Reporte del primer caso humano de infección parasitaria por Mammomonogamus laryngeus en Colombia

Directory of Open Access Journals (Sweden)

Jhon Carlos Castaño

2006-09-01

Full Text Available Los parásitos del género Mammomonogamus afectan el tracto respiratorio de mamíferos domésticos. La especie M. laryngeus es un nemátodo donde la hembra y el macho están unidos en permanente cópula produciendo una forma distintiva de letra "Y" mayúscula. En el mundo han sido reportados hasta el momento poco más de 100 casos de infección en humanos. Este reporte describe el primer paciente infectado en Colombia (Armenia, Quindío, quien presentó como sintomatología tos crónica productiva de dos meses de duración, con inmediata y total recuperación clínica luego de la expulsión del parásito en el esputo durante un fuerte acceso de tos. Este reporte incluye la descripción morfológica del gusano adulto, así como un breve resumen de la epidemiología y manifestaciones clínicas en humanos. También se presentan las fotografías tomadas al parásito, donde se observan algunos de los detalles morfológicos principales, que sirvieron para su identificación.

Un Caso de Brucelosis en Bogotá

Directory of Open Access Journals (Sweden)

Raúl Paredes Manrique

1948-11-01

Full Text Available Después de más de un año de observación presentamos un caso de Fiebre Ondulante aparentemente infectado en Bogotá. Aunque no se trata del primer caso hallado en esta ciudad, tiene el interés de la escasa frecuencia de aparición de la enfermedad entre nosotros, de la comprobación del diagnòstico por métodos distintos de la aglutinación y per el tratamiento llevado a cabo.

Trasplante simultáneo de páncreas y riñón: reporte del primer caso realizado en el Perú

Directory of Open Access Journals (Sweden)

José De Vinatea

2010-04-01

Full Text Available El trasplante simultáneo de páncreas y riñón es la opción terapéutica ideal para pacientes con diabetes mellitus tipo 1 con insuficiencia renal crónica. Permite recuperar la insulino-independencia y evita la necesidad de diálisis, mejorando notablemente la calidad de vida. Así mismo, la restitución de la euglicemia logra que las complicaciones tardías de la diabetes no progresen e incluso regresionen, prolongando la supervivencia global de estos pacientes. Estos beneficios superan a los riesgos de la cirugía y de la inmunosupresión inherentes al trasplante. A nivel mundial, desde 1966, en que se llevó a cabo el primer trasplante de páncreas en Minnesota (Estados Unidos, se han registrado más de 20 000 trasplantes de páncreas, con resultados cada vez mejores gracias al refinamiento en las técnicas quirúrgicas y a los nuevos esquemas de inmunosupresión. En el presente caso clínico, se reporta y describe la realización del primer trasplante simultáneo de páncreas y riñón en el Perú.

Desenvolvimento do trato digestivo de bezerros leiteiros criados em sistema de aleitamento fracionado

Directory of Open Access Journals (Sweden)

Rafael A. Azevedo

2013-07-01

Full Text Available Para avaliar o efeito do sistema de aleitamento fracionado no desenvolvimento ruminal de bezerros leiteiros holandeses, foram utilizados 12 animais, com peso corporal inicial médio de 37,0 kg, alojados individualmente em baias. O tratamento convencional constituiu-se de quatro litros de leite diários durante 60 dias e o fracionado, de seis litros do 6º ao 25º dia; quatro litros dos dias 26 a 45 e dois litros de 46 a 59 dias de vida, além de concentrado, feno de Cynodon sp., água e suplemento mineral, oferecidos livremente. O consumo dos alimentos foi monitorado diariamente e os animais, pesados semanalmente, após o fornecimento da dieta líquida, pela manhã. Aos 60 dias de vida, os animais foram abatidos e realizaram-se pesagens do trato digestivo e medidas histológicas das papilas ruminais. O sistema de aleitamento não interferiu significativamente no consumo de concentrado, de feno, de matéria seca total e no peso corporal final vazio. O aleitamento fracionado resultou em maior peso corporal final, pesos absolutos do trato digestivo, do ruminorretículo, do omaso e dos intestinos, de pesos relativos do omaso e dos intestinos e maior índice mitótico das papilas ruminais. O sistema de aleitamento fracionado pode ser alternativa para melhorar o desenvolvimento ruminal e o desempenho de bezerros.

Efeitos do centeio na utilização digestiva dos nutrientes e no trânsito digestivo do frango

OpenAIRE

Mourão, J.L.; Silva, A.B

2001-01-01

Estudo com o fim de conhecer os efeitos de níveis elevados de centeio na dieta do frango de carne e da sua suplementação com um complexo enzimático com atividade xilanase na digestibilidade e transito digestivo

Adenocarcinoma y carcinoma tipo linfoepitelioma sincrónico en estómago: presentación de un caso y revisión de la literatura

Directory of Open Access Journals (Sweden)

D. Aranguibel

2012-04-01

Full Text Available El cáncer gástrico es una de las principales causas de muerte en el mundo. En Venezuela, las neoplasias gástricas representan 37% de todos los tumores malignos del sistema digestivo, pero el carcinoma tipo linfoepitelioma, sólo se presenta entre 1,6% y 3,1% de los casos. También es rara la presentación de lesiones tumorales sincrónicas. Al respecto se expone el caso clínico, el primero en este país, de un varón con 2 lesiones tumorales sincrónicas. Las lesiones lucían como incipientes, no obstante, el estudio histológico mostró 2 neoplasias malignas de estirpe epitelial: adenocarcinoma bien diferenciado y carcinoma tipo linfoepitelioma.

Enfermedad de Pompe de inicio temprano. A propósito de un caso

OpenAIRE

Grandez-Urbina, J. Antonio; Bustamante-Ubillus, Claudio; Farro-Calderon, Rossy; Linares-Alarcon, Ismael; Goyzueta-Knox, Silvana

2013-01-01

La enfermedad de Pompe es una enfermedad inusual de presentación temprana, causada por el déficit de la síntesis de α 1-4 glucosidasa ácida. Presentamos un caso de inicio insidioso descompensado evidenciándose dificultad respiratoria y cardiomiopatía. La enfermedad de Pompe es muy infrecuente, siendo el primer caso reportado en nuestro medio.

Enfermedad de Pompe de inicio temprano: A propósito de un caso

Directory of Open Access Journals (Sweden)

J. Antonio Grandez-Urbina

2013-10-01

Full Text Available La enfermedad de Pompe es una enfermedad inusual de presentación temprana, causada por el déficit de la síntesis de α 1-4 glucosidasa ácida. Presentamos un caso de inicio insidioso descompensado evidenciándose dificultad respiratoria y cardiomiopatía. La enfermedad de Pompe es muy infrecuente, siendo el primer caso reportado en nuestro medio.

El primer caso de leontiasis ósea en Colombia

Directory of Open Access Journals (Sweden)

Alfonso Bonilla Naar

1949-04-01

Full Text Available Presentamos hoy un caso exótico de la patología humana, una enfermedad aún no definida en su etiopatogenia, la leontiasis ósea. Fue descrita por l\\Ialpighi en 1697, y recibió tal denominación de Virchow desde 1864. Si juzgamos por la revisión de Pugh (1 en los últimos diez años de la Clínica Mayo, en que sólo se han hallado 10 casos de una entidad parecida llamada "Displasia fibrosa de' los huesos", localizada en el cráneo solamente, y que este autor considera como una fase anterior de la Leontiasis, tenemos que concluir que se trata de una entidad muy rara. Además, en lo consultado, incluyendo obras enciclopédicas, es tan escasa la información (sólo en Cecil hay una hoja escrita con criterio definido por Bauer (2 que nos reafirma la importancia de esta comunicación. Deseosos de conocer las publicaciones hechas en los últimos veinte años (1927-1947 revisamos el Index Medicus de Norteamérica a partir del estudio de Marx (3 sobre la anatomía patológica de la leontiasis, trabajo citado por Bauer (2 y que consideramos de importancia para definir la enfermedad, ya que anterior a esta época es improbable que existiera un criterio claro sobre la leontiasis, confundiéndola con muchas otras entidades similares, como veremos luego.

MethPrimer: designing primers for methylation PCRs.

Science.gov (United States)

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Esguince de tobillo de primer grado como causa de paresia del nervio peroneo común. Caso clínico

Directory of Open Access Journals (Sweden)

Í. Úbeda-Pérez de Heredia

2015-06-01

Full Text Available Los esguinces de tobillo, con mecanismo de inversión, son incidencias comunes en la población y constituyen las lesiones más frecuentes en el deporte. Eventualmente pueden ocasionar una neuropatía del nervio peroneo común, debido a un mecanismo de tracción indirecta, a través del nervio peroneo superficial. Se presenta el caso clínico de un varón de 37 años que, tras sufrir un esguince de tobillo de primer grado durante la práctica deportiva, presentó una paresia intensa del nervio peroneo común que se constató mediante estudio ecográfico y electroneuromiográfico. El cuadro se resolvió con tratamiento conservador y electroestimulación. Pese a su rareza, ha de conocerse la asociación entre el esguince de tobillo y la lesión del nervio peroneo común y debe evaluarse la función de dicho nervio en todos los pacientes con esguince de tobillo en sus diferentes grados, tanto en su exploración inicial como en el seguimiento posterior.

Picnodistosis: El caso de Toulouse-Lautrec

Directory of Open Access Journals (Sweden)

Gabriel Alcalá-Cerra

2006-01-01

Full Text Available El pintor francés Henri de Toulouse-Lautrec fue el primer caso de picnodisostosis reconocido a nivel mundial. En este texto se analizan las distintas manifestaciones de la picnodisostosis y se hace énfasis en las que el artista presentó y se detallan desde el punto de vista que brindan los conocimientos surgidos a través del tiempo sobre la fisiopatología de esta enfermedad.

Freqüência de sintomas digestivos em pacientes brasileiros com Diabetes Mellitus Digestive symptoms in Brazilian patients with Diabetes Mellitus

Directory of Open Access Journals (Sweden)

L.E. DE A. TRONCON

2001-06-01

Full Text Available Sintomas sugestivos do comprometimento do tubo digestivo são comuns em pacientes diabéticos, mas estudos comparando as freqüências destes sintomas com as da população geral são escassos e não existem trabalhos dessa natureza com diabéticos brasileiros. OBJETIVO: Determinar as freqüências de diferentes sintomas digestivos em amostra não selecionada de pacientes diabéticos, em comparação às encontradas em pessoas da comunidade. MÉTODOS: A ocorrência de 13 diferentes sintomas digestivos foi investigada por meio da aplicação de um questionário padronizado, especificamente estruturado, em 153 diabéticos dos tipos 1 e 2 e em 50 pessoas aparentemente sadias, tomadas como controles. RESULTADOS: A freqüência de diabéticos com pelo menos um sintoma digestivo foi significativamente superior à verificada no grupo controle (70% vs 36%, p = 0,01. Freqüências elevadas de plenitude gástrica (30% vs 36%, pirose (30% vs 34% e de constipação (17% vs 12%, foram observadas tanto entre os diabéticos como nos controles. No entanto, somente a freqüência de um único sintoma, a disfagia, foi significativamente maior entre os diabéticos, em relação ao grupo controle (13% vs 2%, p = 0,02. CONCLUSÃO: Estes resultados indicam que a freqüência de sintomas digestivos em diabéticos, apesar de elevada, não difere da verificada na população geral, exceto para a disfagia. As freqüências dos diferentes sintomas estiveram próximas das faixas relatadas em estudos do hemisfério Norte, o que não apóia a hipótese de que fatores inerentes ao meio afetam a ocorrência de queixas digestivas em diabéticos.PURPOSE: To determine the frequencies of digestive symptoms in an unselected sample of Brazilian diabetics, in comparison to those verified in the general population. METHODS: The frequencies of 13 digestive symptoms were determined in 153 type 1 and type 2 diabetics and in 50 apparently healthy controls, utilizing a structured

Infecção do trato urinário de repetição por fístula enterovesical secundária a doença diverticular do cólon: um relato de caso

Directory of Open Access Journals (Sweden)

Natália Silva Cavalcanti

2013-12-01

Full Text Available INTRODUÇÃO: As fístulas enterovesicais (FEV são comunicações patológicas entre a bexiga e as alças intestinais pélvicas. Trata-se de uma rara complicação decorrente de doenças inflamatórias e neoplásicas da pelve, além de casos resultantes de iatrogenia, e associa-se a altos índices de morbimortalidade. RELATO DO CASO: Trata-se de um paciente de 61 anos com um quadro de dor e distensão abdominal, vômitos, parada de eliminação de fezes e flatos. APP: Hipertenso, diabético, com antecedentes de disfunção vesical e infecções do trato urinário de repetição (ITUr nos últimos três anos. Por meio da realização de ressonância magnética de abdômen e pelve, diagnosticou-se FEV associada à doença diverticular (DDC do sigmoide. A conduta estabelecida consistiu em colectomia parcial com rebaixamento de colo e cistectomia parcial com colocação cirúrgica de cateter duplo jota à esquerda. DISCUSSÃO: Embora consista de afecção primária do trato digestivo, normalmente o paciente com DDC associada a FEV procura atendimento médico em decorrência de queixas do trato urinário. Nesse caso, a demora no diagnóstico fez com que a queixa principal fosse do trato digestivo e com antecedentes de queixas urinárias. CONCLUSÃO: Apesar de pouco frequente, a ocorrência de ITUr associada à DDC deve ser sempre considerada no diagnóstico diferencial das ITUr pela alta morbimortalidade.

Primer reporte de Phoneutrismo en el Perú: Presentación de dos casos

Directory of Open Access Journals (Sweden)

Ciro Maguiña Vargas

2008-07-01

Full Text Available Se presentan dos casos de mordedura de la araña Phoneutria spp. atendidos en el Hospital Nacional Cayetano Heredia (HNCH en los años 2005 y 2008. En ambos casos la mordedura fue de sintomatología leve y de buena evolución, y se debió a un accidente laboral en personas que trabajan en mercados de venta de fruta al extraer plátanos de cajas procedentes de Tingo María (Selva central. El phoneutrismo es un accidente por arácnidos poco común; sin embargo, sería un problema importante de salud pública sobretodo en las zonas rurales en donde el comercio de plátanos es una de las principales fuente de ingresos de la población. El personal médico no conoce del todo a esta araña, así como la clínica de sus mordeduras, por ello presentamos estos casos que permitirán reconocer estos accidentes para su adecuado manejo y control. (Rev. Med Hered. 2008;19:128-133

Dos casos de quiste de intestino anterior en cavidad oral

Directory of Open Access Journals (Sweden)

Celso Chuquisana-Mostacero

Full Text Available Antecedentes y Objetivo: El quiste de intestino anterior es una entidad congénita poco frecuente. Cuando aparece, su localización más frecuente es el íleon y, aunque pueden aparecer a lo largo de todo el tracto digestivo, es rara su ubicación en la cavidad oral. A menudo se caracteriza por tres hallazgos principales: presencia de una capa de músculo liso bien desarrollada, una capa epitelial típica de alguna porción del tracto alimentario, y la unión íntima a alguna porción del tracto gastrointestinal. Las lesiones quísticas del suelo de boca en la edad infantil más frecuentes son los quistes salivares y las malformaciones linfáticas, ambas englobables en el término ránula. Sin embargo hay otras posibilidades, y la duplicación de intestino anterior, como aparece en los casos que presentamos, es una de ellas. Material y Método: Presentamos 2 pacientes en edad pediátrica con lesión lingual o de suelo de boca, que tras el estudio de imagen adecuado fueron operados por vía intraoral para la extirpación de la tumoración. En uno de los casos se usó abordaje cervical para extirpación de un segundo locus quístico. Resultados: El estudio anatomopatológico mostró en uno de los casos epitelio respiratorio, y en el segundo mucosa gástrica y epitelio respiratorio. Conclusiones: La importancia del diagnóstico y la extirpación completa en este tipo de lesiones viene dada por el riesgo de degeneración maligna en la edad adulta.

Análisis económico del activismo judicial: el caso de la Corte Constitucional colombiana

Directory of Open Access Journals (Sweden)

Jairo Andrés Castaño Peña

2014-01-01

Full Text Available Este escrito presenta una aproximación al fenómeno del activismo judicial desde la perspectiva del Análisis Económico del Derecho (AED. Como cometido, pretende mostrar que existen una serie de incentivos y de circunstancias que hacen que las decisiones de la Corte Constitucional colombiana se puedan calificar como activistas. Para tal fin, en primer lugar, se establecen unos derroteros básicos para la comprensión de la actividad judicial, específicamente de las funciones de control de constitucionalidad y de revisión de acción de tutela de la Corte Constitucional de Colombia; en segundo lugar, se realiza un acercamiento al concepto de activismo judicial, para, a continuación, presentar la formulación de políticas públicas y la creación de leyes como productos dentro de un modelo de mercado, esto con el fin de explicar y mostrar, desde el Análisis Económico del Derecho, las razones que explican la existencia del fenómeno del activismo judicial en el caso colombiano. En último lugar, se presentan dos casos de activismo judicial por parte de la Corte Constitucional colombiana: en primer término, el caso de la protección del derecho a la vivienda digna, o caso del UPAC, y en segundo término, el caso de la protección de los derechos de los recicladores de oficio; casos, uno y otro, donde se puede ver que existen incentivos que provocan decisiones activistas.

Dominant culturable bacterial microbiota in the digestive tract of the American black vulture (Coragyps atratus Bechstein 1793 and search for antagonistic substances Microbiota bacteriana dominante cultivável no trato digestivo do urubu (Coragyps atratus Bechstein 1793

Directory of Open Access Journals (Sweden)

Lydston Rodrigues de Carvalho

2003-07-01

cultura e incubadas em aerobiose e anaerobiose a 37ºC para enumeração, isolamento e identificação. As bactérias isoladas foram usadas posteriormente como produtoras e reveladoras para detectar possíveis fenômenos de antagonismo. A população bacteriana total ao longo do trato digestivo variou de 3,46 ± 0,39 log UFC/g no estômago até 10,75 ± 0,37 log UFC/g no intestino distal. Algumas bactérias foram isoladas pela primeira vez do trato digestivo de C. atratus: Actinomyces bovis, Lactobacillus cellobiosus, Micrococcus luteus, Neisseria sicca, Clostridium bifermentans, Enterobacter agglomerans, Peptostreptococcus sp., Sarcina sp., Serratia odorifera, and Shigella flexneri. Associações entre microorganismos foram observadas durante o isolamento em dois casos, um envolvendo A. bovis e N. sicca, e o outro envolvendo A. bovis e um bastonete Gram-negativo. Hetero-, iso- e autoantagonismos foram observados, sugerindo um papel ecológico para esses microorganismos em termos de autocontrole populacional e de barreira ambiental no trato digestivo dessas aves.

Relación de la función masticatoria con los trastornos digestivos Relation of the masticatory function to the digestive disorders

Directory of Open Access Journals (Sweden)

Martha Concepción Ibáñez Castillo

2007-12-01

Full Text Available Se realizó una investigación en la que se relaciona la función masticatoria con los trastornos digestivos en pacientes que acudieron al chequeo médico en el Hospital Militar Docente "Dr. Joaquín Castillo Duany", en Santiago de Cuba, de enero de 2004 al 2005, mediante un estudio descriptivo y transversal con 199 pacientes de uno y otro sexo y diversos grupos de edades. Se confeccionó un formulario, se agruparon las tablas y se realizó el análisis estadístico. Se observó un predominio de trastornos digestivos en el grupo de 60 años y más, con presencia de desdentamiento y función masticatoria deficiente, por lo que se concluyó que existe una significativa relación entre la función masticatoria y los trastornos digestivos. Se recomienda extender el estudio a todas las áreas de salud, con el fin de utilizar nuestros conocimientos en beneficio de los pacientes.An investigation was carried out to connect the masticatory function with the digestive disorders in patients that had the medical check-up at "Dr. Joaquín Castillo Duany" Military Teaching Hospital, in Santiago de Cuba, from January 2004 to January 2005, by a descriptive cross-sectional study of 199 patients of both sexes and different ages. A questionnaire was designed, tables were grouped and a statistical analysis was made. It was observed a predominance of digestive disorders in the age group 60 and over, with lack of teeth and deficient masticatory function. It was concluded that there was a significant relation between the masticatory function and the digestive disorders. It was recommended to extend the study to all the health areas so as to use our knowledge for the benefit of the patients.

Linfoma T Intestinal Monomórfico CD56+. Primer Caso Informado en Colombia y Revisión de la Literatura

Directory of Open Access Journals (Sweden)

Orlando Ricaurte G

2015-01-01

Full Text Available Mujer de 80 años con hallazgo incidental de masa abdominal en mesogastrio, a quien le realizan resección de intestino delgado por sospecha de absceso con síndrome adherencial. El estudio patológico de la pieza quirúrgica demostró compromiso por  linfoma no Hodgkin T monomórfico CD56+. Los linfomas T del tubo digestivo son inusuales, correspondiendo a 5% de las neoplasias linfoides de esta localización. El linfoma intestinal T monomórfico CD56+, corresponde a 10 - 20% de los linfomas T intestinales, se presenta en regiones donde la enfermedad celiaca es infrecuente y no se asocia a enteropatía. Su curso es agresivo y habitualmente se manifiesta como una emergencia quirúrgica por obstrucción o perforación intestinal.

Notas clínicas: un caso de espiroquetosis bronquial que cede al “Neostibosan "

Directory of Open Access Journals (Sweden)

Alfonso Peláez Mejía

1932-09-01

Full Text Available No son extraños a nuestra Patología Tropical los casos de espiroquetosis bronquial (bronquitis sangrienta, y ya desde 1926 el doctor Rafael Martín Rodríguez inauguró su tesis de doctorado Con algunas observaciones sobre la enfermedad. Es difícil, evidentemente, ennuestro medio, diagnosticarla dada su asociación, muy frecuente, con la tuberculosis y su rareza. Cuando llegamos al Servicio de Clínica interna del profesor Miguel Canales, en calidad de internos, en marzo del año en curso, encontramos en la cama número 2 una enferma entrada en el hospital desde octubre de 1931. Nos llamó la atención la singularidad de su sintomatología que hacía difícil orientar el diagnóstico a determinada afección, máxime cuando sus mayores dolencias estaban del lado del aparato digestivo.

Enfermedad de creutzfeldt-jakob en el Perú: reporte de once casos

Directory of Open Access Journals (Sweden)

Luis Torres-Ramírez

Full Text Available La enfermedad de Creutzfeldt-Jakob (ECJ es una enfermedad neurológica fatal producida por la isoforma patológica de la proteína priónica humana. Se reporta las características clínicas de seis casos de la forma esporádica de ECJ con diagnóstico definitivo por histopatología, y cinco casos con diagnóstico probable, en pacientes atendidos en el Instituto Nacional de Ciencias Neurológicas del Perú. La edad de inicio en los casos definitivos fue de 55,8 años y, en los probables, de 59,6 años, con predominio del sexo masculino. El tiempo de enfermedad fue de 8,8 meses. Se encontró un EEG típico en 50% de los casos definitivos y 80% de los probables. La proteína 14-3-3 en líquido cefalorraquídeo fue positiva en un caso probable y los hallazgos típicos en resonancia magnética se observaron en dos casos probables. Todos los casos cursaron con una evolución clínica típica de la enfermedad, y se considera el primer reporte de ECJ en el Perú

Hipertiroidismo congénito, Reporte de dos casos

Directory of Open Access Journals (Sweden)

Víctor Clemente Mendoza Rojas

2014-04-01

Full Text Available Introducción: El hipertiroidismo es una patología tiroidea poco frecuente en neonatos, relacionada con el antecedente materno de enfermedad de Graves, y por lo tanto con el paso transplacentario de inmunoglobulinas estimulantes del receptor de TSH. Presentación de casos: Reportamos dos casos de sexo femenino, que se presentaron en el Hospital Universitario de Santander. El primero de los casos se manifestó en la primera semana; el segundo caso se presentó tardíamente después del primer mes de vida. Los síntomas que presentaron en común fueron taquicardia persistente e hiperactividad. En uno de los casos la presentación clínica fue confundida con una infección bacteriana, debido a la presencia de fiebre. Se confirma el diagnóstico con los niveles de TSH muy suprimidos y T4 libre elevada, al menos al doble del límite superior. Los dos casos observaron medicamentos antitiroideos y propanolol con buena evolución clínica y de laboratorios; no se observamos complicaciones a corto o largo plazo como arritmias o craneosinostosis. Discusión: El hipertiroidismo congénito es una patología poco frecuente y siempre debe ser sospechado en recién nacidos de madres con antecedente de enfermedad de Graves, sus manifestaciones pueden presentarse prenatalmente o postnatalmente, y su diagnóstico y tratamiento deben ser oportunos para evitar secuelas a largo plazo o incluso la muerte

Caracterización de pacientes con sangramiento digestivo alto Characterization of patients presenting with high digestive bleeding

Directory of Open Access Journals (Sweden)

Jean Le'Clerc Nicolás

2010-06-01

Full Text Available INTRODUCCIÓN. El sangramiento digestivo alto continúa siendo un problema de salud, y junto al abdomen agudo, las heridas y los traumatismos es prácticamente la razón de ser de una guardia de cirugía. MÉTODOS. Se realizó un estudio observacional, descriptivo y de corte transversal, cuyo universo estuvo constituido por todos los pacientes con este diagnóstico ingresados en el Hospital Docente Clinicoquirúrgico «Joaquín Albarrán», entre enero del 2006 y diciembre del 2007 (2 años. RESULTADOS. Las edades más frecuentes estuvieron entre los 70 y 79 años, y fue más frecuente el sexo masculino y el antecedente de enfermedad cardiovascular. La melena fue la principal manifestación clínica. La endoscopia solo se realizó en el 25,16 % de los casos, y en ella se observó principalmente duodenitis y gastritis. Como medidas terapéuticas más comunes se practicaron la hidratación y el uso sondas de Levine. Solo el 20,48 % de los pacientes recibieron tratamiento contra Helicobacter pylori. La estadía hospitalaria promedio fue de 6 días o más. CONCLUSIONES. Las medidas generales de apoyo hemodinámico y la estrecha vigilancia de los pacientes pueden lograr salvaguardar sus vidas aunque no se disponga de un diagnóstico certero. La infección por Helicobacter pylori y su asociación a lesiones erosivas o ulcerosas de la mucosa gastroduodenal no ha sido totalmente asimilada en el pensamiento médico de los cirujanos. La función de la cirugía es cada vez menor en la terapéutica del sangramiento digestivo alto, a pesar de ser uno de los pilares fundamentales para enfrentarlo.INTRODUCTION. High digestive bleeding remains as health problem and together with acute abdomen, wounds and traumatisms is practically the main responsibility of a surgery rounds. METHODS. A cross-sectional, descriptive and observational study was conducted in a sample including all patients with this diagnosis admitted in "Joaquín Albarrán" Clinical Surgical

Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

Directory of Open Access Journals (Sweden)

Harold Castañeda-Peña

2010-01-01

Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

Endoscopic ultrasound-assisted endoscopic resection of carcinoid tumors of the gastrointestinal tract Resección endoscópica asistida por ecoendoscopia de tumores carcinoides del aparato digestivo

Directory of Open Access Journals (Sweden)

D. Martínez-Ares

2004-12-01

in 2 cases (8.3% after ligating the lesion with elastic bands. In all cases the resection was complete, with no recurrence during the follow-up period, and no major complications, except for a single case in which a post-polypectomy hemorrhage occurred that was endoscopically solved. Conclusions: in properly selected patients, the endoscopic resection of carcinoid tumors is a safe and effective technique that permits a complete resection in all cases with few complications. Endoscopic ultrasonography is the technique of choice for selecting the patients who are candidates for endoscopic resection.Introducción: los carcinoides son los tumores neuroendocrinos más frecuentes, representado el tracto digestivo una de sus localizaciones más habituales. La mayoría de las lesiones se localizan en áreas poco accesibles para la endoscopia convencional (intestino delgado y apéndice; los carcinoides localizados en el tracto gastroduodenal y en el intestino grueso pueden ser estudiados endoscópicamente; en estos casos, si se confirma una enfermedad localizada, el tratamiento local mediante resección endoscópica puede ser el tratamiento de elección. Dado que la ecoendoscopia se ha mostrado como la técnica de elección en el estudio de los tumores de crecimiento submucoso, la selección de los pacientes candidatos a una resección local segura y efectiva ha de basarse en esta técnica. Pacientes y método: se han seleccionado los pacientes con tumores carcinoides digestivos tratados endoscópicamente entre 1997 y 2002. Se consideraron subsidiarios de resección endoscópica aquellos pacientes con tumores menores de 10 mm, que respetan la muscular propia y con un estudio de extensión negativo. Los objetivos finales del estudio fueron la evaluación de la eficacia (resección completa y seguridad (complicaciones de la técnica. El seguimiento consistió en biopsias de la escara al mes y los 12 meses de la resección. Resultados: en el periodo referido hemos resecado

Primer3_masker: integrating masking of template sequence with primer design software.

Science.gov (United States)

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

Ludopatía y epilepsia en demencia frontotemporal: Reporte de dos casos

Directory of Open Access Journals (Sweden)

Sheila Castro-Suarez

Full Text Available RESUMEN La demencia frontotemporal es un trastorno neurodegenerativo cuyo subtipo más común es la variante conductual. Es considerada la causa de demencia más frecuente en menores de 60 años. Se presentan dos casos no emparentados cuyos síntomas típicos fueron: deterioro progresivo de la cognición, del comportamiento, alteraciones psiquiátricas como desinhibición, actos impulsivos, apatía, falta de empatía, estereotipias y cambios en los hábitos de alimentación. La resonancia magnética cerebral, en ambos casos, mostró atrofia frontotemporal a predominio izquierdo; en la evaluación neuropsicológica se evidenció alteraciones de las funciones ejecutivas. El primer caso cursó con ludopatía como síntoma inicial, motivo por el cual permaneció por un año en un centro psiquiátrico, siendo el segundo en Latinoamérica y uno de los pocos casos reportados en el mundo. El segundo caso presentó crisis epilépticas en su evolución.

Primer reporte de alcaptonuria en el Perú

Directory of Open Access Journals (Sweden)

Daniel Guillén-Mendoza

Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

Primer reporte de parasitismo de una garrapata blanda del género Ornithodoros (Ixodida: Argasidae sobre Rhinella arenarum (Anura: Bufonidae en el departamento de Valle Fértil, San Juan, Argentina

Directory of Open Access Journals (Sweden)

Acosta, Juan Carlos

2012-08-01

Full Text Available El objetivo de la presente comunicación es reportar por primera vez un caso de parasitismo en Rhinella arenarum y a la vez mencionar el primer registro del género Ornithodoros en el departamento de Valle Fértil, San Juan, Argentina. Siendo el primer registro de parasitismo de anfibios por Ornithodoros en la Argentina y el segundo para el neotrópico.

Histología y morfometría del sistema digestivo del silúrido bagre tigrito (pimelodus pictus)

OpenAIRE

Olaya, C. M.; Ovalle, C. H.; Gómez Ramírez, E.; Rodríguez Caicedo, D.; Caldas Martínez, M. L.; Hurtado Giraldo, H.

2009-01-01

El bagre tigrito Pimelodus pictus es un pez ornamental con gran aceptación en el mercado acuarista internacional, sin embargo, se desconocen muchos aspectos de la biología básica de esta especie. Por tal motivo, se realizó un estudio histológico y morfométrico del sistema digestivo a Àn de contribuir al diseño de futuras dietas. Se sacriÀcaron 7 individuos adultos de P. pictus de 10 ± 0,5 cm de longitud total con una sobredosis de MS-222 (0,5 g/l). Los especímenes se Àjaron en formaldehído al...

Celulitis por Acinetobacter junii-johnsonii adquirida en la comunidad: una presentación de caso

Directory of Open Access Journals (Sweden)

Andrés F. Henao-Martínez

2012-06-01

Full Text Available La infección de piel y tejidos blandos por Acinetobacter no relacionada con trauma es una presentación inusual. La mayoría de los casos descritos presentan enfermedades concomitantes y son causados por Acinetobacter baumanii. Se describe un caso de celulitis no traumática por A. junii-johnsonii con bacteriemia, de inicio en la comunidad y asociado con el tratamiento médico. De acuerdo con nuestro conocimiento, éste sería el primer caso reportado de infección de tejidos blandos y piel por A. juniijohnsonii.La vesícula hemorrágica podría ser una característica clínica de celulitis por Acinetobacter.   doi: http://dx.doi.org/10.7705/biomedica.v32i2.652

Ultramorphology of digestive tract of Anticarsia gemmatalis (Hübner, 1818 (Lepidoptera: Noctuidae at final larval development/ Ultramorfologia do trato digestivo de Anticarsia gemmatalis (Hübner, 1818 (Lepidoptera: Noctuidae no final do desenvolvimento larval

Directory of Open Access Journals (Sweden)

Luis Antônio Toledo

2008-08-01

Full Text Available The digestive tract of insects is an important natural, physical, and chemical defense barrier against pathogen invasion. Certain lepidopteran caterpillars are serious pests of agricultural crops and their biology has received much attention, but little is known about the larval noctuid gut. The morphological analysis of the digestive tract in Anticarsia gemmatalis under scanning electron microscopy (SEM is a good model for studies about its defense mechanism. The material was fixed (2,5% glutaraldehyde solution; 0.1M-phosphate buffer, pH 7.3, post-fixed (1% osmium tetroxide in the same buffer, dried at critical point, gold coated and analyzed in a SEM 515-Philips. A. gemmatalis digestive tract consists of a straight duct of varying length and diameter, subdivided in three main regions: the foregut formed by the oral cavity, pharynx, esophagus, and crop; the midgut that is the largest portion of the digestive tract without noticeable morphological differentiation along its length; and the hindgut that is morphologically differentiated in pylorus, ileum, colon, and rectum. Although the general morphology of the A. gemmatalis digestive tract is quite similar to the other Lepidoptera species, the anatomical array of the crop muscular layers is quite different comparing with the description for other larval insect.O trato digestivo dos insetos constitui uma importante barreira físico-química natural contra invasão de patógenos. Algumas larvas de lepidópteros são consideradas pragas agrícolas potenciais e sua biologia tem recebido muita atenção; no entanto, pouco se sabe sobre a morfologia do sistema digestivo. A análise morfológica do trato digestivo de Anticarsia gemmatalis em nível ultraestrutural é um método bastante eficaz para o estudo dos seus mecanismos de defesa. Os materiais foram fixados (solução de glutaraldeído 2,5%; 0.1M tampão fosfato, pH 7.3, pós-fixados (tetróxido de ósmio 1% no mesmo tampão, desidratados em

Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

OpenAIRE

Harold Castañeda-Peña; Liliana González Niño; Gloria Marciales Vivas; Jorge Winston Barbosa Chacón; Juan Carlos Barbosa Herrera

2010-01-01

Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas). S...

UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

Directory of Open Access Journals (Sweden)

Nomin Batnyam

2012-01-01

Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

El caso Glivec®: primer ejemplo de debate global en torno al sistema de patentes de medicamentos

Directory of Open Access Journals (Sweden)

Inês Moital

2014-11-01

Conclusión: El caso Glivec® ha planteado el debate sobre la adecuación de las normas internacionales, su aplicabilidad en el entorno económico y su adaptación en cada país. Este caso, y otros, deberían contribuir a la reflexión sobre el sistema internacional de patentes a fin de preservar la salud de la población más necesitada de una atención sanitaria adecuada en equilibrio con la protección de la propiedad intelectual y la innovación.

Desarrollo de una propuesta de aula para lograr un aprendizaje significativo del sistema digestivo por medio de las analogías

OpenAIRE

Ramírez Rincón, Rubén Arnulfo

2011-01-01

En este trabajo se desarrolló una estrategia de aula basada en el uso de las analogías. El tema seleccionado es el sistema digestivo, en el cual se utilizan cuatro clases de seres vivos para hacer las comparaciones correspondientes y alcanzar un aprendizaje significativo en los estudiantes de grado séptimo del Instituto Comercial Ruperto Aguilera León del municipio de Nemocón, Cundinamarca. Las especies son: Ameba, Esponja de Mar, Humano y Bovino. Las diversas actividades planteadas se diseña...

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

MÉTODO DE CASOS. UNA METODOLOGÍA ACTIVA PARA ADQUIRIR APRENDIZAJES SIGNIFICATIVOS EN QUÍMICA

Directory of Open Access Journals (Sweden)

Clotilde Pizarro

2015-01-01

Full Text Available En este trabajo se aplica lametodología de casos en estudiantes de primer año de la carrera de Ingeniería en Prevención de Riesgos y Medioambiente. Para lo cual se presenta un caso real de contaminación, ocurrido en una escuela de la región de Valparaíso llamada “La Greda”. Se inicia la aplicación del caso entregando un extracto de la información recolectada de los medios de información y se les realiza una breve inducción acerca de la metodología a aplicar. Luego se realiza un plenario, en el que se debate acercade las posibles soluciones al problema y estableciendo una relación entre el caso y las unidades del programa de química.Se concluye que la aplicación del método de casos, fue una herramienta fructífera en los rendimientos obtenidos por los estudiantes, ya que el porcentaje de aprobación en promedio fue de un 75%, el cual es considerablemente mayor que años anteriores.

Leucemia viral felina simultánea con otras patologías en tres casos clínicos diferentes

OpenAIRE

Ortiz A, José F

2011-01-01

La leucemia viral felina (ViLeF) es una patología, que se asocia con la presentación de varias enfermedades; el artículo presenta tres casos de pacientes cada uno con patologías diferentes que a su vez fueron positivos a ViLeF; no se descarta que esta enfermedad esté relacionada o sea la causa de las tres patologías, en el primer caso se encontró una anemia arregenerativa, en el otro, un carcinoma mamario y en el último, un proceso compatible con una peritonitis felina. Se describen la sintom...

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

La deserción universitaria en primer año : Análisis de la situación de los ingresantes de la Facultad de Ciencias Naturales y Museo de La Plata a través del estudio de caso Introducción a la Botánica

OpenAIRE

Cristina, Inés

2010-01-01

Objetivo general: Indagar los motivos que pueden generar la alta deserción de alumnos ingresantes en la Facultad de Ciencias Naturales y Museo de la UNLP, tomando como caso de estudio la materia Introducción a la Botánica. Objetivos específicos  Identificar situaciones recurrentes que puedan orientar sobre las posibles causas de deserción de alumnos en el primer año de la carrera de Licenciatura en Biología de la Facultad de Ciencias Naturales y Museo, tomando ...

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae) reproducidas en cautiverio

OpenAIRE

Adán Villagarcia Olmeño; Enrique Cuevas

2014-01-01

En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772). La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

Síndrome biopercular: presentación de dos casos y revisión de la literatura

Directory of Open Access Journals (Sweden)

Carlos Santiago Uribe

2008-06-01

Las pacientes presentan diplejía facio-faringo-gloso-masticatoria y parálisis volitiva selectiva de músculos oro-faciales. La evaluación neuropsicológica evidenció compromiso cognitivo, emocional y de la interacción social como parte de un síndrome de la convexidad frontal en el primer caso y, de retardo mental, en el segundo caso. La fonoaudiología demostró que las dos pacientes tenían dificultades en el proceso de masticación y deglución, y dificultades graves en el lenguaje verbal. El pronóstico de recuperación del lenguaje verbal es pobre, pero muchos pacientes pueden recuperar la deglución.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

HISTOLOGÍA Y MORFOMETRÍA DEL SISTEMA DIGESTIVO DEL SILÚRIDO BAGRE TIGRITO (Pimelodus pictus

Directory of Open Access Journals (Sweden)

CM Olaya

2007-01-01

Full Text Available El bagre tigrito Pimelodus pictus es un pez ornamental con gran aceptación en el mercado acuarista internacional, sin embargo, se desconocen muchos aspectos de la biología básica de esta especie. Por tal motivo, se realizó un estudio histológico y morfométrico del sistema digestivo a Àn de contribuir al diseño de futuras dietas. Se sacriÀcaron 7 individuos adultos de P. pictus de 10 ± 0,5 cm de longitud total con una sobredosis de MS-222 (0,5 g/l. Los especímenes se Àjaron en formaldehído al 4%, durante cinco días a 4 °C. Luego se siguió el procedimiento para técnica en paraÀna. Se realizaron cortes de 5 μm de espesor y se colo-rearon con H&E. El sistema digestivo presentó cuatro capas: mucosa, submucosa, muscular y serosa. En el esófago la mucosa estaba compuesta por epitelio plano estratiÀcado con gran número de células caliciformes, y una submucosa de tejido conectivo laxo, seguida por músculo estriado esquelético con dos orientaciones (circular y longitudinal. En todos los órganos evaluados la capa serosa fue muy delgada. En el estómago se identiÀcaron dos regiones, la pilórica y la cardíaca, encontrándose glándulas gástricas en esta última, ambas regiones presentaban una mucosa con epitelio cilíndrico simple, una submucosa de tejido conectivo laxo, y una capa de músculo liso con dos orientaciones (circular y longitudinal así mismo, este órgano fue el que exhibió el mayor espesor en la capa mucosa y muscular. La histología de la mucosa, la submucosa y la capa muscular del intestino fue similar a lo presentado por el estómago, aunque morfométricamente esta región fue la que exhibió los menores valores en todas las capas evaluadas. El estómago bien deÀnido y el intestino con pocos ciegos pilóricos hace suponer que P. pictus es de hábitos omnívoros con preferencia de los alimentos de origen animal.

Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae reproducidas en cautiverio

Directory of Open Access Journals (Sweden)

Adán Villagarcia Olmeño

2014-12-01

Full Text Available En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772. La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

Un caso de leucismo en larvas de Phyllomedusa bicolor (Anura: Hylidae reproducidas en cautiverio

Directory of Open Access Journals (Sweden)

Adan Villagarcía Olmeño

2015-01-01

Full Text Available En este artículo se reporta el primer caso de leucismo en Phyllomedusa bicolor (Boaddaert 1772. La larva leucística descrita fue resultado de un trabajo de manejo reproductivo en cautiverio, y fue fotografiada 97 días después de su eclosión, mostrando una coloración blanca uniforme a excepción de los reflejos dorados de los flancos y el tono oscuro de los ojos.

Prevalência da microbiota no trato digestivo de fêmeas de Lutzomyia longipalpis (Lutz & Neiva, 1912 (Diptera: Psychodidae provenientes do campo

Directory of Open Access Journals (Sweden)

Oliveira Sandra Maria Pereira de

2000-01-01

Full Text Available No presente trabalho foram dissecados o trato digestivo de 245 fêmeas de Lutzomyia longipalpis originários da Gruta da Lapinha, Município de Lagoa Santa, MG, formando 7 grupos de 35 flebotomíneos. Das 8 espécies de bactérias isoladas houve uma predominância de bactérias Gram negativas (BGN pertencentes ao grupo de não fermentadoras de açúcar das seguintes espécies: Acinetobacter lowffii, Stenotrophomonas maltophhilia, Pseudomonas putida e Flavimonas orizihabitans. No grupo das fermentadoras tivemos: Enterobacter cloacae e Klebsiella ozaenae. No grupo dos Gram positivos foram identificados Bacillus thuringiensis e Staphylococcus spp.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Endocarditis por Brucella canis: primer caso documentado en un paciente adulto en Argentina Brucella canis endocarditis: first documented case in Argentina

Directory of Open Access Journals (Sweden)

Valeria Manias

2013-03-01

Full Text Available Se describe el primer caso documentado de endocarditis por Brucella canis en Argentina. El paciente fue un varón adulto que consultó por edemas en miembros inferiores, registros febriles aislados de 2 meses de evolución y dolor precordial opresivo que irradiaba a brazo izquierdo. Negaba contacto con animales de cría o consumo de productos sin pasteurización. Estudios cardiológicos constataron endocarditis infecciosa. Se resuelve cirugía de recambio valvular ante fracaso terapéutico empírico con cefalotina, ampicilina y gentamicina. Los hemocultivos fueron positivos (4 de 4 muestras con bacilos gram negativos. Se realizó la identificación con técnica API 20 NE (bioMérieux, el método automatizado Phoenix (BD y las pruebas bioquímicas convencionales, sin concluir género ni especie. Se derivó la cepa al departamento de Bacteriología Especial INEI-ANLIS "Dr. Carlos G. Malbrán" donde se identificó al aislamiento como Brucella canis. Se rotó el esquema terapéutico a doxiciclina, rifampicina y trimetoprima-sulfametoxazol con buena evolución. La importancia del caso radica en la posible falla del tratamiento antimicrobiano empírico administrado para endocarditis, ya que B. canis no responde a los antimicrobianos convencionales para esta patología.We herein present the case of an adult male patient who consulted for lower extremity edema, a 2- month history of fever and oppressive chest pain radiating to the left arm. He referred neither contact with breeding animals nor consumption of unpasteurized dairy products. A diagnosis of endocarditis was confirmed by cardiac studies. Since the empirical treatment with cephalotin, ampicillin and gentamicin failed, the patient underwent aortic valve replacement. A total of four blood cultures were positive with a gram-negative rod. Bacterial identification was performed using the API 20 NE technique (bioMerieux, the Phoenix automated method (BD and conventional biochemical tests which were

Chikungunya: enfermedad vírica emergente: irrupción en el ámbito laboral: primer caso declarado en España como accidente de trabajo

Directory of Open Access Journals (Sweden)

Marta Cerrillo Arranz

Full Text Available La enfermedad del Chikungunya es una infección causada por el virus Chikungunya y transmitida al hombre por la picadura de mosquitos vectores del género Aedes. Aun siendo endémica de otros países, la elevada movilidad actual de la población por motivos lúdicos, laborales, comerciales y migratorios junto a la presencia del vector competente (Aedes albopictus en numerosas zonas geográficas de España, hace que haya irrumpido en nuestro territorio en los últimos años. La palabra Chikungunya deriva del idioma Makonde (Mozambique. Significa "el que se encorva" en referencia a la postura frecuentemente adoptada por dolor articular. A pesar de su escasa mortalidad, la morbilidad puede ser elevada, afectando de forma significativa a la actividad de vida diaria y capacidad laboral del paciente, reflejado en el consecuente absentismo laboral y repercusión económica. En España, tanto desde el Servicio Sanitario Público como desde los Servicios Médicos de Salud Laboral y Servicios de Prevención, se debe estar preparado para el diagnóstico, seguimiento, tratamiento y prevención de enfermedades hasta ahora desconocidas en nuestro ámbito de trabajo. Este artículo describe el primer caso laboral en España por enfermedad del Chikungunya importada por contagio en Haití.

La influencia del crimen organizado transnacional en el proceso de formulación de políticas públicas. Estudio de caso: Argentina 2001-2013

OpenAIRE

Marín Osorio, Iván Felipe

2016-01-01

Este estudio de caso analiza la influencia del Crimen Organizado Transnacional en la formulación de Políticas Públicas de seguridad en Argentina entre 2001 y 2013. En contraste con otros estudios, se considera que la relación de estos dos fenómenos debe recoger aspectos fundamentales de un enfoque de seguridad integral y multidimensional. En el caso de Argentina, durante 2001 el Crimen Organizado Transnacional ocupó el primer lugar en la agenda pública, lo cual derivó en una serie de acciones...

Esófago de Barrett: experiencia de 10 años en un centro de tercer nivel en México

Directory of Open Access Journals (Sweden)

F. Valdovinos-Andraca

2018-01-01

Conclusiones: La frecuencia de EB fue de 9.6 casos por cada 1,000 endoscopias de tubo digestivo superior. En la mayoría de los pacientes con EB no se documentó displasia y permanecieron sin cambios histopatológicos durante el seguimiento. El 19.3% de los pacientes presentaron displasia o cáncer.

Hiperplasia linfoide de íleon terminal, presentación de un caso

Directory of Open Access Journals (Sweden)

Arley Fajardo Ochoa

2014-08-01

Full Text Available Se presenta el caso de un adolescente masculino de 16 años de edad que acudió a la consulta por dolor abdominal recurrente, localizado en la fosa ilíaca derecha, el cual había recibido tratamiento sintomático con antiespasmódicos y antiparasitarios sin lograr mejoría del dolor, por lo que fue remitido a la consulta de Gastroenterología donde se le realizaron exámenes complementarios que evidenciaron la existencia de una patología en el íleon terminal, se remitió al Instituto de Gastroenterología, donde se le realizó una colonoscopia y se le diagnosticó una hiperplasia linfoide severa de Ileon terminal que con el tratamiento higiénico dietético, se logró disminuir la frecuencia y la intensidad del dolor, sin embargo en las colonoscopías evolutivas se observó un incremento en la intensidad y la extensión de la hiperplasia por lo que se le indicaron exámenes endoscópicos e histológicos cada seis meses, llama la atención que a pesar de la severidad del cuadro, nunca se ha observado ningún episodio de sangrado digestivo que es la forma de presentación más frecuente de esta entidad

Algunas enseñanzas de las crisis bancarias recientes: el caso uruguayo

OpenAIRE

José Manuel Quijano

2005-01-01

El trabajo indaga en algunas de las características de las crisis bancarias del presente así como en el desenlace que las mismas han tenido en los últimos años. Se analiza el caso de Uruguay y se hace referencia al de Argentina, quienes transitaron por una importante crisis cambiaria y bancaria en 1982 y veinte años después, en 2002, volvieron a tropezar con una nueva crisis de dimensión más amplia que la anterior y de graves consecuencias económicas y sociales. El primer apart...

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Un caso de hernia diafragmatica (Agenesia parcial del hemídiafragma izquierdo plastia del díafragma con pulmón atelectásico

Directory of Open Access Journals (Sweden)

Alfonso Bonilla Naar

1951-06-01

Full Text Available Hospital de la Misericordia. Servicio del doctor Martínez. Sala Rosa. C. J. P. E. 10 años. N. El Charquito (Soacha. F. de L .Septi~tnbre 12 de 1950. F. de S. Noviembre 5 de 1950. D. Preliminar, neumonía. C. de ingreso. Consulta porque desde hace dos días tiene dolor abdominal difuso, vómito, estreñimiento, anorexia y fiebre (vomitó un Ascaris. Se trata del primer caso operado en nuestro medio de una hernia diafragmática (por agenesia y vale anotar que según Meyer (1 quien cita a Sagal, hasta 1.933 sólo se conocian doce casos. Harrington (2 cita 12 casos en la Mayo Clinic. Hasta ahora, el defecto del diafragma se había cerrado con faciaperirrenal o con músculo (gran dorsal. En este caso se ensayó con éxito una plastia con un lóbulo pulmonar atelectásico. (Original.

Infección pulmonar por Mycobacterium avium en paciente VIH/SIDA: Primer reporte en Perú

Directory of Open Access Journals (Sweden)

Juan Carrasco

Full Text Available El complejo Mycobacterium avium (MAC es un patógeno que se encuentra en el medioambiente y causa infecciones tanto en pacientes inmunocompetentes como inmunocomprometidos. Se presenta el caso de un paciente VIH positivo varón de 38 años infectado por P. jirovecii y aparentemente infectado por Mycobacterium tuberculosis desde el año 2009, el cual fue tratado con antibioticoterapia para pneumocistosis y terapia antituberculosis (TB logrando mejoría parcial. En el año 2012 se le realizó nuevamente examen de cultivo y un nuevo tratamiento anti TB, frente a la sospecha de estar en presencia de una cepa de TB multidrogorresistente se recomienda realizar la identificación micobacteriana. El examen de cultivo fue positivo y el resultado genotípico resultó positivo para MAC. Se reporta el primer caso de un paciente VIH/SIDA con infección pulmonar por MAC en el Perú, así como una breve revisión de los aspectos epidemiológicos, clínicos y de tratamiento

Cardiomiotomía graduada con funduplicatura anterior laparoscópica en acalasia, experiencia de 48 casos

Directory of Open Access Journals (Sweden)

A. Etchegaray-Dondé

2018-04-01

Full Text Available Resumen: Introducción y objetivos: En la Clínica de Tracto Digestivo Superior del Hospital General de México, el tratamiento de la acalasia se ha estandarizado mediante la realización de una cardiomiotomía estrictamente graduada que permite garantizar una miotomía completa para resolver de forma satisfactoria la disfagia característica de esta enfermedad. Un penrose de 8 cm, se coloca sobre el lecho quirúrgico, para garantizar la inclusión de todo el EEI, 6 cm por arriba de la UGE y 2 cm en sentido caudal, para asegurar la medición laparoscópica. El objetivo del estudio fue evaluar los resultados obtenidos con esta técnica. Material y métodos: Estudio descriptivo, retrospectivo, longitudinal, observacional, en una cohorte de pacientes con diagnóstico de acalasia, en la Clínica de Tracto Digestivo Superior, del Hospital General de México «Dr. Eduardo Liceaga». Resultados: Se incluyeron 48 pacientes; 40 sin tratamiento quirúrgico previo y 8 con recurrencia. En 47 casos el abordaje fue laparoscópico (97.9%; se requirió conversión a procedimiento abierto en 2 casos (tasa conversión 4.25%. La evolución postoperatoria fue satisfactoria en todos los casos, con inicio de la vía oral a las 52 h en promedio y una estancia intrahospitalaria promedio de 5.7 días. Durante el seguimiento de 35.75 meses en promedio no se han registrado recurrencias. No se presentó mortalidad. Conclusiones: La cardiomiotomía graduada (estrictamente medida con funduplicatura anterior mediante abordaje laparoscópico es una opción reproducible, eficaz y segura para el tratamiento quirúrgico de la acalasia. Abstract: Introduction and aims: At the Upper Gastrointestinal Tract Clinic of the Hospital General de Mexico, achalasia treatment has been standarized through strictly graduated cardiomyotomy. This procedure guarantees a complete myotomy for the satisfactory resolution of dysphagia, a characteristic symptom of achalasia. To ensure the

Ontogenia e histoquímica funcional de los sistemas digestivo y visual y de otros órganos durante el desarrollo larvario de la liseta, Chelon labrosus.

OpenAIRE

Sarasquete, Carmen; Ortiz-Delgado, Juan B.; Martos-Sitcha, J. Antonio; de las Heras, Verónica; Yúfera, Manuel; Martínez-Rodríguez, Gonzalo

2014-01-01

El objetivo del trabajo se centró en describir los principales cambios ontogénicos y funcionales de los sistemas digestivo y visual de Chelon labrosus, durante los primeros tres meses de vida larvaria, desde la fertilización hasta 99 dias después de eclosionar (dde). Se observó un largo periodo de reducido crecimiento (3.93%) durante las tres primeras semanas de vida, y una amplia fase de alimentación endo-exotrófica (hasta 13 dde). La mayoría de sistemas, órganos y estructuras tisulares (ojo...

Complex Adaptive System of Systems (CASoS) Engineering Applications. Version 1.0.

Energy Technology Data Exchange (ETDEWEB)

Linebarger, John Michael; Maffitt, S. Louise (New Mexico Institute of Mining and Technology, Albuquerque, NM); Glass, Robert John, Jr.; Beyeler, Walter Eugene; Brown, Theresa Jean; Ames, Arlo Leroy

2011-10-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex eco-socio-economic-technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to highly-saturated interdependencies and allied vulnerabilities to cascades in associated systems. The Phoenix initiative approaches this high-impact problem space as engineers, devising interventions (problem solutions) that influence CASoS to achieve specific aspirations. CASoS embody the world's biggest problems and greatest opportunities: applications to real world problems are the driving force of our effort. We are developing engineering theory and practice together to create a discipline that is grounded in reality, extends our understanding of how CASoS behave, and allows us to better control those behaviors. Through application to real-world problems, Phoenix is evolving CASoS Engineering principles while growing a community of practice and the CASoS engineers to populate it.

Phoenix : Complex Adaptive System of Systems (CASoS) engineering version 1.0.

Energy Technology Data Exchange (ETDEWEB)

Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph; Conrad, Stephen Hamilton; Kelic, Andjelka; Starks, Shirley J.; Beyeler, Walter Eugene; Brodsky, Nancy S.; Verzi, Stephen J.; Brown, Theresa Jean; Glass, Robert John, Jr.; Sunderland, Daniel J.; Mitchell, Michael David; Ames, Arlo Leroy; Maffitt, S. Louise; Finley, Patrick D.; Russell, Eric Dean; Zagonel, Aldo A.; Reedy, Geoffrey E.; Mitchell, Roger A.; Corbet, Thomas Frank, Jr.; Linebarger, John Michael

2011-08-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline of CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.

Doenças do sistema digestório de caprinos e ovinos no semiárido do Brasil

Directory of Open Access Journals (Sweden)

Milena A. Aragão de Lira

2013-02-01

Full Text Available As doenças do sistema digestório de caprinos e ovinos na região semi-árida do nordeste do Brasil foram avaliadas através de um estudo retrospectivo de 2.144 atendimentos de pequenos ruminantes no Hospital Veterinário da Universidade Federal de Campina Grande, Patos, Paraíba, no período de janeiro de 2000 a dezembro de 2011. Os registros foram revisados para determinar a ocorrência e as principais características clínicas, epidemiológicas e patológicas dessas enfermidades. De um total de 512 casos (23,9% de distúrbios digestivos, 367 (71,7% ocorreram em caprinos e 145 (28,3% em ovinos. As helmintoses gastrintestinais e a coccidiose foram as doenças mais frequentes, com um total de 330 casos. Os distúrbios da cavidade ruminoreticular (acidose, indigestão simples, timpanismo, e compactação ruminal totalizaram 94 casos. O abomaso foi afetado primária e secundariamente por úlceras. Casos de obstrução e compressão do trato gastrointestinal também foram observados. Malformações como atresia anal e fenda palatina foram registradas em ambas as espécies, sendo esta última associada à ingestão de Mimosa tenuiflora. Entre as doenças infecciosas foram observados cinco casos de ectima contagioso, dois casos de paratuberculose e dois casos de pitiose gastrointestinal. Em sete animais suspeitou-se de enterotoxemia e 31 casos foram diagnosticados como enterite inespecífica. A não utilização de práticas de controle integrado de parasitas e a utilização de alimentos inadequados durante o período de escassez de forragem contribuiu para a ocorrência de um grande número de doenças. A prática de conservação de forragens poderia reduzir substancialmente a ocorrência de distúrbios digestivos na região semiárida.

Cáncer de mama bilateral sincrónico. Revisión de la literatura y presentación de un caso

Directory of Open Access Journals (Sweden)

Lidia Torres Ajá

2012-05-01

Full Text Available Se conoce como cáncer bilateral sincrónico a los tumores primarios en ambas mamas, que son diagnosticados simultáneamente. Su aparición es poco frecuente, y se presenta aproximadamente en el 1- 2,5 % de todos los pacientes. Se informa el caso de una paciente de 57 años, que acudió a consulta por presentar nódulos mamarios bilaterales, diagnosticados, mediante biopsia por parafina, como cánceres mamarios histológicamente diferentes. Es el primer caso de cáncer mamario bilateral sincrónico diagnosticado en la provincia de Cienfuegos, por lo cual consideramos de interés su publicación y divulgación.

Presentación del primer caso humano de parasitismo por Macracanthorhynchus hirudinaceus en el Perú y breve revisión

Directory of Open Access Journals (Sweden)

María Beltrán F. de Estrada

1997-07-01

Full Text Available Se reporta un caso humano portador de Macracanthorhynchus hirudinaceus. Se trata de un varón de 45 años de edad, natural de la provincia de Chota, departamento de Cajamarca, Perú; con molestias digestivas. El diagnóstico se hizo por el hallazgo de huevos de Macracanthorhynchus hirudinaceus en las heces. Además se encontró Trichuris trichiura, Ancylostoma duodenale, Trichostrongylus sp, Blastocystis hominis y Entamoeba coli. Esta es la primera comunicación de un caso humano de M. hirudinaceus para el Perú.

SÍNDROME NEUROTÓXICO POR MORDEDURA DE Latrodectus mactans: REPORTE DE UN CASO PEDIÁTRICO Y REVISIÓN DE LITERATURA.

Directory of Open Access Journals (Sweden)

Oscar Alberto Castejón Cruz

2015-06-01

Full Text Available Lactrodectismo es un síndrome producido por mordedura de araña del género Latrodectus, el agente conocido como “Viuda Negra”. La incidencia es de 400 casos por año y su mortalidad de 1%. Siendo este el primer caso pediátrico reportado en Honduras. Caso Clínico: Escolar de 9 años, visita el área de Emergencia con 6 horas de evolución de mordedura de araña en mano derecha, ardor, dolor, enrojecimiento en sitio de la lesión, mialgias, artralgias, temblor fino y debilidad a la deambulación con disminución notable de la fuerza. Al evaluarlo taquicárdico, hipertenso con signos de agitación psicomotriz, diaforesis, edema bipalpebral, distensión abdominal y priapismo. Manejándose como un caso grave y egresado sin complicación alguna. Conclusiones: Este caso debe servir como guía para lograr un diagnóstico rápido, de tal manera que el diagnóstico de lactrodectismo sea considerado en los hospitales de manera oportuna. Palabras Clave: Araña viuda negra, picadura de araña, pediatría.

Primer registro de infestación en un reptil por larvas de Amblyomma parvitarsum (Acari: Ixodidae en Argentina

Directory of Open Access Journals (Sweden)

Gabriel Natalio Castillo

2015-05-01

Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.

Gut size flexibility in rodents: what we know, and don't know, after a century of research Flexibilidad en el tamaño del tracto digestivo en roedores: qué sabemos, y qué no sabemos, después de un siglo de investigación

Directory of Open Access Journals (Sweden)

DANIEL E NAYA

2008-12-01

specific absorption (e.g., during highly demanding periods. (6 The qualities of an energetic demand (e.g., its relative intensity rather than simply its presence or absence can affect the amount of digestive flexibility. (7 Quantitative comparisons of the existing data are difficult due to several factors, such as the disparity of experimental treatments and differences in the types of data collected. At the end of this review, further directions for the study of digestive flexibility in rodents are presented.La plasticidad fenotípica constituye un concepto medular en el entendimiento de cómo los organismos interactúan con su ambiente y, por tanto, un tema central en ecología y evolución. Un caso particular de la plasticidad fenotípica es la flexibilidad fenotípica, la cual refiere a los cambios reversibles en un organismo producto de cambios en las condiciones ambientales. La flexibilidad en los rasgos digestivos ha sido estudiada por más de un siglo en diversas especies y contextos. Para el caso de los roedores, los estudios sobre la flexibilidad en el tamaño del tracto digestivo han sido desarrollados principalmente desde dos áreas de la biología, la fisiología y la ecología. Sin embargo, como ha ocurrido con muchos tópicos relacionados con la fisiología ecológica, ambos tipos de estudios se desarrollaron por vías separadas. En este trabajo se intenta evaluar de forma conjunta la información proveniente de ambas áreas. Las principales conclusiones alcanzadas son: (1 la flexibilidad en el tamaño del tracto digestivo puede ser considerada un mecanismo fisiológico ampliamente distribuido, existiendo un clara congruencia entre los ajustes en la morfología digestiva y los cambios en las condiciones ambientales. (2 Los factores experimentales más investigados han sido la calidad de la dieta, el estatus reproductivo, la temperatura ambiental y el ayuno para las especies de laboratorio y la calidad de la dieta y la temperatura para las especies salvajes

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Glucogenosis tipo I: reporte de dos casos en dos hermanos de Cartagena de Indias-Colombia

OpenAIRE

Alvear-Sedán Ciro; Barboza-Ubarnes, Miryam; Bonillas-Fierro Miguel [q.e.p.d

2011-01-01

CASO CLÍNICO: # 1. Producto del primer embarazo de padres no consanguíneos, con lactancia hasta los dos años. A los 18 meses deedad presentó distensión abdominal, hepatomegalia difusa no dolorosa, diarrea de mes y medio, debilidad generalizada, edemaprogresivo en cara y pies, anasarca y anemia. Vesícula, bazo y riñones normales y examen neurológico sin alteraciones. Nopresentó hipoglucemia, ácido láctico normal. Pruebas hepáticas alteradas; colesterol, triglicéridos y ácido úrico en el límite...

Escuela Inclusiva: estudio de caso sobre la inclusión del Trastorno de Espectro Autista

OpenAIRE

Ortuñez Vegas, Sonia

2016-01-01

La educación inclusiva sigue siendo hoy una asignatura pendiente. Este trabajo plantea, un estudio de casos en dos colegios de Zaragoza, respecto a las dificultades y las necesidades que tienen los docentes a la hora de trabajar con niños autistas y de qué manera podría ser posible la inclusión de este alumnado en centros ordinarios. En primer lugar realizamos un breve resumen del trastorno del espectro autista y la evolución de la educación inclusiva. En segundo lugar, se pres...

Cáncer gástrico. Caracterización de los casos operados en la provincia de Cienfuegos (2009-2011

Directory of Open Access Journals (Sweden)

Herson Leonel Otzoy Cún

2013-06-01

Full Text Available Fundamento: el cáncer gástrico es el tumor digestivo más frecuente, en algunos países ocupa la segunda causa de muerte por tumores malignos. Objetivo: caracterizar desde el punto de vista clínico-epidemiológico los cánceres gástricos operados en la provincia de Cienfuegos en el trienio 2009-2011. Métodos: estudio de serie de casos del total de pacientes operados (57 de cáncer gástrico en el Hospital General Universitario Dr. Gustavo Aldereguía Lima de la provincia de Cienfuegos, de enero del 2009 a diciembre de 2011. Las variables analizadas fueron: sexo, edad, factores de riesgo, enfermedades asociadas, localización anatómica, variante histológica, etapa clínica en el momento del diagnóstico, técnicas quirúrgicas aplicadas, complicaciones de la cirugía y estado de los pacientes al momento del egreso. Resultados: el mayor número de pacientes pertenecía al sexo masculino, comprendido entre 50 a 60 años. Los factores de riesgo que más predominaron fueron el tabaquismo, alcoholismo y gastritis crónica. El mayor porciento de los tumores se localizó en el antro gástrico en las etapas clínicas III y IV en el momento del diagnóstico. El tipo histológico más frecuente fue el adenocarcinoma. La técnica quirúrgica más utilizada fue la gastrectomía subtotal ampliada, solamente un 5 % de los casos presentaron complicaciones de la cirugía propiamente dicha. El 96,5 % de los pacientes egresó vivo. Conclusiones: En Cienfuegos los hombres mayores de 50 años son más propensos a padecer de cáncer gástrico; en el mayor número de casos el diagnóstico es tardío y más del 30 % se trata con técnicas paliativas.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Agenda pública local. Los casos de los municipios de El Carmen de Viboral y Turbo, Antioquia-Colombia

Directory of Open Access Journals (Sweden)

Olga Lucía Zapata Cortés

2016-01-01

Full Text Available La conformación de la agenda gubernamental en los municipios de El Carmen de Viboral y Turbo recorrió caminos diferentes. En el primer caso, se propuso una Asamblea Municipal como espacio de participación en el marco de la formulación del Plan de Desarrollo; en el segundo caso, se prefirió la contratación de un consultor externo para la elaboración del Plan de Desarrollo y hubo escasa participación ciudadana. Mediante un estudio de caso, apoyado en el análisis documental y el enfoque de corrientes múltiples para el estudio de la agenda pública, se observan formas diferenciadas de conformar la agenda, así como de aprovechar la participación de las comunidades en este proceso. También se observa que a pesar de las capacidades y fortalezas que trae consigo la presencia de la universidad pública en estos municipios, la incidencia de la Universidad de Antioquia en la configuración de la agenda local es escasa.

Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.

Energy Technology Data Exchange (ETDEWEB)

Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene; Brown, Theresa Jean; Linebarger, John Michael; Moore, Thomas W.; Glass, Robert John, Jr.; Maffitt, S. Louise; Mitchell, Michael David; Ames, Arlo Leroy

2012-01-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understanding and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS

Tumor de Abrikossoff: revisión de la literatura y presentación de tres casos Abrikossoff’s tumor: literature review and report of three cases

Directory of Open Access Journals (Sweden)

R. Luaces Rey

2007-12-01

Full Text Available El tumor de células granulares (TCG es una lesión benigna e infrecuente, que se suele presentar como una masa asintomática de menos de dos centímetros de diámetro. Aunque su origen todavía permanece desconocido, se sospecha que es neural (célula de Schwann, debido a estudios inmunohistoquímicos. Puede aparecer en cualquier parte del cuerpo, pero la región de la cabeza y el cuello es la más habitual (50%. En la cabeza y cuello, la lengua es la localización más común del TCG, seguida por la piel, la laringe, y los sistemas respiratorio y digestivo. En el estudio histológico, es característica la presencia de hiperplasia pseudo- epiteliomatosa, y el epitelio superficial está preservado normalmente. El análisis inmunohistoquímico revela reacción positiva a la proteína S-100, enolasa neuronal y proteínas mielínicas como P0 y P2. Presentamos tres casos de TCG y un resumen breve de la literatura existente. El primer caso fue diagnosticado en una mujer de 36 años de edad, el segundo en un hombre de 45 años, y el tercero en otro hombre de 55 años. Las lesiones estaban localizadas en el borde lateral, la superficie ventral y la superficie dorsal de la lengua. El tratamiento fue quirúrgico en los tres casos y no hay evidencia de recurrencia del tumor después de un período de seguimiento que varía desde los 8 meses a los 2 años.Granular cell tumor (GCT is an uncommon bening lession, pressentig as an asympmtomatic mass, less than two centimeters in diameter. The origin is still unknown, althougt it’s suspected to be neural (Schwann cell, because of immunohistochemical studies. It can appear in any part of the body, but the head and neck region is the most common (50%. In the head and neck, the tongue is the most usual location for GCT, followed by the skin, larynx, respiratory and digestive system. In the histological study is caracteristic the presence of pseudo-epitheliomatous hyperplasia, and the overlying ephitelium is

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Science.gov (United States)

Real Delor, Raúl Emilio

2018-04-23

Se presenta caso de paciente obesa a quien se le realiza endoscopía digestiva alta por disfagia tras ingesta accidental de hueso de pollo. Se constata leve esofagitis de reflujo y atrofia duodenal. La biopsia intestinal informa atrofia intestinal con infiltrado inflamatorio. Los autoanticuerpos para enfermedad celiaca resultan positivos. La paciente nunca presentó síntomas digestivos. Se confirma enfermedad celiaca silente e inicia dieta sin gluten.

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Cutaneous metastases from colonic adenocarcinoma: case report Metástase cutânea de adenocarcinoma de cólon: relato de caso

Directory of Open Access Journals (Sweden)

Caroline Merci Caliari de Neves Gomes

2012-09-01

Full Text Available The presence of cutaneous metastases (CM from a digestive tract cancer is infrequent, appearing in less than 5% of the cases. Given the low incidence of metastasis from colon adenocarcinoma, an unusual case that occurred in the Colorectal Surgery Department of Santa Casa de São Paulo is described in this report, and a brief review of literature is presented. A 78-year-old female patient who underwent right hemicolectomy, developed a tumor with approximately 8 cm in diameter in her gluteus eight months later, which was surgically resected, and the histological diagnosis was metastatic adenocarcinoma of the right colon. Although the literature estimated short survival in cases of CM, the patient developed no signs of tumor recurrence five months after the onset of metastasis in the gluteus, with significant improvement in her quality of life.A presença de metástase cutânea (MC de neoplasia de trato digestivo é um evento pouco frequente, presente em menos de 5% dos casos da doença. Tendo em vista a baixa incidência da metástase cutânea de adenocarcinoma de cólon, será descrito no presente relato um caso incomum que ocorreu no Serviço de Coloproctologia do Departamento de Cirurgia da Irmandade da Santa Casa de São Paulo e será feita uma breve revisão de literatura. Uma paciente do sexo feminino, 78 anos, submetida à hemicolectomia direita, desenvolveu após oito meses tumoração de aproximadamente 8 cm de diâmetro em sua nádega, que foi ressecada cirurgicamente, tendo diagnóstico histológico de metástase de adenocarcinoma de cólon direito. Apesar de ser estimada pela literatura uma sobrevida curta nos casos de MC, a paciente evolui sem sinais de recidiva do tumor após cinco meses do surgimento da metástase em glúteo, com melhora significativa em sua qualidade de vida.

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

Fungal flora of the digestive tract of Rhodnius prolixus, Rhodnius neglectus, Diptelanogaster maximus and Panstrongylus megistus, vectors of Trypanosoma cruzi, Chagas, 1909 Flora fúngica do trato digestivo de Rhodnius prolixus, Rhodnius neglectus, Diptelanogaster maximus e Panstrongylus megistus vetores de Trypanosoma cruzi, Chagas 1909

Directory of Open Access Journals (Sweden)

Aurea Maria Lage de Moraes

2004-12-01

Full Text Available This paper reports a study on the mycobiota in the digestive tract of four important species of triatomines: Rhodnius prolixus, R. neglectus, Diptelanogaster maximus and Panstrongylus megistus. The digestive tracts of 90 adults and 425 nymphs of these four triatomine species were studied and 365 fungal strains were isolated. The genera with the greatest number of species were Aspergillus, Penicillium (14 species in each genus, Acremonium and Cladosporium (three species in each genus, and the most frequent species, in decreasing order, were Aspergillus awamori, Penicillium corylophilum, Cladosporium herbarum and Aspergillus niger. It was concluded that, among the isolated fungi, Aspergillus niger and Penicillium corylophilum might be part of the natural flora of the digestive tract of triatomines.Um estudo da micobiota do trato digestivo de quatro importantes espécies de triatomíneos, Rhodnius prolixus, R. neglectus, Diptelanogaster maximus e Panstrongylus megistus, foi realizado. Foram examinados os tratos digestivos de 90 adultos e 425 ninfas destas espécies de triatomíneos e 365 cepas fúngicas foram isoladas. Os gêneros com o maior número de espécies encontradas foram Aspergillus, Penicillium (14 espécies cada, Acremonium e Cladosporium (3 espécies cada e as espécies mais freqüentes, em ordem decrescente, foram Aspergillus awamori, Penicillium corylophilum, Cladosporium herbarum e Aspergillus niger. Dentre os fungos isolados, concluímos que Aspergillus niger e Penicillium corylophilum possam fazer parte da flora natural do trato digestivo destes triatomíneos.

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

DISTRIBUCIÓN Y ABUNDANCIA DE LOS HUEVOS DE ESTRÓNGILOS DIGESTIVOS EN BOVINOS INFECTADOS NATURALMENTE

Directory of Open Access Journals (Sweden)

Jessica Quijada P

2008-08-01

Full Text Available Objetivo. Determinar la prevalencia, cargas parasitarias y distribución de las infecciones naturales con estróngilos digestivos dentro de rebaños bovinos de una zona ganadera del Estado Falcón en Venezuela Materiales y métodos. Se evaluaron cuatro fincas de bovinos doble propósito. Los animales son tipo “Carora” (mestizaje de razas: Holstein, Pardo Suizo, Cebuínos. Durante siete meses se analizaron (Técnica de Mc Master un total de 1140 muestras. La muestra de cada finca se estratificó en cuatro grupo etarios (1: Becerros 0-6 meses; 2: Mautes 7-12; 3: Novillas 13-24 y 4: Adultos >25 meses. Resultados. Los valores de prevalencia promedio fueron: 31.06-50.36%. Se halló diferencia estadística (p<0,05 entre los niveles de prevalencia entre fincas y entre grupos etarios. Las infecciones se distribuyeron de forma sobredispersada en cada rebaño, evidenciado por los bajos valores de K (0.001-0.01. Conclusiones. Los valores de abundancia se afectaron más por el número de animales con altas cargas que por la prevalencia. La mayoría de las infecciones no revistió importancia clínica, las altas cargas parasitarias representaron 1.75-28.56% de todas las infecciones.

Capital social y desarrollo económico. Los casos de Silicon Valley y Villa El Salvador

Directory of Open Access Journals (Sweden)

Pablo Galaso Reca

2005-01-01

Full Text Available Este artículo se refiere a las relaciones existentes entre el capital social y el desarrollo económico. Para ello, en primer lugar presenta un marco teórico que muestra la evolución del concepto de capital social, su clasificación, medición y algunas aplicaciones prácticas. Posteriormente, explica teóricamente los efectos del capital social en el desarrollo económico. Finalmente, analiza dos experiencias de desarrollo económico altamente vinculadas con el concepto de capital social: los casos de Silicon Valley y Villa El Salvador.

HISTOLOGÍA DEL SISTEMA DIGESTIVO DE Didelphis albiventris (LUND, 1840

Directory of Open Access Journals (Sweden)

C. Moreno-Durán1

2007-06-01

Full Text Available Didelphis albiventris es un marsupial que se encuentra en Colombia en la región Andina desde los 1800 hasta 4000 m.s.n.m (Cuartas - Calle 2003. Su importancia ecológica radica en que es una especie quecontrola poblaciones de roedores, e insectos y contribuye a la dispersión de las semillas.Se llevó a cabo un estudio histológico del sistema digestivo de marsupiales de Didelphis albiventris, provenientes del municipio de Sotaquirá (Boyacá, Colombia. Los órganos se fijaron en formol buferizado al 10%, y se tiñeron con Hematoxilina - Eosina de acuerdo a la técnica de Propath 1992.Se realizaron descripciones histológicas, desde la cavidad oral hasta el intestino grueso. En la lengua se observaron papilas filiformes y tres papilas circunvaladas dispuestas en forma de triángulo en la parte posterior de la lengua, con botones gustativos. El estómago del marsupial se dividió en varias zonas: cardial, fúndica, del cuerpo y pilórica las cuales presentan características similares a la mayoría de mamíferos. En la primera porción del intestino delgado, se observó el duodeno con ausencia de glándulas de Brunner, la disposición de las fibras musculares lisas presentó variación a nivel de duodeno y cloaca, caracterizándose por poseer una muscular circular externa y una muscular longitudinal interna. No se observaron diferenciassignificativas con respecto a otros mamíferos, como roedores y el hombre en hígado, páncreas, vesícula biliar y glándulas salivares por lo cual no se incluyen en el presente trabajo. Se encontraron diferencias con respecto a los mamíferos en la ubicación de las glándulas de Brunner en el íleon y no en el duodeno y la distribución de nódulos linfoides dentro de la lámina propia de la mucosa de todo el tracto gastrointestinal.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

A fístula esôfago-gástrica cervical

Directory of Open Access Journals (Sweden)

Fausto Orsi

Full Text Available OBJETIVO: Analisar a presença de fístula esôfago-gástrica cervical nos pacientes submetidos a esofagectomias por câncer após reconstrução do trânsito digestivo com o estômago nas três vias: pré-esternal, retro-esternal e mediastino posterior. MÉTODO: Em um total de 180 pacientes portadores de carcinoma de células escamosas de esôfago torácico, tratados no Hospital Geral de Nova Iguaçu e no Hospital EMCOR, de agosto de 1968 a março de 2000, foram realizadas 97 esofagectomias e 70 (72,16% reconstruções do trânsito digestivo. O tratamento considerado foi essencialmente cirúrgico através da esofagectomia transpleural direita e da esofagectomia transhiatal. A anastomose esôfago-gástrica cervical foi realizada inicialmente em parede anterior do estômago e depois em parede posterior. Paralelamente, foram realizados estudos experimentais em cadáveres frescos no IML (Instituto Médico Legal de Nova Iguaçu, para avaliação das dimensões das paredes gástricas e pesquisa de suas vascularizações. RESULTADOS: A incidência de fístulas ficou reduzida a 7,69%, quando se passou usar a parede posterior do estômago. A reconstrução do trânsito digestivo foi realizada em 52,86% pela via pré-esternal, 10% pela via retro-esternal e 37,14% pelo leito esofágico. As fístulas ocorreram em 20% dos pacientes (14 casos. Na via pré-esternal ocorreram 24,43% (9 casos, na via retro-esternal 42,85% (3 casos, e mediastino posterior 7,69% (2 casos.( X2= 3,39; p= 0,18 A mortalidade operatória foi de 15,71%, sendo a insuficiência respiratória sua maior causa.((X2= 3,29; p= 0,19. A sobrevida em cinco anos foi de 13,5%. CONCLUSÕES: A esofagectomia com anastomose esôfago-gástrica cervical é o nosso método de escolha. Os melhores resultados foram obtidos com a execução da anastomose esôfago-gástrica cervical na parede posterior do estômago, e através do mediastino posterior.

Al encuentro del lugar: caso de La parada del tonto en Concepción, Chile

Directory of Open Access Journals (Sweden)

Hugo Capellà

2014-09-01

Full Text Available Los lugares de encuentro se establecen en torno a nodos que terminan por convertirse en hitos colectivos, más allá de su forma. En el caso de La parada del tonto en la ciudad de Concepción, nos encontramos con un curioso ejemplo de un céntrico punto de encuentro que ha terminado por convertirse en un lugar con nombre propio. En el presente artículo nos centraremos, en primer lugar, en la construcción de lugares desde su dimensión no solo espacial, sino también temporal, incidiendo en la importancia histórica que han tenido los relojes como hito temporal. En segundo lugar, nos adentraremos en el caso de estudio específico de La parada del tonto, de su transformación de nodo hasta convertirse en hito de referencia colectiva. Finalmente, concluiremos con una teorización sobre la dimensión universal del hito temporal, como sentido del lugar o topoi, cohesionador de un legado colectivo.

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

OpenAIRE

Héctor Armando Durán Peralta; Luis Fernando Córdoba C

2007-01-01

Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando...

Análisis de estabilidad del reactor pftr para una reacción con cinética de primer orden utilizando la funcional de lyapunov

OpenAIRE

Durán Peralta, Héctor Armando; Córdoba C, Luis Fernando

2010-01-01

Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizand...

Eventración diafragmática traumática derecha: Reporte de un caso y revisión de la literatura

Directory of Open Access Journals (Sweden)

Armando Leal Mursuli

2002-12-01

Full Text Available La eventración diafragmática constituye una rara forma de afección diafragmática. Aunque no existen datos concluyentes, las eventraciones adquiridas del lado izquierdo parecen ser las más frecuentes. Por ser poco común, se presenta un paciente que luego de intervención neuroquirúrgica por accidente automovilístico muestra disnea y se le realiza radiografía de tórax, donde se observa elevación importante del hemidiafragma derecho. Se efectúan estudios contrastados del tractus digestivo superior e inferior, ultrasonografía y tomografía axial computadorizada abdominal con pruebas funcionales ventilatorias. Se interviene quirúrgicamente, y se comprueba una eventración diafragmática con laceraciones musculares. Se le realiza plicatura, en 3 planos, con puntos de Halsted y sutura no absorbible. Evolución satisfactoria. Se discute la difícil diferenciación entre eventración y hernia diafragmática, y en la mayoría de los casos la confirmación definitiva se efectúa durante el acto operatorio. No obstante, por el compromiso respiratorio que produce, la conducta quirúrgica será la correcta en estos pacientes. La reparación multilaminar es esencial para evitar la recidiva

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Incremento de la competencia comunicativa en dos adultos con Parálisis Cerebral mediante el dispositivo Makey-Makey. Un estudio de caso

OpenAIRE

Calleja, Marina; Luque, María Luisa; Rodríguez, José Miguel; Liranzo, Ana

2015-01-01

En este trabajo se presentan dos casos de parálisis cerebral (PC) de componente espástico y con graves problemas de comunicación como resultado de una fuerte disartria. Esta disartria les produce una baja inteligibilidad de habla, lo que les crea grandes dificultades en los procesos de interacción comunicativa y social. El objetivo de este estudio fue doble. En primer lugar, comprobar si era posible convertir el dispositivo conocido como Makey-Makey (Mk-Mk), inicialmente concebido...

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

Caso e caos

CERN Document Server

Ruelle, David

1992-01-01

Caso e caos – Il caso ha la sua ragione. Ma quale? E cos’è in realtà il caso? Da dove viene e come può fare irruzione nella nostra descrizione dell’universo? A tutte queste domande, in una chiara e lucida esposizione, cerca di dare risposta David Ruelle. Curiosando tra i risultati scientifici del XX secolo e soffermandosi anche su fenomeni e problemi estranei alla scienza tradizionale – le lotterie, gli oroscopi, la teoria dei giochi, la genesi della turbolenza – Ruelle ci guida a conoscere il caso avendo la matematica, la fisica e tutte le scienze naturali come compagne. Ancora oggi il modo in cui il caso irrompe nelle nostre vite e nel mondo può essere un mistero, ma grazie ai progressi della scienza, qui raccontati, riusciamo a saperne un poco di più.

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Morfologia de órgãos digestivos e não digestivos de suínos de linhagens modernas durante as fases de crescimento, terminação e pós-terminação = Morphology of digestive and non-digestive organs of pigs from modern lineages during growth, finishing and post-finishing phases

Directory of Open Access Journals (Sweden)

Jacinta Diva Ferrugem Gomes

2007-07-01

Full Text Available O melhoramento genético de suínos levou ao surgimento de diversas linhagens suínas que apresentam elevada capacidade de desenvolvimento de massa muscular. Entretanto, pouco se sabe cientificamente sobre a morfologia de órgãos destes animais, conhecimento que ajuda a elucidar características relacionadas ao desempenho zootécnico como ganho de peso e conversão alimentar em carne magra. Objetivou-se, assim, comparar a morfologia dos órgãos digestivos e não-digestivos de suínos de linhagens modernas ao final das fases de Crescimentos Ie II, Terminação e Pós-terminação. O peso dos órgãos em relação ao peso vivo diminuiu significativamente (p The genetic market makes use of various modern swine genotypes that present high capacity for muscular mass development. These genetic lines have been used in swine production without existing scientificinformation about morphology, knowledge that can elucidate factors related to growth performance, such as weight gain and food conversion in lean meat yield. The aim of this experiment was to compare the morphology of digestive and non-digestive organs of moderngenotypes. At the end of the phases: Growing I, Growing II, Finishing and Post-finishing, the pigs were slaughtered and the organs were weighed. The weight of the organs decreased (p < 0.01 with body development, in agreement with the biological growth of the animals. The morphology of the digestive organs were different (p < 0.06 among lineages, which showed that differences can exist, mainly regarding digestive capacity and, possibly, food intake and efficiency. The length of the small intestine was different (p < 0.06 among lines, which can be an indicative of increased body development due to an extended food exposition area to intestinalcells. The scientific knowledge of swine lines morphology is important because this information can contribute to animal growth performance.

Espasmos epilépticos de inicio tardío: presentación de un caso clínico

OpenAIRE

Capote, Gabriela; Cerisola, Alfredo; Scavone, Cristina

2009-01-01

Introducción: los espasmos epilépticos son un tipo específico de crisis epiléptica caracterizada por una contracción muscular breve y brusca que abarca predominantemente el tronco y las extremidades. Cuando aparecen durante el primer año de vida, se presentan en salvas y se asocian al patrón electroencefalográfico típico de hipsarritmia, constituyen el síndrome de West. Es interesante discutir la clasificación nosológica de los casos que se presentan con espasmos epilépticos en salvas de inic...

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Estudio histológico del sistema digestivo en diferentes estadios de desarrollo de la cachama blanca (Piaractus brachypomus

Directory of Open Access Journals (Sweden)

Miguel Ángel Mendoza R.

2013-06-01

Full Text Available La cachama blanca (Piaractus brachypomus es la segunda fuente de producción piscícola en Colombia, después de la tilapia roja (Oreochomi ssp. y antes de la trucha arcoíris (Oncorhynchus mykiss. Se destaca, además, como una de las especies con mayor potencial productivo en el país. Se realizó el estudio histológico del sistema digestivo de la Piaractus brachypomus a fin determinar la morfología normal en diferentes estadios de desarrollo. Para ello se clasificaron los animales según la edad, el tamaño y el peso en ovas embrionadas, larvas con saco vitelino, alevinos después de reabsorción de saco vitelino, juveniles (3-5 cm, 5-7 cm, 10 cm, 15 cm y adultos (300 g. La fijación de los tejidos se realizó en formaldehído al 3,7 % y se describió microscópicamente cavidad bucal, faringe, esófago, estómago, ciegos pilóricos, intestinos y las glándulas anexas, hígado y páncreas. Por último, se describió macroscópicamente la organización anatómica de este sistema.

Upper gastrointestinal findings detected by capsule endoscopy in obscure gastrointestinal bleeding Hallazgos digestivos altos de la cápsula endoscópica en la hemorragia digestiva de origen oscuro

Directory of Open Access Journals (Sweden)

B. Velayos

2009-01-01

para determinar si una segunda gastroscopia previa a la cápsula podría añadir beneficios en el manejo de esta patología. Métodos: estudiamos de forma retrospectiva 82 pacientes a los que se efectuó cápsula endoscópica como estudio de hemorragia oscura que contaban con una única gastroscopia. Los hallazgos que la cápsula apreció en tramos altos se dividieron en normales, leves/conocidos y severos-desconocidos que recomendaron una segunda gastroscopia. Estos últimos casos fueron seguidos. Resultados: la cápsula endoscópica no objetivó hallazgos esofágicos desconocidos. En un 63% no evidenció lesiones gastroduodenales, en un 20% estas eran leves o conocidas y en un 17% se recomendó una nueva gastroscopia al encontrar patología desconocida y que podría motivar la hemorragia digestiva a este nivel. La información motivó cambios en el tratamiento en un 85% de este grupo, con mejoría en el 78%. La cápsula endoscópica encontró alteraciones intercurrentes llamativas en el intestino delgado en sólo un 14%. Conclusiones: una segunda gastroscopia previa a una cápsula endoscópica en el estudio de la hemorragia oscura ofrecería beneficios en términos diagnósticos y a la hora de introducir cambios terapéuticos que consiguen buenos resultados clínicos. El análisis detallado de los fotogramas del tracto digestivo alto es obligado, ya que puede aportar información relevante y con importancia en el manejo de estos pacientes.

La práctica del reciclaje. Estudio de caso de La Asociación Colombiana de Recicladores Independientes, UPZ Engativá-Bogotá D.C.

OpenAIRE

Meléndez Álvarez, Nicolás

2014-01-01

El interés de este estudio de caso es analizar los procesos de reciclaje que lideran la Asociación Colombiana de Recicladores Independientes (ACOREIN) en la Unidad de Planeamiento Zonal (UPZ) 74- Engativá, relacionándolos con las perspectivas de ciudad sostenible. Por tal motivo en el primer apartado, se describe y analiza el concepto de sostenibilidad, desarrollo sostenible, y ciudad sostenible, la cual se encuentra ejemplificada. En el segundo capítulo se describe la labor de reciclaje gest...

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

ULCERA GASTRODUODENAL EM CÃES

Directory of Open Access Journals (Sweden)

Francisco Assis Uma Costa

1993-12-01

Full Text Available As ulcerações no sistema digestivo de cães são consideradas raras. São descritos dois casos de úlcera gastroduodenal em cães. O primeiro animal apresentou úlcera no duodeno próxima!. O segundo mostrou úlcera perfurada na região pilórica do estômago. Nenhum dos animais apresentou evidências de sangramento, mas as lesões eram profundas e arredondadas. Não houve evidência de patologias concorrentes.

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Paragonimiasis Humana Primera Descripción de un caso colombiano

Directory of Open Access Journals (Sweden)

Bernardo Buitrago

1981-09-01

Full Text Available Se describe el primer caso colombiano de Paragonimiasis humana, comprobado histopatológicamente, que afectó principalmente la base del pulmón derecho, comprometiendo por vecindad al hemidiafragma derecho y al hígado. La enfermedad del paciente fue, muy probablemente, adquirida en Mesetas, Meta y tuvo una evolución aproximada de 4 años; el paciente falleció durante el post-operatorio inmediato a la resección de las lesiones pleuro-pulmonares y hepáticas. La sintomatología fue la de una neumopatía crónica con tos hemoptoica y hemoptisis. A pesar de múltiples baciloscopías, iterativamente negativas para bacilo tuberculoso, al paciente se le diagnosticó y trató para Tuberculosis Pulmonar. En nuestro medio, la Paragonimiasis debe ser incluída dentro del diagnóstico diferencial de las neumopatías crónicas con tos hemoptoica y hemoptisis.

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

Directory of Open Access Journals (Sweden)

Héctor Armando Durán Peralta

2007-01-01

Full Text Available Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR, en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando la funcional de Lyapunov. Se trabaja con una cinética de primer orden pues un objetivo de este artículo es mostrar cómo se aplica la funcional de Lyapunov al análisis de un reactor de parámetros distribuidos, dado que es casi inexistente la literatura sobre el método de la funcional de Lyapunov aplicada a la estabilidad de reactores (técnica usada en el análisis de estabilidad de sistemas en ingeniería eléctrica. El análisis de estabilidad dio como resultado perfiles de temperatura y concentración asintóticamente estables para los casos PFTR isotérmico, no isotérmico con constante cinética independiente de la temperatura y PFTR no isotérmico adiabático. Para el PFTR con retiro de calor el análisis condujo a una región de estabilidad asintótica y a una región incierta donde puede o no haber oscilaciones.

Síndrome de carcinoma de células basales nevoides (Síndrome Gorlin: reporte de dos casos y revisión de la literatura

Directory of Open Access Journals (Sweden)

María del Carmen Castro-Mujica

Full Text Available RESUMEN El síndrome Gorlin (SG es una condición genética, con patrón de herencia autosómico dominante, con penetrancia completa y expresividad variable, debida a mutaciones germinales en los genes PTCH1 o SUFU, los cuales son componentes de la vía molecular Sonic hedgehog. El SG se caracteriza por la presencia de múltiples carcinomas de células basales nevoides, quistes odontogénicos, calcificación de la hoz del cerebro y lesiones en sacabocado en palmas y plantas. Este es el primer reporte de casos en el Perú sobre pacientes con SG, que cuentan con evaluación y asesoría genética. Presentamos dos casos de SG que cumplen criterios clínicos del síndrome y una revisión de la literatura.

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Complex Adaptive Systems of Systems (CASOS) engineering environment.

Energy Technology Data Exchange (ETDEWEB)

Detry, Richard Joseph; Linebarger, John Michael; Finley, Patrick D.; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Ames, Arlo Leroy

2012-02-01

Complex Adaptive Systems of Systems, or CASoS, are vastly complex physical-socio-technical systems which we must understand to design a secure future for the nation. The Phoenix initiative implements CASoS Engineering principles combining the bottom up Complex Systems and Complex Adaptive Systems view with the top down Systems Engineering and System-of-Systems view. CASoS Engineering theory and practice must be conducted together to develop a discipline that is grounded in reality, extends our understanding of how CASoS behave and allows us to better control the outcomes. The pull of applications (real world problems) is critical to this effort, as is the articulation of a CASoS Engineering Framework that grounds an engineering approach in the theory of complex adaptive systems of systems. Successful application of the CASoS Engineering Framework requires modeling, simulation and analysis (MS and A) capabilities and the cultivation of a CASoS Engineering Community of Practice through knowledge sharing and facilitation. The CASoS Engineering Environment, itself a complex adaptive system of systems, constitutes the two platforms that provide these capabilities.

Osteomalacia oncogénica: Presentación de dos casos

Directory of Open Access Journals (Sweden)

Fernando Jerkovich

2015-02-01

Full Text Available La osteomalacia oncogénica es una enfermedad rara. Existen descriptos alrededor de 337 casos. Es ocasionada por un tumor productor del factor de crecimiento fibroblástico 23 (FGF-23, hormona que disminuye la reabsorción tubular de fosfatos y altera la hidroxilación renal de la vitamina D, con hipofosfatemia, hiperfosfaturia y niveles bajos de calcitriol. Se presentan dos pacientes de 44 y 70 años, que consultaron por dolores óseos generalizados de aproximadamente un año de evolución en los que se hallaron alteraciones bioquímicas compatibles con osteomalacia hipofosfatémica. En el primer caso se realizó la resección de una tumoración en tejido celular subcutáneo del pie derecho, un año después del diagnóstico clínico. Luego de la exéresis, se disminuyó el aporte de fosfatos que recibía el paciente, pero reaparecieron los dolores al intentar suspenderlos. Ocho años más tarde, hubo recidiva local de la tumoración por lo que se efectuó resección completa. Después de la misma, se logró suspender el aporte de fosfatos. En el segundo caso, el paciente se estudió con tomografía por emisión de positrones con 18F-fluorodesoxiglucosa, hallando formación nodular hipermetabólica en partes blandas de antepie derecho, de 2.26 cm de diámetro. Luego de su escisión se pudo suspender el aporte de fosfatos. Ambos pacientes se encuentran asintomáticos con indicadores de metabolismo fosfocálcico normales. El diagnóstico anatomopatológico en ambos fue un tumor mesenquimático fosfatúrico, variante mixta del tejido conectivo, la entidad más frecuentemente asociada a la osteomalacia oncogénica.

Determinación de enfermedades parasitarias en población infantil de primer a cuarto grado de educación primaria en un ejido del sur de sonora

Directory of Open Access Journals (Sweden)

Gabriela de Los Ángeles Díaz Reyes

2014-06-01

Full Text Available La parasitosis intestinal constituye un problema de salud pública en México, siendo la población infantil la más afectada (9. En el estado de Sonora, se han realizado estudios que ubican la prevalencia de infecciones por microorganismos como Giardia lamblia, Endolimax nana y Entamoeba coli en 20, 10 y 19% respectivamente, con una situación de poliparasitismo en 18% de los casos (6. El hacinamiento, la escasez del agua potable y la carencia de drenaje, constituyen los mayores factores de riesgo para contraer este tipo de enfermedad (1. Como parte de un proyecto de Servicio Social de la Carrera de Químico Biólogo de la Universidad de Sonora, Unidad Regional Sur, se realizó un muestreo coproparasitoscópico en 52 niños de entre Primer y Cuarto grado de educación Primaria, en una población ejidal del sur del estado, con el fin de detectar casos positivos y canalizarlos para su atención. Se registraron 40 casos positivos para parasitosis, representando un 76.9% de la muestra, los principales microorganismos detectados durante el estudio fueron G. lamblia, E. histolityca, E. coli y E. nana, encontrándolos de manera aislada o en algunas muestras en asociaciones multiparasitarias.

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Hepatitis inmune temprana en el curso del síndrome de Sjögren en pediatría

OpenAIRE

Baar Z., Alejandro; Harris D., Paul; Talesnik G., Eduardo; Duarte G. de C., Ignacio

1999-01-01

La hepatitis inmune corresponde a una enfermedad necroinflamatoria del hígado, de causa desconocida, asociada a la presencia de autoanticuerpos circulantes. Puede presentarse aisladamente, o en asociación a otras enfermedades autoinmunes. Entre estas, destaca el síndrome de Sjögren, que compromete preferentemente a las glándulas salivales, aunque puede afectar a cualquier segmento del tubo digestivo, especialmente el hígado. Reportamos el caso de una niña de 12 años de edad, portadora de Sínd...

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Reintegro y permanencia universitaria en Bogotá : el caso de la Facultad de Ingeniería de la Universidad Distrital, 2000-2009

OpenAIRE

Díaz Franco, María Camila

2012-01-01

El presente trabajo de investigación, estudia a través del caso de la cohorte del 2000 de la Facultad de Ingeniería de la Universidad Distrital, el tipo de coyuntura que le permitió a este grupo de jóvenes reingresar a la Universidad y culminar la carrera al haber tenido que abandonarla en un primer momento, por problemas socio-económicos y/o académicos. Por medio del estudio del reintegro universitario, este trabajo se enmarca en el campo, poco explorado, de la existencia y efectividad de m...

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

El outsourcing de sistemas de información de recursos humanos en España: el caso de Roche Diagnostics

OpenAIRE

Claver Cortés, Enrique; González Ramírez, María Reyes; Gascó Gascó, José Luis

1999-01-01

No existen muchos estudios españoles acerca del outsourcing de Sistemas de Información; Norteamérica y Reino Unido son los países dónde más ha proliferado la investigación en este ámbito. Proponemos el uso del método del caso para analizar el outsourcing de Sistemas de Información en nuestro país por dos motivos fundamentalmente: en primer lugar, porque muchos estudios sobre outsourcing han usado este mismo método; en segundo, ya que esta metodología es adecuada cuando el área que va a ser in...

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Primer aislamiento en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina

Directory of Open Access Journals (Sweden)

Laura Errecalde

Full Text Available Describimos el primer caso en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina. Caso clínico: Paciente masculino, con antecedente de insuficiencia renal crónica en hemodiálisis y osteosíntesis de cadera debido a una fractura. Se internó por síndrome febril persistente luego del desplazamiento de la prótesis por un traumatismo. Se aisló de hemocultivos S. aureus resistente a la meticilina adquirido en la comunidad. Durante el tratamiento con vancomicina y daptomicina, se observó un aumento gradual de la CIM de vancomicina de 1 µg/ml (VSSA a 2 µg/ml (h-VISA y a 4 µg/ml (VISA, y la emergencia de no sensibilidad a daptomicina (CIM = 4 µg/ml. Al suspender la vancomicina y la daptomicina, la cepa revirtió al fenotipo de sensibilidad a ambas drogas. Es mandatorio evaluar por CIM la sensibilidad a vancomicina y a daptomicina intratratamiento cuando estas drogas se usan como terapia.

Actuación de un servicio de prevención de riesgos laborales para la atención a casos sospechosos de enfermedad respiratoria por coronavirus (MERS-CoV: A propósito de un caso

Directory of Open Access Journals (Sweden)

María Ascensión Maestre Naranjo

Full Text Available Resumen Tras el primer caso importado en España de infección humana por el coronavirus (MERS-CoV, ingresado en el Hospital Universitario Puerta de Hierro Majadahonda (HUPHM, se procede a la elaboración de un procedimiento de actuación para la atención a casos sospechosos de enfermedad respiratoria de alerta internacional. Este procedimiento se activa en el momento en el que se establece la sospecha de esta enfermedad en el hospital. Se describen las medidas de actuación ante el ingreso de un paciente con estas características, garantizando la calidad asistencial así como la protección de la salud de los trabajadores. Desde el Servicio de Prevención de Riesgos Laborales (SPPRL se procede al registro de los trabajadores implicados, se realiza el estudio de contactos y el seguimiento de los mismos, facilitándose la información y formación a los trabajadores sobre los riesgos ante el nuevo agente causal y la utilización de los equipos de protección adecuados, y la valoración de los trabajadores especialmente sensibles, explicando la activación y puesta en marcha del protocolo en las distintas situaciones en que ha sido necesario.

ULTRASONIDO ENDOSCÓPICO EN PATOLOGÍAS DEL PÁNCREAS

Directory of Open Access Journals (Sweden)

LÁZARO ANTONIO ARANGO M., DR.

2015-09-01

En este artículo se revisarán algunos casos de enfermedades evaluadas con este método, que muestran por qué el EUS, es una herramienta clave para el médico de urgencias y de consulta externa, el internista, el cirujano, el médico del servicio hospitalario y el personal de salud en general, al momento de definir, clasificar y orientar el manejo de determinadas patologías en el tubo digestivo. El EUS es una importante ayuda y no debe ser extraña al personal médico, debe tenerla presente junto a las demás pruebas diagnósticas en patología pancreática. Se señalarán los aspectos más relevantes en cada caso y las indicaciones del EUS.

Neuroblastomicose: registro de três casos

Directory of Open Access Journals (Sweden)

Ehrenfried O. Wittig

1968-03-01

Full Text Available São relatados três casos de neuroblastomicose de sintomatologia variada (urna forma tumoral cerebelar, urna forma abscedante troncular e cerebral e urna forma granulomatosa difusa. No caso da forma tumoral cerebelar havia associação com cisticercose cerebral. Alterações medulares não foram evidenciadas no único caso em que foi possível examinar êste setor do sistema nervoso central (caso 2.

Brain MRI lesions in neuromyelitis optica: clinical case; Lesiones cerebrales de resonancia magnetica en neuromielitis optica: caso clinico

Energy Technology Data Exchange (ETDEWEB)

Rosales Bravo, Luis Guillermo; Heyden Cordero, Marvin; Chinchilla Weinstok, Dennis; Mendelewicz Goldwaig, Isaias, E-mail: neurologia.cima@gmail.com [Caja Costarricense del Seguro Social, Hospital Mexico, Div. de Neurologia, San Jose (Costa Rica)

2011-10-15

Many cases of patients with neuromyelitis optica have submitted without demyelinating lesions in the cerebral white matter, it has documented that this entity can cause from the onset of illness or through its natural evolution. Diagnostic methods currently as Magnetic Resonance Imaging (MRI) and specific antibodies in plasma (such as antiaquaporin-4) have been diagnosed of neuromyelitis optica cases that were initially confused with multiple sclerosis. Disease in Costa Rica has been little prevalent and is not exactly known what the prevalence and incidence. The degree of disorder is illustrated through a case study, both in the cerebral white matter as spinal cord, in a patient with neuromyelitis optica during a follow-up period of 4 years. This is the first case that has been reported in the scientific literature of Costa Rica. (author) [Spanish] Muchos casos de pacientes con neuromielitis optica se han presentado sin lesiones desmielinizantes en la sustancia blanca cerebral, se ha documentado que esta entidad puede causarlas desde el inicio de la enfermedad o a traves de su evolucion natural. Los metodos de diagnostico en la actualidad como la Imagen por Resonancia Magnetica (IRM) y la determinacion de anticuerpos especificos en plasma (como la antiaquaporina-4) han logrado diagnosticar algunos casos de neuromielitis optica que inicialmente fueron confundidos con esclerosis multiple. La enfermedad en Costa Rica ha sido poco prevalente y no se ha conocido con exactitud cual es la prevalencia e incidencia. El grado de afeccion ha sido ilustrado a traves de un caso clinico, tanto en la sustancia blanca cerebral como espinal, en un paciente con neuromielitis optica durante un periodo de seguimiento de 4 anos. Este es el primer caso que ha sido reportado en la literatura cientifica de Costa Rica. (autor)

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Servicio civil en Chile, análisis de los directivos de primer nivel jerárquico (2003-13

Directory of Open Access Journals (Sweden)

Bastián González-Bustamante

2016-02-01

Full Text Available Resumen Este artículo analiza los principales factores que condicionan la selección de un directivo público de primer nivel jerárquico en Chile con base en una perspectiva de corte sociológico y el uso del concepto especies de capital. El trabajo realiza un recorrido teórico y descriptivo sobre la modernización del Estado y la profesionalización de la gestión pública en Chile. Posteriormente con una muestra de 45 casos correspondientes a altos directivos nombrados durante el período 2003-13, se trabaja con modelos de regresión logística para determinar los factores que condicionan la selección de estos funcionarios. Se llega a la conclusión que el capital político no es un factor que favorece la selección del actor.

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

GENERACIÓN DE CASOS DE PRUEBA A PARTIR DE CASOS DE USO EN LAS PRUEBAS DE SOFTWARE

Directory of Open Access Journals (Sweden)

Orelvis Vázquez Ruiz

2006-04-01

Full Text Available

Los casos de uso son utilizados para expresar la funcionalidad requerida en un sistema. Los casos de prueba derivados directamente de casos de uso aprovechan la ventaja que constituye contar con la especificación existente de estos últimos, para garantizar un basamento sólido para las pruebas a realizar sobre el sistema. La capacidad para crear casos de prueba a partir de los casos de uso, y hacer la traza de unos a otros, es una habilidad vital para asegurar un producto de calidad.

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

Directory of Open Access Journals (Sweden)

José Cardona Á.

2011-12-01

Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Fibroma, consecuencia del trauma crónico: Reporte de casos clínicos

OpenAIRE

Pereyra, L.; Gorosito, C.; Vera, Y.

2017-01-01

La cavidad oral, siendo la porción facial del tuvo digestivo, es un entidad absolutamente dinámica en la cual se ven involucradas distintas estructuras como lo son; un gran sistema muscular, piezas dentarias, el maxilar superior y el maxilar inferior con la característica que lo diferencia del resto por ser el único hueso móvil de la cara. De esta forma, la boca está involucrada en distintas funciones vitales para la supervivencia del ser humano, como la masticación y la fonación. La falta de...

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Flora bacteriana aeróbica del tracto digestivo del vampiro común, Desmodus rotundus (Chiroptera: Phyllostomidae

Directory of Open Access Journals (Sweden)

Gloriana Chaverri

2006-09-01

Full Text Available El objetivo de esta investigación fue determinar la flora bacteriana del vampiro común (Desmodus rotundus primordialmente debido a que los datos al respecto están desactualizados, y además por la gran importancia económica de esta especie de murciélago. Veintiún murciélagos fueron recolectados y su flora bacteriana identificada separadamente a nivel de estómago e intestino. Las bacterias fueron identificadas con el Analytical Profile Index (API, y los resultados analizados con el paquete APILAB. Un total de treinta especies fueron aisladas en 16 hembras y cinco machos. Las especies más comunes fueron Escherichia coli y Staphylococcus aureus, aunque otras especies, como Acinetobacter johnsonii, Enterobacter sakazakii, Staphylococcus chromogenes, S. hyicus y S. xylosus también se aislaron con frecuencia. El número de especies identificadas en el estómago y el intestino fue significativamente diferente, siendo el intestino más diverso. Esto ha sido encontrado anteriormente en otros mamíferos, y se atribuye probablemente a la reducción en acidez. Asimismo, la mayoría de las especies identificadas en este estudio forman parte de la flora bacteriana normal del tracto digestivo de mamíferos, aunque también se encontraron otras bacterias comunes en la piel de mamíferos y en ambientes acuáticos Las bacterias de la piel podrían estar colonizando el estómago y/o intestino del vampiro cuando éste tiene contacto con sus presas, lo que sugiere que el hábito alimentario de esta especie facilita su colonización por microorganismos que no se encontrarían comúnmente en su tracto digestivo. Ya que también se identificaron bacterias comunes en ambientes acuáticos, es probable que D. rotundus consuma agua cuando esté disponible, lo que respalda los resultados de otros investigadores, y sugiere que esta podría ser una fuente adicional de invasión microbiana.Aerobic bacterial flora from the digestive tract of the common vampire bat

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Análisis de los efectos de intervenciones públicas en la recuperación de centros urbanos : caso de estudio barrio las Cruces, Bogotá 2002-2014

OpenAIRE

Rosillo Herrera, María Daniela

2015-01-01

En el presente estudio de caso se hace un análisis de los principales efectos socio-espaciales y económicos que tuvieron intervenciones públicas dirigidas a recuperar el centro de Bogotá, en el territorio específico del Barrio Las Cruces, durante los años 2002-2014. Para lograrlo, en un primer momento se hace un análisis conceptual de las relaciones existentes entre intervenciones urbanas y los efectos que estas producen en lo urbano y lo local; en un segundo se identifican los antecedentes q...

¿Qué explica la evolución del rendimiento académico universitario? Un estudio de caso en la Universidad del Pacífico

OpenAIRE

Arlette Beltrán; Karlos La Serna

2009-01-01

"Utilizando un modelo de “panel data” para el caso de los alumnos de la Universidad del Pacífico que ingresaron en el año 2006, el presente trabajo busca determinar si el rendimiento escolar y las características académicas del colegio de procedencia explican el desempeño en la universidad, más allá del primer año de estudios universitarios. Además, se identifican otros factores dan cuenta de dicho desempeño. Los resultados indican que el rendimiento académico en el colegio es uno de los prin...

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

EEES, COMPETENCIAS Y APRENDIZAJE DEL DERECHO ROMANO MEDIANTE EL MÉTODO DEL CASO (I: EL DOBLE MATRIMONIO

Directory of Open Access Journals (Sweden)

Elisa Muñoz Catalan

2013-01-01

Full Text Available Con la realización del presente trabajo pretendemos investigar sobre la importancia actual de aplicar el método del caso en la enseñanza del Derecho Romano, frente a las tradicionales clases teóricas y magistrales. Reparando, muy especialmente, en el alcance de las exigencias metodológicas surgidas con los nuevos planes del estudio Grado en Derecho en el marco del EEES; así como en el desarrollo de una serie de competencias generales y específicas en los estudiantes, que les van a ser muy útiles una vez que finalicen el Grado y se enfrenten a las dificultades del mercado actual, ya que se consideran como los verdaderos protagonistas del proceso de enseñanza-aprendizaje. Por tanto, con la puesta en práctica de este primer caso sobre doble matrimonio romano, ausencia de testamento y herederos legítimos, intentamos acercar al alumnado al casuismo jurisprudencial romano; de este modo, comprenderán que lo importante no es dar la solución al supuesto planteado, sino razonar jurídicamente consiguiendo, a través de debates en grupos, un conocimiento más profundo de las reglas e instituciones aplicables.

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Dermatomiositis: a propósito de 3 casos interesantes

Directory of Open Access Journals (Sweden)

Zianna Almanza Liranza

2010-12-01

Full Text Available Se presentan los casos de 3 pacientes atendidos en el Hospital Pediátrico «Juan Manuel Márquez», 2 de las cuales presentaron como primeras manifestaciones debilidad en los miembros inferiores y artritis que dificultaba la marcha de forma progresiva. El tercer paciente presentaba lesiones escamosas en la piel, hipopigmentadas en la cara y los miembros, acompañadas de astenia y artritis de las rodillas. Se realizaron estudios para concluir el diagnóstico, incluida la biopsia de músculo. Se aplicaron los criterios para confirmar el diagnóstico de dermatomiositis y se excluyeron otras enfermedades según el cuadro clínico y los exámenes complementarios realizados. A los 2 primeros pacientes se les indicó tratamiento inmunomodulador con prednisona y metotrexato, y al tercer paciente se le indicó prednisona y azathioprina. Se observó una buena respuesta al tratamiento y control de la enfermedad. El primer paciente falleció a los 4 meses de tratamiento a causa de complicaciones (vasculitis intestinal y sepsis asociada al tratamiento quirúrgico. Los restantes pacientes se siguen actualmente por consulta.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Herramientas para la investigación en Tecnologías de la Información y la Comunicación. Casos de estudio

Directory of Open Access Journals (Sweden)

Julio Ruiz Palmero

2011-01-01

Full Text Available En este artículo se pretende mostrar las posibilidades de algunas herramientas de recogida de información para el estudio cualitativo y cuantitativo en casos concretos de investigación y evaluación del impacto de las TIC en la enseñanza. Se mostrarán las técnicas seguidas en diferentes casos así como su metodología seguida. Los casos de estudio se corresponden con investigaciones desarrolladas dentro del Grupo de Investigación de Nuevas Tecnologías (Gtea de la Universidad de Málaga. En primer lugar abordaremos dos investigaciones sobre la evaluación de e-portafolios y análisis de diarios del Practicum desarrolladas durante 5 cursos académicos, en tercer lugar nos centraremos en la investigación que se está llevando a cabo dentro del Proyecto Estudio comparativo sobre la utilización y opinión del alumnado universitario sobre las TIC contrastando competencias requeridas como futuros profesionales (Ref. A/023024/09, financiado por la Agencia Española de Cooperación Internacional y en el que participan universidades de 5 países (España, México, Argentina, Perú y Chile y que se encuentra en su última fase de desarrollo.

La adaptación de la responsabilidad social empresarial de empresas multinacionales en México: Caso General Motors México

Directory of Open Access Journals (Sweden)

Rosalía Guadalupe Castillo-Villar

2015-12-01

Full Text Available Como consecuencia de la globalización, la discusión alrededor de las acciones de la responsabilidad social empresarial (RSE de empresas multinacionales ha aumentado en los últimos años. El objetivo de este trabajo es contribuir a la discusión sobre la adaptación o no de estos programas, de tal forma que se adapten a las expectativas y necesidades de la sociedad huésped. En este caso se aporta al estudio en México. Para esto se contribuye en primer lugar un breve marco conceptual de los conceptos independientes, para proceder a la argumentación a favor de esta interacción en particular y por último, se trata un breve ejemplo de esta interacción a través de un caso de estudio de la empresa General Motors que refleja claramente la adaptación de programas de RSE al mismo tiempo que sigue guías corporativas mundiales. En este trabajo se utiliza el análisis de los reportes anuales oficiales de responsabilidad social que publica la compañía como base para el análisis

Neurosindrome minimo en la tripanosomiasis cruzi crónica: (Estudio de dos casos de encefalopatia chagástica crónica

Directory of Open Access Journals (Sweden)

Miguel Eduardo Jörg

1967-01-01

Full Text Available Se presenta el estudio clínico, y anatomopatológico parcial, de dos enfermos con encefalopatía crónica por Trypanosoma cruzi, cuyo síntoma inicial aislado fue la cefalea, a la cual se agregaron progresivamente otros síntomas de enfermedad del sistema nervioso central, llegando tras años a configurarse un cuadro de enfermedad cerebral definida, en el primer caso con sintomatologia cerebral difusa y compromiso de la actividad psíquica, en el segundo caso con síndrome seudotumoral. En ambos casos coexistían signos de cardiopatía, pero sin el conjunto de elementos semiológicos prevalentes en la cardiopatía chagásica. El estudio anatomopatológico del cerebro (el primer caso muere por accidente, el segundo en coma encefalopática, posiblemente agravado por hipermedicación mostró en ambos casos una meningo-córtico encefalitis multimicrofocal, de predomínio superficial, con caracter nodular en torno a vasos sanguíneos alterados (vasculitis primária?. A la encefalitis inflamatoria se agregan en el 2º caso lesiones trombóticas arteriolares (microembolia de trombos murales provenientes de la cardiopatía?. Se hallaron igualmente, areas irregulares de desmielinización, neuronolisis y satelitosis. En el caso 2 se encontraron leishmanioides de T. cruzi en reducido número, en focos de lesión inflamatoria necrotizante típica. Como el síntoma inicial y aislado fuera la cefalea en ambos enfermos, se considera haber confirmado y ampliado las observaciones clínicas de uno de los autores, quien señala a la cefalea (en asociación a reacciones suerológicas positivas como neurosíndrome mínimo en la tripanosomiasis cruzi crónica. Se analisan los posibles mecanismos patogénicos, se exponen los síntomas concomitantes y la evolución de la encefalopatía crónica por T. cruzi, considerando los casos estudiados a la luz de los conocimientos previos sobre las formas neurales de la tripanosomiasis cruzi.The clinical and

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Territorio, desarrollo tecnológico y gestión de recursos naturales renovables: El caso de la pesca

Directory of Open Access Journals (Sweden)

Ignacio Carciofi

2012-01-01

Full Text Available La gestión eficiente de ciertos recursos renovables caracterizados por la propiedad común y el libre acceso ha estado mediatizada por la denominada «Tragedia de los Comunes». La literatura pionera en este campo enfatizaba la necesidad de un marco regulatorio que superara esta tendencia hacia la sobreexplotación y agotamiento del recurso. Elinor Ostrom, sin embargo, en un trabajo seminal, se apartaba de esta línea y reivindicaba, paradójicamente, soluciones basadas en la propiedad y gestión comunal, que parecían estar en el origen del problema. El presente trabajo tiene, en este sentido, un doble objetivo. En primer lugar, realizar una revisión de la literatura económica sobre la explotación de recursos naturales en los espacios comunales y de libre acceso, con especial referencia al caso de la pesca. En segundo, y trascendiendo lo anterior, llamar la atención sobre el hecho de que la solución de Ostrom, que devuelve a la gestión del recurso su componente territorial y local, queda en el caso de la pesca fuertemente comprometida por un progreso tecnológico que está acabando con las pesquerías locales.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Analysis of digestive tract content of the larvae of Polybia scutellaris (White (Hymenoptera, Vespidae Análise do conteúdo do trato digestivo das larvas de Polybia scutellaris (White (Hymenoptera, Vespidae

Directory of Open Access Journals (Sweden)

Victoria Lilian Fernández Corujo

2011-06-01

Full Text Available Polybia scutellaris (White, 1841 is a social wasp of biological interest for its role as pollinator and maybe as biological control agent of sanitary and agricultural pests. This study examines the digestive tract contents of the larvae of P. scutellaris from four nests in Magdalena (Buenos Aires province, Argentina. Contents included both animal (arthropod parts and plant (pollen, leaf and fruit epidermis parts. The pollen content analysis showed that the wasps visited 19 different taxa of plants during the last active period of the colony before the nests had been collected. The range of sources used by P. scutellaris allows us characterizing the species as a generalist flower visitor. Wasps visited both native and exotic plants located nearby the nest. Most of the epidermal plant remains found in the larval digestive tract belonged to Malvaceae, a family not exploited by the studied colonies as pollen source.Polybia scutellaris (White, 1841 é uma vespa social de interesse biológico devido ao seu papel como polinizador e possível agente de controle biológico de pragas sanitárias e agrícolas. O presente estudo analisou o conteúdo do trato digestivo de larvas de P. scutellaris de quatros ninhos em Magdalena (província de Buenos Aires, Argentina. O conteúdo inclui restos animais (partes de artrópodos e vegetais (pólen, epiderme de folhas e frutos. A análise do conteúdo polínico mostrou que as vespas visitaram 19 táxons durante o último período ativo da colônia antes dos ninhos serem coletados. A diversidade de recursos utilizados por P. scutellaris permite caracterizá-la como um visitante generalista de flores. As vespas visitaram plantas nativas e exóticas localizados nas proximidades do ninho. A maioria dos restos de epiderme encontradas no trato digestivo das larvas pertence às Malvaceae, uma família não explorada pelas colônias estudadas como fonte de pólen.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Opciones reales, valuación financiera de proyectos y estrategias de negocios. Aplicaciones al caso mexicano

Directory of Open Access Journals (Sweden)

Francisco Venegas Martínez

2006-01-01

Full Text Available En este trabajo la metodología de opciones reales se presenta como un instrumento indispensable para que los consejos de administración de las empresas tomen decisiones respecto a proyectos de inversión o estrategias de negocios cuando existe la flexibilidad (opcionalidad de tomar en el futuro nuevas decisiones relacionadas con extender, contraer, posponer, enmendar o abandonar un proyecto o estrategia. Al respecto, el presente trabajo realiza una revisión de las diferentes fórmulas analíticas que aparecen en la bibliografía para valuar la opcionalidad de estrategias en el supuesto de que el valor presente de los flujos de efectivo esperados sigue una distribución log normal o bien mediante el uso de métodos de árboles binomiales. En particular, se trata el caso de la toma de decisiones de venta o cierre de una empresa cuando el valor de mercado de sus títulos (de capital y deuda excede el valor presente de los flujos de efectivo esperados o el valor presente de estos flujos es menor que cierto valor de recuperación. En este contexto se analiza el caso de una empresa mexicana de servicios satelitales de comunicación. Asimismo, se aplica la metodología de opciones reales a proyectos carreteros de inversión; específicamente se examina el caso del proyecto de construcción del primer tramo de la autopista Toluca-Atlacomulco según los supuestos de volatilidad constante y estocástica. Es también importante destacar que esta investigación se centra en: i la valuación de opciones reales americanas de abandono; ii valuación de opciones reales compuestas; iii valuación de opciones reales con volatilidad extendiendo el modelo de Hull y White (1987.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Filosofia naturale della causalità e del caso

CERN Document Server

Born, Max

1962-01-01

Introduzione ; causalità e determinismo ; esemplificazione : l'astronomia e la meccanica delle particelle ; contiguità ; principio di antecedenza e termodinamica ; caso ; caso e antecedenza ; materia ; caso ; conclusioni metafisiche.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Caracterización de la fibrosis quística en el primer año de vida

Directory of Open Access Journals (Sweden)

Gladys Fuentes Fernández

Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.

Crisis de las hegemonías en América latina: los casos de Bolivia y Chile

Directory of Open Access Journals (Sweden)

Luis Albero Vivero Arriagada

2014-01-01

Full Text Available El objetivo de este trabajo es comprender y distinguir cómo se manifiesta, la ruptura o crisis de la hegemonía de las clases dominantes, cómo se presentan los procesos y posibilidades de reconfiguración de las clases sociales y las correlaciones de las fuerzas políticas entre las élites dominantes y los sectores excluidos. Se toma como referencia los casos de Bolivia y Chile en el período comprendido entre los años 2006 y 2012 ya que permite tener como referencia los triunfos electorales de Evo Morales en Bolivia y en el caso de Chile el primer gobierno de Michelle Bachelet y el triunfo de Sebastián Piñera. Desde una perspectiva hermenéutica crítica se realiza una revisión y análisis interpretativo de las obras de Antonio Gramsci y de otros referentes del pensamiento crítico latinoamericano que nos aporta un marco teórico que ilumina el análisis interpretativo. Se concluye que los conflictos y las contradicciones presentes en estos países dan cuenta de la posibilidad de construcción de nuevas relaciones sociales y políticas a partir de las luchas contra hegemónicas que han venido protagonizando las clases excluidas.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

CASO AlbAm S.A.

Directory of Open Access Journals (Sweden)

Ricardo Goulart Serra

2015-12-01

Full Text Available RESUMO Os analistas financeiros da AlbAm, uma empresa do setor de autopeças, devem avaliar duas opções de aquisições (Cardblue e Garciadores. O objetivo do caso é servir de oportunidade para os alunos vivenciarem uma decisão de investimentos por meio do lucro econômico. Uma análise superficial certamente levará a decisão equivocada. Levando-se todos os aspectos do caso em consideração, chegar-se-á a uma solução que pode surpreender alguns alunos, uma vez que a empresa melhor gerida não será a melhor oportunidade de investimento. Também se pode aproveitar o caso para discutir a superficialidade da adoção do EBITDA como métrica de gestão comparativamente a uma métrica de valor agregado (lucro econômico - a melhor solução também não é aquela que gera o maior aumento em EBITDA. O caso pode ser usado em disciplinas de finanças (finanças corporativas ou avaliação de empresas em cursos de graduação, pós-graduação ou especialização. Todas as empresas e pessoas relatadas neste caso são fictícias.

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Porfirias poco frecuentes: Casos detectados en la población argentina Non frequent porphyrias in the argentinean population

Directory of Open Access Journals (Sweden)

V A Melito

2006-12-01

Full Text Available Las porfirias son consecuencia de fallas en el metabolismo del hemo. Se clasifican según el tipo de sintomatología clínica prevalente o el órgano donde se expresa preferencialmente la falla metabólica. En general la deficiencia enzimática está asociada a mutaciones en los genes que codifican para cada una de las enzimas. Están descritos 7 tipos de porfiria diferentes. Se transmiten por carácter autosómico dominante a excepción de la PCE, la PHE y la NPA que son recesivas. Sin embargo, están reportadas variantes homocigotas para el resto de las porfirias de pronóstico y evolución mucho más grave que la forma heterocigota. La descripción de estos casos poco frecuentes, sus tratamientos y evolución, facilitarían tanto el diagnóstico diferencial de la porfiria como el conocimiento de las posibilidades terapéuticas en cada caso. Asimismo para las porfirias heterocigotas con manifestación infantil, su identificación temprana y tratamiento aseguraría una mejor evolución minimizando los riesgos asociados. Se han diagnosticado 5 casos de porfirias agudas en niñas: 2 de PAI, 2 de PV y 1 de CPH. Entre las porfirias cutáneas se presentan 25 casos de PCT infantil, el primer caso de PHE en Argentina, 4 casos de PCE infantil y 1 en un adulto y 2 casos de PPE con compromiso hepatobiliar.The Porphyrias are a group of diseases resulting from partial deficiencies in one of the heme biosynthetic enzymes. These disorders can be classified on the basis of their clinical manifestations or according the organ where the metabolic deficiency is mainly expressed. In general this enzyme deficiency is associated with mutations in the genes which codify each enzyme. There are 7 types of Porphyrias. They are autosomal dominant disorders with the exception of PCE, PHE and NPA which are recessive. However, some rare and severe cases with recessive inheritance have also been reported. The description of these infrequent cases and their treatments and

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

Coccidiosis en pollos de engorde. Reporte de caso, Tunja, Boyacá

Directory of Open Access Journals (Sweden)

Sandra Rodriguez

2008-10-01

Full Text Available En el Laboratorio de Microbiología de la Facultadde Ciencias Agrarias de la Fundación UniversitariaJuan de Castellanos, se recibieron para necropsiados pollos machos de la estirpe Ross, de 4 semanasde edad; con reporte de diarrea sanguinolenta, bajacon versión alimenticia, poca ganancia de peso y altamortalidad en el lote. En los hallazgos se evidenciaron lesiones a lo largo del tubo digestivo, principalmenteen los ciegos, los cuales mostraron aumento de tamaño,con abundancia de sangre en la luz del órgano,mucosa hemorrágica, congestionada y aspecto aterciopelado con presencia de coágulos. Luego de la evaluación se diagnosticó una infestación por Eimeriadel género Tenella.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Morfologia de órgãos digestivos e não digestivos de suínos de linhagens modernas durante as fases de crescimento, terminação e pós-terminação - DOI: 10.4025/actascianimsci.v29i3.553 Morphology of digestive and non-digestive organs of pigs from modern lineages during growth, finishing and post-finishing phases - DOI: 10.4025/actascianimsci.v29i3.553

Directory of Open Access Journals (Sweden)

Mariane de Paula Ishi

2007-12-01

Full Text Available O melhoramento genético de suínos levou ao surgimento de diversas linhagens suínas que apresentam elevada capacidade de desenvolvimento de massa muscular. Entretanto, pouco se sabe cientificamente sobre a morfologia de órgãos destes animais, conhecimento que ajuda a elucidar características relacionadas ao desempenho zootécnico como ganho de peso e conversão alimentar em carne magra. Objetivou-se, assim, comparar a morfologia dos órgãos digestivos e não-digestivos de suínos de linhagens modernas ao final das fases de Crescimentos I e II, Terminação e Pós-terminação. O peso dos órgãos em relação ao peso vivo diminuiu significativamente (p The genetic market makes use of various modern swine genotypes that present high capacity for muscular mass development. These genetic lines have been used in swine production without existing scientific information about morphology, knowledge that can elucidate factors related to growth performance, such as weight gain and food conversion in lean meat yield. The aim of this experiment was to compare the morphology of digestive and non-digestive organs of modern genotypes. At the end of the phases: Growing I, Growing II, Finishing and Post-finishing, the pigs were slaughtered and the organs were weighed. The weight of the organs decreased (p < 0.01 with body development, in agreement with the biological growth of the animals. The morphology of the digestive organs were different (p < 0.06 among lineages, which showed that differences can exist, mainly regarding digestive capacity and, possibly, food intake and efficiency. The length of the small intestine was different (p < 0.06 among lines, which can be an indicative of increased body development due to an extended food exposition area to intestinal cells. The scientific knowledge of swine lines morphology is important because this information can contribute to animal growth performance.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Disección traumática de la arteria carótida interna y embolismo cerebral en un jugador de fútbol: Reporte del primer caso

Directory of Open Access Journals (Sweden)

Luisa S. Talledo Paredes

2012-03-01

Full Text Available Reportamos el caso de un varón de 18 años quien sufrió contusión cervical por impacto con balón de fútbol. Tres días después fue hospitalizado con hemiplejia derecha directa y afasia de expresión. La resonancia magnética cerebral mostró lesión isquémica izquierda en ganglios basales. El doppler carotideo evidenció trombo desde el origen de la arteria carótida común izquierda extendida a la arteria carótida interna izquierda (CII y la angiotomografía documentó disección de CII (lesión traumática carotídea tipo IV. Se optó por anticoagulación con warfarina y fisioterapia de rehabilitación; con evolución favorable. La incidencia de la injuria traumática carotídea es muy rara, más aún en futbolistas; el tratamiento es aún controversial, por lo que consideramos de interés el reporte de este caso.

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Consecuencias de la legislación en el consumo alimentario de lagartos. El caso del fardacho

Directory of Open Access Journals (Sweden)

Cantarero, Luis

2001-12-01

Full Text Available The fardacho is a variety of lizard that people in the area of Peñalba (province of Huesca, Spain used to hunt and eat. The author describes the food culture to which the eating of fardacho belonged and the reasons that caused a decrease in the number of these animals in the area. In addition, the author discusses the effects of wildlife-protecting legislation on the eating of this lizard in Peñalba.

En este artículo se analiza el caso del fardacho, una variedad de lagarto que se cazaba y consumía en la zona de Peñalba (Huesca. En primer lugar, se describe la cultura alimentaria del fardacho y las razones que motivaron un descenso en el número de ejemplares de este animal. En segundo lugar, se analizan las consecuencias de la legislación sobre especies protegidas en el consumo de fardachos en Peñalba.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Cuando la comunidad entra en la escuela: un estudio de casos sobre los grupos interactivos, valorados por sus protagonistas

Directory of Open Access Journals (Sweden)

Carmen Álvarez Álvarez

2014-01-01

Full Text Available El artículo analiza el efecto de los grupos interactivos en los procesos de enseñanza y aprendizaje de alumnos y alumnas de educación primaria, analizados a través del grado de satisfacción de las personas implicadas en esta forma de trabajo. Se trata de una de las prácticas de organización del aula más destacadas en los centros educativos que se transforman en Comunidades de Aprendizaje. El artículo sintetiza un estudio de casos llevado a cabo en una escuela española de un entorno urbano, dando voz a los protagonistas de los grupos interactivos: alumnado, profesorado y voluntariado, que incluye las familias que participan en dichos grupos. Se utilizó una encuesta para los estudiantes de tercer ciclo y una entrevista grupal en el caso de los de primer ciclo. Con dichos procedimientos se recogieron las valoraciones realizadas por 148 estudiantes, 24 voluntarios/as y 6 profesores/as. Los resultados permiten constatar que los grupos interactivos constituyen una práctica muy bien acogida por toda la comunidad educativa. Además promueven tanto el éxito escolar como el desarrollo de valores que van más allá de lo instrumental, al implicar directamente a la comunidad en la actividad docente. Todo ello se somete a discusión.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Dengue neonatal en el Perú: Reporte de un caso Neonatal dengue in Peru: a case report

Directory of Open Access Journals (Sweden)

Hermann Silva Delgado

2011-03-01

Full Text Available Se presenta el caso de un neonato de sexo femenino, a término, producto de madre fallecida al séptimo día de su puerperio, por falla multiorgánica debido a dengue grave confirmado por detección de antígeno NS1 e IgM. La recién nacida (RN no tuvo complicaciones, pero a partir del cuarto día de vida desarrolló fiebre, ictericia, manifestaciones de extravasación de plasma, hepatomegalia, ascitis, plaquetopenia y otros signos de síndrome de respuesta inflamatoria sistémica. Su evolución final fue favorable con tratamiento instaurado. Se demuestra con PCR en tiempo real, la presencia del virus dengue serotipo 2 en sangre de la RN, confirmándose el primer caso de dengue neonatal reportado en el Perú.We present the case of a full-term female newborn, whose mother died seven days postpartum from multi-organ failure due to severe dengue confirmed by NS1 antigen detection and positive IgM. The newborn did not have any complication, but at the fourth day of life she developed fever, jaundice, signs of plasma leakage, thrombocytopenia, hepatomegaly, ascitis, and others signs of systemic inflammation response syndrome. She fully recovered with supportive treatment. The RT-PCR test of a peripheral blood sample revealed a positive result for the dengue virus serotype 2, confirming the first case of neonatal dengue reported in Peru.

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

Tratamiento mediante dilatación con balón de un paciente con estenosis subaórtica por membrana: a propósito de un caso

Directory of Open Access Journals (Sweden)

Carlos Mariño

2013-10-01

Full Text Available La estenosis subaórtica es una lesión cardiaca poco frecuente, en el cual el tracto de salida del ventrículo izquierdo está estrechado por la presencia de un anillo fibroso o fibromuscular. Constituye 8 a 20% de todas las formas de obstrucción al tracto de salida del ventrículo izquierdo. La cirugía ha sido considerada el tratamiento de elección cuando el gradiente pico es mayor de 50 mmHg o en pacientes que, con gradientes menores, presentan progresión de la insuficiencia aórtica o dilatación de los diámetros ventriculares, disfunción ventricular o síntomas. Presentamos el caso de un paciente menor de edad, portador de estenosis subaórtica por membrana, con síntomas de insuficiencia cardiaca y función ventricular izquierda muy comprometida, en la que se realizó el tratamiento percutáneo, alternativo al quirúrgico, con resultado exitoso. Constituye el primer caso reportado en el país de tratamiento percutáneo con balón y con evolución favorable.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Detecção de Treponema denticola em casos de abscesso perirradicular agudo Detection of Treponema denticola in cases of acute periradicular abscesses

Directory of Open Access Journals (Sweden)

Isabela das Neves RÔÇAS

2000-09-01

Full Text Available Nosso objetivo foi detectar Treponema denticola em casos de abscesso perirradicular agudo. O DNA extraído das amostras de pus foi examinado pelo método da "Polymerase Chain Reaction" direcionada para o gene do RNAr (fração 16S. A amplificação usando o "primer" da espécie Treponema denticola permitiu detectá-la em 5 dos 6 casos de abscessos examinados. Apenas uma banda de tamanho esperado foi observada para as amostras positivas para esta bactéria, o que foi confirmado pela comparação com o DNA de referência do Treponema denticola (controle positivo. Até o momento, este é o primeiro relato da presença desta espiroqueta, considerada um importante patógeno periodontal em infecções endodônticas. Os resultados sugerem que Treponema denticola também pode ser um importante patógeno endodôntico.The purpose of this study was to report the detection of Treponema denticola in five out of six cases of acute periradicular abscesses. The 16S rRNA gene directed Polymerase Chain Reaction was the method utilized. This is probably the first report hitherto of the occurrence of this spirochete in acute periradicular abscesses.

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

CaSO4: Dy + Teflon thermoluminescent dosemeters

International Nuclear Information System (INIS)

Campos, L.L.

1986-01-01

A pellet dosemeter of CaSO 4 : Dy + Teflon was developed at IPEN. CaSO 4 : Dy thermoluminescent phosphor, grown in the Dosimetric Materials Production Laboratory was chosen, due to its high sensitivity, ease of preparation and comparatively low cost. Pellets were produced by cold pressing and sintering a mixture of CaSO 4 : Dy and Teflon powders. Extensive work was done to study in detail all CaSO 4 : Dy pellets characteristics from the point of view of dosimetry with the purpose of introducing it in the routine use. A filter combination providing an energy independent response from 20 KeV to 1,25 MeV was obtained. The dosemeter consists of three pellets sealed between two thin plastic sheets and placed under plastic and lead filters. The combination of these tree filters allows the exposure as well as the energy determination of an unknown source. (Author) [pt

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Infección por Polyoma virus en un paciente con transplante renal: A propósito de un caso

Directory of Open Access Journals (Sweden)

Reyner Loza Munarriz

2008-07-01

Full Text Available La nefropatia por polyoma virus (NVBK esta siendo reconocida como causa importante de falla del injerto, usualmente confundido con rechazo agudo. A la fecha, no se han reportado casos en el Perú. Se presenta el caso de un niño trasplantado, 17 años de edad, quien presentó elevación persistente de la creatinina sérica en el primer mes postrasplante. Fue tratado como rechazo agudo. Al no presentar mejoría se realizó biopsia renal que mostró marcado daño del epitelio tubular con necrosis parcial y desprendimiento hacia la luz tubular y la presencia de células atípicas con escaso citoplasma e inclusiones intranucleares basofilicas, hallazgos compatibles con infección por virus BK. No se evidenció signos de rechazo. Además, en el papanicolao de orina, se encontró Decoy cells. La carga viral de virus BK fue elevada en sangre y en orina. Se suspendió el tratamiento con mofetil micofenolato, se redujo la dosis de tacrolimus y se inició el tratamiento con leflunomide 40 mg/dia. Seis meses después la función renal del paciente se estabilizó, pero sin mejoría completa quedando con una depuración de creatinina de 30 ml/min/1,73 m² SC. (Rev Med Hered 2008;19:123-127

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

Industria electrónica, investigación y desarrollo (I+D y competencias profesionales. Estrategias para el escalamiento industrial. Estudio de caso en Mérida, Yucatán

Directory of Open Access Journals (Sweden)

René Ileana Velázquez-Pompeyo

2015-09-01

Full Text Available El propósito fundamental de esta investigación es conocer cuáles son las estrategias que facilitan el escalamiento industrial en un estudio de caso de la industria electrónica en el municipio de Mérida, Yucatán. El primer apartado, el marco teórico referencial, describe el escalamiento industrial, las competencias profesionales y la recopilación de otras experiencias de las empresas multinacionales (MNCs en México. El segundo apartado, la propuesta metodológica, tiene como base herramientas cualitativas, como el estudio de caso, la entrevista a profundidad y la revisión de fuentes documentales. El tercer apartado contiene las evidencias obtenidas del escalamiento industrial y las competencias profesionales se obtienen mediante el análisis de indicadores cualitativos, como las características de la empresa, la situación laboral (política de contratación, salarios y ascensos, rotación laboral, perfil ocupacional y capacitación y la caracterización de la cadena de valor productiva. Por último, las conclusiones destacan, en el caso seleccionado, que el escalamiento de producto, proceso y funciones es el resultado del desarrollo de las competencias profesionales de los trabajadores y la implementación de estrategias, como la adquisición de capacidades tecnológicas, la capacitación de la mano de obra y la reorganización del sistema de producción, las colaboraciones interdepartamentales y los vínculos académicos, entre otras. El caso seleccionado evidencia la posibilidad del desarrollo de actividades económicas que demanden actividades de mayor complejidad en el municipio de Mérida, Yucatán para obtener resultados favorables en el desarrollo de la región.

Intususcepción intestinal por pólipo fibroide inflamatorio en una anciana

Directory of Open Access Journals (Sweden)

Antonio M. Maya

2013-10-01

Full Text Available El pólipo fibroide inflamatorio es un tumor benigno poco frecuente del tubo digestivo, descripto por Vanek en 1949. Son lesiones de etiología desconocida, originadas en la submucosa. Están formadas por células mononucleares y mesenquimatosas con citoplasma fusocelular, con una importante proporción de eosinófilos. Sus síntomas son variables, dependiendo de su localización, y son una r ara causa de intususcepción intestinal en adultos. Presentamos el caso de una mujer de 82 años, que sufrió una rara intususcepción de intestino delgado, originada en un pólipo fibroide inflamatorio.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Primer reporte de un caso importado de Malaria por Plasmodium ovale curtisi en Paraguay, confirmado por diagnóstico molecular

Directory of Open Access Journals (Sweden)

Florencia del Puerto

2015-04-01

Full Text Available En países donde el Plasmodium ovale no es común, los microscopistas tienden a identificarlo de manera errónea como Plasmodium vivax. En este trabajo reportamos la identificación de la especie P. ovale curtisi por el método de PCR múltiple semianidada (SnM-PCR y la secuenciación de la subunidad pequeña del gen del ARN 18S, en un paciente paraguayo de 44 años de edad que vino en el 2.013 de Guinea Ecuatorial, África Occidental, a quien se le diagnosticó una infección por P. vivax por microscopía convencional. El empleo de métodos moleculares para la identificación de casos importados de infección con especies del género Plasmodium es uno de los objetivos principales en el control y la prevención de la malaria en Paraguay, teniendo en cuenta que el país se encuentra en fase de pre-eliminación de la enfermedad.

Factores asociados al hallazgo de lesiones preneoplásicas detectadas en citología vaginal: estudio de casos y controles

Directory of Open Access Journals (Sweden)

Lida Yoana Cifuentes

2014-01-01

Full Text Available Objetivo: Identificar factores socioculturales asociados a la presencia de lesiones preneoplásicas en mujeres residentes en un municipio de predominio rural en Boyacá, Colombia. Materiales y Métodos: Estudio observacional analítico, retrospectivo de casos y controles. De un registro institucional, mediante muestreo aleatorio secuencial, se seleccionó una muestra de 168 mujeres: 42 casos y 126 controles, apareadas por edad y estrato socioeconómico, a quienes mediante encuesta se evaluaron los antecedentes y los factores familiares y culturales, posiblemente asociados a la presencia de lesiones preneoplásicas en la citología vaginal. Resultados: Rango de edad entre 16 y 71 años; promedio de edad 42,2 años (SD = 14,57 años; el 79,2% se encontraba con pareja estable; el 90,0% cursó educación primaria o menos; el 11,3% fumaba; la edad promedio de menarquia fue de 13,8 años (SD = 1,38 y el 17,9% la presentó a los 12 años o antes. Todas las mujeres encuestadas han tenido al menos una gestación y el 66,1% ha tenido 3 o más. La edad media de la primera gestación es de 19,7 años (SD = 3,45 y el rango de edad de la primera gestación oscila entre los 15 y 29 años. En el 35,7% de los casos el primer embarazo ocurrió antes de los 18 años. El 31,5% de las mujeres estudiadas tiene antecedente familiar de cáncer. Los siguientes factores se encontraron significativamente asociados con la presencia de lesión preneoplásica en la citología vaginal: historia de dos o más parejas sexuales (OR = 85,0; primer embarazo antes de los 18 años (OR = 40,0; antecedente familiar de cáncer (OR = 23,9; consumo de cigarrillo (OR = 12,1; inicio sexual antes de los 17 años (OR = 11,8; consumo de bebidas alcohólicas (OR = 10,8; antecedente de infecciones vaginales (OR = 10,1; 3 o más gestaciones (OR = 5,2; ningún grado de escolaridad (OR = 3,49; antecedente de aborto (OR = 2,87. Conclusión: Se encontaron factores de riesgo susceptibles de

Measurement of thermal neutron fluence with CaSO4 thermoluminescent phosphors

International Nuclear Information System (INIS)

Liu Jinhua; Su Jingling; Wei Zemin

1984-01-01

During neutron irradiation, some TL phosphors were activated. After leaving the irradiation field the TL phosphor produced self-irradiation. The TL output of self-dose was only related to the original neutron fluence and independent of the γ-radiation. Several CaSO 4 TL phosphors were made. They were CaSO 4 :Dy, CaSO 4 :Dy-Teflon, CaSO 4 :Dy mixed with Dy 2 O 3 , CaSO 4 :Mn mixed with Dy 2 O 3 . The linearity, and lower detection limits of these TL phosphors were measured. The thermal neutron response of CaSO 4 :Mn mixed with Dy 2 O 3 was 64 R/(10 10 cm -2 ) and the lower detection limit was 1.3x10 5 cm -2

Filariosis humana en la selva peruana: reporte de tres casos

Directory of Open Access Journals (Sweden)

María Beltrán

2008-04-01

Full Text Available Se presenta tres casos de filariosis de pacientes varones procedentes de la selva peruana (Junín, San Martín y Pucallpa. Un caso presentó filarias en el globo ocular y frotís sanguíneo, que según morfología, serología y biología molecular se determinó como un posible caso de filariosis zoonótica por Onchocerca spp. Los otros dos casos fueron causados por Dirofilaria spp. uno presentó un nódulo en el pómulo y sensación de movilidad en la zona y fue diagnosticado por serología y el último caso se le extrajo una filaria del dedo pulgar de la mano y fue identificado como tal por morfología y biología molecular. Estos casos son los primeros reportes en el Perú por Dirofilaria spp. y Onchocerca spp.

Tricobezoar gástrico: relato de caso e revisão da literatura

Directory of Open Access Journals (Sweden)

César Tadeu Spadella

1998-04-01

Full Text Available Bezoar é a impactação de material estranho no interior do trato digestivo, originado a partir da ingestão de diversas substâncias, incluindo cabelos ou pêlos, fibras vegetais e outros. No presente estudo relata-se caso de um volumoso tricobezoar gástrico observado em uma adolescente de 16 anos, com queixa de dor e tumoração palpável na região epigástrica, diagnosticado através da endoscopia digestiva alta. Dada às proporções do bezoar, a paciente foi submetida à gastrotomia anterior com retirada de uma massa sólida de cabelos, com 1200 g, a qual moldava todo o estômago, desde o fundo até o piloro. Uma grande úlcera de pressão também foi detectada em região antral, cujas biópsias revelaram- se negativas para neoplasia. Após a alta, sem intercorrências, a paciente foi encaminhada ao Serviço de Neuropsiquiatria para o tratamento da tricofagia e prevenção da recorrência, objetivo final, ao nosso ver, de todo o tratamento.Bezoar is an impaction of swallowed foreign material into the digestive tract. It is formed from several substances included hairs of humans or animals, vegetable matters and others. At present study the authors report a case of a voluminous gastric trichobezoar observed in a 16-yr-old adolescent with abdominal pain and palpated mass in the epigastrium. Trichobezoar was diagnosed throughout fiberoptic gastroscopy and laparotomy was indicated due to exaggerated size of the mass. Anterior gastrotomy was performed and a solid mass of hairs weighting 1200 g was removed. The removed mass occupied the whole stomach from fundus to pylorus. A big pression ulcer was also detected in the antrum. Biopsies of this ulcer showed to be negatives for neoplasy. There were no complications in postoperative recovery. After discharge the patient was referred to the Neuropsychiatric Service for treatment of trichophagia and prevention of recurrence, in our point of view, the main purpose of all treatment.

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

Bloqueo aurículo-ventricular de primer grado en tirotoxicosis aguda First degree atrio-ventricular block in acute thyrotoxicosis

Directory of Open Access Journals (Sweden)

Antonio R. Vilches

2004-02-01

Full Text Available El cuadro clínico de la tirotoxicosis incluye síntomas cardiovasculares variados. La taquicardia sinusal es el trastorno electrocardiográfico más frecuente y los trastornos de conducción son extremadamente raros como modo de presentación. Comunicamos un caso de bloqueo aurículo-ventricular de primer grado en una paciente con hipertiroidismo recién diagnosticado y que comenzó días antes de la consulta con un cuadro general inespecífico. Su evaluación ulterior demostró que se trataba de una tirotoxicosis aguda autoinmune, y su tratamiento con metimazol corrigió el trastorno totalmente. Se discuten los mecanismos fisiopatológicos involucrados y las implicancias clínicas desde el punto de vista del internista.Thyrotoxicosis may present with a variety of cardiovascular symptoms. Sinus tachycardia is the most frequently encountered electrocardiographic abnormality and conduction disturbances are extremely uncommon. We present a case of first degree atrio-ventricular block in a patient with newly diagnosed hyperthyroidism and discuss the underlying pathophysiological mechanisms and the clinical implications from the internist’s standpoint.

First report of a human case of polycystic echinococcosis due to Echinococcus vogeli from neotropical area of Peru, South America Primer reporte de un caso humano de echinococcosis poliquística causada por E. vogeli procedente del área neotropical del Perú, America del Sur

Directory of Open Access Journals (Sweden)

José R. Somocurcio

2004-02-01

Full Text Available We report a human case of polycystic hidatidosis due to Echinococcus vogeli from Contamana (Department of Loreto village located in the central jungle of Peru. The patient is a 44 year-old lady, teacher, who carried a painless liver mass since a year ago. She was submitted to abdominal surgery and the liver mass was removed and showed multiple cysts containing colorless liquid as is showed in the polycystic hidatidosis. The morphology and measure of the hooks obtained from the liquid contained in the cysts are from Echinococcus vogeli. It is the first report of this parasitism in Perú.Reportamos un caso humano de hidatidosis poliquística debido a Echinococcus vogeli procedente de Contamana (Departamento de Loreto, localidad ubicada en la selva central del Perú. La paciente es una mujer de 44 años de edad, profesora, quien portaba una hepatomegalia no dolorosa de un año de evolución. Sometida a intervención quirúrgica, se removió la masa hepática que macroscópicamente mostró múltiples quistes conteniendo líquido incoloro. El examen microscópico correspondió a una hidatidosis poliquística. El examen y medida de los ganchos obtenidos del contenido de los quistes correspondieron a Echinococcus vogeli. Es el primer reporte de este parasitismo en el Perú.

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Parálisis diafragmática bilateral. Presentación de un caso Bilateral diaphragmatic paralysis

Directory of Open Access Journals (Sweden)

Jorge Carnot Pereira

2012-04-01

Full Text Available La parálisis diafragmática bilateral es una entidad muy infrecuente en la clínica, debido a diferentes entidades con capacidad de lesionar el nervio frénico. El compromiso respiratorio que produce requiere cuidado especializado. Este es el primer caso reportado en nuestra literatura a consecuencia de hernias cervicales múltiples. Se presenta un caso de un paciente de 43 años, con antecedentes de salud, exatleta de alto rendimiento, que ingresó en nuestro servicio, con disnea de 5 meses de evolución, que aumentó progresivamente en intensidad hasta mantenerlo en ortopnea constante, fue estudiado exhaustivamente hasta llegar a diagnostico definido y derivarlo al servicio de Neurocirugía para su solución definitiva. La importancia del tema que se presenta es que se describe una presentación rara de parálisis diafragmática bilateral, a consecuencia de hernias discales cervicales múltiples.Bilateral diaphragmatic paralysis is a rare condition in clinical practice due to different entities that can damage phrenic nerve. The resulting respiratory compromise requires medical special care. This is the first case reported in our medical literature caused by multiple cervical hernias. A 43 year-old patient having health history, high performance ex-athlete, admitted in the service with 5-month evolution of dyspnea which progressively increased in intensity up to maintain him in permanent orthopnea, thorough studies were conducted to the definite diagnosis and he was transferred to Neurosurgery Service to a definite solution. A rare presentation of a bilateral diaphragmatic paralysis resulting from multiple cervical hernias gives importance to the topic.

CASO DE PRIMARIA: REZAGO EDUCATIVO POR FALTA DE DESARROLLO DE COMPETENCIAS

OpenAIRE

Saucedo, Gerardo

2012-01-01

Párrafo de inicio, explicación del caso, explicación de un ejercicio tanto individual como grupal para un debate referente al caso,los objetivos del caso, soluciones propuestas por el autor y conclusiones

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Raquitismo carencial: relato de caso

OpenAIRE

Porto, Juliana Antola et al.

2005-01-01

Introdução: O raquitismo é uma doença do tecido ósseo em formação, onde há falha na calcificação e conseguinte acúmulo de tecido osteóide. O raquitismo carencial é decorrente da deficiência dos precursores da vitamina D, sendo a causa de raquitismo mais facilmente evitável e tratável. Objetivo: Relatar um caso, revisar a etiopatogenia e o tratamento do raquitismo carencial. Relato de caso: Paciente masculino com 2 anos de idade, previamente hígido, consulta com dificuldade de deambular progre...

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Tratamiento endovascular del aneurisma de aorta descendente en el adolescente con síndrome de Marfan. Reporte de un caso

Directory of Open Access Journals (Sweden)

Juan G. Barrera, MD

2012-01-01

Full Text Available Se expone el caso de un adolescente de 14 años de edad, con síndrome de Marfan y antecedente de tres cirugías cardiovasculares previas: valvuloplastia aórtica y mitral a los cinco años y valvuloplastia aórtica y reconstrucción de la aorta torácica con tubo de pericardio bovino a sus diez años. En primer tiempo quirúrgico se realizó reemplazo valvular aórtico por válvula mecánica y valvuloplastia mitral y tricuspidea, y en segundo tiempo quirúrgico, durante la misma hospitalización, exclusión endovascular de aneurisma de aorta descendente asintomático sin complicaciones. Antes del egreso se diagnosticó una endofuga tipo II que se manejó con observación clínica. Luego de un año del procedimiento, los controles clínico y tomográfico son satisfactorios.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Uveomeningencefalites: registro de dois casos

Directory of Open Access Journals (Sweden)

Wilson Luiz Sanvito

1982-03-01

Full Text Available Após considerações a propósito das manifestações clínicas das uveomeningencefalites, são relatados dois casos com características clínicas ligeiramente diferentes. No caso 1 tratava-se da doença de Harada, tendo o paciente apresentado quadro meningítico agudo acompanhado de confusão mental. O exame do líquido cefalorraquidiano evidenciou um quadro inflamatório do tipo linfo-monocitário e o paciente evoluiu com distúrbios acentuados da memória e uveíte bilateral. Após alguns meses de evolução, a doença deixou como seqüelas uma síndrome de Korsakoff e ambliopia acentuada no olho esquerdo. No caso 2 tratava-se de doença de Behcet, tendo o paciente apresentado dois surtos de meningite do tipo linfomonocitário, lesões herpetiformes na genitalia e uveíte no olho direito que evoluiu para amaurose. São feitas considerações sobre os aspectos etiopatogênicos destas afecções e sobre o controvertido uso dos corticosteróides em seu tratamento.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

As leis da natureza e os casos de Tooley

Directory of Open Access Journals (Sweden)

Rodrigo Reis Lastra Cid

2013-06-01

Full Text Available Os objetivos deste artigo são: (1 apresentar quatro teorias com relação à natureza das leis naturais, (2 mostrar que apenas uma delas é capaz de responder satisfatoriamente aos Casos de Tooley e (3 indicar por que tais casos são relevantes para a nossa ontologia. Estes objetivos são importantes, pois o conceito de "lei natural" é utilizado em muitos, se não todos, os domínios das ciências e em muitos domínios da filosofia; e, se tais casos forem possíveis, eles serão situações que precisariam ser adequadamente descritas. Se uma e apenas uma teoria puder descrever tais casos adequadamente, haverá fortes razões para preferir tal teoria frente às outras.

El tamaño del Poder Legislativo como modulador del sistema electoral en la democracia representativa, el caso costarricense

Directory of Open Access Journals (Sweden)

Diego González Fernández

2014-07-01

Full Text Available El tamaño de los poderes legislativos es, dentro de las democracias representativas contemporáneas, un modulador fundamental del sistema electoral. Más aún, en sistemas donde lo que prima son las fórmulas electorales de carácter proporcional –fórmula Hare, Hare Modificado, D’Hondt, entre otras- en la elección de los legisladores, como es el caso costarricense, y en general, en toda América Latina. Siendo así, se parte de dos premisas básicas: en primer término, un parlamento con mayor número de integrantes se traduce en que el sistema electoral realizará una repartición más adecuada de diputaciones por partido político; y, en segundo lugar, esta proposición se complementa defendiendo que en los poderes legislativos donde la relación de proporcionalidad entre representante-representado, es decir, el número de habitantes que representa un legislador muestre mayor proximidad, expresará una tendencia a una mayor calidad en la democracia. A partir de estas premisas, se vislumbra el fin de este artículo el cual estudia primeramente la perspectiva teórica del tema, para después profundizar en el abordaje contemporáneo con detalle en el caso costarricense. Ello mediante un estudio al artículo 106 de la Constitución Política y un abordaje comparativo con la región latinoamericana.

Secuestro pulmonar una infrecuente causa de hipertension pulmonar persistente en el recién nacido reporte de un caso

Directory of Open Access Journals (Sweden)

Lupo Méndez

2017-01-01

Full Text Available La hipertensión pulmonar persistente del recién nacido ( HPPRN es una entidad frecuente en las unidades de cuidados intensivos neonatales ( UCIN , sin embargo, algunas de sus causas pasan desapercibidas, debido a su baja frecuencia y poca asociación con esta patología. A propósito de un caso en nuestra UCIN , en un neonato a término que presentó HPPRN secundario a una malformación pulmonar, raramente asociada con esta patología en este grupo etareo, ya que se encontró mayor disposición a factores propios del nacimiento, y noxas maternas. El paciente presentó dificultad respiratoria horas después de su nacimiento, con evolución y persistencia de su sintomatología, por lo que se necesitó de diversos medios diagnósticos para establecer su etiología. Es importante destacar que el primer ecocardiograma doppler no mostró ninguna alteración anatómica o funcional, reportado normal; con posterior empeoramiento clínico del neonato, por lo que se ordenó un control ecocardiografico, y se evidenció una presión pulmonar estimada de 71 mmHg; se continuó el estudio etiológico con imágenes complemen - tarias, en esta caso una tomografía de tórax contrastada, y finalmente fue corroborado con un cateterismo cardiaco, lo cual permitió a su vez, manejo terapéutico y corrección de anomalía estructural de vasos pulmonares.

The ternary system K2SO4MgSO4CaSO4

Science.gov (United States)

Rowe, J.J.; Morey, G.W.; Silber, C.C.

1967-01-01

Melting and subsolidus relations in the system K2SO4MgSO4CaSO4 were studied using heating-cooling curves, differential thermal analysis, optics, X-ray diffraction at room and high temperatures and by quenching techniques. Previous investigators were unable to study the binary MgSO4CaSO4 system and the adjacent area in the ternary system because of the decomposition of MgSO4 and CaSO4 at high temperatures. This problem was partly overcome by a novel sealed-tube quenching method, by hydrothermal synthesis, and by long-time heating in the solidus. As a result of this study, we found: (1) a new compound, CaSO4??3MgSO4 (m.p. 1201??C) with a field extending into the ternary system; (2) a high temperature form of MgSO4 with a sluggishly reversible inversion. An X-ray diffraction pattern for this polymorphic form is given; (3) the inversion of ??-CaSO4 (anhydrite) to ??-CaSO4 at 1195??C, in agreement with grahmann; (1) (4) the melting point of MgSO4 is 1136??C and that of CaSO4 is 1462??C (using sealed tube methods to prevent decomposition of the sulphates); (5) calcium langbeinite (K2SO4??2CaSO4) is the only compound in the K2SO4CaSO4 binary system. This resolved discrepancies in the results of previous investigators; (6) a continuous solid solution series between congruently melting K2SOP4??2MgSO4 (langbeinite) and incongruently melting K2SO4??2CaSO4 (calcium langbeinite); (7) the liquidus in the ternary system consists of primary phase fields of K2SO4, MgSO4, CaSO4, langbeinite-calcium langbeinite solid solution, and CaSO4??3MgSO4. The CaSO4 field extends over a large portion of the system. Previously reported fields for the compounds (K2SO4??MgSO4??nCaSO4), K2SO4??3CaSO4 and K2SO4??CaSO4 were not found; (8) a minimum in the ternary system at: 740??C, 25% MgSO4, 6% CaSO4, 69% K2SO4; and ternary eutectics at 882??C, 49% MgSO4, 19% CaSO4, 32% K2SO4; and 880??, 67??5% MgSO4, 5% CaSO4, 27??5% K2SO4. ?? 1967.

Caso Ouro Fino Saúde Animal Caso Ouro Fino Saúde Animal Ouro Fino Saúde Animal case

Directory of Open Access Journals (Sweden)

Bernardo Hauch Ribeiro de Castro

2012-04-01

Full Text Available O Caso Ouro Fino Saúde Animal ilustra uma tomada de decisão, pelos executivos da empresa, sobre a entrada em um novo mercado, de vacinas para bovinos. Diante da necessidade de dar um passo maior em direção ao crescimento sustentável, a empresa não poderia deixar de entrar nesse segmento, que representava mais de metade do mercado brasileiro de produtos veterinários. No entanto, era um passo arriscado. A principal questão do caso é avaliar as alternativas de comprar vacinas de terceiros ou produzir internamente suas próprias vacinas. A empresa do caso é a Ouro Fino Saúde Animal, empresa brasileira de produtos veterinários, instalada no Estado de São Paulo, com faturamento de mais de R$ 100 milhões anuais. Os dois principais personagens deste caso são os diretores financeiro e industrial da empresa. A situação passa-se em 2005. Como instrumento de ensino, o caso foi concebido para o ensino de estratégia em cursos de pós-graduação em administração, levando os alunos a avaliar vantagens e desvantagens de cada uma das alternativas. Como objetivo secundário, o caso propicia alguns elementos para uma estimativa da viabilidade financeira da opção de implantar uma nova unidade produtiva e a possibilidade de refletir sobre uma decisão já tomada, de entrada no novo mercado. Por fim, o caso traz uma série de informações sobre o mercado brasileiro e sobre o mercado mundial de produtos veterinários. É possível, com base nestes dados, trabalhar questões ligadas à segmentação e posicionamento da empresa no setor, ficando a critério do professor este tipo de uso.El Caso Ouro Fino Saúde Animal ilustra una toma de decisiones por los ejecutivos de la empresa, a la entrada en un nuevo mercado de las vacunas para el ganado. Ante la necesidad de dar un paso importante hacia el crecimiento sostenible, Ouro Fino Saúde Animal no podía dejar de entrar, ya que representaba más de la mitad del mercado de productos veterinarios

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

Xeroderma pigmentoso. Síndrome de Sanctis Cacchione: Presentación de 1 caso

Directory of Open Access Journals (Sweden)

Leopoldina Falcón Lincheta

1998-06-01

Full Text Available El xeroderma pigmentoso es una afección genética poco frecuente que traduce la hipersensibilidad celular a la radiación ultravioleta en asociación con una anormal reparación del ácido dexosirribonucleico, y que produce pecosidades, fotofobia y subsecuentemente cambios neoplásicos en zonas expuestas al sol. En este trabajo se presenta el primer caso reportado en Cuba en un niño de 5 años de edad, con la entidad clínica en su forma más severa de manifestarse, el síndrome de Sactis Cacchione, que involucra las manifestaciones cutáneas y oculares con trastornos neurológicos y somáticos graves, y provoca daños letales.Xeroderma pigmentosum is a rare genetic affection that transforms cellular hypersensitivity to ultraviolet radiation in association with an abnormal repairing of the desoxyribonucleic acid, and that produces freckles, photophobia and, subsequently, neoplasitc changes in zones exposed to sunlight. In this paper it is reported the first case detected in Cuba in a five-year-old child suffering from the most severe manifestation of this disease, the Sanctis Cacchione´s syndrome, which involves skin and ocular manifestations with serious somatic and neurological disorders and provokes lethal damages.

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Alterações de neuroimagem no parkinsonismo: estudo de cinco casos

Directory of Open Access Journals (Sweden)

Costa Maria do Desterro Leiros da

2003-01-01

Full Text Available Apresentamos 5 casos de parkinsonismo nos quais as imagens de ressonância magnética (RM mostram alterações em estruturas do circuito dos núcleos da base (NB. Foram estudados 5 pacientes: 3 do sexo masculino e 2 do feminino nos quais as manifestações clínicas tiveram início nas faixas estárias de 5 a 52 anos. Os exames de RM foram realizados com equipamento de 1.5T. As imagens nas sequências em T2 evidenciaram hipersinal bilateral e simétrico nas seguintes topografias: exclusivamente na substância negra (3 casos, exclusivamente no globo pálido (1 caso e envolvendo simultaneamente a substância negra, o globo pálido e as conexões nigro-estriatais (1 caso. Em três casos havia dados sugestivos de parkinsonismo secundário: um pelo herbicida glifosato; outro após vacinação anti-sarampo; outro após período de coma por encefalite. Nos dois casos restantes, o diagnóstico clínico era de doença de Parkinson (DP. Entretanto, nesses dois casos, os dados da RM permitiram excluir o diagnóstico inicial de DP. A RN foi fundamental para identificar casos de parkinsonismo secundário, embora em alguns destes pacientes não tenha sido possível determinar os agentes etiológicos.

Streptococcus gallolyticus subsp. pasteurianus en líquido cefalorraquídeo de un paciente pediátrico

Directory of Open Access Journals (Sweden)

Liz M Vélez Balestro

Full Text Available Hasta la fecha se han descrito casos de meningitis por Streptococcus gallolyticus subsp. pasteurianus en adultos, y de los pocos casos pediátricos, el mayor número se presentó en neonatos. En este trabajo presentamos un caso de meningitis y bacteriemia por este estreptococo en un paciente de 9 meses, con reiteradas hospitalizaciones por enfermedades respiratorias; este constituye el primer aislamiento documentado del citado microorganismo en Santa Fe.

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Libertad de expresión y el caso del lenguaje del odio. Una aproximación desde la perspectiva norteamericana y la perspectiva alemana

Directory of Open Access Journals (Sweden)

Oscar Pérez de la Fuente

2010-12-01

Full Text Available Resumen Este artículo analiza las concepciones sobre la libertad de expresión en el caso del lenguaje del odio, centrándose en algunos aspectos de la perspectiva norteamericana y en algunos aspectos de la perspectiva alemana. El primer modelo está basado en la libertad negativa y se corresponde con la visión del mercado de las ideas que ha elaborado la jurisprudencia de la Corte Suprema norteamericana. Este Tribunal ha otorgado una papel prioritario a la libertad de expresión, que debería limitarse sólo en casos de un peligro claro y presente o amenaza de desordenes públicos. El segundo modelo, centrado en la libertad positiva, otorga un papel prioritario a la dignidad humana frente a la libertad de expresión. El Tribunal Constitucional Federal alemán ha considerado que en el conflicto de derechos fundamentales debe establecerse una ponderación según las circunstancias de caso concreto. Abstract This article analyzes the conceptions on freedom of expression in the case of hate speech, focusing in some aspects of the North American perspective and in some aspects of the German perspective. The first model is based on negative freedom and it corresponds with the vision of marketplace of ideas that has elaborated the jurisprudence of the North American Supreme Court. This Court has given a priority role to the free speech that only must be limited in cases of clear and present danger or a threat of the breach of the peace. The second model is focused in the positive freedom, it gives a priority role to the human dignity in front of free speech. The Federal Constitutional Court has established that the conflict between fundamental rights must be considered according to the circumstances of the specific case. 

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

Descripción histológica comparativa del desarrollo del sistema digestivo y visual de larvas de chame Dormitator latifrons (Pisces: Eleotridae

Directory of Open Access Journals (Sweden)

Vanesa V López-López

2015-07-01

Full Text Available Se realizó la descripción del desarrollo de larvas de uno a seis días post-eclosión (dpe, para generar información que ayude a comprender la capacidad alimenticia en etapas tempranas. Las larvas se obtuvieron mediante la inducción hormonal de reproductores, utilizando implantes de análogos sintéticos de GnRH durante la temporada de septiembre-noviembre de 2010. Las muestras fueron incluídas en historesina y teñidas con hematoxilina-eosina. Una vez eclosionada, la larva presenta gran cantidad de vitelo que absorbe gradualmente (1° a 3° dpe. Al 4° dpe, existe una cavidad bucal abierta con estructuras dentales, en este estadio se ha completado el desarrollo ocular, que presenta pigmentación. Se observa la formación de las hendiduras branquiales y se diferencia el intestino en anterior y posterior y se distingue la presencia de vacuolas digestivas en el intestino anterior. En el 5° dpe, se observaron los paquetes de fibras musculares y se distinguió una estructura estomacal. En el 6° dpe, el páncreas, pliegues intestinales y membrana de borde de cepillo son visibles y se observaron partículas de alimento y bacterias dentro del intestino. En base a lo anterior, se concluye que las larvas de D. latifrons han desarrollado completamente el tracto digestivo y órganos asociados que le ayudarán a la búsqueda de alimento, entonces a partir del 4° dpe son capaces de iniciar la alimentación exógena.

Teratocarcinosarcoma rinosinusal: Reporte de un caso

OpenAIRE

González G,Claudia; Iñiguez,Rodrigo; Aranís Jiménez,Carolina; Castiblanco Galvis,Adriana

2008-01-01

Teratocarcinosarcoma rinosinusal es una neoplasia maligna infrecuente y rara, que combina elementos de teratoma y carcinosarcoma. Se compone de epitelio benigno o maligno (fibroblastos), mesénquima (cartílago, hueso o músculo liso) y elementos neurales. Hasta el año 2008 se han reportado un total de 63 casos de ubicación rinosinusal. Presentamos el caso de un teratocarcinosarcoma de fosa nasal, en un hombre de 67 años de edad, que consultó por obstrucción nasal rápidamente progresiva. La lesi...

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

Dos estudios de casos

Directory of Open Access Journals (Sweden)

Hernán Guillermo Salazar Morales

1989-04-01

Full Text Available RESUMEN A continuación se presenta dos casos de estudio en donde se puede apreciar a la forma  como se establecen  las relaciones en una organización y lo que una DECISION  puede llegar a incidir en el desarrollo de las operaciones de una empresa. Decisiones basadas en la intuición, o en corazonadas, frecuentemente conducen en dirección equivocada, ocasionando pérdidas en tiempo, personal y dinero. El proceso de toma de decisiones deben ser TAREAS ESTRUCTURADAS que se sustenten con hechos. Su ejecución debe hacerse secuencialmente y cumplir con cada uno de sus pasos. El diseño de los  casos está orientado para que  sirvan como material de aplicación en la asignatura de  taller de planeación.

Cryptosporidiosis of the biliary tract mimicking pancreatic cancer in an AIDS patient Criptosporidiose do trato biliar simulando câncer do pâncreas em paciente com AIDS

Directory of Open Access Journals (Sweden)

Lenice do Rosário de Souza

2004-03-01

Full Text Available Diarrhea caused by Cryptosporidium sp is frequent in patients with AIDS, but involvement of other organs of the digestive tract is uncommon. We report a case of Cryptosporidium-associated obstruction of the biliary tract mimicking cancer of the head of the pancreas in a 43-year-old woman with AIDS.A diarréia causada pelo Cryptosporidium sp é muito freqüente em pacientes com AIDS, mas o envolvimento de outros órgãos do aparelho digestivo é incomum. Relata-se o caso de uma mulher de 43 anos, que tinha AIDS, que apresentava obstrução das vias biliares associada ao Cryptosporidium, simulando câncer da cabeça do pâncreas.

Casos autoctones de esquistossomose mansonica em criancas de Recife, PE

Directory of Open Access Journals (Sweden)

Constanca Simoes Barbosa

2013-08-01

Full Text Available OBJETIVO : Investigar criadouros com moluscos hospedeiros e casos humanos autóctones para esquistossomose. MÉTODOS : Entre julho de 2010 e setembro de 2012 foram realizados: (1 levantamento malacológico para busca ativa de criadouros, coleta e identificação de caramujos Biomphalaria positivos para Schistosoma mansoni em Recife, PE; (2 inquérito de prevalência com 2.718 escolares, de sete a 14 anos, para diagnóstico de casos de esquistossomose; (3 exame clínico e ultrassonografia nos casos positivos para S. mansoni. Os casos foram investigados quanto à sua autoctonia e avaliados clinicamente. Os casos e criadouros foram georreferenciados e espacializados. RESULTADOS : Foram identificados 30 criadouros de B. straminea , quatro deles potenciais focos de transmissão, uma vez que os testes moleculares identificaram DNA de S. mansoni nos caramujos coletados. Foram diagnosticadas 14 crianças com esquistossomose; entre elas, cinco foram consideradas casos autóctones da doença. CONCLUSÕES : Ações emergenciais pela vigilância em saúde são necessárias para evitar que a esquistossomose se endemize em Recife, como acontece em localidades litorâneas do estado de Pernambuco.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Mujer de 52 años con shock cardiogénico secundario a síndrome de takotsubo tras reparación quirúrgica de la válvula mitral

Directory of Open Access Journals (Sweden)

Francisco J. Rodríguez Rodrigo

2014-01-01

Full Text Available Presentamos un caso de miocardiopatía de takotsubo en una paciente con insuficiencia valvular mitral severa (por prolapso severo del velo posterior, acaecida después de la reparación quirúrgica de dicha válvula. Hasta donde conocemos, este es el primer caso descrito en la literatura.

A young woman with first-trimester metrorrhagia, fever and skin lesions Mujer joven con metrorragia del primer trimestre, fiebre y lesiones cutáneas

Directory of Open Access Journals (Sweden)

A. Lalueza Blanco

2006-03-01

Full Text Available Inflammatory bowel disease commonly affects women with child-bearing potential, and clinical activity extent is most relevant at the time of conception. Below, we report on the case of a 19-year-old woman who was admitted for first-trimester metrorrhagia and fever, with various extraintestinal manifestations, mainly including erythema nodosum and episcleritis during the course of disease. The differential diagnosis of these manifestations led to the diagnosis of Crohn's disease, which involved the whole colon.La enfermedad inflamatoria intestinal afecta frecuentemente a mujeres en edad fértil, siendo fundamental el grado de actividad clínica en el momento de la concepción. A continuación se presenta el caso de una mujer de 19 años que ingresa por metrorragia del primer trimestre y fiebre; destacando durante su evolución la aparición de diferentes manifestaciones extraintestinales, fundamentalmente eritema nodoso y epiescleritis. A través del diagnóstico diferencial de estas manifestaciones se llegó al diagnóstico de una enfermedad de Crohn que afectaba a todo el colon.

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

Síndrome de Isaacs: relato de três casos

Directory of Open Access Journals (Sweden)

SCOLA ROSANA HERMÍNIA

1999-01-01

Full Text Available Relatamos três casos de síndrome de Isaacs, que apresentavam mioquímia clínica, cãibras, dificuldades para o relaxamento muscular, hipertrofia muscular e aumento da sudorese. A eletromiografia de agulha mostrou atividade muscular contínua involuntária, caracterizada como descargas mioquímicas. Os estudos da condução nervosa foram normais. Biópsia de músculo, realizado nos três casos, mostrou atrofia de fibras do tipo 2. Dois casos apresentaram melhora clínica com a utilização de carbamazepina e um com prednisona.

Queratitis por Acanthamoeba sp.: primer caso confirmado por aislamiento y tipificación molecular en Bahía Blanca, provincia de Buenos Aires, Argentina Acanthamoeba sp. keratitis: first case confirmed by isolation and molecular typification in Bahía Blanca, Buenos Aires Province, Argentina

Directory of Open Access Journals (Sweden)

M. L. Gertiser

2010-06-01

Full Text Available Algunas especies del género Acanthamoeba provocan queratitis amebiana (QA, una infección de la córnea muy dolorosa, generalmente unilateral, con compromiso importante de la visión. Se presenta el caso de una mujer de 31 años usuaria de lentes de contacto con hábitos inadecuados de higiene y conservación de las lentes. La paciente consultó por enrojecimiento y dolor intenso en el ojo derecho, de dos meses de evolución. Luego del examen oftalmológico y ante la sospecha de una etiología parasitaria se realizó una biopsia de la zona lesionada, que se destinó al análisis bacteriológico y parasitológico en el laboratorio. También se remitieron los líquidos de lavado y el estuche de las lentes. No se detectó crecimiento bacteriano en las muestras. Los cultivos para la búsqueda de Acanthamoeba resultaron positivos en todos los especímenes analizados. Las amebas aisladas fueron clasificadas morfológica y molecularmente como pertenecientes al género Acanthamoeba. El presente trabajo muestra el primer caso de queratitis por Acanthamoeba de la ciudad de Bahía Blanca identificado por el laboratorio mediante procedimientos de alto valor diagnóstico.Some species of the Acanthamoeba genus cause keratitis, a very painful, most likely unilateral corneal infection , associated with eye and vision impairment. We here present a case of a 31-year-old female patient, a regular user of soft contact lenses without good practices of lens hygiene and handling. The patient attended medical consultation after two months of inflammation and pain in her right eye. After ophthalmological studies, and due to suspicion of a parasitic infection, a biopsy was performed and the sample submitted for bacteriological and parasitological analyses. Moreover, contact lens holders and lens cleaning solutions were studied. The samples yielded negative results for bacterial infection. However, cultivation of all samples showed the presence of amoeboid parasites

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

EVALUACIÓN DE LA PRESENTACIÓN DE CASO, CLÍNICA DE ODONTOLOGÍA DE RESTAURATIVAS: PROPUESTA DE UNA METODOLOGÍA CON RÚBRICA

Directory of Open Access Journals (Sweden)

Orlando Maroto Marín

2010-01-01

Full Text Available La evaluación de la clínica de restaurativa representa todo un reto para cualquier docente odontólogo, ya que debe de evaluar el desempeño o la técnica de los estudiantes en representaciones numéricas, que demuestran si un estudiante es capaz de aprobar el curso o en caso contrario repetirlo. En este artículo se expone una experiencia sobre el uso de una guía de evaluación con rúbricas para la presentación de caso, primer procedimiento que se debe evaluar en la clínica dental de docencia. La guía se aplicó a manera de prueba en la Clínica de Restaurativas de V año, de la Facultad de Odontología de la Universidad de Costa Rica. Para la elaboración del instrumento de evaluación, se realizó un inventario sobre los procedimientos que se llevan a cabo durante el desarrollo de la clínica y cuyo conocimiento por parte del estudiante es necesario. Los procedimientos se agruparon de acuerdo con los dominios: cognitivos, psicomotores y afectivos. Al aplicar la rúbrica se obtuvieron resultados positivos, tanto por parte de los docentes, como por parte de los estudiantes, requiriéndose la corrección de algunos detalles para alcanzar un resultado óptimo.

Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

Directory of Open Access Journals (Sweden)

Cesar Augusto Hernández-Suarez

2016-09-01

Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

International Nuclear Information System (INIS)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-01-01

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

Synthesis and luminescence properties of Eu"2"+ doped CaSO_4 phosphor

International Nuclear Information System (INIS)

Aghalte, G.A.; Dhoble, S.J.; Pawar, N.R.

2016-01-01

Eu"2"+ doped CaSO_4 Phosphor were synthesized by precipitation method. PL analysis of Eu"2"+ activated CaSO_4 phosphor exhibited characteristic emission properties; CaSO_4:Eu Phosphor has received considerable attention because of its high sensitivity to X-ray and λ ray irradiation. CaSO_4:Eu phosphor powder was successfully synthesized by the wet chemical co-precipitation method. The structure morphology and luminescent properties of the phosphor were characterized by X-ray diffraction, scanning electron microscopy and photoluminescence spectroscopy

Carcinoma de pele no segmento craniofacial: Relato de 3 casos

Directory of Open Access Journals (Sweden)

Iana Lara Pereira Maia

2014-09-01

Full Text Available O câncer de pele é a neoplasia mais frequente no Brasil. O tipo histológico mais comum é o carcinoma basocelular (CBC, 70% dos casos, seguido pelo carcinoma espinocelular (CEC e pelo melanoma. Relatamos três carcinomas de pele no segmento crânio facial, evidenciando as abordagens cirúrgicas realizadas. No caso 1, apresenta-se um CBC em hemiface submetido à exérese com retalho V-Y. No caso 2, destaca-se um CEC em couro cabeludo submetido à exérese com retalhos de rotação e da vizinhança. No caso 3, relata-se um CBC na região pré-auricular e no dorso nasal submetido à exérese com retalho de Limberg e de Rieger.

Esvaziamento gástrico após administração oral de contraste em tomografia computadorizada do abdômen: descrição de seis casos

Directory of Open Access Journals (Sweden)

Martins Fernando Antonio Nogueira da Cruz

2004-01-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: A lesão pulmonar secundária à aspiração do conteúdo gástrico é complicação associada à perda dos reflexos protetores das vias aéreas. Neste contexto, a realização de exames tomográficos que incluem a contrastação do trato digestivo exige particular atenção em crianças abaixo de cinco anos, que necessitam anestesia geral ou sedação para assegurar imobilidade durante o procedimento. A indução da anestesia ou sedação, após ingestão da solução de contraste pode trazer risco substancial para a broncoaspiração do conteúdo gástrico. Isto faz com que se opte por administrar o contraste por sonda gástrica após a intubação traqueal, uma vez que não se conhece o tempo de esvaziamento gástrico após utilização de solução contrastante. Esta conduta representa aumento do tempo de anestesia, o que resulta em constante questionamento sobre a possibilidade de esvaziamento do conteúdo gástrico em tempo inferior a uma hora. Seis casos de pacientes submetidos à tomografia de abdômen foram avaliados quanto ao esvaziamento gástrico por meio da realização de cortes tomográficos na topografia do estômago, com o objetivo de determinar a presença ou ausência de conteúdo residual líquido nesse órgão, após a administração da solução de contraste. RELATO DOS CASOS: Foram avaliadas seis crianças submetidas à tomografia contrastada do abdômen. Duas, não anestesiadas, apresentaram expressivo resíduo líquido gástrico decorridos 50 e 45 minutos, respectivamente, da ingestão de contraste. Quatro, submetidas à anestesia geral, também apresentaram resíduo líquido gástrico decorridos 40 a 50 minutos da administração de contraste via sonda oro/nasogástrica. Em duas destas persistiu apreciável resíduo líquido no estômago, mesmo após a aspiração do conteúdo pela sonda. CONCLUSÕES: Nos casos observados, o período de 40 a 50 minutos foi insuficiente para o esvaziamento do

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Síndrome de Asperger: relato de um caso

Directory of Open Access Journals (Sweden)

Letícia Viana Pereira

2012-04-01

Full Text Available Objetivo: O presente estudo tem como real objetivo o relato de um caso de Síndrome de Asperger comprado às características descritas na literatura. Metodologia: A partir de um relato de um caso atendido na Clínica Escola de Fonoaudiologia do Centro Universitário Metodista Izabela Hendrix, determinadas características foram comparadas com o descrito na literatura pertinente. Os trabalhos foram lidos, fichados e agrupados, segundos algumas características de abordagem, para posterior análise e comparação com o caso clínico relatado. Discussão e resultados: As crianças com Síndrome de Asperger são, em geral, diferentes entre si. Freqüentemente procedimentos realizados que podem ser indicados para uma criança seriam inadequados para outra. Assim, sugestões apresentadas pela literatura devem ser consideradas para melhorar a assistência à criança, como a compreensão mais abrangente e a reflexão aprofundada em relação a cada caso em específico. Conclusão: O acompanhamento e tratamento fonoaudiológico nesses casos, é de suma importância para o desenvolvimento o mais próximo possível do considerado formal na linguagem e na comunicação destes indivíduos. Vivências clínicas mostram as estratégias que podem ser sugeridas para estas crianças, lembrando que casa criança possui suas particularidades, que devem sempre ser levadas em consideração.

UMA TEORÍA CAUSAL PARA LOS CASOS FREGE

Directory of Open Access Journals (Sweden)

ABEL WAJNERMAN PAZ

2015-06-01

Full Text Available Fodor ha argumentado a favor de un par de tesis que pueden caracterizarse como constituyendo un dilema: Por un lado, si adoptamos una teoría funcional para los conceptos explicamos semánticamente los casos Frege pero caemos en el holismo semántico. Por otro lado, si adoptamos una teoría causal/informacional evitamos el holismo pero no explicamos los casos Frege semánticamente. Fodor (por ej, 1994, 1998 y 2008 intenta evitar la segunda parte del dilema argumentando que los casos de Frege pueden tener una explicación sintáctica y no semántica. En este trabajo intentaré ofrecer una salida alternativa al dilema fodoriano. Propondré una explicación semántica de los casos Frege que incorpora tanto elementos de una teoría causal como de una de rol funcional. Afirmaré que el contenido cognitivo o estrecho de un concepto (el tipo de contenido aparentemente exigido por los casos Frege es el conjunto de contenidos causales/informacionales de las representaciones que figuran en su rol funcional. Considero que individuar a las representaciones en los roles por medio de sus contenidos causales permite evitar el holismo (evitando el proceso de ramsificación típicamente empleado para individuar a los roles y que identificar el contenido cognitivo con contenidos causales/informacionales de las representaciones en los roles permite evitar el referencialismo de las propuestas causales (podemos distinguir sentido de referencia en términos causales.

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Signals and systems primer with Matlab

CERN Document Server

Poularikas, Alexander D

2006-01-01

Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

DEFF Research Database (Denmark)

Hansen, A C; Grunwald, T; Lund, Anders Henrik

2001-01-01

could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

Doenças do sistema digestório de caprinos e ovinos no semiárido do Brasil Diseases of the digestive system of sheep and goats in the semiarid region of Brazil

Directory of Open Access Journals (Sweden)

Milena A. Aragão de Lira

2013-02-01

Full Text Available As doenças do sistema digestório de caprinos e ovinos na região semi-árida do nordeste do Brasil foram avaliadas através de um estudo retrospectivo de 2.144 atendimentos de pequenos ruminantes no Hospital Veterinário da Universidade Federal de Campina Grande, Patos, Paraíba, no período de janeiro de 2000 a dezembro de 2011. Os registros foram revisados para determinar a ocorrência e as principais características clínicas, epidemiológicas e patológicas dessas enfermidades. De um total de 512 casos (23,9% de distúrbios digestivos, 367 (71,7% ocorreram em caprinos e 145 (28,3% em ovinos. As helmintoses gastrintestinais e a coccidiose foram as doenças mais frequentes, com um total de 330 casos. Os distúrbios da cavidade ruminoreticular (acidose, indigestão simples, timpanismo, e compactação ruminal totalizaram 94 casos. O abomaso foi afetado primária e secundariamente por úlceras. Casos de obstrução e compressão do trato gastrointestinal também foram observados. Malformações como atresia anal e fenda palatina foram registradas em ambas as espécies, sendo esta última associada à ingestão de Mimosa tenuiflora. Entre as doenças infecciosas foram observados cinco casos de ectima contagioso, dois casos de paratuberculose e dois casos de pitiose gastrointestinal. Em sete animais suspeitou-se de enterotoxemia e 31 casos foram diagnosticados como enterite inespecífica. A não utilização de práticas de controle integrado de parasitas e a utilização de alimentos inadequados durante o período de escassez de forragem contribuiu para a ocorrência de um grande número de doenças. A prática de conservação de forragens poderia reduzir substancialmente a ocorrência de distúrbios digestivos na região semiárida.Diseases of the digestive system of goats and sheep in the semiarid region of northeastern Brazil were evaluated by a retrospective study of 2,144 attendances of small ruminants in the Veterinary Hospital of the

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

Science.gov (United States)

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

Thermoluminescent properties of CaSO4:Dy prepared by precipitation method

International Nuclear Information System (INIS)

Roman, J.; Rivera, T.; Azorin, J.

2009-10-01

This paper reports the synthesis and thermoluminescent (Tl) characterization of CaSO 4 :Dy obtained by the precipitation method. Thermoluminescent CaSO 4 :Dy powder and Teflon (PTFE) were mixed in order to obtain samples in pellets form. Samples of CaSO 4 :Dy were exposed to a radiation gamma source of 60 Co and 90 Sr beta particles. Tl response of CaSO 4 :Dy showed a glow curve with two peaks centered at around 164 and 302 C. Tl phosphor showed a good linearity in the range from 0.5 to 30 Gy. Fading of the Tl information was 5.19 % in 37 days and presented a standard deviation of 4% for reproducibility. (Author)

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

Science.gov (United States)

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

Miastenia gravis infantil: relato de caso diagnosticado clinicamente

Directory of Open Access Journals (Sweden)

J. Rodrigo Lopes

1985-09-01

Full Text Available Registro de caso de miastenia infantil (forma congênita, em criança com 16 meses de idade. Ênfase ao diagnóstico diferencial das várias formas de miastenia na infância é dada durante a discussão do caso. O diagnóstico baseou-se na resposta imediata a teste com Neostigmina, seguido de terapêutica satisfatória com Mestinon.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

Science.gov (United States)

Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

2015-07-28

Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

Tres casos de odontomas

Directory of Open Access Journals (Sweden)

Salvador Javier Santos Medina

2015-03-01

Full Text Available Los odontomas son los tumores odontogénicos más comunes, casi siempre se diagnostican accidentalmente, en exámenes radiográficos; pueden sospecharse al retardar el brote dentario o producir maloclusiones. Se clasifican en odontomas compuestos y complejos, ambos constituidos por estructuras dentales como: esmalte, dentina, cemento y tejido pulpar. Su eliminación quirúrgica y la biopsia es el tratamiento de elección. El propósito de este trabajo es reportar tres casos de pacientes atendidos en el Hospital Pediátrico de Las Tunas, todos remitidos previamente por el ortodoncista. El primero, tipo compuesto, en un escolar de 9 años de edad, masculino, asociado a un 31 retenido; el segundo caso se trata de un gran odontoma complejo en una escolar de 11 años de edad, femenina, que produjo interferencia en el brote del 11 y el tercero compuesto; en un escolar de 10 años, masculino, en la línea media entre 11 y 21, con producción de diastema y brote del 12 por palatino. De ellos uno fue descubierto por un examen radiográfico de rutina y los otros dos sospechados por la maloclusión secundaria; todos se trataron quirúrgicamente. Estos casos demuestran la frecuencia de estos tumores en la cavidad bucal y la importancia de la realización de exámenes clínicos y radiográficos para su detección y tratamiento precoz, así como la importancia de la interrelación entre el ortodoncista y el maxilofacial en la resolución satisfactoria de esta entidad

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

Science.gov (United States)

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Blood Donation and Transfusion: A Primer for Health Educators.

Science.gov (United States)

Felts, W. Michael; Glascoff, Mary A.

1991-01-01

Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

Small Commercial Building Re-tuning: A Primer

Energy Technology Data Exchange (ETDEWEB)

Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

2013-09-30

To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

Gestión de riesgos financieros. Experiencia en un banco latinoamericano1

Directory of Open Access Journals (Sweden)

Edmundo R. Lizarzaburu

2012-10-01

Full Text Available El presente documento busca presentar los principales conceptos de riesgos financieros presentes en la banca; en particular, se trabajará el caso de un banco peruano, considerando aspectos tales como la gestión de riesgos, Basilea III y la crisis económica internacional. El caso se desarrolla en el primer semestre del 2012 en el mercado peruano.

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

Complicaciones maternas de la cesárea en gestantes a término en periodo expulsivo en un hospital general de Lima, Perú

Directory of Open Access Journals (Sweden)

Javier Puma

2015-01-01

Full Text Available Objetivo: Describir las complicaciones maternas de la cesárea en gestantes a término en periodo expulsivo en un hospital general. Material y métodos: Estudio descriptivo, observacional, retrospectivo, tipo serie de casos, realizado en el Hospital Nacional Cayetano Heredia entre el 1 de enero de 2011 hasta el 31 diciembre de 2012. Se incluyeron 67 gestantes a término operadas en periodo expulsivo. Se revisaron las historias clínicas de las pacientes, se registraron las características clínicas y las complicaciones maternas. Resultados: En el periodo de estudio se realizaron 4 218 cesáreas, siendo el 1,84% hechas en periodo expulsivo. En general, 59/ 67 (88,1% presentaron algún tipo de complicación. Se observaron 8 casos de hipotonía uterina (11,9% y 2 (2,9% de atonía. En 5 (7,4% pacientes ocurrieron desgarros de segmento adyacente a la histerotomía, siendo 2 de ellos asociados a compromiso de cuerpo uterino y vagina, y 4 (5,9% casos a laceración de arteria uterina, uno fue bilateral. No se produjeron lesiones en tracto urinario ni digestivo y tampoco hubo necesidad de reintervención quirúrgica. Cuatro pacientes presentaron hemorragia puerperal, dos asociados a hipotonía uterina post cesárea. En 56 (83,5% casos ocurrió anemia post operatoria. Hubo 1 (1,5% caso de endometritis, 3 (4,5% infecciones de herida operatoria. Conclusiones: La cesárea realizada en período expulsivo ocasiona complicaciones frecuentes, algunas muy severas.

Mayaro virus: imported cases of human infection in São Paulo State, Brazil Vírus Mayaro: casos importados de infecção humana no Estado de São Paulo, Brasil

Directory of Open Access Journals (Sweden)

Terezinha Lisieux M. Coimbra

2007-08-01

Full Text Available Mayaro virus (MAYV is an arbovirus (Togaviridae: Alphavirus enzootic in tropical South America and maintained in a sylvan cycle involving wild vertebrates and Haemagogus mosquitoes. MAYV cases occur sporadically in persons with a history of recent activities inside or around forests. This paper reports three cases of MAYV fever detected in men infected in Camapuã, MS, Brazil. Serum samples collected at four days and two months after the onset of the symptoms and examined by hemagglutination inhibition test, revealed monotypic seroconversion to MAYV. Isolation of the virus was obtained from one of the samples by inoculation of the first blood samples into newborn mice. A suspension of the infected mouse brain was inoculated into C6/36 cells culture and the virus was identified by indirect immunofluorescent assay with alphavirus polyclonal antibodies. RT-PCR, performed with RNA extracted from the supernatant of C6/36 infected cells in the presence of alphavirus generic primers as well as specific MAYV primers, confirmed these results. The reported cases illustrate the importance of laboratory confirmation in establishing a correct diagnosis. Clinical symptoms are not always indicative of a disease caused by an arbovirus. Also MAYV causes febrile illness, which may be mistaken for dengue.O vírus Mayaro (MAYV é um arbovírus do gênero Alphavirus, família Togaviridae, enzoótico na América do Sul, sendo mantido em ciclo silvestre envolvendo vertebrados e mosquitos Haemagogus. Casos de MAYV são esporádicos e ocorrem em pessoas com história de recentes atividades dentro ou próximo a florestas. Este artigo relata infecção por MAYV detectada em três pacientes, infectados em Camapuã, MS, Brasil. Amostras de sangue, coletadas no 4º dia e no 2º mês após o início dos sintomas, foram usadas para teste de inibição da hemaglutinação, que revelou soroconversão monotípica para MAYV. O isolamento do vírus foi obtido somente de uma das

DIVERTÍCULO RECTAL. REPORTE DE UN CASO

OpenAIRE

Ángel-P, Alberto; Cardona-R, Danilo

2017-01-01

RESUMEN Introducción: La enfermedad diverticular del colon es frecuente en la población general, afectando al 50% de las personas mayores de 50 años, sin embargo, los divertículos ubicados en el recto son excepcionalmente raros. El objetivo de este estudio es informar el caso de un hombre de 67 años con enfermedad diverticular de colon sigmoides y colon transverso, con un divertículo rectal que se diagnosticó durante una colonoscopia ambulatoria. Caso clínico: Hombre de 67 años quien cons...

El desarrollo de la identidad profesional del profesorado: el caso del especialista de música

Directory of Open Access Journals (Sweden)

José Luis Aróstegui Plaza

2013-01-01

Full Text Available En este artículo me propongo hacer una revisión del concepto de identidad social y de sus implicaciones para la formación del profesorado de música. Para ello hablaré, en primer lugar, de los conceptos de «identidad social» y de su variante, las «identidades sonoras», que forma parte de él. En segundo, se verá su implicación para la formación de la «identidad profesional» del profesorado de música. Finalmente, haré una reflexión de las consecuencias que pueden sacarse para toda la formación del profesorado. El caso del profesorado de música puede ser ilustrativo de cómo una concentración en contenidos o en competencias, las mismas para todo el mundo, nos lleva a un modelo de profesorado muy distinto a otro centrado en la comprensión del significado de las interacciones que se producen en el aula. Me propongo, pues, ofrecer datos que puedan ser interesantes para quienes estén interesados en la formación del profesorado de música, al tiempo que se aborda una cuestión relevante para la formación del profesorado en general.

De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

Directory of Open Access Journals (Sweden)

Christopher A Gulvik

Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Primers As Socializing Agents in American and Finnish Schools.

Science.gov (United States)

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

Angioedema recorrente – caso clínico

Directory of Open Access Journals (Sweden)

Sandrina Martins

2016-02-01

Full Text Available Introdução: O Angioedema hereditário (AEH é uma causa rara de angioedema recorrente, resultante de um defeito a nível do gene que codifica o inibidor do C1 esterase (C1 -INH. O edema envolve predominantemente os tecidos da face, membros, trato gastrointestinal e área genital. O envolvimento da laringe, apesar de menos frequente, constitui a expressão clínica mais grave, sendo potencialmente fatal. Caso clínico: Descreve -se o caso clínico de uma criança do sexo feminino de oito anos de idade referenciada à consulta de pediatria por episódios recorrentes de angioedema. O estudo efetuado revelou tratar -se de um caso de AEH. Discussão: O diagnóstico, estabelecido com base no quadro clínico, estudo do complemento e história familiar, é de importância fundamental considerando que o AEH é potencialmente fatal e exige uma terapêutica específica.

Distrofia neuroaxonal infantil: relato de dois casos

Directory of Open Access Journals (Sweden)

SCOLA ROSANA HERMINIA

1999-01-01

Full Text Available Descrevemos dois casos de distrofia neuroaxonal infantil ou doença de Seitelberger, que é doença rara, neurodegenerativa, com herança autossômica recessiva. O primeiro caso, sexo masculino, com 8 anos de idade, apresentava atraso do desenvolvimento psicomotor, ataxia e fraqueza muscular. Ao exame físico foi encontrado nistagmo horizontal e vertical com palidez do disco óptico, hipotonia e arreflexia profunda. O segundo caso, sexo masculino, com 1 ano e 6 meses de idade, apresentava atraso do desenvolvimento psicomotor e convulsões. No exame físico, apresentava atrofia de nervo óptico, hipertonia e hiperreflexia. A biópsia de nervo sural de ambos os pacientes mostrou aumento dos axônios, compatível com distrofia neuroaxonal. As características clínicas pleomórficas, bem como os achados neurofisiológicos variáveis tornam difícil firmar o diagnóstico, o qual é ajudado pela confirmação anatomopatológica dos esferóides neuroaxonais.

Organización y liderazgo en la construcción de un Sistema Agroalimentario Localizado. Un estudio de caso sobre el nopal en Hidalgo, México

Directory of Open Access Journals (Sweden)

Jesús Gerardo Torres Salcido

2018-01-01

Full Text Available Objetivo: analizar el papel que juegan la organización y los liderazgos en la construcción de los Sistemas Agroalimentarios Localizados (SIAL. En este sentido, se describe el funcionamiento organizativo y el papel de los liderazgos por medio de un estudio de caso de una organización cuya actividad fundamental es la producción de nopal orgánico en la localidad de El Rincón, ubicada en el estado de Hidalgo, México. Metodología: tipo participativa. Consistió en visitas a campo, entrevistas semiestructuradas y no estructuradas, reuniones con productores y análisis FODA. Resultados: las organizaciones verticales y los liderazgos centralizados pueden impulsar un desarrollo del SIAL en un primer momento, pero son un obstáculo y una limitante en otros momentos que se distinguen por la desaparición, física o virtual, del liderazgo. Limitaciones: si bien se trata de un primer trabajo de acompañamiento para el desarrollo de un SIAL, es necesario recomponer previamente las relaciones de confianza entre la comunidad, dañadas por la inoperancia de la organización y de los actuales liderazgos. Conclusiones: adicionalmente al restablecimiento de relaciones de confianza, la organización debe ser más abierta para impulsar y valorizar el nopal como un producto diferenciado con un alto potencial para el desarrollo territorial.

Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

NARCIS (Netherlands)

RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

1990-01-01

We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

Directory of Open Access Journals (Sweden)

Anderson Pinheiro de Freitas

2004-06-01

Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

A method for automatically extracting infectious disease-related primers and probes from the literature

Directory of Open Access Journals (Sweden)

Pérez-Rey David

2010-08-01

Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

Comprometimento medular por linfoma tipo Burkitt: relato de um caso

Directory of Open Access Journals (Sweden)

Murillo Côrtes Drummond

1985-06-01

Full Text Available Registro de caso de linfoma tipo Burkitt com comprometimento intrarraqueano em criança de três anos de idade. Considerações sobre esse tipo de tumor são feitas em função do caso observado e de dados da literatura.

La jurisdicción del Tribunal Europeo de Derechos Humanos en casos de extradición. A propósito del caso Klein c. Rusia

Directory of Open Access Journals (Sweden)

Jan Schneider

2010-12-01

Full Text Available Analizamos la decisión del Tribunal Europeo de Derechos Humanos –TEDH– en el caso Klein c. Rusia de un ciudadano israelí requerido en extradición por Colombia para la ejecución de una sentencia por entrenamiento de grupos paramilitares. La decisión es presentada en el marco más amplio de la jurisprudencia del TEDH en casos de extradición desde Estados europeos a terceros Estados donde existe el riesgo de violación de los derechos humanos. Desarrollamos los principios que el TEDH aplica en estos casos y verificamos su aplicación en el caso Klein c. Rusia, tomando en cuenta también la opinión separada de los jueces minoritarios. En las conclusiones presentamos una perspectiva sobre cómo evitar la impunidad de perpetradores de violaciones de derechos humanos que no pueden ser extraditados por razones humanitarias.

Carlo Caso (1940 - 2007)

CERN Multimedia

Leonardo Rossi

Carlo Caso (1940 - 2007) Our friend and colleague Carlo Caso passed away on July 7th, after several months of courageous fight against cancer. Carlo spent most of his scientific career at CERN, taking an active part in the experimental programme of the laboratory. His long and fruitful involvement in particle physics started in the sixties, in the Genoa group led by G. Tomasini. He then made several experiments using the CERN liquid hydrogen bubble chambers -first the 2000HBC and later BEBC- to study various facets of the production and decay of meson and baryon resonances. He later made his own group and joined the NA27 Collaboration to exploit the EHS Spectrometer with a rapid cycling bubble chamber as vertex detector. Amongst their many achievements, they were the first to measure, with excellent precision, the lifetime of the charmed D mesons. At the start of the LEP era, Carlo and his group moved to the DELPHI experiment, participating in the construction and running of the HPC electromagnetic c...

Tumor neuroendocrino de la mama. Presentación de un caso y revisión de la literatura

Directory of Open Access Journals (Sweden)

Lidia Torres Aja

2017-04-01

Full Text Available Los carcinomas neuroendocrinos primarios de mama son neoplasias raras que representan entre un 2 y un 5 % de los tumores mamarios. Para su diagnóstico se requiere que más del 50 % del tumor presente marcadores neuroendocrinos. Estos tumores que se observan principalmente en mujeres de edad avanzada se presentan como una masa bien delimitada, generalmente no acompañada de adenopatías axilares. El pronóstico de este tipo de cáncer todavía no está muy claro, aunque estudios recientes demuestran que es similar al de los carcinomas ductales infiltrantes convencionales. Se presenta el caso de una paciente de 76 años que acudió a consulta por presentar gran tumoración que ocupaba prácticamente toda la mama derecha sin adenopatías axilares y la cual fue informada mediante biopsia por parafina como un carcinoma neuroendocrino. Este es el primer tumor de esta característica histológica diagnosticado en Cienfuegos, por lo cual se considera de interés científico su publicación.

Primer on molecular genetics. DOE Human Genome Program

Energy Technology Data Exchange (ETDEWEB)

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Afasia global sem hemiparesia: relato de caso

OpenAIRE

SILVA,MARCUS TULIUS TEIXEIRA DA; CAVALCANTI,JOSÉ LUÍS DE SÁ; MOREIRA,DENISE MADEIRA

2000-01-01

Afasia global geralmente é acompanhada por hemiparesia direita devido à extensão da lesão subjacente. Recentemente têm sido registrados na literatura casos em que tal síndrome ou não se acompanha do déficit motor ou este é apenas transitório, sendo esta condição conhecida como afasia global sem hemiparesia (AGSH). Relatamos caso de AGSH devido a infarto cerebral embólico cardiogênico, corroborando a tese de que esta condição pode ter valor preditivo para o diagnóstico de infartos embólicos....

Mielopatia necrotizante e neoplasias: registro clinico-patologico de dois casos

Directory of Open Access Journals (Sweden)

Marcos R. G. de Freitas

1983-06-01

Full Text Available São relatados dois casos de mielopatia transversa subaguda associada a tumores malignos. O primeiro paciente apresentava neoplasia de células reticulares histiocitárias e o segundo, carcinoma renal. Os autores fazem revisão dos casos similares descritos na literatura. As alterações anátomo-patológicas medulares encontradas foram semelhantes às descritas nos relatos prévios, sendo que no primeiro caso havia também intenso infiltrado inflamatório perivascular e a presença de astrócitos bizarros. Tais alterações encontradas sugerem ser esta afecção de natureza viral.

Development of Thermoluminescence Dosimeter CaSO4:Dy as Personal and Environmental Dosimeters

International Nuclear Information System (INIS)

Hasnel Sofyan

2009-01-01

Development of personal and environmental dosimeters using material phosphors of CaSO 4 :Dy powder in form capillary glass and disc teflon thermoluminescence (TL) dosimeter have been done. TL dosimeter CaSO 4 :Dy powder used can record dose response less than 0.01 mGy. Fading of TL dosimeter capillary glass after 29 days is 25%. In 1 batch, making of CaSO 4 :Dy powder can obtain 2 groups of dosimeter capillaries with coefficient variance smaller than 10%. This discrepancy caused difference in powder making and reading of the TL dosimeter. TL dosimeter CaSO 4 :Dy teflon disc with dia. 5 mm and 0.8 mm thickness is homogeneous mixture between phosphor powder with dia. 80 to 150 mesh and teflon powder dia. 20 μm. The composition of CaSO 4 :Dy and teflon in TL dosimeter influence sensitivity of the dosimeter. It’ concluded that in order to obtain optimal sensitivity of TL dosimeter, the composition of CaSO 4 :Dy and teflon is 3 and 1 with pressured of disc in 700 MPa. (author).

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

A Primer on Concepts and Applications of Proteomics in Neuroscience

DEFF Research Database (Denmark)

Hosp, Fabian; Mann, Matthias

2017-01-01

The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

Science.gov (United States)

Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

1996-07-01

To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

Insulinoma canino: relato de caso

Directory of Open Access Journals (Sweden)

L. Padovani

Full Text Available RESUMO O insulinoma é um tumor das células β do pâncreas, que têm a função de produzir e secretar insulina e, geralmente são malignos em cães. O presente trabalho descreve o diagnóstico e o manejo terapêutico de três casos de insulinoma. Os sinais clínicos dos animais relatados variaram de acordo com a severidade e a duração da hipoglicemia. O diagnóstico presuntivo se deu através dos sinais clínicos e da dosagem de insulina sérica no momento de mais intensa hipoglicemia e, o diagnóstico definitivo foi obtido por meio de exame histopatológico nos três casos relatados. O tratamento realizado variou de acordo com a intensidade dos sinais clínicos.

Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

Science.gov (United States)

2018-01-18

This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

DEFF Research Database (Denmark)

Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

2014-01-01

Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

Directory of Open Access Journals (Sweden)

S Hamid Raji

2011-01-01

Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

Escorpionismo: presentación de un posible caso grave ocurrido en la Ciudad Autónoma de Buenos Aires

Directory of Open Access Journals (Sweden)

Patricia C Docampo

2011-06-01

Full Text Available El escorpionismo, en su aspecto clínico es un envenenamiento de causa accidental producido por la inoculación del veneno de un alacrán o escorpión, que en Argentina ocurre predominantemente en áreas urbanas, en el ámbito domiciliario o peridomiciliario. En nuestro país son tres las especies de escorpiones de interés médico-sanitario: Tityus (T. trivittatus, T. confluens y T. bahiensis. El cuadro clínico se caracteriza por presentar dolor agudo con escaso compromiso cutáneo y manifestaciones sistémicas que, sin tratamiento pueden provocar la muerte, principalmente en niños. El objetivo de esta comunicación es dar a conocer el primer caso de escorpionismo grave, ocurrido en la Ciudad Autónoma de Buenos Aires, en una niña de 4 años de edad y describir el cuadro clínico característico y la necesidad del tratamiento precoz en los casos moderados y severos.Scorpionism in its clinical aspect is an envenoming caused by accidental sting and inoculation of venom from a scorpion, which in Argentina occurs predominantly in urban areas, in the home environment or peridomiciliary. In our country there are three species of scorpions of medical-health concern: Tityus (T. trivittatus, T. confluens and T. bahiensis. The clinical picture is characterized by severe pain with limited cutaneous and systemic manifestations, that without treatment can cause death, especially in children. The aim of this communication is to present the first case of severe scorpionism occurred in the City of Buenos Aires, in a 4 years old girl, and to describe the characteristic clinical picture and the need for early treatment in moderate and severe cases of scorpionism.

Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

Science.gov (United States)

Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

2010-03-01

Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

Science.gov (United States)

Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

2013-01-01

Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-07-01

Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

Development of a microsatellite primer set to investigate the genetic ...

Indian Academy of Sciences (India)

Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

Development of specific primers for genus Fusarium and F. solani ...

African Journals Online (AJOL)

Yomi

2012-01-05

Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Miopia aguda induzida por topiramato: relato de dois casos

Directory of Open Access Journals (Sweden)

Kathy Dadam Sgrott

2011-06-01

Full Text Available RESUMO A miopia aguda pode ser desencadeada pelo uso de medicações sistêmicas, dentre elas, o anticonvulsivante topiramato. Este trabalho descreve dois casos de pacientes jovens com quadro agudo bilateral de miopia induzida por terapia com topiramato para controle de síndrome depressiva, fazendo relação com casos semelhantes descritos na literatura e revisão bibliográfica pertinente.

Cuatrocientos setenta y siete casos de uretritis masculina

Directory of Open Access Journals (Sweden)

Federico Díaz González

1985-12-01

Full Text Available En el año de 1985 se estudiaron, desde el punto de vista del laboratorio, 477 casos de uretritis masculina; 49 de ellos (10.3% fueron de uretritis gonocócica (UG y 428 (89.7% de uretritis no gonocócica (UNG. Estos resultados concuerdan con los obtenidos en series previas; se discute la importancia de la UNG y se plantea la posibilidad de que muchos de los casos de esta entidad sean de la modalidad postgonocócica (UPG.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

Science.gov (United States)

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO

Directory of Open Access Journals (Sweden)

Marco Suárez

2006-05-01

Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

Oftalmoplegia extrínseca progressiva: registro de três casos

Directory of Open Access Journals (Sweden)

Luiz Antonio Alves Duro

1982-12-01

Full Text Available São relatados 3 casos de pacientes femininos com atrofia dos músculos oculares extrínsecos, sendo 2 de início provável aos 25 anos e 1 aos 56 anos. No que se referem às intercorrencias não miogênicas, no caso 1 havia otoscle-rose, comum na família e incapacidade para engravidar. A menarca ocorreu aos 19 anos e a menopausa aos 40, o que igualmente ocorreu com o caso 2, este o único a mostrar alterações eletrocardiográficas. No caso 3 havia sinal de Romberg e hiporreflexia profunda, sendo comum a incidência de catarata congênita. Com relação à patologia muscular, apesar das queixas serem praticamente restritas aos músculos extrínsecos oculares, procedemos à biópsia de outros músculos, além dos oculares, evidenciando-se em todos acometimento do tipo miogênico, o mesmo ocorrendo na EMG. Acreditamos tratar-se de processo miogênico difuso, em que pese a dominância das manifestações oculares.

Ares, Janus, Globalization: A Primer For The Military Leader in NATO

National Research Council Canada - National Science Library

Clemons, Dean

2002-01-01

...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

Bayesian models a statistical primer for ecologists

CERN Document Server

Hobbs, N Thompson

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

Toracoplastia traumática: relato de caso

OpenAIRE

Addor,Gabriela; Monteiro,Andreia Salarini; Nigri,David Henrique; Judice,Luiz Felippe; Haddad,Rui; Franco,Carlos Alberto de Barros

2007-01-01

O trauma é uma doença que afeta predominantemente os jovens, sendo a principal causa de morte nas primeiras três décadas de vida. O tórax instável é observado em aproximadamente 10% dos casos de trauma de tórax, com mortalidade de 10-15%. O caso clínico apresentado refere-se a uma paciente, vítima de acidente automobilístico, com trauma de tórax, ocasionando hemopneumotórax e fratura de múltiplos arcos costais, dor de difícil controle e deformidade torácica. São discutidas as opções terapêuti...

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

O CASO MOREL: UM CASO DE INVESTIGAÇÃO LITERÁRIA MOREL CASE: A CASE OF LITERARY RESEARCH

Directory of Open Access Journals (Sweden)

JOANA DARC RIBEIRO

2000-01-01

Full Text Available Este estudo tem por objetivo a leitura do romance O Caso Morel, de RubemFonseca, cujo enfoque recai sobre o problema do personagem-escritor e o dacriação ficcional tematizados no espaço romanesco. Ao lado de uma“investigação policial” o leitor depara nesse primeiro romance do autor comuma “investigação literária” problematizada em vários níveis.The aim of this paper is the reading of O Caso Morel, by Rubem Fonseca,focusing on the character-writter and fictional creation. Besides a detectiveinvestigation we can find in the author’s first novel a problematic literacyinvestigation in several levels.

Hemofilia A neonatal: reporte de un caso en Sincelejo (Colombia

Directory of Open Access Journals (Sweden)

Jorge Mendoza-Herrera

2013-01-01

Full Text Available La hemofilia es una enfermedad hemorrágica hereditaria caracterizada por la deficiencia funcional o cuantitativa del factor VIII (hemofilia A o del factor IX (hemofilia B de la coagulación. El diagnóstico de la hemofilia es eminentemente clínico; situación clave que ofrece una ventana de oportunidad para que el médico de primer nivel de atención esta - blezca un diagnóstico oportuno y eficiente. Los datos clínicos de los dos tipos de hemofilia son sustancialmente idénticos y varían solo en relación con el grado de la deficiencia. En este trabajo se describe un caso de un recién nacido que presentó un hematoma como consecuencia de una venopunción. El paciente presentó prolongación en el tiempo parcial de tromboplastina y una disminución del Factor VIII de la coagulación, confirmándose el diagnóstico de hemofilia A. Se inició tratamiento con factor VIII recombinante y el paciente presentó una gran mejoría de cuadro clínico. Este trabajo tiene como objetivo alertar al cuerpo médico sobre la importancia de conside - rar esta enfermedad dentro del diagnóstico diferencial en los síndromes hemorrágicos del recién nacido, incluso sin la existencia de antecedentes famili ares. El tratamiento apropiado generará un impacto positivo en la salud de los pacientes y su familia, reduciendo con ello las complicaciones, costos por hos pitalización y muerte.

Pesquisaje activo de sospechas de reacciones adversas a medicamentos en el Hospital "Dr. Salvador Allende: Primer semestre 2006 Active screening of suspicions of adverse reactions to drugs in "Dr. Salvador Allende" Hospital: First semester 2006

Directory of Open Access Journals (Sweden)

José de Jesús Rego Hernández

2007-12-01

Full Text Available Se realizó un estudio descriptivo mediante la revisión diaria del movimiento hospitalario, obtenido en el Departamento de Registros Médicos del Hospital "Dr. Salvador Allende" desde enero hasta junio de 2006 a fin de poder identificar los ingresos susceptibles de ser reacciones adversas a medicamentos, con el objetivo de detectar la frecuencia de ingresos por sospechas de reacciones adversas a medicamentos, así como de caracterizar a estos pacientes. Se llenó una planilla de notificación para cada sospecha de reacción adversa y se analizaron los datos contenidos en las historias clínicas respectivas. Se utilizó una base de Excel diseñada al efecto por el Centro para el Desarrollo de la Farmacoepidemiología. Ingresaron 6 201 pacientes, de los cuales 384 eran susceptibles de tener una reacción adversa a medicamentos (6,2 % y finalmente, se consideraron 57 pacientes cuyo motivo de ingreso se relacionó con algún medicamento (0,9 %. El 66,7 % de los casos eran mayores de 60 años de edad, sin diferencias en cuanto al sexo. Los grupos farmacológicos con mayores afectaciones fueron los analgésicos no opiodes (59,7 % y los antibacterianos (19,4 %. El sangramiento digestivo alto resultó la reacción adversa que más se encontró (57,9 %, con predominio en mayores de 60 años de edad (72,7 %; el ácido acetilsalicílico estuvo presente en el 66,7 % de los casos con este diagnóstico. En el75,5 % de los casos la reacción se consideró como graveA descriptive study was conducted by the daily revision of hospital movement obtained in the Department of Medical Registries of "Dr. Salvador Allende" Hospital from January to June, 2006, aimed at identifying the admissions susceptible to adverse reactions to drugs to detect the frequency of admissions due to suspicions of adverse reactions to drugs, as well as to characterize these patients. A notification form was filled in per each suspicion of adverse reaction, and the data contained in the

A web-based adaptive tutor to teach PCR primer design

NARCIS (Netherlands)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

A Web-based Adaptive Tutor to Teach PCR Primer Design

NARCIS (Netherlands)

Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

Radiation protection primer

International Nuclear Information System (INIS)

Aigner, R.; Melzer, E.; Seissler, H.

1986-01-01

This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

Bond strength of primer/cement systems to zirconia subjected to artificial aging.

Science.gov (United States)

Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

2016-11-01

Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

¿Pueden los niños adquirir y aplicar conocimientos de emprendimiento?. El caso del subprograma, mi primer empresa: “emprender jugando”

Directory of Open Access Journals (Sweden)

Javier Damián Simón

2015-01-01

Full Text Available En México el tema de la Educación en Emprendimiento (EE en escuelas primarias es una línea emergente en la investigación educativa. El objetivo principal de la investigación fue evaluar la estructura y puesta en marcha de los planes de negocio elaborados por niños en el marco del subprograma Mi Primer Empresa: “emprender jugando”. La investigación fue descriptiva y exploratoria. Participaron 26 alumnos, 15 varones y 11 mujeres que cursaban el quinto y sexto grado en la Escuela Primaria Rural Benito Juárez ubicada en la localidad del Edén del municipio de San Juan Bautista Tuxtepec, Oaxaca. Se estudiaron tres variables: plan de negocio, conocimientos teóricos de emprendimiento y, habilidades de emprendimiento infantil. Se aplicó un cuestionario y un documento base de la estructura del plan de negocios que proporcionó la Fundación Educación Superior Empresa (FESE y, el análisis de la información fue hecha mediante el software estadístico SPSS V.19. En términos generales los resultados muestran que los participantes sí adquirieron y aplicaron conocimientos teóricos de emprendimiento pues fueron capaces de desarrollar el plan de negocio correspondiente a su mini empresa.

Incorporating travel-time reliability into the congestion management process : a primer.

Science.gov (United States)

2015-02-01

This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

Bayesian models: A statistical primer for ecologists

Science.gov (United States)

Hobbs, N. Thompson; Hooten, Mevin B.

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

Science.gov (United States)

Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

2016-01-01

Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

Comparison of the TL intensity of the sintered composites of CaSO4+Tm

International Nuclear Information System (INIS)

Junot, O.D.; Sousa, F.L. de; Chagas, M.A.P.; Souza, D.N.

2009-01-01

The objective of this work is to compare the thermoluminescent intensity (TL) of CaSO 4 +Tm, CaSO 4 +Tm+glass and glass+Tm composites for use as thermoluminescent dosimeter (TLD). The route used to prepare the CaSO 4 +Tm and the CaSO 4 +Tm+glass was by mixing 1 g of CaSO 4 with 0.02 g of thulium oxide (99,9% purity) and 0.3 g of commercial and colorless glass. To mixing the composites were taken to a magnetic stirrer for 30 min with 10 mL of distilled water for better homogenization. The powder mixtures were dried in a stove at 100 deg C for 24 h. After drying, it was added polyvinyl alcohol (PVA) to improve the binding material. The pellets were compacted by application of an uniaxial pressing and sintered at 700 deg C/ 6 h. The route used in the preparation of glass+Tm pellets was similar to one previously mentioned, except by the use of 1 g of glass and 0.02 of Tm. After the sintering, the pellets dimensions were 1 mm thick and 6 mm in diameter. All samples were irradiated by a beta source ( 90 Sr + 90 Y) and received doses from 1.00 Gy to 20 Gy. Each composite presented a characteristic emission curve. The dosimeter of CaSO 4 +Tm+glass presented two peaks, the first at 115 deg C, and the second, very intense, ate 150 deg C. The CaSO 4 +Tm dosimeter showed a less intense peak at 140 deg C and another, more intense, at 235 deg C. In the composites of glass+Tm, the most intense peak has a thermoluminescent signal 94,04% lower than the most intense peak of CaSO 4 +Tm+glass and 81.57% lower than the most intense peak of CaSO 4 +Tm. After the analysis of TL emission curves, we observed that the CaSO 4 +Tm+glass have the highest TL intensity and a TL response proportional to the dose absorbed. (author)

El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

Directory of Open Access Journals (Sweden)

Fernanda Martins Castro

2015-06-01

Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

International Nuclear Information System (INIS)

D. S. Lucas

2004-01-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

Science.gov (United States)

Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

2016-01-01

Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

Science.gov (United States)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

A Primer on Observational Measurement.

Science.gov (United States)

Girard, Jeffrey M; Cohn, Jeffrey F

2016-08-01

Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

Leptospirosis: serie de casos en un centro penitenciario de la costa de Ecuador

Directory of Open Access Journals (Sweden)

D. Valarezo-Sevilla

2014-06-01

Full Text Available Se describe los casos de dos pacientes inicialmente diagnosticados como dengue e infección urinaria. Los pacientes eran personas privadas de la libertad en la misma prisión y estuvieron en contacto con agua dulce estancada aproximadamente dos semanas antes del inicio de los síntomas durante las fiestas del carnaval, siendo el sitio probable de la contaminación. El tiempo transcurrido entre el ingreso al hospital y la sospecha de leptospirosis (y el inicio del tratamiento fue de cuatro días para el paciente del caso 1 y dos días para el caso 2; entre el ingreso y la confirmación diagnóstica por laboratorio fue de diez días para el caso 1 y cuatro días para el caso 2. Se concluye que la leptospirosis no se considera como una opción dentro del diagnóstico diferencial inicial sino luego de descartar otras patologías.

Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

Directory of Open Access Journals (Sweden)

Julio J. Masquijo

2014-10-01

Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

Science.gov (United States)

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

Science.gov (United States)

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

Directory of Open Access Journals (Sweden)

Douglas de Almeida Pereira

2015-09-01

Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

Los informes contables externos y la legitimidad organizacional con el entorno: estudio de un caso en Colombia

Directory of Open Access Journals (Sweden)

Mauricio Gómez Villegas

2009-08-01

Full Text Available Este documento es una aproximación académica a la contabilidad y a los informes contables externos. Su preocupación es la caracterización y comprensión del papel de la contabilidad en las organizaciones y en la sociedad. Por ello sintetiza la visión económica dominante y algunas de las perspectivas sociales e institucionales sobre el rol de la contabilidad y la información contable financiera. Parte de la pregunta: ¿Aporta la contabilidad al propósito de legitimidad organizacional con el entorno? Así, el objetivo del trabajo es realizar una síntesis de las visiones que explican el papel de los informes contables externos, los estados financieros particularmente, desde la visión dominante y desde una perspectiva neoinstitucional en contabilidad. Para ello el documento recoge un primer estudio de caso, que pretende aportar a la necesaria contrastación empírica para la comprensión del rol de la contabilidad en Colombia. Adoptamos la visión según la cual, ante todo, la información contable desempeña un rol institucional, como mecanismo de legitimación de la organización con su entorno

CRIPTOCOCOSE: RELATO DE CASO

Directory of Open Access Journals (Sweden)

Fernanda Alvarez GENTIL

2016-12-01

Full Text Available Criptococose, doença infecciosa fúngica, oportunista, potencialmente fatal, que acomete animais silvestres e domésticos, principalmente cachorro e gato e o homem. Causada pela levedura, Cryptococcus neoformans. Mais frequente em adultos, comumente diagnosticada em pacientes imunodeprimidos, como os soropositivos, fator predisponente mais frequente. Outros fatores são: uso prolongado de medicações imunossupressoras, doenças como diabetes, sarcoidose, doença de Hodgkin e outras neoplasias hematológicas, lúpus eritematoso, artrite reumatoide, doença de Behçet, e transplante de vísceras sólidas. Geralmente adquirida pela inalação do agente etiológico. Objetivo: este estudo objetiva relatar o caso de um paciente portador de criptococose, que esteve invernado no Hospital São José do Avaí (HSJA de Itaperuna, no mês de setembro de 2016, corroborando na literatura descrita sobre o tema, justifica-se o tema pela raridade do caso. Metodologia: inicialmente realizou-se pesquisa bibliográfica através da seleção de autores que asseguraram uma fundamentação teórico-metodológica que serviu de arcabouço para o desenvolvimento do estudo. A metodologia apresentada refere-se a um relato de caso, realizado a partir do prontuário do paciente e dos exames disponíveis. Resultados: a Radiografia de tórax evidenciou massa pulmonar em lobo inferior direito e a Tomografia de tórax também demonstrou esse acometimento; sendo realizada biópsia desse fragmento, que consolidou o diagnóstico de criptococose. A lâmina do paciente, corada com hematoxilina-eosina demonstrou aspectos característicos do acometimento por esse fungo. Conclusão: para o tratamento, pode-se utilizar antifúngicos como a anfotericina B associado com 5-flucitosina, em infecções disseminadas; ou fluconazol e itraconazol, para infecções cutâneas. 

La responsabilidad en el derecho penal internacional: una aproximación desde la filosofía de John Searle. Reflexiones a partir del caso Lubanga

Directory of Open Access Journals (Sweden)

Rodrigo A. González Fernández

2013-06-01

Full Text Available En este trabajo examinamos el tópico de la responsabilidad en el derecho penal internacional a la luz de la filosofía de John Searle, y del fallo dictado por la Corte Penal Internacional en el caso de Thomas Lubanga. En el primer acápite analizamos la declaración de responsabilidad penal en función de la teoría de actos de habla de Austin y de Searle, tratándola como un acto ilocucionario cuyo significado es dependiente de un marco institucional específico. Luego, en el segundo acápite, mostramos de qué forma tal marco puede reconstruirse como un ejemplo paradigmático de la realidad social construida descrita por Searle, especialmente en virtud del nexo entre mente, lenguaje y sociedad. A nuestro juicio, los conceptos de intencionalidad colectiva, atribución de funciones de estatus y poderes deónticos son fundamentales para entender tal nexo. En efecto, tal como argumentamos en la tercera sección, los sistemas de poderes deónticos asociados al derecho internacional no solo explican la aparición de Tribunales penales internacionales, como la Corte Penal Internacional, sino además el carácter imprescriptible de los crímenes de lesa humanidad. Los acuerdos internacionales que promueven y protegen los derechos humanos, y que tratan la imprescriptibilidad de aquellos crímenes, son objeto de análisis en la sección final, en donde exponemos algunas reflexiones finales a partir del caso Lubanga.

Acomodar, ordenar y leer. La disposición de los libros en acervos novohispanos durante la segunda mitad del siglo XVIII

Directory of Open Access Journals (Sweden)

Manuel Suárez Rivera

2015-06-01

Full Text Available El articulo representa un primer acercamiento a la forma en que los novohispanos acomodaban sus libros en los estantes, tanto de bibliotecas particulares como de librerías durante la segunda mitad del siglo XVIII. A partir de una serie de inventarios levantados por el control que llevaba el Santo Oficio, estudio brevemente algunos casos concretos en donde se revela la forma en la que estaban dispuestos los volúmenes; en un primer momento me refiero a bibliotecas particulares y después algunas librerías. Luego del análisis, es claro que el tamaño de los libros fue el criterio predominante en el acomodo, seguidos de una laxa clasificación temática y, en algunos casos, el estado físico de los libros.

Babesiose cerebral em bovinos: 20 casos

Directory of Open Access Journals (Sweden)

Rodrigues Aline

2005-01-01

Full Text Available Num estudo retrospectivo de 1.071 necropsias de bovinos, foram encontrados 20 casos de babesiose cerebral confirmados pelo exame de esfregaços do córtex telencefálico. A maioria desses casos ocorreu no verão, em bovinos adultos de raças européias ou suas cruzas. Além dos sinais clínicos neurológicos, observou-se hemoglobinúria, anorexia, febre, taquicardia, taquipnéia e queda na produção de leite. O hemograma realizado em cinco bovinos afetados revelou acentuada anemia regenerativa; em média, 20% dos eritrócitos estavam parasitados por Babesia bovis. Na necropsia de todos os casos, a substância cinzenta dos córtices telencefálico e cerebelar e dos núcleos da base era consistente e caracteristicamente róseo-cereja. Essa coloração devia-se ao seqüestro de eritrócitos nos capilares encefálicos. Nesses eritrócitos, podiam-se observar, tanto em esfregaços do córtex como em preparações histológicas do encéfalo, microorganismos com morfologia compatível com B. bovis. Outros achados de necropsia incluíam hemoglobinúria, rins vermelho-escuros, hepatoesplenomegalia, fígado vermelho-alaranjado, icterícia, hemorragias epicárdicas e endocárdicas e edema e congestão dos linfonodos mesentéricos.

EL PRIMER APORTE DE LOS OBISPOS CHILENOS A LA CODIFICACIÓN DEL DERECHO CANÓNICO DE 1917: LOS POSTULATA EPISCOPORUM ACERCA DEL MATRIMONIO

Directory of Open Access Journals (Sweden)

Carlos Salinas Araneda

2008-12-01

Full Text Available La redacción del primer Código de Derecho Canónico que tuvo la Iglesia latina fue ordenado por el papa san Pío X, en 1904. La tarea codificadora, empero, no fue obra de un grupo cerrado de expertos, sino que tuvo en cuenta el parecer del episcopado, el que fue consultado en dos momentos diferentes; en ambos casos fueron requeridos los obispos chilenos. En este trabajo se estudia, a partir de la documentación guardada en el Archivo Secreto Vaticano, el aporte de los obispos chilenos en la primera consulta, realizada en 1904, en lo referido al matrimonio.The drafting of the first Código de Derecho Canónico of the Latin Church was established by Pope Pío X in 1904. The codifying task, however, was not the result of a closed group of experts. It considered the opinión of bishops around the world who were consulted in two different moments. In both cases, Chilean bishops were requested to provide their opinions. This work, which is based on documents from the Vatican Secret Archives, studies the contribution of Chilean bishops to the marriage discussion in the first round of consultation of 1904.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Denilce Meneses Lopes

2010-01-01

Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

Grúa para obras de gran altura

Directory of Open Access Journals (Sweden)

Hochtief, AG

1961-12-01

Full Text Available En las construcciones modernas donde las estructuras se extienden predominantemente en altura, caso corriente en los llamados rascacielos, entre los elementos auxiliares de obra se encuentra, en primer lugar, la grúa.

Aprender a dormir sin mam??: estudio de casos

OpenAIRE

??lvarez Lozano, Marta

2015-01-01

Dado el caso de un ni??o con un h??bito incorrecto de sue??o, con sus correspondientes consecuencias, se lleva a cabo un estudio de casos que pretende modificar este h??bito a trav??s de un programa de intervenci??n basado en la reeducaci??n del sue??o mediante la modificaci??n de conducta. Para proceder a modificarla se ha trabajado con un m??todo de desensibilizaci??n sistem??tica, que a su vez, se ayuda de un sistema de econom??a de fichas para causar motivaci??n en el sujeto, y adem??s, d...

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

Directory of Open Access Journals (Sweden)

Ana Paula Morales Cobra Carvalho

2009-06-01

Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.

Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

Science.gov (United States)

Corman, Rena

This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

Science.gov (United States)

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

OpenAIRE

Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

2015-01-01

Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

A primer on the mortgage market and mortgage finance

OpenAIRE

Daniel J. McDonald; Daniel L. Thornton

2008-01-01

This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

Science.gov (United States)

Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

2018-02-01

The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

A primer on pseudorandom generators

CERN Document Server

Goldreich, Oded

2010-01-01

A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

A primer on quantum fluids

CERN Document Server

Barenghi, Carlo

2016-01-01

The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

Making the connection: advancing traffic incident management in transportation planning : a primer.

Science.gov (United States)

2013-07-01

"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

Science.gov (United States)

Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

Angioma de iris: a propósito de un caso

Directory of Open Access Journals (Sweden)

José L. Torres-Peña

2017-07-01

Discusión: Sintomáticamente lo más frecuente en los angiomas de iris es el hifema transitorio como pudo presentar nuestro paciente, aunque también se ha descrito aumentos de la presión intraocular producto de los hifemas de repetición en algún caso aislado. El manejo habitual es la observación aunque algunos casos requieren resección quirúrgica.

Estudio de caso de los sMOOC y su pedagogía en el contexto online//Case Study of sMOOC and its Pedagogy in the online context

Directory of Open Access Journals (Sweden)

Julia Mañero Contreras

2016-07-01

Full Text Available En un contexto dominado por las nuevas tecnologías, los MOOCs parecen posicionarse como una alternativa o complemento a la formación tradicional. Se observa sin embargo, que la metodología empleada por este tipo de cursos masivos, no difiere de la empleada en el aula. Este artículo evalúa y describe una nueva tipología de MOOC, denominada Social MOOC, el cual se presenta como disruptivo en cuanto a pedagogía empleada se refiere. A través de la plataforma ECO Learning, se analiza de forma exhaustiva mediante un estudio de caso la pedagogía y el rol del estudiante en el primer sMOOC que tuvo lugar durante los meses de marzo y abril de 2015. Se concluye que la pedagogía empleada en esta nueva versión social de los ya citados MOOC, es innovadora tanto dentro como fuera del contexto digital.