are independent of the as yet unknown WIMP density near the Earth as well as of the WIMP-nucleus cross section. The only information about the nature of halo WIMPs which one needs is the WIMP mass. I also present a method for the determination of the WIMP mass by combining two (or more) experiments with different detector materials. This method is not only independent of the model of Galactic halo but also of that of WIMPs. (orig.)

  12. Synergistic effect of combined transcranial direct current stimulation/constraint-induced movement therapy in children and young adults with hemiparesis: study protocol.

    Science.gov (United States)

    Gillick, Bernadette; Menk, Jeremiah; Mueller, Bryon; Meekins, Gregg; Krach, Linda E; Feyma, Timothy; Rudser, Kyle

    2015-11-12

    Perinatal stroke occurs in more than 1 in 2,500 live births and resultant congenital hemiparesis necessitates investigation into interventions which may improve long-term function and decreased burden of care beyond current therapies ( http://www.cdc.gov/ncbddd/cp/data.html ). Constraint-Induced Movement Therapy (CIMT) is recognized as an effective hemiparesis rehabilitation intervention. Transcranial direct current stimulation as an adjunct treatment to CIMT may potentiate neuroplastic responses and improve motor function. The methodology of a clinical trial in children designed as a placebo-controlled, serial -session, non-invasive brain stimulation trial incorporating CIMT is described here. The primary hypotheses are 1) that no serious adverse events will occur in children receiving non-invasive brain stimulation and 2) that children in the stimulation intervention group will show significant improvements in hand motor function compared to children in the placebo stimulation control group. A randomized, controlled, double-blinded clinical trial. Twenty children and/or young adults (ages 8-21) with congenital hemiparesis, will be enrolled. The intervention group will receive ten 2-hour sessions of transcranial direct current stimulation combined with constraint-induced movement therapy and the control group will receive sham stimulation with CIMT. The primary outcome measure is safety assessment of transcranial direct current stimulation by physician evaluation, vital sign monitoring and symptom reports. Additionally, hand function will be evaluated using the Assisting Hand Assessment, grip strength and assessment of goals using the Canadian Occupational Performance Measure. Neuroimaging will confirm diagnoses, corticospinal tract integrity and cortical activation. Motor cortical excitability will also be examined using transcranial magnetic stimulation techniques. Combining non-invasive brain stimulation and CIMT interventions has the potential to improve motor

  13. A direct immunoassay for detecting diatoms in groundwater as an indicator of the direct influence of surface water

    Science.gov (United States)

    Walker, C.E.; Schrock, R.M.; Reilly, T.J.; Baehr, A.L.

    2005-01-01

    Groundwater under the direct influence of surface water (GWUDISW) is of concern in communities where growing public demand on groundwater resources has resulted in increased withdrawals and hydraulic stress near surface water bodies. Under these conditions, contaminants such as methyl-tert butyl ether (MTBE) and biological materials have been detected in domestic wells. Other contaminants and pathogens associated with surface water are not routinely tested for in groundwater-supplied systems. To address the need for methods to easily identify potentially vulnerable supplies, a direct immunoassay for the quantitative detection of diatoms in raw water samples was developed as a measure of surface water influence on groundwater. Cell wall preparations from Nitzschia palea Kützing, a freshwater diatom found throughout North America, were used to produce a polyclonal antibody that was applied in a direct enzyme-linked immunosorbent assay (ELISA) developed to detect the presence of N. palea cell wall components. The direct immunoassay allows detection at 500 cells L−1, a level similar to diatom concentrations observed in samples of groundwater collected near the test site. This investigation was the first attempt to utilize an ELISA as an indicator of surface water influence on groundwater. Further research is needed to develop more specific diatom-based monoclonal antibodies, determine cross-reactivity, and optimize sample processing and ELISA procedures for development of a standardized method.

  14. Learned helplessness and the detection of contingency: a direct test.

    Science.gov (United States)

    Tennen, H; Drum, P E; Gillen, R; Stanton, A

    1982-12-01

    Two studies tested a basic hypothesis of the learned helplessness model: That performance deficits associated with exposure to uncontrollable outcomes are directly mediated by an individual's perception of response-outcome independence. In the first experiment 48 subjects were exposed to noise bursts. For one experimental group, the termination of the noise was response-contingent. For five other groups, noise-burst termination was independent of subjects' responses. These five groups varied in the number of trials on which they received positive feedback: As predicted, subjects over-estimated the amount of control they had over noise termination as a positive linear function of the amount of noncontingent positive feedback they received. Although subjects exposed to either noncontingent positive or negative feedback showed subsequent performance deficits on an anagrams task, the expected relation between perceived control and subsequent performance failed to emerge. These findings were replicated in a second experiment. In addition, subjects' locus, stability, and globality attributions failed to predict subsequent performance. These results call into question the central premises of helplessness theory: That perceived uncontrollability and causal attributions mediate learned helplessness.

  15. In search of genetic constraints limiting the evolution of egg size: direct and correlated responses to artificial selection on a prenatal maternal effector.

    Science.gov (United States)

    Pick, J L; Hutter, P; Tschirren, B

    2016-06-01

    Maternal effects are an important force in nature, but the evolutionary dynamics of the traits that cause them are not well understood. Egg size is known to be a key mediator of prenatal maternal effects with an established genetic basis. In contrast to theoretical expectations for fitness-related traits, there is a large amount of additive genetic variation in egg size observed in natural populations. One possible mechanism for the maintenance of this variation is through genetic constraints caused by a shared genetic basis among traits. Here we created replicated, divergent selection lines for maternal egg investment in Japanese quail (Coturnix japonica) to quantify the role of genetic constraints in the evolution of egg size. We found that egg size responds rapidly to selection, accompanied by a strong response in all egg components. Initially, we observed a correlated response in body size, but this response declined over time, showing that egg size and body size can evolve independently. Furthermore, no correlated response in fecundity (measured as the proportion of days on which a female laid an egg) was observed. However, the response to selection was asymmetrical, with egg size plateauing after one generation of selection in the high but not the low investment lines. We attribute this pattern to the presence of genetic asymmetries, caused by directional dominance or unequal allele frequencies. Such asymmetries may contribute to the evolutionary stasis in egg size observed in natural populations, despite a positive association between egg size and fitness.

  16. Improving the Accuracy of Direct Geo-referencing of Smartphone-Based Mobile Mapping Systems Using Relative Orientation and Scene Geometric Constraints

    Science.gov (United States)

    Alsubaie, Naif M.; Youssef, Ahmed A.; El-Sheimy, Naser

    2017-01-01

    This paper introduces a new method which facilitate the use of smartphones as a handheld low-cost mobile mapping system (MMS). Smartphones are becoming more sophisticated and smarter and are quickly closing the gap between computers and portable tablet devices. The current generation of smartphones are equipped with low-cost GPS receivers, high-resolution digital cameras, and micro-electro mechanical systems (MEMS)-based navigation sensors (e.g., accelerometers, gyroscopes, magnetic compasses, and barometers). These sensors are in fact the essential components for a MMS. However, smartphone navigation sensors suffer from the poor accuracy of global navigation satellite System (GNSS), accumulated drift, and high signal noise. These issues affect the accuracy of the initial Exterior Orientation Parameters (EOPs) that are inputted into the bundle adjustment algorithm, which then produces inaccurate 3D mapping solutions. This paper proposes new methodologies for increasing the accuracy of direct geo-referencing of smartphones using relative orientation and smartphone motion sensor measurements as well as integrating geometric scene constraints into free network bundle adjustment. The new methodologies incorporate fusing the relative orientations of the captured images and their corresponding motion sensor measurements to improve the initial EOPs. Then, the geometric features (e.g., horizontal and vertical linear lines) visible in each image are extracted and used as constraints in the bundle adjustment procedure which correct the relative position and orientation of the 3D mapping solution. PMID:28973958

  17. Improving the Accuracy of Direct Geo-referencing of Smartphone-Based Mobile Mapping Systems Using Relative Orientation and Scene Geometric Constraints

    Directory of Open Access Journals (Sweden)

    Naif M. Alsubaie

    2017-09-01

    Full Text Available This paper introduces a new method which facilitate the use of smartphones as a handheld low-cost mobile mapping system (MMS. Smartphones are becoming more sophisticated and smarter and are quickly closing the gap between computers and portable tablet devices. The current generation of smartphones are equipped with low-cost GPS receivers, high-resolution digital cameras, and micro-electro mechanical systems (MEMS-based navigation sensors (e.g., accelerometers, gyroscopes, magnetic compasses, and barometers. These sensors are in fact the essential components for a MMS. However, smartphone navigation sensors suffer from the poor accuracy of global navigation satellite System (GNSS, accumulated drift, and high signal noise. These issues affect the accuracy of the initial Exterior Orientation Parameters (EOPs that are inputted into the bundle adjustment algorithm, which then produces inaccurate 3D mapping solutions. This paper proposes new methodologies for increasing the accuracy of direct geo-referencing of smartphones using relative orientation and smartphone motion sensor measurements as well as integrating geometric scene constraints into free network bundle adjustment. The new methodologies incorporate fusing the relative orientations of the captured images and their corresponding motion sensor measurements to improve the initial EOPs. Then, the geometric features (e.g., horizontal and vertical linear lines visible in each image are extracted and used as constraints in the bundle adjustment procedure which correct the relative position and orientation of the 3D mapping solution.

  18. Halo-independent direct detection of momentum-dependent dark matter

    DEFF Research Database (Denmark)

    Cherry, J. F.; Frandsen, M. T.; Shoemaker, I. M.

    2014-01-01

    We show that the momentum dependence of dark matter interactions with nuclei can be probed in direct detection experiments without knowledge of the dark matter velocity distribution. This is one of the few properties of DM microphysics that can be determined with direct detection alone, given...... a signal of dark matter in multiple direct detection experiments with different targets. Long-range interactions arising from the exchange of a light mediator are one example of momentum-dependent DM. For data produced from the exchange of a massless mediator we find for example that the mediator mass can...

  19. Positive cloud-to-ground lightning detection by a direction-finder network

    Science.gov (United States)

    Macgorman, Donald R.; Taylor, William L.

    1989-01-01

    Consideration is given to the ability of an automatic direction-finder network to identify cloud-to-ground flashes that effectively lower positive charge to the ground (+CG flashes). Records from an extremely low frequency system are examined to determine whether or not 340 +CG flashes detected by the network have coincident waveforms characteristic of +CG flashes. It is found that false detection in the system is negligible for +CG flashes with range-normalized amplitudes of at least 50 direction-finder units. Also, it is shown that no more than about 15 percent of the +CG flashes detected by the system at smaller amplitudes are false detections.

  20. A review of the discovery reach of directional Dark Matter detection

    Energy Technology Data Exchange (ETDEWEB)

    Mayet, F., E-mail: mayet@lpsc.in2p3.fr [Laboratoire de Physique Subatomique et de Cosmologie, Université Grenoble Alpes, CNRS/IN2P3, Grenoble (France); Green, A.M. [School of Physics and Astronomy, University of Nottingham, University Park, Nottingham, NG7 2RD (United Kingdom); Battat, J.B.R. [Physics Department, Wellesley College, 106 Central Street, Wellesley, MA 02481 (United States); Billard, J. [IPNL, Université de Lyon, Université Lyon 1, CNRS/IN2P3, 4 rue E. Fermi 69622 Villeurbanne cedex (France); Bozorgnia, N. [GRAPPA Institute, University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Gelmini, G.B. [Department of Physics and Astronomy, University of California, Los Angeles 475 Portola Plaza, Los Angeles, CA 90095 (United States); Gondolo, P. [Department of Physics and Astronomy, University of Utah, 115 South 1400 East #201, Salt Lake City, Utah 84112-0830 (United States); Kavanagh, B.J. [Institut de Physique Théorique, Université Paris-Saclay, CNRS, CEA, F-91191 Gif-sur-Yvette (France); Sorbonne Universités, UPMC Univ Paris 06, UMR 7589, LPTHE, F-75005, Paris (France); Lee, S.K. [Princeton Center for Theoretical Science, Princeton University, Princeton, NJ 08544 (United States); Broad Institute, Cambridge, MA 02142 (United States); Loomba, D. [Physics & Astronomy Department, University of New Mexico, 1919 Lomas Blvd NE, Albuquerque, NM 87131 (United States); Monroe, J. [Department of Physics, Royal Holloway, University of London, Egham Hill, Surrey, TW20 0EX (United Kingdom); Morgan, B. [Department of Physics, University of Warwick, Gibbet Hill Road, Coventry, CV4 7AL (United Kingdom); O’Hare, C.A.J. [School of Physics and Astronomy, University of Nottingham, University Park, Nottingham, NG7 2RD (United Kingdom); and others

    2016-04-20

    Cosmological observations indicate that most of the matter in the Universe is Dark Matter. Dark Matter in the form of Weakly Interacting Massive Particles (WIMPs) can be detected directly, via its elastic scattering off target nuclei. Most current direct detection experiments only measure the energy of the recoiling nuclei. However, directional detection experiments are sensitive to the direction of the nuclear recoil as well. Due to the Sun’s motion with respect to the Galactic rest frame, the directional recoil rate has a dipole feature, peaking around the direction of the Solar motion. This provides a powerful tool for demonstrating the Galactic origin of nuclear recoils and hence unambiguously detecting Dark Matter. Furthermore, the directional recoil distribution depends on the WIMP mass, scattering cross section and local velocity distribution. Therefore, with a large number of recoil events it will be possible to study the physics of Dark Matter in terms of particle and astrophysical properties. We review the potential of directional detectors for detecting and characterizing WIMPs.

  1. Observer-Based Perturbation Extremum Seeking Control with Input Constraints for Direct-Contact Membrane Distillation Process

    KAUST Repository

    Eleiwi, Fadi

    2017-05-08

    An Observer-based Perturbation Extremum Seeking Control (PESC) is proposed for a Direct-Contact Membrane Distillation (DCMD) process. The process is described with a dynamic model that is based on a 2D Advection-Diffusion Equation (ADE) model which has pump flow rates as process inputs. The objective of the controller is to optimize the trade-off between the permeate mass flux and the energy consumption by the pumps inside the process. Cases of single and multiple control inputs are considered through the use of only the feed pump flow rate or both the feed and the permeate pump flow rates. A nonlinear Lyapunov-based observer is designed to provide an estimation for the temperature distribution all over the designated domain of the DCMD process. Moreover, control inputs are constrained with an anti-windup technique to be within feasible and physical ranges. Performance of the proposed structure is analyzed, and simulations based on real DCMD process parameters for each control input are provided.

  2. Signal to Noise Ratios of Pulsed and Sinewave Modulated Direct Detection Lidar for IPDA Measurements

    Science.gov (United States)

    Sun, Xiaoli; Abshire, James B.

    2011-01-01

    The signal-to-noise ratios have been derived for IPDA lidar using a direct detection receiver for both pulsed and sinewave laser modulation techniques, and the results and laboratory measurements are presented

  3. Light dark matter versus astrophysical constraints

    OpenAIRE

    Cline, James M.; Frey, Andrew R.

    2011-01-01

    Hints of direct dark matter detection coming from the DAMA, CoGeNT experiments point toward light dark matter with isospin-violating and possibly inelastic couplings. However an array of astrophysical constraints are rapidly closing the window on light dark matter. We point out that if the relic density is determined by annihilation into invisible states, these constraints can be evaded. As an example we present a model of quasi-Dirac dark matter, interacting via two U(1) gauge bosons, one of...

  4. Advancing Solar Irradiance Measurement for Climate-Related Studies: Accurate Constraint on Direct Aerosol Radiative Effect (DARE)

    Science.gov (United States)

    Tsay, Si-Chee; Ji, Q. Jack

    2011-01-01

    Earth's climate is driven primarily by solar radiation. As summarized in various IPCC reports, the global average of radiative forcing for different agents and mechanisms, such as aerosols or CO2 doubling, is in the range of a few W/sq m. However, when solar irradiance is measured by broadband radiometers, such as the fleet of Eppley Precision Solar Pyranometers (PSP) and equivalent instrumentation employed worldwide, the measurement uncertainty is larger than 2% (e.g., WMO specification of pyranometer, 2008). Thus, out of the approx. 184 W/sq m (approx.263 W/sq m if cloud-free) surface solar insolation (Trenberth et al. 2009), the measurement uncertainty is greater than +/-3.6 W/sq m, overwhelming the climate change signals. To discern these signals, less than a 1 % measurement uncertainty is required and is currently achievable only by means of a newly developed methodology employing a modified PSP-like pyranometer and an updated calibration equation to account for its thermal effects (li and Tsay, 2010). In this talk, we will show that some auxiliary measurements, such as those from a collocated pyrgeometer or air temperature sensors, can help correct historical datasets. Additionally, we will also demonstrate that a pyrheliometer is not free of the thermal effect; therefore, comparing to a high cost yet still not thermal-effect-free "direct + diffuse" approach in measuring surface solar irradiance, our new method is more economical, and more likely to be suitable for correcting a wide variety of historical datasets. Modeling simulations will be presented that a corrected solar irradiance measurement has a significant impact on aerosol forcing, and thus plays an important role in climate studies.

  5. The Diurnal Variation of the Wimp Detection Event Rates in Directional Experiments

    CERN Document Server

    Vergados, J D

    2009-01-01

    The recent WMAP data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Modern particle theories naturally provide viable cold dark matter candidates with masses in the GeV-TeV region. Supersymmetry provides the lightest supersymmetric particle (LSP), theories in extra dimensions supply the lightest Kaluza-Klein particle (LKP) etc. The nature of dark matter can only be unraveled only by its direct detection in the laboratory. All such candidates will be called WIMPs (Weakly Interacting Massive Particles). In any case the direct dark matter search, which amounts to detecting the recoiling nucleus, following its collision with WIMP, is central to particle physics and cosmology. In this work we briefly review the theoretical elements relevant to the direct dark matter detection experiments, paying particular attention to directional experiments. i.e experiments in which, not only the energy but the direction of the recoiling nucleus is ob...

  6. Ultrasensitive detection of coliforms by means of direct asymmetric PCR combined with disposable magnetic amperometric genosensors.

    Science.gov (United States)

    Loaiza, Oscar A; Campuzano, Susana; Pedrero, María; García, Pedro; Pingarrón, José M

    2009-01-01

    An extremely sensitive procedure for the isolation and detection of DNA from bacterial cell cultures is described. Direct asymmetric PCR amplified products from E. coli cultures are specifically detected, at a concentration level as low as 0.01 cfu mL(-1) (cfu, colony forming unit), using disposable magnetic DNA hybridization amperometric sensors with no need for culture preconcentration steps.

  7. Bloodstream infections caused by Pseudomonas spp.; how to detect carbapenemase producers directly from positive blood cultures ?

    OpenAIRE

    Dortet, Laurent; Boulanger, Anne; Poirel, Laurent; Nordmann, Patrice

    2014-01-01

    The Carba NP test has been evaluated to detect carbapenemase-producing Pseudomonas spp. directly from blood cultures. This rapid and cost-effective test permits an early identification of carbapenemase-producing Pseudomonas spp. directly from blood cultures with excellent sensitivity and specificity. Results may be useful in particular for guiding the first-line therapy and epidemiological purposes.

  8. Receiver Signal to Noise Ratios for IPDA Lidars Using Sine-wave and Pulsed Laser Modulation and Direct Detections

    Science.gov (United States)

    Sun, Xiaoli; Abshire, James B.

    2011-01-01

    Integrated path differential absorption (IPDA) lidar can be used to remotely measure the column density of gases in the path to a scattering target [1]. The total column gas molecular density can be derived from the ratio of the laser echo signal power with the laser wavelength on the gas absorption line (on-line) to that off the line (off-line). 80th coherent detection and direct detection IPDA lidar have been used successfully in the past in horizontal path and airborne remote sensing measurements. However, for space based measurements, the signal propagation losses are often orders of magnitude higher and it is important to use the most efficient laser modulation and detection technique to minimize the average laser power and the electrical power from the spacecraft. This paper gives an analysis the receiver signal to noise ratio (SNR) of several laser modulation and detection techniques versus the average received laser power under similar operation environments. Coherent detection [2] can give the best receiver performance when the local oscillator laser is relatively strong and the heterodyne mixing losses are negligible. Coherent detection has a high signal gain and a very narrow bandwidth for the background light and detector dark noise. However, coherent detection must maintain a high degree of coherence between the local oscillator laser and the received signal in both temporal and spatial modes. This often results in a high system complexity and low overall measurement efficiency. For measurements through atmosphere the coherence diameter of the received signal also limits the useful size of the receiver telescope. Direct detection IPDA lidars are simpler to build and have fewer constraints on the transmitter and receiver components. They can use much larger size 'photon-bucket' type telescopes to reduce the demands on the laser transmitter. Here we consider the two most widely used direct detection IPDA lidar techniques. The first technique uses two CW

  9. Nonlinear impairment compensation for DFT-S OFDM signal transmission with directly modulated laser and direct detection

    Science.gov (United States)

    Gou, Pengqi; Wang, Kaihui; Qin, Chaoyi; Yu, Jianjun

    2017-03-01

    We experimentally demonstrate a 16-ary quadrature amplitude modulation (16QAM) DFT-spread optical orthogonal frequency division multiplexing (OFDM) transmission system utilizing a cost-effective directly modulated laser (DML) and direct detection. For 20-Gbaud 16QAM-OFDM signal, with the aid of nonlinear equalization (NLE) algorithm, we respectively provide 6.2-dB and 5.2-dB receiver sensitivity improvement under the hard-decision forward-error-correction (HD-FEC) threshold of 3.8×10-3 for the back-to-back (BTB) case and after transmission over 10-km standard single mode fiber (SSMF) case, related to only adopt post-equalization scheme. To our knowledge, this is the first time to use dynamic nonlinear equalizer (NLE) based on the summation of the square of the difference between samples in one IM/DD OFDM system with DML to mitigate nonlinear distortion.

  10. Simultaneous multi-vehicle detection and tracking framework with pavement constraints based on machine learning and particle filter algorithm

    Science.gov (United States)

    Wang, Ke; Huang, Zhi; Zhong, Zhihua

    2014-11-01

    Due to the large variations of environment with ever-changing background and vehicles with different shapes, colors and appearances, to implement a real-time on-board vehicle recognition system with high adaptability, efficiency and robustness in complicated environments, remains challenging. This paper introduces a simultaneous detection and tracking framework for robust on-board vehicle recognition based on monocular vision technology. The framework utilizes a novel layered machine learning and particle filter to build a multi-vehicle detection and tracking system. In the vehicle detection stage, a layered machine learning method is presented, which combines coarse-search and fine-search to obtain the target using the AdaBoost-based training algorithm. The pavement segmentation method based on characteristic similarity is proposed to estimate the most likely pavement area. Efficiency and accuracy are enhanced by restricting vehicle detection within the downsized area of pavement. In vehicle tracking stage, a multi-objective tracking algorithm based on target state management and particle filter is proposed. The proposed system is evaluated by roadway video captured in a variety of traffics, illumination, and weather conditions. The evaluating results show that, under conditions of proper illumination and clear vehicle appearance, the proposed system achieves 91.2% detection rate and 2.6% false detection rate. Experiments compared to typical algorithms show that, the presented algorithm reduces the false detection rate nearly by half at the cost of decreasing 2.7%-8.6% detection rate. This paper proposes a multi-vehicle detection and tracking system, which is promising for implementation in an on-board vehicle recognition system with high precision, strong robustness and low computational cost.

  11. The direct detection of non-baryonic dark matter in the Galaxy?

    Science.gov (United States)

    Hawkins, M. R. S.

    1998-05-01

    It has been argued in a number of recent papers that dark matter is in the form of Jupiter-mass primordial black holes that betray their presence by microlensing quasars. This lensing accounts for a number of characteristic properties of quasar light curves, in both single quasars and gravitationally lensed multiple systems, that are not explained on the basis of intrinsic variation. One prediction of this idea is that Jupiter-mass bodies will be detected by the MACHO experiment as short events of about 2 d duration, although the expected frequency of detection is still very hard to estimate. However, the recent report by the MACHO group of the detection of a Jupiter-mass body in the direction of the Galactic bulge is consistent with this prediction, and is possibly the first direct detection of non-baryonic matter in the Galaxy.

  12. Exploring the Cosmic Frontier, Task A - Direct Detection of Dark Matter, Task B - Experimental Particle Astrophysics

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, John A.J. [Univ. of New Mexico, Albuquerque, NM (United States); Gold, Michael S. [Univ. of New Mexico, Albuquerque, NM (United States)

    2016-08-11

    This report summarizes the work of Task A and B for the period 2013-2016. For Task A the work is for direct detection of dark matter with the single-phase liquid argon experiment Mini-CLEAN. For Task B the work is for the search for new physics in the analysis of fluorescence events with the Auger experiment and for the search for the indirect detection of dark matter with the HAWC experiment.

  13. Switchable Reporter Enzymes Based on Mutually Exclusive Domain Interactions Allow Antibody Detection Directly in Solution

    OpenAIRE

    Banala, Sambashiva; Aper, Stijn J. A.; Schalk, Werner; Merkx, Maarten

    2013-01-01

    Detection of antibodies is essential for the diagnosis of many diseases including infections, allergies and autoimmune diseases. Current heterogeneous immunoassays require multiple time-consuming binding and washing steps, which limits their application in point-of-care diagnostics and high-throughput screening. Here we report switchable reporter enzymes that allow simple colorimetric detection of antibodies directly in solution. Our approach is based on the antibody-induced disruption of an ...

  14. Very high-capacity short-reach VCSEL systems exploiting multicarrier intensity modulation and direct detection.

    Science.gov (United States)

    Gatto, Alberto; Argenio, Debora; Boffi, Pierpaolo

    2016-06-13

    Multicarrier intensity modulation of a bandwidth-limited long-wavelength VCSEL is exploited combined to direct detection to achieve very high capacity simple systems for short-reach applications. Tailored FDM subcarriers modulation and allocation allow to match the non-uniform frequency response of the system induced by the direct modulation and detection of the FDM signal and by the uncompensated SSMF propagation, overcoming the VCSEL bandwidth limitations. A whole transported throughput ranging from 34 Gb/s to 25 Gb/s from few hundreds meters to 20 km of SSMF propagation is experimentally demonstrated even by employing a 5-GHz band VCSEL source.

  15. Time and direction of arrival detection and filtering for imaging in strongly scattering random media

    CERN Document Server

    Borcea, Liliana; Tsogka, Chrysoula

    2016-01-01

    We study detection and imaging of small reflectors in heavy clutter, using an array of transducers that emits and receives sound waves. Heavy clutter means that multiple scattering of the waves in the heterogeneous host medium is strong and overwhelms the arrivals from the small reflectors. Building on the adaptive time-frequency filter of [1], we propose a robust method for detecting the direction of arrival of the direct echoes from the small reflectors, and suppressing the unwanted clutter backscatter. This improves the resolution of imaging. We illustrate the performance of the method with realistic numerical simulations in a non-destructive testing setup.

  16. Bose-Einstein-condensed scalar field dark matter and the gravitational wave background from inflation: New cosmological constraints and its detectability by LIGO

    Science.gov (United States)

    Li, Bohua; Shapiro, Paul R.; Rindler-Daller, Tanja

    2017-09-01

    We consider an alternative to weakly interacting massive particle (WIMP) cold dark matter (CDM)—ultralight bosonic dark matter (m ≳10-22 eV /c2) described by a complex scalar field (SFDM) with a global U (1 ) symmetry—for which the comoving particle number density or charge density is conserved after particle production during standard reheating. We allow for a repulsive self-interaction. In a Λ SFDM universe, SFDM starts out relativistic, evolving from stiff (w =1 ) to radiation-like (w =1 /3 ), before becoming nonrelativistic at late times (w =0 ). Thus, before the familiar radiation-dominated era, there is an earlier era of stiff-SFDM domination. During both the stiff-SFDM-dominated and radiation-dominated eras, the expansion rate is higher than in Λ CDM . The SFDM particle mass m and quartic self-interaction coupling strength λ are therefore constrained by cosmological observables, particularly Neff, the effective number of neutrino species during big bang nucleosynthesis, and zeq, the redshift of matter-radiation equality. Furthermore, since the stochastic gravitational-wave background (SGWB) from inflation is amplified during the stiff-SFDM-dominated era, it can contribute a radiation-like component large enough to affect these observables by further boosting the expansion rate after the stiff era ends. Remarkably, this same amplification makes detection of the SGWB possible at high frequencies by current laser interferometer experiments, e.g., aLIGO/Virgo and LISA. For SFDM particle parameters that satisfy these cosmological constraints, the amplified SGWB is detectable by LIGO for a broad range of reheat temperatures Treheat, for values of the tensor-to-scalar ratio r currently allowed by cosmic microwave background polarization measurements. For a given r and λ /(m c2)2, the marginally allowed Λ SFDM model for each Treheat has the smallest m that satisfies the cosmological constraints, and maximizes the present SGWB energy density for that

  17. Development of a monoclonal sandwich ELISA for direct detection of bluetongue virus 8 in infected animals.

    Science.gov (United States)

    Ten Haaf, Andre; Kohl, Johannes; Pscherer, Sibylle; Hamann, Hans-Peter; Eskens, Hans Ulrich; Bastian, Max; Gattenlöhner, Stefan; Tur, Mehmet Kemal

    2017-05-01

    Bluetongue is an infectious viral disease which can cause mortality in affected ruminants, and tremendous economic damage via impacts upon fertility, milk production and the quality of wool. The disease is caused by bluetongue virus (BTV) which is transmitted by species of Culicoides biting midge. Rapid detection of BTV is required to contain disease outbreaks and reduce economic losses. The purpose of this study was to develop a monoclonal sandwich ELISA for direct detection of BTV in infected animals. Phage display technology was used to isolate BTV specific antibody fragments by applying the human scFv Tomlinson antibody libraries directly on purified BTV-8 particles. Three unique BTV-8 specific human antibody fragments were isolated which were able to detect purified BTV particles and also BTV in serum of an infected sheep. A combination of a human/mouse scFv-Fc chimeric fusion protein and a human Fab fragment in a sandwich ELISA format was able to detect BTV specifically with a limit of detection (LOD) of 10(4) infectious virus particles, as determined by tissue culture titration. This approach provided pilot data towards the development of a novel diagnostic test that might be used for direct detection of BTV-8 particles. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. New detection systems of bacteria using highly selective media designed by SMART: selective medium-design algorithm restricted by two constraints.

    Science.gov (United States)

    Kawanishi, Takeshi; Shiraishi, Takuya; Okano, Yukari; Sugawara, Kyoko; Hashimoto, Masayoshi; Maejima, Kensaku; Komatsu, Ken; Kakizawa, Shigeyuki; Yamaji, Yasuyuki; Hamamoto, Hiroshi; Oshima, Kenro; Namba, Shigetou

    2011-01-27

    Culturing is an indispensable technique in microbiological research, and culturing with selective media has played a crucial role in the detection of pathogenic microorganisms and the isolation of commercially useful microorganisms from environmental samples. Although numerous selective media have been developed in empirical studies, unintended microorganisms often grow on such media probably due to the enormous numbers of microorganisms in the environment. Here, we present a novel strategy for designing highly selective media based on two selective agents, a carbon source and antimicrobials. We named our strategy SMART for highly Selective Medium-design Algorithm Restricted by Two constraints. To test whether the SMART method is applicable to a wide range of microorganisms, we developed selective media for Burkholderia glumae, Acidovorax avenae, Pectobacterium carotovorum, Ralstonia solanacearum, and Xanthomonas campestris. The series of media developed by SMART specifically allowed growth of the targeted bacteria. Because these selective media exhibited high specificity for growth of the target bacteria compared to established selective media, we applied three notable detection technologies: paper-based, flow cytometry-based, and color change-based detection systems for target bacteria species. SMART facilitates not only the development of novel techniques for detecting specific bacteria, but also our understanding of the ecology and epidemiology of the targeted bacteria.

  19. New detection systems of bacteria using highly selective media designed by SMART: selective medium-design algorithm restricted by two constraints.

    Directory of Open Access Journals (Sweden)

    Takeshi Kawanishi

    Full Text Available Culturing is an indispensable technique in microbiological research, and culturing with selective media has played a crucial role in the detection of pathogenic microorganisms and the isolation of commercially useful microorganisms from environmental samples. Although numerous selective media have been developed in empirical studies, unintended microorganisms often grow on such media probably due to the enormous numbers of microorganisms in the environment. Here, we present a novel strategy for designing highly selective media based on two selective agents, a carbon source and antimicrobials. We named our strategy SMART for highly Selective Medium-design Algorithm Restricted by Two constraints. To test whether the SMART method is applicable to a wide range of microorganisms, we developed selective media for Burkholderia glumae, Acidovorax avenae, Pectobacterium carotovorum, Ralstonia solanacearum, and Xanthomonas campestris. The series of media developed by SMART specifically allowed growth of the targeted bacteria. Because these selective media exhibited high specificity for growth of the target bacteria compared to established selective media, we applied three notable detection technologies: paper-based, flow cytometry-based, and color change-based detection systems for target bacteria species. SMART facilitates not only the development of novel techniques for detecting specific bacteria, but also our understanding of the ecology and epidemiology of the targeted bacteria.

  20. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Science.gov (United States)

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Detection of viruses directly from the fresh leaves of a Phalaenopsis orchid using a microfluidic system.

    Science.gov (United States)

    Chang, Wen-Hsin; Yang, Sung-Yi; Lin, Chih-Lin; Wang, Chih-Hung; Li, Ping-Chen; Chen, Tzong-Yueh; Jan, Fuh-Jyh; Lee, Gwo-Bin

    2013-11-01

    Early detection of pathogens is crucial for the effective surveillance of diseases. Many efforts have been made to explore methods which can detect these pathogens within a short period of time without requiring a tedious protocol. However, these developed methods have disadvantages such as they are relatively time-consuming or require specialized laboratory facilities. In this work, we have developed an integrated microfluidic system for rapid and automatic detection of viruses by direct analysis from fresh Phalaenopsis orchid leaves. The entire protocol, including ribonucleic acid (RNA) purification, reverse transcription loop-mediated-isothermal-amplification (RT-LAMP) and optical detection by measuring changes in turbidity was performed on a single chip. This is the first time that an integrated microfluidic system for the detection of viruses infecting the Phalaenopsis orchid has been demonstrated. The sensitivity of the developed system was also explored in this study to validate its performance. In this study, the authors report the development of an integrated microfluidic system for rapid and automatic detection of viruses by direct analysis of fresh Phalaenopsis orchid leaves, performing the 3-step protocol using a single chip. Similar methods may find clinical application for fast and accurate detection of viral infections. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Direct photon detection in PbPb collisions in the ALICE experiment at LHC

    Energy Technology Data Exchange (ETDEWEB)

    Conesa, G. [Laboratori Nazionale Di Frascati, INFN, Via Enrico Fermi, 40, P.O box 13, I-00044 Frascati (Italy); Ippolitov, M. [RRC ' Kurchatov Institute' , Kurchatov sq.1, Moscow, 123182 (Russian Federation); Kharlov, Yu. [Institute for High Energy Physics, Protvino, 142281 (Russian Federation)]. E-mail: Yuri.Kharlov@cern.ch; Manko, V. [RRC ' Kurchatov Institute' , Kurchatov sq.1, Moscow, 123182 (Russian Federation); Peressounko, D. [RRC ' Kurchatov Institute' , Kurchatov sq.1, Moscow, 123182 (Russian Federation); Sadovsky, S. [Institute for High Energy Physics, Protvino, 142281 (Russian Federation); Schutz, Y. [CERN, Geneva CH-1211 (Switzerland)

    2007-02-01

    Direct photons are considered as one of the most important signatures of thermalized quark-gluon matter produced in relativistic heavy-ion collisions. The ALICE experiment at LHC, which is being prepared to study heavy-ion collisions at the energies 5.5A TeV, will be equipped by the photon spectrometer PHOS to detect direct photons and measure their spectrum in a wide momentum range 0 < p {sub T} < 100 GeV/c with high precision. Expected yields of direct photons at the LHC energies, as well as experimental methods to measure photon spectrum in the PHOS detector, are discussed in the paper.

  3. 16-level differential phase shift keying (D16PSK) in direct detection optical communication systems

    DEFF Research Database (Denmark)

    Sambaraju, R.; Tokle, Torger; Jensen, J.B.

    2006-01-01

    Optical 16-level differential phase shift keying (D16PSK) carrying four bits for every symbol is proposed for direct detection optical communication systems. Transmitter and receiver schematics are presented, and the receiver sensitivity is discussed. We numerically investigate the impact...

  4. Signatures of Earth-scattering in the direct detection of Dark Matter

    DEFF Research Database (Denmark)

    Kavanagh, Bradley J.; Catena, Riccardo; Kouvaris, Chris

    2017-01-01

    Direct detection experiments search for the interactions of Dark Matter (DM) particles with nuclei in terrestrial detectors. But if these interactions are sufficiently strong, DM particles may scatter in the Earth, affecting their distribution in the lab. We present a new analytic calculation...

  5. Interplay and Characterization of Dark Matter Searches at Colliders and in Direct Detection Experiments

    CERN Document Server

    Malik, Sarah A.; Araujo, Henrique; Belyaev, A.; Bœhm, Céline; Brooke, Jim; Buchmueller, Oliver; Davies, Gavin; De Roeck, Albert; de Vries, Kees; Dolan, Matthew J.; Ellis, John; Fairbairn, Malcolm; Flaecher, Henning; Gouskos, Loukas; Khoze, Valentin V.; Landsberg, Greg; Newbold, Dave; Papucci, Michele; Sumner, Timothy; Thomas, Marc; Worm, Steven

    2015-01-01

    In this White Paper we present and discuss a concrete proposal for the consistent interpretation of Dark Matter searches at colliders and in direct detection experiments. Based on a specific implementation of simplified models of vector and axial-vector mediator exchanges, this proposal demonstrates how the two search strategies can be compared on an equal footing.

  6. Direct biosensor immunoassays for the detection of nonmilk proteins in milk powder

    NARCIS (Netherlands)

    Haasnoot, W.; Olieman, K.; Cazemier, G.; Verheijen, R.

    2001-01-01

    The low prices of some nonmilk proteins make them attractive as potential adulterants in dairy products. An optical biosensor (BIACORE 3000) was used to develop a direct and combined biosensor immunoassay (BIA) for the simultaneous detection of soy, pea, and soluble wheat proteins in milk powders.

  7. Direct detection of unamplified hepatitis C virus RNA using unmodified gold nanoparticles

    NARCIS (Netherlands)

    Shawky, S.M.; Bald, D.; Azzazy, H.M.

    2010-01-01

    Background: Gold nanoparticles (AuNPs) exhibit a unique phenomenon known as Surface Plasmon Resonance, which is responsible for their intense red color. This color changes to blue upon aggregation of AuNPs. Objective: This work aims to develop a rapid, simple and cheap assay for direct detection of

  8. Direct imaging Raman microscope based on tunable wavelength excitation and narrow band emission detection

    NARCIS (Netherlands)

    Puppels, G.J.; Puppels, G.J.; Grond, M.; Grond, M.; Greve, Jan

    1993-01-01

    A new type of imaging Raman microscope is described. First the advantages and disadvantages of the two possible approaches to Raman microscopy based on signal detection by means of a charge-coupled-device camera (i.e., direct imaging and image reconstruction) are discussed. Arguments are given to

  9. Horizontal Directional Drilling-Length Detection Technology While Drilling Based on Bi-Electro-Magnetic Sensing

    Science.gov (United States)

    Wang, Yudan; Wen, Guojun; Chen, Han

    2017-01-01

    The drilling length is an important parameter in the process of horizontal directional drilling (HDD) exploration and recovery, but there has been a lack of accurate, automatically obtained statistics regarding this parameter. Herein, a technique for real-time HDD length detection and a management system based on the electromagnetic detection method with a microprocessor and two magnetoresistive sensors employing the software LabVIEW are proposed. The basic principle is to detect the change in the magnetic-field strength near a current coil while the drill stem and drill-stem joint successively pass through the current coil forward or backward. The detection system consists of a hardware subsystem and a software subsystem. The hardware subsystem employs a single-chip microprocessor as the main controller. A current coil is installed in front of the clamping unit, and two magneto resistive sensors are installed on the sides of the coil symmetrically and perpendicular to the direction of movement of the drill pipe. Their responses are used to judge whether the drill-stem joint is passing through the clamping unit; then, the order of their responses is used to judge the movement direction. The software subsystem is composed of a visual software running on the host computer and a software running in the slave microprocessor. The host-computer software processes, displays, and saves the drilling-length data, whereas the slave microprocessor software operates the hardware system. A combined test demonstrated the feasibility of the entire drilling-length detection system. PMID:28448445

  10. Horizontal Directional Drilling-Length Detection Technology While Drilling Based on Bi-Electro-Magnetic Sensing.

    Science.gov (United States)

    Wang, Yudan; Wen, Guojun; Chen, Han

    2017-04-27

    The drilling length is an important parameter in the process of horizontal directional drilling (HDD) exploration and recovery, but there has been a lack of accurate, automatically obtained statistics regarding this parameter. Herein, a technique for real-time HDD length detection and a management system based on the electromagnetic detection method with a microprocessor and two magnetoresistive sensors employing the software LabVIEW are proposed. The basic principle is to detect the change in the magnetic-field strength near a current coil while the drill stem and drill-stem joint successively pass through the current coil forward or backward. The detection system consists of a hardware subsystem and a software subsystem. The hardware subsystem employs a single-chip microprocessor as the main controller. A current coil is installed in front of the clamping unit, and two magneto resistive sensors are installed on the sides of the coil symmetrically and perpendicular to the direction of movement of the drill pipe. Their responses are used to judge whether the drill-stem joint is passing through the clamping unit; then, the order of their responses is used to judge the movement direction. The software subsystem is composed of a visual software running on the host computer and a software running in the slave microprocessor. The host-computer software processes, displays, and saves the drilling-length data, whereas the slave microprocessor software operates the hardware system. A combined test demonstrated the feasibility of the entire drilling-length detection system.

  11. Direct detection of the thorium-229 isomer. Milestone towards a nuclear clock

    Energy Technology Data Exchange (ETDEWEB)

    Wense, L. von der; Seiferle, B.; Neumayr, J.B.; Maier, H.J.; Wirth, H.F.; Thirolf, P.G. [Ludwig-Maximilians-University Munich, Garching (Germany); Laatiaoui, M. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Helmholtz Institute Mainz (Germany); Mokry, C.; Eberhardt, K. [Helmholtz Institute Mainz (Germany); Johannes Gutenberg University, Mainz (Germany); Runke, J. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Johannes Gutenberg University, Mainz (Germany); Duellmann, C.E. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Helmholtz Institute Mainz (Germany); Johannes Gutenberg University, Mainz (Germany); Trautmann, N. [Johannes Gutenberg University, Mainz (Germany)

    2016-07-01

    In the whole landscape of atomic nuclei, {sup 229}Th possesses the only known transition which by today could allow for the development of a nuclear frequency standard. The corresponding isomeric state has an energy of just 7.8 eV, which is even accessible by laser and frequency-comb technology. The isomer to ground-state transition, however, could not be directly detected within the past 40 years, despite significant efforts. In the presentation the first time unambiguous direct detection of the isomeric transition is described. This detection will allow for the determination of the decay parameters and in this way pave the way for the development of a nuclear clock.

  12. Directly measuring the concurrence of two-atom state via detecting coherent lights

    Science.gov (United States)

    Chen, Li; Yang, Ming; Zhang, Li-Hua; Cao, Zhuo-Liang

    2017-11-01

    Concurrence is an important parameter for quantifying quantum entanglement, but usually the state tomography must be determined before quantification. In this paper we propose a scheme, based on cavity-assisted atom–light interaction, to measure the concurrence of two-atom pure states and the Collins–Gisin state directly, without tomography. The concurrence of atomic states is encoded in the output coherent optical beams after interacting with cavities and the atoms therein, so the results of detection applied to the output coherent optical beams provide the concurrence data of the atomic states. This scheme provides an alternative method for directly measuring atomic entanglement by detecting coherent light, rather than measuring the atomic systems, which thus greatly simplifies the realization complexity of the direct measurement of atomic entanglement. In addition, as the cavity-assisted atom–light interaction used here is robust and scalable in realistic applications, the current scheme may be realized in the near future.

  13. Direct detection of OTA by impedimetric aptasensor based on modified polypyrrole-dendrimers

    Energy Technology Data Exchange (ETDEWEB)

    Mejri-Omrani, Nawel [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Miodek, Anna; Zribi, Becem [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France); Marrakchi, Mouna [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Université de Tunis El Manar, Higher Institute of Applied Biological Sciences (ISSBAT), 1006 Tunis (Tunisia); Hamdi, Moktar [Université de Carthage, National Institute of Applied Sciences and Technology (INSAT) Laboratoire d' Ecologie et de Technologie Microbiennes (LETMi), 1080 Tunis (Tunisia); Marty, Jean-Louis [BAE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan (France); Korri-Youssoufi, Hafsa, E-mail: hafsa.korri-youssoufi@u-psud.fr [ICMMO, CNRS, Université Paris-Saclay, Equipe de Chimie Bio-organique et Bio-inorganique, Bâtiment 420, 91405 Orsay (France)

    2016-05-12

    Ochratoxin A (OTA) is a carcinogenic mycotoxin that contaminates food such as cereals, wine and beer; therefore it represents a risk for human health. Consequently, the allowed concentration of OTA in food is regulated by governmental organizations and its detection is of major agronomical interest. In the current study we report the development of an electrochemical aptasensor able to directly detect trace OTA without any amplification procedure. This aptasensor was constructed by coating the surface of a gold electrode with a film layer of modified polypyrrole (PPy), which was thereafter covalently bound to polyamidoamine dendrimers of the fourth generation (PAMAM G4). Finally, DNA aptamers that specifically binds OTA were covalently bound to the PAMAM G4 providing the aptasensor, which was characterized by using both Atomic Force Microscopy (AFM) and Surface Plasmon Resonance (SPR) techniques. The study of OTA detection by the constructed electrochemical aptasensor was performed using Electrochemical Impedance Spectroscopy (EIS) and revealed that the presence of OTA led to the modification of the electrical properties of the PPy layer. These modifications could be assigned to conformational changes in the folding of the aptamers upon specific binding of OTA. The aptasensor had a dynamic range of up to 5 μg L{sup −1} of OTA and a detection limit of 2 ng L{sup −1} of OTA, which is below the OTA concentration allowed in food by the European regulations. The efficient detection of OTA by this electrochemical aptasensor provides an unforeseen platform that could be used for the detection of various small molecules through specific aptamer association. - Highlights: • Development of innovative platform for direct and ultra-sensitive toxins detection. • Aptasensor based on modified conductive polypyrrole layer. • We demonstrate the conformation change of aptamer upon toxin binding. • We highlight that detection was obtained by modification of charge of

  14. Integrity Constraints in Trust Management

    NARCIS (Netherlands)

    Etalle, Sandro; Winsborough, William H.

    We introduce the use, monitoring, and enforcement of integrity constraints in trust managementstyle authorization systems. We consider what portions of the policy state must be monitored to detect violations of integrity constraints. Then we address the fact that not all participants in a trust

  15. Detecting Direction of Pepper Stem by Using CUDA-Based Accelerated Hybrid Intuitionistic Fuzzy Edge Detection and ANN

    Directory of Open Access Journals (Sweden)

    Mahit Gunes

    2016-01-01

    Full Text Available In recent years, computer vision systems have been used in almost every field of industry. In this study, image processing algorithm has been developed by using CUDA (GPU which is 79 times faster than CPU. We had used this accelerated algorithm in destemming process of pepper. 65 percent of total national production of pepper is produced in our cities, Kahramanmaras and Gaziantep in Turkey. Firstly, hybrid intuitionistic fuzzy algorithm edge detection has been used for preprocessing of original image and Otsu method has been used for determining automatic threshold in this algorithm. Then the multilayer perceptron artificial neural network has been used for the classification of patterns in processed images. Result of ANN test for detection direction of pepper has shown high accuracy performance in CPU-based implementation and in GPU-based implementation.

  16. Piezoelectric immunosensor for the direct and rapid detection of Francisella tularensis.

    Science.gov (United States)

    Pohanka, M; Skládal, P

    2007-01-01

    A novel immunosensing device based on a piezoelectric sensor for direct detection of the biological warfare agent Francisella tularensis was developed. This sensor includes mouse polyclonal antibody immobilized in a layer of protein A covalently linked to the gold electrode of the sensor. The immunosensor is able to detect F. tularensis with the limit of detection 10(5) CFU/mL with a typical measuring cycle > 5 min. The sensor was successfully evaluated for rapid detection of F. tularensis spikes in drinking water and milk; no deterioration of sensitivity in comparison with buffer solutions was observed. The proposed concept of a rapid measurement of microbial agents seems to be promising for evaluation of samples after short pre-cultivation enrichment.

  17. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    Energy Technology Data Exchange (ETDEWEB)

    Caballero, David, E-mail: caballero@unistra.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Martinez, Elena [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Bausells, Joan [Centre Nacional de Microelectronica (CNM-IMB), CSIC, Campus UAB, 08193 Bellaterra (Spain); Errachid, Abdelhamid, E-mail: abdelhamid.errachid-el-salhi@univ-lyon1.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Universite Claude Bernard - Lyon 1, LSA - UMR 5180, 43 Bd du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Samitier, Josep [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. Black-Right-Pointing-Pointer Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. Black-Right-Pointing-Pointer Silicon nitride offers multiple advantages compared to other common materials. Black-Right-Pointing-Pointer The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si{sub 3}N{sub 4}) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si{sub 3}N{sub 4}-based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO{sub 2}/Si{sub 3}N{sub 4} structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10{sup -13}-10{sup -7} M were detected, showing a sensitivity of 0.128 {Omega} {mu}M{sup -1} and a limit of detection of 10{sup -14} M. The specificity of the sensor was also addressed by studying the

  18. An automated flow for directed evolution based on detection of promiscuous scaffolds using spatial and electrostatic properties of catalytic residues.

    Directory of Open Access Journals (Sweden)

    Sandeep Chakraborty

    Full Text Available The aspiration to mimic and accelerate natural evolution has fueled interest in directed evolution experiments, which endow or enhance functionality in enzymes. Barring a few de novo approaches, most methods take a template protein having the desired activity, known active site residues and structure, and proceed to select a target protein which has a pre-existing scaffold congruent to the template motif. Previously, we have established a computational method (CLASP based on spatial and electrostatic properties to detect active sites, and a method to quantify promiscuity in proteins. We exploit the prospect of promiscuous active sites to serve as the starting point for directed evolution and present a method to select a target protein which possesses a significant partial match with the template scaffold (DECAAF. A library of partial motifs, constructed from the active site residues of the template protein, is used to rank a set of target proteins based on maximal significant matches with the partial motifs, and cull out the best candidate from the reduced set as the target protein. Considering the scenario where this 'incubator' protein lacks activity, we identify mutations in the target protein that will mirror the template motif by superimposing the target and template protein based on the partial match. Using this superimposition technique, we analyzed the less than expected gain of activity achieved by an attempt to induce β-lactamase activity in a penicillin binding protein (PBP (PBP-A from T. elongatus, and attributed this to steric hindrance from neighboring residues. We also propose mutations in PBP-5 from E. coli, which does not have similar steric constraints. The flow details have been worked out in an example which aims to select a substitute protein for human neutrophil elastase, preferably related to grapevines, in a chimeric anti-microbial enzyme which bolsters the innate immune defense system of grapevines.

  19. Using a large area CMOS APS for direct chemiluminescence detection in Western blotting electrophoresis

    Science.gov (United States)

    Esposito, Michela; Newcombe, Jane; Anaxagoras, Thalis; Allinson, Nigel M.; Wells, Kevin

    2012-03-01

    Western blotting electrophoretic sequencing is an analytical technique widely used in Functional Proteomics to detect, recognize and quantify specific labelled proteins in biological samples. A commonly used label for western blotting is Enhanced ChemiLuminescence (ECL) reagents based on fluorescent light emission of Luminol at 425nm. Film emulsion is the conventional detection medium, but is characterized by non-linear response and limited dynamic range. Several western blotting digital imaging systems have being developed, mainly based on the use of cooled Charge Coupled Devices (CCDs) and single avalanche diodes that address these issues. Even so these systems present key drawbacks, such as a low frame rate and require operation at low temperature. Direct optical detection using Complementary Metal Oxide Semiconductor (CMOS) Active Pixel Sensors (APS)could represent a suitable digital alternative for this application. In this paper the authors demonstrate the viability of direct chemiluminescent light detection in western blotting electrophoresis using a CMOS APS at room temperature. Furthermore, in recent years, improvements in fabrication techniques have made available reliable processes for very large imagers, which can be now scaled up to wafer size, allowing direct contact imaging of full size western blotting samples. We propose using a novel wafer scale APS (12.8 cm×13.2 cm), with an array architecture using two different pixel geometries that can deliver an inherently low noise and high dynamic range image at the same time representing a dramatic improvement with respect to the current western blotting imaging systems.

  20. Multisensory Attention in Motion: Uninformative Sounds Increase the Detectability of Direction Changes of Moving Visual Stimuli

    Directory of Open Access Journals (Sweden)

    Durk Talsma

    2011-10-01

    Full Text Available It has recently been shown that spatially uninformative sounds can cause a visual stimulus to pop-out from an array of similar distractor stimuli when that sound is presented near simultaneously with a feature change in the visual stimulus. Until now, this effect has only been shown for stimuli that remain at a fixed position. Here we extend these results by showing that auditory stimuli can also improve the detectability of visual stimulus features related to motion. To accomplish this we presented moving visual stimuli (small dots on a computer screen. At a random moment during a trial, one of these stimuli could abruptly start moving in an orthogonal direction. Participants' task was to indicate whether such a change in direction had occurred or not by making a corresponding button press. When a sound (a short 1000Hz tone pip was presented simultaneously with a motion change, participants were able to detect this motion direction change among a significantly higher number of distractor stimuli, compared to when the sound was absent. When the number of distractor stimuli was kept constant, detection accuracy was significantly higher when the tone was present, compared to when it was absent. Using signal detection theory, we determined that this change in accuracy was reflected in an increase in d“, while we found no evidence to suggest that participants' response bias (as reflected nearly equal beta parameters, changed due to the presence of the sounds.

  1. Performance of a direct detection camera for off-axis electron holography

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Shery L.Y., E-mail: shery.chang@asu.edu [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); LeRoy Eyring Center for Solid State Science, Arizona State University, Tempe, AZ 85287 (United States); Dwyer, Christian [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Department of Physics, Arizona State University, Tempe, AZ 85287 (United States); Barthel, Juri; Boothroyd, Chris B.; Dunin-Borkowski, Rafal E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons, and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany)

    2016-02-15

    The performance of a direct detection camera (DDC) is evaluated in the context of off-axis electron holographic experiments in a transmission electron microscope. Its performance is also compared directly with that of a conventional charge-coupled device (CCD) camera. The DDC evaluated here can be operated either by the detection of individual electron events (counting mode) or by the effective integration of many such events during a given exposure time (linear mode). It is demonstrated that the improved modulation transfer functions and detective quantum efficiencies of both modes of the DDC give rise to significant benefits over the conventional CCD cameras, specifically, a significant improvement in the visibility of the holographic fringes and a reduction of the statistical error in the phase of the reconstructed electron wave function. The DDC's linear mode, which can handle higher dose rates, allows optimisation of the dose rate to achieve the best phase resolution for a wide variety of experimental conditions. For suitable conditions, the counting mode can potentially utilise a significantly lower dose to achieve a phase resolution that is comparable to that achieved using the linear mode. The use of multiple holograms and correlation techniques to increase the total dose in counting mode is also demonstrated. - Highlights: • Performance of a direct detection camera for off-axis electron holography has been evaluated. • Better holographic fringe visibility and phase resolution are achieved using DDC. • Both counting and linear modes offered by DDC are advantageous for different dose regimes.

  2. Direct electrochemistry of glucose oxidase assembled on graphene and application to glucose detection

    Energy Technology Data Exchange (ETDEWEB)

    Wu Ping; Shao Qian; Hu Yaojuan; Jin Juan; Yin Yajing; Zhang Hui [Jiangsu Key Laboratory of Biofunctional Materials, Laboratory of Electrochemistry, College of Chemistry and Environmental Science, Nanjing Normal University, Nanjing 210097 (China); Cai Chenxin, E-mail: cxcai@njnu.edu.c [Jiangsu Key Laboratory of Biofunctional Materials, Laboratory of Electrochemistry, College of Chemistry and Environmental Science, Nanjing Normal University, Nanjing 210097 (China)

    2010-12-01

    The direct electrochemistry of glucose oxidase (GOx) integrated with graphene was investigated. The voltammetric results indicated that GOx assembled on graphene retained its native structure and bioactivity, exhibited a surface-confined process, and underwent effective direct electron transfer (DET) reaction with an apparent rate constant (k{sub s}) of 2.68 s{sup -1}. This work also developed a novel approach for glucose detection based on the electrocatalytic reduction of oxygen at the GOx-graphene/GC electrode. The assembled GOx could electrocatalyze the reduction of dissolved oxygen. Upon the addition of glucose, the reduction current decreased, which could be used for glucose detection with a high sensitivity (ca. 110 {+-} 3 {mu}A mM{sup -1} cm{sup -2}), a wide linear range (0.1-10 mM), and a low detection limit (10 {+-} 2 {mu}M). The developed approach can efficiently exclude the interference of commonly coexisting electroactive species due to the use of a low detection potential (-470 mV, versus SCE). Therefore, this study has not only successfully achieved DET reaction of GOx assembled on graphene, but also established a novel approach for glucose detection and provided a general route for fabricating graphene-based biosensing platform via assembling enzymes/proteins on graphene surface.

  3. Two-Stage Linearization Filter for Direct-Detection Subcarrier Modulation

    OpenAIRE

    Li, Z.; Erkilinc, M. S.; Maher, R.; Galdino, L.; Shi, K.; Thomsen, B. C.; Bayvel, P.; Killey, R. I.

    2016-01-01

    A novel digital two-stage linearization filter is proposed for direct-detection (DD) systems and assessed experimentally for the first time. The performance improvement is quantified by experiments with a 7 × 25 Gb/s wavelength division multiplexing DD single sideband 16-QAM Nyquist-shaped subcarrier modulation system with a net optical information spectral density of 2.3 (b/s)/Hz. The results indicate that this technique can effectively compensate the nonlinearity caused by square-law detect...

  4. Detection of directivity in seismic site response from microtremor spectral analysis

    Directory of Open Access Journals (Sweden)

    V. Del Gaudio

    2008-07-01

    Full Text Available Recent observations have shown that slope response to seismic shaking can be characterised by directional variations of a factor of 2–3 or larger, with maxima oriented along local topography features (e.g. maximum slope direction. This phenomenon appears influenced by slope material properties and has occasionally been detected on landslide-prone slopes, where a down-slope directed amplification could enhance susceptibility to seismically-induced landsliding. The exact conditions for the occurrence of directional amplification remain still unclear and the implementation of investigation techniques capable to reveal the presence of such phenomena is desirable. To this purpose we tested the applicability of a method commonly used to evaluate site resonance properties (Horizontal to Vertical Noise Ratio – HVNR or Nakamura's method as reconnaissance technique for the identification of site response directivity. Measurements of the azimuthal variation of H/V spectral ratios (i.e. between horizontal and vertical component of ambient microtremors were conducted in a landslide-prone study area of central Italy where a local accelerometric network had previously provided evidence of directivity phenomena on some slopes. The test results were compared with average H/V spectral ratios obtained for low-to-moderate earthquakes recorded by the accelerometric stations. In general, noise and seismic recordings provided different amplitudes of spectral ratios at similar frequencies, likely because of differences in signal and instrument characteristics. Nevertheless, both kinds of recordings showed that at sites affected by site response directivity major H/V peaks have orientations consistent (within 20°–30° with the direction of maximum shaking energy. Therefore, HVNR appears to be a promising technique for identifying seismic response directivity. Furthermore, in a comparative test conducted on a slope mantled in part by a deep-seated landslide

  5. Direct detection of saponins in crude extracts of soapnuts by FTIR.

    Science.gov (United States)

    Almutairi, Meshari Saad; Ali, Muhammad

    2015-01-01

    Direct detection of saponins in soapnuts (Sapindus mukorossi) using Fourier transform infrared (FTIR) spectroscopy is investigated in this project. Potassium bromide powder was mixed with extracted powder of soapnuts and compressed to a thin pellet for examination process. The outcome of the FTIR spectra of saponin demonstrated characteristic triterpenoid saponin absorptions of OH, C = O, C-H, and C = C, while the glycoside linkages to the sapogenins were indicated by the absorptions of C-O. The significance of this study is that saponin absorption peaks are directly detectable in crude aqueous and 95% ethanol extracts of soapnuts powder using FTIR spectroscopy, thereby eliminating the need of further expensive and exhaustive purification steps. The extracts of soapnuts were screened for saponins along with controls by phytochemical tests, and advanced spectroscopic techniques such as ultra fast liquid chromatography and ultra performance liquid chromatography quadrupole-time of flight-mass spectrometry were also implemented to validate the saponins.

  6. The Diurnal Variation of the Wimp Detection Event Rates in Directional Experiments

    OpenAIRE

    Vergados, J D; Moustakidis, Ch. C.

    2009-01-01

    The recent WMAP data have confirmed that exotic dark matter together with the vacuum energy (cosmological constant) dominate in the flat Universe. Modern particle theories naturally provide viable cold dark matter candidates with masses in the GeV-TeV region. Supersymmetry provides the lightest supersymmetric particle (LSP), theories in extra dimensions supply the lightest Kaluza-Klein particle (LKP) etc. The nature of dark matter can only be unraveled only by its direct detection in the labo...

  7. Direct Optical Detection of Viral Nucleoprotein Binding to an Anti-Influenza Aptamer

    OpenAIRE

    Negri, Pierre; Chen, Guojun; Kage, Andreas; Nitsche, Andreas; Naumann, Dieter; Xu, Bingqian; Dluhy, Richard A.

    2012-01-01

    We have demonstrated label-free optical detection of viral nucleoprotein binding to a polyvalent anti-influenza aptamer by monitoring the surface-enhanced Raman (SERS) spectra of the aptamer-nucleoprotein complex. The SERS spectra demonstrated that selective binding of the aptamer-nucleoprotein complex could be differentiated from that of the aptamer alone based solely on the direct spectral signature for the aptamer-nucleoprotein complex. Multivariate statistical methods, including principal...

  8. Direct detection of the Josephson radiation emitted from superconducting thin-film microbridges

    DEFF Research Database (Denmark)

    Pedersen, Niels Falsig; Sørensen, O. H.; Mygind, Jesper

    1976-01-01

    We report direct measurements of the Josephson radiation emitted in X band from a superconducting thin-film microbridge coupled to a resonance cavity. Power is emitted if one of the harmonics of the Josephson frequency is in the bandwidth of the receiver. The maximum power emitted during our expe...... experiment was 10−13 W. The Josephson radiation could easily be detected at frequencies off resonance. Applied Physics Letters is copyrighted by The American Institute of Physics....

  9. The value of an additional hypoechoic lesion-directed biopsy core for detecting prostate cancer.

    Science.gov (United States)

    Gosselaar, Claartje; Roobol, Monique J; Roemeling, Stijn; Wolters, Tineke; van Leenders, Geert J L H; Schröder, Fritz H

    2008-03-01

    To determine the value of a hypoechoic lesion (HL)-directed biopsy in addition to a systematic sextant biopsy for detecting prostate cancer. Within the European Randomized study of Screening for Prostate Cancer, 37 627 assays for prostate-specific antigen (PSA) were done in men aged 55-75 years (screening round 1-3, interval 4 years). A PSA level of >or=3.0 ng/mL prompted a systematic transrectal ultrasonography (TRUS)-guided lateralized sextant biopsy (4986 biopsy sessions were evaluated). If there was a HL, an additional lesion-directed biopsy was taken. At the initial screening, 1840 men were biopsied and 532 cancers were detected (28.9%). Of the men biopsied, 436 had a HL and an additional biopsy (23.7%). In these men, 230 cancers were detected (52.8%). In 3.5% (eight of 230) only the HL-directed core showed malignancy. At the repeat and third screening, respectively, 19.3% and 18.9% of the men biopsied had prostate cancer, 16.8% and 9.3% had an HL and the additional core detected two (2.2%) and one (5.9%) cancers. At the first screen most cancers found by the additional core were clinically relevant. In later screens these cancers seemed to be minimal. The performance of TRUS as a screening tool is poor. The value of the additional core was limited as only 3.5% of the visible cancers were detected solely by the additional biopsy (round 1). However, a substantial part of these cancers were clinically relevant and would have been missed without the additional biopsy. This finding was less clear in screening round 2 and 3, even in men who were not previously biopsied.

  10. Horizontal Directional Drilling-Length Detection Technology While Drilling Based on Bi-Electro-Magnetic Sensing

    Directory of Open Access Journals (Sweden)

    Yudan Wang

    2017-04-01

    Full Text Available The drilling length is an important parameter in the process of horizontal directional drilling (HDD exploration and recovery, but there has been a lack of accurate, automatically obtained statistics regarding this parameter. Herein, a technique for real-time HDD length detection and a management system based on the electromagnetic detection method with a microprocessor and two magnetoresistive sensors employing the software LabVIEW are proposed. The basic principle is to detect the change in the magnetic-field strength near a current coil while the drill stem and drill-stem joint successively pass through the current coil forward or backward. The detection system consists of a hardware subsystem and a software subsystem. The hardware subsystem employs a single-chip microprocessor as the main controller. A current coil is installed in front of the clamping unit, and two magneto resistive sensors are installed on the sides of the coil symmetrically and perpendicular to the direction of movement of the drill pipe. Their responses are used to judge whether the drill-stem joint is passing through the clamping unit; then, the order of their responses is used to judge the movement direction. The software subsystem is composed of a visual software running on the host computer and a software running in the slave microprocessor. The host-computer software processes, displays, and saves the drilling-length data, whereas the slave microprocessor software operates the hardware system. A combined test demonstrated the feasibility of the entire drilling-length detection system.

  11. You can hide but you have to run: direct detection with vector mediators

    Energy Technology Data Exchange (ETDEWEB)

    D’Eramo, Francesco [Department of Physics, University of California Santa Cruz,1156 High St., Santa Cruz, CA 95064 (United States); Santa Cruz Institute for Particle Physics,1156 High St., Santa Cruz, CA 95064 (United States); Kavanagh, Bradley J. [Laboratoire de Physique Théorique et Hautes Energies, CNRS, UMR 7589,4 Place Jussieu, F-75252, Paris (France); Institut de Physique Théorique, Université Paris Saclay, CNRS, CEA,Orme des Merisiers batiment 774, F-91191 Gif-sur-Yvette Cedex (France); Panci, Paolo [Institut d’Astrophysique de Paris, UMR 7095 CNRS, Université Pierre et Marie Curie,98 bis Boulevard Arago, Paris 75014 (France)

    2016-08-18

    We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running. In some cases the inclusion of these effects changes the bounds by several orders of magnitude, as a consequence of operator mixing which generates new interactions at low energy. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Finally, we provide tools to facilitate the inclusion of these effects in future studies: general approximate expressions for the low energy couplings and a public code runDM to evolve the couplings between arbitrary energy scales.

  12. Alamouti-Type Space-Time Coding for Free-Space Optical Communication with Direct Detection

    Science.gov (United States)

    Simon, M. K.; Vilnrotter, V.

    2003-11-01

    In optical communication systems employing direct detection at the receiver, intensity modulations such as on-off keying (OOK) or pulse-position modulation (PPM) are commonly used to convey the information. Consider the possibility of applying space-time coding in such a scenario, using, for example, an Alamouti-type coding scheme [1]. Implicit in the Alamouti code is the fact that the modulation that defines the signal set is such that it is meaningful to transmit and detect both the signal and its negative. While modulations such as phase-shift keying (PSK) and quadrature amplitude modulation (QAM) naturally fall into this class, OOK and PPM do not since the signal polarity (phase) would not be detected at the receiver. We investigate a modification of the Alamouti code to be used with such modulations that has the same desirable properties as the conventional Alamouti code but does not rely on the necessity of transmitting the negative of a signal.

  13. Direct detection of early-stage cancers using circulating tumor DNA

    DEFF Research Database (Denmark)

    Phallen, Jillian; Sausen, Mark; Adleff, Vilmos

    2017-01-01

    Early detection and intervention are likely to be the most effective means for reducing morbidity and mortality of human cancer. However, development of methods for noninvasive detection of early-stage tumors has remained a challenge. We have developed an approach called targeted error correction...... sequencing (TEC-Seq) that allows ultrasensitive direct evaluation of sequence changes in circulating cell-free DNA using massively parallel sequencing. We have used this approach to examine 58 cancer-related genes encompassing 81 kb. Analysis of plasma from 44 healthy individuals identified genomic changes...... related to clonal hematopoiesis in 16% of asymptomatic individuals but no alterations in driver genes related to solid cancers. Evaluation of 200 patients with colorectal, breast, lung, or ovarian cancer detected somatic mutations in the plasma of 71, 59, 59, and 68%, respectively, of patients with stage...

  14. Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples

    Directory of Open Access Journals (Sweden)

    Trindade Giliane S

    2009-09-01

    Full Text Available Abstract Background Orthopoxvirus (OPV and Parapoxvirus (PPV have been associated with worldwide exanthematic outbreaks. Some species of these genera are able to infect humans and domestic animals, causing serious economic losses and public health impact. Rapid, useful and highly specific methods are required to detect and epidemiologically monitor such poxviruses. In the present paper, we describe the development of a nested-multiplex PCR method for the simultaneous detection of OPV and PPV species directly from exanthematic lesions, with no previous viral isolation or DNA extraction. Methods and Results The OPV/PPV nested-multiplex PCR was developed based on the evaluation and combination of published primer sets, and was applied to the detection of the target pathogens. The method showed high sensitivity, and the specificity was confirmed by amplicon sequencing. Exanthematic lesion samples collected during bovine vaccinia or contagious ecthyma outbreaks were submitted to OPV/PPV nested-multiplex PCR and confirmed its applicability. Conclusion These results suggest that the presented multiplex PCR provides a highly robust and sensitive method to detect OPV and PPV directly from clinical samples. The method can be used for viral identification and monitoring, especially in areas where OPV and PPV co-circulate.

  15. Direction sensitive fall detection using a triaxial accelerometer and a barometric pressure sensor.

    Science.gov (United States)

    Tolkiehn, Marie; Atallah, Louis; Lo, Benny; Yang, Guang-Zhong

    2011-01-01

    Falling is one of the leading causes of serious health decline or injury-related deaths in the elderly. For survivors of a fall, the resulting health expenses can be a devastating burden, largely because of the long recovery time and potential comorbidities that ensue. The detection of a fall is, therefore, important in care of the elderly for decreasing the reaction time by the care-givers especially for those in care who are particularly frail or living alone. Recent advances in motion-sensor technology have enabled wearable sensors to be used efficiently for pervasive care of the elderly. In addition to fall detection, it is also important to determine the direction of a fall, which could help in the location of joint weakness or post-fall fracture. This work uses a waist-worn sensor, encompassing a 3D accelerometer and a barometric pressure sensor, for reliable fall detection and the determination of the direction of a fall. Also assessed is an efficient analysis framework suitable for on-node implementation using a low-power micro-controller that involves both feature extraction and fall detection. A detailed laboratory analysis is presented validating the practical application of the system.

  16. Detection of short tandem repeat polymorphisms from human nails using direct polymerase chain reaction method.

    Science.gov (United States)

    Tie, Jian; Uchigasaki, Seisaku

    2014-11-01

    Human nail is an important forensic material for parental testing and individual identification in large-scale disasters. Detection of STR polymorphism from hard tissues generally requires DNA purification, which is technically complicated and time consuming. In the present study, we attempted to detect STR polymorphisms from untreated human nail samples by direct PCR amplification method using the primer mixture supplied with the GenePrint® SilverSTR® III System or the AmpFℓSTR® Identifiler® PCR Amplification Kit, and Tks Gflex DNA polymerase known to be effective for amplification from crude samples. A nail fragment measuring approximately 1.5 mm in breadth and 0.5 mm in length was placed directly into a PCR tube, and various PCR conditions were tested. The PCR products were analyzed by denaturing acrylamide gel electrophoresis or CE. Multiple STR polymorphisms were detected successfully. This method that detects STR polymorphisms not only from fresh human fingernails, but also from old nail fragments stored at room temperature for up to 10 years is expected to become a novel DNA analytical method in forensic medicine and genetic studies. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    Directory of Open Access Journals (Sweden)

    Jnnifer A. Sánchez

    2014-05-01

    Full Text Available Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%, II: nheA, hblC (2%, III: hblC, cytK (41.2%, IV: hblC (47%. Of 75 cassava starch samples, 44% were contaminated with toxigenic B. cereus and four different toxigenic consortia were determined: I: nheA, hblC, cytK (48.5%, II: nheA, hblC, cytK, cesB (3%, III: hblC, cytK (30.3%, IV: hblC (18.2%. In general, in dietary complement for children only enterotoxigenic consortia were detected while in cassava starch the enterotoxigenic consortia predominated over the emetic. Multiplex PCR was useful to detect toxigenic B. cereus contamination allowing direct and imultaneous detection of all toxin genes in foods. This study is the first in Colombia to evaluate toxigenic B. cereus, providing information of importance for microbiological risk evaluation in dried foods.

  18. Direct inference of SNP heterozygosity rates and resolution of LOH detection.

    Directory of Open Access Journals (Sweden)

    Xiaohong Li

    2007-11-01

    Full Text Available Single nucleotide polymorphisms (SNPs have been increasingly utilized to investigate somatic genetic abnormalities in premalignancy and cancer. LOH is a common alteration observed during cancer development, and SNP assays have been used to identify LOH at specific chromosomal regions. The design of such studies requires consideration of the resolution for detecting LOH throughout the genome and identification of the number and location of SNPs required to detect genetic alterations in specific genomic regions. Our study evaluated SNP distribution patterns and used probability models, Monte Carlo simulation, and real human subject genotype data to investigate the relationships between the number of SNPs, SNP HET rates, and the sensitivity (resolution for detecting LOH. We report that variances of SNP heterozygosity rate in dbSNP are high for a large proportion of SNPs. Two statistical methods proposed for directly inferring SNP heterozygosity rates require much smaller sample sizes (intermediate sizes and are feasible for practical use in SNP selection or verification. Using HapMap data, we showed that a region of LOH greater than 200 kb can be reliably detected, with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database. Higher densities of SNPs may exist in certain local chromosomal regions that provide some opportunities for reliably detecting LOH of segment sizes smaller than 50 kb. These results suggest that the interpretation of the results from genome-wide scans for LOH using commercial arrays need to consider the relationships among inter-SNP distance, detection probability, and sample size for a specific study. New experimental designs for LOH studies would also benefit from considering the power of detection and sample sizes required to accomplish the proposed aims.

  19. Polarization-interleave-multiplexed discrete multi-tone modulation with direct detection utilizing MIMO equalization.

    Science.gov (United States)

    Zhou, Xian; Zhong, Kangping; Gao, Yuliang; Sui, Qi; Dong, Zhenghua; Yuan, Jinhui; Wang, Liang; Long, Keping; Lau, Alan Pak Tao; Lu, Chao

    2015-04-06

    Discrete multi-tone (DMT) modulation is an attractive modulation format for short-reach applications to achieve the best use of available channel bandwidth and signal noise ratio (SNR). In order to realize polarization-multiplexed DMT modulation with direct detection, we derive an analytical transmission model for dual polarizations with intensity modulation and direct diction (IM-DD) in this paper. Based on the model, we propose a novel polarization-interleave-multiplexed DMT modulation with direct diction (PIM-DMT-DD) transmission system, where the polarization de-multiplexing can be achieved by using a simple multiple-input-multiple-output (MIMO) equalizer and the transmission performance is optimized over two distinct received polarization states to eliminate the singularity issue of MIMO demultiplexing algorithms. The feasibility and effectiveness of the proposed PIM-DMT-DD system are investigated via theoretical analyses and simulation studies.

  20. Direct visual inspection of the cervix with Lugol iodine for the detection of premalignant lesions.

    Science.gov (United States)

    El-Shalakany, Amr H; Saeed, Mohammed M; Abdel-Aal, Mohammed Reda; El-Nakeeb, Atef Hamed; Noseirat, Nael; Ayyad, Sohair B; El Din, Zeinab Sehab

    2008-07-01

    To evaluate the feasibility and efficiency of direct visual inspection after Lugol iodine painting in detecting cervical premalignant and malignant lesions. This study included 1,012 women recruited from gynecology outpatient clinic screened for premalignant or malignant lesions of the cervix. All women underwent cervical smear test, direct visual inspection of the cervix after painting with acetic acid (DVI-A) and after painting with Lugol iodine (DVI-LI). Abnormal test results were referred for colposcopy and biopsy. Cervical smears were abnormal in 24 women (2.4%). Direct visual inspection of the cervix after painting with acetic acid test was abnormal in 92 women (9.1%). Direct visual inspection after Lugol iodine painting test was abnormal in 93 women (9.2%). There were 106 women (10.5%) referred for colposcopy, with 88 women (8.8%) having biopsies taken. Biopsies showed premalignant and malignant lesions in 44 cases only. There were 35 low-grade squamous intraepithelial lesion, 5 high-grade squamous intraepithelial lesion, and 4 cervical cancers. Test efficiency parameters particularly sensitivity, specificity, and positive and negative predictive values of DVI-LI were 97.7%, 94.8%, 46.2%, and 99.9%, respectively; those of cytology were 22.7%, 97.6%, 41.7%, and 96.6%, respectively, and those of DVI-A were 90.9%, 94.6%, 43.5%, and 99.6%, respectively. Direct visual inspection after Lugol iodine painting is feasible and easy to perform with superior sensitivity to cervical cytology and DVI-A in detecting cervical premalignant and malignant lesions. Direct visual inspection after Lugol iodine painting can be used as an efficient primary screening tool with a satisfactory low biopsy rate in low resources settings.

  1. First direct fluorescence polarization assay for the detection and quantification of spirolides in mussel samples

    Energy Technology Data Exchange (ETDEWEB)

    Otero, Paz; Alfonso, Amparo [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain); Alfonso, Carmen [CIFGA Laboratorio, Plaza de Santo Domingo, 1, 27001 Lugo (Spain); Araoz, Romulo; Molgo, Jordi [CNRS, Institut de Neurobiologie Alfred Fessard - FRC2118, Laboratoire de Neurobiologie et Developpement UPR3294, 1 Avenue de la Terrasse, 91198 Gif sur Yvette Cedex (France); Vieytes, Mercedes R. [Departamento de Fisiologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, 27002 Lugo (Spain); Botana, Luis M., E-mail: luis.botana@usc.es [Departamento de Farmacologia, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus Universitario s/n, 27002 Lugo (Spain)

    2011-09-09

    Highlights: {yields} A direct assay based in the binding of nAChR to spirolide toxins by FP is described. {yields} A direct relationship between FP and 13-desMeC in the range of 10-500 nM is obtained. {yields} FP is dependent on the 13, 19-didesMeC in a higher concentration range than 13-desMeC. {yields} FP assay is a sensitive method to detect and quantify 13-desMeC in mussel samples. - Abstract: In 2009, we achieve the first inhibition FP assay to detect imine cyclic toxins. In the present paper we propose a new FP assay for direct quantify spirolides. This new method has resulted in significant improvement of sensitivity, rapidity and accessibility. In the method design, nicotinic acetylcholine receptor from Torpedo marmorata membranes labelled with a derivative of fluorescein was used. Spirolides, 13-desmethyl spirolide C (13-desMeC) and 13,19-didesmethyl spirolide C (13,19-didesMeC) were extracted and purified from cultures of the Alexandrium ostenfeldii dinoflagellate. Data showed the decrease of FP when toxin concentration was increased. Thus, a relationship between the FP units and the spirolides amount present in a sample was obtained. This direct assay is a reproducible, simple and very sensitive method with a detection limit about 25 nM for 13-desMeC and 150 nM for 13,19-didesMeC. The procedure was used to measure spirolides in mussel samples using an extraction and clean up protocol suitable for the FP assay. Results obtained show that this method is able to quantify 13-desMeC in the range of 50-350 {mu}g kg{sup -1} meat. Other liposoluble toxins did not interfere with the assay, proving a specific method. Moreover, the matrix do not affect in the range of toxin concentrations that involving risk of spirolides intoxication.

  2. Exploration of strategies for implementation of screen-printed mercuric iodide converters in direct detection AMFPIs for digital breast tomosynthesis

    Science.gov (United States)

    Antonuk, Larry E.; El-Mohri, Youcef; Zhao, Qihua; Jiang, Hao

    2017-03-01

    Digital breast tomosynthesis (DBT) has become an increasingly important tool in the diagnosis of breast disease. For those DBT imaging systems based on active matrix, flat-panel imager (AMFPI) arrays, the incident radiation is detected directly or indirectly by means of an a-Se or CsI:Tl x-ray converter, respectively. While all AMFPI DBT devices provide clinically useful volumetric information, their performance is limited by the relatively modest average signal generated per interacting X ray by present converters compared to the electronic additive noise of the system. To address this constraint, we are pursuing the development of a screen-printed form of mercuric iodide (SP HgI2) which has demonstrated considerably higher sensitivities (i.e., larger average signal per interacting X ray) than those of conventional a-Se and CsI:Tl converters, as well as impressive DQE and MTF performance under mammographic irradiation conditions. A converter offering such enhanced sensitivity would greatly improve signal-to-noise performance and facilitate quantum-limited imaging down to significantly lower exposures than present AMFPI DBT systems. However, before this novel converter material can be implemented practically, challenges associated with SP HgI2 must be addressed. Most significantly, high levels of charge trapping (which lead to image lag as well as fall-off in DQE at higher exposures) need to be reduced - while improving the uniformity in pixel-to-pixel signal response as well as maintaining low dark current and otherwise favorable DQE performance. In this paper, a pair of novel strategies for overcoming the challenge of charge trapping in SP HgI2 converters are described, and initial results from empirical and calculational studies of these strategies are reported.

  3. Microfluidic device for the detection of glucose using a micro direct methanol fuel cell as an amperometric detection power source.

    Science.gov (United States)

    Ito, Takeshi; Kunimatsu, Masayuki; Kaneko, Satoru; Ohya, Seishiro; Suzuki, Koji

    2007-02-15

    We designed and prepared a novel microbiosensing system consisting of a microbioreactor fabricated using photosensitive sheets intercalated between Pyrex wafers as a dam structure, together with a micro fuel cell as a power source device between the electrodes for amperometric detection. The dam structure retains enzyme (glucose oxidase, GOx)-immobilized microbeads in a microchannel. Microelectrodes are used as an integrated detector within a microchannel located downstream of the dam structure, and these are used to detect the oxidation current of hydrogen peroxide produced from a glucose sample and GOx. A micro direct methanol fuel cell (mu-DMFC, i.d. 500 microm) was fabricated on a polymeric substrate and was used to supply a potential for the electrochemical detector. In this case, two mu-DMFCs were stacked on one substrate to increase the voltage for the oxidation of hydrogen peroxide. A linear response curve was obtained in range from 0.1 to 10 mM glucose for the designed microbiosensing system. These results show that a microfluidic biosensing system designed with a mu-DMFC device is useful and has the potential to assist minuaturization and simplification of the sensing system, in addition to increasing disposability of the device.

  4. Use of PCR for Direct Detection of Campylobacter Species in Bovine Feces†

    Science.gov (United States)

    Inglis, G. Douglas; Kalischuk, Lisa D.

    2003-01-01

    This study reports on the use of PCR to directly detect and distinguish Campylobacter species in bovine feces without enrichment. Inhibitors present in feces are a major obstacle to using PCR to detect microorganisms. The QIAamp DNA stool minikit was found to be an efficacious extraction method, as determined by the positive amplification of internal control DNA added to bovine feces before extraction. With nested or seminested multiplex PCR, Campylobacter coli, C. fetus, C. hyointestinalis, and C. jejuni were detected in all fecal samples inoculated at ≈104 CFU g−1, and 50 to 83% of the samples inoculated at ≈103 CFU g−1 were positive. At ≈102 CFU g−1, C. fetus, C. hyointestinalis, and C. jejuni (17 to 50% of the samples) but not C. coli were detected by PCR. From uninoculated bovine feces, a total of 198 arbitrarily selected isolates of Campylobacter were recovered on four commonly used isolation media incubated at three temperatures. The most frequently isolated taxa were C. jejuni (152 isolates) and C. lanienae (42 isolates), but isolates of C. fetus subsp. fetus, Arcobacter butzleri, and A. skirrowii also were recovered (≤2 isolates per taxon). Considerable variability was observed in the frequency of isolation of campylobacters among the four media and three incubation temperatures tested. With genus-specific primers, Campylobacter DNA was detected in 75% of the fecal samples, representing an 8% increase in sensitivity relative to that obtained with microbiological isolation across the four media and three incubation temperatures tested. With nested primers, C. jejuni and C. lanienae were detected in 25 and 67% of the samples, respectively. In no instance was DNA from either C. coli, C. fetus, or C. hyointestinalis detected in uninoculated bovine feces. PCR was more sensitive than isolation on microbiological media for detecting C. lanienae (17%) but not C. jejuni. Campylobacters are a diverse and fastidious group of bacteria, and the

  5. Direct tissue blot immunoassay for detection of Xylella fastidiosa in olive trees

    Directory of Open Access Journals (Sweden)

    Khaled DJELOUAH

    2015-01-01

    Full Text Available A direct tissue blot immunoassay (DTBIA technique has been compared with ELISA and PCR for detection of Xylella fastidiosa in olive trees from Apulia (southern Italy. Fresh cross-sections of young twigs and leaf petioles were printed onto nitrocellulose membranes and analyzed in the laboratory. Analyses of a first group of 61 samples gave similar efficiency for the three diagnostic techniques for detection the bacterium (24 positive and 36 negative samples, except for a single sample which was positive only with DTBIA and PCR. Similar results were obtained by separately analyzing suckers and twigs collected from different sectors of tree canopies of a second group of 20 olive trees (ten symptomatic and ten symptomless. In this second test the three diagnostic techniques confirmed the irregular distribution of the bacterium in the tree canopies and erratic detectability of the pathogen in the young suckers. It is therefore necessary to analyse composite samples per tree which should be prepared with twigs collected from different sides of the canopy. The efficiency comparable to ELISA and PCR, combined with the advantages of easier handling, speed and cost, make DTBIA a valid alternative to ELISA in large-scale surveys for occurrence of X. fastidiosa. Moreover, the printing of membranes directly in the field prevents infections spreading to Xylella-free areas, through movement of plant material with pathogen vectors for laboratory testing.

  6. A TLC-Direct Bioautography Method for Detection of Antiurolithiatic Metabolites.

    Science.gov (United States)

    Patil, Anita Surendra; Paikrao, Hariprasad Madhukarrao; Kale, Ankit Subhash; Manik, Surendra Raghoba

    2017-05-01

    Hyperoxaluria is major urinary disorder troubling largest population throughout the world predominantly involving calcium oxalate (CaOx) crystals. Ancient Ayurvedic system of medicine in India claims better option in treatment of urolithiasis. A plant from "Pashanbheda" group is Phyllanthus niruri L., possessing antiurolithiatic activity, needed to be screened and validated. In the present study, a rapid, easy and efficient method for CaOx crystal inhibition in the agar gel system analogous to antimicrobial well diffusion assay is proposed. A novel thin-layer chromatography (TLC)-direct bioautography method was also proposed to detect the antilithiatic metabolites. It helps to localize the active metabolites in P. niruri, further the partial structure elucidation was characterized by High Resolution Liquid Chromatography by mass spectroscopy (LC-HRMS) analysis. The agar well diffusion method shows 50% inhibitory concentration (IC50) value at 228.55 and 493.529 mg/mL for tri-sodium citrate and P. niruri extract, respectively. The lowest concentration showing visible crystal inhibition (minimum inhibitory concentration, MIC) in both samples was found to be 20 mg/mL. In this study, a unique agar gel well diffusion and TLC-direct bioautography method successfully screened, detected and confirmed CaOx crystal inhibitory metabolites from P. niruri. The tuberonic acid was detected in bioactive fraction of P. niruri by LC-HRMS characterization. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Dispersion compensation of fiber optic communication system with direct detection using artificial neural networks (ANNs)

    Science.gov (United States)

    Maghrabi, Mahmoud M. T.; Kumar, Shiva; Bakr, Mohamed H.

    2018-02-01

    This work introduces a powerful digital nonlinear feed-forward equalizer (NFFE), exploiting multilayer artificial neural network (ANN). It mitigates impairments of optical communication systems arising due to the nonlinearity introduced by direct photo-detection. In a direct detection system, the detection process is nonlinear due to the fact that the photo-current is proportional to the absolute square of the electric field intensity. The proposed equalizer provides the most efficient computational cost with high equalization performance. Its performance is comparable to the benchmark compensation performance achieved by maximum-likelihood sequence estimator. The equalizer trains an ANN to act as a nonlinear filter whose impulse response removes the intersymbol interference (ISI) distortions of the optical channel. Owing to the proposed extensive training of the equalizer, it achieves the ultimate performance limit of any feed-forward equalizer (FFE). The performance and efficiency of the equalizer is investigated by applying it to various practical short-reach fiber optic communication system scenarios. These scenarios are extracted from practical metro/media access networks and data center applications. The obtained results show that the ANN-NFFE compensates for the received BER degradation and significantly increases the tolerance to the chromatic dispersion distortion.

  8. Spectrally efficient polarization multiplexed direct-detection OFDM system without frequency gap.

    Science.gov (United States)

    Wei, Chia-Chien; Zeng, Wei-Siang; Lin, Chun-Ting

    2016-01-25

    We experimentally demonstrate a spectrally efficient direct-detection orthogonal frequency-division multiplexing (DD-OFDM) system. In addition to polarization-division multiplexing, removing the frequency gap further improves the spectral efficiency of the OFDM system. The frequency gap between a reference carrier and OFDM subcarriers avoids subcarrier-to-subcarrier beating interference (SSBI) in traditional DD-OFDM systems. Without dynamic polarization control, the resulting interference after square-law direct detection in the proposed gap-less system is polarization-dependent and composed of linear inter-carrier interference (ICI) and nonlinear SSBI. Thus, this work proposes an iterative multiple-input multiple-output detection scheme to remove the mixed polarization-dependent interference. Compared to the previous scheme, which only removes ICI, the proposed scheme can further eliminate SSBI to achieve the improvement of ∼ 7 dB in signal-to-noise ratio. Without the need for polarization control, we successfully utilize 7-GHz bandwidth to transmit a 39.5-Gbps polarization multiplexed OFDM signal over 100 km.

  9. Fabrication of SERS swab for direct detection of trace explosives in fingerprints.

    Science.gov (United States)

    Gong, Zhengjun; Du, Hongjie; Cheng, Fansheng; Wang, Cong; Wang, Canchen; Fan, Meikun

    2014-12-24

    Swab sampling is of great importance in surface contamination analysis. A cotton swab (cotton Q-tip) was successfully transformed into surface-enhanced Raman scattering (SERS) substrate (SERS Q-tip) through a bottom-up strategy, where Ag NPs were first self-assembled onto the Q-tip followed by in situ growing. The capability for direct swab detection of Raman probe Nile Blue A (NBA) and a primary explosive marker 2,4-dinitrotoluene (2,4-DNT) using the SERS Q-tip was explored. It was found that at optimum conditions, a femotogram of NBA on glass surface could be swab-detected. The lowest detectable amount for 2,4-DNT is only ∼1.2 ng/cm(2) (total amount of 5 ng) on glass surface, 2 orders of magnitude more sensitive than similar surface analysis achieved with infrared technique, and comparable even with that obtained by ion mobility spectrometry-mass spectrometry. Finally, 2,4-DNT left on fingerprints was also analyzed. It was found that SERS signal of 2,4-DNT from 27th fingerprint after touching 2,4-DNT powder can still be clearly identified by swabbing with the SERS Q-tip. We believe this is the first direct SERS swabbing test of explosives on fingerprint on glass. Considering its relative long shelf life (>30 d), the SERS Q-tip may find great potential in future homeland security applications when combined with portable Raman spectrometers.

  10. A multimedia constraint system

    NARCIS (Netherlands)

    J.E.A. van Hintum; G.J. Reynolds

    1995-01-01

    textabstractThe MADE constraint system provides excellent opportunities to introduce constraints in a multimedia application. Multimedia applications are not only a good place to experiment with constraint systems; constraints in a multimedia environment are almost indispensable. Due to the

  11. Semisynthetic bioluminescent sensor proteins for direct detection of antibodies and small molecules in solution.

    Science.gov (United States)

    Arts, Remco; Ludwig, Susann Katrina Julie; van Gerven, Benice C B; Magdalena Estirado, Eva; Milroy, Lech-Gustav; Merkx, Maarten

    2017-10-17

    Single-step immunoassays that can be performed directly in solution are ideally suited for point-of-care diagnostics. Our group recently developed a new platform of bioluminescent sensor proteins (LUMABS; LUMinescent AntiBody Sensor) that allow antibody detection in blood plasma. Thus far, LUMABS has been limited to the detection of antibodies recognizing natural peptide epitopes. Here, we report the development of semisynthetic LUMABS sensors that recognize non-peptide epitopes. The non-natural amino acid para-azidophenylalanine was introduced at the position of the original antibody-recognition sites as a chemical handle to enable site-specific conjugation of synthetic epitope molecules coupled to a dibenzocylcooctyne moiety via strain-promoted click chemistry. The approach was successfully demonstrated by developing semisynthetic LUMABS sensors for antibodies targeting the small molecules dinitrophenol and creati-nine (DNP-LUMABS and CR-LUMABS) with affinities of 5.8 pM and 1.3 nM, respectively. An important application of these semisynthetic LUMABS is the detection of small molecules using a competition assay format, which is demonstrated here for the detection of creatinine. Using a preassembled complex of CR-LUMABS and an anti-creatinine antibody, the detection of high micromolar concentrations of creatinine was possible both in buffer and 1:1 diluted blood plasma. The use of semisynthetic LUMABS sensors significantly expands the range of antibody targets and enables the application of LUMABS sensors for the ratiometric bioluminescent detection of small molecules using a competitive immunoassay format.

  12. Direct detection of OTA by impedimetric aptasensor based on modified polypyrrole-dendrimers.

    Science.gov (United States)

    Mejri-Omrani, Nawel; Miodek, Anna; Zribi, Becem; Marrakchi, Mouna; Hamdi, Moktar; Marty, Jean-Louis; Korri-Youssoufi, Hafsa

    2016-05-12

    Ochratoxin A (OTA) is a carcinogenic mycotoxin that contaminates food such as cereals, wine and beer; therefore it represents a risk for human health. Consequently, the allowed concentration of OTA in food is regulated by governmental organizations and its detection is of major agronomical interest. In the current study we report the development of an electrochemical aptasensor able to directly detect trace OTA without any amplification procedure. This aptasensor was constructed by coating the surface of a gold electrode with a film layer of modified polypyrrole (PPy), which was thereafter covalently bound to polyamidoamine dendrimers of the fourth generation (PAMAM G4). Finally, DNA aptamers that specifically binds OTA were covalently bound to the PAMAM G4 providing the aptasensor, which was characterized by using both Atomic Force Microscopy (AFM) and Surface Plasmon Resonance (SPR) techniques. The study of OTA detection by the constructed electrochemical aptasensor was performed using Electrochemical Impedance Spectroscopy (EIS) and revealed that the presence of OTA led to the modification of the electrical properties of the PPy layer. These modifications could be assigned to conformational changes in the folding of the aptamers upon specific binding of OTA. The aptasensor had a dynamic range of up to 5 μg L(-1) of OTA and a detection limit of 2 ng L(-1) of OTA, which is below the OTA concentration allowed in food by the European regulations. The efficient detection of OTA by this electrochemical aptasensor provides an unforeseen platform that could be used for the detection of various small molecules through specific aptamer association. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. DESIGN OF DPSK MODULATOR AND DIRECT DETECTION RECEIVER FOR DWDM BASED OPTICAL COMMUNICATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Gurjit Kaur

    2016-06-01

    Full Text Available In this paper a 16-bit differential phase shift keying (DPSK modulator is designed for 32 dense wavelength division multiplexing (DWDM channels. The DWDM channels are designed with 0.8nm separation in wavelength and operated at 4dBm input power. In the DWDM system, these 32 multiplexed signals propagate through a fiber length of 100 km followed by an erbium-doped fiber amplifier (EDFA inline. The channel is equipped with pre-amplifier and a dispersion compensating fiber for better performance. Also, a threshold detector is designed for both in-phase and quadrature components to detect the input amplitude and provide a quantized output amplitude level. The result shows that, a 16-bit DPSK optical signal is demodulated successfully using direct detection receiver.

  14. Direct detection of singlet dark matter in classically scale-invariant standard model

    Directory of Open Access Journals (Sweden)

    Kazuhiro Endo

    2015-10-01

    Full Text Available Classical scale invariance is one of the possible solutions to explain the origin of the electroweak scale. The simplest extension is the classically scale-invariant standard model augmented by a multiplet of gauge singlet real scalar. In the previous study it was shown that the properties of the Higgs potential deviate substantially, which can be observed in the International Linear Collider. On the other hand, since the multiplet does not acquire vacuum expectation value, the singlet components are stable and can be dark matter. In this letter we study the detectability of the real singlet scalar bosons in the experiment of the direct detection of dark matter. It is shown that a part of this model has already been excluded and the rest of the parameter space is within the reach of the future experiment.

  15. Direct detection of lower hybrid wave using a reflectometer on Alcator C-Moda)

    Science.gov (United States)

    Shiraiwa, S.; Baek, S.; Dominguez, A.; Marmar, E.; Parker, R.; Kramer, G. J.

    2010-10-01

    The possibility of directly detecting a density perturbation produced by lower hybrid (LH) waves using a reflectometer is presented. We investigate the microwave scattering of reflectometer probe beams by a model density fluctuation produced by short wavelength LH waves in an Alcator C-Mod experimental condition. In the O-mode case, the maximum response of phase measurement is found to occur when the density perturbation is approximately centimeters in front of the antenna, where Bragg scattering condition is satisfied. In the X-mode case, the phase measurement is predicted to be more sensitive to the density fluctuation close to the cut-off layer. A feasibility test was carried out using a 50 GHz O-mode reflectometer on the Alcator C-Mod tokamak, and positive results including the detection of 4.6 GHz pump wave and parametric decay instabilities were obtained.

  16. Iodine-125 radioimmunoassay for the direct detection of benzodiazepines in blood and urine

    Energy Technology Data Exchange (ETDEWEB)

    Goddard, C.P.; Stead, A.H.; Mason, P.A.; Law, B.; Moffat, A.C.; McBrien, M.; Cosby, S.

    1986-05-01

    A radioimmunoassay (RIA) for the direct detection of benzodiazepines in blood and urine is described. It is based on a commercially available antiserum and an easily synthesised radio-iodinated derivative of clonazepam that allows the use of relatively simple gamma-counting procedures. The assay can detect low therapeutic levels of all of the benzodiazepines currently available in the UK in 50-..mu..l samples of blood and urine (1-50 ng ml/sup -1/, depending on the drug); no prior sample preparation is required. It is inexpensive, rapid, simple to perform and is broadly specific for the benzodiazepine class of drugs. The assay offers a most suitable means of screening large numbers of samples of forensic interest for the presence of the benzodiazepines.

  17. Direct naked-eye detection of chiral and Faraday effects in white light

    Science.gov (United States)

    Ropars, G.; Le Floch, A.; Enoch, J.; Lakshminarayanan, V.

    2012-03-01

    We demonstrate that the human eye is able to detect the optical activity of chiral molecules and the Faraday effect, even under white-light viewing conditions, without the help of any polarizer. Indeed, we show that our eye acts as a differential analyzer and isolates the response in the blue part of the visible spectrum, thus avoiding the difficulties related to the inherent chromatic dispersion encountered in usual experiments performed under white-light conditions. Moreover the human eye enables to clearly distinguish between the fundamental reciprocal and non-reciprocal characteristics of the optical activity and the Faraday effect, respectively. Furthermore the human eye, without any specific optical dichroic axis in the retina, enables us to read, with the naked eye, hidden information encoded via different states of polarization, and suggests the possibility of direct detection of quantum entanglement effects.

  18. New Fpg probe chemistry for direct detection of recombinase polymerase amplification on lateral flow strips.

    Science.gov (United States)

    Powell, Michael L; Bowler, Frank R; Martinez, Aurore J; Greenwood, Catherine J; Armes, Niall; Piepenburg, Olaf

    2018-02-15

    Rapid, cost-effective and sensitive detection of nucleic acids has the ability to improve upon current practices employed for pathogen detection in diagnosis of infectious disease and food testing. Furthermore, if assay complexity can be reduced, nucleic acid amplification tests could be deployed in resource-limited and home use scenarios. In this study, we developed a novel Fpg (Formamidopyrimidine DNA glycosylase) probe chemistry, which allows lateral flow detection of amplification in undiluted recombinase polymerase amplification (RPA) reactions. The prototype nucleic acid lateral flow chemistry was applied to a human genomic target (rs1207445), Campylobacter jejuni 16S rDNA and two genetic markers of the important food pathogen E. coli O157:H7. All four assays have an analytical sensitivity between 10 and 100 copies DNA per amplification. Furthermore, the assay is performed with fewer hands-on steps than using the current RPA Nfo lateral flow method as dilution of amplicon is not required for lateral flow analysis. Due to the simplicity of the workflow, we believe that the lateral flow chemistry for direct detection could be readily adapted to a cost-effective single-use consumable, ideal for use in non-laboratory settings. Copyright © 2017. Published by Elsevier Inc.

  19. Magnetic bubble chambers and sub-GeV dark matter direct detection

    Science.gov (United States)

    Bunting, Philip C.; Gratta, Giorgio; Melia, Tom; Rajendran, Surjeet

    2017-05-01

    We propose a new application of single molecule magnet crystals: their use as "magnetic bubble chambers" for the direct detection of sub-GeV dark matter. The spins in these macroscopic crystals effectively act as independent nanoscale magnets. When antialigned with an external magnetic field they form metastable states with a relaxation time that can be very long at sufficiently low temperatures. The Zeeman energy stored in this system can be released through localized heating, caused for example by the scattering or absorption of dark matter, resulting in a spin avalanche (or "magnetic deflagration") that amplifies the effects of the initial heat deposit, enabling detection. Much like the temperature and pressure in a conventional bubble chamber, the temperature and external magnetic field set the detection threshold for a single molecule magnet crystal. We discuss this detector concept for dark matter detection and propose ways to ameliorate backgrounds. If successfully developed, this detector concept can search for hidden photon dark matter in the meV-eV mass range with sensitivities exceeding current bounds by several orders of magnitude.

  20. Magnetized carbon nanotubes for visual detection of proteins directly in whole blood.

    Science.gov (United States)

    Huang, Yan; Wen, Yongqiang; Baryeh, Kwaku; Takalkar, Sunitha; Lund, Michelle; Zhang, Xueji; Liu, Guodong

    2017-11-15

    The authors describe a magnetized carbon nanotube (MCNT)-based lateral flow strip biosensor for visual detection of proteins directly in whole blood avoiding complex purification and sample pre-treatments. MCNT were synthesized by coating Fe3O4 nanoparticles on the shortened multiwalled carbon nanotube (CNT) surface via co-precipitation of ferric and ferrous ions within a dispersion of shorten multiwalled CNTs. The antibody-modified MCNTs were used to capture target protein in whole blood; the formed MCNT-antibody-target protein complexes were applied to the lateral flow strip biosensor, in which a capture antibody was immobilized on the test zone of the biosensor. The captured MCNTs on the test zone and control zone were producing characteristic brown/black bands, and this enabled target protein to be visually detected. Quantification was accomplished by reading the intensities of the bands with a portable strip reader. Rabbit IgG was used as a model target to demonstrate the proof-of-concept. After systematic optimizations of assay parameters, the detection limit of the assay in whole blood was determined to be 10 ng mL-1 (S/N = 3) with a linear dynamic range of 10-200 ng mL-1. This study provides a rapid and low-cost approach for detecting proteins in blood, showing great promise for clinical application and biomedical diagnosis, particularly in limited resource settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Rapid detection of NBOME's and other NPS on blotter papers by direct ATR-FTIR spectrometry.

    Science.gov (United States)

    Coelho Neto, José

    2015-07-01

    Blotter paper is among the most common forms of consumption of new psychotropic substances (NPS), formerly referred as designer drugs. In many cases, users are misled to believe they are taking LSD when, in fact, they are taking newer and less known drugs like the NBOMEs or other substituted phenethylamines. We report our findings in quick testing of blotter papers for illicit substances like NBOMEs and other NPS by taking ATR-FTIR spectra directly from blotters seized on the streets, without any sample preparation. Both sides (front and back) of each blotter were tested. Collected data were analyzed by single- and multi-component spectral matching and submitted to chemometric discriminant analysis. Our results showed that, on 66.7% of the cases analyzed, seized blotters contained one or more types of NBOMEs, confirming the growing presence of this novel substances on the market. Matching IR signals were detected on both or just one side of the blotters and showed variable strength. Although no quantitative analysis was made, detection of these substances by the proposed approach serves as indication of variable and possibly higher dosages per blotter when compared to LSD, which showed to be below the detection limit of the applied method. Blotters containing a mescaline-like compound, later confirmed by GC-MS and LC-MS to be MAL (methallylescaline), a substance very similar to mescaline, were detected among the samples tested. Validity of direct ATR-FTIR testing was confirmed by checking the obtained results against independent GC-MS or LC-MS results for the same cases/samples. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Direct growth of graphene on quartz substrates for label-free detection of adenosine triphosphate.

    Science.gov (United States)

    Xu, Shicai; Man, Baoyuan; Jiang, Shouzhen; Yue, Weiwei; Yang, Cheng; Liu, Mei; Chen, Chuansong; Zhang, Chao

    2014-04-25

    We demonstrate that continuous, uniform graphene films can be directly synthesized on quartz substrates using a two-temperature-zone chemical vapor deposition system and that their layers can be controlled by adjusting the precursor partial pressure. Raman spectroscopy and transmission electron microscopy confirm the formation of monolayer graphene with a grain size of ∼100 nm. Hall measurements show a room-temperature carrier mobility above 1500 cm2 V(-1) s(-1). The optical transmittance and conductance of the graphene films are comparable to those of transferred metal-catalyzed graphene. The method avoids the complicated and skilled post-growth transfer process and allows the graphene to be directly incorporated into a fully functional biosensor for label-free detection of adenosine triphosphate (ATP). This device shows a fast response time of a few milliseconds and achieves a high sensitivity to ATP molecules over a very wide range from 0.002 to 5 mM.

  3. LHC and Tevatron bounds on the dark matter direct detection cross-section for vector mediators

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Preston, Anthony

    2012-01-01

    We study the interactions of a new spin-1 mediator that connects the Standard Model to dark matter. We constrain its decay channels using monojet and monophoton searches, as well as searches for resonances in dijet, dilepton and diboson final states including those involving a possible Higgs. We...... then interpret the resulting limits as bounds on the cross-section for dark matter direct detection without the need to specify a particular model. For mediator masses between 300 and 1000 GeV these bounds are considerably stronger than the ones obtained under the assumption that the mediator can be integrated...

  4. Direct Detection Phenomenology in Models Where the Products of Dark Matter Annihilation Interact with Nuclei

    DEFF Research Database (Denmark)

    Cherry, John F.; Frandsen, Mads T.; Shoemaker, Ian M.

    2015-01-01

    experiments is controlled by relativistic kinematics. This results in a distinctive recoil spectrum, a non-standard and or even absent annual modulation, and the ability to probe DM masses as low as a $\\sim$10 MeV. We use current LUX data to show that experimental sensitivity to thermal relic annihilation...... to nuclei, the limit from annihilation to relativistic particles in the Sun can be stronger than that of conventional non-relativistic direct detection by more than three orders of magnitude for masses in a 2-7 GeV window....

  5. Near-IR Direct Detection of Water Vapor in Tau Bootis b

    Science.gov (United States)

    2014-02-24

    rights reserved. Printed in the U.S.A. NEAR-IR DIRECT DETECTION OF WATER VAPOR IN TAU BOÖTIS b Alexandra C. Lockwood1, John A. Johnson1,2, Chad F...Bender3,4, John S. Carr5, Travis Barman6, Alexander J. W. Richert3,4, and Geoffrey A. Blake1 1 Division of Geological and Planetary Sciences, California...their host star. Hundreds of transiting planets have been discovered and characterized, and the ongoing Kepler mission has found potential exoplanet

  6. PMD compensation in fiber-optic communication systems with direct detection using LDPC-coded OFDM.

    Science.gov (United States)

    Djordjevic, Ivan B

    2007-04-02

    The possibility of polarization-mode dispersion (PMD) compensation in fiber-optic communication systems with direct detection using a simple channel estimation technique and low-density parity-check (LDPC)-coded orthogonal frequency division multiplexing (OFDM) is demonstrated. It is shown that even for differential group delay (DGD) of 4/BW (BW is the OFDM signal bandwidth), the degradation due to the first-order PMD can be completely compensated for. Two classes of LDPC codes designed based on two different combinatorial objects (difference systems and product of combinatorial designs) suitable for use in PMD compensation are introduced.

  7. Can LIGO Directly Detect the Scalar Field Dark Energy of 5D Gravity?

    Science.gov (United States)

    Zhang, Tianxi

    2017-06-01

    The observed acceleration of the present universe is commonly attributed to the existence of dark energy as a dominant component throughout the universe. A direct detection of dark energy has become one of the most important issues in the modern astrophysics and cosmology. Two widely accepted candidates of the dark energy are the cosmological constant Λ and the quintessence. Unlike the cosmological constant, the quintessence is a scalar field Φ that varies throughout spacetime, and has been modelled in various ways such as the four-dimensional (4D) Brans-Dicke scalar-tensor theory of gravitation and the five-dimensional (5D) Kaluza-Klein scalar-vector-tensor theory of gravitation. The scalar field of 5D gravity was shown to be capable of polarizing the space or vacuum and thus can extend the optical length of the path of a laser beam that passes through the polarized space or vacuum. Recently, the author, in terms of his 5D fully covariant Kaluza-Klein scalar-vector-tensor theory of gravitation, has quantitatively related the dielectric constant of the polarized vacuum (and thus the optical length of the path in the polarized vacuum) to the charge-mass ratio of a charged object. This study further demonstrates that the vacuum polarization by the scalar field dark energy of 5D gravity, when the object is highly charged, can be significant enough for the extremely accurate LIGO, which has recently detected first ever the gravitational waves from the binary black hole merger, to directly detect. It is shown that a some-thousand-kilogram sphere electrically charged to tens of kilovolts can polarize the vacuum by its scalar field dark energy and thus extend the optical path length of a laser beam that travels through one LIGO arm with some hundred reflections by approximately 10-18 m, which is one-order higher than that to be detected by the LIGO detectors. Therefore, being added a highly charged sphere into the experimental setup, LIGO may directly discover the

  8. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...... of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using...... and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection....

  9. Challenges of detecting directional selection after a bottleneck: lessons from Sorghum bicolor.

    Science.gov (United States)

    Hamblin, Martha T; Casa, Alexandra M; Sun, Hong; Murray, Seth C; Paterson, Andrew H; Aquadro, Charles F; Kresovich, Stephen

    2006-06-01

    Multilocus surveys of sequence variation can be used to identify targets of directional selection, which are expected to have reduced levels of variation. Following a population bottleneck, the signal of directional selection may be hard to detect because many loci may have low variation by chance and the frequency spectrum of variation may be perturbed in ways that resemble the effects of selection. Cultivated Sorghum bicolor contains a subset of the genetic diversity found in its wild ancestor(s) due to the combined effects of a domestication bottleneck and human selection on traits associated with agriculture. As a framework for distinguishing between the effects of demography and selection, we sequenced 204 loci in a diverse panel of 17 cultivated S. bicolor accessions. Genomewide patterns of diversity depart strongly from equilibrium expectations with regard to the variance of the number of segregating sites, the site frequency spectrum, and haplotype configuration. Furthermore, gene genealogies of most loci with an excess of low frequency variants and/or an excess of segregating sites do not show the characteristic signatures of directional and diversifying selection, respectively. A simple bottleneck model provides an improved but inadequate fit to the data, suggesting the action of other population-level factors, such as population structure and migration. Despite a known history of recent selection, we find little evidence for directional selection, likely due to low statistical power and lack of an appropriate null model.

  10. Evaluation of GenoType Mycobacteria Direct Assay in Comparison with Gen-Probe Mycobacterium tuberculosis Amplified Direct Test and GenoType MTBDRplus for Direct Detection of Mycobacterium tuberculosis Complex in Clinical Samples▿

    OpenAIRE

    Neonakis, Ioannis K; Gitti, Zoe; Baritaki, Stavroula; Petinaki, Efi; Baritaki, Maria; SPANDIDOS, DEMETRIOS A.

    2009-01-01

    Three molecular assays were evaluated for the direct detection of Mycobacterium tuberculosis complex bacteria in 125 respiratory and 22 nonrespiratory samples. The overall sensitivities obtained were as follows: GenoType MTBDRplus, 97.9%; GenoType Mycobacteria Direct, 93.7%; Gen-Probe Mycobacterium tuberculosis Amplified Direct Test, 89.6%. The specificity of the assays used was 100%.

  11. Portal imaging with a direct-detection active matrix flat panel imager

    Science.gov (United States)

    Lachaine, Martin Emile

    2001-07-01

    The problem of charge creation by x-rays in amorphous selenium (a-Se) is studied. A quantitative theory is developed which includes collective and single electron-hole pair excitations by a passing electron. This theory is incorporated into a Monte Carlo code to calculate track structures in a-Se. The initial positions of the electron-hole pairs along these tracks are used to study the fraction of pairs which recombine versus incident x-ray energy and applied electric field. The experimentally-observed energy dependence of recombination is attributed to a spur size which is dependent on the velocity of the ionizing electrons. The theory and simulations agree with available experimental data in the energy range from 20 keV to 10 MeV. The use of an a-Se based direct-detection active matrix flat-panel imager (AMFPI) is explored at megavoltage energies for use in the verification of radiotherapy treatments. As with most other megavoltage detectors, a metal front plate is used to reduce patient scatter and to act as a buildup layer. The Modulation Transfer Function (MTF), Noise Power Spectrum (NPS), and Detective Quantum Efficiency (DQE) are measured. The DQE for the direct detection AMFPI is compared with the published DQE of an indirect detection AMFPI for portal imaging. The direct detector has a lower DQE at zero frequency, but there is a cross-over at approximately 0.3 cycles/mm after which it has a higher DQE. A theoretical expression for the DQE of medical imaging detectors with non-elementary cascade stages is derived. This formalism can be used in conjunction with Monte Carlo techniques to evaluate the DQE of megavoltage imaging detectors. The predictions of the theory agree with the experimental DQE results for the direct-detection AMFPI and also for published results for the DQE of both a metal/phosphor detector and an indirect-detection AMFPI. The effect of scatter on image quality is modeled in terms of the scatter fraction (SF) and scatter-to-primary ratio

  12. Transfer Entropy Estimation and Directional Coupling Change Detection in Biomedical Time Series

    Directory of Open Access Journals (Sweden)

    Lee Joon

    2012-04-01

    Full Text Available Abstract Background The detection of change in magnitude of directional coupling between two non-linear time series is a common subject of interest in the biomedical domain, including studies involving the respiratory chemoreflex system. Although transfer entropy is a useful tool in this avenue, no study to date has investigated how different transfer entropy estimation methods perform in typical biomedical applications featuring small sample size and presence of outliers. Methods With respect to detection of increased coupling strength, we compared three transfer entropy estimation techniques using both simulated time series and respiratory recordings from lambs. The following estimation methods were analyzed: fixed-binning with ranking, kernel density estimation (KDE, and the Darbellay-Vajda (D-V adaptive partitioning algorithm extended to three dimensions. In the simulated experiment, sample size was varied from 50 to 200, while coupling strength was increased. In order to introduce outliers, the heavy-tailed Laplace distribution was utilized. In the lamb experiment, the objective was to detect increased respiratory-related chemosensitivity to O2 and CO2 induced by a drug, domperidone. Specifically, the separate influence of end-tidal PO2 and PCO2 on minute ventilation (V˙E before and after administration of domperidone was analyzed. Results In the simulation, KDE detected increased coupling strength at the lowest SNR among the three methods. In the lamb experiment, D-V partitioning resulted in the statistically strongest increase in transfer entropy post-domperidone for PO2→V˙E. In addition, D-V partitioning was the only method that could detect an increase in transfer entropy for PCO2→V˙E, in agreement with experimental findings. Conclusions Transfer entropy is capable of detecting directional coupling changes in non-linear biomedical time series analysis featuring a small number of observations and presence of outliers. The results

  13. Multiple sound source localization using gammatone auditory filtering and direct sound componence detection

    Science.gov (United States)

    Chen, Huaiyu; Cao, Li

    2017-06-01

    In order to research multiple sound source localization with room reverberation and background noise, we analyze the shortcomings of traditional broadband MUSIC and ordinary auditory filtering based broadband MUSIC method, then a new broadband MUSIC algorithm with gammatone auditory filtering of frequency component selection control and detection of ascending segment of direct sound componence is proposed. The proposed algorithm controls frequency component within the interested frequency band in multichannel bandpass filter stage. Detecting the direct sound componence of the sound source for suppressing room reverberation interference is also proposed, whose merits are fast calculation and avoiding using more complex de-reverberation processing algorithm. Besides, the pseudo-spectrum of different frequency channels is weighted by their maximum amplitude for every speech frame. Through the simulation and real room reverberation environment experiments, the proposed method has good performance. Dynamic multiple sound source localization experimental results indicate that the average absolute error of azimuth estimated by the proposed algorithm is less and the histogram result has higher angle resolution.

  14. Rapid detection of haloarchaeal carotenoids via liquid-liquid microextraction enabled direct TLC MALDI-MS.

    Science.gov (United States)

    Manikandan, Muthu; Hasan, Nazim; Wu, Hui-Fen

    2013-03-30

    For the first time, we demonstrate the use of TiO2 nanoparticles (NPs) for enhancing the carotenoid production by the extremophilic haloarchea, Haloferax mediterranei. TiO2 NPs at optimal concentration of 375 mg/L results in a 95% increase in the production of carotenoid pigment compared to the control (no TiO2 NPs). The carotenoid pigments extracted from TiO2 NPs treated H. mediterranei cells, were separated using thin layer chromatography (TLC). The separated carotenoid spots were subjected directly for MALDI MS detection. To limit the sample diffusion during matrix addition on TLC plates, a simple bordering mode was exercised. Using this method we were able to detect the pigments successfully using MALDI-MS, directly from TLC plates after separation. In addition, we also applied the Pt NPs capped with ODT via Liquid-liquid microextraction (LLME) for extracting the pigment molecules from the halobacteria in MALDI-MS. These novel NP approaches possess numerous advantages such as; rapidity, ease in synthesis, high sensitivity and low cost. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Leptophilic Dark Matter in Direct Detection Experiments and in the Sun

    Energy Technology Data Exchange (ETDEWEB)

    Kopp, Joachim; Niro, Viviana; Schwetz, Thomas; Zupan, Jure

    2010-11-01

    Dark matter interacting predominantly with leptons instead of nuclear matter has received a lot of interest recently. In this talk, we investigate the signals expected from such 'leptophilic Dark Matter' in direct detection experiments and in experiments looking for Dark Matter annihilation into neutrinos in the Sun. In a model-independent framework, we calculate the expected interaction rates for different scattering processes, including elastic and inelastic scattering off atomic electron shells, as well as loop-induced scattering off atomic nuclei. In those cases where the last effect dominates, leptophilic Dark Matter cannot be distinguished from conventional WIMPs. On the other hand, if inelastic scattering off the electron shell dominates, the expected event spectrum in direct detection experiments is different and would provide a distinct signal. However, we find that the signals in DAMA and/or CoGeNT cannot be explained by invoking leptophilic DM because the predicted and observed energy spectra do not match, and because of neutrino bounds from the Sun.

  16. On the direct detection of multi-component dark matter: sensitivity studies and parameter estimation

    Science.gov (United States)

    Herrero-Garcia, Juan; Scaffidi, Andre; White, Martin; Williams, Anthony G.

    2017-11-01

    We study the case of multi-component dark matter, in particular how direct detection signals are modified in the presence of several stable weakly-interacting-massive particles. Assuming a positive signal in a future direct detection experiment, stemming from two dark matter components, we study the region in parameter space where it is possible to distinguish a one from a two-component dark matter spectrum. First, we leave as free parameters the two dark matter masses and show that the two hypotheses can be significantly discriminated for a range of dark matter masses with their splitting being the critical factor. We then investigate how including the effects of different interaction strengths, local densities or velocity dispersions for the two components modifies these conclusions. We also consider the case of isospin-violating couplings. In all scenarios, we show results for various types of nuclei both for elastic spin-independent and spin-dependent interactions. Finally, assuming that the two-component hypothesis is confirmed, we quantify the accuracy with which the parameters can be extracted and discuss the different degeneracies that occur. This includes studying the case in which only a single experiment observes a signal, and also the scenario of having two signals from two different experiments, in which case the ratios of the couplings to neutrons and protons may also be extracted.

  17. Turbine Reliability and Operability Optimization through the use of Direct Detection Lidar Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, David K; Lewis, Matthew J; Pavlich, Jane C; Wright, Alan D; Johnson, Kathryn E; Pace, Andrew M

    2013-02-01

    The goal of this Department of Energy (DOE) project is to increase wind turbine efficiency and reliability with the use of a Light Detection and Ranging (LIDAR) system. The LIDAR provides wind speed and direction data that can be used to help mitigate the fatigue stress on the turbine blades and internal components caused by wind gusts, sub-optimal pointing and reactionary speed or RPM changes. This effort will have a significant impact on the operation and maintenance costs of turbines across the industry. During the course of the project, Michigan Aerospace Corporation (MAC) modified and tested a prototype direct detection wind LIDAR instrument; the resulting LIDAR design considered all aspects of wind turbine LIDAR operation from mounting, assembly, and environmental operating conditions to laser safety. Additionally, in co-operation with our partners, the National Renewable Energy Lab and the Colorado School of Mines, progress was made in LIDAR performance modeling as well as LIDAR feed forward control system modeling and simulation. The results of this investigation showed that using LIDAR measurements to change between baseline and extreme event controllers in a switching architecture can reduce damage equivalent loads on blades and tower, and produce higher mean power output due to fewer overspeed events. This DOE project has led to continued venture capital investment and engagement with leading turbine OEMs, wind farm developers, and wind farm owner/operators.

  18. The detection of communicative signals directed at the self in infant prefrontal cortex

    Directory of Open Access Journals (Sweden)

    Tobias eGrossmann

    2010-10-01

    Full Text Available A precondition for successful communication between people is the detection of signals indicating the intention to communicate, such as eye contact or calling a person’s name. In adults, establishing communication by eye contact or calling a person’s name results in overlapping activity in right prefrontal cortex, suggesting that, regardless of modality, the intention to communicate is detected by the same brain region. We measured prefrontal cortex responses in 5-month-olds using near-infrared spectroscopy (NIRS to examine the neural basis of detecting communicative signals across modalities in early development. Infants watched human faces that either signaled eye contact or directed their gaze away from the infant, and they also listened to voices that addressed them with their own name or another name. The results revealed that infants recruit adjacent but non-overlapping regions in the left dorsal prefrontal cortex when they process eye contact and own name. Moreover, infants that responded sensitively to eye contact in the one prefrontal region were also more likely to respond sensitively to their own name in the adjacent prefrontal region as revealed in a correlation analysis, suggesting that responding to communicative signals in these two regions might be functionally related. These NIRS results suggest that infants selectively process and attend to communicative signals directed at them. However, unlike adults, infants do not seem to recruit a common prefrontal region when processing communicative signals of different modalities. The implications of these findings for our understanding of infants’ developing communicative abilities are discussed.

  19. Direct detection of Trichomonas vaginalis virus in Trichomonas vaginalis positive clinical samples from the Netherlands.

    Science.gov (United States)

    Jehee, Ivo; van der Veer, Charlotte; Himschoot, Michelle; Hermans, Mirjam; Bruisten, Sylvia

    2017-12-01

    Trichomonas vaginalis is the most common sexually transmitted parasitical infection worldwide. T. vaginalis can carry a virus: Trichomonas vaginalis virus (TVV). To date, four TVV species have been described. Few studies have investigated TVV prevalence and its clinical importance. We have developed a nested reverse-transcriptase PCR, with novel, type specific primers to directly detect TVV RNA in T. vaginalis positive clinical samples. A total of 119T. vaginalis positive clinical samples were collected in Amsterdam and "s-Hertogenbosch, the Netherlands, from 2012 to 2016. For all samples T. vaginalis was genotyped using multi-locus sequence typing. The T. vaginalis positive samples segregated into a two-genotype population: type I (n=64) and type II (n=55). All were tested for TVV with the new TVV PCR. We detected 3 of the 4 TVV species. Sequencing of the amplified products showed high homology with published TVV genomes (82-100%). Half of the T. vaginalis clinical samples (n=60, 50.4%) were infected with one or more TVV species, with a preponderance for TVV infections in T. vaginalis type I (n=44, 73.3%). Clinical data was available for a subset of samples (n=34) and we observed an association between testing positive for (any) TVV and reporting urogenital symptoms (p=0.023). The nested RT-PCR allowed for direct detection of TVV in T. vaginalis positive clinical samples. This may be helpful in studies and clinical settings, since T. vaginalis disease and/or treatment outcome may be influenced by the protozoa"s virus. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Direct Detection of the Biological Toxin in Acidic Environment by Electrochemical Impedimetric Immunosensor

    Directory of Open Access Journals (Sweden)

    Changhoon Chai

    2010-12-01

    Full Text Available This study describes the direct detection of the biological toxin (Ricin in acidic environment without pH adjustment by hydrophobically modified electrochemical impedance immunosensor (EII. The nano-porous aluminum substrate for EII was hydrophobically modified via self-assembled monolayer (SAM of APTES. Biosensor for the detection of the Ricin was fabricated by the covalent cross-linking of antibody (Ab with APTES-SAM. The immunoreactions between the immobilized Ab and the biological toxin in several diagnostic solutions were monitored by the electrochemical impedance spectroscopy (EIS under the polarization of EII versus reference electrode. EII could detect the presence of the biological toxin in acidic foods in 20 mins without pH adjustment. The negatively charged ions including hydroxides would be adsorbed on the hydrophobic body of APTES-SAMs by the polarization during EIS analysis, and offset the effect of acids on the immunological activity of the immobilized Ab. It suggested that the adsorption of negatively charged ions helped to keep the immunological activities of the immobilized Ab on EII in acidic environment. Proposed mechanism of the localized pH adjustment that makes possible immunoreaction occurrence in low pH sample matrix is briefly discussed.

  1. Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD)

    Science.gov (United States)

    Generazio, Edward R.

    2015-01-01

    Directed Design of Experiments for Validating Probability of Detection Capability of NDE Systems (DOEPOD) Manual v.1.2 The capability of an inspection system is established by applications of various methodologies to determine the probability of detection (POD). One accepted metric of an adequate inspection system is that there is 95% confidence that the POD is greater than 90% (90/95 POD). Design of experiments for validating probability of detection capability of nondestructive evaluation (NDE) systems (DOEPOD) is a methodology that is implemented via software to serve as a diagnostic tool providing detailed analysis of POD test data, guidance on establishing data distribution requirements, and resolving test issues. DOEPOD demands utilization of observance of occurrences. The DOEPOD capability has been developed to provide an efficient and accurate methodology that yields observed POD and confidence bounds for both Hit-Miss or signal amplitude testing. DOEPOD does not assume prescribed POD logarithmic or similar functions with assumed adequacy over a wide range of flaw sizes and inspection system technologies, so that multi-parameter curve fitting or model optimization approaches to generate a POD curve are not required. DOEPOD applications for supporting inspector qualifications is included.

  2. Development of Piezoelectric DNA-Based Biosensor for Direct Detection of Mycobacterium Tuberculosis in Clinical Specimens

    Directory of Open Access Journals (Sweden)

    Thongchai KAEWPHINIT

    2010-02-01

    Full Text Available This study was focused on establishment of piezoelectric biosensor for direct detection of Mycobacterium tuberculosis (MTB in clinical specimens. The quartz crystal immobilized via 3-mercaptopropionic acid (MPA/avidin/DNA biotinylated probe on gold surface and hybridization of the DNA target to DNA biotinylated probe. The optimal concentration of MPA, avidin and 5’-biotinylated DNA probe for immobilization of specific DNA probe on gold surface were 15 mM, 0.1 mg/ml and 1.5 μM, respectively. The detection of genomic DNA digestion in the range from 0.5 to 30 μg/ml. The fabricated biosensor was evaluated through an examination of 200 samples. No cross hybridization were observed against M. avium complex (MAC and other microorganism. This target DNA preparation without amplification will reduce time consuming, costs, and the tedious step of amplification. This study can be extended to develop the new method which is high sensitivity, specificity, cheap, easy to use, and rapid for detection of MTB in many fields.

  3. Digital quantification of miRNA directly in plasma using integrated comprehensive droplet digital detection.

    Science.gov (United States)

    Zhang, Kaixiang; Kang, Dong-Ku; Ali, M Monsur; Liu, Linan; Labanieh, Louai; Lu, Mengrou; Riazifar, Hamidreza; Nguyen, Thi N; Zell, Jason A; Digman, Michelle A; Gratton, Enrico; Li, Jinghong; Zhao, Weian

    2015-11-07

    Quantification of miRNAs in blood can be potentially used for early disease detection, surveillance monitoring and drug response evaluation. However, quantitative and robust measurement of miRNAs in blood is still a major challenge in large part due to their low concentration and complicated sample preparation processes typically required in conventional assays. Here, we present the 'Integrated Comprehensive Droplet Digital Detection' (IC 3D) system where the plasma sample containing target miRNAs is encapsulated into microdroplets, enzymatically amplified and digitally counted using a novel, high-throughput 3D particle counter. Using Let-7a as a target, we demonstrate that IC 3D can specifically quantify target miRNA directly from blood plasma at extremely low concentrations ranging from 10s to 10 000 copies per mL in ≤3 hours without the need for sample processing such as RNA extraction. Using this new tool, we demonstrate that target miRNA content in colon cancer patient blood is significantly higher than that in healthy donor samples. Our IC 3D system has the potential to introduce a new paradigm for rapid, sensitive and specific detection of low-abundance biomarkers in biological samples with minimal sample processing.

  4. Direct, label-free, selective, and sensitive microbial detection using a bacteriorhodopsin-based photoelectric immunosensor.

    Science.gov (United States)

    Chen, Hsiu-Mei; Jheng, Kai-Ru; Yu, An-Dih

    2017-05-15

    A photoelectric immunosensor using purple membranes (PM) as the transducer, which contains photoactive bacteriorhodopsin, is here first demonstrated for direct and label-free microbial detection. Biotinylated polyclonal antibodies against Escherichia coli were immobilized on a PM-coated electrode through further surface biotinylation and bridging avidin or NeutrAvidin. The photocurrent generated by the antibody-coated sensor was reduced after incubation with E. coli K-12 cultures, with the reduction level increased with the culture populations. The immunosensor prepared via NeutrAvidin exhibited much better selectivity than the one prepared via avidin, recognizing almost none of the tested Gram-positive bacteria. Cultures with populations ranging from 1 to 10(7)CFU/10mL were detected in a single step without any preprocessing. Both AFM and Raman analysis confirmed the layer-by-layer fabrication of the antibody-coated substrates as well as the binding of microorganisms. By investigating the effect of illumination orientation and simulating the photocurrent responses with an equivalent circuit model containing a chemical capacitance, we suggest that the photocurrent reduction was primarily caused by the light-shielding effect of the captured bacteria. Using the current fabrication technique, versatile bacteriorhodopsin-based photoelectric immunosensors can be readily prepared to detect a wide variety of biological cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. NEAR-IR DIRECT DETECTION OF WATER VAPOR IN TAU BOÖTIS b

    Energy Technology Data Exchange (ETDEWEB)

    Lockwood, Alexandra C.; Johnson, John A.; Blake, Geoffrey A. [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States); Bender, Chad F.; Richert, Alexander J. W. [Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802 (United States); Carr, John S. [Naval Research Laboratory, Washington, DC 20375 (United States); Barman, Travis, E-mail: alock@caltech.edu [Lunar and Planetary Laboratory, University of Arizona, Tucson, AZ 85721 (United States)

    2014-03-10

    We use high dynamic range, high-resolution L-band spectroscopy to measure the radial velocity (RV) variations of the hot Jupiter in the τ Boötis planetary system. The detection of an exoplanet by the shift in the stellar spectrum alone provides a measure of the planet's minimum mass, with the true mass degenerate with the unknown orbital inclination. Treating the τ Boo system as a high flux ratio double-lined spectroscopic binary permits the direct measurement of the planet's true mass as well as its atmospheric properties. After removing telluric absorption and cross-correlating with a model planetary spectrum dominated by water opacity, we measure a 6σ detection of the planet at K{sub p} = 111 ± 5 km s{sup –1}, with a 1σ upper limit on the spectroscopic flux ratio of 10{sup –4}. This RV leads to a planetary orbital inclination of i=45{sub −4}{sup +3}° and a mass of M{sub P}=5.90{sub −0.20}{sup +0.35} M{sub Jup}. We report the first detection of water vapor in the atmosphere of a non-transiting hot Jupiter, τ Boo b.

  6. Direct detection of diarrheagenic Aeromonas from faeces by polymerase chain reaction (PCR) targeting aerolysin toxin gene.

    Science.gov (United States)

    Kannan, S; Suresh Kanna, P; Karkuzhali, K; Chattopadhyay, U K; Pal, D

    2001-01-01

    Detection of diarrheagenic Aeromonas specific aerolysin toxin (Aer) gene by PCR based assay and isolation, identification of diarrhea causing Aeromonas from faeces by culture methods were carried out in the Division of Active Surveillance, National Institute of Cholera and Enteric Diseases (NICED), Kolkata, India for a period of 12 months. Out of 602 faecal samples collected from patients with acute diarrhea admitted in Infectious Diseases (ID) Hospital, Kolkata, 68 (11.29%) samples were found to be possessing Aer gene by PCR technique. The conventional culture methods using selective media yielded only 64 (10.6%) Aeromonas strains from the same faecal samples. The different Aeromonas species possessing Aer gene identified by PCR based technique include A. hydrophila (55.8%), A. caviae (17.6%), A. veronii (10.2%), A. schubertii (4.4%), A. jandaei (2.9%) and A. trota (8.8%). The isolation and identification of Aeromonas by routine culture did not detect enterotoxigenic A. trota present in four diarrheal faecal samples. The failure of the growth of enterotoxigenic A. trota on selective media may be attributed to the ampicillin susceptibility of those strains. The quality control studies revealed that PCR method for the direct detection of Aer gene from the faeces has the sensitivity of 100% and specificity of 98%.

  7. Direct detection of a break in the teraelectronvolt cosmic-ray spectrum of electrons and positrons

    Science.gov (United States)

    DAMPE Collaboration; Ambrosi, G.; An, Q.; Asfandiyarov, R.; Azzarello, P.; Bernardini, P.; Bertucci, B.; Cai, M. S.; Chang, J.; Chen, D. Y.; Chen, H. F.; Chen, J. L.; Chen, W.; Cui, M. Y.; Cui, T. S.; D'Amone, A.; de Benedittis, A.; De Mitri, I.; di Santo, M.; Dong, J. N.; Dong, T. K.; Dong, Y. F.; Dong, Z. X.; Donvito, G.; Droz, D.; Duan, K. K.; Duan, J. L.; Duranti, M.; D'Urso, D.; Fan, R. R.; Fan, Y. Z.; Fang, F.; Feng, C. Q.; Feng, L.; Fusco, P.; Gallo, V.; Gan, F. J.; Gao, M.; Gao, S. S.; Gargano, F.; Garrappa, S.; Gong, K.; Gong, Y. Z.; Guo, D. Y.; Guo, J. H.; Hu, Y. M.; Huang, G. S.; Huang, Y. Y.; Ionica, M.; Jiang, D.; Jiang, W.; Jin, X.; Kong, J.; Lei, S. J.; Li, S.; Li, X.; Li, W. L.; Li, Y.; Liang, Y. F.; Liang, Y. M.; Liao, N. H.; Liu, H.; Liu, J.; Liu, S. B.; Liu, W. Q.; Liu, Y.; Loparco, F.; Ma, M.; Ma, P. X.; Ma, S. Y.; Ma, T.; Ma, X. Q.; Ma, X. Y.; Marsella, G.; Mazziotta, M. N.; Mo, D.; Niu, X. Y.; Peng, X. Y.; Peng, W. X.; Qiao, R.; Rao, J. N.; Salinas, M. M.; Shang, G. Z.; H. Shen, W.; Shen, Z. Q.; Shen, Z. T.; Song, J. X.; Su, H.; Su, M.; Sun, Z. Y.; Surdo, A.; Teng, X. J.; Tian, X. B.; Tykhonov, A.; Vagelli, V.; Vitillo, S.; Wang, C.; Wang, H.; Wang, H. Y.; Wang, J. Z.; Wang, L. G.; Wang, Q.; Wang, S.; Wang, X. H.; Wang, X. L.; Wang, Y. F.; Wang, Y. P.; Wang, Y. Z.; Wen, S. C.; Wang, Z. M.; Wei, D. M.; Wei, J. J.; Wei, Y. F.; Wu, D.; Wu, J.; Wu, L. B.; Wu, S. S.; Wu, X.; Xi, K.; Xia, Z. Q.; Xin, Y. L.; Xu, H. T.; Xu, Z. L.; Xu, Z. Z.; Xue, G. F.; Yang, H. B.; Yang, P.; Yang, Y. Q.; Yang, Z. L.; Yao, H. J.; Yu, Y. H.; Yuan, Q.; Yue, C.; Zang, J. J.; Zhang, C.; Zhang, D. L.; Zhang, F.; Zhang, J. B.; Zhang, J. Y.; Zhang, J. Z.; Zhang, L.; Zhang, P. F.; Zhang, S. X.; Zhang, W. Z.; Zhang, Y.; Zhang, Y. J.; Zhang, Y. Q.; Zhang, Y. L.; Zhang, Y. P.; Zhang, Z.; Zhang, Z. Y.; Zhao, H.; Zhao, H. Y.; Zhao, X. F.; Zhou, C. Y.; Zhou, Y.; Zhu, X.; Zhu, Y.; Zimmer, S.

    2017-12-01

    High-energy cosmic-ray electrons and positrons (CREs), which lose energy quickly during their propagation, provide a probe of Galactic high-energy processes and may enable the observation of phenomena such as dark-matter particle annihilation or decay. The CRE spectrum has been measured directly up to approximately 2 teraelectronvolts in previous balloon- or space-borne experiments, and indirectly up to approximately 5 teraelectronvolts using ground-based Cherenkov γ-ray telescope arrays. Evidence for a spectral break in the teraelectronvolt energy range has been provided by indirect measurements, although the results were qualified by sizeable systematic uncertainties. Here we report a direct measurement of CREs in the energy range 25 gigaelectronvolts to 4.6 teraelectronvolts by the Dark Matter Particle Explorer (DAMPE) with unprecedentedly high energy resolution and low background. The largest part of the spectrum can be well fitted by a ‘smoothly broken power-law’ model rather than a single power-law model. The direct detection of a spectral break at about 0.9 teraelectronvolts confirms the evidence found by previous indirect measurements, clarifies the behaviour of the CRE spectrum at energies above 1 teraelectronvolt and sheds light on the physical origin of the sub-teraelectronvolt CREs.

  8. Detection of the Magnetic Easy Direction in Steels Using Induced Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Edgard M. Silva

    2016-12-01

    Full Text Available Conventional manufacturing processes cause plastic deformation that leads to magnetic anisotropy in processed materials. A deeper understanding of materials characterization under rotational magnetization enables engineers to optimize the overall volume, mass, and performance of devices such as electrical machines in industry. Therefore, it is important to find the magnetic easy direction of the magnetic domains in a simple and straightforward manner. The Magnetic easy direction can be obtained through destructive tests such as the Epstein frame method and the Single Sheet Tester by taking measurements in regions of irreversible magnetization usually called domains. In the present work, samples of rolled SAE 1045 steel (formed by perlite and ferrite microstructures were submitted to induced magnetic fields in the reversibility region of magnetic domains to detect the magnetic easy direction. The magnetic fields were applied to circular samples with different thicknesses and angles varying from 0° to 360° with steps of 45°. A square sample with a fixed thickness was also tested. The results showed that the proposed non-destructive approach is promising to evaluate the magnetic anisotropy in steels independently of the geometry of the sample. The region studied presented low induction losses and was affected by magnetic anisotropy, which did not occur in other works that only took into account regions of high induction losses.

  9. Computer-aided detection in direct digital full-field mammography: initial results

    Energy Technology Data Exchange (ETDEWEB)

    Baum, F.; Fischer, U.; Obenauer, S.; Grabbe, E. [Department of Radiology, Georg-August-Universitaet Goettingen, Robert-Koch-Strasse 40, 37075 Goettingen (Germany)

    2002-12-01

    For the first time, full-field digital mammography (FFDM) allows computer-aided detection (CAD) analysis of directly acquired digital image data. The purpose of this study was to evaluate a CAD system in patients with histologically correlated breast cancer depicted with FFDM. Sixty-three cases of histologically proven breast cancer detected with FFDM (Senographe 2000D, GE Medical Systems, Buc, France) were analyzed using a CAD system (Image Checker V2.3, R2 Technology, Los Altos, Calif.). Fourteen of these malignancies were characterized as microcalcifications, 37 as masses, and 12 as both. The mammographic findings were categorized as BI-RADS 3 (n=5), BI-RADS 4 (n=17) and BI-RADS 5 (n=40). The sensitivity for malignant lesions and the rate of false-positive marks per image were calculated. The sensitivity and its 95% confidence interval (CI) were estimated. The sensitivity of the CAD R2 system in breast cancer seen on FFDM was 89% for microcalcifications [CI{sub 95%}=(70%; 98%)] and 81% for masses [CI{sub 95%}=(67%; 91%)]. As expected, the detection rate was higher in lesions categorized as BI-RADS 5 (37 of 40) compared with lesions categorized as BI-RADS 4 (11 of 17). In the group categorized as BI-RADS 3 the detection rate was 4 of 5 lesions; however, this group was very small. The rate of false-positive marks was 0.35 microcalcification marks/image and 0.26 mass marks/image. The overall rate of false-positive marks was 0.61 per image. CAD based on FFDM provides an optimized work flow. Results are equivalent to the results reported for CAD analysis of secondarily digitized image data. Sensitivity for microcalcifications is acceptable and for masses is low. The number of false-positive marks per image should be reduced. (orig.)

  10. Laser Noise and its Impact on the Performance of Intensity-Modulation with Direct-Detection Analog Photonic Links

    National Research Council Canada - National Science Library

    Urick, Vincent J; Devgan, Preetpaul S; McKinney, Jason D; Dexter, James L

    2007-01-01

    The equations for radio-frequency gain, radio-frequency noise figure, compression dynamic range and spurious-free dynamic range are derived for an analog photonic link employing intensity modulation and direct detection...

  11. Synergistic effect of combined transcranial direct current stimulation/constraint-induced movement therapy in children and young adults with hemiparesis: study protocol

    National Research Council Canada - National Science Library

    Gillick, Bernadette; Menk, Jeremiah; Mueller, Bryon; Meekins, Gregg; Krach, Linda E; Feyma, Timothy; Rudser, Kyle

    2015-01-01

    ...) is recognized as an effective hemiparesis rehabilitation intervention. Transcranial direct current stimulation as an adjunct treatment to CIMT may potentiate neuroplastic responses and improve motor function...

  12. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Phuong Dinh Tam; Mai Anh Tuan [International Training Institute for Materials Science (Viet Nam); Tran Trung [Department of Electrochemistry, Hung-Yen University of Technology and Education (Viet Nam); Nguyen Duc Chien [Institute of Engineering Physics, Hanoi University of Technology, 1 Dai Co Viet Road, Hanoi (Viet Nam)], E-mail: tr_trunghut@yahoo.com

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  13. Sparse Volterra model based on optical single side-band NPAM-4 direct-detection system

    Science.gov (United States)

    Ying, Hao; Zhu, Mingyue; Zhang, Jing; Yi, Xingwen; Song, Yang; Qiu, Kun

    2018-01-01

    Signal-to-signal beating interference (SSBI) is one of the main drawbacks in direct-detection based optical transmission systems. Volterra filter is a common equalization method to mitigate the nonlinear distortion. However, the computational complexity may be unacceptable as the transmission capacity increases. In this paper, we propose a sparse Volterra model combining the feed forward equalization (FFE) and higher order terms of a modified Volterra filter with Schmidt orthogonal searching to mitigate the linear and nonlinear interference and reduce the complexity significantly in an optical single-side band (SSB) Nyquist pulse-shaped four-level pulse amplitude (NPAM-4) system. The experimental results show that the sparse Volterra filter and full Volterra filter have comparable performance, but the former only needs half kernels of the latter.

  14. Direct detection of dark matter in models with a light Z'

    DEFF Research Database (Denmark)

    Frandsen, Mads Toudal; Kahlhoefer, Felix; Sarkar, Subir

    2011-01-01

    We discuss the direct detection signatures of dark matter interacting with nuclei via a Z' mediator, focussing on the case where both the dark matter and the $Z'$ have mass of a few GeV. Isospin violation (i.e. different couplings to protons and neutrons) arises naturally in this scenario....... In particular it is possible to reconcile the preferred parameter regions inferred from the observed DAMA and CoGeNT modulations with the bounds from XENON100, which requires f_n/f_p = -0.7. Moreover, the Z' mediator can also yield a large spin-dependent cross-section which could contribute to the DAMA signal......, while the spin-independent cross-section is adequate to explain the CoGeNT signal....

  15. Investigation of PMD in direct-detection optical OFDM with zero padding.

    Science.gov (United States)

    Li, Xiang; Alphones, Arokiaswami; Zhong, Wen-De; Yu, Changyuan

    2013-09-09

    We investigate the polarization-mode dispersion (PMD) effect of zero padding OFDM (ZP-OFDM) in direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) systems. We first study the conventional equalization method for ZP-OFDM. Then an equalization method based on sorted QR decomposition is proposed to further improve the performance. It is found that the performance improvement of ZP-OFDM is due to the frequency domain oversampling (FDO) induced inter-carrier interference (ICI). Numerical simulation results show that compared with cyclic prefix OFDM (CP-OFDM), ZP-OFDM has a significantly higher tolerance to PMD in DDO-OFDM systems when the channel spectral nulls occur at certain differential group delay (DGD) values.

  16. Directed Design of Experiments for Validating Probability of Detection Capability of a Testing System

    Science.gov (United States)

    Generazio, Edward R. (Inventor)

    2012-01-01

    A method of validating a probability of detection (POD) testing system using directed design of experiments (DOE) includes recording an input data set of observed hit and miss or analog data for sample components as a function of size of a flaw in the components. The method also includes processing the input data set to generate an output data set having an optimal class width, assigning a case number to the output data set, and generating validation instructions based on the assigned case number. An apparatus includes a host machine for receiving the input data set from the testing system and an algorithm for executing DOE to validate the test system. The algorithm applies DOE to the input data set to determine a data set having an optimal class width, assigns a case number to that data set, and generates validation instructions based on the case number.

  17. Application of order cyclostationary demodulation to damage detection in a direct-driven wind turbine bearing

    Science.gov (United States)

    Liu, Xiaofeng; Bo, Lin; Peng, Chang

    2014-02-01

    This paper presents a method of fault detection and isolation for a direct-driven wind turbine (DWT) bearing. Computed order tracking is employed to convert the non-stationary envelope signal in the time domain into a quasi-stationary signal in the angular domain by even-angle resampling. Cyclostationary demodulation is then utilized to expose the orders related to fault characteristics in the demodulation spectrum. In order to realize the automatic fault diagnosis and emit a stable alarm about bearing damage, the peak value of the demodulation spectrum is scaled and compared to a defined threshold. The significant advantage of the proposed method is the implementation of an automatic algorithm for DWT bearing diagnostics under randomly varying speed and highly alternating load. Practical applications are provided to show that the proposed approach is able to achieve reliable failure warning in the bearing condition monitoring of a DWT.

  18. 2-Micron Pulsed Direct Detection IPDA Lidar for Atmospheric CO2 Measurement

    Science.gov (United States)

    Yu, Jirong; Petros, Mulugeta; Refaat, Tamer; Reithmaier, Karl; Remus, Ruben; Singh, Upendra; Johnson, Will; Boyer, Charlie; Fay, James; Johnston, Susan; hide

    2014-01-01

    A 2-micron high energy, pulsed Integrated Path Differential Absorption (IPDA) lidar has been developed for atmospheric CO2 measurements. Development of this lidar heavily leverages the 2-micron laser technologies developed in LaRC over the last decade. The high pulse energy, direct detection lidar operating at CO2 2-micron absorption band provides an alternate approach to measure CO2 concentrations. This new 2-micron pulsed IPDA lidar has been flown in spring of this year for total ten flights with 27 flight hours. It is able to make measurements of the total amount of atmospheric CO2 from the aircraft to the ground or cloud. It is expected to provide high-precision measurement capability by unambiguously eliminating contamination from aerosols and clouds that can bias the IPDA measurement.

  19. Inelastic Boosted Dark Matter at Direct Detection Experiments arXiv

    CERN Document Server

    Giudice, Gian F.; Park, Jong-Chul; Shin, Seodong

    We explore a novel class of multi-particle dark sectors, called Inelastic Boosted Dark Matter (iBDM). These models are constructed by combining properties of particles that scatter off matter by making transitions to heavier states (Inelastic Dark Matter) with properties of particles that are produced with a large Lorentz boost in annihilation processes in the galactic halo (Boosted Dark Matter). This combination leads to new signals that can be observed at ordinary direct detection experiments, but require unconventional searches for energetic recoil electrons in coincidence with displaced multi-track events. Related experimental strategies can also be used to probe MeV-range boosted dark matter via their interactions with electrons inside the target material.

  20. First direct detection limits on sub-GeV dark matter from XENON10.

    Science.gov (United States)

    Essig, Rouven; Manalaysay, Aaron; Mardon, Jeremy; Sorensen, Peter; Volansky, Tomer

    2012-07-13

    The first direct detection limits on dark matter in the MeV to GeV mass range are presented, using XENON10 data. Such light dark matter can scatter with electrons, causing ionization of atoms in a detector target material and leading to single- or few-electron events. We use 15  kg day of data acquired in 2006 to set limits on the dark-matter-electron scattering cross section. The strongest bound is obtained at 100 MeV where σ(e)dark-matter masses between 20 MeV and 1 GeV are bounded by σ(e)dark-matter candidates with masses well below the GeV scale.

  1. Effect of gravitational focusing on annual modulation in dark-matter direct-detection experiments.

    Science.gov (United States)

    Lee, Samuel K; Lisanti, Mariangela; Peter, Annika H G; Safdi, Benjamin R

    2014-01-10

    The scattering rate in dark-matter direct-detection experiments should modulate annually due to Earth's orbit around the Sun. The rate is typically thought to be extremized around June 1, when the relative velocity of Earth with respect to the dark-matter wind is maximal. We point out that gravitational focusing can alter this modulation phase. Unbound dark-matter particles are focused by the Sun's gravitational potential, affecting their phase-space density in the lab frame. Gravitational focusing can result in a significant overall shift in the annual-modulation phase, which is most relevant for dark matter with low scattering speeds. The induced phase shift for light O(10)  GeV dark matter may also be significant, depending on the threshold energy of the experiment.

  2. Hypercharged dark matter and direct detection as a probe of reheating.

    Science.gov (United States)

    Feldstein, Brian; Ibe, Masahiro; Yanagida, Tsutomu T

    2014-03-14

    The lack of new physics at the LHC so far weakens the argument for TeV scale thermal dark matter. On the other hand, heavier, nonthermal dark matter is generally difficult to test experimentally. Here we consider the interesting and generic case of hypercharged dark matter, which can allow for heavy dark matter masses without spoiling testability. Planned direct detection experiments will be able to see a signal for masses up to an incredible 1010  GeV, and this can further serve to probe the reheating temperature up to about 109  GeV, as determined by the nonthermal dark matter relic abundance. The Z-mediated nature of the dark matter scattering may be determined in principle by comparing scattering rates on different detector nuclei, which in turn can reveal the dark matter mass. We will discuss the extent to which future experiments may be able to make such a determination.

  3. Electronic polarization-division demultiplexing based on digital signal processing in intensity-modulation direct-detection optical communication systems.

    Science.gov (United States)

    Kikuchi, Kazuro

    2014-01-27

    We propose a novel configuration of optical receivers for intensity-modulation direct-detection (IM · DD) systems, which can cope with dual-polarization (DP) optical signals electrically. Using a Stokes analyzer and a newly-developed digital signal-processing (DSP) algorithm, we can achieve polarization tracking and demultiplexing in the digital domain after direct detection. Simulation results show that the power penalty stemming from digital polarization manipulations is negligibly small.

  4. Prospects for determining the particle/antiparticle nature of WIMP dark matter with direct detection experiments

    Science.gov (United States)

    Kavanagh, Bradley J.; Queiroz, Farinaldo S.; Rodejohann, Werner; Yaguna, Carlos E.

    2017-10-01

    It was recently pointed out that direct detection signals from at least three different targets may be used to determine whether the Dark Matter (DM) particle is different from its antiparticle. In this work, we examine in detail the feasibility of this test under different conditions, motivated by proposals for future detectors. Specifically, we perform likelihood fits to mock data under the hypotheses that the DM particle is identical to or different from its antiparticle, and determine the significance with which the former can be rejected in favor of the latter. In our analysis, we consider 3 different values of the DM mass (50 GeV, 300 GeV, 1 TeV) and 4 different experimental ensembles, each consisting of at least 3 different targets — Xe and Ar plus one among the following: Si, Ge, CaWO4, or Ge/CaWO4. For each of these experimental ensembles and each DM mass, the expected discrimination significance is calculated as a function of the DM-nucleon couplings. In the best case scenario, the discrimination significance can exceed O(3σ ) for three of the four ensembles considered, reaching O(5σ ) at special values of the DM-nucleon couplings. For the ensemble including Si, O(5σ ) significance can be achieved for a range of DM masses and over a much wider range of DM-nucleon couplings, highlighting the need for a variety of experimental targets in order to determine the DM properties. These results show that future direct detection signals could be used to exclude, at a statistically significant level, a Majorana or a real DM particle, giving a critical clue about the identity of the Dark Matter.

  5. Direct detection of collagenous proteins by fluorescently labeled collagen mimetic peptides

    Science.gov (United States)

    Li, Yang; Ho, Daniel; Meng, Huan; Chan, Tania R.; An, Bo; Yu, Hanry; Brodsky, Barbara; Jun, Albert S.; Yu, S. Michael

    2013-01-01

    Although fibrous collagens are major structural components of extracellular matrix in mammals, collagen overproduction is associated with many human diseases including cancers and fibrosis. Collagen is typically identified in biomedical research by western blot and immunohistochemistry; however anti-collagen antibodies employed in these analyses are difficult to prepare and their affinities to collagen can diminish if collagen becomes denatured during analyses. Previously, we discovered that single-stranded collagen mimetic peptides [CMPs, sequence: (GlyProHyp)9] can bind to denatured collagen chains by triple helix hybridization. Here we present collagen-specific staining methods using simple CMPs conjugated to common fluorophores (e.g. carboxyfluorescein), which allow direct detection of collagens and collagen-like proteins in SDS-PAGE and in various mammalian tissue sections. By directly staining SDS-PAGE gels with fluorescently labeled CMPs, both intact (type I, II, and IV) and MMP-1 cleaved collagen (type I) chains as well as complement factor C1q were detected. Collagen bands containing as little as 5 ng were optically visualized while no staining was observed for fibronectin, laminin, and a collection of proteins from mammalian cell lysate. The CMP was unable to stain collagen-like bacterial protein which contains numerous charged amino acids that are believed to stabilize triple helix in place of Hyp. We also show that fluorescently labeled CMPs can specifically visualize collagens in fixed tissue sections (e.g., skin, cornea, and bone) more effectively than anti-collagen I antibody, and allow facile identification of pathologic conditions in fibrotic liver tissues. PMID:23253177

  6. Direct sequencing of mitochondrial DNA detects highly divergent haplotypes in blue marlin (Makaira nigricans).

    Science.gov (United States)

    Finnerty, J R; Block, B A

    1992-06-01

    We were able to differentiate between species of billfish (Istiophoridae family) and to detect considerable intraspecific variation in the blue marlin (Makaira nigricans) by directly sequencing a polymerase chain reaction (PCR)-amplified, 612-bp fragment of the mitochondrial cytochrome b gene. Thirteen variable nucleotide sites separated blue marlin (n = 26) into 7 genotypes. On average, these genotypes differed by 5.7 base substitutions. A smaller sample of swordfish from an equally broad geographic distribution displayed relatively little intraspecific variation, with an average of 1.3 substitutions separating different genotypes. A cladistic analysis of blue marlin cytochrome b variants indicates two major divergent evolutionary lines within the species. The frequencies of these two major evolutionary lines differ significantly between Atlantic and Pacific ocean basins. This finding is important given that the Atlantic stocks of blue marlin are considered endangered. Migration from the Pacific can help replenish the numbers of blue marlin in the Atlantic, but the loss of certain mitochondrial DNA haplotypes in the Atlantic due to overfishing probably could not be remedied by an influx of Pacific fish because of their absence in the Pacific population. Fishery management strategies should attempt to preserve the genetic diversity within the species. The detection of DNA sequence polymorphism indicates the utility of PCR technology in pelagic fishery genetics.

  7. Detection of time delays and directional interactions based on time series from complex dynamical systems

    Science.gov (United States)

    Ma, Huanfei; Leng, Siyang; Tao, Chenyang; Ying, Xiong; Kurths, Jürgen; Lai, Ying-Cheng; Lin, Wei

    2017-07-01

    Data-based and model-free accurate identification of intrinsic time delays and directional interactions is an extremely challenging problem in complex dynamical systems and their networks reconstruction. A model-free method with new scores is proposed to be generally capable of detecting single, multiple, and distributed time delays. The method is applicable not only to mutually interacting dynamical variables but also to self-interacting variables in a time-delayed feedback loop. Validation of the method is carried out using physical, biological, and ecological models and real data sets. Especially, applying the method to air pollution data and hospital admission records of cardiovascular diseases in Hong Kong reveals the major air pollutants as a cause of the diseases and, more importantly, it uncovers a hidden time delay (about 30-40 days) in the causal influence that previous studies failed to detect. The proposed method is expected to be universally applicable to ascertaining and quantifying subtle interactions (e.g., causation) in complex systems arising from a broad range of disciplines.

  8. Photoacoustic spectroscopy applied to the direct detection of bioactive compounds in Agaricus brasiliensis mycelium.

    Science.gov (United States)

    de Oliveira, Fernando Maia; Mokochinski, João Benhur; Reyes Torres, Yohandra; Dalla Santa, Herta Stutz; González-Borrero, Pedro Pablo

    2017-12-05

    This paper describes the application of the photoacoustic spectroscopic (PAS) for detection of bioactive compounds in Agaricus brasiliensis mycelium. The mycelium was cultivated by solid-state fermentation and by submerged fermentation. Vegetal residues from food industry were used as substrates for fermentation: apple pomace (Malus domestica), wheat (Triticum aestivum), peel and pomace of pineapple (Ananas comosus), malt (Hordeum vulgare) and grape pomace (Vitis vinifera). Dry and ground samples of biomass were directly put into the PA cell. The optical absorption spectra indicated the existence of three main absorption bands: one around 280 nm related to phytosterols (ergosterol), phenolic acids, flavonoids and aromatic amino acids, another at 340 nm, due to phenolic and flavonoid compounds, and the third one at around 550 nm associated with anthocyanins and anthocyanidins. A correlation between the PA signal and the total phenolic content was satisfactory, as well as for the analyzed spectrum region (270 nm up to 1000 nm), using multivariate methods. Our results indicated that PA technique may be considered as an analytical tool to quickly detect bioactive compounds in mushrooms without the need of sample pretreatment.

  9. Evaluation of the possibility of detecting benzenic pollutants by direct spectrophotometry on PDMS solid sorbent

    Energy Technology Data Exchange (ETDEWEB)

    Lamotte, Michel; Violet, Philippe Fornier de; Garrigues, Philippe [Lab. de Physico-Toxico-Chimie, Universite de Bordeaux 1, Talence (France); Hardy, Michel [Supelco Sigma-Aldrich, Saint Quentin Fallavier (France)

    2002-01-01

    Solid-phase extraction has become one of the most commonly used techniques for preconcentration of analytes from environmental samples. In the standard use of solid sorbent phases the extracted pollutants are subsequently eluted with a suitable organic solvent before chromatographic analysis. An alternative to this procedure is analysis of the adsorbed and concentrated pollutants by direct application of a spectroscopic method (fluorimetry or absorptiometry) to the phase. Although this method cannot be expected to give results as precise as those given by chromatographic methods, it might have valuable applications, particularly for ''on site'' pollution monitoring. This paper reports an evaluation of the capability of the method for the spectrophotometric detection of BTX (benzene, toluene, xylenes) in aqueous media and in contaminated atmospheres, with polydimethylsiloxane (PDMS) as sorbent. The tests performed, with the estimated detection limits, indicate that the method is relatively simple and easy to operate and sensitive enough for application to the monitoring of pollution both in water and in air in an industrial ambient atmosphere. (orig.)

  10. Direct electrochemical sensor for label-free DNA detection based on zero current potentiometry.

    Science.gov (United States)

    Wu, Nai-ying; Gao, Wei; He, Xu-lun; Chang, Zhu; Xu, Mao-tian

    2013-01-15

    A direct electrochemical DNA biosensor based on zero current potentiometry was fabricated by immobilization of ssDNA onto gold nanoparticles (AuNPs) coated pencil graphite electrode (PGE). One ssDNA/AuNPs/PGE was connected in series between clips of working and counter electrodes of a potentiostat, and then immersed into the solution together with a reference electrode, establishing a novel DNA biosensor for specific DNA detection. The variation of zero current potential difference (ΔE(zcp)) before and after hybridization of the self-assembled probe DNA with the target DNA was used as a signal to characterize and quantify the target DNA sequence. The whole DNA biosensor fabrication process was characterized by cyclic voltammetry and electrochemical impedance spectroscopy with the use of ferricyanide as an electrochemical redox indicator. Under the optimized conditions, ΔE(zcp) was linear with the concentrations of the complementary target DNA in the range from 10nM to 1μM, with a detection limit of 6.9nM. The DNA biosensor showed a good reproducibility and selectivity. Prepared DNA biosensor is facile and sensitive, and it eliminates the need of using exogenous reagents to monitor the oligonucleotides hybridization. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Layered ACO-OFDM for intensity-modulated direct-detection optical wireless transmission.

    Science.gov (United States)

    Wang, Qi; Qian, Chen; Guo, Xuhan; Wang, Zhaocheng; Cunningham, David G; White, Ian H

    2015-05-04

    Layered asymmetrically clipped optical orthogonal frequency division multiplexing (ACO-OFDM) with high spectral efficiency is proposed in this paper for optical wireless transmission employing intensity modulation with direct detection. In contrast to the conventional ACO-OFDM, which only utilizes odd subcarriers for modulation, leading to an obvious spectral efficiency loss, in layered ACO-OFDM, the subcarriers are divided into different layers and modulated by different kinds of ACO-OFDM, which are combined for simultaneous transmission. In this way, more subcarriers are used for data transmission and the spectral efficiency is improved. An iterative receiver is also proposed for layered ACO-OFDM, where the negative clipping distortion of each layer is subtracted once it is detected so that the signals from different layers can be recovered. Theoretical analysis shows that the proposed scheme can improve the spectral efficiency by up to 2 times compared with conventional ACO-OFDM approaches with the same modulation order. Meanwhile, simulation results confirm a considerable signal-to-noise ratio gain over ACO-OFDM at the same spectral efficiency.

  12. Direct-detection optical OFDM superchannel for long-reach PON using pilot regeneration.

    Science.gov (United States)

    Hu, Rong; Yang, Qi; Xiao, Xiao; Gui, Tao; Li, Zhaohui; Luo, Ming; Yu, Shaohua; You, Shanhong

    2013-11-04

    We demonstrate a novel long-reach PON downstream scheme based on the regenerated pilot assisted direct-detection optical orthogonal frequency division multiplexing (DDO-OFDM) superchannel transmission. We use the optical comb source to form DDO-OFDM superchannel, and reserve the center carrier as a seed pilot. The seed pilot is further tracked and reused to generate multiple optical carriers at the local exchange. Each regenerated pilot carrier is selected to beat with an adjacent OFDM sub-band at ONU, so that the electrical bandwidth limitation can be much released compared to the conventional DDO-OFDM superchannel detection. With the proposed proof-of-concept architecture, we experimentally demonstrated a 116.7 Gb/s superchannel OFDM-PON system with transmission reach of 100 km, and 1:64 splitting ratio. We analyze the impact of carrier-to-sideband power ratio (CSPR) on system performance. The experiment result shows that, 5 dB power margin is still remained at ONU using such technique.

  13. Direct In Vivo Electrochemical Detection of Haemoglobin in Red Blood Cells

    Science.gov (United States)

    Toh, Rou Jun; Peng, Weng Kung; Han, Jongyoon; Pumera, Martin

    2014-08-01

    The electrochemical behavior of iron ion in haemoglobin provides insight to the chemical activity in the red blood cell which is important in the field of hematology. Herein, the detection of haemoglobin in human red blood cells on glassy carbon electrode (GC) was demonstrated. Red blood cells or raw blood cells was immobilized on a glassy carbon electrode surface with Nafion films employed to sandwich the layer of biological sample firmly on the electrode surface. Cyclic voltammetry (CV) analyses revealed a well-defined reduction peak for haemoglobin at about -0.30 V (vs. Ag/AgCl) at the red blood cell (GC-Nf-RBC-3Nf) and blood (GC-Nf-B-3Nf) film modified GCE in a pH 3.5 phosphate buffer solution. We further demonstrated that the complex biological conditions of a human red blood cell displayed no interference with the detection of haemoglobin. Such findings shall have an implication on the possibilities of studying the electrochemical behaviour of haemoglobin directly from human blood, for various scientific and clinical purposes.

  14. Identification of Dark Matter particles with LHC and direct detection data

    CERN Document Server

    Bertone, Gianfranco; Fornasa, Mattia; de Austri, Roberto Ruiz; Trotta, Roberto

    2010-01-01

    Dark matter (DM) is currently searched for with a variety of detection strategies. Accelerator searches are particularly promising, but even if Weakly Interacting Massive Particles (WIMPs) are found at the Large Hadron Collider (LHC), it will be difficult to prove that they constitute the bulk of the DM in the Universe. We show that a significantly better reconstruction of the DM properties can be obtained with a combined analysis of LHC and direct detection (DD) data, by making a simple Ansatz on the WIMP local density, i.e. by assuming that the local density scales with the cosmological relic abundance. We demonstrate this method in an explicit example in the context of a 24-parameter supersymmetric model, with a neutralino LSP in the stau co-annihilation region. Our results show that future ton-scale DD experiments will allow to break degeneracies in the SUSY parameter space and achieve a significantly better reconstruction of the neutralino composition and its relic density than with LHC data alone.

  15. Detection and Quantization of Bearing Fault in Direct Drive Wind Turbine via Comparative Analysis

    Directory of Open Access Journals (Sweden)

    Wei Teng

    2016-01-01

    Full Text Available Bearing fault is usually buried by intensive noise because of the low speed and heavy load in direct drive wind turbine (DDWT. Furthermore, varying wind speed and alternating loads make it difficult to quantize bearing fault feature that indicates the degree of deterioration. This paper presents the application of multiscale enveloping spectrogram (MuSEnS and cepstrum to detect and quantize bearing fault in DDWT. MuSEnS can manifest fault modulation information adaptively based on the capacity of complex wavelet transform, which enables the weak bearing fault in DDWT to be detected. Cepstrum can calculate the average interval of periodic components in frequency domain and is suitable for quantizing bearing fault feature under varying operation conditions due to the logarithm weight on the power spectrum. Through comparing a faulty DDWT with a normal one, the bearing fault feature is evidenced and the quantization index is calculated, which show a good application prospect for condition monitoring and fault diagnosis in real DDWT.

  16. Layer-by-layer assembly of functionalized reduced graphene oxide for direct electrochemistry and glucose detection.

    Science.gov (United States)

    Mascagni, Daniela Branco Tavares; Miyazaki, Celina Massumi; da Cruz, Nilson Cristino; de Moraes, Marli Leite; Riul, Antonio; Ferreira, Marystela

    2016-11-01

    We report an electrochemical glucose biosensor made with layer-by-layer (LbL) films of functionalized reduced graphene oxide (rGO) and glucose oxidase (GOx). The LbL assembly using positively and negatively charged rGO multilayers represents a simple approach to develop enzymatic biosensors. The electron transport properties of graphene were combined with the specificity provided by the enzyme. rGO was obtained and functionalized using chemical methods, being positively charged with poly(diallyldimethylammonium chloride) to form GPDDA, and negatively charged with poly(styrene sulfonate) to form GPSS. Stable aqueous dispersions of GPDDA and GPSS are easily obtained, enabling the growth of LbL films on various solid supports. The use of graphene in the immobilization of GOx promoted Direct Electron Transfer, which was evaluated by Cyclic Voltammetry. Amperometric measurements indicated a detection limit of 13.4μmol·L(-1) and sensitivity of 2.47μA·cm(-2)·mmol(-1)·L for glucose with the (GPDDA/GPSS)1/(GPDDA/GOx)2 architecture, whose thickness was 19.80±0.28nm, as determined by Surface Plasmon Resonance (SPR). The sensor may be useful for clinical analysis since glucose could be detected even in the presence of typical interfering agents and in real samples of a lactose-free milk and an electrolyte solution to prevent dehydration. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Direction detection thresholds of passive self-motion in artistic gymnasts.

    Science.gov (United States)

    Hartmann, Matthias; Haller, Katia; Moser, Ivan; Hossner, Ernst-Joachim; Mast, Fred W

    2014-04-01

    In this study, we compared direction detection thresholds of passive self-motion in the dark between artistic gymnasts and controls. Twenty-four professional female artistic gymnasts (ranging from 7 to 20 years) and age-matched controls were seated on a motion platform and asked to discriminate the direction of angular (yaw, pitch, roll) and linear (leftward-rightward) motion. Gymnasts showed lower thresholds for the linear leftward-rightward motion. Interestingly, there was no difference for the angular motions. These results show that the outstanding self-motion abilities in artistic gymnasts are not related to an overall higher sensitivity in self-motion perception. With respect to vestibular processing, our results suggest that gymnastic expertise is exclusively linked to superior interpretation of otolith signals when no change in canal signals is present. In addition, thresholds were overall lower for the older (14-20 years) than for the younger (7-13 years) participants, indicating the maturation of vestibular sensitivity from childhood to adolescence.

  18. Direct Detection of Protein Biomarkers in Human Fluids Using Site-Specific Antibody Immobilization Strategies

    Directory of Open Access Journals (Sweden)

    Maria Soler

    2014-01-01

    Full Text Available Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  19. Soft Concurrent Constraint Programming

    OpenAIRE

    Bistarelli, S.; Montanari, U.; Rossi, F.

    2002-01-01

    Soft constraints extend classical constraints to represent multiple consistency levels, and thus provide a way to express preferences, fuzziness, and uncertainty. While there are many soft constraint solving formalisms, even distributed ones, by now there seems to be no concurrent programming framework where soft constraints can be handled. In this paper we show how the classical concurrent constraint (cc) programming framework can work with soft constraints, and we also propose an extension ...

  20. Optimum beamforming subject to multiple linear constraints

    Science.gov (United States)

    Steele, A. K.

    1980-09-01

    Optimum beamformers with a single look direction constraint can suffer from signal suppression problems when the optimum weights are calculated from the inverse of the signal-plus-noise cross-spectral matrix. Signal suppression occurs when the beam steer direction does not exactly correspond to the signal direction and this can occur if the number of fixed beams is small. The use of multiple linear constraints upon the optimum weights reduces this signal suppression. Multiple directional constraints can lead to ill-conditioned equations. However, it is shown that the limiting solutions of multiple directional constraints are multiple derivative contraints and these do not lead to ill-conditioned equations. The ability of various derivative constraints to prevent signal suppression is analyzed quantitatively.

  1. High resolution biomedical imaging system with direct detection of x-rays via a charge coupled device

    Science.gov (United States)

    Atac, Muzaffer; McKay, Timothy A.

    1998-01-01

    An imaging system is provided for direct detection of x-rays from an irradiated biological tissue. The imaging system includes an energy source for emitting x-rays toward the biological tissue and a charge coupled device (CCD) located immediately adjacent the biological tissue and arranged transverse to the direction of irradiation along which the x-rays travel. The CCD directly receives and detects the x-rays after passing through the biological tissue. The CCD is divided into a matrix of cells, each of which individually stores a count of x-rays directly detected by the cell. The imaging system further includes a pattern generator electrically coupled to the CCD for reading a count from each cell. A display device is provided for displaying an image representative of the count read by the pattern generator from the cells of the CCD.

  2. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry........ The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result...

  3. Direct Detection of Erythromycin-Resistant Bordetella pertussis in Clinical Specimens by PCR.

    Science.gov (United States)

    Wang, Zengguo; Han, Ruijun; Liu, Ying; Du, Quanli; Liu, Jifeng; Ma, Chaofeng; Li, Hengxin; He, Qiushui; Yan, Yongping

    2015-11-01

    Resistance of Bordetella pertussis to erythromycin has been increasingly reported. We developed an allele-specific PCR method for rapid detection of erythromycin-resistant B. pertussis directly from nasopharyngeal (NP) swab samples submitted for diagnostic PCR. Based on the proven association of erythromycin resistance with the A2047G mutation in the 23S rRNA of B. pertussis, four primers, two of which were designed to be specific for either the wild-type or the mutant allele, were used in two different versions of the allele-specific PCR assay. The methods were verified with results obtained by PCR-based sequencing of 16 recent B. pertussis isolates and 100 NP swab samples submitted for diagnostic PCR. The detection limits of the two PCR assays ranged from 10 to 100 fg per reaction for both erythromycin-susceptible and -resistant B. pertussis. Two amplified fragments of each PCR, of 286 and 112 bp, respectively, were obtained from a mutant allele of the isolates and/or NP swab samples containing B. pertussis DNAs. For the wild-type allele, only a 286-bp fragment was visible when the allele-specific PCR assay 1 was performed. No amplification was found when a number of non-Bordetella bacterial pathogens and NP swab samples that did not contain the DNAs of B. pertussis were examined. This assay can serve as an alternative for PCR-based sequencing, especially for local laboratories in resource-poor countries. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Goal-Directed Modulation of Neural Memory Patterns: Implications for fMRI-Based Memory Detection.

    Science.gov (United States)

    Uncapher, Melina R; Boyd-Meredith, J Tyler; Chow, Tiffany E; Rissman, Jesse; Wagner, Anthony D

    2015-06-03

    Remembering a past event elicits distributed neural patterns that can be distinguished from patterns elicited when encountering novel information. These differing patterns can be decoded with relatively high diagnostic accuracy for individual memories using multivoxel pattern analysis (MVPA) of fMRI data. Brain-based memory detection--if valid and reliable--would have clear utility beyond the domain of cognitive neuroscience, in the realm of law, marketing, and beyond. However, a significant boundary condition on memory decoding validity may be the deployment of "countermeasures": strategies used to mask memory signals. Here we tested the vulnerability of fMRI-based memory detection to countermeasures, using a paradigm that bears resemblance to eyewitness identification. Participants were scanned while performing two tasks on previously studied and novel faces: (1) a standard recognition memory task; and (2) a task wherein they attempted to conceal their true memory state. Univariate analyses revealed that participants were able to strategically modulate neural responses, averaged across trials, in regions implicated in memory retrieval, including the hippocampus and angular gyrus. Moreover, regions associated with goal-directed shifts of attention and thought substitution supported memory concealment, and those associated with memory generation supported novelty concealment. Critically, whereas MVPA enabled reliable classification of memory states when participants reported memory truthfully, the ability to decode memory on individual trials was compromised, even reversing, during attempts to conceal memory. Together, these findings demonstrate that strategic goal states can be deployed to mask memory-related neural patterns and foil memory decoding technology, placing a significant boundary condition on their real-world utility. Copyright © 2015 the authors 0270-6474/15/358531-15$15.00/0.

  5. Theory and practice of enzyme bioaffinity electrodes. Direct electrochemical product detection.

    Science.gov (United States)

    Limoges, Benoît; Marchal, Damien; Mavré, François; Savéant, Jean-Michel; Schöllhorn, Bernd

    2008-06-11

    The use of enzyme labeling techniques to convert biorecognition events into high sensitivity electrochemical signals may follow two different strategies. One, in which the current is the electrocatalytic response of a redox couple serving as cosubstrate to a redox enzyme label and another that consists in the detection of an electrochemically active product of the enzyme label. The theoretical relationships that link, in the latter case, the electrochemical current response to the amount of recognized labeled target analyte are established for steady-state diffusion-convection chronoamperometric regimes. Two governing parameters thus emerge. One measures the Michaelis-Menten competition in the enzyme kinetics. The other characterizes the competition between the enzymatic kinetics and the diffusion of the substrate. The electrochemical response is finally related to the labeled target analyte concentration in solution through the recognition isotherm. The direct electrochemical product detection thus provides a route to the characteristics of the recognition isotherm, which serves as a calibration curve in analytical applications. The establishment of further theoretical relationships allows one to surmise the increase in sensitivity that may be obtained by using cyclic voltammetry instead of steady-state chronoamperometry in standard electrochemical cells or by accumulation of the enzyme-product in cells of small volume/surface ratios. The theoretical predictions are tested with the example of the avidin-biotin recognition process in a system that involves alkaline phosphatase as enzyme label and 4-amino-2,6-dichlorophenyl phosphate as substrate, generating 4-amino-2,6-dichlorophenol as electrochemically active product. The advantages of the dichloro-substitution are discussed. The theoretical analysis is a requisite for a rational and realistic discussion of the analytical performances of the steady-state chronoamperometric and cyclic voltammetric approaches

  6. Direct detection of hundreds of exoplanets with a space-based mid-infrared interferometer

    Science.gov (United States)

    Quanz, S. P.; Kammerer, J.

    2017-09-01

    One of the long-term goals of exoplanet research is the (atmospheric) characterization of a sizeable sample of small, terrestrial planets in order to assess their potential habitability. In this context it is important to quantitatively assess the scientific return of various mission concepts in order to derive robust science requirements. While transit and secondary eclipse spectroscopy may provide data on a few systems, it seems questionable whether a larger planet sample can be investigated given that most planets do not transit in front of their host stars. Hence, direct detection methods may be required. Here we predict the exoplanet yield of a space-based mid-infrared nulling interferometer (akin to the Darwin mission concept) using a catalog of nearby stars and the planet occurrence rates found by NASA's Kepler mission. We find that a mission with the technical specifications of Darwin could detect >300 exoplanets (with radii between 0.5 and 6 Earth radii). Roughly 85 planets have radii between 0.5 and 1.75 Earth radii and equilibrium temperatures between 200 and 450 K and are prime targets for spectroscopic follow-up observations in the second phase of the mission investigating their potential habitability. Higher planet yields can be realized by further optimizing the observing strategy. We also compare the baseline planet yield of a space-based mid-infrared interferometer to that of a large space-based optical/IR telescope. We conclude that a Darwin-like mission concept should be put back on the long-term agenda of the exoplanet community and related space agencies.

  7. Comparison of PCR, Culture, and Direct Fluorescent-Antibody Testing for Detection of Bordetella pertussis

    Science.gov (United States)

    Loeffelholz, Mike J.; Thompson, Curt J.; Long, Karla S.; Gilchrist, Mary J. R.

    1999-01-01

    We prospectively compared the performance of culture, direct fluorescent-antibody testing (DFA), and an in-house-developed PCR test targeting the repeated insertion sequence IS481 for the detection of Bordetella pertussis in nasopharyngeal swab specimens. We tested 319 consecutive paired specimens on which all three tests were performed. A total of 59 specimens were positive by one or more tests. Of these, 5 were positive by all three tests, 2 were positive by culture and PCR, 16 were positive by PCR and DFA, 28 were positive by PCR only, and 8 were positive by DFA only. Any specimen positive by culture was considered to be a true positive, as were specimens positive by both PCR and DFA. Specimens positive only by PCR or DFA were considered discrepant, and their status was resolved by review of patient histories. Patients with symptoms meeting the Centers for Disease Control and Prevention clinical case definition for pertussis and who had a specimen positive by PCR or DFA were considered to have true B. pertussis infections. Of the 28 patients positive by PCR only, 20 met the clinical case definition for pertussis, while 3 of the 8 patients positive by DFA only met the clinical case definition. After resolution of the status of discrepant specimens, the sensitivity, specificity, positive predictive value, and negative predictive value were 15.2, 100, 100, and 87.5%, respectively, for culture; 93.5, 97.1, 84.3, and 98.9%, respectively, for PCR; and 52.2, 98.2, 82.8, and 92.4%, respectively, for DFA. The actual positive predictive value of PCR was probably greater, as several PCR-positive patients who did not meet the clinical case definition had symptoms consistent with typical or atypical pertussis. PCR is a sensitive and specific method for the detection of B. pertussis. PMID:10449467

  8. An Investigation of Backgrounds in the DEAP-3600 Dark Matter Direct Detection Experiment

    Science.gov (United States)

    Veloce, Laurelle Maria

    Astronomical and cosmological observations reveal that the majority of the matter in our universe is made of an unknown, non-luminous substance called dark matter. Many experimental attempts are underway to directly detect particle dark matter, which is very difficult to measure due to the expected low interaction rate with normal matter. DEAP-3600 is a direct dark matter search experiment located two kilometres underground at SNOLAB, in Sudbury, Ontario. DEAP-3600 will make use of liquid argon as the detector material, which scintillates as charged particles pass through. The work presented here is an investigation of expected background sources in the DEAP detector. Because DEAP-3600 is a noble liquid-based experiment, a thin film of [1,1,4,4]-tetraphenyl-[1,3]-butadiene (TPB) is coated on the detector walls to shift the scintillation peak from the UV to visible regime for detection. However, alphas passing through TPB produce scintillation signals which can mimic recoil events. Because scintillation properties can change with temperature, we have conducted an investigation of alpha-induced TPB scintillation at temperatures ranging from 300 K to 3.4 K. We were able to characterize the light yield and decay times, and demonstrated that these background events should be distinguishable from true recoil events in liquid argon, thus enabling DEAP-3600 to achieve higher dark matter sensitivity. Additionally, we investigate the performance of the liquid argon purification systems, specifically the activated charcoal used for radon filtration. Previous measurements with the DEAP prototype experiment have demonstrated the necessity of removing radon from the argon prior to filling the detector, due to the release of contaminates from the argon storage systems. Charcoal radon filters are extremely efficient, however, if the emanation rate of the charcoal is too high, there is the possibility of re-contamination. We performed a measurement of the radon emanation rate of a

  9. Repair or Violation Detection? Pre-Attentive Processing Strategies of Phonotactic Illegality Demonstrated on the Constraint of g-Deletion in German

    Science.gov (United States)

    Steinberg, Johanna; Jacobsen, Thomas Konstantin; Jacobsen, Thomas

    2016-01-01

    Purpose: Effects of categorical phonotactic knowledge on pre-attentive speech processing were investigated by presenting illegal speech input that violated a phonotactic constraint in German called "g-deletion." The present study aimed to extend previous findings of automatic processing of phonotactic violations and to investigate the…

  10. NuSTAR J033202-2746.8: direct constraints on the Compton reflection in a heavily obscured quasar at z ≈ 2

    DEFF Research Database (Denmark)

    Del Moro, A.; Mullaney, J. R.; Alexander, D. M.

    2014-01-01

    We report Nuclear Spectroscopic Telescope Array (NuSTAR) observations of NuSTAR J033202-2746.8, a heavily obscured, radio-loud quasar detected in the Extended Chandra Deep Field-South, the deepest layer of the NuSTAR extragalactic survey (∼400 ks, at its deepest). NuSTAR J033202-2746.8 is reliabl...

  11. Detection of inhomogeneities in precipitation time series in Portugal using direct sequential simulation

    Science.gov (United States)

    Ribeiro, Sara; Caineta, Júlio; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2016-05-01

    Climate data homogenisation is of major importance in climate change monitoring, validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. The reason is that non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on a geostatistical simulation technique (DSS - direct sequential simulation), where local probability density functions (pdfs) are calculated at candidate monitoring stations using spatial and temporal neighbouring observations, which then are used for the detection of inhomogeneities. Such approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). That study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneity detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall, Wald-Wolfowitz runs, Von Neumann ratio, Pettitt, Buishand range test, and standard normal homogeneity test (SNHT) for a single break). Moreover, a sensitivity analysis is performed to investigate the number of simulated realisations which should be used to infer the local pdfs with more accuracy. Accordingly, the number of simulations per iteration was increased from 50 to 500, which resulted in a more representative local pdf. As in the previous study, the results are compared with those from the

  12. Inhomogeneities detection in annual precipitation time series in Portugal using direct sequential simulation

    Science.gov (United States)

    Caineta, Júlio; Ribeiro, Sara; Costa, Ana Cristina; Henriques, Roberto; Soares, Amílcar

    2014-05-01

    Climate data homogenisation is of major importance in monitoring climate change, the validation of weather forecasting, general circulation and regional atmospheric models, modelling of erosion, drought monitoring, among other studies of hydrological and environmental impacts. This happens because non-climate factors can cause time series discontinuities which may hide the true climatic signal and patterns, thus potentially bias the conclusions of those studies. In the last two decades, many methods have been developed to identify and remove these inhomogeneities. One of those is based on geostatistical simulation (DSS - direct sequential simulation), where local probability density functions (pdf) are calculated at candidate monitoring stations, using spatial and temporal neighbouring observations, and then are used for detection of inhomogeneities. This approach has been previously applied to detect inhomogeneities in four precipitation series (wet day count) from a network with 66 monitoring stations located in the southern region of Portugal (1980-2001). This study revealed promising results and the potential advantages of geostatistical techniques for inhomogeneities detection in climate time series. This work extends the case study presented before and investigates the application of the geostatistical stochastic approach to ten precipitation series that were previously classified as inhomogeneous by one of six absolute homogeneity tests (Mann-Kendall test, Wald-Wolfowitz runs test, Von Neumann ratio test, Standard normal homogeneity test (SNHT) for a single break, Pettit test, and Buishand range test). Moreover, a sensibility analysis is implemented to investigate the number of simulated realisations that should be used to accurately infer the local pdfs. Accordingly, the number of simulations per iteration is increased from 50 to 500, which resulted in a more representative local pdf. A set of default and recommended settings is provided, which will help

  13. [Importance of repeat laterally directed sextant prostate biopsy for detection of prostate cancer in high-risk patients].

    Science.gov (United States)

    Vaiciūnas, Kestutis; Auskalnis, Stasys; Matjosaitis, Aivaras; Mickevicius, Antanas; Mickevicius, Ramūnas; Trumbeckas, Darius; Jievaltas, Mindaugas

    2007-01-01

    Our purpose was to evaluate the relevance of repeat laterally directed sextant prostate biopsy for detection of prostate cancer in high-risk patients. Our study included 195 men at high risk for prostate cancer (elevated prostate-specific antigen level and/or abnormal prostate detected by digital rectal examination). We consulted the patients in outpatient department of Kaunas University of Medicine Hospital during 2003-2007. We performed transrectal ultrasound-guided laterally directed sextant prostate biopsy in every patient. For the patients with benign histological findings and increased risk of prostate cancer, laterally directed sextant biopsies were repeated. Prostate cancer was detected in 30.3% of patients (59/195) on the first prostate biopsy, in 13.1% (11/84) on the second prostate biopsy, in 10.3% (4/39) on the third, and in 7.7% (1/13) on the forth biopsy. After all biopsies, prostate cancer was detected in 38.5% (75/195) of patients, and it differed significantly from the percentage of prostate cancer cases detected on the first biopsy (30.3%, P=0.04). We detected 78.7% (59/75) of all prostate cancer cases by the first laterally directed sextant prostate biopsy. The rest 21.3% (16/75) of cases we detected by repeat biopsies. The second laterally directed sextant prostate biopsy revealed additional 14.6% (n=11) of prostate cancer cases and increased the detection of prostate cancer to 93.3% (70/75). At the time of the first prostate biopsy, prostate cancer was diagnosed most frequently when patients had both risk factors: elevated prostate-specific antigen level and abnormal digital prostate examination; prostate cancer was diagnosed in 45.3% of these patients. The odds ratio to detect prostate cancer by the first biopsy in patients with elevated prostate-specific antigen level and abnormal digital prostate examination was 3.7, and odds ratio to detect prostate cancer by repeat biopsies was 4.7. Repeat ultrasound-guided laterally directed sextant

  14. The principle and first results of betatron tune measurement by direct diode detection

    CERN Document Server

    Gasior, M

    2005-01-01

    The fractional part of the tune value of a circular accelerator can be measured by observing the betatron oscillations of the beam on a position sensitive pick-up. In the frequency domain the betatron signal is seen as sidebands on the revolution harmonics. The bunches in the beam often have a very short length with respect to the revolution period, resulting in a wideband pick-up signal spectrum, containing many betatron lines. Classical tune measurement systems filter out just one or a few of these betatron sidebands. As a consequence, most of the betatron energy is lost and only a very small fraction remains for further processing. This paper describes a new method, referred to as Direct Diode Detection (3D), which overcomes this and a few other problems. The basic idea is to time stretch the beam pulses from the pick up in order to increase the betatron frequency content in the baseband. This can be accomplished by a simple diode detector followed by an RC low pass filter, as used in the common envelope d...

  15. Frequency interleaving towards spectrally efficient directly detected optical OFDM for next-generation optical access networks.

    Science.gov (United States)

    Mehedy, Lenin; Bakaul, Masuduzzaman; Nirmalathas, Ampalavanapillai

    2010-10-25

    In this paper, we theoretically analyze and demonstrate that spectral efficiency of a conventional direct detection based optical OFDM system (DDO-OFDM) can be improved significantly using frequency interleaving of adjacent DDO-OFDM channels where OFDM signal band of one channel occupies the spectral gap of other channel and vice versa. We show that, at optimum operating condition, the proposed technique can effectively improve the spectral efficiency of the conventional DDO-OFDM system as much as 50%. We also show that such a frequency interleaved DDO-OFDM system, with a bit rate of 48 Gb/s within 25 GHz bandwidth, achieves sufficient power budget after transmission over 25 km single mode fiber to be used in next-generation time-division-multiplexed passive optical networks (TDM-PON). Moreover, by applying 64- quadrature amplitude modulation (QAM), the system can be further scaled up to 96 Gb/s with a power budget sufficient for 1:16 split TDM-PON.

  16. Direct Generation and Detection of Quantum Correlated Photons with 3.2 um Wavelength Spacing.

    Science.gov (United States)

    Sua, Yong Meng; Fan, Heng; Shahverdi, Amin; Chen, Jia-Yang; Huang, Yu-Ping

    2017-12-13

    Quantum correlated, highly non-degenerate photons can be used to synthesize disparate quantum nodes and link quantum processing over incompatible wavelengths, thereby constructing heterogeneous quantum systems for otherwise unattainable superior performance. Existing techniques for correlated photons have been concentrated in the visible and near-IR domains, with the photon pairs residing within one micron. Here, we demonstrate direct generation and detection of high-purity photon pairs at room temperature with 3.2 um wavelength spacing, one at 780 nm to match the rubidium D2 line, and the other at 3950 nm that falls in a transparent, low-scattering optical window for free space applications. The pairs are created via spontaneous parametric downconversion in a lithium niobate waveguide with specially designed geometry and periodic poling. The 780 nm photons are measured with a silicon avalanche photodiode, and the 3950 nm photons are measured with an upconversion photon detector using a similar waveguide, which attains 34% internal conversion efficiency. Quantum correlation measurement yields a high coincidence-to-accidental ratio of 54, which indicates the strong correlation with the extremely non-degenerate photon pairs. Our system bridges existing quantum technology to the challenging mid-IR regime, where unprecedented applications are expected in quantum metrology and sensing, quantum communications, medical diagnostics, and so on.

  17. Assessing compatibility of direct detection data: halo-independent global likelihood analyses

    Science.gov (United States)

    Gelmini, Graciela B.; Huh, Ji-Haeng; Witte, Samuel J.

    2016-10-01

    We present two different halo-independent methods to assess the compatibility of several direct dark matter detection data sets for a given dark matter model using a global likelihood consisting of at least one extended likelihood and an arbitrary number of Gaussian or Poisson likelihoods. In the first method we find the global best fit halo function (we prove that it is a unique piecewise constant function with a number of down steps smaller than or equal to a maximum number that we compute) and construct a two-sided pointwise confidence band at any desired confidence level, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a ``constrained parameter goodness-of-fit'' test statistic, whose p-value we then use to define a ``plausibility region'' (e.g. where p >= 10%). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. p < 10%). We illustrate these methods by applying them to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic spin-independent isospin-conserving interactions or exothermic spin-independent isospin-violating interactions.

  18. Direct detection of nasal Staphylococcus aureus carriage via helicase-dependent isothermal amplification and chip hybridization

    Directory of Open Access Journals (Sweden)

    Frech Georges C

    2012-08-01

    Full Text Available Abstract Background The bacterium Staphylococcus aureus constitutes one of the most important causes of nosocomial infections. One out of every three individuals naturally carries S. aureus in their anterior nares, and nasal carriage is associated with a significantly higher infection rate in hospital settings. Nasal carriage can be either persistent or intermittent, and it is the persistent carriers who, as a group, are at the highest risk of infection and who have the highest nasal S. aureus cell counts. Prophylactic decolonization of S. aureus from patients’ noses is known to reduce the incidence of postsurgical infections, and there is a clear rationale for rapid identification of nasal S. aureus carriers among hospital patients. Findings A molecular diagnostic assay was developed which is based on helicase-dependent target amplification and amplicon detection by chip hybridization to a chip surface, producing a visible readout. Nasal swabs from 70 subjects were used to compare the molecular assay against culturing on “CHROMagar Staph aureus” agar plates. The overall relative sensitivity was 89%, and the relative specificity was 94%. The sensitivity rose to 100% when excluding low-count subjects (S. aureus colony-forming units per swab. Conclusions This molecular assay is much faster than direct culture and has sensitivity that is appropriate for identification of high-count (>100 S. aureus colony-forming units per swab nasal S. aureus carriers who are at greatest risk for nosocomial infections.

  19. Prompt directional detection of galactic supernova by combining large liquid scintillator neutrino detectors

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, V.; Chirac, T.; Lasserre, T., E-mail: vincent.fischer@cea.fr, E-mail: tchirac@gmail.fr, E-mail: thierry.lasserre@cea.fr [Commissariat a l' énergie atomique et aux énergies alternatives, Centre de Saclay, IRFU, 91191 Gif-sur-Yvette (France); and others

    2015-08-01

    Core-collapse supernovae produce an intense burst of electron antineutrinos in the few-tens-of-MeV range. Several Large Liquid Scintillator-based Detectors (LLSD) are currently operated worldwide, being very effective for low energy antineutrino detection through the Inverse Beta Decay (IBD) process. In this article, we develop a procedure for the prompt extraction of the supernova location by revisiting the details of IBD kinematics over the broad energy range of supernova neutrinos. Combining all current scintillator-based detector, we show that one can locate a canonical supernova at 10 kpc with an accuracy of 45 degrees (68% C.L.). After the addition of the next generation of scintillator-based detectors, the accuracy could reach 12 degrees (68% C.L.), therefore reaching the performances of the large water Čerenkov neutrino detectors. We also discuss a possible improvement of the SuperNova Early Warning System (SNEWS) inter-experiment network with the implementation of a directionality information in each experiment. Finally, we discuss the possibility to constrain the neutrino energy spectrum as well as the mass of the newly born neutron star with the LLSD data.

  20. Assessing Compatibility of Direct Detection Data: Halo-Independent Global Likelihood Analyses

    CERN Document Server

    Gelmini, Graciela B.

    2016-10-18

    We present two different halo-independent methods utilizing a global maximum likelihood that can assess the compatibility of dark matter direct detection data given a particular dark matter model. The global likelihood we use is comprised of at least one extended likelihood and an arbitrary number of Poisson or Gaussian likelihoods. In the first method we find the global best fit halo function and construct a two sided pointwise confidence band, which can then be compared with those derived from the extended likelihood alone to assess the joint compatibility of the data. In the second method we define a "constrained parameter goodness-of-fit" test statistic, whose $p$-value we then use to define a "plausibility region" (e.g. where $p \\geq 10\\%$). For any halo function not entirely contained within the plausibility region, the level of compatibility of the data is very low (e.g. $p < 10 \\%$). As an example we apply these methods to CDMS-II-Si and SuperCDMS data, assuming dark matter particles with elastic s...

  1. Direct Dark Matter Detection through the use of a Xenon Based TPC Detector

    Science.gov (United States)

    Daniel, Jonathan; Akerib, Daniel; LZ group at SLAC

    2018-01-01

    The vast majority of matter in the universe is unaccounted for. Only 15% of the universe's mass density is visible matter, while the other 85% is Dark Matter (DM). The Weakly Interacting Massive Particle (WIMP) is currently the frontrunner of the DM candidates. The Large Underground Xenon (LUX) and next generation LUX-ZEPLIN (LZ) experiments are designed to directly detect WIMPs. Both experiments are xenon-based Time Projection Chambers (TPC) used to observe possible WIMP interactions. These interactions produce photons and electrons with the photons being collected in a set of two photomultiplier tube (PMT) arrays and the electrons drifted upwards in the detector by a strong electric field to create a secondary production of photons in gaseous xenon. These two populations of photons are classified as S1 and S2 signals, respectively. Using these signals we reconstruct the energy and position of the interaction and in doing so we can eliminate background events that would otherwise “light up” the detector. My participation in the experiment, while at SLAC, was the creation of the grids that produce the large electric field, along with additional lab activities aimed at testing the grids. While at Stan State, I work on background modeling in order to distinguish a possible WIMP signal from ambient backgrounds.

  2. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Rapid detection of respiratory viruses by shell vial culture and direct staining by using pooled and individual monoclonal antibodies.

    Science.gov (United States)

    Matthey, S; Nicholson, D; Ruhs, S; Alden, B; Knock, M; Schultz, K; Schmuecker, A

    1992-03-01

    The Bartels respiratory virus panel detection kit is an indirect fluorescent-antibody (IFA) method that uses pooled and individual antisera for tissue culture confirmation of seven respiratory viruses. We evaluated these reagents for detecting viral antigen in shell vial cultures and by direct staining of cells from respiratory specimens. The isolation from 254 specimens of respiratory viruses in shell vial cultures compared with standard tube cultures was highly sensitive (94%) and specific (97.3%). The numbers of viral isolates detected in three consecutive years of testing with shell vial cultures were 68 of 254 (26.8%), 101 of 381 (26.5%), and 122 of 430 (28.4%). IFA direct staining of all 1,065 specimens resulted in 183 (17.2) being uninterpretable because of inadequate numbers of cells or interfering fluorescence. The sensitivity and specificity of the interpretable IFA direct stains in comparison with shell vial cultures were 85.9 and 87.1%, respectively. For detection of 881 adequate specimens, Bartels respiratory syncytial virus IFA direct staining compared with an Ortho Diagnostics Systems direct fluorescent-antibody test for respiratory syncytial virus RSV was highly sensitive (95.5%) and specific (97%). Shell vial cultures combined with Bartels IFA reagents are a rapid alternative to standard tube cultures. Bartels IFA direct staining with individual antisera provides useful same-day screening of respiratory specimens, but the antiserum pool was not effective in screening for positive specimens because of excessive amounts of nonspecific fluorescence.

  4. Baseline Face Detection, Head Pose Estimation, and Coarse Direction Detection for Facial Data in the SHRP2 Naturalistic Driving Study

    Energy Technology Data Exchange (ETDEWEB)

    Paone, Jeffrey R [ORNL; Bolme, David S [ORNL; Ferrell, Regina Kay [ORNL; Aykac, Deniz [ORNL; Karnowski, Thomas Paul [ORNL

    2015-01-01

    Keeping a driver focused on the road is one of the most critical steps in insuring the safe operation of a vehicle. The Strategic Highway Research Program 2 (SHRP2) has over 3,100 recorded videos of volunteer drivers during a period of 2 years. This extensive naturalistic driving study (NDS) contains over one million hours of video and associated data that could aid safety researchers in understanding where the driver s attention is focused. Manual analysis of this data is infeasible, therefore efforts are underway to develop automated feature extraction algorithms to process and characterize the data. The real-world nature, volume, and acquisition conditions are unmatched in the transportation community, but there are also challenges because the data has relatively low resolution, high compression rates, and differing illumination conditions. A smaller dataset, the head pose validation study, is available which used the same recording equipment as SHRP2 but is more easily accessible with less privacy constraints. In this work we report initial head pose accuracy using commercial and open source face pose estimation algorithms on the head pose validation data set.

  5. Stochastic Constraint Programming

    OpenAIRE

    Walsh, Toby

    2009-01-01

    To model combinatorial decision problems involving uncertainty and probability, we introduce stochastic constraint programming. Stochastic constraint programs contain both decision variables (which we can set) and stochastic variables (which follow a probability distribution). They combine together the best features of traditional constraint satisfaction, stochastic integer programming, and stochastic satisfiability. We give a semantics for stochastic constraint programs, and propose a number...

  6. Joint Direction-of-Departure and Direction-of-Arrival Estimation in a UWB MIMO Radar Detecting Targets with Fluctuating Radar Cross Sections

    Directory of Open Access Journals (Sweden)

    Idnin Pasya

    2014-01-01

    Full Text Available This paper presents a joint direction-of-departure (DOD and direction-of-arrival (DOA estimation in a multiple-input multiple-output (MIMO radar utilizing ultra wideband (UWB signals in detecting targets with fluctuating radar cross sections (RCS. The UWB MIMO radar utilized a combination of two-way MUSIC and majority decision based on angle histograms of estimated DODs and DOAs at each frequency of the UWB signal. The proposed angle estimation scheme was demonstrated to be effective in detecting targets with fluctuating RCS, compared to conventional spectra averaging method used in subband angle estimations. It was found that a wider bandwidth resulted in improved estimation performance. Numerical simulations along with experimental evaluations in a radio anechoic chamber are presented.

  7. Direct fluorescent antibody assay and polymerase chain reaction for the detection of Chlamydia trachomatis in patients with vernal keratoconjunctivitis.

    Science.gov (United States)

    Nishiwaki-Dantas, Maria Cristina; de Abreu, Mariza Toledo; de Melo, Cynthia Mendonça; Romero, Ivana Lopes; Neto, Rubens Belfort Matos; Dantas, Paulo Elias Correa

    2011-01-01

    To identify Chlamydia trachomatis via polymerase chain reaction and a direct fluorescent antibody assay in patients with vernal keratoconjunctivitis while comparing the efficacies of both tests for detecting Chlamydia trachomatis in these conditions. Conjunctival scraping samples were obtained from 177 patients who were divided into two groups: a vernal keratoconjunctivitis group (group A) and a control group (group B). The polymerase chain reaction and a direct fluorescent antibody assay were performed. Sensitivity, specificity, receiver operating characteristic curves, and areas under the curve were calculated for both tests in groups A and B. Receiver operating characteristic curves were plotted using a categorical variable with only two possible outcomes (positive and negative). Statistical analysis revealed a significant association between vernal keratoconjunctivitis and Chlamydia trachomatis infection detected by a direct fluorescent antibody assay with high sensitivity and specificity. All patients in group A with positive polymerase chain reactions also presented with positive direct fluorescent antibody assays. The association between vernal keratoconjunctivitis and Chlamydia trachomatis infection was confirmed by positive direct fluorescent antibody assays in 49.4% of vernal keratoconjunctivitis patients and by positive polymerase chain reactions in 20% of these patients. The direct fluorescent antibody assay detected Chlamydia trachomatis in a higher number of patients than did the polymerase chain reaction. Although the diagnosis of trachoma is essentially clinical, the disease may not be detected in vernal keratoconjunctivitis patients. Due to the high frequency of chlamydial infection detected in patients with vernal keratoconjunctivitis, we suggest considering routine laboratory tests to detect Chlamydia trachomatis in patients with severe and refractory allergic disease.

  8. Direct screening of tetracyclines in water and bovine milk using room temperature phosphorescence detection

    Energy Technology Data Exchange (ETDEWEB)

    Traviesa-Alvarez, J.M. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Costa-Fernandez, J.M. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Pereiro, R. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain); Sanz-Medel, A. [Department of Physical and Analytical Chemistry, Faculty of Chemistry, University of Oviedo, c/Julian Claveria 8, 33006 Oviedo (Spain)]. E-mail: asm@uniovi.es

    2007-04-18

    A fast and simple flow-through optosensor was designed and characterized for the direct screening of four tetracycline (TCC) antibiotics (tetracycline, oxytetracycline, chlortetracycline and doxycycline) in water and bovine milk samples. The proposed optosensor provides rapid binary yes/no overall responses, being appropriate for the screening of this family of antibiotics above or below a pre-set concentration threshold. The experimental set-up is based on a flow-injection manifold coupled on-line to a phosphorescence detector. Aliquots of the samples are pretreated with Eu(III) to form room temperature phosphorescent metal chelates and injected in the flow manifold. Those chelates are then on-line retained on a conventional flow-cell (packed with polymeric Amberlite XAD-4 particles) which is placed inside the cell holder of the phosphorimeter. After the emission is registered, the antibiotic-metal complexes are eluted from the packed resin with 1 M HCl (for milk samples a second regeneration step, using methanol, should be performed). A sample throughput of about 20 samples per hour was obtained. Optimum experimental conditions include a pH 9, a Eu(III) concentration of 2 x 10{sup -4} M and 8 mM sodium sulphite as chemical deoxygenant. The phosphorescence emitted by the europium-TCC complexes was measured at 394 and 617 nm for excitation and emission wavelengths, respectively. The unreliability region, given by the probability of false positives and false negatives, respectively (set at 5% in both cases) was in the range between 0.2 and 11.6 nM for detection of tetracyclines in water samples (at a cut-off level of 4 nM) and in the range between 165 and 238 nM for detection of tetracyclines in milk (cut-off level fixed at the normative EU level of 200 nM). Finally, the applicability of the proposed screening optosensor was tested for the reliable control of tetracyclines in contaminated and uncontaminated water and milk samples.

  9. Importance of repeat laterally directed sextant prostate biopsy for detection of prostate cancer in high-risk patients

    OpenAIRE

    Vaičiūnas, Kęstutis; Auškalnis, Stasys; Matjošaitis, Aivaras Jonas; Mickevičius, Antanas; Mickevičius, Ramūnas; Trumbeckas, Darius; Jievaltas, Mindaugas

    2007-01-01

    Our purpose was to evaluate the relevance of repeat laterally directed sextant prostate biopsy for detection of prostate cancer in high-risk patients. Material and methods. Our study included 195 men at high risk for prostate cancer (elevated prostatespecific antigen level and/or abnormal prostate detected by digital rectal examination). We consulted the patients in outpatient department of Kaunas University of Medicine Hospital during 2003–2007. We performed transrectal ultrasound-guided lat...

  10. Micro-Spec: an Integrated, Direct-Detection Spectrometer for Far-Infrared and Submillimeter Astronomy

    Science.gov (United States)

    Cataldo, Giuseppe

    2014-01-01

    The far-infrared and submillimeter portions of the electromagnetic spectrum provide a unique view of the astrophysical processes present in the early universe. Our ability to fully explore this rich spectral region has been limited, however, by the size and cost of the cryogenic spectrometers required to carry out such measurements. Micro-Spec (u-Spec) is a high-sensitivity, direct-detection spectrometer concept working in the 450-1000 micromillimeter wavelength range which will enable a wide range of flight missions that would otherwise be challenging due to the large size of current instruments with the required spectral resolution and sensitivity. The spectrometer design utilizes two internal antenna arrays, one for transmitting and one for receiving, superconducting microstrip transmission lines for power division and phase delay, and an array of microwave kinetic inductance detectors (MKIDs) to achieve these goals. The instrument will be integrated on a approximately 10 square cm silicon chip and can therefore become an important capability under the low background conditions accessible via space and high-altitude borne platforms. In this paper, an optical design methodology for Micro-Spec is presented, with particular attention given to its twodimensional diffractive region, where the light of different wavelengths is focused on the different detectors. The method is based on the maximization of the instrument resolving power and minimization of the RMS phase error on the instrument focal plane. This two-step optimization can generate geometrical configurations given specific requirements on spectrometer size, operating spectral range and performance. A point design with resolving power of 257, an RMS phase error less than 0.1 radians and four stigmatic points was developed for initial demonstration and will be the basis of future instruments with resolving power up to about 1200.

  11. Amorphous selenium direct detection CMOS digital x-ray imager with 25 micron pixel pitch

    Science.gov (United States)

    Scott, Christopher C.; Abbaszadeh, Shiva; Ghanbarzadeh, Sina; Allan, Gary; Farrier, Michael; Cunningham, Ian A.; Karim, Karim S.

    2014-03-01

    We have developed a high resolution amorphous selenium (a-Se) direct detection imager using a large-area compatible back-end fabrication process on top of a CMOS active pixel sensor having 25 micron pixel pitch. Integration of a-Se with CMOS technology requires overcoming CMOS/a-Se interfacial strain, which initiates nucleation of crystalline selenium and results in high detector dark currents. A CMOS-compatible polyimide buffer layer was used to planarize the backplane and provide a low stress and thermally stable surface for a-Se. The buffer layer inhibits crystallization and provides detector stability that is not only a performance factor but also critical for favorable long term cost-benefit considerations in the application of CMOS digital x-ray imagers in medical practice. The detector structure is comprised of a polyimide (PI) buffer layer, the a-Se layer, and a gold (Au) top electrode. The PI layer is applied by spin-coating and is patterned using dry etching to open the backplane bond pads for wire bonding. Thermal evaporation is used to deposit the a-Se and Au layers, and the detector is operated in hole collection mode (i.e. a positive bias on the Au top electrode). High resolution a-Se diagnostic systems typically use 70 to 100 μm pixel pitch and have a pre-sampling modulation transfer function (MTF) that is significantly limited by the pixel aperture. Our results confirm that, for a densely integrated 25 μm pixel pitch CMOS array, the MTF approaches the fundamental material limit, i.e. where the MTF begins to be limited by the a-Se material properties and not the pixel aperture. Preliminary images demonstrating high spatial resolution have been obtained from a frst prototype imager.

  12. Directly detected (55)Mn MRI: application to phantoms for human hyperpolarized (13)C MRI development.

    Science.gov (United States)

    von Morze, Cornelius; Carvajal, Lucas; Reed, Galen D; Swisher, Christine Leon; Tropp, James; Vigneron, Daniel B

    2014-12-01

    In this work we demonstrate for the first time directly detected manganese-55 ((55)Mn) magnetic resonance imaging (MRI) using a clinical 3T MRI scanner designed for human hyperpolarized (13)C clinical studies with no additional hardware modifications. Due to the similar frequency of the (55)Mn and (13)C resonances, the use of aqueous permanganate for large, signal-dense, and cost-effective "(13)C" MRI phantoms was investigated, addressing the clear need for new phantoms for these studies. Due to 100% natural abundance, higher intrinsic sensitivity, and favorable relaxation properties, (55)Mn MRI of aqueous permanganate demonstrates dramatically increased sensitivity over typical (13)C phantom MRI, at greatly reduced cost as compared with large (13)C-enriched phantoms. A large sensitivity advantage (22-fold) was demonstrated. A cylindrical phantom (d=8 cm) containing concentrated aqueous sodium permanganate (2.7 M) was scanned rapidly by (55)Mn MRI in a human head coil tuned for (13)C, using a balanced steady state free precession acquisition. The requisite penetration of radiofrequency magnetic fields into concentrated permanganate was investigated by experiments and high frequency electromagnetic simulations, and found to be sufficient for (55)Mn MRI with reasonably sized phantoms. A sub-second slice-selective acquisition yielded mean image signal-to-noise ratio of ~60 at 0.5 cm(3) spatial resolution, distributed with minimum central signal ~40% of the maximum edge signal. We anticipate that permanganate phantoms will be very useful for testing HP (13)C coils and methods designed for human studies. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Nouvelles Limites sur la Detection Directe de la Matiere Sombre avec l'Experience PICASSO

    Science.gov (United States)

    Piro, Marie-Cecile

    Astronomical and cosmological observations strongly suggest the presence of an exotic form of non-relativistic, non-baryonic matter that would represent 26% of the actual energy-matter content of the Universe. This so-called cold dark matter would be composed of Weakly Interactive Massive Particles (WIMP). PICASSO (Project In CAnada to Search for Supersymmetric Objects) aims to detect directly one of the dark matter candidates proposed in the framework of supersymmetric extensions of the standard model : the neutralino. The experiment is installed in the SNOLAB underground laboratory at Sudbury (Ontario) and uses superheated C4F10 droplets detectors, a variant of bubble chamber technique. Phase transitions in the superheated liquids are triggered by 19F recoils caused by the elastic collision with neutralinos and create an acoustic signal which is recorded by piezoelectric sensors. This thesis presents recent progress in PICASSO leading to a substantially increased sensitivity in the search of neutralinos. New fabrication and purification procedures allowed a background reduction of about a factor 10 of the major detectors contamination caused by alpha emitters. Detailed studies allowed to localize these emitters in the detectors. In addition, data analysis efforts were able to improve substantially the discrimination between alpha particle induced events and those created by nuclear recoils. New analysis tools were also developed in order to discriminate between particle induced and non-particle induced events, such as electronic backgrounds and acoustic noise signals. An important new background suppression mechanism at higher temperatures led to the present improved sensitivity of PICASSO at low WIMP masses.

  14. Integrity Constraints in Trust Management (Extended Abstract)

    NARCIS (Netherlands)

    Etalle, Sandro; Winsborough, William H.; Ahn, G-J.

    We introduce the use, monitoring, and enforcement of integrity constraints in trust managementstyle authorization systems. We consider what portions of the policy state must be monitored to detect violations of integrity constraints. Then we address the fact that not all participants in a trust

  15. Quantum Secure Direct Communication Based on Dense Coding and Detecting Eavesdropping with Four-Particle Genuine Entangled State

    Directory of Open Access Journals (Sweden)

    Jian Li

    2015-09-01

    Full Text Available A novel quantum secure direct communication protocol based on four-particle genuine entangled state and quantum dense coding is proposed. In this protocol, the four-particle genuine entangled state is used to detect eavesdroppers, and quantum dense coding is used to encode the message. Finally, the security of the proposed protocol is discussed. During the security analysis, the method of entropy theory is introduced, and two detection strategies are compared quantitatively by comparing the relationship between the maximal information that the eavesdroppers (Eve can obtain, and the probability of being detected. Through the analysis we can state that our scheme is feasible and secure.

  16. Direct fluorescent antibody assay and polymerase chain reaction for the detection of Chlamydia trachomatis in patients with vernal keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Maria Cristina Nishiwaki-Dantas

    2011-01-01

    Full Text Available OBJECTIVES: To identify Chlamydia trachomatis via polymerase chain reaction and a direct fluorescent antibodyassay in patients with vernal keratoconjunctivitis while comparing the efficacies of both tests for detectingChlamydia trachomatis in these conditions. METHODS: Conjunctival scraping samples were obtained from 177 patients who were divided into two groups: avernal keratoconjunctivitis group (group A and a control group (group B. The polymerase chain reaction and adirect fluorescent antibody assay were performed. Sensitivity, specificity, receiver operating characteristic curves,and areas under the curve were calculated for both tests in groups A and B. Receiver operating characteristic curveswere plotted using a categorical variable with only two possible outcomes (positive and negative. RESULTS: Statistical analysis revealed a significant association between vernal keratoconjunctivitis and Chlamydia trachomatis infection detected by a direct fluorescent antibody assay with high sensitivity and specificity. Allpatients in group A with positive polymerase chain reactions also presented with positive direct fluorescentantibody assays. CONCLUSION: The association between vernal keratoconjunctivitis and Chlamydia trachomatis infection wasconfirmed by positive direct fluorescent antibody assays in 49.4% of vernal keratoconjunctivitis patients and bypositive polymerase chain reactions in 20% of these patients. The direct fluorescent antibody assay detectedChlamydia trachomatis in a higher number of patients than did the polymerase chain reaction. Although thediagnosis of trachoma is essentially clinical, the disease may not be detected in vernal keratoconjunctivitis patients.Due to the high frequency of chlamydial infection detected in patients with vernal keratoconjunctivitis, we suggestconsidering routine laboratory tests to detect Chlamydia trachomatis in patients with severe and refractory allergicdisease.

  17. Light dark matter versus astrophysical constraints

    Energy Technology Data Exchange (ETDEWEB)

    Cline, James M., E-mail: jcline@physics.mcgill.ca [Physics Department, McGill University, Montreal, QC, H3A2T8 (Canada); Frey, Andrew R., E-mail: a.frey@uwinnipeg.ca [Department of Physics and Winnipeg Institute for Theoretical Physics, University of Winnipeg, Winnipeg, MB, R3B2E9 (Canada)

    2012-01-05

    Hints of direct dark matter detection coming from the DAMA, CoGeNT experiments point toward light dark matter with isospin-violating and possibly inelastic couplings. However an array of astrophysical constraints are rapidly closing the window on light dark matter. We point out that if the relic density is determined by annihilation into invisible states, these constraints can be evaded. As an example we present a model of quasi-Dirac dark matter, interacting via two U(1) gauge bosons, one of which couples to baryon number and the other which kinetically mixes with the photon. Annihilation is primarily into 'dark neutrinos' that do not mix with the SM, but which could provide an extra component of dark radiation. The model could soon be tested by several experiments searching for such light gauge bosons, and we predict that both could be detected. The model also requires a fourth generation of quarks, whose existence might increase the production cross section of Higgs bosons at the Tevatron and LHC.

  18. Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    and quantification of viable Campylobacter jejuni directly from chicken faecal samples. The results of this method anda DNA-based quantitative real-time PCR (qPCR) method were compared with those of a bacterial culture method. Using bacterial culture andRT-qPCR methods, viable C. jejuni cells could be detected...

  19. Detection, direction discrimination, and off-frequency interference of center-frequency modulations and glides for vowel formants

    NARCIS (Netherlands)

    Lyzenga, J.; Carlyon, R.P.

    2005-01-01

    Vowels are mainly classified by the positions of peaks in their frequency spectra, the formants. For normal-hearing subjects, change detection and direction discrimination were measured for linear glides in the center frequency (CF) of formantlike sounds. A CF rove was used to prevent subjects from

  20. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  1. THE VERY EARLY LIGHT CURVE OF SN 2015F IN NGC 2442: A POSSIBLE DETECTION OF SHOCK-HEATED COOLING EMISSION AND CONSTRAINTS ON SN Ia PROGENITOR SYSTEM

    Energy Technology Data Exchange (ETDEWEB)

    Im, Myungshin; Choi, Changsu; Kim, Jae-Woo [Center for the Exploration of the Origin of the universe (CEOU), Seoul National University, Seoul (Korea, Republic of); Yoon, Sung-Chul [Astronomy Program, Department of Physics and Astronomy, Seoul National University, Seoul (Korea, Republic of); Ehgamberdiev, Shuhrat A. [Ulugh Beg Astronomical Institute, Tashkent (Uzbekistan); Monard, Libert A. G. [Kleinkaroo Observatory, Center for Backyard Astrophysics Kleinkaroo, Sint Helena 1B, P.O. Box 281, Calitzdorp 6660 (South Africa); Sung, Hyun-Il, E-mail: mim@astro.snu.ac.kr, E-mail: changsu@astro.snu.ac.kr [Korea Astronomy and Space Science Institute, Daejeon 305-348 (Korea, Republic of)

    2015-11-15

    The main progenitor candidates of Type Ia supernovae (SNe Ia) are white dwarfs in binary systems where the companion star is another white dwarf (double degenerate (DD) system) or a less-evolved, non-degenerate star with R{sub *} ≳ 0.1 R{sub ⊙} (single degenerate system). However, no direct observational evidence exists to tell us which progenitor system is more common. Recent studies suggest that the light curve of a supernova shortly after its explosion can be used to set a limit on the progenitor size, R{sub *}. Here, we report high-cadence monitoring observations of SN 2015F, a normal SN Ia in the galaxy NGC 2442, starting about 84 days before the first light time. Using our daily cadence data, we capture the emergence of the radioactively powered light curve; more importantly, with >97.4% confidence, we detect possible dim precursor emission that appears roughly 1.5 days before the rise of the radioactively powered emission. The signal is consistent with theoretical expectations for a progenitor system involving a companion star with R{sub *} ≃ 0.1–1 R{sub ⊙} or a prompt explosion of a DD system, but is inconsistent with the typically invoked size of a white dwarf progenitor of R{sub *} ∼ 0.01 R{sub ⊙}. Upper limits on the precursor emission also constrain the progenitor size to be R{sub *} ≲ 0.1 R{sub ⊙} with a companion star size of R{sub *} ≲ 1.0 R{sub ⊙}, excluding a very large companion star in the progenitor system. Additionally, we find that the distance to SN 2015F is 23.9 ± 0.4 Mpc.

  2. Label-Free Direct Detection of miRNAs with Poly-Silicon Nanowire Biosensors.

    Directory of Open Access Journals (Sweden)

    Jing He

    Full Text Available The diagnostic and prognostic value of microRNAs (miRNAs in a variety of diseases is promising. The novel silicon nanowire (SiNW biosensors have advantages in molecular detection because of their high sensitivity and fast response. In this study, poly-crystalline silicon nanowire field-effect transistor (poly-SiNW FET device was developed to achieve specific and ultrasensitive detection of miRNAs without labeling and amplification.The poly-SiNW FET was fabricated by a top-down Complementary Metal Oxide Semiconductor (CMOS wafer fabrication based technique. Single strand DNA (ssDNA probe was bind to the surface of the poly-SiNW device which was silanated and aldehyde-modified. By comparing the difference of resistance value before and after ssDNA and miRNA hybridization, poly-SiNW device can be used to detect standard and real miRNA samples.Poly-SiNW device with different structures (different line width and different pitch was applied to detect standard Let-7b sample with a detection limitation of 1 fM. One-base mismatched sequence could be distinguished meanwhile. Furthermore, these poly-SiNW arrays can detect snRNA U6 in total RNA samples extracted from HepG2 cells with a detection limitation of 0.2 μg/mL. In general, structures with pitch showed better results than those without pitch in detection of both Let-7b and snRNA U6. Moreover, structures with smaller pitch showed better detection efficacy.Our findings suggest that poly-SiNW arrays could detect standard and real miRNA sample without labeling or amplification. Poly-SiNW biosensor device is promising for miRNA detection.

  3. Comparison of diagnostic ability of storage phosphor plate in detecting proximal caries with direct measurement by stereomicroscope: a pilot study

    Directory of Open Access Journals (Sweden)

    Velayudhannair Vivek

    2015-09-01

    Full Text Available Radiography plays an important role in detection of interproximal caries. The aim of study is to compare diagnostic ability of photo stimulable phosphor (PSP with direct measurement using stereomicroscope in detecting proximal caries. Hundred proximal surfaces of 50 extracted human posterior teeth were radiographed with dental X-ray unit. The image receptors used was storage phosphor plate Vista scan (size 2, (time of exposure 0.4 s. Radiographs were interpreted and caries lesions were classified on a 4-point scale suggested by Abesi et al. The teeth were sectioned with diamond disc and were examined under a stereomicroscope with 20x magnification. Diagnostic accuracy of digital image is similar to that observed with stereomicroscope. The PSP plate digital X ray system can effectively be employed for detecting proximal caries as compared to direct observation by stereomicroscope. Further study with more number of observer/evaluator and large sample size is recommended.

  4. Comparison of Diagnostic Ability of Storage Phosphor Plate in Detecting Proximal Caries with Direct Measurement by Stereomicroscope: A Pilot Study.

    Science.gov (United States)

    Vivek, Velayudhannair; Thomas, Sunila; Nair, Bindu J; Vineet, Alex Daniel; Thomas, Jincy; Ranimol, Prasanna; Vijayan, Aswathy K

    2015-09-28

    Radiography plays an important role in detection of interproximal caries. The aim of study is to compare diagnostic ability of photo stimulable phosphor (PSP) with direct measurement using stereomicroscope in detecting proximal caries. Hundred proximal surfaces of 50 extracted human posterior teeth were radiographed with dental X-ray unit. The image receptors used was storage phosphor plate Vista scan (size 2), (time of exposure 0.4 s). Radiographs were interpreted and caries lesions were classified on a 4-point scale suggested by Abesi et al. The teeth were sectioned with diamond disc and were examined under a stereomicroscope with 20x magnification. Diagnostic accuracy of digital image is similar to that observed with stereomicroscope. The PSP plate digital X ray system can effectively be employed for detecting proximal caries as compared to direct observation by stereomicro-scope. Further study with more number of observer/evaluator and large sample size is recommended.

  5. Have we found conclusive evidence for dark matter through direct detection experiments?

    Science.gov (United States)

    Yang, Jun

    2014-04-01

    A WIMP-model-independent method is used to examine the existing evidence for low mass dark matter. Using XENON100's recent result of 224.6 live days × 34 kg exposure and PICASSO's result that was published in 2012, we have obtained constraints on the couplings |an| < 0.4 and |ap| < 0.3, corresponding to spin-dependent cross-sections of σn<2.5×10-38 cm and σp<1.4×10-38 cm2 for a WIMP mass of 10 GeV/c2. It is shown that the spin-independent isospin-violating dark matter model also fails to reconcile the recent result from XENON100 with the positive results from DAMA, CoGeNT and CDMS-II.

  6. Direct detection of early-stage cancers using circulating tumor DNA

    NARCIS (Netherlands)

    Phallen, Jillian; Sausen, Mark; Adleff, Vilmos; Leal, Alessandro; Hruban, Carolyn; White, James; Anagnostou, Valsamo; Fiksel, Jacob; Cristiano, Stephen; Papp, Eniko; Speir, Savannah; Reinert, Thomas; Orntoft, Mai-Britt Worm; Woodward, Brian D.; Murphy, Derek; Parpart-Li, Sonya; Riley, David; Nesselbush, Monica; Sengamalay, Naomi; Georgiadis, Andrew; Li, Qing Kay; Madsen, Mogens Rørbæk; Mortensen, Frank Viborg; Huiskens, Joost; Punt, Cornelis; van Grieken, Nicole; Fijneman, Remond; Meijer, Gerrit; Husain, Hatim; Scharpf, Robert B.; Diaz, Luis A.; Jones, Siân; Angiuoli, Sam; Ørntoft, Torben; Nielsen, Hans Jørgen; Andersen, Claus Lindbjerg; Velculescu, Victor E.

    2017-01-01

    Early detection and intervention are likely to be the most effective means for reducing morbidity and mortality of human cancer. However, development of methods for noninvasive detection of early-stage tumors has remained a challenge. We have developed an approach called targeted error correction

  7. Direct detection and quantification of transition metal ions in human atherosclerotic plaques

    DEFF Research Database (Denmark)

    Stadler, Nadina; Lindner, Robyn A; Davies, Michael Jonathan

    2004-01-01

    and copper in ex vivo healthy human arteries and carotid lesions. The EPR spectra detected are characteristic of nonheme Fe(III) complexes. Statistically elevated levels of iron were detected in the intima of lesions compared with healthy controls (0.370 versus 0.022 nmol/mg tissue for EPR, 0.525 versus 0...

  8. The Shallow Subsurface Structure Detected by the Directionally Dependent H/V Spectral Ratio of Microtremors

    Science.gov (United States)

    Kawase, H.; Matsushima, S.; Kosaka, H.; Kobayashi, T.

    2016-12-01

    We observed microtremors around a strong motion observation site of Port and Harbor Research Institute in Onahama, Japan and found that directional dependence of microtremor H/V spectral ratios (MHVRs) exists in some parts of the area around the site. The directional dependence is more apparent and has a higher dominant frequency, at around 3 to 5 Hz, compared to those observed in Uji campus of Kyoto University, at around 0.5 Hz. We defined a parameter called "Direction Dependent Coefficient γ" to indicate the degree of the difference of the two orthogonal components that implies the directional dependence from the MHVRs. We rotated the axis and calculated γ for each angle and searched for the axis that gives the largest γ at a point. The points where the axis with larger amplitude among the two axis are pointing in the north-south direction are aligned in the north-south direction and the points where larger axis are pointing in the east-west direction are aligned in the east-west direction, forming a T-shape like distribution. We calculated the theoretical MHVRs in order to simulate the observed MHVRs and succeeded to show the existence of a narrow wedge from the MHVRs. From these results, and taking in account of the peak frequency, we can interpret that lateral heterogeneity in the shallow subsurface with relatively narrow width may exist beneath these points parallel to the direction of the larger amplitude axis.

  9. The Soft Cumulative Constraint

    OpenAIRE

    Petit, Thierry; Poder, Emmanuel

    2009-01-01

    This research report presents an extension of Cumulative of Choco constraint solver, which is useful to encode over-constrained cumulative problems. This new global constraint uses sweep and task interval violation-based algorithms.

  10. Causality Constraints in Conformal Field Theory

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    Causality places nontrivial constraints on QFT in Lorentzian signature, for example fixing the signs of certain terms in the low energy Lagrangian. In d-dimensional conformal field theory, we show how such constraints are encoded in crossing symmetry of Euclidean correlators, and derive analogous constraints directly from the conformal bootstrap (analytically). The bootstrap setup is a Lorentzian four-point function corresponding to propagation through a shockwave. Crossing symmetry fixes the signs of certain log terms that appear in the conformal block expansion, which constrains the interactions of low-lying operators. As an application, we use the bootstrap to rederive the well known sign constraint on the (∂φ)4 coupling in effective field theory, from a dual CFT. We also find constraints on theories with higher spin conserved currents. Our analysis is restricted to scalar correlators, but we argue that similar methods should also impose nontrivial constraints on the interactions of spinni...

  11. Characteristics and comparative performance of direct culture, direct PCR and enumeration methods for detection and quantification of Campylobacter spp. in broiler caeca.

    Science.gov (United States)

    Rodgers, J D; Lawes, J R; Vidal, A B; Ellis-Iversen, J; Ridley, A; Pleydell, E J; Powell, L F; Toszeghy, M; Stapleton, K; Clifton-Hadley, F A

    2012-10-12

    Detection and enumeration of Campylobacter spp. in broiler chicken flocks are key components of research and surveillance studies aimed at reducing Campylobacter infections in people. Direct culture of caecal contents onto selective agar is the typical method used to confirm flock colonisation. Modified charcoal cefoperazone deoxycholate agar (mCCDA) is commonly used for this method, although alternative selective media have been used. Additionally, PCR methods to detect Campylobacter DNA from caecal contents may provide a rapid alternative. However comparative performance data for these methods is limited and therefore required to ensure optimal detection methods for this sample type. In this study, 306 broiler caeca were tested for Campylobacter using direct culture on mCCDA, Skirrows and Preston agars and two real-time PCR methods, one specific for mapA/ceuE regions and another for the flaA gene region. Additionally, the suitability of spread plating and spiral plating methods for enumeration of Campylobacter and the impact of sample storage were assessed. This study confirmed modified CCDA as an optimal media for detection of Campylobacter in broiler caeca. It was significantly more sensitive than Skirrows or Preston agars. This study also demonstrated that the mapA/ceuE PCR had excellent agreement with culture on mCCDA and is a genuine alternative method. Spread plating and spiral plating methods were suitable for enumeration although spiral plating appeared more sensitive for stored samples (72 h). A 1 log reduction in viable Campylobacters was observed in stored samples, therefore storage effects should be considered for quantitative studies with broiler caeca. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  12. Sensitivity of the Cherenkov Telescope Array to the detection of a dark matter signal in comparison to direct detection and collider experiments

    Science.gov (United States)

    Balázs, Csaba; Conrad, Jan; Farmer, Ben; Jacques, Thomas; Li, Tong; Meyer, Manuel; Queiroz, Farinaldo S.; Sánchez-Conde, Miguel A.

    2017-10-01

    Imaging atmospheric Cherenkov telescopes (IACTs) that are sensitive to potential γ -ray signals from dark matter (DM) annihilation above ˜50 GeV will soon be superseded by the Cherenkov Telescope Array (CTA). CTA will have a point source sensitivity an order of magnitude better than currently operating IACTs and will cover a broad energy range between 20 GeV and 300 TeV. Using effective field theory and simplified models to calculate γ -ray spectra resulting from DM annihilation, we compare the prospects to constrain such models with CTA observations of the Galactic center with current and near-future measurements at the Large Hadron Collider (LHC) and direct detection experiments. For DM annihilations via vector or pseudoscalar couplings, CTA observations will be able to probe DM models out of reach of the LHC, and, if DM is coupled to standard fermions by a pseudoscalar particle, beyond the limits of current direct detection experiments.

  13. Composing constraint solvers

    NARCIS (Netherlands)

    P. Zoeteweij (Peter)

    2005-01-01

    htmlabstractComposing constraint solvers based on tree search and constraint propagation through generic iteration leads to efficient and flexible constraint solvers. This was demonstrated using OpenSolver, an abstract branch-and-propagate tree search engine that supports a wide range of relevant

  14. Development of Nanoparticles Based Assays for the Direct Detection of Unamplified Nucleic Acids in Clinical Specimens

    NARCIS (Netherlands)

    S.M.S. Abdou (Sherif)

    2014-01-01

    markdownabstract__Abstract__ Advances in molecular diagnostic technologies have led to substantial progress in the understanding and detection of a multitude of diseases including infectious, genetic diseases and cancer. These technologies have become a cornerstone in modern clinical diagnostics.

  15. Machine Learning Techniques for Optical Performance Monitoring from Directly Detected PDM-QAM Signals

    DEFF Research Database (Denmark)

    Thrane, Jakob; Wass, Jesper; Piels, Molly

    2017-01-01

    Linear signal processing algorithms are effective in dealing with linear transmission channel and linear signal detection, while the nonlinear signal processing algorithms, from the machine learning community, are effective in dealing with nonlinear transmission channel and nonlinear signal...... detection. In this paper, a brief overview of the various machine learning methods and their application in optical communication is presented and discussed. Moreover, supervised machine learning methods, such as neural networks and support vector machine, are experimentally demonstrated for in-band optical...

  16. Highly sensitive surface-scanning detector for the direct bacterial detection using magnetoelastic (ME) biosensors

    Science.gov (United States)

    Liu, Yuzhe; Horikawa, Shin; Chen, I.-Hsuan; Du, Songtao; Wikle, Howard C.; Suh, Sang-Jin; Chin, Bryan A.

    2017-05-01

    This paper demonstrates a highly sensitive surface-scanning detector used for magnetoelastic (ME) biosensors for the detection of Salmonella on the surface of a polyethylene (PE) food preparation surface. The design and fabrication methods of the new planar spiral coil are introduced. Different concentrations of Salmonella were measured on the surface of a PE board. The efficacy of Salmonella capture and detection is discussed.

  17. Radiative corrections for the direct detection of neutralino dark matter and its relic density

    Energy Technology Data Exchange (ETDEWEB)

    Steppeler, Patrick Norbert

    2016-07-01

    In this thesis we calculate supersymmetric one-loop corrections of the strong interaction to elastic neutralino-nucleon scattering. The calculation is described in detail and performed in full generality within the Minimal Supersymmetric Standard Model (MSSM). In order to benefit from the well-established tensor reduction method, we have to stabilise the latter for vanishing Gram determinants. Afterwards the radiative corrections are matched onto an effective field theory based on the scalar operator anti χχ anti qq and the axial-vector operator anti χγ{sub 5}γ{sub μ}χ anti qγ{sub 5}γ{sup μ}q. This matching procedure is performed at the high scale μ{sub high}∝1000 GeV, whereas the associated nuclear matrix elements are defined at the low scale μ{sub low}∝5 GeV. To link both scales, the running of the effective operators and their corresponding Wilson coefficients is taken into account via renormalisation group equations. The lightest neutralino can be considered as a canonical example for a weakly interacting, massive particle which could constitute dark matter. To verify the existence of such particles, so-called direct detection experiments are conducted currently. These are based on the interaction between dark matter and nucleons. The leading contributions to the spin-independent and spin-dependent neutralino-nucleon cross sections are governed by the effective operators mentioned above, respectively. The calculation of the associated radiative corrections corresponds to a reduction of the theoretical uncertainty and permits to identify neutralino properties more reliably in case of positive findings and to set more robust exclusion bounds in case of negative findings. Furthermore, we calculate radiative corrections to annihilation and coannihilation processes of gauginos into quarks, where we focus again on supersymmetric one-loop corrections of the strong interaction. These processes contribute dominantly to the (co)annihilation cross section

  18. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  19. Broad-Range Detection of Microorganisms Directly from Bronchoalveolar Lavage Specimens by PCR/Electrospray Ionization-Mass Spectrometry

    Science.gov (United States)

    Ullberg, Måns; Lüthje, Petra; Mölling, Paula; Strålin, Kristoffer

    2017-01-01

    The clinical demand on rapid microbiological diagnostic is constantly increasing. PCR coupled to electrospray ionization-mass spectrometry, PCR/ESI-MS, offers detection and identification of over 750 bacteria and Candida species directly from clinical specimens within 6 hours. In this study, we investigated the clinical performance of the IRIDICA BAC LRT Assay for detection of bacterial pathogens in 121 bronchoalveolar lavage (BAL) samples that were received consecutively at our bacterial laboratory for BAL culture. Commensal or pathogenic microorganisms were detected in 118/121 (98%) BAL samples by PCR/ESI-MS, while in 104/121 (86%) samples by routine culture (PPCR/ESI-MS was evaluated in comparison with conventional culture-based or molecular methods. The agreement between positive findings was overall good. Most Staphylococcus aureus-positive PCR/ESI-MS results were confirmed by culture or species-specific PCR (27/33, 82%). The identity of Streptococcus pneumoniae could however be confirmed for only 6/17 (35%) PCR/ESI-MS-positive samples. Non-cultivable and fastidious pathogens, which were not covered by standard culture procedures were readily detected by PCR/ESI-MS, including Legionella pneumophila, Bordetella pertussis, Norcadia species and Mycoplasma pneumoniae. In conclusion, PCR/ESI-MS detected a broad range of potential pathogens with equal or superior sensitivity compared to conventional methods within few hours directly from BAL samples. This novel method might thus provide a relevant tool for diagnostics in critically ill patients. PMID:28085931

  20. Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments.

    Science.gov (United States)

    Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K

    2014-03-01

    Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

  1. Marine environmental pollution stress detection through direct viable counts of bacteria

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaiah, N.; Kenkre, V.D.; Verlecar, X.N.

    Direct viable counts (DVC) of bacteria were quantified from polluted and relatively less/non-polluted coastal locations during different seasons to assess whether they can be routinely monitored for an understanding of environmental stress(es...

  2. Rapid whole-genome sequencing for detection and characterization of microorganisms directly from clinical samples.

    Science.gov (United States)

    Hasman, Henrik; Saputra, Dhany; Sicheritz-Ponten, Thomas; Lund, Ole; Svendsen, Christina Aaby; Frimodt-Møller, Niels; Aarestrup, Frank M

    2014-01-01

    Whole-genome sequencing (WGS) is becoming available as a routine tool for clinical microbiology. If applied directly on clinical samples, this could further reduce diagnostic times and thereby improve control and treatment. A major bottleneck is the availability of fast and reliable bioinformatic tools. This study was conducted to evaluate the applicability of WGS directly on clinical samples and to develop easy-to-use bioinformatic tools for the analysis of sequencing data. Thirty-five random urine samples from patients with suspected urinary tract infections were examined using conventional microbiology, WGS of isolated bacteria, and direct sequencing on pellets from the urine samples. A rapid method for analyzing the sequence data was developed. Bacteria were cultivated from 19 samples but in pure cultures from only 17 samples. WGS improved the identification of the cultivated bacteria, and almost complete agreement was observed between phenotypic and predicted antimicrobial susceptibilities. Complete agreement was observed between species identification, multilocus sequence typing, and phylogenetic relationships for Escherichia coli and Enterococcus faecalis isolates when the results of WGS of cultured isolates and urine samples were directly compared. Sequencing directly from the urine enabled bacterial identification in polymicrobial samples. Additional putative pathogenic strains were observed in some culture-negative samples. WGS directly on clinical samples can provide clinically relevant information and drastically reduce diagnostic times. This may prove very useful, but the need for data analysis is still a hurdle to clinical implementation. To overcome this problem, a publicly available bioinformatic tool was developed in this study.

  3. Consistency of direct microscopic examination and ELISA in detection of Giardia in stool specimen among children

    Directory of Open Access Journals (Sweden)

    Zohreh Torabi

    2014-09-01

    Full Text Available Objective: To investigate the consistency of direct microscopic examination and ELISA for determination of Giadia in stool specimen. Method: Study population consisted of children with any clinical symptoms of Giardia infestation since last two weeks. Fresh stool specimen was collected from each child. The stools specimens were assessed by two methods of direct microscopic examination and ELISA.The degree of agreement between direct stool exam and ELISA was calculated by Cohen's kappa coefficient. Results: In this study, 124 children with age range 2-12 years were investigated. A total of 64 (61.7% and 79 (65.7% of children had Giardia by direct stool exam and ELISA test respectively. There was association between frequency of constipation and Giardia infection (P=0.036. The Cohen's kappa coefficient calculated for degree of agreement between direct stool exam and ELISA showed κ=0.756 (P<0.001. Conclusions: The frequency of Giardia infection in symptomatic children was high and there was high agreement rate between ELISA and direct stool smear.

  4. On the Capacity of the Intensity-Modulation Direct-Detection Optical Broadcast Channel

    KAUST Repository

    Chaaban, Anas

    2016-01-12

    The capacity of the intensity-modulation directdetection optical broadcast channel (OBC) is investigated, under both average and peak intensity constraints. An outer bound on the capacity region is derived by adapting Bergmans’ approach to the OBC. Inner bounds are derived by using superposition coding with either truncated-Gaussian (TG) distributions or discrete distributions. While the discrete distribution achieves higher rates, the TG distribution leads to a simpler representation of the achievable rate region. At high signal-to-noise ratio (SNR), it is shown that the TG distribution is nearly optimal. It achieves the symmetric-capacity within a constant gap (independent of SNR), which approaches half a bit as the number of users grows. It also achieves the capacity region within a constant gap. At low SNR, it is shown that on-off keying (OOK) with time-division multipleaccess (TDMA) is optimal. This is interesting in practice since both OOK and TDMA have low complexity. At moderate SNR (typically [0,8] dB), a discrete distribution with a small alphabet size achieves fairly good performance.

  5. Diagnostic accuracy of intraoral film and direct digital images for detection of simulated recurrent decay.

    Science.gov (United States)

    Nair, M K; Ludlow, J B; May, K N; Nair, U P; Johnson, M P; Close, J M

    2001-01-01

    This study compared the diagnostic accuracy of bitewing images for detection of simulated recurrent caries using the following imaging modalities: Ektaspeed Plus film and different digital imaging system technologies comprised of a charge-coupled device (CCD) based digital imaging unit, a photo-stimulable phosphor (PSP) based unit and contrast- and brightness-enhanced PSP images. Twenty-four extracted posterior teeth with MOD inlay preparations were secured in models simulating a natural arrangement of teeth. Lesions were created in proximal boxes using dental burs of varying sizes. Defects were filled with wax and plaster and preparations were restored with composite or amalgam. Averages of receiver operating curve areas (Az) revealed diagnostic performances of Az = 0.74 for film, Az = 0.80 for CCD, Az = 0.73 for unenhanced PSP and Az = 0.64 for enhanced PSP. The differences between these means were significant (MANOVA p modalities. CCD performance was not significantly better than enhanced PSP. Lesions under radiopaque composite restorations were easier to detect, followed by those under amalgam and radiolucent composites across imaging modalities and lesion locations. Based on lesion location, those located at the buccal point angle were easiest to detect, followed by those at mid-gingival floor and lingual-point angle sites. Contrast and brightness-enhanced digital images enabled better signal detection and a comparable performance with film for detection of artificially induced recurrent caries.

  6. Optofluidic analysis system for amplification-free, direct detection of Ebola infection

    Science.gov (United States)

    Cai, H.; Parks, J. W.; Wall, T. A.; Stott, M. A.; Stambaugh, A.; Alfson, K.; Griffiths, A.; Mathies, R. A.; Carrion, R.; Patterson, J. L.; Hawkins, A. R.; Schmidt, H.

    2015-09-01

    The massive outbreak of highly lethal Ebola hemorrhagic fever in West Africa illustrates the urgent need for diagnostic instruments that can identify and quantify infections rapidly, accurately, and with low complexity. Here, we report on-chip sample preparation, amplification-free detection and quantification of Ebola virus on clinical samples using hybrid optofluidic integration. Sample preparation and target preconcentration are implemented on a PDMS-based microfluidic chip (automaton), followed by single nucleic acid fluorescence detection in liquid-core optical waveguides on a silicon chip in under ten minutes. We demonstrate excellent specificity, a limit of detection of 0.2 pfu/mL and a dynamic range of thirteen orders of magnitude, far outperforming other amplification-free methods. This chip-scale approach and reduced complexity compared to gold standard RT-PCR methods is ideal for portable instruments that can provide immediate diagnosis and continued monitoring of infectious diseases at the point-of-care.

  7. Development of paper-gate transistor toward direct detection from microbiological fluids

    Science.gov (United States)

    Kajisa, Taira; Sakata, Toshiya

    2017-04-01

    In this study, a paper-gate transistor was developed to detect glucose using an extended-gate field-effect transistor (FET). A filter paper was used as an extended gate electrode, in which Au nanoparticles (AuNPs) modified with phenylboronic acids (PBAs) were included. PBA-AuNPs play an important role as a support to not only be entrapped in cellulose fibrils but also bind to the targeted glucose in a paper. The surface properties of PBA-AuNPs were investigated to elucidate the electrical properties of the paper-gate electrode using an absorption spectrum and a zeta potential analysis. Moreover, the paper-gate electrode enabled us to detect glucose at the micromolar level on the basis of the principle of FET devices. A platform based on the paper-gate transistor is suitable for a highly sensitive system to detect glucose in trace samples such as tears, sweat, and saliva in the future.

  8. Proximal surface caries detection with direct-exposure and rare earth screen/film imaging

    Energy Technology Data Exchange (ETDEWEB)

    Lundeen, R.C.; McDavid, W.D.; Barnwell, G.M.

    1988-12-01

    This laboratory study compared five imaging systems for their diagnostic accuracy in detection of proximal surface dental caries. Ten viewers provided data on radiographic detectability of carious lesions. The diagnostic accuracy of each system was determined with receiver operating characteristic (ROC) curves by comparing viewer data with the true state of the teeth as determined microscopically. D-speed film marginally outperformed the other four systems, but the three screen/film systems matched the diagnostic accuracy of E-speed film. Radiation reductions between 62% and 92% were achieved with the screen/film systems when compared to the two conventional dental films. The feasibility of designing a screen/film bite-wing cassette was shown, but the poor diagnostic accuracy of the present bite-wing system indicated a need for a new technology in caries detection.

  9. "Salvage microbiology": detection of bacteria directly from clinical specimens following initiation of antimicrobial treatment.

    Directory of Open Access Journals (Sweden)

    John J Farrell

    Full Text Available PCR coupled with electrospray ionization mass spectrometry (ESI-MS is a diagnostic approach that has demonstrated the capacity to detect pathogenic organisms from culture negative clinical samples after antibiotic treatment has been initiated. [1] We describe the application of PCR/ESI-MS for detection of bacteria in original patient specimens that were obtained after administration of antibiotic treatment in an open investigation analysis.We prospectively identified cases of suspected bacterial infection in which cultures were not obtained until after the initiation of antimicrobial treatment. PCR/ESI-MS was performed on 76 clinical specimens that were submitted for conventional microbiology testing from 47 patients receiving antimicrobial treatment.In our series, 72% (55/76 of cultures obtained following initiation of antimicrobial treatment were non-diagnostic (45 negative cultures; and 10 respiratory specimens with normal flora (5, yeast (4, or coagulase-negative staphylococcus (1. PCR/ESR-MS detected organisms in 83% (39/47 of cases and 76% (58/76 of the specimens. Bacterial pathogens were detected by PCR/ESI-MS in 60% (27/45 of the specimens in which cultures were negative. Notably, in two cases of relapse of prosthetic knee infections in patients on chronic suppressive antibiotics, the previous organism was not recovered in tissue cultures taken during extraction of the infected knee prostheses, but was detected by PCR/ESI-MS.Molecular methods that rely on nucleic acid amplification may offer a unique advantage in the detection of pathogens collected after initiation of antimicrobial treatment and may provide an opportunity to target antimicrobial therapy and "salvage" both individual treatment regimens as well as, in select cases, institutional antimicrobial stewardship efforts.

  10. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  11. Sensitive Detection of Francisella tularensis Directly from Whole Blood by Use of the GeneXpert System.

    Science.gov (United States)

    Banada, Padmapriya P; Deshpande, Srinidhi; Chakravorty, Soumitesh; Russo, Riccardo; Occi, James; Meister, Gabriel; Jones, Kelly J; Gelhaus, Carl H; Valderas, Michelle W; Jones, Martin; Connell, Nancy; Alland, David

    2017-01-01

    Francisella tularensis is a potential bioterrorism agent that is highly infectious at very low doses. Diagnosis of tularemia by blood culture and nucleic acid-based diagnostic tests is insufficiently sensitive. Here, we demonstrate a highly sensitive F. tularensis assay that incorporates sample processing and detection into a single cartridge suitable for point-of-care detection. The assay limit of detection (LOD) and dynamic range were determined in a filter-based cartridge run on the GeneXpert system. F. tularensis DNA in buffer or CFU of F. tularensis was spiked into human or macaque blood. To simulate detection in human disease, the assay was tested on blood drawn from macaques infected with F. tularensis Schu S4 at daily intervals. Assay detection was compared to that with a conventional quantitative PCR (qPCR) assay and blood culture. The assay LOD was 0.1 genome equivalents (GE) per reaction and 10 CFU/ml F. tularensis in both human and macaque blood. In infected macaques, the assay detected F. tularensis on days 1 to 4 postinfection in 21%, 17%, 60%, and 83% of macaques, respectively, compared to conventional qPCR positivity rates of 0%, 0%, 30%, and 100% and CFU detection of blood culture at 0%, 0%, 0%, and 10% positive, respectively. Assay specificity was 100%. The new cartridge-based assay can rapidly detect F. tularensis in bloodstream infections directly in whole blood at the early stages of infection with a sensitivity that is superior to that of other methods. The simplicity of the automated testing procedures may make this test suitable for rapid point-of-care detection. Copyright © 2016 American Society for Microbiology.

  12. Indirect versus direct detection methods of Trichinella spp. infection in wild boar (Sus scrofa).

    Science.gov (United States)

    Gómez-Morales, Maria Angeles; Ludovisi, Alessandra; Amati, Marco; Bandino, Ennio; Capelli, Gioia; Corrias, Franco; Gelmini, Luca; Nardi, Alberigo; Sacchi, Cristina; Cherchi, Simona; Lalle, Marco; Pozio, Edoardo

    2014-04-07

    Trichinella spp. infections in wild boar (Sus scrofa), one of the main sources of human trichinellosis, continue to represent a public health problem. The detection of Trichinella spp. larvae in muscles of wild boar by digestion can prevent the occurrence of clinical trichinellosis in humans. However, the analytical sensitivity of digestion in the detection process is dependent on the quantity of tested muscle. Consequently, large quantities of muscle have to be digested to warrant surveillance programs, or more sensitive tests need to be employed. The use of indirect detection methods, such as the ELISA to detect Trichinella spp. infections in wild boar has limitations due to its low specificity. The aim of the study was to implement serological detection of anti-Trichinella spp. antibodies in meat juices from hunted wild boar for the surveillance of Trichinella spp. infections. Two tests were used, ELISA for the initial screening test, and a specific and sensitive Western blot (Wb) as a confirmatory test. The circulation of anti-Trichinella IgG was determined in hunted wild boar muscle juice samples in 9 provinces of 5 Italian regions. From 1,462 muscle fluid samples, 315 (21.5%, 95% C.I. 19.51-23.73) were tested positive by ELISA. The 315 ELISA-positive muscle fluid samples were further tested by Wb and 32 (10.1%, 95% C.I. 7.29-13.99) of these were positive with a final seroprevalence of 2.2% (95% C.I 1.55-3.07; 32/1,462). Trichinella britovi larvae were detected by artificial digestion in muscle tissues of one (0.07%, 95%C.I. 0.01-0.39) out of the 1,462 hunted wild boars. No Trichinella spp. larvae were detected in Wb-negative wild boar. From 2006 to 2012, a prevalence of 0.017% was detected by muscle digestion in wild boar hunted in the whole Italian territory. The combined use of both serological methods had a sensitivity 31.4 times higher than that of the digestion (32/1,462 versus 1/1,462), suggesting their potential use for the surveillance of the

  13. Detection of strep throat causing bacterium directly from medical swabs by touch spray-mass spectrometry.

    Science.gov (United States)

    Jarmusch, Alan K; Pirro, Valentina; Kerian, Kevin S; Cooks, R Graham

    2014-10-07

    Strep throat causing Streptococcus pyogenes was detected in vitro and in simulated clinical samples by performing touch spray ionization-mass spectrometry. MS analysis took only seconds to reveal characteristic bacterial and human lipids. Medical swabs were used as the substrate for ambient ionization. This work constitutes the initial step in developing a non-invasive MS-based test for clinical diagnosis of strep throat. It is limited to the single species, S. pyogenes, which is responsible for the vast majority of cases. The method is complementary to and, with further testing, a potential alternative to current methods of point-of-care detection of S. pyogenes.

  14. Preliminary evaluation of second harmonic direct detection scheme for low-dose range in alanine/EPR dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Felipe [Departamento de Fisica e Matematica, FFCLRP, Universidade de Sao Paulo, Ribeirao Preto, SP (Brazil); Departamento de Fisica, Facultad de Ciencias Naturales, Exactas y Tecnologia, Universidad de Panama (Panama); Departamento de Salud Radiologica, Caja de Seguro Social (Panama); Graeff, Carlos F.O.; Baffa, Oswaldo [Departamento de Fisica e Matematica, FFCLRP, Universidade de Sao Paulo, Ribeirao Preto, SP (Brazil)]. E-mail: baffa@ffclrp.usp.br

    2002-04-21

    The usefulness of a direct detection scheme of the second harmonic (2h) overmodulated signal from irradiated alanine in EPR dosimetry was studied. For this purpose, a group of DL-alanine/paraffin cylindrical pellets was produced. The dosimeters were irradiated with a {sup 60}Co radiotherapy gamma source with doses of 0.05, 0.1, 0.5, 1 and 5 Gy. The EPR measurements were carried out in a VARIAN-E4 spectrometer operating in X-band with optimized parameters to obtain highest amplitude signals of both harmonics. The 2h signal was detected directly at twice the modulation frequency. In preliminary results, the 2h showed some advantages over the 1h such as better resolution for doses below 1 Gy, better repeatability results and better linear behaviour in the dose range indicated. (author)

  15. Comparison of direct digital and conventional radiography for the detection of proximal surface caries in the mixed dentition.

    Science.gov (United States)

    Uprichard, K K; Potter, B J; Russell, C M; Schafer, T E; Adair, S; Weller, R N

    2000-01-01

    The aim of this study was to compare the performance of direct digital radiography and traditional dental radiography for the detection of proximal surface dental caries in the mixed dentition. 15 quadrants of extracted teeth, arranged from the primary canine to permanent first molar, were imaged using direct digital (Schick Technologies, Long Island City, NY, USA) and conventional films (D-speed and E-speed Plus; Eastman Kodak Co., Rochester, NY, USA). Five pediatric dentists viewed the images and scored the 270 proximal surfaces for presence of caries on a 5 point scale and extent of caries on a 4 point scale. The teeth were sectioned and viewed microscopically to determine the gold standard. Receiver operating characteristic (ROC) analysis and analysis of variance (ANOVA) were used to evaluate the viewer's performance for detecting proximal caries using the 3 different image receptor types. Experienced examiners were significantly more accurate in diagnosis of proximal surface caries using either D-speed or E-speed Plus films than they were using the direct digital receptor. The mean areas under the ROC curve (Az) for the viewers were 0.7595 for D-speed film, 0.7557 for E-speed Plus film, and 0.5928 for the direct digital receptor. The results also indicated that selected viewers' accuracy increased when viewing the direct digital images a second time. CCD based direct digital radiography was not as accurate as conventional film images for the purpose of diagnosing proximal surface caries in the mixed dentition. However, the results imply that with increased experience, direct digital images may be as accurate as conventional film based images for diagnosis.

  16. A Study of Nuclear Recoils in Liquid Argon Time Projection Chamber for the Direct Detection of WIMP Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Huajie [Princeton Univ., NJ (United States)

    2014-11-01

    Robust results of WIMP direct detection experiments depend on rm understandings of nuclear recoils in the detector media. This thesis documents the most comprehensive study to date on nuclear recoils in liquid argon - a strong candidate for the next generation multi-ton scale WIMP detectors. This study investigates both the energy partition from nuclear recoil energy to secondary modes (scintillation and ionization) and the pulse shape characteristics of scintillation from nuclear recoils.

  17. Wavelet Entropy and Directed Acyclic Graph Support Vector Machine for Detection of Patients with Unilateral Hearing Loss in MRI Scanning

    OpenAIRE

    Wang, Shuihua; Yang, Ming; Du, Sidan; Yang, Jiquan; Liu, Bin; Gorriz, Juan M.; Ramírez, Javier; Yuan, Ti-Fei; Zhang, Yudong

    2016-01-01

    Highlights We develop computer-aided diagnosis system for unilateral hearing loss detection in structural magnetic resonance imaging. Wavelet entropy is introduced to extract image global features from brain images. Directed acyclic graph is employed to endow support vector machine an ability to handle multi-class problems. The developed computer-aided diagnosis system achieves an overall accuracy of 95.1% for this three-class problem of differentiating left-sided and right-sided he...

  18. Component processes in contour integration: a direct comparison between snakes and ladders in a detection and a shape discrimination task.

    Science.gov (United States)

    Vancleef, Kathleen; Wagemans, Johan

    2013-11-01

    In contour integration, a relevant question is whether snakes and ladders are processed similarly. Higher presentation time thresholds for ladders in detection tasks indicate this is not the case. However, in a detection task only processing differences at the level of element linking and possibly contour localization might be picked up, while differences at the shape encoding level cannot be noticed. In this study, we make a direct comparison of detection and shape discrimination tasks to investigate if processing differences in the visual system between snakes and ladders are limited to contour detection or extend to higher level contour processing, like shape encoding. Stimuli consisted of elements that were oriented collinearly (snakes) or orthogonally (ladders) to the contour path and were surrounded by randomly oriented background elements. In two tasks, six experienced subjects either detected the contour when presented with a contour and a completely random stimulus or performed a shape discrimination task when presented with two contours with different curvature. Presentation time was varied in 9 steps between 8 and 492 ms. By applying a generalized linear mixed model we found that differences in snake and ladder processing are not limited to a detection stage but are also apparent at a shape encoding stage. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Evaluation of the usefulness of smartphone-directed applications for measuring heart rate and arrhythmia detection

    Directory of Open Access Journals (Sweden)

    Michał Witkowski

    2017-12-01

    Conclusions: The majority of the free applications, available for smartphones, are able to measure HR precisely in patients with sinus rhythm, while in patients with AF, the exact measurement is significantly impeded by HR deficits. Only one out of 16 applications was able to measure HR in a patient with AF. None of the available applications could detect AF.

  20. Simple Nanoimprinted Polymer Nanostructures for Uncooled Thermal Detection by Direct Surface Plasmon Resonance Imaging.

    Science.gov (United States)

    Hong, Brandon; Vallini, Felipe; Fang, Cheng-Yi; Alasaad, Amr; Fainman, Yeshaiahu

    2017-03-08

    We experimentally demonstrate the uncooled detection of long wavelength infrared (IR) radiation by thermal surface plasmon sensing using an all optical readout format. Thermal infrared radiation absorbed by an IR-sensitive material with high thermo-optic coefficient coated on a metal grating creates a refractive index change detectable by the shift of the supported surface plasmon resonance (SPR) measured optically in the visible spectrum. The interface localization of SPR modes and optical readout allow for submicrometer thin film transducers and eliminate complex readout integrated circuits, respectively, reducing form factor, leveraging robust visible detectors, and enabling low-cost imaging cameras. We experimentally present the radiative heat induced thermo-optic action detectable by SPR shift through imaging of a thermal source onto a bulk metal grating substrate with IR-absorptive silicon nitride coating. Toward focal plane array integration, a route to facile fabrication of pixelated metal grating structures by nanoimprint lithography is developed, where a stable polymer, parylene-C, serves as an IR-absorptive layer with a high thermo-optic coefficient. Experimental detection of IR radiation from real thermal sources imaged at infinity is demonstrated by our nanoimprinted polymer-SPR pixels with an estimated noise equivalent temperature difference of 21.9 K.

  1. Direct protein detection with a nano-interdigitated array gate MOSFET.

    Science.gov (United States)

    Tang, Xiaohui; Jonas, Alain M; Nysten, Bernard; Demoustier-Champagne, Sophie; Blondeau, Franoise; Prévot, Pierre-Paul; Pampin, Rémi; Godfroid, Edmond; Iñiguez, Benjamin; Colinge, Jean-Pierre; Raskin, Jean-Pierre; Flandre, Denis; Bayot, Vincent

    2009-08-15

    A new protein sensor is demonstrated by replacing the gate of a metal oxide semiconductor field effect transistor (MOSFET) with a nano-interdigitated array (nIDA). The sensor is able to detect the binding reaction of a typical antibody Ixodes ricinus immunosuppressor (anti-Iris) protein at a concentration lower than 1 ng/ml. The sensor exhibits a high selectivity and reproducible specific detection. We provide a simple model that describes the behavior of the sensor and explains the origin of its high sensitivity. The simulated and experimental results indicate that the drain current of nIDA-gate MOSFET sensor is significantly increased with the successive binding of the thiol layer, Iris and anti-Iris protein layers. It is found that the sensor detection limit can be improved by well optimizing the geometrical parameters of nIDA-gate MOSFET. This nanobiosensor, with real-time and label-free capabilities, can easily be used for the detection of other proteins, DNA, virus and cancer markers. Moreover, an on-chip associated electronics nearby the sensor can be integrated since its fabrication is compatible with complementary metal oxide semiconductor (CMOS) technology.

  2. Rapid whole genome sequencing for the detection and characterization of microorganisms directly from clinical samples

    DEFF Research Database (Denmark)

    Hasman, Henrik; Saputra, Dhany; Sicheritz-Pontén, Thomas

    2014-01-01

    Whole genome sequencing (WGS) is becoming available as a routine tool for clinical microbiology. If applied directly on clinical samples this could further reduce diagnostic time and thereby improve control and treatment. A major bottle-neck is the availability of fast and reliable bioinformatics...... microbiology, WGS of isolated bacteria and by directly sequencing on pellets from the urine. A rapid method for analyzing the sequence data was developed. Bacteria were cultivated from 19 samples, but only in pure culture from 17. WGS improved the identification of the cultivated bacteria and almost complete...

  3. INS/EKF-based stride length, height and direction intent detection for walking assistance robots.

    Science.gov (United States)

    Brescianini, Dario; Jung, Jun-Young; Jang, In-Hun; Park, Hyun Sub; Riener, Robert

    2011-01-01

    We propose an algorithm used to obtain the information on stride length, height difference, and direction based on user's intent during walking. For exoskeleton robots used to assist paraplegic patients' walking, this information is used to generate gait patterns by themselves in on-line. To obtain this information, we attach an inertial measurement unit(IMU) on crutches and apply an extended kalman filter-based error correction method to reduce the phenomena of drift due to bias of the IMU. The proposed method is verifed in real walking scenarios including walking, climbing up-stairs, and changing direction of walking with normal. © 2011 IEEE

  4. High-Throughput Direct Fecal PCR Assay for Detection of Mycobacterium avium subsp. paratuberculosis in Sheep and Cattle

    Science.gov (United States)

    Waldron, Anna M.; Galea, Francesca; Whittington, Ann-Michele; Saunders, Vanessa F.; Begg, Douglas J.; de Silva, Kumudika; Purdie, Auriol C.; Whittington, Richard J.

    2014-01-01

    Johne's disease (JD) is a chronic enteric disease caused by Mycobacterium avium subsp. paratuberculosis that affects ruminants. Transmission occurs by the fecal-oral route. A commonly used antemortem diagnostic test for the detection of M. avium subsp. paratuberculosis in feces is liquid culture; however, a major constraint is the 2- to 3-month incubation period needed for this method. Rapid methods for the detection of M. avium subsp. paratuberculosis based on PCR have been reported, but comprehensive validation data are lacking. We describe here a new test, the high-throughput-Johnes (HT-J), to detect M. avium subsp. paratuberculosis in feces. Its diagnostic accuracy was compared with that of liquid radiometric (Bactec) fecal culture using samples from cattle (1,330 samples from 23 herds) and sheep (596 samples from 16 flocks). The multistage protocol involves the recovery of M. avium subsp. paratuberculosis cells from a fecal suspension, cell rupture by bead beating, extraction of DNA using magnetic beads, and IS900 quantitative PCR. The limit of detection of the assay was 0.0005 pg, and the limit of quantification was 0.005 pg M. avium subsp. paratuberculosis genomic DNA. Only M. avium subsp. paratuberculosis was detected from a panel of 51 mycobacterial isolates, including 10 with IS900-like sequences. Of the 549 culture-negative fecal samples from unexposed herds and flocks, 99% were negative in the HT-J test, while 60% of the bovine- and 84% of the ovine-culture-positive samples were positive in the HT-J test. As similar total numbers of samples from M. avium subsp. paratuberculosis-exposed animals were positive in culture and HT-J tests in both species, and as the results of a McNemar's test were not significant, these methods probably have similar sensitivities, but the true diagnostic sensitivities of these tests are unknown. These validation data meet the consensus-based reporting standards for diagnostic test accuracy studies for paratuberculosis and

  5. Prospective multicentre evaluation of the direct nitrate reductase assay for the rapid detection of extensively drug-resistant tuberculosis.

    Science.gov (United States)

    Martin, Anandi; Imperiale, Belen; Ravolonandriana, Pascaline; Coban, Ahmet Yilmaz; Akgunes, Alper; Ikram, Aamer; Satti, Luqman; Odoun, Mathieu; Pandey, Pooja; Mishra, Manvi; Affolabi, Dissou; Singh, Urvashi; Rasolofo, Voahangy; Morcillo, Nora; Vandamme, Peter; Palomino, Juan Carlos

    2014-02-01

    To perform a multicentre study evaluating the performance of the direct nitrate reductase assay (NRA) for the detection of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis in sputum samples. The study was conducted in six laboratories performing tuberculosis diagnosis that were located in six different countries. The NRA was performed directly on sputum samples in parallel with the reference method used at each site. Detection of resistance was performed for rifampicin, isoniazid, ofloxacin and kanamycin. Excellent agreement was obtained for all drugs tested at the majority of sites. The accuracy was 93.7%-100% for rifampicin, 88.2%-100% for isoniazid, 94.6%-100% for ofloxacin and 100% for kanamycin. The majority of NRA results were available at day 21 for sites 1, 2 and 5. Site 3 had a turnaround time of 13.9 days, at site 4 it was 18.4 days and at site 6 it was 16.2 days. The contamination rate ranged between 2.5% and 12%. Rapid detection of drug resistance by the direct NRA on sputum smear-positive samples was accurate and easy to implement in clinical diagnostic laboratories, making it a good alternative for rapid screening for MDR and XDR tuberculosis.

  6. Development of a direct blood-based PCR system to detect BLV provirus using CoCoMo primers.

    Science.gov (United States)

    Takeshima, Shin-Nosuke; Watanuki, Sonoko; Ishizaki, Hiroshi; Matoba, Kazuhiro; Aida, Yoko

    2016-06-01

    Bovine leukemia virus (BLV), the etiologic agent of enzootic bovine leucosis, has caused pandemic outbreaks worldwide. Because transcription of the BLV is quickly blocked after infection, detecting integrated provirus at host genome is an important method of identifying whether an animal is infected. The aim of the present study was to develop a novel direct blood-based PCR system to detect the BLV provirus with high specificity and at low cost. The assay was based on the BLV-CoCoMo degenerate primers, which amplify all known BLV strains. Cattle blood samples (n = 182) were collected from the same BLV-positive farm and subjected to BLV-CoCoMo-direct-PCR to detect the BLV provirus. The proviral load was then estimated. This novel PCR method showed 100 % specificity. The BLV-CoCoMo-direct-PCR can be used in a variety of laboratory situations because it does not require expensive equipment/reagents, DNA purification, or a second round of PCR. Therefore, the method is extremely cost-effective and the risk of a false-positive result due to DNA contamination is very low.

  7. Direct electrospray ion current monitoring detection and its use with on-line capillary electrophoresis mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Wahl, J.H.; Hofstadler, S.A.; Smith, R.D. (Pacific Northwest Lab., Richland, WA (United States))

    1995-01-15

    A novel detection scheme for use with the capillary electrophoresis-electrospray ionization interface is presented, based upon the direct measurement of electrospray ion current after expansion into vacuum, that is shown to provide the basis for a simple detector or for simultaneous dual detection with mass spectrometry. The utility of this novel dual-detection scheme is illustrated with capillary electrophoresis Fourier transform ion cyclotron resonance (FTICR) mass spectrometry in which spectra are acquired only when a solute zone elutes from the CE capillary. This acquisition scheme affords significantly improved sensitivity and permits the acquisition of longer time domain signals without sacrificing separation efficiency. Mass resolving power in excess of 10[sup 5] (fwhm) is demonstrated by FTICR for components from a peptide/protein mixture comprised of analytes with molecular masses ranging from 2 to 29 kDa. 24 refs., 3 figs.

  8. Electrochemical detection of uric acid using ruthenium-dioxide-coated carbon nanotube directly grown onto Si wafer

    Science.gov (United States)

    Shih, Yi-Ting; Lee, Kuei-Yi; Lin, Chung-Kuang

    2015-12-01

    Carbon nanotubes (CNTs) directly grown onto a Si substrate by thermal chemical vapor deposition were used in uric acid (UA) detection. The process is simple and formation is easy without the need for additional chemical treatments. However, CNTs lack selectivity and sensitivity to UA. To enhance the electrochemical analysis, ruthenium oxide was used as a catalytic mediator in the modification of electrodes. The electrochemical results show that RuO2 nanostructures coated onto CNTs can strengthen the UA signal. The peak currents of RuO2 nanostructures coated onto CNTs linearly increase with increasing UA concentration, meaning that they can work as electrodes for UA detection. The lowest detection limit and highest sensitivity were 55 nM and 4.36 µA/µM, respectively. Moreover, the characteristics of RuO2 nanostructures coated onto CNTs were examined by scanning electron microscopy, transmission electron microscopy, and Raman spectroscopy.

  9. A sensitive capacitive immunosensor for direct detection of human heart fatty acid-binding protein (h-FABP).

    Science.gov (United States)

    Mihailescu, Carmen-Marinela; Stan, Dana; Iosub, Rodica; Moldovan, Carmen; Savin, Mihaela

    2015-01-01

    The fabrication of a capacitive interdigitated immunosensor (CID) based on a mixed self-assembled monolayer (mSAM) film for the direct detection of heart fatty-acid binding protein (h-FABP) without any labeling is described. The capacitance changes of mSAMs vs. homogenous ordered self-assembled monolayers (hSAMs) on gold work electrodes/covalently bonded antibodies/buffered medium are utilized for monitoring the specific antibody-antigen interaction. Capacitance measurements in the absence and presence of Faradaic currents were performed. The electrochemical properties of mixed monolayers were compared with those of a pure monolayer of 11-mercaptoundecanoic acid (MUA) self-assembled on gold surfaces. Taking into account the stability of the studied monolayers during the electrochemical experiments with the Faradaic process, the best SAM functionalization method was used for developing a sensitive capacitive immunosensor with a non-Faradaic process for direct immune detection of human h-FABP. Under the optimized conditions, the proposed mixed self-assembled monolayer (mSAM1) on gold electrode exhibited good insulating properties such as a capacitive behavior when detecting h-FABP from human serum in the range of 98 pg ml(-1)-100 ng ml(-1), with a detection limit of 0.836 ng ml(-1) comparative with a homogenous self-assembled monolayer (hSAM). Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    that both is highly accurate and enables multiplexing. A current bottleneck for direct genome analyses by minisequencing, however, is the sensitivity, since minisequencing relies on linear signal amplification. Here, we present SNPtrap, which is a novel approach that combines the specificity and possibility...

  11. Exploiting direct and indirect methods for the detection of the total carotenoid content in dried pasta

    NARCIS (Netherlands)

    Doka, O.; Bicanic, D.D.; Végvári, G.; Buijnsters, J.G.; Spruijt, R.B.; Luterotti, S.

    2010-01-01

    The total carotenoid concentration (TCC) of several commercially available dried pastas prepared with or without eggs was assessed by means of the two well-established destructive approaches [spectrophotometry (SP) and high-performance liquid chromatography (HPLC)] and three non-destructive, direct

  12. Indirect and direct detection prospects for TeV dark matter in the nine parameter MSMM

    NARCIS (Netherlands)

    Cabrera-Catalan, M.E.; Ando, S.; Weniger, C.; Zandanel, F.

    2015-01-01

    We investigate the prospects of indirect and direct dark matter searches within the minimal supersymmetric standard model with nine parameters (MSSM-9). These nine parameters include three gaugino masses, Higgs, slepton and squark masses, all treated independently. We perform a Bayesian Monte Carlo

  13. Prenatal diagnosis of autosomal dominant hereditary spastic paraplegia (SPG4) using direct mutation detection

    DEFF Research Database (Denmark)

    Nielsen, Jørgen E; Koefoed, Pernille; Kjaergaard, Susanne

    2004-01-01

    OBJECTIVE: To present a report on prenatal diagnosis using direct SPG4 gene analysis in a family with autosomal dominant hereditary spastic paraplegia (AD-HSP). METHODS: Genetic linkage and haplotype analysis were previously carried out with chromosome 2p markers. DNA was obtained from affected...

  14. The Effects of Constraints in a Mathematics Classroom

    Science.gov (United States)

    Stokes, Patricia D.

    2013-01-01

    The dictionary definition of constraint is one-sided, solely restrictive. The problem-solving definition is two-sided. Constraints come in pairs. One retains its restrictive function, precluding something specific; the other directs search for its substitute. The paired constraint model is applied to both domain and classroom. I discuss the…

  15. Broad-Range Detection of Microorganisms Directly from Bronchoalveolar Lavage Specimens by PCR/Electrospray Ionization-Mass Spectrometry.

    Directory of Open Access Journals (Sweden)

    Måns Ullberg

    Full Text Available The clinical demand on rapid microbiological diagnostic is constantly increasing. PCR coupled to electrospray ionization-mass spectrometry, PCR/ESI-MS, offers detection and identification of over 750 bacteria and Candida species directly from clinical specimens within 6 hours. In this study, we investigated the clinical performance of the IRIDICA BAC LRT Assay for detection of bacterial pathogens in 121 bronchoalveolar lavage (BAL samples that were received consecutively at our bacterial laboratory for BAL culture. Commensal or pathogenic microorganisms were detected in 118/121 (98% BAL samples by PCR/ESI-MS, while in 104/121 (86% samples by routine culture (P<0.01. Detection of potentially pathogenic microorganisms by PCR/ESI-MS was evaluated in comparison with conventional culture-based or molecular methods. The agreement between positive findings was overall good. Most Staphylococcus aureus-positive PCR/ESI-MS results were confirmed by culture or species-specific PCR (27/33, 82%. The identity of Streptococcus pneumoniae could however be confirmed for only 6/17 (35% PCR/ESI-MS-positive samples. Non-cultivable and fastidious pathogens, which were not covered by standard culture procedures were readily detected by PCR/ESI-MS, including Legionella pneumophila, Bordetella pertussis, Norcadia species and Mycoplasma pneumoniae. In conclusion, PCR/ESI-MS detected a broad range of potential pathogens with equal or superior sensitivity compared to conventional methods within few hours directly from BAL samples. This novel method might thus provide a relevant tool for diagnostics in critically ill patients.

  16. Detection of direct and indirect noise generated by synthetic hot spots in a duct

    Science.gov (United States)

    De Domenico, Francesca; Rolland, Erwan O.; Hochgreb, Simone

    2017-04-01

    Sound waves in a combustor are generated from fluctuations in the heat release rate (direct noise) or the acceleration of entropy, vorticity or compositional perturbations through nozzles or turbine guide vanes (indirect or entropy noise). These sound waves are transmitted downstream as well as reflected upstream of the acceleration point, contributing to the overall noise emissions, or triggering combustion instabilities. Previous experiments attempted to isolate indirect noise by generating thermoacoustic hot spots electrically and measuring the transmitted acoustic waves, yet there are no measurements on the backward propagating entropy and acoustic waves. This work presents the first measurements which clearly separate the direct and indirect noise contributions to pressure fluctuations upstream of the acceleration point. Synthetic entropy spots are produced by unsteady electrical heating of a grid of thin wires located in a tube. Compression waves (direct noise) are generated from this heating process. The hot spots are then advected with the mean flow and finally accelerated through an orifice plate located at the end of the tube, producing a strong acoustic signature which propagates upstream (indirect noise). The convective time is selected to be longer than the heating pulse length, in order to obtain a clear time separation between direct and indirect noise in the overall pressure trace. The contribution of indirect noise to the overall noise is shown to be non-negligible either in subsonic or sonic throat conditions. However, the absolute amplitude of direct noise is larger than the corresponding fraction of indirect noise, explaining the difficulty in clearly identifying the two contributions when they are merged. Further, the work shows the importance of using appropriate pressure transducer instrumentation and correcting for the respective transfer functions in order to account for low frequency effects in the determination of pressure fluctuations.

  17. ICA analysis of fMRI with real-time constraints: an evaluation of fast detection performance as function of algorithms, parameters and a priori conditions.

    Science.gov (United States)

    Soldati, Nicola; Calhoun, Vince D; Bruzzone, Lorenzo; Jovicich, Jorge

    2013-01-01

    Independent component analysis (ICA) techniques offer a data-driven possibility to analyze brain functional MRI data in real-time. Typical ICA methods used in functional magnetic resonance imaging (fMRI), however, have been until now mostly developed and optimized for the off-line case in which all data is available. Real-time experiments are ill-posed for ICA in that several constraints are added: limited data, limited analysis time and dynamic changes in the data and computational speed. Previous studies have shown that particular choices of ICA parameters can be used to monitor real-time fMRI (rt-fMRI) brain activation, but it is unknown how other choices would perform. In this rt-fMRI simulation study we investigate and compare the performance of 14 different publicly available ICA algorithms systematically sampling different growing window lengths (WLs), model order (MO) as well as a priori conditions (none, spatial or temporal). Performance is evaluated by computing the spatial and temporal correlation to a target component as well as computation time. Four algorithms are identified as best performing (constrained ICA, fastICA, amuse, and evd), with their corresponding parameter choices. Both spatial and temporal priors are found to provide equal or improved performances in similarity to the target compared with their off-line counterpart, with greatly reduced computation costs. This study suggests parameter choices that can be further investigated in a sliding-window approach for a rt-fMRI experiment.

  18. Detecting and monitoring of water inrush in tunnels and coal mines using direct current resistivity method: A review

    Directory of Open Access Journals (Sweden)

    Shucai Li

    2015-08-01

    Full Text Available Detecting, real-time monitoring and early warning of underground water-bearing structures are critically important issues in prevention and mitigation of water inrush hazards in underground engineering. Direct current (DC resistivity method is a widely used method for routine detection, advanced detection and real-time monitoring of water-bearing structures, due to its high sensitivity to groundwater. In this study, the DC resistivity method applied to underground engineering is reviewed and discussed, including the observation mode, multiple inversions, and real-time monitoring. It is shown that a priori information constrained inversion is desirable to reduce the non-uniqueness of inversion, with which the accuracy of detection can be significantly improved. The focused resistivity method is prospective for advanced detection; with this method, the flanking interference can be reduced and the detection distance is increased subsequently. The time-lapse resistivity inversion method is suitable for the regions with continuous conductivity changes, and it can be used to monitor water inrush in those regions. Based on above-mentioned features of various methods in terms of benefits and limitations, we propose a three-dimensional (3D induced polarization method characterized with multi-electrode array, and introduce it into tunnels and mines combining with real-time monitoring with time-lapse inversion and cross-hole resistivity method. At last, the prospective applications of DC resistivity method are discussed as follows: (1 available advanced detection technology and instrument in tunnel excavated by tunnel boring machine (TBM, (2 high-resolution detection method in holes, (3 four-dimensional (4D monitoring technology for water inrush sources, and (4 estimation of water volume in water-bearing structures.

  19. Stretchable Complementary Split Ring Resonator (CSRR-Based Radio Frequency (RF Sensor for Strain Direction and Level Detection

    Directory of Open Access Journals (Sweden)

    Seunghyun Eom

    2016-10-01

    Full Text Available In this paper, we proposed a stretchable radio frequency (RF sensor to detect strain direction and level. The stretchable sensor is composed of two complementary split ring resonators (CSRR with microfluidic channels. In order to achieve stretchability, liquid metal (eutectic gallium-indium, EGaIn and Ecoflex substrate are used. Microfluidic channels are built by Ecoflex elastomer and microfluidic channel frames. A three-dimensional (3D printer is used for fabrication of microfluidic channel frames. Two CSRR resonators are designed to resonate 2.03 GHz and 3.68 GHz. When the proposed sensor is stretched from 0 to 8 mm along the +x direction, the resonant frequency is shifted from 3.68 GHz to 3.13 GHz. When the proposed sensor is stretched from 0 to 8 mm along the −x direction, the resonant frequency is shifted from 2.03 GHz to 1.78 GHz. Therefore, we can detect stretched length and direction from independent variation of two resonant frequencies.

  20. Agreement between Direct Fluorescent Microscopy and Ziehl-Neelsen Concentration Techniques in Detection of Pulmonary Tuberculosis in Northwest Ethiopia.

    Science.gov (United States)

    Workineh, Meseret; Maru, Mandie; Seman, Ibrahim; Bezu, Ziyadu; Negash, Markos; Melku, Mulugeta; Gize, Addisu; Shibabaw, Agumas

    2017-09-01

    The sensitivity of smear microscopy for diagnosis of tuberculosis might be improved through treatment of sputum with sodium hypochlorite and application of fluorescent microscopy. This study aimed to determine the agreement between direct Fluorescent Microscopy and Ziehl-Neelsen concentration technique by their ability of detecting acid fast bacilli in resource poor settings. A cross sectional study was conducted at Gondar University Referral Hospital, Northwest Ethiopia. Three sputum specimens were collected from consecutive TB suspects. Direct and concentrated sputum smears were air-dried, heat-fixed and stained by auramine O and Ziehl-Neelsen staining techniques respectively. The stained slides were examined for acid fast bacilli using direct Fluorescent Microscopy and Ziehl-Neelsen concentration techniques. Of 293 specimens, 4.4% and 2.4 % were AFB positive by direct fluorescent microscopy and Ziehl-Neelsen bleach concentrated techniques respectively. There was high percentage of tuberculosis positivity from early morning sputum samples (2.4%) compared to first spot (1.4%) and second spot (1.7%) sputum samples when using Ziehl-Neelsen sodium hypochlorite concentration technique. A moderate agreement was seen between the two methods (Kappa=0.484, P valuefluorescent microscopy has shown high positivity rate compared to Ziehl-Neelsen concentration technique. A moderate agreement was seen between the two methods. Thus, Ziehl-Neelsen bleach sedimentation technique is recommended for detection of pulmonary tuberculosis at peripheral health service level when Fluorescent Microscopy is not available.

  1. Sensitive impedimetric biosensor for direct detection of diazinon based on lipases

    Directory of Open Access Journals (Sweden)

    Nicole J Jaffrezic-Renault

    2014-07-01

    Full Text Available Two novel impedimetric biosensors for highly sensitive and rapid quantitative detection of diazinon in an aqueous medium were developed using two types of lipase, from Candida Rugosa (microbial source (CRL and from porcine pancreas (animal source (PPL immobilized onto a functionalized gold electrode. The lipase is characterized to specifically catalyze the hydrolysis of ester functions leading to the transformation of diazinon into diethyl phosphorothioic acid (DETP and 2-isopropyl-4-methyl-6-hydroxypyrimidine (IMHP. The developed biosensors both presented a large wide range of linearity up to 50µM with a detection limit of 10 nM for the CRL biosensor and 0.1 µM for the PPL biosensor. A comparative study was carried out between the two biosensors and results showed higher sensitivity for the CRL sensor. Moreover, it presented good accuracy and reproducibility, and had very good storage and multiple use stability for 25 days when stored at 4°C.

  2. The Direct Detection and Characterization of M-dwarf Planets Using Light Echoes

    Science.gov (United States)

    Sparks, William B.; White, Richard L.; Lupu, Roxana E.; Ford, Holland C.

    2018-02-01

    Exoplanets orbiting M-dwarf stars are a prime target in the search for life in the universe. M-dwarf stars are active, with powerful flares that could adversely impact prospects for life, though there are counter-arguments. Here, we turn flaring to advantage and describe ways in which it can be used to enhance the detectability of planets, in the absence of transits or a coronagraph, significantly expanding the accessible discovery and characterization space. Flares produce brief bursts of intense luminosity, after which the star dims. Due to the light travel time between the star and planet, the planet receives the high-intensity pulse, which it re-emits through scattering (a light echo) or intrinsic emission when the star is much fainter, thereby increasing the planet’s detectability. The planet’s light-echo emission can potentially be discriminated from that of the host star by means of a time delay, Doppler shift, spatial shift, and polarization, each of which can improve the contrast of the planet to the star. Scattered light can reveal the albedo spectrum of the planet to within a size scale factor, and is likely to be polarized. Intrinsic emission mechanisms include fluorescent pumping of multiple molecular hydrogen and neutral oxygen lines by intense Lyα and Lyβ flare emission, recombination radiation of ionized and photodissociated species, and atmospheric processes such as terrestrial upper atmosphere airglow and near-infrared hydroxyl emission. We discuss the feasibility of detecting light echoes and find that light echo detection is possible under favorable circumstances.

  3. Network analysis to detect common strategies in Italian foreign direct investment

    Science.gov (United States)

    De Masi, G.; Giovannetti, G.; Ricchiuti, G.

    2013-03-01

    In this paper we reconstruct and discuss the network of Italian firms investing abroad, exploiting information from complex network analysis. This method, detecting the key nodes of the system (both in terms of firms and countries of destination), allows us to single out the linkages among firms without ex-ante priors. Moreover, through the examination of affiliates’ economic activity, it allows us to highlight different internationalization strategies of “leaders” in different manufacturing sectors.

  4. Detection of strep throat causing bacterium directly from medical swabs by touch spray - mass spectrometry

    OpenAIRE

    Jarmusch, Alan K.; Pirro, Valentina; Kerian, Kevin S.; Cooks, Graham

    2014-01-01

    Strep throat causing Streptococcus pyogenes was detected in vitro and in simulated clinical samples by performing touch spray ionization - mass spectrometry. MS analysis took only seconds to reveal characteristic bacterial and human lipids. Medical swabs were used as the substrate for ambient ionization. This work constitutes the initial step in developing a noninvasive MS-based test for clinical diagnosis of strep throat. It is limited to the single species, S. pyogenes, which is responsible...

  5. Gold Nanoparticles as a Direct and Rapid Sensor for Sensitive Analytical Detection of Biogenic Amines

    Science.gov (United States)

    El-Nour, K. M. A.; Salam, E. T. A.; Soliman, H. M.; Orabi, A. S.

    2017-03-01

    A new optical sensor was developed for rapid screening with high sensitivity for the existence of biogenic amines (BAs) in poultry meat samples. Gold nanoparticles (GNPs) with particle size 11-19 nm function as a fast and sensitive biosensor for detection of histamine resulting from bacterial decarboxylation of histidine as a spoilage marker for stored poultry meat. Upon reaction with histamine, the red color of the GNPs converted into deep blue. The appearance of blue color favorably coincides with the concentration of BAs that can induce symptoms of poisoning. This biosensor enables a semi-quantitative detection of analyte in real samples by eye-vision. Quality evaluation is carried out by measuring histamine and histidine using different analytical techniques such as UV-vis, FTIR, and fluorescence spectroscopy as well as TEM. A rapid quantitative readout of samples by UV-vis and fluorescence methods with standard instrumentation were proposed in a short time unlike chromatographic and electrophoretic methods. Sensitivity and limit of detection (LOD) of 6.59 × 10-4 and 0.6 μM, respectively, are determined for histamine as a spoilage marker with a correlation coefficient ( R 2) of 0.993.

  6. Evaluation of Simplexa™ Group A Strep Direct Kit compared to Hologic® Group A streptococcal direct assay for detection of Group A Streptococcus (GAS) in throat swabs.

    Science.gov (United States)

    Church, Deirdre L; Lloyd, Tracie; Larios, Oscar; Gregson, Daniel B

    2018-01-05

    Diagnosis of bacterial pharyngitis is confirmed by detection of Group A Streptococcus (GAS) in patient throat samples. Testing of throat samples has historically relied on culture but new molecular methods allow much faster test turnaround time (i.e., same day vs. 48-72h for culture). Our laboratory uses the Hologic® GAS Direct (GASD) assay for screening more than 125,000 throat samples per annum. Simplexa™ GAS Direct is a new real-time PCR (qPCR) assay that does not require initial DNA extraction. Performance of Simplexa qPCR was compared to GASD. 289 throat swabs were collected from patients attending ambulatory clinics in Calgary. A total of 60 (20.8%) of the samples were initially GAS positive by either method; 54 by both methods, 4 by Simplex qPCR alone, and 2 by GASD alone. An in-house PCR using a unique GAS primer set was used to resolve the 6 discrepant results. Overall, GASD compared to Simplexa qPCR had sensitivity, specificity, positive predictive value and negative predictive value of 93.1% vs 100%, 100% vs. 100%, 100% vs. 100% and 98.31% vs. 100% respectively. Implementation of Simplexa qPCR in our laboratory setting would cost more but allow the high sample volume to be reported in half the time and save 0.62 MLT FTE. In comparison to culture, the implementation of Simplexa qPCR would save 2.79 MLA FTE plus 0.94 MLT FTE. Simplexa qPCR has improved performance and diagnostic efficiency in a high-volume laboratory compared to GASD for GAS detection in throat swabs. Copyright © 2018 American Society for Microbiology.

  7. Direct detection of the parametrically generated half-harmonic voltage in a Josephson tunnel junction

    DEFF Research Database (Denmark)

    Mygind, Jesper; Pedersen, Niels Falsig; Sørensen, O. H.

    1976-01-01

    The first direct observation of the parametrically generated half-harmonic voltage in a Josephson tunnel junction is reported. A microwave signal at f=17.25 GHz is applied to the junction dc current biased at zero voltage such that the Josephson plasma resonance fp=f/2. Under these conditions a l...... a large-amplitude microwave signal is emitted at fp provided the input power exceeds a threshold value. The results are compared to existing theory. Applied Physics Letters is copyrighted by The American Institute of Physics.......The first direct observation of the parametrically generated half-harmonic voltage in a Josephson tunnel junction is reported. A microwave signal at f=17.25 GHz is applied to the junction dc current biased at zero voltage such that the Josephson plasma resonance fp=f/2. Under these conditions...

  8. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  9. Rapid detection of sugar alcohol precursors and corresponding nitrate ester explosives using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Sisco, Edward; Forbes, Thomas P

    2015-04-21

    This work highlights the rapid detection of nitrate ester explosives and their sugar alcohol precursors by direct analysis in real time mass spectrometry (DART-MS) using an off-axis geometry. Demonstration of the effect of various parameters, such as ion polarity and in-source collision induced dissociation (CID) on the detection of these compounds is presented. Sensitivity of sugar alcohols and nitrate ester explosives was found to be greatest in negative ion mode with sensitivities ranging from hundreds of picograms to hundreds of nanograms, depending on the characteristics of the particular molecule. Altering the in-source CID potential allowed for acquisition of characteristic molecular ion spectra as well as fragmentation spectra. Additional studies were completed to identify the role of different experimental parameters on the sensitivity for these compounds. Variables that were examined included the DART gas stream temperature, the presence of a related compound (i.e., the effect of a precursor on the detection of a nitrate ester explosive), incorporation of dopant species and the role of the analysis surface. It was determined that each variable affected the response and detection of both sugar alcohols and the corresponding nitrate ester explosives. From this work, a rapid and sensitive method for the detection of individual sugar alcohols and corresponding nitrate ester explosives, or mixtures of the two, has been developed, providing a useful tool in the real-world identification of homemade explosives.

  10. Direct Detection of Rifampin and Isoniazid Resistance in Sputum Samples from Tuberculosis Patients by High-Resolution Melt Curve Analysis

    Science.gov (United States)

    Anthwal, Divya; Gupta, Rakesh Kumar; Bhalla, Manpreet; Bhatnagar, Shinjini

    2017-01-01

    ABSTRACT Drug-resistant tuberculosis (TB) is a major threat to TB control worldwide. Globally, only 40% of the 340,000 notified TB patients estimated to have multidrug-resistant-TB (MDR-TB) were detected in 2015. This study was carried out to evaluate the utility of high-resolution melt curve analysis (HRM) for the rapid and direct detection of MDR-TB in Mycobacterium tuberculosis in sputum samples. A reference plasmid library was first generated of the most frequently observed mutations in the resistance-determining regions of rpoB, katG, and an inhA promoter and used as positive controls in HRM. The assay was first validated in 25 MDR M. tuberculosis clinical isolates. The assay was evaluated on DNA isolated from 99 M. tuberculosis culture-positive sputum samples that included 84 smear-negative sputum samples, using DNA sequencing as gold standard. Mutants were discriminated from the wild type by comparing melting-curve patterns with those of control plasmids using HRM software. Rifampin (RIF) and isoniazid (INH) monoresistance were detected in 11 and 21 specimens, respectively, by HRM. Six samples were classified as MDR-TB by sequencing, one of which was missed by HRM. The HRM-RIF, INH-katG, and INH-inhA assays had 89% (95% confidence interval [CI], 52, 100%), 85% (95% CI, 62, 97%), and 100% (95% CI, 74, 100%) sensitivity, respectively, in smear-negative samples, while all assays had 100% sensitivity in smear-positive samples. All assays had 100% specificity. Concordance of 97% to 100% (κ value, 0.9 to 1) was noted between sequencing and HRM. Heteroresistance was observed in 5 of 99 samples by sequencing. In conclusion, the HRM assay was a cost-effective (Indian rupee [INR]400/US$6), rapid, and closed-tube method for the direct detection of MDR-TB in sputum, especially for direct smear-negative cases. PMID:28330890

  11. Direct detection of common and rare inversion mutations in the genetic diagnosis of severe hemophilia A

    Energy Technology Data Exchange (ETDEWEB)

    Windsor, A.S.; Lillicrap, D.P.; Taylor, S.A.M. [Queen`s Univ., Ontario (Canada)

    1994-09-01

    Approximately 50% of the cases of severe hemophilia A (factor VIII:C < 0.01 units/ml) may be due to gross rearrangements of the factor VIII gene. The mutation involves homologous sequences upstream of the factor VIII locus and within intron 22 in an intrachromosomal recombination, inversion, event. The rearrangements can readily be detected on a Southern blot using a probe that is complementary to sequences from within intron 22. We describe here the analysis of this mutation in 71 severe hemophilia A patients. Thirty two of the patients (45%) showed evidence of a rearrangement. Five different patterns of rearrangements were seen, two of which have previously been described and account for the majority of cases (pattern 1, 70% and pattern 2, 16%). Three other abnormal patterns were observed. The inversion mechanism does not usually result in the loss or gain of any genetic material, but in one patient, in whom a unique rearrangement pattern was observed (pattern 3), we have previously documented a gross deletion which removes exons 1-22 of the factor VII gene as well as sequences 5{prime} to the gene. In another individual a fourth pattern in which an extra 19.0 kb band is present was detected. In this case it is unclear as to whether the rearrangement is responsible for the disease or is simply coincident normal variation. A fifth pattern, in which an extra 16.0 kb band was detected, was observed in a family with a new mutation causing hemophilia A. The affected individual and his mother inherited a de novo rearrangement of the factor VIII gene from his unaffected grandfather, implicating it as the cause of the disease. In conclusion, testing for the factor VIII inversion mutation was positive in approximately 45% of severe hemophiliacs, 72% of whom were isolated cases, and as such should constitute the initial stage in the genetic testing protocol for these patients` families.

  12. DIRECT DETECTION OF THE HELICAL MAGNETIC FIELD GEOMETRY FROM 3D RECONSTRUCTION OF PROMINENCE KNOT TRAJECTORIES

    Energy Technology Data Exchange (ETDEWEB)

    Zapiór, Maciej; Martinez-Gómez, David, E-mail: zapior.maciek@gmail.com [Physics Department, University of the Balearic Islands, Cra. de Valldemossa, km 7.5. Palma (Illes Balears), E-07122 (Spain)

    2016-02-01

    Based on the data collected by the Vacuum Tower Telescope located in the Teide Observatory in the Canary Islands, we analyzed the three-dimensional (3D) motion of so-called knots in a solar prominence of 2014 June 9. Trajectories of seven knots were reconstructed, giving information of the 3D geometry of the magnetic field. Helical motion was detected. From the equipartition principle, we estimated the lower limit of the magnetic field in the prominence to ≈1–3 G and from the Ampère’s law the lower limit of the electric current to ≈1.2 × 10{sup 9} A.

  13. Direct detection of brominated flame retardants from plastic e-waste using liquid extraction surface analysis mass spectrometry.

    Science.gov (United States)

    Paine, Martin R L; Rae, Ian D; Blanksby, Stephen J

    2014-06-15

    The worldwide generation of plastic electronic waste (e-waste) is reaching epic proportions. The presence of toxic brominated flame retardants (BFRs) within these materials limits their ability to be recycled, resulting in large amounts of e-waste reaching landfills. Liquid extraction surface analysis mass spectrometry (LESA-MS) employing a chip-based nanoelectrospray coupled to a triple quadrupole mass spectrometer represents a novel control technology for directing e-waste streams for recycling. LESA-MS allows direct sampling and analysis of solid material, capable of detecting BFRs including polybrominated diphenyl ethers (PBDEs) and tetrabromobisphenol A (TBBP-A), the two most common flame retardant additives currently in circulation. Authentic PBDE congeners and TBBP-A were deposited on glass and characterised by LESA-MS analysis. PBDEs are notoriously difficult to detect via electrospray; however, they were detected with ease by utilising a combination of nanoelectrospray and solvent doped with ammonium acetate. In situ detection of TBBP-A within plastic e-waste was also possible by performing LESA-MS on the surface of granulated material provided by a commercial waste depot. E-waste sample analysis was completely automated, with each sample analysed in less than 1 min. LESA-MS is fast, simple, and robust allowing unambiguous detection of a range of additives through tandem mass spectrometry. LESA-MS does not require dissolution of the solid matrix nor the sample to be present under vacuum and the use of separative techniques prior to analysis is not necessary. Copyright © 2014 John Wiley & Sons, Ltd.

  14. A "turn-on" fluorescent sensor for ozone detection in ambient air using protein-directed gold nanoclusters.

    Science.gov (United States)

    Wu, Di; Qi, Wenjing; Liu, Chun; Zhang, Qing

    2017-04-01

    A "turn-on" fluorescent sensor for ozone using bovine serum albumin-directed gold nanoclusters (BSA-Au NCs) via energy transfer was developed. The spectral overlap of fluorescent spectrum of BSA-Au NCs with absorption spectrum of indigo carmine (IDS) was utilized. Ozone cleaves C = C bond of IDS and suppresses energy transfer from BSA-Au NCs to IDS. Therefore, this proposed fluorescent sensor is a "turn-on" detection motif. It is the first application of fluorescent nanoclusters in sensitively detecting ozone from 0.2 to 12 μM with the limit of detection of 35 nM (the volume of 500 μL, 1.68 ppb). The proposed fluorescent sensor for ozone is more sensitive and faster (within 2 min) than most methods and is with good selectivity for ozone detection against other reactive oxygen species, reactive nitrogen, or metallic ions. Besides, the proposed method is also utlized in ozone detection in ambient air by monitoring 1 h (60 min) in Qijiang district in Chongqing city. The average of concentration of ozone in ambient air ranges from 44.97 to 52.85 μg/m3. The results are compared with the automatic monitoring data provided by Qijiang Environmental Monitoring Station and the relative deviations range, respectively, from 2.1 to 5.6%, which suggests that it is a promising fluorescent sensor for ozone in ambient air. This study not only develops a new model of energy transfer motif using BSA-Au NCs as donor and IDS as acceptor but also expands the application of BSA-Au NCs in environmental science. Graphical abstract A "turn-on" fluorescent sensor for ozone detection using bovine serum albumin-directed gold nanoclusters (BSA-Au NCs) via energy transfer is developed. It is the first time to utilize spectral overlap of fluorescent spectrum of BSA-Au NCs with absorption spectrum of indigo carmine and to achieve fast, sensitive, and selective ozone detection with a limit of detection of down to 35 nM (the volume of 500 μL, 1.68 ppb).

  15. Detecting directional selection in the presence of recent admixture in African-Americans.

    Science.gov (United States)

    Lohmueller, Kirk E; Bustamante, Carlos D; Clark, Andrew G

    2011-03-01

    We investigate the performance of tests of neutrality in admixed populations using plausible demographic models for African-American history as well as resequencing data from African and African-American populations. The analysis of both simulated and human resequencing data suggests that recent admixture does not result in an excess of false-positive results for neutrality tests based on the frequency spectrum after accounting for the population growth in the parental African population. Furthermore, when simulating positive selection, Tajima's D, Fu and Li's D, and haplotype homozygosity have lower power to detect population-specific selection using individuals sampled from the admixed population than from the nonadmixed population. Fay and Wu's H test, however, has more power to detect selection using individuals from the admixed population than from the nonadmixed population, especially when the selective sweep ended long ago. Our results have implications for interpreting recent genome-wide scans for positive selection in human populations. © 2011 by the Genetics Society of America

  16. Gold nanoparticles directly modified glassy carbon electrode for non-enzymatic detection of glucose

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Gang; Shu, Honghui; Ji, Kai [Ministry-of-Education Key Laboratory for the Green Preparation and Application of Functional Materials, Faculty of Materials Science and Engineering, Hubei University, No. 368 Youyi Avenue, Wuchang, Wuhan 430062 (China); Oyama, Munetaka [Department of Material Chemistry, Graduate School of Engineering, Kyoto University, Nishikyo-ku, Kyoto 615-8520 (Japan); Liu, Xiong [Ministry-of-Education Key Laboratory for the Green Preparation and Application of Functional Materials, Faculty of Materials Science and Engineering, Hubei University, No. 368 Youyi Avenue, Wuchang, Wuhan 430062 (China); He, Yunbin, E-mail: ybhe@hubu.edu.cn [Ministry-of-Education Key Laboratory for the Green Preparation and Application of Functional Materials, Faculty of Materials Science and Engineering, Hubei University, No. 368 Youyi Avenue, Wuchang, Wuhan 430062 (China)

    2014-01-01

    This work describes controllable preparation of gold nanoparticles on glassy carbon electrodes by using the seed mediated growth method, which contains two steps, namely, nanoseeds attachment and nanocrystals growth. The size and the dispersion of gold nanoparticles grown on glassy carbon electrodes could be easily tuned through the growth time based on results of field-emission scanning electron microscopy. Excellent electrochemical catalytic characteristics for glucose oxidation were observed for the gold nanoparticles modified glassy carbon electrodes (AuNPs/GC), resulting from the extended active surface area provided by the dense gold nanoparticles attached. It exhibited a wide linear range from 0.1 mM to 25 mM with the sensitivity of 87.5 μA cm{sup −2} mM{sup −1} and low detection limit down to 0.05 mM for the sensing of glucose. The common interfering species such as chloride ion, ascorbic acid, uric acid and 4-acetamidophenol were verified having no interference effect on the detection of glucose. It is demonstrated that the seed mediated method is one of the facile approaches for fabricating Au nanoparticles modified substrates, which could work as one kind of promising electrode materials for the glucose nonenzymatic sensing.

  17. Piezoelectric Materials Under Natural and Man-Made Radiation: The Potential for Direct Radiation Detection

    Science.gov (United States)

    Wart, Megan; Simpson, Evan; Flaska, Marek

    2018-01-01

    Radiation detection systems used for monitoring long term waste storage need to be compact, rugged, and have low or no power requirements. By using piezoelectric materials it may be possible to create a reliable self-powered radiation detection system. To determine the feasibility of this approach, the electrical signal response of the piezoelectric materials to radiation must be characterized. To do so, an experimental geometry has been designed and a neutron source has been chosen as described in this paper, which will be used to irradiate a uranium foil for producing fission fragments. These future experiments will be aimed at finding the threshold of exposure of lead zirconate titanate (PZT) plates needed to produce and electrical signal. Based on the proposed experimental geometry the thermal neutron beam-line at the Breazeale Reactor at The Pennsylvania State University will be used as the neutron source. The uranium foil and neutron source will be able to supply a maximum flux of 1.5e5 fission fragments/second*cm2 to each of the PZT plates.

  18. Piezoelectric Materials Under Natural and Man-Made Radiation: The Potential for Direct Radiation Detection

    Directory of Open Access Journals (Sweden)

    Wart Megan

    2018-01-01

    Full Text Available Radiation detection systems used for monitoring long term waste storage need to be compact, rugged, and have low or no power requirements. By using piezoelectric materials it may be possible to create a reliable self-powered radiation detection system. To determine the feasibility of this approach, the electrical signal response of the piezoelectric materials to radiation must be characterized. To do so, an experimental geometry has been designed and a neutron source has been chosen as described in this paper, which will be used to irradiate a uranium foil for producing fission fragments. These future experiments will be aimed at finding the threshold of exposure of lead zirconate titanate (PZT plates needed to produce and electrical signal. Based on the proposed experimental geometry the thermal neutron beam-line at the Breazeale Reactor at The Pennsylvania State University will be used as the neutron source. The uranium foil and neutron source will be able to supply a maximum flux of 1.5e5 fission fragments/second*cm2 to each of the PZT plates.

  19. Gold nanoparticles directly modified glassy carbon electrode for non-enzymatic detection of glucose

    Science.gov (United States)

    Chang, Gang; Shu, Honghui; Ji, Kai; Oyama, Munetaka; Liu, Xiong; He, Yunbin

    2014-01-01

    This work describes controllable preparation of gold nanoparticles on glassy carbon electrodes by using the seed mediated growth method, which contains two steps, namely, nanoseeds attachment and nanocrystals growth. The size and the dispersion of gold nanoparticles grown on glassy carbon electrodes could be easily tuned through the growth time based on results of field-emission scanning electron microscopy. Excellent electrochemical catalytic characteristics for glucose oxidation were observed for the gold nanoparticles modified glassy carbon electrodes (AuNPs/GC), resulting from the extended active surface area provided by the dense gold nanoparticles attached. It exhibited a wide linear range from 0.1 mM to 25 mM with the sensitivity of 87.5 μA cm-2 mM-1 and low detection limit down to 0.05 mM for the sensing of glucose. The common interfering species such as chloride ion, ascorbic acid, uric acid and 4-acetamidophenol were verified having no interference effect on the detection of glucose. It is demonstrated that the seed mediated method is one of the facile approaches for fabricating Au nanoparticles modified substrates, which could work as one kind of promising electrode materials for the glucose nonenzymatic sensing.

  20. Microfluidic approaches for isolation, detection, and characterization of extracellular vesicles: Current status and future directions.

    Science.gov (United States)

    Gholizadeh, Shima; Shehata Draz, Mohamed; Zarghooni, Maryam; Sanati-Nezhad, Amir; Ghavami, Saeid; Shafiee, Hadi; Akbari, Mohsen

    2017-05-15

    Extracellular vesicles (EVs) are cell-derived vesicles present in body fluids that play an essential role in various cellular processes, such as intercellular communication, inflammation, cellular homeostasis, survival, transport, and regeneration. Their isolation and analysis from body fluids have a great clinical potential to provide information on a variety of disease states such as cancer, cardiovascular complications and inflammatory disorders. Despite increasing scientific and clinical interest in this field, there are still no standardized procedures available for the purification, detection, and characterization of EVs. Advances in microfluidics allow for chemical sampling with increasingly high spatial resolution and under precise manipulation down to single molecule level. In this review, our objective is to give a brief overview on the working principle and examples of the isolation and detection methods with the potential to be used for extracellular vesicles. This review will also highlight the integrated on-chip systems for isolation and characterization of EVs. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Goal-directed ultrasound in the detection of long-bone fractures

    Science.gov (United States)

    Marshburn, Thomas H.; Legome, Eric; Sargsyan, Ashot; Li, Shannon Melton James; Noble, Vicki A.; Dulchavsky, Scott A.; Sims, Carrie; Robinson, David

    2004-01-01

    BACKGROUND: New portable ultrasound (US) systems are capable of detecting fractures in the remote setting. However, the accuracy of ultrasound by physicians with minimal ultrasound training is unknown. METHODS: After one hour of standardized training, physicians with minimal US experience clinically evaluated patients presenting with pain and trauma to the upper arm or leg. The investigators then performed a long-bone US evaluation, recording their impression of fracture presence or absence. Results of the examination were compared with routine plain or computer aided radiography (CT). RESULTS: 58 patients were examined. The sensitivity and specificity of US were 92.9% and 83.3%, and of the physical examination were 78.6% and 90.0%, respectively. US provided improved sensitivity with less specificity compared with physical examination in the detection of fractures in long bones. CONCLUSION: Ultrasound scans by minimally trained clinicians may be used to rule out a long-bone fracture in patients with a medium to low probability of fracture.

  2. Direct HST Dust Lane Detection in Powerful Narrow-Line Radio Galaxies

    Directory of Open Access Journals (Sweden)

    Edgar A. Ramírez

    2017-11-01

    Full Text Available We present the analysis of near-infrared Hubble Space Telescope imaging of 10 Fanaroff Riley II powerful radio galaxies at low redshift (0.03 < z < 0.11 optically classified as narrow-line radio galaxies. The photometric properties of the host galaxy are measured using galfit, and compared with those from the literature. Our high resolution near-infrared observations provide new and direct information on the central kpc-scale dust lanes in our sample that could be connected to the pc-scale torus structure. Moreover, analyzing the infrared spectrograph Spitzer spectra of our sample, we suggest properties of the dust size of the torus.

  3. Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

    Science.gov (United States)

    Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

    2014-07-01

    2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples.

    Science.gov (United States)

    Antikainen, J; Tarkka, E; Haukka, K; Siitonen, A; Vaara, M; Kirveskari, J

    2009-08-01

    A rapid 16-plex polymerase chain reaction (PCR) suitable for routine diagnostics of diarrheagenic Escherichia coli (EHEC, EIEC, EAEC, ETEC, and EPEC) was developed, validated with control strains, and tested with 250 diarrhoeal stool samples. The specificity was 100% when tested with 289 control bacterial strains, and the analytical sensitivity of automated DNA extraction directly from stool samples was made by boiling the bacterial culture (10(4)-10(5) colony forming units/ml). The assay design starting directly from extraction of stool DNA allowed same day analysis without compromising sensitivity and specificity, which makes it superior compared to PCR after culturing the bacteria. The 16-plex PCR method demonstrated high prevalence of diarrheagenic E. coli in stool samples of patients returning from abroad (39.0%) in contrast to the patients with no travel history (8.7%; p < 0.001). The high prevalence of diarrheagenic E. coli suggests that their screening should be part of normal diarrhoea diagnostics, at least in the leading diagnostic laboratories.

  5. Effective field theory treatment of the neutrino background in direct dark matter detection experiments

    Science.gov (United States)

    Dent, James B.; Dutta, Bhaskar; Newstead, Jayden L.; Strigari, Louis E.

    2016-04-01

    Distinguishing a dark matter interaction from an astrophysical neutrino-induced interaction will be major challenge for future direct dark matter searches. In this paper, we consider this issue within nonrelativistic effective field theory (EFT), which provides a well-motivated theoretical framework for determining nuclear responses to dark matter scattering events. We analyze the nuclear energy recoil spectra from the different dark matter-nucleon EFT operators, and compare them to the nuclear recoil energy spectra that are predicted to be induced by astrophysical neutrino sources. We determine that for 11 of the 14 possible operators, the dark matter-induced recoil spectra can be cleanly distinguished from the corresponding neutrino-induced recoil spectra with moderate-size detector technologies that are now being pursued, e.g., these operators would require 0.5 tonne years to be distinguished from the neutrino background for low mass dark matter. Our results imply that in most models detectors with good energy resolution will be able to distinguish a dark matter signal from a neutrino signal, without the need for much larger detectors that must rely on additional information from timing or direction. In addition we calculate up-to-date exclusion limits in the EFT model space using data from the LUX experiment.

  6. Directional Stand-off Detection of Fast Neutrons and Gammas Using Angular Scattering Distributions

    Energy Technology Data Exchange (ETDEWEB)

    Vanier P. e.; Dioszegi, I.; Salwen, C.; Forman, L.

    2009-10-25

    We have investigated the response of a DoubleScatter Neutron Spectrometer (DSNS) for sources at long distances (gr than 200 meters). We find that an alternative method for analyzing double scatter data avoids some uncertainties introduced by amplitude measurements in plastic scintillators.Time of flight is used to discriminate between gamma and neutron events, and the kinematic distributions of scattering angles are assumed to apply. Non-relativistic neutrons are most likely to scatter at 45°, while gammas with energies greater than 2 MeV are most likely to be forward scattered. The distribution of scattering angles of fission neutrons arriving from a distant point source generates a 45° cone, which can be back-projected to give the source direction. At the same time, the distribution of Compton-scattered gammas has a maximum in the forward direction, and can be made narrower by selecting events that deposit minimal energy in the first scattering event. We have further determined that the shape of spontaneous fission neutron spectra at ranges gr than 110 m is still significantly different from thecosmic ray background.

  7. Phenomenological constraints on light mixed sneutrino dark matter scenarios

    Directory of Open Access Journals (Sweden)

    Mitsuru Kakizaki

    2015-10-01

    Full Text Available In supersymmetric models with Dirac neutrinos, the lightest sneutrino can be a good thermal dark matter candidate when the soft sneutrino trilinear parameter is large. In this paper, we focus on scenarios where the mass of the mixed sneutrino LSP is of the order of GeV so the sneutrino dark matter is still viable complying with the limits by current and near future direct detection experiments. We investigate phenomenological constraints in the parameter space of the models, as well as the vacuum stability bound. Finally, we show that the allowed regions can be explored by measuring Higgs boson properties at future collider experiments.

  8. An empirically grounded agent based model for modeling directs, conflict detection and resolution operations in Air Traffic Management

    CERN Document Server

    Bongiorno, C; Mantegna, Rosario N

    2016-01-01

    We present an agent based model of the Air Traffic Management socio-technical complex system that aims at modeling the interactions between aircrafts and air traffic controllers at a tactical level. The core of the model is given by the conflict detection and resolution module and by the directs module. Directs are flight shortcuts that are given by air controllers to speed up the passage of an aircraft within a certain airspace and therefore to facilitate airline operations. Conflicts resolution between flight trajectories can arise during the en-route phase of each flight due to both not detailed flight trajectory planning or unforeseen events that perturb the planned flight plan. Our model performs a local conflict detection and resolution procedure. Once a flight trajectory has been made conflict-free, the model searches for possible improvements of the system efficiency by issuing directs. We give an example of model calibration based on real data. We then provide an illustration of the capability of our...

  9. In vitro comparison of four different dental X-ray films and direct digital radiography for proximal caries detection.

    Science.gov (United States)

    Alkurt, Meryem Torman; Peker, Ilkay; Bala, Oya; Altunkaynak, Bulent

    2007-01-01

    This study investigated the efficiency of different speeds of conventional intraoral films and a direct digital system for proximal caries detection. In this study, 48 extracted human posterior permanent teeth were used. Conventional bitewing radiographs and direct digital radiographs were obtained from the teeth. Three observers independently assessed 96 proximal surfaces, each observer had 10 years of experience. The presence or absence of caries was scored according to a five-point scale. True caries depth was determined by histological examination. The diagnostic accuracy of each radiographic system was assessed by means of a receiver operating characteristic (ROC) curve analysis. The mean of areas under the ROC curve (Az) was analyzed by pairwise comparison of ROC curve. The interobserver agreement was evaluated by using ANOVA analysis. The statistical analysis of Az scores exhibited no significant difference for the five imaging modalities (p > 0.05). There was no statistically significant difference between interobserver agreements (p > 0.05). The results of this study showed that the diagnostic performance of E- and F-speed films and direct digital radiography are similar for proximal caries detection.

  10. COHERENT constraints on nonstandard neutrino interactions

    Science.gov (United States)

    Liao, Jiajun; Marfatia, Danny

    2017-12-01

    Coherent elastic neutrino-nucleus scattering consistent with the standard model has been observed by the COHERENT experiment. We study nonstandard neutrino interactions using the detected spectrum. For the case in which the nonstandard interactions (NSI) are induced by a vector mediator lighter than 50 MeV, we obtain constraints on the coupling of the mediator. For a heavier mediator, we find that degeneracies between the NSI parameters severely weaken the constraints. However, these degeneracies do not affect COHERENT constraints on the effective NSI parameters for matter propagation in the Earth.

  11. Symbolic Constraints in Constructive Geometric Constraint Solving

    OpenAIRE

    Hoffmann, Christoph M.; Joan-Arinyo, Robert

    1997-01-01

    In design and manufacturing applications, users of computer aided design systems want to define relationships between dimension variables, since such relationships express design intent very flexibly. This work reports on a technique developed to enhance a class of constructive geometric constraint solvers with the capability of managing functional relationships between dimension variables. The method is shown to be correct.

  12. High efficiency direct detection of ions from resonance ionization of sputtered atoms

    Science.gov (United States)

    Gruen, Dieter M.; Pellin, Michael J.; Young, Charles E.

    1986-01-01

    A method and apparatus are provided for trace and other quantitative analysis with high efficiency of a component in a sample, with the analysis involving the removal by ion or other bombardment of a small quantity of ion and neutral atom groups from the sample, the conversion of selected neutral atom groups to photoions by laser initiated resonance ionization spectroscopy, the selective deflection of the photoions for separation from original ion group emanating from the sample, and the detection of the photoions as a measure of the quantity of the component. In some embodiments, the original ion group is accelerated prior to the RIS step for separation purposes. Noise and other interference are reduced by shielding the detector from primary and secondary ions and deflecting the photoions sufficiently to avoid the primary and secondary ions.

  13. Direct fluorescence detection of VirE2 secretion by Agrobacterium tumefaciens.

    Science.gov (United States)

    Yaakov, Noga; Barak, Yoav; Pereman, Idan; Christie, Peter J; Elbaum, Michael

    2017-01-01

    VirE2 is a ssDNA binding protein essential for virulence in Agrobacterium tumefaciens. A tetracysteine mutant (VirE2-TC) was prepared for in vitro and in vivo fluorescence imaging based on the ReAsH reagent. VirE2-TC was found to be biochemically active as it binds both ssDNA and the acidic secretion chaperone VirE1. It was also biologically functional in complementing virE2 null strains transforming Arabidopsis thaliana roots and Nicotiana tabacum leaves. In vitro experiments demonstrated a two-color fluorescent complex using VirE2-TC/ReAsH and Alexa Fluor 488 labeled ssDNA. In vivo, fluorescent VirE2-TC/ReAsH was detected in bacteria and in plant cells at time frames relevant to transformation.

  14. Direct detection of near-surface faults by migration of back-scattered surface waves

    KAUST Repository

    Yu, Han

    2014-08-05

    We show that diffraction stack migration can be used to estimate the distribution of near-surface faults. The assumption is that near-surface faults generate detectable back-scattered surface waves from impinging surface waves. The processing steps are to isolate the back-scattered surface waves, and then migrate them by diffraction migration using the surface wave velocity as the migration velocity. Instead of summing events along trial quasi-hyperbolas, surface wave migration sums events along trial quasi-linear trajectories that correspond to the moveout of back-scattered surface waves. A deconvolution filter derived from the data can be used to collapse a dispersive arrival into a non-dispersive event. Results with synthetic data and field records validate the feasibility of this method. Applying this method to USArray data or passively recorded exploration data might open new opportunities in mapping tectonic features over the extent of the array.

  15. Detecting consistent patterns of directional adaptation using differential selection codon models.

    Science.gov (United States)

    Parto, Sahar; Lartillot, Nicolas

    2017-06-23

    Phylogenetic codon models are often used to characterize the selective regimes acting on protein-coding sequences. Recent methodological developments have led to models explicitly accounting for the interplay between mutation and selection, by modeling the amino acid fitness landscape along the sequence. However, thus far, most of these models have assumed that the fitness landscape is constant over time. Fluctuations of the fitness landscape may often be random or depend on complex and unknown factors. However, some organisms may be subject to systematic changes in selective pressure, resulting in reproducible molecular adaptations across independent lineages subject to similar conditions. Here, we introduce a codon-based differential selection model, which aims to detect and quantify the fine-grained consistent patterns of adaptation at the protein-coding level, as a function of external conditions experienced by the organism under investigation. The model parameterizes the global mutational pressure, as well as the site- and condition-specific amino acid selective preferences. This phylogenetic model is implemented in a Bayesian MCMC framework. After validation with simulations, we applied our method to a dataset of HIV sequences from patients with known HLA genetic background. Our differential selection model detects and characterizes differentially selected coding positions specifically associated with two different HLA alleles. Our differential selection model is able to identify consistent molecular adaptations as a function of repeated changes in the environment of the organism. These models can be applied to many other problems, ranging from viral adaptation to evolution of life-history strategies in plants or animals.

  16. Perspectives of direct detection of supersymmetric dark matter in the NMSSM

    Directory of Open Access Journals (Sweden)

    C. Beskidt

    2017-08-01

    Full Text Available In the Next-to-Minimal-Supersymmetric-Standard-Model (NMSSM the lightest supersymmetric particle (LSP is a candidate for the dark matter (DM in the universe. It is a mixture from the various gauginos and Higgsinos and can be bino-, Higgsino- or singlino-dominated. Singlino-dominated LSPs can have very low cross sections below the neutrino background from coherent neutrino scattering which is limiting the sensitivity of future direct DM search experiments. However, previous studies suggested that the combination of both, the spin-dependent (SD and spin-independent (SI searches are sensitive in complementary regions of parameter space, so considering both searches will allow to explore practically the whole parameter space of the NMSSM. In this letter, the different scenarios are investigated with a new scanning technique, which reveals that significant regions of the NMSSM parameter space cannot be explored, even if one considers both, SI and SD, searches.

  17. Perspectives of direct detection of supersymmetric dark matter in the NMSSM

    Science.gov (United States)

    Beskidt, C.; de Boer, W.; Kazakov, D. I.; Wayand, S.

    2017-08-01

    In the Next-to-Minimal-Supersymmetric-Standard-Model (NMSSM) the lightest supersymmetric particle (LSP) is a candidate for the dark matter (DM) in the universe. It is a mixture from the various gauginos and Higgsinos and can be bino-, Higgsino- or singlino-dominated. Singlino-dominated LSPs can have very low cross sections below the neutrino background from coherent neutrino scattering which is limiting the sensitivity of future direct DM search experiments. However, previous studies suggested that the combination of both, the spin-dependent (SD) and spin-independent (SI) searches are sensitive in complementary regions of parameter space, so considering both searches will allow to explore practically the whole parameter space of the NMSSM. In this letter, the different scenarios are investigated with a new scanning technique, which reveals that significant regions of the NMSSM parameter space cannot be explored, even if one considers both, SI and SD, searches.

  18. Direct metagenomic detection of viral pathogens in nasal and fecal specimens using an unbiased high-throughput sequencing approach.

    Directory of Open Access Journals (Sweden)

    Shota Nakamura

    Full Text Available With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3 and fecal specimens (N = 5, and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738 reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90% of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered, except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures.

  19. Aptamer-functionalized nanoporous gold film for high-performance direct electrochemical detection of bisphenol A in human serum

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Ye, E-mail: zhuye@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Zhou, Chuqing; Yan, Xupeng; Yan, Yan [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Qiang, E-mail: qiangwang@tjut.edu.cn [Institute of New Energy Materials & Low-Carbon Technologies, Tianjin University of Technology, Tianjin 300384 (China)

    2015-07-09

    Highlights: • NPGF exhibits excellent catalytic activity towards the redox reaction of BPA. • The perfect combination of NPGF with aptamer ensures high sensitivity and selectivity. • The detection limit is determined to be 0.056 ± 0.004 nM BPA. • The detection limit is 15-fold lower than gold nanoparticle-based sensor. • The sensor was successfully applied to detect BPA in human serum samples. - Abstract: In the present work, a highly sensitive and selective biosensor based on aptamer-functionalized nanoporous gold film (NPGF) was successfully developed for direct electrochemical detection of bisphenol A (BPA). NPGF was prepared by dealloying Ag from Au/Ag alloy leaf in concentrated nitric acid. The obtained NPGF was attached onto glassy carbon electrode and then was functionalized with BPA-specific aptamer via the formation of Au−S bond. The fabrication of the sensor was characterized by scanning electron microscopy and X-ray photoelectron spectroscopy. NPGF exhibited excellent electrocatalytic activity towards the redox reaction of BPA, which ensured high sensitivity of the sensor. The aptamer-captured BPA showed a pair of redox peaks around 0.35/0.28 V (vs. Ag/AgCl). The experimental parameters in terms of aptamer concentration, reaction time, pH, and temperature were optimized. The calibration plot showed a linear range from 0.1 nM to 100 nM BPA with a remarkable detection limit of 0.056 ± 0.004 nM BPA. Particularly, the successful application of the developed sensor for the detection of BPA in human serum samples suggests its promising potential for clinical diagnosis.

  20. Temporal Concurrent Constraint Programming

    DEFF Research Database (Denmark)

    Nielsen, Mogens; Palamidessi, Catuscia; Valencia, Frank Dan

    2002-01-01

    The ntcc calculus is a model of non-deterministic temporal concurrent constraint programming. In this paper we study behavioral notions for this calculus. In the underlying computational model, concurrent constraint processes are executed in discrete time intervals. The behavioral notions studied...

  1. Credit Constraints in Education

    Science.gov (United States)

    Lochner, Lance; Monge-Naranjo, Alexander

    2012-01-01

    We review studies of the impact of credit constraints on the accumulation of human capital. Evidence suggests that credit constraints have recently become important for schooling and other aspects of households' behavior. We highlight the importance of early childhood investments, as their response largely determines the impact of credit…

  2. The Antigone Constraint.

    Science.gov (United States)

    Tuggy, David

    This paper presents a class of sentences that certain syntactic rules of English would be expected to produce, but that are not grammatical. The sentences all involve the raising of a sentential Noun Phrase (NP) and the subsequent application of some syntactic rule to that senential NP. A constraint, referred to as the Antigone Constraint, is…

  3. Theory of Constraints (TOC)

    DEFF Research Database (Denmark)

    Michelsen, Aage U.

    2004-01-01

    Tankegangen bag Theory of Constraints samt planlægningsprincippet Drum-Buffer-Rope. Endvidere skitse af The Thinking Process.......Tankegangen bag Theory of Constraints samt planlægningsprincippet Drum-Buffer-Rope. Endvidere skitse af The Thinking Process....

  4. Evaluating Distributed Timing Constraints

    DEFF Research Database (Denmark)

    Kristensen, C.H.; Drejer, N.

    1994-01-01

    In this paper we describe a solution to the problem of implementing time-optimal evaluation of timing constraints in distributed real-time systems.......In this paper we describe a solution to the problem of implementing time-optimal evaluation of timing constraints in distributed real-time systems....

  5. A compendium of chameleon constraints

    Science.gov (United States)

    Burrage, Clare; Sakstein, Jeremy

    2016-11-01

    The chameleon model is a scalar field theory with a screening mechanism that explains how a cosmologically relevant light scalar can avoid the constraints of intra-solar-system searches for fifth-forces. The chameleon is a popular dark energy candidate and also arises in f(R) theories of gravity. Whilst the chameleon is designed to avoid historical searches for fifth-forces it is not unobservable and much effort has gone into identifying the best observables and experiments to detect it. These results are not always presented for the same models or in the same language, a particular problem when comparing astrophysical and laboratory searches making it difficult to understand what regions of parameter space remain. Here we present combined constraints on the chameleon model from astrophysical and laboratory searches for the first time and identify the remaining windows of parameter space. We discuss the implications for cosmological chameleon searches and future small-scale probes.

  6. Possible detection of an emission feature near 584 A in the direction of G191-B2B

    Science.gov (United States)

    Green, James; Bowyer, Stuart; Jelinsky, Patrick

    1990-01-01

    A possible spectral emission feature is reported in the direction of the nearby hot white dwarf G191-B2B at 581.5 + or - 6 A with a significance of 3.8 sigma. This emission has been identified as He I 584.3 A. The emission cannot be due to local geocoronal emission or interplanetary backscatter of solar He I 584 A emission because the feature is not detected in a nearby sky exposure. Possible sources for this emission are examined, including the photosphere of G191-B2B, the comparison star G191-B2A, and a possible nebulosity near or around G191-B2B. The parameters required to explain the emission are derived for each case. All of these explanations require unexpected physical conditions; hence we believe this result must receive confirming verification despite the statistical likelihood of the detection.

  7. Polydimethylsiloxane extraction from silicone rubber into baked goods detected by direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Gross, Jürgen H

    2015-01-01

    Flexible baking molds and other household utensils are made of polydimethylsiloxane (PDMS), also known as silicone rubber. PDMS is prone to release oligomers upon elongated contact with fats, e.g., in the process of baking dough. Positive-ion direct analysis in real time (DART) mass spectrometry (MS) provides an efficient tool for the analysis of PDMS up to m/z 3000. Here, DART ionization is employed in combination with Fourier transform ion cyclotron resonance MS to detect PDMS released into muffins when baked in silicone rubber baking molds. Intensive signals caused by PDMS do occur in the m/z 700-1500 range of DART mass spectra obtained from the crusty surface of muffins after the use of such silicone rubber molds. In addition, triacylglyceroles (TAGs) present as natural ingredients of the analyzed muffins were detected as [TAG+NH(4)](+) ions.

  8. Astrophysical limitations to the identification of dark matter: indirect neutrino signals vis-a-vis direct detection recoil rates

    CERN Document Server

    Serpico, Pasquale D

    2010-01-01

    A convincing identification of dark matter (DM) particles can probably be achieved only through a combined analysis of different detections strategies, which provides an effective way of removing degeneracies in the parameter space of DM models. In practice, however, this program is made complicated by the fact that different strategies depend on different physical quantities, or on the same quantities but in a different way, making the treatment of systematic errors rather tricky. We discuss here the uncertainties on the recoil rate in direct detection experiments and on the muon rate induced by neutrinos from dark matter annihilations in the Sun, and we show that, contrarily to the local DM density or overall cross section scale, irreducible astrophysical uncertainties affect the two rates in a different fashion, therefore limiting our ability to reconstruct the parameters of the dark matter particle. By varying within their respective errors astrophysical parameters such as the escape velocity and the velo...

  9. Direct detection of surface localized specialized metabolites from Glycyrrhiza lepidota (American licorice) by leaf spray mass spectrometry.

    Science.gov (United States)

    Freund, Dana M; Martin, Amanda C; Cohen, Jerry D; Hegeman, Adrian D

    2018-01-01

    Leaf spray-MS minimizes tissue manipulation by effectively and quickly assessing in vivo specialized metabolites from intact plant tissue surfaces, including trichome metabolites. Intact leaves of Glycyrrhiza lepidota Pursh. (American licorice) were analyzed by direct electrospray leaf spray-MS, an ambient ionization technique. Comparison of metabolites detected by leaf spray-MS to those from LC-MS of bulk tissue and trichome enriched extracts showed dramatic differences. Leaf spray-MS results suggest that in specific situations this approach could complement traditional LC-MS analysis of bulk extracts. Leaf spray-MS as a metabolomics technique eliminates sample pretreatment and preparation allowing for rapid sampling in real time of living intact tissues. Specialized metabolites on the surface of tissues such as glandular trichomes metabolites are detected by leaf spray-MS.

  10. Graphene oxide functionalized with silver@silica-polyethylene glycol hybrid nanoparticles for direct electrochemical detection of quercetin.

    Science.gov (United States)

    Veerapandian, Murugan; Seo, Yeong-Tai; Yun, Kyusik; Lee, Min-Ho

    2014-08-15

    A direct electrochemical detection of quercetin based on functionalized graphene oxide modified on gold-printed circuit board chip was demonstrated in this study. Functionalized graphene oxide materials are prepared by the covalent reaction of graphene oxide with silver@silica-polyethylene glycol nanoparticles (~12.35nm). Functionalized graphene oxide electrode shows a well-defined voltammetric response in phosphate buffered saline and catalyzes the oxidation of quercetin to quinone without the need of an enzyme. Significantly, the functionalized graphene oxide modified electrode exhibited a higher sensitivity than pristine gold-printed circuit board and graphene oxide electrodes, a wide concentration range of 7.5 to 1040nM and detection limit of 3.57nM. Developed biosensor platform is selective toward quercetin in the presence of an interferent molecule. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Detection of nicotine as an indicator of tobacco smoke by direct analysis in real time (DART) tandem mass spectrometry

    Science.gov (United States)

    Kuki, Ákos; Nagy, Lajos; Nagy, Tibor; Zsuga, Miklós; Kéki, Sándor

    2015-01-01

    The residual tobacco smoke contamination (thirdhand smoke, THS) on the clothes of a smoker was examined by direct analysis in real time (DART) mass spectrometry. DART-MS enabled sensitive and selective analysis of nicotine as the indicator of tobacco smoke pollution. Tandem mass spectrometric (MS/MS) experiments were also performed to confirm the identification of nicotine. Transferred thirdhand smoke originated from the fingers of a smoker onto other objects was also detected by DART mass spectrometry. DART-MS/MS was utilized for monitoring the secondhand tobacco smoke (SHS) in the air of the laboratory using nicotine as an indicator. To the best of our knowledge, this is the first report on the application of DART-MS and DART-MS/MS to the detection of thirdhand smoke and to the monitoring of secondhand smoke.

  12. Evaluation of a Direct Immunofluorescent Assay and/or Conjunctival Cytology for Detection of Canine Distemper Virus Antigen.

    Science.gov (United States)

    Athanasiou, Labrini V; Kantere, Maria C; Kyriakis, Constantinos S; Pardali, Dimitra; Adamama Moraitou, Katerina; Polizopoulou, Zoe S

    2017-11-29

    Canine distemper is a common and potentially lethal multisystemic disease caused by the Canine distemper virus (CDV). We evaluated the diagnostic performance of direct immunofluorescent assay (FA) and cytology to detect CDV antigen in conjunctival cells compared with an established polymerase chain reaction (PCR) detection assay used as a gold standard for CDV diagnosis. Samples were collected from 57 young dogs presenting with central nervous system signs compatible with distemper disease. Exfoliative epithelial cells were collected from the right and left conjunctiva of each animal using nylon-bristled cytobrushes for cytology and cotton swabs for FA and PCR. For the direct FA, samples were stained with anti-CDV polyclonal antiserum conjugated to fluorescein isothiocyanate and imaged using a fluorescent microscope. Out of 57 dogs tested, 19 were PCR positive (15 positive in direct FA and 4 positive in cytology, including one that was negative by PCR), whereas 37 dogs were negative in all methods. A good agreement was observed between the FA and PCR, with a κ-value of 0.833 (95% CI: 0.678-0.989). Meanwhile, there was poor agreement between cytology and PCR (κ-value of 0.164; 95% CI: -0.045 to 0.373) and a fair agreement between FA and cytology (κ-value of 0.231; 95% CI: -0.026 to 0.487). Our results indicated a poor performance of cytology for the detection of CDV antigen. In contrast, FA is a 100% specific and an adequately sensitive assay (sensitivity: 78.95%, negative likelihood ratio: 0.21, 95% CI: 0.09-0.50) for antemortem diagnosis of canine distemper.

  13. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  14. Escherichia coli detection using mTEC agar and fluorescent antibody direct viable counting on coastal recreational water samples.

    Science.gov (United States)

    Zimmerman, A M; Rebarchik, D M; Flowers, A R; Williams, J L; Grimes, D J

    2009-10-01

    Escherichia coli is the faecal indicator species recommended by the US Environmental Protection Agency (USEPA) for monitoring fresh recreational water. Viable but nonculturable (VBNC) E. coli are living cells that are dormant and not culturable using standard microbiological cultivation methods. This study reports a comparison between the mTEC culture method recommended by USEPA for E. coli enumeration and a fluorescent antibody-direct viable count (FA-DVC) method to visualize living E. coli cells with a microscope. Escherichia coli, faecal coliforms and Enterococcus were detected using standard methods recommended by the USEPA. VBNC E. coli was visualized with FA-DVC. Results were analysed with standard statistical methods (Pearson correlation; paired-sample t-test). Significantly higher numbers of E. coli were detected using the FA-DVC method than using the mTEC method. Escherichia coli results were also compared with faecal coliform (mFC broth) and Enterococcus (mEI agar) counts in the same samples. The results of this comparative study demonstrate that E. coli can be present in higher numbers than what are detected with standard culture methods. This study re-emphasizes the need for a rapid, accurate and precise method for detecting health risks to humans who use recreational waters.

  15. Direct comparison of two vaginal self-sampling devices for the detection of human papillomavirus infections.

    Science.gov (United States)

    Jentschke, M; Chen, K; Arbyn, M; Hertel, B; Noskowicz, M; Soergel, P; Hillemanns, P

    2016-09-01

    Two devices for vaginal self-sampling of dry cell material (Evalyn Brush, Rovers Medical Devices; Qvintip, Aprovix) were compared using the Abbott RealTime High Risk HPV test. Both self-sampling devices (change of order with every patient) including instructions for use and a questionnaire were handed to 146 patients in a colposcopy clinic prior to scheduled colposcopies with collection of cervical reference specimens by gynaecologists using a broom-like device. Matched self-collected and physician collected specimens were transferred to ThinPrep medium and tested for the presence of hr-HPV. Biopsies were taken if indicated by colposcopy. Evaluation of 136 patients with complete data (136/146; 93.2%) showed high agreement of overall hr-HPV detection rates between self-collected and clinician-collected specimens (Evalyn: 91.2% [kappa 0.822]; Qvintip: 89.0% [kappa 0.779]). Colposcopy and histological evaluation revealed 55 women without cervical intraepithelial neoplasia (CIN), 32 CIN1, 34 CIN2, 14 CIN3 and one adenocarcinoma in situ. Hr-HPV testing detected all CIN3+ cases on the clinician-taken or Evalyn self-samples (14/14) and 93% of them on the Qvintip samples (13/14). There was no significant difference regarding the sensitivity for CIN2+ or CIN3+ and specificity of hr-HPV testing on self- vs. clinician samples and on Evalyn vs. Qvintip. Based on signal intensities of β-globin, the observed DNA concentration with Evalyn samples (mean CN: 22.0; 95%-CI: 21.5-22.6) was found to be significantly higher compared to that of Qvintip samples (mean CN: 23.8; 95%-CI 23.2-24.4), regardless of the order of self-sampling (p<0.0001). Most women considered self-sampling easy and comfortable. Qvintip was considered easier than the Evalyn Brush to understand (p<0.001) and to use (p=0.002). This study confirms that hr-HPV testing with a clinically validated PCR-based HPV assay is as accurate on self-samples as on clinician-samples without significant difference between both

  16. Evaluation of simple microbiol tests for detection of fecal coliforms directly at 44.5 degrees C.

    Science.gov (United States)

    Tewari, Suman; Ramteke, P W; Garg, S K

    2003-06-01

    Simple microbial test comprising H2S paper strip test, presence-absence (PA) test, and fluorogenic brila broth (BB) test performed directly at 44.5 degrees C were evaluated and compared with the standard most probable number (MPN) method for detection of fecal coliforms in 173 drinking water sources. BB and PA test were comparable with standard MPN method, whereas, poor compliance was noted for H2S test. PA test when compared with standard MPN test only 15% disagreement was detected, whereas, highest disagreement of 40% was observed in case of H2S test. BB test was found to be highly sensitive as only 7.8% disagreement with that of standard MPN test was found. Three hundred cultures obtained from positive tests were identified in order to evaluate the specificities of test used in detection of fecal indicator Escherichia coli. BB test was also found highly specific in detection of indicator organism as compared to PA and H2S test. Among the organisms isolated from BB test 84.4% of them were identified as E. coli as compared to 43.4 and 33.3 in PA and H2S test, respectively. The low incidence of recovery of E. coli (18.1%) for the standard MPN method places doubt on the validity of its application in tropical areas. The result of this investigation suggest that BB performed directly at 44.5 degrees C could be suitable cost effective test to assess the microbiological quality of drinking water in India and other tropical countries.

  17. Dark sequential Z portal: Collider and direct detection experiments

    OpenAIRE

    Arcadi, Giorgio; Campos, Miguel D.; Lindner, Manfred; Masiero, Antonio; Queiroz, Farinaldo S.

    2018-01-01

    We revisit the status of a Majorana fermion as a dark matter candidate when a sequential Z′ gauge boson dictates the dark matter phenomenology. Direct dark matter detection signatures rise from dark matter-nucleus scatterings at bubble chamber and liquid xenon detectors, and from the flux of neutrinos from the Sun measured by the IceCube experiment, which is governed by the spin-dependent dark matter-nucleus scattering. On the collider side, LHC searches for dilepton and monojet + missing ene...

  18. Material Property Estimation for Direct Detection of DNAPL using Integrated Ground-Penetrating Radar Velocity, Imaging and Attribute Analysis

    Energy Technology Data Exchange (ETDEWEB)

    John H. Bradford; Stephen Holbrook; Scott B. Smithson

    2004-12-09

    The focus of this project is direct detection of DNAPL's specifically chlorinated solvents, via material property estimation from multi-fold surface ground-penetrating radar (GPR) data. We combine state-of-the-art GPR processing methodology with quantitative attribute analysis and material property estimation to determine the location and extent of residual and/or pooled DNAPL in both the vadose and saturated zones. An important byproduct of our research is state-of-the-art imaging which allows us to pinpoint attribute anomalies, characterize stratigraphy, identify fracture zones, and locate buried objects.

  19. Detection of group A streptococcal antigen directly from throat swabs with a ten-minute latex agglutination test.

    OpenAIRE

    Miceika, B G; Vitous, A S; Thompson, K D

    1985-01-01

    Results obtained with the Culturette brand 10-Minute Group A Strep ID system were compared with culture results to measure the ability of this system to detect group A streptococci directly from more than 800 throat swabs. Our study showed a sensitivity of 92.4% and a specificity of 92.8% for this acid extraction, latex agglutination method when compared with anaerobic culturing for group A streptococci. The results suggest that the 10-Minute Group A Strep ID method may prove to be a useful, ...

  20. Direct X-ray detection with hybrid solar cells based on organolead halide perovskites

    Science.gov (United States)

    Gill, Hardeep Singh; Elshahat, Bassem; Sajo, Erno; Kumar, Jayant; Kokil, Akshay; Zygmanski, Piotr; Li, Lian; Mosurkal, Ravi

    2014-03-01

    Organolead halide perovskite materials are attracting considerable interest due to their exceptional opto-electronic properties, such as, high charge carrier mobilities, high exciton diffusion length, high extinction coefficients and broad-band absorption. These interesting properties have enabled their application in high performance hybrid photovoltaic devices. The high Z value of their constituents also makes these materials efficient for absorbing X-rays. Here we will present on the efficient use of hybrid solar cells based on organolead perovskite materials as X-ray detectors. Hybrid solar cells based on CH3NH3PbI3 were fabricated using facile processing techniques on patterned indium tin oxide coated glass substrates. The solar cells typically had a planar configuration of ITO/CH3NH3PbI3/P3HT/Ag. High sensitivity for X-rays due to high Z value, larger carrier mobility and better charge collection was observed. Detecting X-rays with energies relevant to medical oncology applications opens up the potential for diagnostic imaging applications.

  1. Direct detection of antiprotons with the Timepix3 in a new electrostatic selection beamline

    Energy Technology Data Exchange (ETDEWEB)

    Pacifico, N., E-mail: nicola.pacifico@cern.ch [Institute of Physics and Technology, University of Bergen, Allgaten 55, 5007 Bergen (Norway); Aghion, S. [Politecnico of Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); INFN Milano, via Celoria 16, 20133 Milano (Italy); Alozy, J. [Physics Department, CERN, 1211 Geneva 23 (Switzerland); Amsler, C.; Ariga, A.; Ariga, T. [Laboratory for High Energy Physics, Albert Einstein Center for Fundamental Physics, University of Bern, 3012 Bern (Switzerland); Bonomi, G. [Department of Mechanical and Industrial Engineering, University of Brescia, via Branze 38, 25123 Brescia (Italy); INFN Pavia, via Bassi 6, 27100 Pavia (Italy); Bräunig, P. [Kirchhoff-Institute for Physics, Heidelberg University, Im Neuenheimer Feld 227, 69120 Heidelberg (Germany); Bremer, J. [Physics Department, CERN, 1211 Geneva 23 (Switzerland); Brusa, R.S. [Department of Physics, University of Trento, via Sommarive 14, 38123 Povo, Trento (Italy); TIFPA/INFN Trento, via Sommarive 14, 38123 Povo, Trento (Italy); Cabaret, L. [Laboratory Aimé Cotton, University of Paris-Sud, ENS Cachan, CNRS, University Paris-Saclay, 91405 Orsay Cedex (France); Caccia, M. [INFN Milano, via Celoria 16, 20133 Milano (Italy); Department of Science, University of Insubria, Via Valleggio 11, 22100 Como (Italy); Campbell, M. [Physics Department, CERN, 1211 Geneva 23 (Switzerland); Caravita, R. [Department of Physics, University of Genova, via Dodecaneso 33, 16146 Genova (Italy); INFN Genova, via Dodecaneso 33, 16146 Genova (Italy); Castelli, F. [INFN Milano, via Celoria 16, 20133 Milano (Italy); Department of Physics, University of Milano, via Celoria 16, 20133 Milano (Italy); Cerchiari, G. [Max Planck Institute for Nuclear Physics, Saupfercheckweg 1, 69117 Heidelberg (Germany); Chlouba, K. [Czech Technical University, Prague, Brehov 7, 11519 Prague 1 (Czech Republic); and others

    2016-09-21

    We present here the first results obtained employing the Timepix3 for the detection and tagging of annihilations of low energy antiprotons. The Timepix3 is a recently developed hybrid pixel detector with advanced Time-of-Arrival and Time-over-Threshold capabilities and has the potential of allowing precise kinetic energy measurements of low energy charged particles from their time of flight. The tagging of the characteristic antiproton annihilation signature, already studied by our group, is enabled by the high spatial and energy resolution of this detector. In this study we have used a new, dedicated, energy selection beamline (GRACE). The line is symbiotic to the AEgIS experiment at the CERN Antiproton Decelerator and is dedicated to detector tests and possibly antiproton physics experiments. We show how the high resolution of the Timepix3 on the Time-of-Arrival and Time-over-Threshold information allows for a precise 3D reconstruction of the annihilation prongs. The presented results point at the potential use of the Timepix3 in antimatter-research experiments where a precise and unambiguous tagging of antiproton annihilations is required.

  2. Aggregating energy flexibilities under constraints

    DEFF Research Database (Denmark)

    Valsomatzis, Emmanouil; Pedersen, Torben Bach; Abello, Alberto

    2016-01-01

    The flexibility of individual energy prosumers (producers and/or consumers) has drawn a lot of attention in recent years. Aggregation of such flexibilities provides prosumers with the opportunity to directly participate in the energy market and at the same time reduces the complexity of scheduling...... the energy units. However, aggregated flexibility should support normal grid operation. In this paper, we build on the flex-offer (FO) concept to model the inherent flexibility of a prosumer (e.g., a single flexible consumption device such as a clothes washer). An FO captures flexibility in both time...... and amount dimensions. We define the problem of aggregating FOs taking into account grid power constraints. We also propose two constraint-based aggregation techniques that efficiently aggregate FOs while retaining flexibility. We show through a comprehensive evaluation that our techniques, in contrast...

  3. Early detection of Pseudomonas aeruginosa – comparison of conventional versus molecular (PCR detection directly from adult patients with cystic fibrosis (CF

    Directory of Open Access Journals (Sweden)

    Moore John E

    2004-10-01

    Full Text Available Abstract Background Pseudomonas aeruginosa (PA is the most important bacterial pathogen in patients with cystic fibrosis (CF patients. Currently, routine bacteriological culture on selective/non- selective culture media is the cornerstone of microbiological detection. The aim of this study was to compare isolation rates of PA by conventional culture and molecular (PCR detection directly from sputum. Methods Adult patients (n = 57 attending the regional adult CF centre in Northern Ireland, provided fresh sputum following airways clearance exercise. Following processing of the specimen with sputasol (1:1 vol, the specimen was examined for the presence of PA by plating onto a combination of culture media (Pseudomonas isolation agar, Blood agar & McConkey agar. In addition, from the same specimen, genomic bacterial DNA was extracted (1 ml and was amplified employing two sequence-specific targets, namely (i the outer membrane protein (oprL gene locus and (ii the exotoxin A (ETA gene locus. Results By sputum culture, there were 30 patients positive for PA, whereas by molecular techniques, there were 35 positive patients. In 39 patients (22 PA +ve & 17 PA -ve, there was complete agreement between molecular and conventional detection and with both PCR gene loci. The oprL locus was more sensitive than the ETA locus, as the former was positive in 10 more patients and there were no patients where the ETA was positive and the oprL target negative. Where a PCR +ve/culture -ve result was recorded (10 patients, we followed these patients and recorded that 5 of these patients converted to being culture-positive at times ranging from 4–17 months later, with a mean lag time of 4.5 months. Conclusions This study indicates that molecular detection of PA in sputum employing the oprL gene target, is a useful technique in the early detection of PA, gaining on average 4.5 months over conventional culture. It now remains to be established whether aggressive antibiotic

  4. An atomic model of brome mosaic virus using direct electron detection and real-space optimization

    Science.gov (United States)

    Wang, Zhao; Hryc, Corey F.; Bammes, Benjamin; Afonine, Pavel V.; Jakana, Joanita; Chen, Dong-Hua; Liu, Xiangan; Baker, Matthew L.; Kao, Cheng; Ludtke, Steven J.; Schmid, Michael F.; Adams, Paul D.; Chiu, Wah

    2014-01-01

    Advances in electron cryo-microscopy have enabled structure determination of macromolecules at near-atomic resolution. However, structure determination, even using de novo methods, remains susceptible to model bias and overfitting. Here we describe a complete workflow for data acquisition, image processing, all-atom modelling and validation of brome mosaic virus, an RNA virus. Data were collected with a direct electron detector in integrating mode and an exposure beyond the traditional radiation damage limit. The final density map has a resolution of 3.8 Å as assessed by two independent data sets and maps. We used the map to derive an all-atom model with a newly implemented real-space optimization protocol. The validity of the model was verified by its match with the density map and a previous model from X-ray crystallography, as well as the internal consistency of models from independent maps. This study demonstrates a practical approach to obtain a rigorously validated atomic resolution electron cryo-microscopy structure. PMID:25185801

  5. An atomic model of brome mosaic virus using direct electron detection and real-space optimization

    Science.gov (United States)

    Wang, Zhao; Hryc, Corey F.; Bammes, Benjamin; Afonine, Pavel V.; Jakana, Joanita; Chen, Dong-Hua; Liu, Xiangan; Baker, Matthew L.; Kao, Cheng; Ludtke, Steven J.; Schmid, Michael F.; Adams, Paul D.; Chiu, Wah

    2014-09-01

    Advances in electron cryo-microscopy have enabled structure determination of macromolecules at near-atomic resolution. However, structure determination, even using de novo methods, remains susceptible to model bias and overfitting. Here we describe a complete workflow for data acquisition, image processing, all-atom modelling and validation of brome mosaic virus, an RNA virus. Data were collected with a direct electron detector in integrating mode and an exposure beyond the traditional radiation damage limit. The final density map has a resolution of 3.8 Å as assessed by two independent data sets and maps. We used the map to derive an all-atom model with a newly implemented real-space optimization protocol. The validity of the model was verified by its match with the density map and a previous model from X-ray crystallography, as well as the internal consistency of models from independent maps. This study demonstrates a practical approach to obtain a rigorously validated atomic resolution electron cryo-microscopy structure.

  6. Detection of lupus anticoagulant in the era of direct oral anticoagulants.

    Science.gov (United States)

    Hoxha, Ariela; Banzato, Alessandra; Ruffatti, Amelia; Pengo, Vittorio

    2017-02-01

    Lupus anticoagulant (LAC) is an in vitro phenomenon determining a phospholipid-dependent elongation of clotting times. The presence of LAC associated with anticardiolipin (aCL) and anti-β2 glycoprotein I (anti-β2GPI) antibodies is strongly associated with thrombosis and pregnancy morbidity. Direct oral anticoagulants (DOACs) targeting thrombin and factor Xa are currently widely use to prevent and treat venous and arterial thromboembolism. Some concern has, however, been expressed about the possibility of false laboratory results during LAC assessment in patients taking these drugs. Several in vitro studies, spiking DOACs into normal plasma as well as ex vivo at peak levels in treated patients, led in false-positive LAC. The dilute Russell Viper Venom time is the assay that is most influenced by rivaroxaban, edoxaban, dabigatran and less by apixaban. Both screening and confirmatory tests have resulted equally prolonged for activated partial thromboplastin time and have not led to false-positive results, but this may depend on the type of reagent used for the test. Taipan/Ecarin snake venoms ratios, has been recommend by some investigators as they do not seem to be affected by rivaroxaban or edoxaban, but these tests are neither standardized nor generally available in clinical practice. In conclusion, for the time being it does not seem advisable to carry out LAC testing during anti-factor Xa and anti-factor IIa treatment because of the risk of false-positive results. Whenever needed in deciding the suspension of DOACs or in case of recurrent thrombosis, LAC determination should be carried out at trough better if DOAC concentration is known. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Direct detection and quantification of abasic sites for in vivo studies of DNA damage and repair

    Energy Technology Data Exchange (ETDEWEB)

    Wang Yanming [Division of Radiopharmaceutical Science, Case Center for Imaging Research, Department of Radiology, Case Western Reserve University, Cleveland, OH 44122 (United States)], E-mail: yanming.wang@case.edu; Liu Lili [Department of Hematology and Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, OH 44122 (United States); Wu Chunying [Division of Radiopharmaceutical Science, Case Center for Imaging Research, Department of Radiology, Case Western Reserve University, Cleveland, OH 44122 (United States); Bulgar, Alina [Department of Hematology and Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, OH 44122 (United States); Somoza, Eduardo; Zhu Wenxia [Division of Radiopharmaceutical Science, Case Center for Imaging Research, Department of Radiology, Case Western Reserve University, Cleveland, OH 44122 (United States); Gerson, Stanton L. [Department of Hematology and Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, OH 44122 (United States)

    2009-11-15

    Use of chemotherapeutic agents to induce cytotoxic DNA damage and programmed cell death is a key strategy in cancer treatments. However, the efficacy of DNA-targeted agents such as temozolomide is often compromised by intrinsic cellular responses such as DNA base excision repair (BER). Previous studies have shown that BER pathway resulted in formation of abasic or apurinic/apyrimidinic (AP) sites, and blockage of AP sites led to a significant enhancement of drug sensitivity due to reduction of DNA base excision repair. Since a number of chemotherapeutic agents also induce formation of AP sites, monitoring of these sites as a clinical correlate of drug effect will provide a useful tool in the development of DNA-targeted chemotherapies aimed at blocking abasic sites from repair. Here we report an imaging technique based on positron emission tomography (PET) that allows for direct quantification of AP sites in vivo. For this purpose, positron-emitting carbon-11 has been incorporated into methoxyamine ([{sup 11}C]MX) that binds covalently to AP sites with high specificity. The binding specificity of [{sup 11}C]MX for AP sites was demonstrated by in vivo blocking experiments. Using [{sup 11}C]MX as a radiotracer, animal PET studies have been conducted in melanoma and glioma xenografts for quantification of AP sites. Following induction of AP sites by temozolomide, both tumor models showed significant increase of [{sup 11}C]MX uptake in tumor regions in terms of radioactivity concentration as a function of time, which correlates well with conventional aldehyde reactive probe (ARP)-based bioassays for AP sites.

  8. Direct dark matter detection with the DarkSide-50 experiment

    Energy Technology Data Exchange (ETDEWEB)

    Pagani, Luca [Univ. of Genoa (Italy)

    2017-01-01

    The existence of dark matter is known because of its gravitational effects, and although its nature remains undisclosed, there is a growing indication that the galactic halo could be permeated by weakly interacting massive particles (WIMPs) with mass of the order of $100$\\,GeV/c$^2$ and coupling with ordinary matter at or below the weak scale. In this context, DarkSide-50 aims to direct observe WIMP-nucleon collisions in a liquid argon dual phase time-projection chamber located deep underground at Gran Sasso National Laboratory, in Italy. In this work a re-analysis of the data that led to the best limit on WIMP-nucleon cross section with an argon target is done. As starting point of the new approach, the energy reconstruction of events is considered: a new energy variable is developed where anti-correlation between ionization and scintillation produced by an interaction is taken into account. As first result, a better energy resolution is achieved. In this new energy framewor k, access is granted to micro-physics parameters fundamental to argon scintillation such as the recombination and quenching as a function of the energy. The improved knowledge of recombination and quenching allows to develop a new model for distinguish between events possibly due to WIMPs and backgrounds. In light of the new model, the final result of this work is a more stringent limit on spin independent WIMP-nucleon cross section with an argon target. This work was supervised by Marco Pallavicini and was completed in collaboration with members of the DarkSide collaboration.

  9. Constraint-based reachability

    Directory of Open Access Journals (Sweden)

    Arnaud Gotlieb

    2013-02-01

    Full Text Available Iterative imperative programs can be considered as infinite-state systems computing over possibly unbounded domains. Studying reachability in these systems is challenging as it requires to deal with an infinite number of states with standard backward or forward exploration strategies. An approach that we call Constraint-based reachability, is proposed to address reachability problems by exploring program states using a constraint model of the whole program. The keypoint of the approach is to interpret imperative constructions such as conditionals, loops, array and memory manipulations with the fundamental notion of constraint over a computational domain. By combining constraint filtering and abstraction techniques, Constraint-based reachability is able to solve reachability problems which are usually outside the scope of backward or forward exploration strategies. This paper proposes an interpretation of classical filtering consistencies used in Constraint Programming as abstract domain computations, and shows how this approach can be used to produce a constraint solver that efficiently generates solutions for reachability problems that are unsolvable by other approaches.

  10. Structure-selective hot-spot Raman enhancement for direct identification and detection of trace penicilloic acid allergen in penicillin.

    Science.gov (United States)

    Zhang, Liying; Jin, Yang; Mao, Hui; Zheng, Lei; Zhao, Jiawei; Peng, Yan; Du, Shuhu; Zhang, Zhongping

    2014-08-15

    Trace penicilloic acid allergen frequently leads to various fatal immune responses to many patients, but it is still a challenge to directly discriminate and detect its residue in penicillin by a chemosensing way. Here, we report that silver-coated gold nanoparticles (Au@Ag NPs) exhibit a structure-selective hot-spot Raman enhancement capability for direct identification and detection of trace penicilloic acid in penicillin. It has been demonstrated that penicilloic acid can very easily link Au@Ag NPs together by its two carboxyl groups, locating itself spontaneously at the interparticle of Au@Ag NPs to form strong Raman hot-spot. At the critical concentration inducing the nanoparticle aggregation, Raman-enhanced effect of penicilloic acid is ~60,000 folds higher than that of penicillin. In particular, the selective Raman enhancement to the two carboxyl groups makes the peak of carboxyl group at C6 of penicilloic acid appear as a new Raman signal due to the opening of β-lactam ring of penicillin. The surface-enhanced Raman scattering (SERS) nanoparticle sensor reaches a sensitive limit lower than the prescribed 1.0‰ penicilloic acid residue in penicillin. The novel strategy to examine allergen is more rapid, convenient and inexpensive than the conventional separation-based assay methods. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Production of anti-Cryptosporidium polyclonal antibodies and standardization of direct immunofluorescence for detecting oocysts in water

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki

    2011-10-01

    Full Text Available INTRODUCTION: The production of anti-Cryptosporidium polyclonal antibodies and its use in direct immunofluorescence assays to determine the presence of Cryptosporidium in water are described in the present work. METHODS: Two rabbits were immunized with soluble and particulate antigens from purified Cryptosporidium oocysts. The sera produced were prepared for immunoglobulin G extraction, which were then purified and conjugated with fluorescein isothiocyanate (FITC. Slides containing known amounts of oocysts were prepared to determine the sensitivity of the technique. To test the specificity, slides containing Giardia duodenalis cysts were prepared. RESULTS: The conjugate was successfully used in water samples experimentally contaminated with Cryptosporidium oocysts, and it was possible to detect up to five oocysts/spot, corresponding to contamination of 250 oocysts/mL. CONCLUSIONS: The three immunizations performed in the rabbits were enough to produce antibodies against Cryptosporidium, the standard direct immunofluorescence assay permitted the detection of five oocysts in 20% of the samples, and no cross-reaction with Giardia duodenalis cysts occurred.

  12. The thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio parahaemolyticus: Sequence variation and implications for detection and function.

    Science.gov (United States)

    Nilsson, William B; Turner, Jeffrey W

    2016-07-01

    Vibrio parahaemolyticus is a leading cause of bacterial food-related illness associated with the consumption of undercooked seafood. Only a small subset of strains is pathogenic. Most clinical strains encode for the thermostable direct hemolysin (TDH) and/or the TDH-related hemolysin (TRH). In this work, we amplify and sequence the trh gene from over 80 trh+strains of this bacterium and identify thirteen genetically distinct alleles, most of which have not been deposited in GenBank previously. Sequence data was used to design new primers for more reliable detection of trh by endpoint PCR. We also designed a new quantitative PCR assay to target a more conserved gene that is genetically-linked to trh. This gene, ureR, encodes the transcriptional regulator for the urease gene cluster immediately upstream of trh. We propose that this ureR assay can be a useful screening tool as a surrogate for direct detection of trh that circumvents challenges associated with trh sequence variation. Published by Elsevier B.V.

  13. Detection of the dominant direction of information flow and feedback links in densely interconnected regulatory networks

    Directory of Open Access Journals (Sweden)

    Ispolatov Iaroslav

    2008-10-01

    Full Text Available Abstract Background Finding the dominant direction of flow of information in densely interconnected regulatory or signaling networks is required in many applications in computational biology and neuroscience. This is achieved by first identifying and removing links which close up feedback loops in the original network and hierarchically arranging nodes in the remaining network. In mathematical language this corresponds to a problem of making a graph acyclic by removing as few links as possible and thus altering the original graph in the least possible way. The exact solution of this problem requires enumeration of all cycles and combinations of removed links, which, as an NP-hard problem, is computationally prohibitive even for modest-size networks. Results We introduce and compare two approximate numerical algorithms for solving this problem: the probabilistic one based on a simulated annealing of the hierarchical layout of the network which minimizes the number of "backward" links going from lower to higher hierarchical levels, and the deterministic, "greedy" algorithm that sequentially cuts the links that participate in the largest number of feedback cycles. We find that the annealing algorithm outperforms the deterministic one in terms of speed, memory requirement, and the actual number of removed links. To further improve a visual perception of the layout produced by the annealing algorithm, we perform an additional minimization of the length of hierarchical links while keeping the number of anti-hierarchical links at their minimum. The annealing algorithm is then tested on several examples of regulatory and signaling networks/pathways operating in human cells. Conclusion The proposed annealing algorithm is powerful enough to performs often optimal layouts of protein networks in whole organisms, consisting of around ~104 nodes and ~105 links, while the applicability of the greedy algorithm is limited to individual pathways with ~100

  14. Searches for Anisotropies in the Arrival Directions of the Highest Energy Cosmic Rays Detected by the Pierre Auger Observatory

    Science.gov (United States)

    Aab, A.; Abreu, P.; Aglietta, M.; Ahn, E. J.; Samarai, I. Al; Albuquerque, I. F. M.; Allekotte, I.; Allen, J.; Allison, P.; Almela, A.; Alvarez Castillo, J.; Alvarez-Muñiz, J.; Alves Batista, R.; Ambrosio, M.; Aminaei, A.; Anchordoqui, L.; Andringa, S.; Aramo, C.; Aranda, V. M.; Arqueros, F.; Asorey, H.; Assis, P.; Aublin, J.; Ave, M.; Avenier, M.; Avila, G.; Awal, N.; Badescu, A. M.; Barber, K. B.; Bäuml, J.; Baus, C.; Beatty, J. J.; Becker, K. H.; Bellido, J. A.; Berat, C.; Bertaina, M. E.; Bertou, X.; Biermann, P. L.; Billoir, P.; Blaess, S. G.; Blanco, M.; Bleve, C.; Blümer, H.; Boháčová, M.; Boncioli, D.; Bonifazi, C.; Bonino, R.; Borodai, N.; Brack, J.; Brancus, I.; Bridgeman, A.; Brogueira, P.; Brown, W. C.; Buchholz, P.; Bueno, A.; Buitink, S.; Buscemi, M.; Caballero-Mora, K. S.; Caccianiga, B.; Caccianiga, L.; Candusso, M.; Caramete, L.; Caruso, R.; Castellina, A.; Cataldi, G.; Cazon, L.; Cester, R.; Chavez, A. G.; Chiavassa, A.; Chinellato, J. A.; Chudoba, J.; Cilmo, M.; Clay, R. W.; Cocciolo, G.; Colalillo, R.; Coleman, A.; Collica, L.; Coluccia, M. R.; Conceição, R.; Contreras, F.; Cooper, M. J.; Cordier, A.; Coutu, S.; Covault, C. E.; Cronin, J.; Curutiu, A.; Dallier, R.; Daniel, B.; Dasso, S.; Daumiller, K.; Dawson, B. R.; de Almeida, R. M.; De Domenico, M.; de Jong, S. J.; de Mello Neto, J. R. T.; De Mitri, I.; de Oliveira, J.; de Souza, V.; del Peral, L.; Deligny, O.; Dembinski, H.; Dhital, N.; Di Giulio, C.; Di Matteo, A.; Diaz, J. C.; Díaz Castro, M. L.; Diogo, F.; Dobrigkeit, C.; Docters, W.; D'Olivo, J. C.; Dorofeev, A.; Dorosti Hasankiadeh, Q.; Dova, M. T.; Ebr, J.; Engel, R.; Erdmann, M.; Erfani, M.; Escobar, C. O.; Espadanal, J.; Etchegoyen, A.; Facal San Luis, P.; Falcke, H.; Fang, K.; Farrar, G.; Fauth, A. C.; Fazzini, N.; Ferguson, A. P.; Fernandes, M.; Fick, B.; Figueira, J. M.; Filevich, A.; Filipčič, A.; Fox, B. D.; Fratu, O.; Freire, M. M.; Fröhlich, U.; Fuchs, B.; Fujii, T.; Gaior, R.; García, B.; Garcia-Gamez, D.; Garcia-Pinto, D.; Garilli, G.; Gascon Bravo, A.; Gate, F.; Gemmeke, H.; Ghia, P. L.; Giaccari, U.; Giammarchi, M.; Giller, M.; Glaser, C.; Glass, H.; Gómez Berisso, M.; Gómez Vitale, P. F.; Gonçalves, P.; Gonzalez, J. G.; González, N.; Gookin, B.; Gordon, J.; Gorgi, A.; Gorham, P.; Gouffon, P.; Grebe, S.; Griffith, N.; Grillo, A. F.; Grubb, T. D.; Guarino, F.; Guedes, G. P.; Hampel, M. R.; Hansen, P.; Harari, D.; Harrison, T. A.; Hartmann, S.; Harton, J. L.; Haungs, A.; Hebbeker, T.; Heck, D.; Heimann, P.; Herve, A. E.; Hill, G. C.; Hojvat, C.; Hollon, N.; Holt, E.; Homola, P.; Hörandel, J. R.; Horvath, P.; Hrabovský, M.; Huber, D.; Huege, T.; Insolia, A.; Isar, P. G.; Jandt, I.; Jansen, S.; Jarne, C.; Josebachuili, M.; Kääpä, A.; Kambeitz, O.; Kampert, K. H.; Kasper, P.; Katkov, I.; Kégl, B.; Keilhauer, B.; Keivani, A.; Kemp, E.; Kieckhafer, R. M.; Klages, H. O.; Kleifges, M.; Kleinfeller, J.; Krause, R.; Krohm, N.; Krömer, O.; Kruppke-Hansen, D.; Kuempel, D.; Kunka, N.; LaHurd, D.; Latronico, L.; Lauer, R.; Lauscher, M.; Lautridou, P.; Le Coz, S.; Leão, M. S. A. B.; Lebrun, D.; Lebrun, P.; Leigui de Oliveira, M. A.; Letessier-Selvon, A.; Lhenry-Yvon, I.; Link, K.; López, R.; Louedec, K.; Lozano Bahilo, J.; Lu, L.; Lucero, A.; Ludwig, M.; Malacari, M.; Maldera, S.; Mallamaci, M.; Maller, J.; Mandat, D.; Mantsch, P.; Mariazzi, A. G.; Marin, V.; Mariş, I. C.; Marsella, G.; Martello, D.; Martin, L.; Martinez, H.; Martínez Bravo, O.; Martraire, D.; Masías Meza, J. J.; Mathes, H. J.; Mathys, S.; Matthews, J.; Matthews, J. A. J.; Matthiae, G.; Maurel, D.; Maurizio, D.; Mayotte, E.; Mazur, P. O.; Medina, C.; Medina-Tanco, G.; Meissner, R.; Melissas, M.; Melo, D.; Menshikov, A.; Messina, S.; Meyhandan, R.; Mićanović, S.; Micheletti, M. I.; Middendorf, L.; Minaya, I. A.; Miramonti, L.; Mitrica, B.; Molina-Bueno, L.; Mollerach, S.; Monasor, M.; Monnier Ragaigne, D.; Montanet, F.; Morello, C.; Mostafá, M.; Moura, C. A.; Muller, M. A.; Müller, G.; Müller, S.; Münchmeyer, M.; Mussa, R.; Navarra, G.; Navas, S.; Necesal, P.; Nellen, L.; Nelles, A.; Neuser, J.; Nguyen, P. H.; Niechciol, M.; Niemietz, L.; Niggemann, T.; Nitz, D.; Nosek, D.; Novotny, V.; Nožka, L.; Ochilo, L.; Oikonomou, F.; Olinto, A.; Oliveira, M.; Pacheco, N.; Pakk Selmi-Dei, D.; Palatka, M.; Pallotta, J.; Palmieri, N.; Papenbreer, P.; Parente, G.; Parra, A.; Paul, T.; Pech, M.; Pȩkala, J.; Pelayo, R.; Pepe, I. M.; Perrone, L.; Petermann, E.; Peters, C.; Petrera, S.; Petrov, Y.; Phuntsok, J.; Piegaia, R.; Pierog, T.; Pieroni, P.; Pimenta, M.; Pirronello, V.; Platino, M.; Plum, M.; Porcelli, A.; Porowski, C.; Prado, R. R.; Privitera, P.; Prouza, M.; Purrello, V.; Quel, E. J.; Querchfeld, S.; Quinn, S.; Rautenberg, J.; Ravel, O.; Ravignani, D.; Revenu, B.; Ridky, J.; Riggi, S.; Risse, M.; Ristori, P.; Rizi, V.; Rodrigues de Carvalho, W.; Rodriguez Fernandez, G.; Rodriguez Rojo, J.; Rodríguez-Frías, M. D.; Rogozin, D.; Ros, G.; Rosado, J.; Rossler, T.; Roth, M.; Roulet, E.; Rovero, A. C.; Saffi, S. J.; Saftoiu, A.; Salamida, F.; Salazar, H.; Saleh, A.; Salesa Greus, F.; Salina, G.; Sánchez, F.; Sanchez-Lucas, P.; Santo, C. E.; Santos, E.; Santos, E. M.; Sarazin, F.; Sarkar, B.; Sarmento, R.; Sato, R.; Scharf, N.; Scherini, V.; Schieler, H.; Schiffer, P.; Schmidt, D.; Scholten, O.; Schoorlemmer, H.; Schovánek, P.; Schröder, F. G.; Schulz, A.; Schulz, J.; Schumacher, J.; Sciutto, S. J.; Segreto, A.; Settimo, M.; Shadkam, A.; Shellard, R. C.; Sidelnik, I.; Sigl, G.; Sima, O.; Śmiałkowski, A.; Šmída, R.; Snow, G. R.; Sommers, P.; Sorokin, J.; Squartini, R.; Srivastava, Y. N.; Stanič, S.; Stapleton, J.; Stasielak, J.; Stephan, M.; Stutz, A.; Suarez, F.; Suomijärvi, T.; Supanitsky, A. D.; Sutherland, M. S.; Swain, J.; Szadkowski, Z.; Szuba, M.; Taborda, O. A.; Tapia, A.; Tepe, A.; Theodoro, V. M.; Timmermans, C.; Todero Peixoto, C. J.; Toma, G.; Tomankova, L.; Tomé, B.; Tonachini, A.; Torralba Elipe, G.; Torres Machado, D.; Travnicek, P.; Trovato, E.; Ulrich, R.; Unger, M.; Urban, M.; Valdés Galicia, J. F.; Valiño, I.; Valore, L.; van Aar, G.; van Bodegom, P.; van den Berg, A. M.; van Velzen, S.; van Vliet, A.; Varela, E.; Vargas Cárdenas, B.; Varner, G.; Vázquez, J. R.; Vázquez, R. A.; Veberič, D.; Verzi, V.; Vicha, J.; Videla, M.; Villase ñor, L.; Vlcek, B.; Vorobiov, S.; Wahlberg, H.; Wainberg, O.; Walz, D.; Watson, A. A.; Weber, M.; Weidenhaupt, K.; Weindl, A.; Werner, F.; Widom, A.; Wiencke, L.; Wilczyńska, B.; Wilczyński, H.; Williams, C.; Winchen, T.; Wittkowski, D.; Wundheiler, B.; Wykes, S.; Yamamoto, T.; Yapici, T.; Yuan, G.; Yushkov, A.; Zamorano, B.; Zas, E.; Zavrtanik, D.; Zavrtanik, M.; Zepeda, A.; Zhou, J.; Zhu, Y.; Zimbres Silva, M.; Ziolkowski, M.; Zuccarello, F.; Pierre Auger Collaboration

    2015-05-01

    We analyze the distribution of arrival directions of ultra-high-energy cosmic rays recorded at the Pierre Auger Observatory in 10 years of operation. The data set, about three times larger than that used in earlier studies, includes arrival directions with zenith angles up to 80°, thus covering from -90{}^\\circ to +45{}^\\circ in declination. After updating the fraction of events correlating with the active galactic nuclei (AGNs) in the Véron-Cetty and Véron catalog, we subject the arrival directions of the data with energies in excess of 40 EeV to different tests for anisotropy. We search for localized excess fluxes, self-clustering of event directions at angular scales up to 30°, and different threshold energies between 40 and 80 EeV. We then look for correlations of cosmic rays with celestial structures both in the Galaxy (the Galactic Center and Galactic Plane) and in the local universe (the Super-Galactic Plane). We also examine their correlation with different populations of nearby extragalactic objects: galaxies in the 2MRS catalog, AGNs detected by Swift-BAT, radio galaxies with jets, and the Centaurus A (Cen A) galaxy. None of the tests show statistically significant evidence of anisotropy. The strongest departures from isotropy (post-trial probability ˜ 1.4%) are obtained for cosmic rays with E\\gt 58 EeV in rather large windows around Swift AGNs closer than 130 Mpc and brighter than 1044 erg s-1 (18° radius), and around the direction of Cen A (15° radius).

  15. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    Directory of Open Access Journals (Sweden)

    Zakham F

    2013-11-01

    new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu, accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T.Conclusion: The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in critical cases to adjust the treatment regimen and limit the emergence of MDR and XDR strains.Keywords: Morocco, Mycobacterium tuberculosis, multidrug resistance, rpoB, katG, inhA promoter

  16. New Constraints on Dark Matter Effective Theories from Standard Model Loops

    CERN Document Server

    Crivellin, Andreas; Procura, Massimiliano

    2014-01-01

    We consider an effective field theory for a gauge singlet Dirac dark matter (DM) particle interacting with the Standard Model (SM) fields via effective operators suppressed by the scale $\\Lambda \\gtrsim 1$ TeV. We perform a systematic analysis of the leading loop contributions to spin-independent (SI) DM--nucleon scattering using renormalization group evolution between $\\Lambda$ and the low-energy scale probed by direct detection experiments. We find that electroweak interactions induce operator mixings such that operators that are naively velocity-suppressed and spin-dependent can actually contribute to SI scattering. This allows us to put novel constraints on Wilson coefficients that were so far poorly bounded by direct detection. Constraints from current searches are comparable to LHC bounds, and will significantly improve in the near future. Interestingly, the loop contribution we find is maximally isospin violating even if the underlying theory is isospin conserving.

  17. New constraints on dark matter effective theories from standard model loops.

    Science.gov (United States)

    Crivellin, Andreas; D'Eramo, Francesco; Procura, Massimiliano

    2014-05-16

    We consider an effective field theory for a gauge singlet Dirac dark matter particle interacting with the standard model fields via effective operators suppressed by the scale Λ ≳ 1 TeV. We perform a systematic analysis of the leading loop contributions to spin-independent Dirac dark matter-nucleon scattering using renormalization group evolution between Λ and the low-energy scale probed by direct detection experiments. We find that electroweak interactions induce operator mixings such that operators that are naively velocity suppressed and spin dependent can actually contribute to spin-independent scattering. This allows us to put novel constraints on Wilson coefficients that were so far poorly bounded by direct detection. Constraints from current searches are already significantly stronger than LHC bounds, and will improve in the near future. Interestingly, the loop contribution we find is isospin violating even if the underlying theory is isospin conserving.

  18. A novel SNP analysis method to detect copy number alterations with an unbiased reference signal directly from tumor samples

    Directory of Open Access Journals (Sweden)

    LaFramboise William A

    2011-01-01

    Full Text Available Abstract Background Genomic instability in cancer leads to abnormal genome copy number alterations (CNA as a mechanism underlying tumorigenesis. Using microarrays and other technologies, tumor CNA are detected by comparing tumor sample CN to normal reference sample CN. While advances in microarray technology have improved detection of copy number alterations, the increase in the number of measured signals, noise from array probes, variations in signal-to-noise ratio across batches and disparity across laboratories leads to significant limitations for the accurate identification of CNA regions when comparing tumor and normal samples. Methods To address these limitations, we designed a novel "Virtual Normal" algorithm (VN, which allowed for construction of an unbiased reference signal directly from test samples within an experiment using any publicly available normal reference set as a baseline thus eliminating the need for an in-lab normal reference set. Results The algorithm was tested using an optimal, paired tumor/normal data set as well as previously uncharacterized pediatric malignant gliomas for which a normal reference set was not available. Using Affymetrix 250K Sty microarrays, we demonstrated improved signal-to-noise ratio and detected significant copy number alterations using the VN algorithm that were validated by independent PCR analysis of the target CNA regions. Conclusions We developed and validated an algorithm to provide a virtual normal reference signal directly from tumor samples and minimize noise in the derivation of the raw CN signal. The algorithm reduces the variability of assays performed across different reagent and array batches, methods of sample preservation, multiple personnel, and among different laboratories. This approach may be valuable when matched normal samples are unavailable or the paired normal specimens have been subjected to variations in methods of preservation.

  19. Wavelet Entropy and Directed Acyclic Graph Support Vector Machine for Detection of Patients with Unilateral Hearing Loss in MRI Scanning.

    Science.gov (United States)

    Wang, Shuihua; Yang, Ming; Du, Sidan; Yang, Jiquan; Liu, Bin; Gorriz, Juan M; Ramírez, Javier; Yuan, Ti-Fei; Zhang, Yudong

    2016-01-01

    Highlights We develop computer-aided diagnosis system for unilateral hearing loss detection in structural magnetic resonance imaging.Wavelet entropy is introduced to extract image global features from brain images. Directed acyclic graph is employed to endow support vector machine an ability to handle multi-class problems.The developed computer-aided diagnosis system achieves an overall accuracy of 95.1% for this three-class problem of differentiating left-sided and right-sided hearing loss from healthy controls. Aim: Sensorineural hearing loss (SNHL) is correlated to many neurodegenerative disease. Now more and more computer vision based methods are using to detect it in an automatic way. Materials: We have in total 49 subjects, scanned by 3.0T MRI (Siemens Medical Solutions, Erlangen, Germany). The subjects contain 14 patients with right-sided hearing loss (RHL), 15 patients with left-sided hearing loss (LHL), and 20 healthy controls (HC). Method: We treat this as a three-class classification problem: RHL, LHL, and HC. Wavelet entropy (WE) was selected from the magnetic resonance images of each subjects, and then submitted to a directed acyclic graph support vector machine (DAG-SVM). Results: The 10 repetition results of 10-fold cross validation shows 3-level decomposition will yield an overall accuracy of 95.10% for this three-class classification problem, higher than feedforward neural network, decision tree, and naive Bayesian classifier. Conclusions: This computer-aided diagnosis system is promising. We hope this study can attract more computer vision method for detecting hearing loss.

  20. Direct Determination of a Small-Molecule Drug, Valproic Acid, by an Electrically-Detected Microcantilever Biosensor for Personalized Diagnostics

    Directory of Open Access Journals (Sweden)

    Long-Sun Huang

    2015-01-01

    Full Text Available Direct, small-molecule determination of the antiepileptic drug, valproic acid, was investigated by a label-free, nanomechanical biosensor. Valproic acid has long been used as an antiepileptic medication, which is administered through therapeutic drug monitoring and has a narrow therapeutic dosage range of 50–100 μg·mL−1 in blood or serum. Unlike labeled and clinically-used measurement techniques, the label-free, electrical detection microcantilever biosensor can be miniaturized and simplified for use in portable or hand-held point-of-care platforms or personal diagnostic tools. A micromachined microcantilever sensor was packaged into the micro-channel of a fluidic system. The measurement of the antiepileptic drug, valproic acid, in phosphate-buffered saline and serum used a single free-standing, piezoresistive microcantilever biosensor in a thermally-controlled system. The measured surface stresses showed a profile over a concentration range of 50–500 μg·mL−1, which covered the clinically therapeutic range of 50–100 μg·mL−1. The estimated limit of detection (LOD was calculated to be 45 μg·mL−1, and the binding affinity between the drug and the antibody was measured at around 90 ± 21 μg·mL−1. Lastly, the results of the proposed device showed a similar profile in valproic acid drug detection with those of the clinically-used fluorescence polarization immunoassay.

  1. Rapid detection of Orthopoxvirus by semi-nested PCR directly from clinical specimens: a useful alternative for routine laboratories.

    Science.gov (United States)

    Abrahão, Jônatas Santos; Drumond, Betânia Paiva; Trindade, Giliane de Souza; da Silva-Fernandes, André Tavares; Ferreira, Jaqueline Maria Siqueira; Alves, Pedro Augusto; Campos, Rafael Kroon; Siqueira, Larissa; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien

    2010-04-01

    Orthopoxvirus (OPV) has been associated with worldwide exanthematic outbreaks, which have resulted in serious economic losses as well as impact on public health. Although the current classical and molecular methods are useful for the diagnosis of OPV, they are largely inaccessible to unsophisticated clinical laboratories. The major reason for the inaccessibility is that they require both virus isolation and DNA manipulation. In this report, a rapid, sensitive and low-cost semi-nested PCR method is described for the detection of OPV DNA directly from clinical specimens. A set of primers was designed to amplify the conserved OPV vgf gene. The most useful thermal and chemical conditions were selected and minimum non-inhibitory dilutions were determined. More than 100 Brazilian Vaccinia virus (VACV) field clinical specimens were tested using this semi-nested PCR in order to confirm its applicability. Cowpox virus was also detected by PCR from the ear scabs of scarified Balb/c mice. In addition, the method was highly sensitive for the detection of VACV DNA in murine blood and excreta, which are among the suggested reservoirs of OPV. Together, these data suggest that semi-nested PCR can be used for initial screening for OPV and as a routine diagnostic laboratory method. 2010 Wiley-Liss, Inc.

  2. A New Lab Developed Real Time PCR Assay for Direct Detection of C. Difficle from Stool Sample without DNA Extraction.

    Science.gov (United States)

    Li, Brandon

    2016-09-01

    Clostridium difficile is a major cause of nosocomial antibiotic-associated infectious diarrhea and pseudomembranous colitis. Detection of C. difficile by anaerobic bacterial culture and/or cytotoxicity assays has been largely replaced by rapid enzyme immunoassays (EIA). However, due to the lack of sensitivity of stool EIA, we developed a multiplex real-time PCR assay targeting the C. difficile toxin genes tcdB. stool samples from hospitalized pediatric patients suspected of having C. difficile-associated disease were prospectively collected. Three testing modalities were evaluated, including enriched culture, cepheid Xpert and real-time Pcr (tcdB) on stool samples performed with tcdB gene-specific primers and hydrolysis probes. A total of 150 de-identified clinical specimen were analyzed. The sensitivities of stool real-time Pcr were 95% against cepheid Xpert C. difficile and 93% against enriched culture respectively, with a specificity of 97% and 94%. The lower limit of detection of the stool real-time PCR was 0.5 cFU/ml of per reaction for tcdB. Direct detection of C. difficile toxin genes in stool samples by real-time Pcr showed performance comparable to enriched culture. Real-time PCR of DNA from stool samples is a rapid and cost-effective diagnostic modality for patients that should facilitate appropriate patient management.

  3. Evaluation of real time PCR assays for the detection and enumeration of enterohemorrhagic Escherichia coli directly from cattle feces.

    Science.gov (United States)

    Luedtke, Brandon E; Bono, James L; Bosilevac, Joseph M

    2014-10-01

    Shiga toxin-producing Escherichia coli are a growing concern in the area of food safety, and the United States Department of Agriculture Food Safety and Inspection Service has identified the serotypes O26, O45, O103, O111, O121, O145, and O157 as adulterants in certain types of raw beef. The most relevant to human disease are the enterohemorrhagic E. coli (EHEC) strains that possess intimin (eae), Shiga toxin 1 and/or 2 (stx1-2), and in most cases the conserved pO157 or pO157 like virulence plasmid. Contamination of raw beef with EHEC is likely to occur via the transfer of cattle feces on hides to the carcass. To detect EHEC directly from cattle feces, we evaluated the utility of a multiplex real time PCR assay that targets the EHEC associated gene target ecf1 in combination with eae and stx1-2. Our assay had an increased sensitivity and provided a reliable limit of detection (LOD) of 1.25×10(3)colony-forming unitspermL (CFUs/mL) in an EHEC spiked fecal background. In addition, we evaluated the use of a duplex qPCR assay using ecf1 for the enumeration of total EHEC directly from cattle feces. The reliable limit of quantification (LOQ) was determined to be 1.25×10(3)CFUs/mL. Our assay requires minimal sample processing and provides LOD and LOQ of EHEC directly from cattle feces that are the lowest reported. The application of this assay towards the identification of cattle shedding EHEC at a level above 1.25×10(3)CFUs/mL could be a first line of defense in identifying cattle shedding these pathogens. Published by Elsevier B.V.

  4. Hematobiochemical alterations and direct blood polymerase chain reaction detection of Theileria annulata in naturally infected crossbred cows

    Directory of Open Access Journals (Sweden)

    Anita Ganguly

    2015-01-01

    Full Text Available Aim: The aim was to determine hemato-biochemical changes and rapid diagnosis of Theileria annulata in naturally infected crossbred cows. Materials and Methods: Blood samples from lactating crossbred cows (n=40 between 3 and 7 years of age and showing clinical signs of tropical theileriosis were collected, with or without anticoagulant, and analyzed for tropical theileriosis by direct smear, direct blood polymerase chain reaction (PCR detection of merozoite-piroplasm surface antigen (Tams1 gene specific amplicon, estimation of hematological and biochemical parameters. Healthy crossbred cows (n=6, examined free from hemoprotozoan infections were included as control. Results: The infected crossbred cows revealed significantly (p<0.001 lower values of total erythrocytic counts (4.46±0.2× 106/μL, hemoglobin (Hb 6.025±0.39 g%, packed cell volume (17.05±1.1%, mean corpuscular volume (37.94±1.70 fL and mean corpuscular Hb (13.5±0.48 pg; p<0.002 compared with healthy control. The serum samples of infected cows revealed profound (p<0.05 hyponatremia (Na 133.21±2.36 mEq/l and hypocalcemia (Ca 8.39±0.34 mg%. Infected crossbred cows showed a significant increase (p<0.05 of mean serum activity of alanine aminotransferase (61.45±13.36 U/L, aspartate aminotransferase (146.1±20.97 U/L, blood urea nitrogen (28.26±3.90 mg%, creatinine (1.55±0.13 mg%, direct bilirubin (0.33±0.04 mg%; p<0.001 and lactate dehydrogenase (3001.32±167.0 U/L; p<001. Blood direct PCR revealed a 721-bp fragment amplified from the target gene encoding 30-kDa major merozoite surface antigen of T. annulata using specific primer pairs. This assay was positive for all the infected animals. Conclusion: The assessments of hemato-biochemical parameters in T. annulata infected crossbred cows may be useful in understanding disease pathogenesis, prognosis and corrective measures for supportive therapy. Moreover, blood direct PCR can reliably be used for rapid detection of T. annulata

  5. Wearable Therapy - Detecting Information from Wearables and Mobiles that are Relevant to Clinical and Self-directed Therapy.

    Science.gov (United States)

    Arnrich, Bert; Ersoy, Cem; Mayora, Oscar; Dey, Anind; Berthouze, Nadia; Kunze, Kai

    2017-01-09

    This accompanying editorial provides a brief introduction into the focus theme "Wearable Therapy". The focus theme "Wearable Therapy" aims to present contributions which target wearable and mobile technologies to support clinical and self-directed therapy. A call for papers was announced to all participants of the "9th International Conference on Pervasive Computing Technologies for Healthcare" and was published in November 2015. A peer review process was conducted to select the papers for the focus theme. Six papers were selected to be included in this focus theme. The paper topics cover a broad range including an approach to build a health informatics research program, a comprehensive literature review of self-quantification for health self-management, methods for affective state detection of informal care givers, social-aware handling of falls, smart shoes for supporting self-directed therapy of alcohol addicts, and reference information model for pervasive health systems. More empirical evidence is needed that confirms sustainable effects of employing wearable and mobile technology for clinical and self-directed therapy. Inconsistencies between different conceptual approaches need to be revealed in order to enable more systematic investigations and comparisons.

  6. The design of a cryogenic dark matter detector based on the detection of the recoil direction of target nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Gaitskell, R.J. [Oxford Univ. (United Kingdom). Dept. of Physics; Angrave, L.C. [Oxford Univ. (United Kingdom). Dept. of Physics; Booth, N.E. [Oxford Univ. (United Kingdom). Dept. of Physics; Esposito, E. [Oxford Univ. (United Kingdom). Dept. of Physics; Giles, T.J. [Oxford Univ. (United Kingdom). Dept. of Physics; Hoess, C. [Oxford Univ. (United Kingdom). Dept. of Physics; Houwman, E.P. [Oxford Univ. (United Kingdom). Dept. of Physics; Salmon, G.L. [Oxford Univ. (United Kingdom). Dept. of Physics; Van den Putte, M. [Oxford Univ. (United Kingdom). Dept. of Physics; Waenninger, S. [Oxford Univ. (United Kingdom). Dept. of Physics

    1996-02-11

    We discuss the design of a cryogenic detector for a WIMP dark matter search based on single crystal absorbers and using Series Arrays of Superconducting Tunnel Junctions (SASTJs). The distribution of recoil vectors of target nuclei from WIMP interactions are affected by the motion of the laboratory through the dark matter halo. The angular distribution of recoil directions is skewed due to the motion of the solar system around the galaxy and is modulated by the diurnal and annual rotation of the earth. We discuss the kinematics of the recoil events and how a directional signal might be identified in our cryogenic detectors using the fast response of SASTJs to the ballistic phonons arising in the absorber from WIMP interactions. We consider how the anisotropy of a dark matter recoil distribution can be used to place statistical limits on its component relative to the isotropic background signal. We also consider how the dark matter limit is altered if only the axis of the nuclear recoil, rather than the full recoil direction is available. We also briefly consider the effect of phonon focusing within single crystal absorbers. Focusing will modulate strongly the signal detected by the SASTJs, on the crystal surface, as the position of the interaction within the crystal varies. A comparison is made between the behaviour of phonons in strongly focusing crystals, such as Nb, Si and LiF, and their near isotropic propagation in BaF{sub 2}. (orig.).

  7. A lateral flow immunosensor for direct, sensitive, and highly selective detection of hemoglobin A1c in whole blood.

    Science.gov (United States)

    Ang, Shu Hwang; Thevarajah, T Malathi; Woi, Pei Meng; Alias, Yatimah Binti; Khor, Sook Mei

    2016-03-15

    An immunosensor that operates based on the principles of lateral flow was developed for direct detection of hemoglobin A1c (HbA1c) in whole blood. We utilized colloidal gold-functionalized antibodies to transduce the specific signal generated when sandwich immuno-complexes were formed on the strip in the presence of HbA1c. The number and intensity of the test lines on the strips indicate normal, under control, and elevated levels of HbA1c. In addition, a linear relationship between HbA1c levels and immunosensor signal intensity was confirmed, with a dynamic range of 4-14% (20-130 mmol mol(-1)) HbA1c. Using this linear relationship, we determined the HbA1c levels in blood as a function of the signal intensity on the strips. Measurements were validated using the Bio-Rad Variant II HPLC and DCA Vantage tests. Moreover, the immunosensor was verified to be highly selective for detection of HbA1c against HbA0, glycated species of HbA0, and HbA2. The limit of detection was found to be 42.5 μg mL(-1) (1.35 mmol mol(-1)) HbA1c, which is reasonably sensitive compared to the values reported for microarray immunoassays. The shelf life of the immunosensor was estimated to be 1.4 months when stored at ambient temperature, indicating that the immunoassay is stable. Thus, the lateral flow immunosensor developed here was shown to be capable of performing selective, accurate, rapid, and stable detection of HbA1c in human blood samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. DIRECT DETECTION OF PRECURSORS OF GAS GIANTS FORMED BY GRAVITATIONAL INSTABILITY WITH THE ATACAMA LARGE MILLIMETER/SUBMILLIMETER ARRAY

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, Lucio [Center for Theoretical Astrophysics and Cosmology, Institute for Computational Science, University of Zurich, Winterthurerstrasse 190, CH-8057 Zürich (Switzerland); Peters, Thomas [Max-Planck-Institut für Astrophysik, Karl-Schwarzschild-Str. 1, D-85748 Garching (Germany); Pineda, Jaime E. [Max-Planck-Institut für extraterrestrische Physik, Giessenbachstrasse 1, D-85748 Garching (Germany); Wadsley James; Rogers, Patrick, E-mail: p.rogers@marianopolis.edu [Department of Physics and Astronomy, McMaster University, Hamilton, ON L8S 4M1 (Canada)

    2016-06-01

    Phases of gravitational instability are expected in the early phases of disk evolution, when the disk mass is still a substantial fraction of the mass of the star. Disk fragmentation into sub-stellar objects could occur in the cold exterior part of the disk. Direct detection of massive gaseous clumps on their way to collapse into gas giant planets would offer an unprecedented test of the disk instability model. Here we use state-of-the-art 3D radiation-hydro simulations of disks undergoing fragmentation into massive gas giants, post-processed with RADMC-3D to produce dust continuum emission maps. These are then fed into the Common Astronomy Software Applications (CASA) ALMA simulator. The synthetic maps show that both overdense spiral arms and actual clumps at different stages of collapse can be detected with the Atacama Large Millimeter/submillimeter Array (ALMA) in the full configuration at the distance of the Ophiuchus star forming region (125 pc). The detection of clumps is particularly effective at shorter wavelengths (690 GHz) combining two resolutions with multi-scale clean. Furthermore, we show that a flux-based estimate of the mass of a protoplanetary clump can be comparable to a factor of three higher than the gravitationally bound clump mass. The estimated mass depends on the assumed opacity, and on the gas temperature, which should be set using the input of radiation-hydro simulations. We conclude that ALMA has the capability to detect “smoking gun” systems that are a signpost of the disk instability model for gas giant planet formation.

  9. Biological constraints do not entail cognitive closure.

    Science.gov (United States)

    Vlerick, Michael

    2014-12-01

    From the premise that our biology imposes cognitive constraints on our epistemic activities, a series of prominent authors--most notably Fodor, Chomsky and McGinn--have argued that we are cognitively closed to certain aspects and properties of the world. Cognitive constraints, they argue, entail cognitive closure. I argue that this is not the case. More precisely, I detect two unwarranted conflations at the core of arguments deriving closure from constraints. The first is a conflation of what I will refer to as 'representation' and 'object of representation'. The second confuses the cognitive scope of the assisted mind for that of the unassisted mind. Cognitive closure, I conclude, cannot be established from pointing out the (uncontroversial) existence of cognitive constraints. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Free-space optical communications with peak and average constraints: High SNR capacity approximation

    KAUST Repository

    Chaaban, Anas

    2015-09-07

    The capacity of the intensity-modulation direct-detection (IM-DD) free-space optical channel with both average and peak intensity constraints is studied. A new capacity lower bound is derived by using a truncated-Gaussian input distribution. Numerical evaluation shows that this capacity lower bound is nearly tight at high signal-to-noise ratio (SNR), while it is shown analytically that the gap to capacity upper bounds is a small constant at high SNR. In particular, the gap to the high-SNR asymptotic capacity of the channel under either a peak or an average constraint is small. This leads to a simple approximation of the high SNR capacity. Additionally, a new capacity upper bound is derived using sphere-packing arguments. This bound is tight at high SNR for a channel with a dominant peak constraint.

  11. Evaluation of a rapid method for the detection of streptococcal group A antigen directly from throat swabs.

    Science.gov (United States)

    Venezia, R A; Ryan, A; Alward, S; Kostun, W A

    1985-01-01

    Throat swabs from 196 pediatric patients were processed by a direct extraction-latex agglutination method (Group A Strep Direct Antigen Identification Test [DAI]) that detects group A streptococci in the specimen. The method requires a 45-min enzymatic extraction period at 37 degrees C and a 4-min reaction period with antibody-linked latex particles. The results were compared with those of the culture and fluorescent antibody methods and the clinical presentation of the patient for pharyngitis. Ninety-three percent of the specimens resulted in agreement by all tests, and 28% were culture positive for group A streptococci. Compared with the culture method, the DAI had a sensitivity and a specificity of 83% and 99%, respectively. The positive predictive values were 98% versus the culture method and 93% versus the fluorescent antibody method, whereas the negative predictive values were 94% versus both other methods. Of the 14 discrepant results when both clinical presentation of an acute pharyngitis and the test results were compared, the culture method provided the best correlation. An additional 64 specimens were processed by the DAI and another direct extraction-latex agglutination method (Culturette Ten-Minute Group A Strep ID Test), and the results were compared with those of the culture method. This group had a 40.6% culture isolation rate for group A streptococci. The sensitivity and specificity of the DAI and Strep ID methods versus the culture method were 81 and 100%, and 77 and 97%, respectively. These results indicate that the DAI is accurate for diagnosing group A streptococcal pharyngitis directly from throat swabs. However, negative results in the presence of a symptomatic patient must be confirmed by standard culture techniques. PMID:3884656

  12. Novel directed search strategy to detect continuous gravitational waves from neutron stars in low- and high-eccentricity binary systems

    Science.gov (United States)

    Leaci, Paola; Astone, Pia; D'Antonio, Sabrina; Frasca, Sergio; Palomba, Cristiano; Piccinni, Ornella; Mastrogiovanni, Simone

    2017-06-01

    We describe a novel, very fast and robust, directed search incoherent method (which means that the phase information is lost) for periodic gravitational waves from neutron stars in binary systems. As a directed search, we assume the source sky position to be known with enough accuracy, but all other parameters (including orbital ones) are supposed to be unknown. We exploit the frequency modulation due to source orbital motion to unveil the signal signature by commencing from a collection of time and frequency peaks (the so-called "peakmap"). We validate our algorithm (pipeline), adding 131 artificial continuous-wave signals from pulsars in binary systems to simulated detector Gaussian noise, characterized by a power spectral density Sh=4 ×10-24 Hz-1 /2 in the frequency interval [70, 200] Hz, which is overall commensurate with the advanced detector design sensitivities. The pipeline detected 128 signals, and the weakest signal injected (added) and detected has a gravitational-wave strain amplitude of ˜10-24, assuming one month of gapless data collected by a single advanced detector. We also provide sensitivity estimations, which show that, for a single-detector data covering one month of observation time, depending on the source orbital Doppler modulation, we can detect signals with an amplitude of ˜7 ×10-25. By using three detectors, and one year of data, we would easily gain a factor 3 in sensitivity, translating into being able to detect weaker signals. We also discuss the parameter estimate proficiency of our method, as well as computational budget: sifting one month of single-detector data and 131 Hz-wide frequency range takes roughly 2.4 CPU hours. Hence, the current procedure can be readily applied in ally-sky schemes, sieving in parallel as many sky positions as permitted by the available computational power. Finally, we introduce (ongoing and future) approaches to attain sensitivity improvements and better accuracy on parameter estimates in view of the

  13. Evaluation of novel direct- and indirect-detection active matrix flat-panel imagers (AMFPIs) for mammography

    Science.gov (United States)

    El-Mohri, Youcef; Antonuk, Larry E.; Jee, Kyung-Wook; Kang, Yixiu; Li, Yixin; Sawant, Amit R.; Su, Zhong; Wang, Yi; Yamamoto, Jin; Zhao, Qihua

    2003-06-01

    A performance evaluation of small-area, high-spatial-resolution, active matrix flat-panel imager (AMFPI) prototypes, operated under mammographic conditions, is reported. These prototypes are based on two 512 x 512 pixel imagers employing novel designs to enhance signal performance for direct and indirect detection. The indirect detection prototype is based on a 75 μm pixel pitch array incorporating a continuous photodiode design, as opposed to the discrete photodiode design used in conventional flat-panel imagers. This array was coupled to a pair of commercially-available x-ray converters: (1) a 34 mg/cm2 Gd2O2S:Tb phosphor screen (Min-R, Kodak) and (2) a 150 μm thick structured CsI:Tl scintillator on a fiber-optic plate (FOS-HL, Hamamatsu). The direct detection prototype is based on a 100 μm pixel pitch array and uses a 240 μm thick, high gain mercuric iodide (HgI2) photoconductor. Measurements of sensitivity, MTF, NPS and DQE were performed with a 26 kVp mammography beam attenuated by a 4 cm BR-12 breast phantom at various radiation exposures. Results from empirical studies of sensitivity indicate that these imagers offer a substantial enhancement in signal over conventional flat-panel imagers. Measurements of DQE for the imagers show values greater than those obtained from high performance mammographic film-screen systems, under some conditions. These studies also show that the FOS-HL imager configuration despite its lower MTF, exhibits DQE performance (up to approximately 0.77) superior or equivalent to that of the Min-R configuration due to better optical properties of the converter. In addition, despite a smaller pixel pitch, both of these indirect detection configurations exhibit improved DQE in comparison to similar configurations employing a 97 μm pitch discrete photodiode design, especially at low exposures. Results of DQE measurements from the HgI2 photoconductor prototype are promising (DQE values up to approximately 0.6). Finally, calculations of

  14. Improvement of Upper Extremity Deficit after Constraint-Induced Movement Therapy Combined with and without Preconditioning Stimulation Using Dual-hemisphere Transcranial Direct Current Stimulation and Peripheral Neuromuscular Stimulation in Chronic Stroke Patients: A Pilot Randomized Controlled Trial

    Directory of Open Access Journals (Sweden)

    Takashi Takebayashi

    2017-10-01

    Full Text Available In this study, we investigated the effects of dual-hemisphere transcranial direct current stimulation (dual-tDCS of both the affected (anodal tDCS and non-affected (cathodal tDCS primary motor cortex, combined with peripheral neuromuscular electrical stimulation (PNMES, on the effectiveness of constraint-induced movement therapy (CIMT as a neurorehabilitation intervention in chronic stroke. We conducted a randomized controlled trial of feasibility, with a single blind assessor, with patients recruited from three outpatient clinics. Twenty chronic stroke patients were randomly allocated to the control group, receiving conventional CIMT, or the intervention group receiving dual-tDCS combined with PNMES before CIMT. Patients in the treatment group first underwent a 20-min period of dual-tDCS, followed immediately by PNMES, and subsequent CIMT for 2 h. Patients in the control group only received CIMT (with no pretreatment stimulation. All patients underwent two CIMT sessions, one in the morning and one in the afternoon, each lasting 2 h, for a total of 4 h of CIMT per day. Upper extremity function was assessed using the Fugl-Meyer Assessment (primary outcome, as well as the amount of use (AOU and quality of movement (QOM scores, obtained via the Motor Activity Log (secondary outcome. Nineteen patients completed the study, with one patient withdrawing after allocation. Compared to the control group, the treatment improvement in upper extremity function and AOU was significantly greater in the treatment than control group (change in upper extremity score, 9.20 ± 4.64 versus 4.56 ± 2.60, respectively, P < 0.01, η2 = 0.43; change in AOU score, 1.10 ± 0.65 versus 0.62 ± 0.85, respectively, P = 0.02, η2 = 0.52. There was no significant effect of the intervention on the QOM between the intervention and control groups (change in QOM score, 1.00 ± 0.62 versus 0.71 ± 0.72, respectively, P = 0.07, η2

  15. New constraints and discovery potential of sub-GeV dark matter with xenon detectors

    Science.gov (United States)

    McCabe, Christopher

    2017-08-01

    Existing xenon dark matter (DM) direct detection experiments can probe the DM-nucleon interaction of DM with a sub-GeV mass through a search for photon emission from the recoiling xenon atom. We show that LUX's constraints on sub-GeV DM, which utilize the scintillation (S1) and ionization (S2) signals, are approximately 3 orders of magnitude more stringent than previous xenon constraints in this mass range, derived from the XENON10 and XENON100 S2-only searches. The new LUX constraints provide the most stringent direct detection constraints for DM particles with a mass below 0.5 GeV. In addition, the photon emission signal in LUX and its successor LZ maintain the discrimination between background and signal events so that an unambiguous discovery of sub-GeV DM is possible. We show that LZ has the potential to reconstruct the DM mass with ≃20 % accuracy for particles lighter than 0.5 GeV.

  16. An analytical solution to obtain the optimum source location using multiple direction finders on a spherical surface. [for lightning detection

    Science.gov (United States)

    Orville, Richard E., Jr.

    1987-01-01

    An analytical solution is presented for determining the optimum location of a radiating source on the surface of a sphere, given multiple bearings. The bearings are assumed to have small errors of the order of 0-10 deg. The optimum location is found by minimizing the sum of the squares of the perpendicular great-circle distances from the source to the bearing lines. This is achieved analytically through an eigenvalue approach, rather than the usual iterative, numerical approach. Bearings of different weight are taken into account by approximating the distance from each direction finder to the source. The result is general and may have wide application. Since it is simple and nearly as fast as the triangulation technique for source location, it is now used in the SUNY-Albany East Coast Lightning Detection Network to compute the optimum location for lightning in real time.

  17. Suppression of laser phase noise in direct-detection optical OFDM transmission using phase-conjugated pilots

    Science.gov (United States)

    Zhang, Lu; Ming, Yi; Li, Jin

    2017-11-01

    Due to the unique phase noise (PN) characteristics in direct-detection optical OFDM (DDO-OFDM) systems, the design of PN compensator is considered as a difficult task. In this paper, a laser PN suppression scheme with low complexity for DDO-OFDM based on coherent superposition of data carrying subcarriers and their phase conjugates is proposed. Through theoretical derivation, the obvious PN suppression is observed. The effectiveness of this technique is demonstrated by simulation of a 4-QAM DDO-OFDM system over 1000 km transmission length at different laser line-width and subcarrier frequency spacing. The results show that the proposed scheme can significantly suppress both varied phase rotation term (PTR) and inter-carrier interference (ICI), and the laser line-width can be relaxed with up to 9 dB OSNR saving or even breakthrough of performance floor.

  18. Experimental demonstration of 30 Gb/s direct-detection optical OFDM transmission with blind symbol synchronisation using virtual subcarriers.

    Science.gov (United States)

    Bouziane, R; Milder, P A; Erkılınç, S; Galdino, L; Kilmurray, S; Thomsen, B C; Bayvel, P; Killey, R I

    2014-02-24

    The paper investigates the performance of a blind symbol synchronisation technique for optical OFDM systems based on virtual subcarriers. The test-bed includes a real-time 16-QAM OFDM transmitter operating at a net data rate of 30.65 Gb/s using a single OFDM band with a single FPGA-DAC subsystem and demonstrates transmission over 23.3 km SSMF with direct detection at a BER of 10(-3). By comparing the performance of the proposed synchronisation scheme with that of the Schmidl and Cox algorithm, it was found that the two approaches achieve similar performance for large numbers of averaging symbols, but the performance of the proposed scheme degrades as the number of averaging symbols is reduced. The proposed technique has lower complexity and bandwidth overhead as it does not rely on training sequences. Consequently, it is suitable for implementation in high speed optical OFDM transceivers.

  19. The Tropospheric Wind Lidar Technology Experiment (TWiLiTE): An Airborne Direct Detection Doppler Lidar Instrument Development Program

    Science.gov (United States)

    Gentry, Bruce; McGill, Matthew; Schwemmer, Geary; Hardesty, Michael; Brewer, Alan; Wilkerson, Thomas; Atlas, Robert; Sirota, Marcos; Lindemann, Scott

    2006-01-01

    Global measurement of tropospheric winds is a key measurement for understanding atmospheric dynamics and improving numerical weather prediction. Global wind profiles remain a high priority for the operational weather community and also for a variety of research applications including studies of the global hydrologic cycle and transport studies of aerosols and trace species. In addition to space based winds, a high altitude airborne system flown on UAV or other advanced platforms would be of great interest for studying mesoscale dynamics and hurricanes. The Tropospheric Wind Lidar Technology Experiment (TWiLiTE) project was selected in 2005 by the NASA Earth Sun Technology Office as part of the Instrument Incubator Program. TWiLiTE will leverage significant research and development investments in key technologies made in the past several years. The primary focus will be on integrating these sub-systems into a complete molecular direct detection Doppler wind lidar system designed for autonomous operation on a high altitude aircraft, such as the NASA WB57, so that the nadir viewing lidar will be able to profile winds through the full troposphere. TWiLiTE is a collaboration involving scientists and technologists from NASA Goddard, NOAA ESRL, Utah State University Space Dynamics Lab and industry partners Michigan Aerospace Corporation and Sigma Space Corporation. NASA Goddard and it's partners have been at the forefront in the development of key lidar technologies (lasers, telescopes, scanning systems, detectors and receivers) required to enable spaceborne global wind lidar measurement. The TWiLiTE integrated airborne Doppler lidar instrument will be the first demonstration of a airborne scanning direct detection Doppler lidar and will serve as a critical milestone on the path to a fixture spaceborne tropospheric wind system. The completed system will have the capability to profile winds in clear air from the aircraft altitude of 18 h to the surface with 250 m vertical

  20. Measuring mouse retina response near the detection threshold to direct stimulation of photons with sub-poisson statistics

    Science.gov (United States)

    Tavala, Amir; Dovzhik, Krishna; Schicker, Klaus; Koschak, Alexandra; Zeilinger, Anton

    Probing the visual system of human and animals at very low photon rate regime has recently attracted the quantum optics community. In an experiment on the isolated photoreceptor cells of Xenopus, the cell output signal was measured while stimulating it by pulses with sub-poisson distributed photons. The results showed single photon detection efficiency of 29 +/-4.7% [1]. Another behavioral experiment on human suggests a less detection capability at perception level with the chance of 0.516 +/-0.01 (i.e. slightly better than random guess) [2]. Although the species are different, both biological models and experimental observations with classical light stimuli expect that a fraction of single photon responses is filtered somewhere within the retina network and/or during the neural processes in the brain. In this ongoing experiment, we look for a quantitative answer to this question by measuring the output signals of the last neural layer of WT mouse retina using microelectrode arrays. We use a heralded downconversion single-photon source. We stimulate the retina directly since the eye lens (responsible for 20-50% of optical loss and scattering [2]) is being removed. Here, we demonstrate our first results that confirms the response to the sub-poisson distributied pulses. This project was supported by Austrian Academy of Sciences, SFB FoQuS F 4007-N23 funded by FWF and ERC QIT4QAD 227844 funded by EU Commission.

  1. A VUV detection system for the direct photonic identification of the first excited isomeric state of 229Th

    Science.gov (United States)

    Seiferle, Benedict; von der Wense, Lars; Laatiaoui, Mustapha; Thirolf, Peter G.

    2016-03-01

    With an expected energy of 7.6(5) eV, 229Th possesses the lowest excited nuclear state in the landscape of all presently known nuclei. The energy corresponds to a wavelength of about 160 nm and would conceptually allow for an optical laser excitation of a nuclear transition. We report on a VUV optical detection system that was designed for the direct detection of the isomeric ground-state transition of 229Th. 229(m)Th ions originating from a 233U α-recoil source are collected on a micro electrode that is placed in the focus of an annular parabolic mirror. The latter is used to parallelize the UV fluorescence that may emerge from the isomeric ground-state transition of 229Th. The parallelized light is then focused by a second annular parabolic mirror onto a CsI-coated position-sensitive MCP detector behind the mirror exit. To achieve a high signal-to-background ratio, a small spot size on the MCP detector needs to be achieved. Besides extensive ray-tracing simulations of the optical setup, we present a procedure for its alignment, as well as test measurements using a D2 lamp, where a focal-spot size of ≈100 μm has been achieved. Assuming a purely photonic decay, a signal-to-background ratio of ≈7000:1 could be achieved.

  2. Surface-Enhanced Raman Scattering Based on Controllable-Layer Graphene Shells Directly Synthesized on Cu Nanoparticles for Molecular Detection.

    Science.gov (United States)

    Qiu, Hengwei; Huo, Yanyan; Li, Zhen; Zhang, Chao; Chen, Peixi; Jiang, Shouzhen; Xu, Shicai; Ma, Yong; Wang, Shuyun; Li, Hongsheng

    2015-10-05

    Graphene shells with a controllable number of layers were directly synthesized on Cu nanoparticles (CuNPs) by chemical vapor deposition (CVD) to fabricate a graphene-encapsulated CuNPs (G/CuNPs) hybrid system for surface-enhanced Raman scattering (SERS). The enhanced Raman spectra of adenosine and rhodamine 6G (R6G) showed that the G/CuNPs hybrid system can strongly suppress background fluorescence and increase signal-to-noise ratio. In four different types of SERS systems, the G/CuNPs hybrid system exhibits more efficient SERS than a transferred graphene/CuNPs hybrid system and pure CuNPs and graphene substrates. The minimum detectable concentrations of adenosine and R6G by the G/CuNPs hybrid system can be as low as 10(-8) and 10(-10)  M, respectively. The excellent linear relationship between Raman intensity and analyte concentration can be used for molecular detection. The graphene shell can also effectively prevent surface oxidation of Cu nanoparticles after exposure to ambient air and thus endow the hybrid system with a long lifetime. This work provides a basis for the fabrication of novel SERS substrates. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Wavelet entropy and directed acyclic graph support vector machine for detection of patients with unilateral hearing loss in MRI scanning

    Directory of Open Access Journals (Sweden)

    Shuihua Wang

    2016-10-01

    Full Text Available (Aim Sensorineural hearing loss (SNHL is correlated to many neurodegenerative disease. Now more and more computer vision based methods are using to detect it in an automatic way. (Materials We have in total 49 subjects, scanned by 3.0T MRI (Siemens Medical Solutions, Erlangen, Germany. The subjects contain 14 patients with right-sided hearing loss (RHL, 15 patients with left-sided hearing loss (LHL, and 20 healthy controls (HC. (Method We treat this as a three-class classification problem: RHL, LHL, and HC. Wavelet entropy (WE was selected from the magnetic resonance images of each subjects, and then submitted to a directed acyclic graph support vector machine (DAG-SVM. (Results The 10 repetition results of 10-fold cross validation shows 3-level decomposition will yield an overall accuracy of 95.10% for this three-class classification problem, higher than feedforward neural network, decision tree, and naive Bayesian classifier. (Conclusions This computer-aided diagnosis system is promising. We hope this study can attract more computer vision method for detecting hearing loss.

  4. Direct determination of mercury in white vinegar by matrix assisted photochemical vapor generation atomic fluorescence spectrometry detection

    Energy Technology Data Exchange (ETDEWEB)

    Liu Qingyang, E-mail: liuqingyang0807@yahoo.com.c [Beijing Center for Physical and Chemical Analysis, Beijing 100089 (China)

    2010-07-15

    This paper proposes the use of photochemical vapor generation with acetic acid as sample introduction for the direct determination of ultra-trace mercury in white vinegars by atomic fluorescence spectrometry. Under ultraviolet irradiation, the sample matrix (acetic acid) can reduce mercury ion to atomic mercury Hg{sup 0}, which is swept by argon gas into an atomic fluorescence spectrometer for subsequent analytical measurements. The effects of several factors such as the concentration of acetic acid, irradiation time, the flow rate of the carrier gas and matrix effects were discussed and optimized to give detection limits of 0.08 ng mL{sup -1} for mercury. Using the experimental conditions established during the optimization (3% v/v acetic acid, 30 s irradiation time and 20 W mercury lamp), the precision levels, expressed as relative standard deviation, were 4.6% (one day) and 7.8% (inter-day) for mercury (n = 9). Addition/recovery tests for evaluation of the accuracy were in the range of 92-98% for mercury. The method was also validated by analysis of vinegar samples without detectable amount of Hg spiked with aqueous standard reference materials (GBW(E) 080392 and GBW(E) 080393). The results were also compared with those obtained by acid digestion procedure and determination of mercury by ICP-MS. There was no significant difference between the results obtained by the two methods based on a t-test (at 95% confidence level).

  5. An Overview of Transmission Line Protection by Artificial Neural Network: Fault Detection, Fault Classification, Fault Location, and Fault Direction Discrimination

    Directory of Open Access Journals (Sweden)

    Anamika Yadav

    2014-01-01

    Full Text Available Contemporary power systems are associated with serious issues of faults on high voltage transmission lines. Instant isolation of fault is necessary to maintain the system stability. Protective relay utilizes current and voltage signals to detect, classify, and locate the fault in transmission line. A trip signal will be sent by the relay to a circuit breaker with the purpose of disconnecting the faulted line from the rest of the system in case of a disturbance for maintaining the stability of the remaining healthy system. This paper focuses on the studies of fault detection, fault classification, fault location, fault phase selection, and fault direction discrimination by using artificial neural networks approach. Artificial neural networks are valuable for power system applications as they can be trained with offline data. Efforts have been made in this study to incorporate and review approximately all important techniques and philosophies of transmission line protection reported in the literature till June 2014. This comprehensive and exhaustive survey will reduce the difficulty of new researchers to evaluate different ANN based techniques with a set of references of all concerned contributions.

  6. Ionic liquid-capped graphene quantum dots as label-free fluorescent probe for direct detection of ferricyanide.

    Science.gov (United States)

    Sun, Xue; Qian, Yuting; Jiao, Yajie; Liu, Jiyang; Xi, Fengna; Dong, Xiaoping

    2017-04-01

    Despite complex molecular and atomic doping, efficient post-functionalization strategies for graphene quantum dots (GQDs) are of key importance to control the physicochemical properties and broaden the practical applications. With ionic liquid as specific modification agents, herein, the preparation of ionic liquid-capped GQDs (IL-GQDs) and its application as label-free fluorescent probe for direct detection of anion were reported. Hydroxyl-functionalized GQDs that could be easily gram-scale synthesized and possessed single-crystalline were chosen as the model GQDs. Also, the most commonly used ionic liquids, water-soluble 1-butyl-3-methyl imidazolium tetrafluoroborate (BMIMBF 4 ) was chosen as the model IL. Under the ultrasonic treatment, BMIMBF 4 easily composited with GQDs to form IL-GQDs. The synthesized IL-GQDs were characterized by atomic force microscopy (AFM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and fluorescence (FL) spectrum. After successful combination with IL, the excitation-independent photoluminescence behavior of GQDs presented almost no change, whereas, the anion responsiveness of IL-GQDs drastically improved, which afforded the IL-GQDs a sensitive response to Fe(CN) 6 3- . Based on the strong fluorescence quench, a facile and sensitive detection of Fe(CN) 6 3- was achieved. A wide linear range of 1.0×10 -7 to 2.5×10 -3 moll -1 with a low detection limit of 40 nmol l -1 was obtained. As the composition and properties of IL and GQDs could be easily tuned by varying the structure, ionic liquids-capped GQDs might present promising potential for their applications in sensing and catalysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Direct detection of two different tumor-derived extracellular vesicles by SAM-AuNIs LSPR biosensor.

    Science.gov (United States)

    Thakur, Abhimanyu; Qiu, Guangyu; Ng, Siu-Pang; Guan, Jintao; Yue, Jianbo; Lee, Youngjin; Wu, Chi-Man Lawrence

    2017-08-15

    Extracellular vesicles (EVs) are abundant in various biological fluids including blood, saliva, urine, as well as extracellular milieu. Accumulating evidence has indicated that EVs, which contain functional proteins and small RNAs, facilitate intercellular communication between neighbouring cells, and are critical to maintain various physiological processes. In contrast, EV-derived toxic signals can spread out over the tissues adjacent to the injured area in certain diseases, including brain tumors and neurodegenerative disorders. This demands better characterization of EVs which can be employed for liquid biopsy clinically as well as for the study of intercellular signalling. Exosomes and microvesicles share a number of similar characteristics, but it is important to distinguish between these two types of EVs. Here, we report for the first time that our in-house developed Localized Surface Plasmon Resonance biosensor with self-assembly gold nanoislands (SAM-AuNIs) can be used to detect and distinguish exosomes from MVs isolated from A-549 cells, SH-SY5Y cells, blood serum, and urine from a lung cancer mouse model. Exosomes, compared with MVs, produced a distinguishable response to the bare LSPR biosensor without functionalization, suggesting a different biophysical interaction between exosomes and MVs with SAM AuNIs. This sensor attains the limit of detection to 0.194µg/ml, and the linear dynamic range covers 0.194-100µg/ml. This discovery not only reveals great insight into the distinctive membrane property of tumor-derived exosomes and MVs, but also facilitate the development of novel LSPR biosensors for direct detection and isolation of heterogeneous EVs. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Contrasting accounts of direction and shape perception in short-range motion: Counterchange compared with motion energy detection.

    Science.gov (United States)

    Norman, Joseph; Hock, Howard; Schöner, Gregor

    2014-07-01

    It has long been thought (e.g., Cavanagh & Mather, 1989) that first-order motion-energy extraction via space-time comparator-type models (e.g., the elaborated Reichardt detector) is sufficient to account for human performance in the short-range motion paradigm (Braddick, 1974), including the perception of reverse-phi motion when the luminance polarity of the visual elements is inverted during successive frames. Human observers' ability to discriminate motion direction and use coherent motion information to segregate a region of a random cinematogram and determine its shape was tested; they performed better in the same-, as compared with the inverted-, polarity condition. Computational analyses of short-range motion perception based on the elaborated Reichardt motion energy detector (van Santen & Sperling, 1985) predict, incorrectly, that symmetrical results will be obtained for the same- and inverted-polarity conditions. In contrast, the counterchange detector (Hock, Schöner, & Gilroy, 2009) predicts an asymmetry quite similar to that of human observers in both motion direction and shape discrimination. The further advantage of counterchange, as compared with motion energy, detection for the perception of spatial shape- and depth-from-motion is discussed.

  9. Direct detection of a triplet vinylnitrene, 1,4-naphthoquinone-2-ylnitrene, in solution and cryogenic matrices.

    Science.gov (United States)

    Sarkar, Sujan K; Sawai, Asako; Kanahara, Kousei; Wentrup, Curt; Abe, Manabu; Gudmundsdottir, Anna D

    2015-04-01

    The photolysis of 2-azido-1,4-naphthoquinone (1) in argon matrices at 8 K results in the corresponding triplet vinylnitrene (3)2, which was detected directly by IR spectroscopy. Vinylnitrene (3)2 is stable in argon matrices but forms 2-cyanoindane-1,3-dione (3) upon further irradiation. Similarly, the irradiation of azide 1 in 2-methyltetrahydrofuran (MTHF) matrices at 5 K resulted in the ESR spectrum of vinylnitrene (3)2, which is stable up to at least 100 K. The zero-field splitting parameters for nitrene (3)2, D/hc = 0.7292 cm(-1) and E/hc = 0.0048 cm(-1), verify that it has significant 1,3-biradical character. Vinylnitrene (3)2 (λmax ∼ 460 nm, τ = 22 μs) is also observed directly in solution at ambient temperature with laser flash photolysis of 1. Density functional theory (DFT) calculations support the characterization of vinylnitrene (3)2 and the proposed mechanism for its formation. Because vinylnitrene (3)2 is relatively stable, it has potential use as a building-block for high-spin assemblies.

  10. Development of a 2-micron Pulsed Differential Absorption Lidar for Atmospheric CO2 Concentration Measurement by Direct Detection Technique

    Science.gov (United States)

    Yu, J.; Singh, U. N.; Petros, M.; Bai, Y.

    2011-12-01

    Researchers at NASA Langley Research Center are developing a 2-micron Pulsed Differential Absorption Lidar instrument for ground and airborne measurements via direct detection method. This instrument will provide an alternate approach to measure atmospheric CO2 concentrations with significant advantages. A high energy pulsed approach provides high-precision measurement capbility by having high signal-to-noise level and unambiguously eliminates the contamination from aerosols and clouds that can bias the IPDA measurement. A key component of the CO2 DIAL system, transceiver, is an existing, airborne ready, robust hardware which can provide 250mJ at 10Hz with double pulse format specifically designed for DIAL instrument. The exact wavelengths of the transceiver are controlled by well defined CW seed laser source to provide the required injection source for generating on-and-off line wavelength pulses sequentially. The compact, rugged, highly reliable transceiver is based on the unique Ho:Tm:YLF high-energy 2-micron pulsed laser technology. All the optical mounts are custom designed and have space heritage. They are designed to be adjustable and lockable and hardened to withstand vibrations that can occur in airborne operation. For the direct detection lidar application, a large primary mirror size is preferred. A 14 inch diameter telescope will be developed for this program. The CO2 DIAL/IPDA system requires many electronic functions to operate. These include diode, RF, seed laser, and PZT drivers; injection seeding detection and control; detector power supplies; and analog inputs to sample various sensors. Under NASA Laser Risk Reduction Program (LRRP), a control unit Compact Laser Electronics (CLE), is developed for the controlling the coherent wind lidar transceiver. Significant modifications and additions are needed to update it for CO2 lidar controls. The data acquisition system was built for ground CO2 measurement demonstration. The software will be updated for

  11. Constraints in Genetic Programming

    Science.gov (United States)

    Janikow, Cezary Z.

    1996-01-01

    Genetic programming refers to a class of genetic algorithms utilizing generic representation in the form of program trees. For a particular application, one needs to provide the set of functions, whose compositions determine the space of program structures being evolved, and the set of terminals, which determine the space of specific instances of those programs. The algorithm searches the space for the best program for a given problem, applying evolutionary mechanisms borrowed from nature. Genetic algorithms have shown great capabilities in approximately solving optimization problems which could not be approximated or solved with other methods. Genetic programming extends their capabilities to deal with a broader variety of problems. However, it also extends the size of the search space, which often becomes too large to be effectively searched even by evolutionary methods. Therefore, our objective is to utilize problem constraints, if such can be identified, to restrict this space. In this publication, we propose a generic constraint specification language, powerful enough for a broad class of problem constraints. This language has two elements -- one reduces only the number of program instances, the other reduces both the space of program structures as well as their instances. With this language, we define the minimal set of complete constraints, and a set of operators guaranteeing offspring validity from valid parents. We also show that these operators are not less efficient than the standard genetic programming operators if one preprocesses the constraints - the necessary mechanisms are identified.

  12. Psychological constraints on egalitarianism

    DEFF Research Database (Denmark)

    Kasperbauer, Tyler Joshua

    2015-01-01

    Debates over egalitarianism for the most part are not concerned with constraints on achieving an egalitarian society, beyond discussions of the deficiencies of egalitarian theory itself. This paper looks beyond objections to egalitarianism as such and investigates the relevant psychological...... philosophy, which aim to construct moral goals with current social and political constraints in mind, to argue that human psychology must be part of a non-ideal theory of egalitarianism. The descriptive thesis holds that the most fundamental psychological challenge to egalitarian ideals comes from what...... processes motivating people to resist various aspects of egalitarianism. I argue for two theses, one normative and one descriptive. The normative thesis holds that egalitarians must take psychological constraints into account when constructing egalitarian ideals. I draw from non-ideal theories in political...

  13. Random Constraint Satisfaction Problems

    Directory of Open Access Journals (Sweden)

    Amin Coja-Oghlan

    2009-11-01

    Full Text Available Random instances of constraint satisfaction problems such as k-SAT provide challenging benchmarks. If there are m constraints over n variables there is typically a large range of densities r=m/n where solutions are known to exist with probability close to one due to non-constructive arguments. However, no algorithms are known to find solutions efficiently with a non-vanishing probability at even much lower densities. This fact appears to be related to a phase transition in the set of all solutions. The goal of this extended abstract is to provide a perspective on this phenomenon, and on the computational challenge that it poses.

  14. Constraint-based scheduling applying constraint programming to scheduling problems

    CERN Document Server

    Baptiste, Philippe; Nuijten, Wim

    2001-01-01

    Constraint Programming is a problem-solving paradigm that establishes a clear distinction between two pivotal aspects of a problem: (1) a precise definition of the constraints that define the problem to be solved and (2) the algorithms and heuristics enabling the selection of decisions to solve the problem. It is because of these capabilities that Constraint Programming is increasingly being employed as a problem-solving tool to solve scheduling problems. Hence the development of Constraint-Based Scheduling as a field of study. The aim of this book is to provide an overview of the most widely used Constraint-Based Scheduling techniques. Following the principles of Constraint Programming, the book consists of three distinct parts: The first chapter introduces the basic principles of Constraint Programming and provides a model of the constraints that are the most often encountered in scheduling problems. Chapters 2, 3, 4, and 5 are focused on the propagation of resource constraints, which usually are responsibl...

  15. The physical phenomena associated with stator winding insulation condition as detected by the ramped direct high-voltage method

    Science.gov (United States)

    Rux, Lorelynn Mary

    Deregulation of the electric utility industry has increased the need to monitor the state of powerplant equipment, such as critical generators and motors, to improve availability and reduce life cycle costs via condition-based maintenance. To achieve these goals, nondestructive condition assessment and diagnostic tests are necessary to evaluate the quality and condition of a machine's stator winding insulation system. Periodic tests are generally conducted to monitor insulation aging, diagnose problems, or provide some assurance that the winding has a minimum level of electrical strength. The basic principles of insulation testing are presented herein, and the physical mechanisms that affect the current versus voltage response are described. A stator winding insulation model was developed based on this theoretical foundation for use in understanding and analyzing the macroscopic behavior of complex insulation phenomena. A comprehensive, controlled laboratory experiment was conducted on a set of stator coils that were deliberately manufactured with and without insulation defects. Specific defects were chosen to represent the types of insulation problems typically encountered during manufacture or as a result of in-service aging, and included lack of resin cure, loosely-applied insulating tapes, internal conductive contamination, reduced density of the groundwall insulation, and thermal cycling damage. Results are presented from a series of electrical tests conducted on the coil specimens to compare the effectiveness of various test methods in detecting the different insulation problems. The tests included insulation resistance, polarization index, ramped direct voltage, dissipation factor, dielectric spectroscopy, partial discharge, and recovery voltage measurements. Dielectric principles and testing experience obtained during this investigation were applied to a collection of test results obtained by the author from in-service machines during the past ten years

  16. Modeling Network Transition Constraints with Hypergraphs

    DEFF Research Database (Denmark)

    Harrod, Steven

    2011-01-01

    values. A directed hypergraph formulation is derived to address railway network sequencing constraints, and an experimental problem sample solved to estimate the magnitude of objective inflation when interaction effects are ignored. The model is used to demonstrate the value of advance scheduling...

  17. Microwave plasma torch mass spectrometry for the direct detection of copper and molybdenum ions in aqueous liquids.

    Science.gov (United States)

    Xiong, Xiaohong; Jiang, Tao; Zhou, Runzhi; Wang, Shangxian; Zou, Wei; Zhu, Zhiqiang

    2016-05-01

    Microwave plasma torch (MPT) is a simple and low power-consumption ambient ion source. And the MPT Mass spectra of many metal elements usually exhibit some novel features different from their inductively coupled plasma (ICP) mass spectra, which may be helpful for metal element analysis. Here, we presented the results about the MPT mass spectra of copper and molybdenum elements by a linear ion trap mass spectrometer (LTQ). The generated copper or molybdenum contained ions in plasma were characterized further in collision-induced dissociated (CID) experiments. These researches built a novel, direct and sensitive method for the direct analysis of trace levels of copper and molybdenum in aqueous liquids. Quantitative results showed that the limit of detection (LOD) by using MS(2) procedure was estimated to be 0.265 µg/l (ppb) for copper and 0.497 µg/l for molybdenum. The linear d