Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

Science.gov (United States)

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

Developmental expression of Toll‑like receptors in the guinea pig lung.

Science.gov (United States)

Ma, Lingjie; Yang, Jiali; Yang, Li; Shi, Juan; Xue, Jing; Li, Yong; Liu, Xiaoming

2017-03-01

The guinea pig is a useful model for investigating infectious and non‑infectious lung diseases due to the sensitivity of its respiratory system and susceptibility to infectious agents. Toll‑like receptors (TLRs) are important components of the innate immune response and are critical for lung immune function. In the present study, the differentiation of epithelial cells in the guinea pig lung was examined during gestation by studying anatomic morphology and the major epithelial cell types using cell type‑specific markers. The developmental expression of all 9 TLRs and the TLR signaling adaptors myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor associated factor 6 (TRAF‑6) were investigated by reverse transcription‑quantitative polymerase chain reaction and western blotting analysis. The formation of lung lobes in guinea pigs was observed at 45 days of gestation (dGA), along with the expression of the basal cell marker keratin 14 and the alveolar type II cell marker pro‑surfactant protein. However, the cube cell marker secretoglobin family1A member 1 and ciliated cell marker b‑tubulin IV were only detected in the lungs from 52 dGA onward. The expression levels of all TLRs, MyD88 and TRAF‑6 were determined in lung tissues harvested from embryos, newborn, postnatal and adult animals. The expression levels of all TLR signaling components displayed similar dynamic expression patterns with gestation age and postnatal maturation time, except for TLR‑4 and TLR‑7. mRNA expression levels of TLR components were significantly increased in the lungs at 45 and 52 dGA, compared with later developmental stages. These results suggest that TLR expression in the guinea pig lung is developmentally regulated, enhancing the understanding of lung biology in guinea pig models.

Protein expression in the nucleus accumbens of rats exposed to developmental vitamin D deficiency.

Directory of Open Access Journals (Sweden)

John McGrath

Full Text Available INTRODUCTION: Developmental vitamin D (DVD deficiency is a candidate risk factor for schizophrenia. Animal models have confirmed that DVD deficiency is associated with a range of altered genomic, proteomic, structural and behavioural outcomes in the rat. Because the nucleus accumbens has been implicated in neuropsychiatric disorders, in the current study we examined protein expression in this region in adult rats exposed to DVD deficiency METHODS: Female Sprague Dawley rats were maintained on a vitamin D deficient diet for 6 weeks, mated and allowed to give birth, after which a diet containing vitamin D was reintroduced. Male adult offspring (n = 8 were compared to control male (n = 8. 2-D gel electrophoresis-based proteomics and mass spectroscopy were used to investigate differential protein expression. RESULTS: There were 35 spots, mapped to 33 unique proteins, which were significantly different between the two groups. Of these, 22 were down-regulated and 13 up-regulated. The fold changes were uniformly small, with the largest FC being -1.67. Within the significantly different spots, three calcium binding proteins (calbindin1, calbindin2 and hippocalcin were altered. Other proteins associated with DVD deficiency related to mitochondrial function, and the dynamin-like proteins. CONCLUSIONS: Developmental vitamin D deficiency was associated with subtle changes in protein expression in the nucleus accumbens. Disruptions in pathways related to calcium-binding proteins and mitochondrial function may underlie some of the behavioural features associated with animal models of developmental vitamin D deficiency.

The silkworm (Bombyx mori microRNAs and their expressions in multiple developmental stages.

Directory of Open Access Journals (Sweden)

Xiaomin Yu

Full Text Available BACKGROUND: MicroRNAs (miRNAs play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. METHODOLOGY/PRINCIPAL FINDINGS: We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs and 14 novel miRNAs (including 11 predicted novel miRNAs. Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5' and/or 3' ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. CONCLUSIONS/SIGNIFICANCE: Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over

Prepatterning of developmental gene expression by modified histones before zygotic genome activation

DEFF Research Database (Denmark)

Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.

2011-01-01

A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

Developmental and adult characterization of secretagogin expressing amacrine cells in zebrafish retina.

Directory of Open Access Journals (Sweden)

Stefanie Dudczig

Full Text Available Calcium binding proteins show stereotypical expression patterns within diverse neuron types across the central nervous system. Here, we provide a characterization of developmental and adult secretagogin-immunolabelled neurons in the zebrafish retina with an emphasis on co-expression of multiple calcium binding proteins. Secretagogin is a recently identified and cloned member of the F-hand family of calcium binding proteins, which labels distinct neuron populations in the retinas of mammalian vertebrates. Both the adult distribution of secretagogin labeled retinal neurons as well as the developmental expression indicative of the stage of neurogenesis during which this calcium binding protein is expressed was quantified. Secretagogin expression was confined to an amacrine interneuron population in the inner nuclear layer, with monostratified neurites in the center of the inner plexiform layer and a relatively regular soma distribution (regularity index > 2.5 across central-peripheral areas. However, only a subpopulation (~60% co-labeled with gamma-aminobutyric acid as their neurotransmitter, suggesting that possibly two amacrine subtypes are secretagogin immunoreactive. Quantitative co-labeling analysis with other known amacrine subtype markers including the three main calcium binding proteins parvalbumin, calbindin and calretinin identifies secretagogin immunoreactive neurons as a distinct neuron population. The highest density of secretagogin cells of ~1800 cells / mm2 remained relatively evenly along the horizontal meridian, whilst the density dropped of to 125 cells / mm2 towards the dorsal and ventral periphery. Thus, secretagogin represents a new amacrine label within the zebrafish retina. The developmental expression suggests a possible role in late stage differentiation. This characterization forms the basis of functional studies assessing how the expression of distinct calcium binding proteins might be regulated to compensate for the loss

Longitudinal associations between physically abusive parents' emotional expressiveness and children's self-regulation.

Science.gov (United States)

Milojevich, Helen M; Haskett, Mary E

2018-03-01

The present study took a developmental psychopathology approach to examine the longitudinal association between parents' emotional expressiveness and children's self-regulation. Data collection spanned from 2004 to 2008. Ninety-two physically abusive parents completed yearly assessments of their emotional expressiveness, as well as their children's self-regulation abilities. Observational and behavioral measures were also obtained yearly to capture both parents' emotional expressiveness and children's self-regulation. Specifically, parents participated in a parent-child interaction task, which provided insight into their levels of flat affect. A puzzle box task was completed by each child to assess self-regulation. Results indicated, first, that greater parental expression of negative emotions predicted poorer self-regulation in children, both concurrently and across time. Second, parental expressions of positive emotions and parents' flat affect were unrelated to children's self-regulation. Findings inform our understanding of parental socialization of self-regulation and provide insight into the roles of distinct components of emotional expressiveness. Moreover, findings have crucial implications for understanding emotional expressiveness in high-risk samples and increase our understanding of within-group functioning among maltreating families that may serve as a means to direct intervention efforts. Copyright © 2018 Elsevier Ltd. All rights reserved.

Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

Directory of Open Access Journals (Sweden)

Reed Christopher

2009-11-01

Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

Developmental regulation of ecdysone receptor (EcR and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera.

Directory of Open Access Journals (Sweden)

Tathyana Rachel Palo Mello

2014-12-01

Full Text Available Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH, control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1. EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g. miR-133 and miR-375, as well honeybee-specific ones (e.g. miR-3745 and miR-3761. Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect.

Expression of the Ly-6 family proteins Lynx1 and Ly6H in the rat brain is compartmentalized, cell-type specific, and developmentally regulated

DEFF Research Database (Denmark)

Thomsen, Morten Skøtt; Cinar, Betül; Jensen, Majbrit Myrup

2014-01-01

regarding the distribution and developmental regulation of these proteins in the brain. We use protein cross-linking and synaptosomal fractions to demonstrate that the Ly-6 proteins Lynx1 and Ly6H are membrane-bound proteins in the brain, which are present on the cell surface and localize to synaptic...... demonstrate that Lynx1 and Ly6H are expressed in cultured neurons, but not cultured micro- or astroglial cultures. In addition, Lynx1, but not Ly6H was detected in the CSF. Finally, we show that the Ly-6 proteins Lynx1, Lynx2, Ly6H, and PSCA, display distinct expression patterns during postnatal development...

A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

Science.gov (United States)

Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

2017-01-12

We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

Regulation of root hair initiation and expansin gene expression in Arabidopsis

Science.gov (United States)

Cho, Hyung-Taeg; Cosgrove, Daniel J.

2002-01-01

The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

International Nuclear Information System (INIS)

Aluru, Neelakanteswar; Kuo, Elaine; Helfrich, Lily W.; Karchner, Sibel I.; Linney, Elwood A.; Pais, June E.; Franks, Diana G.

2015-01-01

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

Energy Technology Data Exchange (ETDEWEB)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Kuo, Elaine [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stanford University, 450 Serra Mall, Stanford, CA 94305 (United States); Helfrich, Lily W. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Northwestern University, 633 Clark St, Evanston, IL 60208 (United States); Karchner, Sibel I. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Linney, Elwood A. [Department of Molecular Genetics and Microbiology, Duke University Medical Center, Box 3020, Durham, NC 27710 (United States); Pais, June E. [New England Biolabs, 240 County Road, Ipswich, MA 01938 (United States); Franks, Diana G. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt

RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

Science.gov (United States)

Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

2017-05-01

To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p  0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

Science.gov (United States)

Izard, Carroll E; Abe, Jo Ann A

2004-09-01

Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

Directory of Open Access Journals (Sweden)

Michael Hadjiargyrou

2018-01-01

Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

Thyroid Hormone Regulates the Expression of the Sonic Hedgehog Signaling Pathway in the Embryonic and Adult Mammalian Brain

OpenAIRE

Desouza, Lynette A.; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E.; Kottmann, Andreas H.; Tole, Shubha; Vaidya, Vidita A.

2011-01-01

Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and...

Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

Science.gov (United States)

Kohsokabe, Takahiro; Kaneko, Kunihiko

2016-01-01

Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

Developmental Hypothyroidism Reduces the Expression of ...

Science.gov (United States)

Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,

Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

Science.gov (United States)

Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

2005-05-13

Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

Developmental expression of the alpha-skeletal actin gene

Directory of Open Access Journals (Sweden)

Vonk Freek J

2008-06-01

Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

Science.gov (United States)

Kohsokabe, Takahiro

2016-01-01

ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution

Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

Science.gov (United States)

Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

2010-01-01

Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

Contextual emotion regulation therapy: a developmentally based intervention for pediatric depression.

Science.gov (United States)

Kovacs, Maria; Lopez-Duran, Nestor L

2012-04-01

For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.

The Drosophila Perlecan gene trol regulates multiple signaling pathways in different developmental contexts

Directory of Open Access Journals (Sweden)

Perry Trinity L

2007-11-01

Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and

Hypoxia regulates microRNA expression in the human carotid body

International Nuclear Information System (INIS)

Mkrtchian, Souren; Lee, Kian Leong; Kåhlin, Jessica; Ebberyd, Anette; Poellinger, Lorenz; Fagerlund, Malin Jonsson; Eriksson, Lars I.

2017-01-01

The carotid body (CB) is the key sensing organ for physiological oxygen levels in the body. Under conditions of low oxygen (hypoxia), the CB plays crucial roles in signaling to the cardiorespiratory center in the medulla oblongata for the restoration of oxygen homeostasis. How hypoxia regulates gene expression in the human CB remains poorly understood. While limited information on transcriptional regulation in animal CBs is available, the identity and impact of important post-transcriptional regulators such as non-coding RNAs, and in particular miRNAs are not known. Here we show using ex vivo experiments that indeed a number of miRNAs are differentially regulated in surgically removed human CB slices when acute hypoxic conditions were applied. Analysis of the hypoxia-regulated miRNAs shows that they target biological pathways with upregulation of functions related to cell proliferation and immune response and downregulation of cell differentiation and cell death functions. Comparative analysis of the human CB miRNAome with the global miRNA expression patterns of a large number of different human tissues showed that the CB miRNAome had a unique profile which reflects its highly specialized functional status. Nevertheless, the human CB miRNAome is most closely related to the miRNA expression pattern of brain tissues indicating that they may have the most similar developmental origins. - Highlights: • Hypoxia triggers differential expression of many miRNAs in the human carotid body. • This can lead to the upregulation of proliferation and immune response functions. • CB expression profile in the carotid body resembles the miRNA expression pattern in the brain. • miRNAs are involved in the regulation of carotid body functions including oxygen sensing.

Hypoxia regulates microRNA expression in the human carotid body

Energy Technology Data Exchange (ETDEWEB)

Mkrtchian, Souren, E-mail: souren.mkrtchian@ki.se [Section for Anesthesiology and Intensive Care Medicine, Department of Physiology and Pharmacology, Karolinska Institute, SE-171 77 Stockholm (Sweden); Lee, Kian Leong, E-mail: csilkl@nus.edu.sg [Cancer Science Institute of Singapore, National University of Singapore, 117599 Singapore (Singapore); Kåhlin, Jessica [Section for Anesthesiology and Intensive Care Medicine, Department of Physiology and Pharmacology, Karolinska Institute, SE-171 77 Stockholm (Sweden); Function Perioperative Medicine and Intensive Care, Karolinska University Hospital, SE-171 76 Stockholm (Sweden); Ebberyd, Anette [Section for Anesthesiology and Intensive Care Medicine, Department of Physiology and Pharmacology, Karolinska Institute, SE-171 77 Stockholm (Sweden); Poellinger, Lorenz [Cancer Science Institute of Singapore, National University of Singapore, 117599 Singapore (Singapore); Department of Cell and Molecular Biology, Karolinska Institute, SE-171 77 Stockholm (Sweden); Fagerlund, Malin Jonsson; Eriksson, Lars I. [Section for Anesthesiology and Intensive Care Medicine, Department of Physiology and Pharmacology, Karolinska Institute, SE-171 77 Stockholm (Sweden); Function Perioperative Medicine and Intensive Care, Karolinska University Hospital, SE-171 76 Stockholm (Sweden)

2017-03-15

The carotid body (CB) is the key sensing organ for physiological oxygen levels in the body. Under conditions of low oxygen (hypoxia), the CB plays crucial roles in signaling to the cardiorespiratory center in the medulla oblongata for the restoration of oxygen homeostasis. How hypoxia regulates gene expression in the human CB remains poorly understood. While limited information on transcriptional regulation in animal CBs is available, the identity and impact of important post-transcriptional regulators such as non-coding RNAs, and in particular miRNAs are not known. Here we show using ex vivo experiments that indeed a number of miRNAs are differentially regulated in surgically removed human CB slices when acute hypoxic conditions were applied. Analysis of the hypoxia-regulated miRNAs shows that they target biological pathways with upregulation of functions related to cell proliferation and immune response and downregulation of cell differentiation and cell death functions. Comparative analysis of the human CB miRNAome with the global miRNA expression patterns of a large number of different human tissues showed that the CB miRNAome had a unique profile which reflects its highly specialized functional status. Nevertheless, the human CB miRNAome is most closely related to the miRNA expression pattern of brain tissues indicating that they may have the most similar developmental origins. - Highlights: • Hypoxia triggers differential expression of many miRNAs in the human carotid body. • This can lead to the upregulation of proliferation and immune response functions. • CB expression profile in the carotid body resembles the miRNA expression pattern in the brain. • miRNAs are involved in the regulation of carotid body functions including oxygen sensing.

High Expression of Pitx-2 in the ICAT-deficient Metanephros Leads to Developmental Arrest

International Nuclear Information System (INIS)

Hasegawa, Yoshimi; Iizuka-Kogo, Akiko; Akiyama, Tetsu; Senda, Takao

2010-01-01

ICAT (Inhibitor of β-catenin and T cell factor) inhibits the interaction between β-catenin and TCF/LEF transcription factor and serves as a negative regulator of Wnt signaling. In a subset of ICAT knockout mice, significant delay in the ureteric bud branching and renal agenesis are observed. In order to examine the process of this developmental defect, molecular changes were analyzed in fetal ICAT–/– kidneys with a focus on Wnt-signaling associated factors. The protein level of active β-catenin was elevated in ICAT–/– kidneys. DNA microarray and immunohistochemical analyses revealed that the expression of a Wnt target gene Pitx-2 was enhanced in ICAT–/– kidneys. There was no genotypic difference in the expression level of another Wnt target gene, c-Ret. These results suggest that the enhancement of Pitx-2 expression induced by activated Wnt signaling leads to delays in ureteric bud branching and subsequent renal agenesis. In the ICAT–/– kidneys which developed to E18.5 without any apparent defect, renal glomeruli, convoluted tubules and collecting ducts were decreased in density and showed abnormal structure. ICAT may be required for various developmental stages during renal development

Developmental and visual input-dependent regulation of the CB1 cannabinoid receptor in the mouse visual cortex.

Directory of Open Access Journals (Sweden)

Taisuke Yoneda

Full Text Available The mammalian visual system exhibits significant experience-induced plasticity in the early postnatal period. While physiological studies have revealed the contribution of the CB1 cannabinoid receptor (CB1 to developmental plasticity in the primary visual cortex (V1, it remains unknown whether the expression and localization of CB1 is regulated during development or by visual experience. To explore a possible role of the endocannabinoid system in visual cortical plasticity, we examined the expression of CB1 in the visual cortex of mice. We found intense CB1 immunoreactivity in layers II/III and VI. CB1 mainly localized at vesicular GABA transporter-positive inhibitory nerve terminals. The amount of CB1 protein increased throughout development, and the specific laminar pattern of CB1 appeared at P20 and remained until adulthood. Dark rearing from birth to P30 decreased the amount of CB1 protein in V1 and altered the synaptic localization of CB1 in the deep layer. Dark rearing until P50, however, did not influence the expression of CB1. Brief monocular deprivation for 2 days upregulated the localization of CB1 at inhibitory nerve terminals in the deep layer. Taken together, the expression and the localization of CB1 are developmentally regulated, and both parameters are influenced by visual experience.

Zfp206 regulates ES cell gene expression and differentiation.

Science.gov (United States)

Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R

2006-01-01

Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.

DNA methylation regulates gabrb2 mRNA expression: developmental variations and disruptions in l-methionine-induced zebrafish with schizophrenia-like symptoms.

Science.gov (United States)

Wang, L; Jiang, W; Lin, Q; Zhang, Y; Zhao, C

2016-11-01

Single nucleotide polymorphisms (SNPs) in the human type A gamma-aminobutyric acid (GABA) receptor β 2 subunit gene (GABRB2) have been associated with schizophrenia and quantitatively correlated with mRNA expression in the postmortem brain tissue of patients with schizophrenia. l-Methionine (MET) administration has been reported to cause a recrudescence of psychotic symptoms in patients with schizophrenia, and similar symptoms have been generated in MET-induced mice. In this study, a zebrafish animal model was used to evaluate the relationship between the gabrb2 mRNA expression and its promoter DNA methylation in developmental and MET-induced schizophrenia-like zebrafish. The results indicated developmental increases in global DNA methylation and decreases in gabrb2 promoter methylation in zebrafish. A significant increase in gabrb2 mRNA levels was observed after GABA was synthesized. Additionally, the MET-triggered schizophrenia-like symptoms in adult zebrafish, involving social withdrawal and cognitive dysfunction analyzed with social interaction and T-maze behavioral tests, were accompanied by significantly increased DNA methylation levels in the global genome and the gabrb2 promoter. Furthermore, the significant correlation between gabrb2 mRNA expression and gabrb2 promoter methylation observed in the developmental stages became non-significant in MET-triggered adult zebrafish. These findings demonstrate that gabrb2 mRNA expression is associated with DNA methylation varies by developmental stage and show that these epigenetic association mechanisms are disrupted in MET-triggered adult zebrafish with schizophrenia-like symptoms. In conclusion, these results provide plausible epigenetic evidence of the GABA A receptor β 2 subunit involvement in the schizophrenia-like behaviors and demonstrate the potential use of zebrafish models in neuropsychiatric research. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

The ribonuclease Dis3 is an essential regulator of the developmental transcriptome

Directory of Open Access Journals (Sweden)

Hou Dezhi

2012-08-01

Full Text Available Abstract Background Dis3 is ribonuclease that acts directly in the processing, turnover, and surveillance of a large number of distinct RNA species. Evolutionarily conserved from eubacteria to eukaryotes and a crucial component of the RNA processing exosome, Dis3 has been shown to be essential in yeast and fly S2 cells. However, it is not known whether Dis3 has essential functions in a metazoan. This study inquires whether Dis3 is required for Drosophila development and viability and how Dis3 regulates the transcriptome in the developing fly. Results Using transgenic flies, we show that Dis3 knock down (Dis3KD retards growth, induces melanotic tumor formation, and ultimately results in 2nd instar larval lethality. In order to determine whether Dis3KD fly phenotypes were a consequence of disrupting developmentally regulated RNA turnover, we performed RNA deep sequencing analysis on total RNA isolated from developmentally staged animals. Bioinformatic analysis of transcripts from Dis3KD flies reveals substantial transcriptomic changes, most notably down-regulation in early expressed RNAs. Finally, gene ontology analysis of this early stage shows that Dis3 regulates transcripts related to extracellular structure and remodelling, neurogenesis, and nucleotide metabolism. Conclusions We conclude that Dis3 is essential for early Drosophila melanogaster development and has specific and important stage-specific roles in regulating RNA metabolism. In showing for the first time that Dis3 is required for the development of a multicellular organism, our work provides mechanistic insight into how Dis3—either independent of or associated with the RNA processing exosome—participates in cell type-specific RNA turnover in metazoan development.

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

Energy Technology Data Exchange (ETDEWEB)

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)

2016-08-15

Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

International Nuclear Information System (INIS)

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-01-01

Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

Identification and Transcription Profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): Developmental Regulation and Environmental Response

Science.gov (United States)

2014-12-18

Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation and environmental response...7205 Email lmzhao@ufl.edu Abstract: The cDNA of a NADH dehydrogenase-ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus...information useful for developing dsRNA pesticide for mosquito control. Keywords: Aedes taeniorhynchus, AetNDUFS8, mRNA expression, development

A single cis element maintains repression of the key developmental regulator Gata2.

Directory of Open Access Journals (Sweden)

Jonathan W Snow

2010-09-01

Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.

Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

Science.gov (United States)

Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

2008-04-01

The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation.

Science.gov (United States)

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-09-15

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in Bdnf(lacZ/+) mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. Copyright © 2015 Elsevier Inc. All rights reserved.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation

Science.gov (United States)

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-01-01

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656

Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens.

Science.gov (United States)

Lin, Shumao; Li, Hongmei; Mu, Heping; Luo, Wen; Li, Ying; Jia, Xinzheng; Wang, Sibing; Jia, Xiaolu; Nie, Qinghua; Li, Yugu; Zhang, Xiquan

2012-07-10

A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3' untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. There is a critical miRNA, let-7b

cGMP and NHR signaling co-regulate expression of insulin-like peptides and developmental activation of infective larvae in Strongyloides stercoralis.

Directory of Open Access Journals (Sweden)

Jonathan D Stoltzfus

2014-07-01

Full Text Available The infectious form of the parasitic nematode Strongyloides stercoralis is a developmentally arrested third-stage larva (L3i, which is morphologically similar to the developmentally arrested dauer larva in the free-living nematode Caenorhabditis elegans. We hypothesize that the molecular pathways regulating C. elegans dauer development also control L3i arrest and activation in S. stercoralis. This study aimed to determine the factors that regulate L3i activation, with a focus on G protein-coupled receptor-mediated regulation of cyclic guanosine monophosphate (cGMP pathway signaling, including its modulation of the insulin/IGF-1-like signaling (IIS pathway. We found that application of the membrane-permeable cGMP analog 8-bromo-cGMP potently activated development of S. stercoralis L3i, as measured by resumption of feeding, with 85.1 ± 2.2% of L3i feeding in 200 µM 8-bromo-cGMP in comparison to 0.6 ± 0.3% in the buffer diluent. Utilizing RNAseq, we examined L3i stimulated with DMEM, 8-bromo-cGMP, or the DAF-12 nuclear hormone receptor (NHR ligand Δ7-dafachronic acid (DA--a signaling pathway downstream of IIS in C. elegans. L3i stimulated with 8-bromo-cGMP up-regulated transcripts of the putative agonistic insulin-like peptide (ILP -encoding genes Ss-ilp-1 (20-fold and Ss-ilp-6 (11-fold in comparison to controls without stimulation. Surprisingly, we found that Δ7-DA similarly modulated transcript levels of ILP-encoding genes. Using the phosphatidylinositol-4,5-bisphosphate 3-kinase inhibitor LY294002, we demonstrated that 400 nM Δ7-DA-mediated activation (93.3 ± 1.1% L3i feeding can be blocked using this IIS inhibitor at 100 µM (7.6 ± 1.6% L3i feeding. To determine the tissues where promoters of ILP-encoding genes are active, we expressed promoter::egfp reporter constructs in transgenic S. stercoralis post-free-living larvae. Ss-ilp-1 and Ss-ilp-6 promoters are active in the hypodermis and neurons and the Ss-ilp-7 promoter is active in the

Developmental changes in the metabolic network of snapdragon flowers.

Directory of Open Access Journals (Sweden)

Joëlle K Muhlemann

Full Text Available Evolutionary and reproductive success of angiosperms, the most diverse group of land plants, relies on visual and olfactory cues for pollinator attraction. Previous work has focused on elucidating the developmental regulation of pathways leading to the formation of pollinator-attracting secondary metabolites such as scent compounds and flower pigments. However, to date little is known about how flowers control their entire metabolic network to achieve the highly regulated production of metabolites attracting pollinators. Integrative analysis of transcripts and metabolites in snapdragon sepals and petals over flower development performed in this study revealed a profound developmental remodeling of gene expression and metabolite profiles in petals, but not in sepals. Genes up-regulated during petal development were enriched in functions related to secondary metabolism, fatty acid catabolism, and amino acid transport, whereas down-regulated genes were enriched in processes involved in cell growth, cell wall formation, and fatty acid biosynthesis. The levels of transcripts and metabolites in pathways leading to scent formation were coordinately up-regulated during petal development, implying transcriptional induction of metabolic pathways preceding scent formation. Developmental gene expression patterns in the pathways involved in scent production were different from those of glycolysis and the pentose phosphate pathway, highlighting distinct developmental regulation of secondary metabolism and primary metabolic pathways feeding into it.

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

Science.gov (United States)

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

Identification and transcription profiling of trypsin in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation, blood feeding, and permethrin exposure.

Science.gov (United States)

Zhao, Liming; Chen, Jian; Becnel, James J; Kline, Daniel L; Clark, Gary G; Linthicum, Kenneth J

2011-05-01

The cDNA of a trypsin gene from Aedes (Ochlerotatus) taeniorhynchus (Weidemann) was cloned and sequenced. The full-length mRNA sequence (890 bp) for trypsin from Ae. taeniorhynchus (AetTryp1) was obtained, which encodes an open reading frame of 765 bp (i.e., 255 amino acids). To detect whether AetTryp is developmentally regulated, a quantitative real-time polymerase chain reaction was used to examine AetTrypl mRNA expression levels in different developmental stages of Ae. taeniorhynchus. AetTryp1 was expressed at low levels in egg, larval, and pupal stages, but was differentially expressed in adult Ae. taeniorhynchus, with highest levels found in 5-d-old female adults when compared with teneral adults. In addition, AetTryp1 mRNA expression differed between sexes, with expression levels much lower in males. However, in both males and females, there was a significant increase in AetTryp1 transcription levels as age increased and peaked in 5-d-old adults. AetTrypl expressed in 5-d-old female Ae. taeniorhynchus significantly increased after 30 min postblood feeding compared with the control. The AetTryp1 mRNA expression in 5-d-old female Ae. taeniorhynchus was affected by different concentrations of permethrin.

Developmental gene expression profiles of the human pathogen Schistosoma japonicum

Directory of Open Access Journals (Sweden)

McManus Donald P

2009-03-01

Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.

Myostatin regulates miR-431 expression via the Ras-Mek-Erk signaling pathway.

Science.gov (United States)

Wu, Rimao; Li, Hu; Li, Tingting; Zhang, Yong; Zhu, Dahai

2015-05-29

MicroRNAs (miRNAs) play critical regulatory roles in controlling myogenic development both in vitro and in vivo; however, the molecular mechanisms underlying transcriptional regulation of miRNA genes in skeletal muscle cells are largely unknown. Here, using a microarray hybridization approach, we identified myostatin-regulated miRNA genes in skeletal muscle tissues by systematically searching miRNAs that are differentially expressed between wild-type and myostatin-null mice during development. We found that 116 miRNA genes were differentially expressed in muscles between these mice across different developmental stages. We further characterized myostatin-regulated miR-431 was upregulated in skeletal muscle tissues of myostatin-null mice. In functional studies, we found that overexpression of miR-431 in C2C12 myoblast cells attenuated myostatin-induced suppression of myogenic differentiation. Mechanistic studies further demonstrated that myostatin acted through the Ras-Mek-Erk signaling pathway to transcriptionally regulate miR-431 expression C2C12 cells. Our findings provide new insight into the mechanisms underlying transcriptional regulation of miRNA genes by myostatin during skeletal muscle development. Copyright © 2015 Elsevier Inc. All rights reserved.

Developmental Regulation across the Life Span: Toward a New Synthesis

Science.gov (United States)

Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten

2013-01-01

How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…

Developmental expression and distribution of nesfatin-1/NUCB2 in the canine digestive system.

Science.gov (United States)

Jiang, Shudong; Zhou, Weijuan; Zhang, Xingwang; Wang, Dengfeng; Zhu, Hui; Hong, Meizhen; Gong, Yajing; Ye, Jing; Fang, Fugui

2016-03-01

Nesfatin-1/NUCB2 is a neuropeptide that plays important roles in regulating food intake and energy homeostasis. The distribution of nesfatin-1/NUCB2 protein and mRNA has not been investigated in the canine digestive system. The present study was conducted to evaluate the expression of nesfatin-1/NUCB2 protein and NUCB2 mRNA in the canine digestive organs (esophagus, stomach, duodenum, jejunum, ileum, cecum, colon, rectum, liver and pancreas). The tissues of the digestive system were collected from dogs at different developmental stages (infantile, juvenile, pubertal and adult). Nesfatin-1/NUCB2 protein localization in the organs of adult dogs was detected by immunohistochemistry. The expression of NUCB2 mRNA at the four developmental stages was analyzed by real-time fluorescence quantitative PCR (qRT-PCR). Nesfatin-1/NUCB2 protein was distributed in the fundic gland region of the stomach, and the islet area and exocrine portions of the pancreas. However, NUCB2 mRNA was found in all digestive organs, although the expression levels in the pancreas and stomach were higher than those in liver, duodenum and other digestive tract tissues (Pdigestive organs. These findings provide the basis of further investigations to elucidate the functions of nefatin-1 in the canine digestive system. Copyright © 2015 Elsevier GmbH. All rights reserved.

Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

Institute of Scientific and Technical Information of China (English)

HSU Heng; Robert L. CHURCH

2004-01-01

During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

NeuroD1: developmental expression and regulated genes in the rodent pineal gland

DEFF Research Database (Denmark)

Muñoz, Estela M; Bailey, Michael J; Rath, Martin F

2007-01-01

NeuroD1/BETA2, a member of the bHLH transcription factor family, is known to influence the fate of specific neuronal, endocrine and retinal cells. We report here that NeuroD1 mRNA is highly abundant in the developing and adult rat pineal gland. Pineal expression begins in the 17-day embryo at which...... time it is also detectable in other brain regions. Expression in the pineal gland increases during the embryonic period and is maintained thereafter at levels equivalent to those found in the cerebellum and retina. In contrast, NeuroD1 mRNA decreases markedly in non-cerebellar brain regions during...... development. Pineal NeuroD1 levels are similar during the day and night, and do not appear to be influenced by sympathetic neural input. Gene expression analysis of the pineal glands from neonatal NeuroD1 knockout mice identifies 127 transcripts that are down-regulated (>twofold, p

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

Science.gov (United States)

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

Directory of Open Access Journals (Sweden)

Vanessa C McFadden

2017-02-01

Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.

Directory of Open Access Journals (Sweden)

Xiao-Jian Sun

Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.

miRNA-21 is developmentally regulated in mouse brain and is co-expressed with SOX2 in glioma

International Nuclear Information System (INIS)

Põlajeva, Jelena; Swartling, Fredrik J; Jiang, Yiwen; Singh, Umashankar; Pietras, Kristian; Uhrbom, Lene; Westermark, Bengt; Roswall, Pernilla

2012-01-01

MicroRNAs (miRNAs) and their role during tumor development have been studied in great detail during the last decade, albeit their expression pattern and regulation during normal development are however not so well established. Previous studies have shown that miRNAs are differentially expressed in solid human tumors. Platelet-derived growth factor (PDGF) signaling is known to be involved in normal development of the brain as well as in malignant primary brain tumors, gliomas, but the complete mechanism is still lacking. We decided to investigate the expression of the oncogenic miR-21 during normal mouse development and glioma, focusing on PDGF signaling as a potential regulator of miR-21. We generated mouse glioma using the RCAS/tv-a system for driving PDGF-BB expression in a cell-specific manner. Expression of miR-21 in mouse cell cultures and mouse brain were assessed using Northern blot analysis and in situ hybridization. Immunohistochemistry and Western blot analysis were used to investigate SOX2 expression. LNA-modified siRNA was used for irreversible depletion of miR-21. For inhibition of PDGF signaling Gleevec (imatinib mesylate), Rapamycin and U0126, as well as siRNA were used. Statistical significance was calculated using double-sided unpaired Student´s t-test. We identified miR-21 to be highly expressed during embryonic and newborn brain development followed by a gradual decrease until undetectable at postnatal day 7 (P7), this pattern correlated with SOX2 expression. Furthermore, miR-21 and SOX2 showed up-regulation and overlapping expression pattern in RCAS/tv-a generated mouse brain tumor specimens. Upon irreversible depletion of miR-21 the expression of SOX2 was strongly diminished in both mouse primary glioma cultures and human glioma cell lines. Interestingly, in normal fibroblasts the expression of miR-21 was induced by PDGF-BB, and inhibition of PDGF signaling in mouse glioma primary cultures resulted in suppression of miR-21 suggesting that mi

The regulation of CD5 expression in murine T cells

Directory of Open Access Journals (Sweden)

Herzenberg Leonard A

2001-05-01

Full Text Available Abstract Background CD5 is a pan-T cell surface marker that is also present on a subset of B cells, B-1a cells.Functional and developmental subsets of T cells express characteristic CD5 levels that vary over roughly a 30-fold range. Previous investigators have cloned a 1.7 Kb fragment containing the CD5 promoter and showed that it can confer similar lymphocyte-specific expression pattern as observed for endogenous CD5 expression. Results We further characterize the CD5 promoter and identify minimal and regulatory regions on the CD5 promoter. Using a luciferase reporter system, we show that a 43 bp region on the CD5 promoter regulates CD5 expression in resting mouse thymoma EL4 T cells and that an Ets binding site within the 43 bp region mediates the CD5 expression. In addition, we show that Ets-1, a member of the Ets family of transcription factors, recognizes the Ets binding site in the electrophoretic mobility shift assay (EMSA. This Ets binding site is directly responsible for the increase in reporter activity when co-transfected with increasing amounts of Ets-1 expression plasmid. We also identify two additional evolutionarily-conserved regions in the CD5 promoter (CD5X and CD5Y and demonstrate the respective roles of the each region in the regulation of CD5 transcription. Conclusion Our studies define a minimal and regulatory promoter for CD5 and show that the CD5 expression level in T cells is at least partially dependent on the level of Ets-1 protein. Based on the findings in this report, we propose a model of CD5 transcriptional regulation in T cells.

Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta

DEFF Research Database (Denmark)

Rewitz, Kim; Rybczynski, Robert; Warren, James T.

2006-01-01

this work to the tobacco hornworm Manduca sexta, an established model for endocrinological and developmental studies. cDNA clones were obtained for three Manduca orthologs of CYP306A1 (phantom; phm, the 25-hydroxylase), CYP302A1 (disembodied; dib, the 22-hydroxylase) and CYP315A1 (shadow; sad, the 2...... in the developmentally varying steroidogenic capacities of the prothoracic glands during the fifth instar. The consistent expression of the Halloween genes confirms the importance of the prothoracic glands in pupal-adult development. These studies establish Manduca as an excellent model for examining the regulation...

Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

Science.gov (United States)

Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon

2017-07-03

Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

BMP signaling in the human fetal ovary is developmentally regulated and promotes primordial germ cell apoptosis.

Science.gov (United States)

Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A

2010-08-01

Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.

Thyroid hormone regulates the expression of the sonic hedgehog signaling pathway in the embryonic and adult Mammalian brain.

Science.gov (United States)

Desouza, Lynette A; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E; Kottmann, Andreas H; Tole, Shubha; Vaidya, Vidita A

2011-05-01

Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and hyperthyroidism bidirectionally influenced Shh mRNA in embryonic forebrain signaling centers at stages before fetal thyroid hormone synthesis. Further, Smo and Ptc expression were significantly decreased in the forebrain of embryos derived from hypothyroid dams. Adult-onset thyroid hormone perturbations also regulated expression of the Shh pathway bidirectionally, with a significant induction of Shh, Ptc, and Smo after hyperthyroidism and a decline in Smo expression in the hypothyroid brain. Short-term T₃ administration resulted in a significant induction of cortical Shh mRNA expression and also enhanced reporter gene expression in Shh(+/LacZ) mice. Further, acute T₃ treatment of cortical neuronal cultures resulted in a rapid and significant increase in Shh mRNA, suggesting direct effects. Chromatin immunoprecipitation assays performed on adult neocortex indicated enhanced histone acetylation at the Shh promoter after acute T₃ administration, providing further support that Shh is a thyroid hormone-responsive gene. Our results indicate that maternal and adult-onset perturbations of euthyroid status cause robust and region-specific changes in the Shh pathway in the embryonic and adult forebrain, implicating Shh as a possible mechanistic link for specific neurodevelopmental effects of thyroid hormone.

Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Shuhua Zhan

Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

Science.gov (United States)

Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

2012-12-01

Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

Brief Report: Representational Momentum for Dynamic Facial Expressions in Pervasive Developmental Disorder

Science.gov (United States)

Uono, Shota; Sato, Wataru; Toichi, Motomi

2010-01-01

Individuals with pervasive developmental disorder (PDD) have difficulty with social communication via emotional facial expressions, but behavioral studies involving static images have reported inconsistent findings about emotion recognition. We investigated whether dynamic presentation of facial expression would enhance subjective perception of…

Reph, a regulator of Eph receptor expression in the Drosophila melanogaster optic lobe.

Directory of Open Access Journals (Sweden)

Richard E Dearborn

Full Text Available Receptors of the Eph family of tyrosine kinases and their Ephrin ligands are involved in developmental processes as diverse as angiogenesis, axon guidance and cell migration. However, our understanding of the Eph signaling pathway is incomplete, and could benefit from an analysis by genetic methods. To this end, we performed a genetic modifier screen for mutations that affect Eph signaling in Drosophila melanogaster. Several dozen loci were identified on the basis of their suppression or enhancement of an eye defect induced by the ectopic expression of Ephrin during development; many of these mutant loci were found to disrupt visual system development. One modifier locus, reph (regulator of eph expression, was characterized in molecular detail and found to encode a putative nuclear protein that interacts genetically with Eph signaling pathway mutations. Reph is an autonomous regulator of Eph receptor expression, required for the graded expression of Eph protein and the establishment of an optic lobe axonal topographic map. These results reveal a novel component of the regulatory pathway controlling expression of eph and identify reph as a novel factor in the developing visual system.

SOX9 regulates microRNA miR-202-5p/3p expression during mouse testis differentiation

DEFF Research Database (Denmark)

Wainwright, Elanor N; Jorgensen, Joan S; Kim, Youngha

2013-01-01

MicroRNAs are important regulators of developmental gene expression, but their contribution to fetal gonad development is not well understood. We have identified the evolutionarily conserved gonadal microRNAs miR-202-5p and miR-202-3p as having a potential role in regulating mouse embryonic gonad....... Expression of the primary transcript of miR-202-5p/3p remained low in XY gonads in a conditional Sox9-null mouse model, suggesting that pri-miR-202 transcription is downstream of SOX9, a transcription factor that is both necessary and sufficient for male sex determination. We identified the pri-miR-202...

Developmental programming of energy balance regulation: is physical activity more 'programmable' than food intake?

Science.gov (United States)

Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A

2016-02-01

Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life

RNAi Screen in Drosophila melanogastor Identifies Regulators of Steroidogenesis and Developmental Maturation

DEFF Research Database (Denmark)

Danielsen, Erik Thomas

and duration required for juvenile-adult transition. This PhD project demonstrates the power of Drosophila genetics by taking an in vivo genome-wide RNAi screening approach to uncover genes required for the function of steroid producing tissue and developmental maturation. In total, 1909 genes were found...... to be required for the prothoracic gland function and affected the developmental timing for the juvenile-adult transition. Among the screen hits, we focused on an uncharacterized gene, sit (CG5278), which is highly expressed in the gland and is required for ecdysone production. Sit is a homolog of mammalian very...... flux of cholesterol uptake in the gland cells and affected the endosomal trafficking. Therefore this gene was suggested to be named stuck in traffic (sit). Sit’s role in cholesterol uptake was also supported by the observation that the developmental delayed phenotype from loss of sit expression...

Developmentally regulated GTP-binding protein 2 is required for stabilization of Rac1-positive membrane tubules.

Science.gov (United States)

Mani, Muralidharan; Lee, Unn Hwa; Yoon, Nal Ae; Yoon, Eun Hye; Lee, Byung Ju; Cho, Wha Ja; Park, Jeong Woo

2017-11-04

Previously we have reported that developmentally regulated GTP-binding protein 2 (DRG2) localizes on Rab5 endosomes and plays an important role in transferrin (Tfn) recycling. We here identified DRG2 as a key regulator of membrane tubule stability. At 30 min after Tfn treatment, DRG2 localized to membrane tubules which were enriched with phosphatidylinositol 4-monophosphate [PI(4)P] and did not contain Rab5. DRG2 interacted with Rac1 more strongly with GTP-bound Rac1 and tubular localization of DRG2 depended on Rac1 activity. DRG2 depletion led to destabilization of membrane tubules, while ectopic expression of DRG2 rescued the stability of the membrane tubules in DRG2-depleted cells. Our results reveal a novel mechanism for regulation of membrane tubule stability mediated by DRG2. Copyright © 2017 Elsevier Inc. All rights reserved.

Developmental expression of Manduca shade, the P450 mediating the final step in molting hormone synthesis

DEFF Research Database (Denmark)

Rewitz, Kim; Rybczynski, Robert; Warren, James T.

2006-01-01

body and epidermis with very low expression in the prothoracic gland and nervous system. Developmental variations in E20MO enzymatic activity are almost perfectly correlated with comparable changes in the gene expression of Msshd in the fat body and midgut during the fifth instar and the beginning...... gene shade (shd; CYP314A1) that encodes the E20MO in the tobacco hornworm, Manduca sexta. Manduca Shd (MsShd) mediates the conversion of E to 20E when expressed in Drosophila S2 cells. In accord with the central dogma, the data show that Msshd is expressed mainly in the midgut, Malpighian tubules, fat...... of pupal-adult development. The results indicate three successive and overlapping peaks of expression in the fat body, midgut and Malpighian tubules, respectively, during the fifth larval instar. The data suggest that precise tissue-specific transcriptional regulation controls the levels, and thereby...

Transcriptome Characterization of Dendrolimus punctatus and Expression Profiles at Different Developmental Stages.

Directory of Open Access Journals (Sweden)

Cong-Hui Yang

Full Text Available The pine moth Dendrolimus punctatus (Walker is a common insect pest that confers serious damage to conifer forests in south of China. Extensive physiology and ecology studies on D. punctatus have been carried out, but the lack of genetic information has limited our understanding of the molecular mechanisms behind its development and resistance. Using RNA-seq approach, we characterized the transcriptome of this pine moth and investigated its developmental expression profiles during egg, larval, pupal, and adult stages. A total of 107.6 million raw reads were generated that were assembled into 70,664 unigenes. More than 30% unigenes were annotated by searching for homology in protein databases. To better understand the process of metamorphosis, we pairwise compared four developmental phases and obtained 17,624 differential expression genes. Functional enrichment analysis of differentially expressed genes showed positive correlation with specific physiological activities of each stage, and these results were confirmed by qRT-PCR experiments. This study provides a valuable genomic resource of D. punctatus covering all its developmental stages, and will promote future studies on biological processes at the molecular level.

Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

Directory of Open Access Journals (Sweden)

Heying Zhou

Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

Developmental programming: prenatal testosterone excess disrupts anti-Müllerian hormone expression in preantral and antral follicles.

Science.gov (United States)

Veiga-Lopez, Almudena; Ye, Wen; Padmanabhan, Vasantha

2012-03-01

To investigate the impact of prenatal T excess on the expression of key ovarian regulators implicated in follicular recruitment and persistence using a large animal model of polycystic ovarian syndrome (PCOS). Interventional, animal model study. Academic research unit. A total of 25 female fetuses, 14 prepubertal female, and 24 adult female Suffolk sheep. Prenatal T treatment. Immunohistochemical determination of expression of anti-Müllerian hormone (AMH), kit ligand, and growth differentiation factor 9 (GDF9) in fetal, prepubertal, and adult ovarian tissues. Prenatal T treatment reduced the AMH protein expression in granulosa cells (GC) of preantral follicles and increased its expression in antral follicles compared with age-matched adult controls. These differences were not evident in prepubertal animals. Protein expression of GDF9 and kit ligand was not altered at any of the developmental time points studied. Prenatal T exposure is associated with changes in AMH expression in preantral and antral follicles in adult ovaries, similar to findings in women with PCOS. These findings indicate that abnormal folliculogenesis in PCOS may be at least in part mediated by changes in AMH expression. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

Directory of Open Access Journals (Sweden)

Xingguo Zhu

Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

Neonatal maternal deprivation response and developmental changes in gene expression revealed by hypothalamic gene expression profiling in mice.

Directory of Open Access Journals (Sweden)

Feng Ding

Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.

LncRNA Dum interacts with Dnmts to regulate Dppa2 expression during myogenic differentiation and muscle regeneration

Science.gov (United States)

Wang, Lijun; Zhao, Yu; Bao, Xichen; Zhu, Xihua; Kwok, Yvonne Ka-yin; Sun, Kun; Chen, Xiaona; Huang, Yongheng; Jauch, Ralf; Esteban, Miguel A; Sun, Hao; Wang, Huating

2015-01-01

Emerging studies document the roles of long non-coding RNAs (LncRNAs) in regulating gene expression at chromatin level but relatively less is known how they regulate DNA methylation. Here we identify an lncRNA, Dum (developmental pluripotency-associated 2 (Dppa2) Upstream binding Muscle lncRNA) in skeletal myoblast cells. The expression of Dum is dynamically regulated during myogenesis in vitro and in vivo. It is also transcriptionally induced by MyoD binding upon myoblast differentiation. Functional analyses show that it promotes myoblast differentiation and damage-induced muscle regeneration. Mechanistically, Dum was found to silence its neighboring gene, Dppa2, in cis through recruiting Dnmt1, Dnmt3a and Dnmt3b. Furthermore, intrachromosomal looping between Dum locus and Dppa2 promoter is necessary for Dum/Dppa2 interaction. Collectively, we have identified a novel lncRNA that interacts with Dnmts to regulate myogenesis. PMID:25686699

Gene expression analysis in human osteoblasts exposed to dexamethasone identifies altered developmental pathways as putative drivers of osteoporosis

Directory of Open Access Journals (Sweden)

Sadlier Denise M

2007-02-01

Full Text Available Abstract Background Osteoporosis, a disease of decreased bone mineral density represents a significant and growing burden in the western world. Aging population structure and therapeutic use of glucocorticoids have contributed in no small way to the increase in the incidence of this disease. Despite substantial investigative efforts over the last number of years the exact molecular mechanism underpinning the initiation and progression of osteoporosis remain to be elucidated. This has meant that no significant advances in therapeutic strategies have emerged, with joint replacement surgery being the mainstay of treatment. Methods In this study we have used an integrated genomics profiling and computational biology based strategy to identify the key osteoblast genes and gene clusters whose expression is altered in response to dexamethasone exposure. Primary human osteoblasts were exposed to dexamethasone in vitro and microarray based transcriptome profiling completed. Results These studies identified approximately 500 osteoblast genes whose expression was altered. Functional characterization of the transcriptome identified developmental networks as being reactivated with 106 development associated genes found to be differentially regulated. Pathway reconstruction revealed coordinate alteration of members of the WNT signaling pathway, including frizzled-2, frizzled-7, DKK1 and WNT5B, whose differential expression in this setting was confirmed by real time PCR. Conclusion The WNT pathway is a key regulator of skeletogenesis as well as differentiation of bone cells. Reactivation of this pathway may lead to altered osteoblast activity resulting in decreased bone mineral density, the pathological hallmark of osteoporosis. The data herein lend weight to the hypothesis that alterations in developmental pathways drive the initiation and progression of osteoporosis.

Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

International Nuclear Information System (INIS)

Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.

2008-01-01

The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans

Developmentally regulated expression of reporter gene in adult ...

Indian Academy of Sciences (India)

pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

Developmental Expression and Hypoxic Induction of Hypoxia Inducible Transcription Factors in the Zebrafish.

Science.gov (United States)

Köblitz, Louise; Fiechtner, Birgit; Baus, Katharina; Lussnig, Rebecca; Pelster, Bernd

2015-01-01

The hypoxia inducible transcription factor (HIF) has been shown to coordinate the hypoxic response of vertebrates and is expressed in three different isoforms, HIF-1α, HIF-2α and HIF-3α. Knock down of either Hif-1α or Hif-2α in mice results in lethality in embryonic or perinatal stages, suggesting that this transcription factor is not only controlling the hypoxic response, but is also involved in developmental phenomena. In the translucent zebrafish embryo the performance of the cardiovascular system is not essential for early development, therefore this study was designed to analyze the expression of the three Hif-isoforms during zebrafish development and to test the hypoxic inducibility of these transcription factors. To complement the existing zfHif-1α antibody we expressed the whole zfHif-2α protein and used it for immunization and antibody generation. Similarly, fragments of the zfHif-3α protein were used for immunization and generation of a zfHif-3α specific antibody. To demonstrate presence of the Hif-isoforms during development [between 1 day post fertilization (1 dpf) and 9 dpf] affinity-purified antibodies were used. Hif-1α protein was present under normoxic conditions in all developmental stages, but no significant differences between the different developmental stages could be detected. Hif-2α was also present from 1 dpf onwards, but in post hatching stages (between 5 and 9 dpf) the expression level was significantly higher than prior to hatching. Similarly, Hif-3α was expressed from 1 dpf onwards, and the expression level significantly increased until 5 dpf, suggesting that Hif-2α and Hif-3α play a particular role in early development. Hypoxic exposure (oxygen partial pressure = 5 kPa) in turn caused a significant increase in the level of Hif-1α protein even at 1 dpf and in later stages, while neither Hif-2α nor Hif-3α protein level were affected. In these early developmental stages Hif-1α therefore appears to be more important for

Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

Science.gov (United States)

Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

2013-09-01

Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Atrial natriuretic peptide regulates Ca channel in early developmental cardiomyocytes.

Directory of Open Access Journals (Sweden)

Lin Miao

Full Text Available BACKGROUND: Cardiomyocytes derived from murine embryonic stem (ES cells possess various membrane currents and signaling cascades link to that of embryonic hearts. The role of atrial natriuretic peptide (ANP in regulation of membrane potentials and Ca(2+ currents has not been investigated in developmental cardiomyocytes. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the role of ANP in regulating L-type Ca(2+ channel current (I(CaL in different developmental stages of cardiomyocytes derived from ES cells. ANP decreased the frequency of action potentials (APs in early developmental stage (EDS cardiomyocytes, embryonic bodies (EB as well as whole embryo hearts. ANP exerted an inhibitory effect on basal I(CaL in about 70% EDS cardiomyocytes tested but only in about 30% late developmental stage (LDS cells. However, after stimulation of I(CaL by isoproterenol (ISO in LDS cells, ANP inhibited the response in about 70% cells. The depression of I(CaL induced by ANP was not affected by either Nomega, Nitro-L-Arginine methyl ester (L-NAME, a nitric oxide synthetase (NOS inhibitor, or KT5823, a cGMP-dependent protein kinase (PKG selective inhibitor, in either EDS and LDS cells; whereas depression of I(CaL by ANP was entirely abolished by erythro-9-(2-Hydroxy-3-nonyl adenine (EHNA, a selective inhibitor of type 2 phosphodiesterase(PDE2 in most cells tested. CONCLUSION/SIGNIFICANCES: Taken together, these results indicate that ANP induced depression of action potentials and I(CaL is due to activation of particulate guanylyl cyclase (GC, cGMP production and cGMP-activation of PDE2 mediated depression of adenosine 3', 5'-cyclic monophophate (cAMP-cAMP-dependent protein kinase (PKA in early cardiomyogenesis.

Photoperiodic regulation of the sucrose transporter StSUT4 affects the expression of circadian-regulated genes and ethylene production

Directory of Open Access Journals (Sweden)

Izabela eChincinska

2013-02-01

Full Text Available Several recent publications report different subcellular localisation of members of the SUT4 subfamily of sucrose transporters. The physiological function of SUT4 sucrose transporters is still not entirely clarified as down-regulation of members of the SUT4 clade had very different effects in rice, poplar and potato. Here, we provide new data on the localization and function of the Solanaceous StSUT4 protein, further elucidating involvement in the onset of flowering, tuberization and in the shade avoidance syndrome of potato plants.Induction of early flowering and tuberization in SUT4-inhibited potato plants correlates with increased sucrose export from leaves and increased sucrose and starch accumulation in terminal sink organs such as developing tubers. SUT4 does not only affect the expression of gibberellin and ethylene biosynthetic enzymes, but also the rate of ethylene synthesis in potato. In SUT4-inhibited plants, the ethylene production no longer follows a diurnal rhythm, leading to the assumption that StSUT4 controls circadian gene expression, potentially by regulating sucrose export from leaves. Furthermore, SUT4 expression affects clock-regulated genes such as StFT, StSOC1 and StCO, which might also be involved in a photoperiod-dependently controlled tuberization. A model is proposed in which StSUT4 controls a phloem-mobile signalling molecule generated in leaves which together with enhanced sucrose export affects developmental switches in apical meristems. SUT4 seems to link photoreceptor-perceived information about the light quality and day length, with phytohormone biosynthesis and the expression of circadian genes.

Phenanthrene causes ocular developmental toxicity in zebrafish embryos and the possible mechanisms involved

International Nuclear Information System (INIS)

Huang, Lixing; Wang, Chonggang; Zhang, Youyu; Wu, Meifang; Zuo, Zhenghong

2013-01-01

Highlights: • Phe exposure caused obvious morphological changes in the retina. • Phe exposure caused apoptosis and reduction of cell proliferation in the retina. • Phe causes ocular toxicity might be via the AhR/Zeb1/Mitf/Pax6 signaling pathway. • AhR is a repressor of Zeb1. -- Abstract: Recent studies show that polycyclic aromatic hydrocarbons (PAHs) may be a candidate cause of developmental defects of the retina, but the mechanism is still unclear. We evaluated the mechanism(s) underlying PAH-induced retinal development defects due to exposure to environmental concentrations of Phenanthrene (Phe) in zebrafish. We found that exposure to environmental concentrations of Phe caused obvious morphological changes, developmental retardation, apoptosis, and reduction of cell proliferation in the retina. Our results indicated that Phe could cause visual system developmental defects. Phe exposure up-regulated aryl hydrocarbon receptor (AhR) and microphthalmia-associated transcription factor (Mtif) expression, and down-regulated zinc finger E-box binding homeobox 1 (Zeb1) and paired box 6 (Pax6). Moreover, we demonstrated that AhR was a repressor of Zeb1. We propose that Phe's ocular toxicity is mediated by up-regulating AhR, which then down-regulates Zeb1, in turn inducing Mitf expression while inhibiting Pax6 expression

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

Directory of Open Access Journals (Sweden)

Westerdahl Ann-Charlotte

2010-06-01

Full Text Available Abstract Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

Science.gov (United States)

Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

2010-06-09

Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

Energy Technology Data Exchange (ETDEWEB)

Henrique Barreta, Marcos [Universidade Federal de Santa Catarina, Campus Universitario de Curitibanos, Curitibanos, SC (Brazil); Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Ferreira, Rogerio [Centro de Educacao Superior do Oeste-Universidade do Estado de Santa Catarina, Chapeco, SC (Brazil); Oliveira, Joao Francisco de; Goncalves, Paulo Bayard Dias [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Bordignon, Vilceu, E-mail: vilceu.bordignon@mcgill.ca [Department of Animal Science, McGill University, Ste-Anne-De-Bellevue, QC (Canada)

2012-10-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

International Nuclear Information System (INIS)

Henrique Barreta, Marcos; Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de; Ferreira, Rogério; Oliveira, João Francisco de; Gonçalves, Paulo Bayard Dias; Bordignon, Vilceu

2012-01-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana.

Science.gov (United States)

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H; Trivedi, Prabodh K

2016-08-19

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana.

Identification, developmental expression and regulation of the Xenopus ortholog of human FANCG/XRCC9.

Science.gov (United States)

Stone, Stacie; Sobeck, Alexandra; van Kogelenberg, Margriet; de Graaf, Bendert; Joenje, Hans; Christian, Jan; Hoatlin, Maureen E

2007-07-01

Fanconi anemia (FA) is associated with variable developmental abnormalities, bone marrow failure and cancer susceptibility. FANCG/XRCC9 is member of the FA core complex, a group of proteins that control the monoubiquitylation of FANCD2, an event that plays a critical role in maintaining genomic stability. Here we report the identification of the Xenopus laevis ortholog of human FANCG (xFANCG), its expression during development, and its molecular interactions with a partner protein, xFANCA. The xFANCG protein sequence is 47% similar to its human ortholog, with highest conservation in the two putative N-terminal leucine zippers and the tetratricopeptide repeat (TPR) motifs. xFANCG is maternally and zygotically transcribed. Prior to the midblastula stage, a single xFANCG transcript is observed but two additional alternatively spliced mRNAs are detected after the midblastula transition. One of the variants is predicted to encode a novel isoform of xFANCG lacking exon 2. The mutual association between FANCG and FANCA required for their nuclear import is conserved in Xenopus egg extracts. Our data demonstrate that interactions between FANCA and FANCG occur at the earliest stage of vertebrate development and raise the possibility that functionally different isoforms of xFANCG may play a role in early development.

DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions

Science.gov (United States)

Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.

2011-01-01

The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518

Transcriptional regulation of the grape cytochrome P450 monooxygenase gene CYP736B expression in response to Xylella fastidiosa infection

Directory of Open Access Journals (Sweden)

Walker M Andrew

2010-07-01

Full Text Available Abstract Background Plant cytochrome P450 monooxygenases (CYP mediate synthesis and metabolism of many physiologically important primary and secondary compounds that are related to plant defense against a range of pathogenic microbes and insects. To determine if cytochrome P450 monooxygenases are involved in defense response to Xylella fastidiosa (Xf infection, we investigated expression and regulatory mechanisms of the cytochrome P450 monooxygenase CYP736B gene in both disease resistant and susceptible grapevines. Results Cloning of genomic DNA and cDNA revealed that the CYP736B gene was composed of two exons and one intron with GT as a donor site and AG as an acceptor site. CYP736B transcript was up-regulated in PD-resistant plants and down-regulated in PD-susceptible plants 6 weeks after Xf inoculation. However, CYP736B expression was very low in stem tissues at all evaluated time points. 5'RACE and 3'RACE sequence analyses revealed that there were three candidate transcription start sites (TSS in the upstream region and three candidate polyadenylation (PolyA sites in the downstream region of CYP736B. Usage frequencies of each transcription initiation site and each polyadenylation site varied depending on plant genotype, developmental stage, tissue, and treatment. These results demonstrate that expression of CYP736B is regulated developmentally and in response to Xf infection at both transcriptional and post-transcriptional levels. Multiple transcription start and polyadenylation sites contribute to regulation of CYP736B expression. Conclusions This report provides evidence that the cytochrome P450 monooxygenase CYP736B gene is involved in defense response at a specific stage of Xf infection in grapevines; multiple transcription initiation and polyadenylation sites exist for CYP736B in grapevine; and coordinative and selective use of transcription initiation and polyadenylation sites play an important role in regulation of CYP736B expression

Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage.

Directory of Open Access Journals (Sweden)

Fatma Kaplan

2011-03-01

Full Text Available The ascarosides form a family of small molecules that have been isolated from cultures of the nematode Caenorhabditis elegans. They are often referred to as "dauer pheromones" because most of them induce formation of long-lived and highly stress resistant dauer larvae. More recent studies have shown that ascarosides serve additional functions as social signals and mating pheromones. Thus, ascarosides have multiple functions. Until now, it has been generally assumed that ascarosides are constitutively expressed during nematode development.Cultures of C. elegans were developmentally synchronized on controlled diets. Ascarosides released into the media, as well as stored internally, were quantified by LC/MS. We found that ascaroside biosynthesis and release were strongly dependent on developmental stage and diet. The male attracting pheromone was verified to be a blend of at least four ascarosides, and peak production of the two most potent mating pheromone components, ascr#3 and asc#8 immediately preceded or coincided with the temporal window for mating. The concentration of ascr#2 increased under starvation conditions and peaked during dauer formation, strongly supporting ascr#2 as the main population density signal (dauer pheromone. After dauer formation, ascaroside production largely ceased and dauer larvae did not release any ascarosides. These findings show that both total ascaroside production and the relative proportions of individual ascarosides strongly correlate with these compounds' stage-specific biological functions.Ascaroside expression changes with development and environmental conditions. This is consistent with multiple functions of these signaling molecules. Knowledge of such differential regulation will make it possible to associate ascaroside production to gene expression profiles (transcript, protein or enzyme activity and help to determine genetic pathways that control ascaroside biosynthesis. In conjunction with findings

Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

Directory of Open Access Journals (Sweden)

Alberto Miranda

2011-04-01

Full Text Available Cellular prion protein (PRNP is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs. Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB differentiation in mouse Prnp-null (KO and WT embryonic stem cell (ESC lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5 in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel and SPRN (Shadoo, whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

Developmental co-expression of small molecular weight apolipoprotein B synthesis and triacylglycerol secretion

International Nuclear Information System (INIS)

Coleman, R.A.; Haynes, E.B.; Sand, T.M.; Davis, R.A.

1987-01-01

The development of the liver's ability to coordinately express the synthesis and secretion of the two major components of very low density lipoproteins (VLDL): triacylglycerol (TG) and apolipoprotein B (apo B) was examined in cultured hepatocytes obtained from fetal, suckling and adult rats. Hepatocytes from fetal and suckling rats synthesized and secreted TG at rates lower than that displayed by adult cells. When TG synthesis was equalized by adding oleic acid to the culture medium, fetal cells still secreted only 39% as much TG as did adult cells. To determine the basis for the apparent defect in VLDL assembly/secretion displayed by fetal cells, the synthesis and secretion of [ 35 S]methionine-labeled apo B was quantified by immunoprecipitation. Although adult and fetal cells synthesized and secreted large molecular weight apo B at similar rates, the synthesis and secretion of small molecular weight apo B was 2-fold greater in adult cells. These data suggest that the ability to assemble/secrete VLDL triacylglycerol varies in parallel with the developmental expression of small molecular weight apo B. Furthermore, these studies show the usefulness of the cultured rat hepatocyte model for examining the ontogeny and regulation of VLDL assembly/secretion

Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

Directory of Open Access Journals (Sweden)

Ro Dae-Kyun

2009-07-01

Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

Science.gov (United States)

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

Dynamic regulation of mRNA and miRNA associated with the developmental stages of skin pigmentation in Japanese ornamental carp.

Science.gov (United States)

Tian, Xue; Pang, Xiaolei; Wang, Liangyan; Li, Mengrong; Dong, Chuanju; Ma, Xiao; Wang, Lei; Song, Dongying; Feng, Jianxin; Xu, Peng; Li, Xuejun

2018-04-20

The Japanese ornamental carp (Cyprinus carpio var. Koi) is famous for multifarious colors and patterns, making it commonly culture and trade across the world. Although functional genes and inheritance of color traits have been commonly studied, seldom attentions were focused on the genetic regulation during the developmental process of pigmentation. To better understand the mechanism of skin color development, we observed the morphogenesis of pigment cells during the post-embryonic stages and analysed the temporal expression pattern of mRNAs/miRNAs profiles in four distinct developmental stages. 59 and 103 differentially expressed genes/miRNAs (DEGs/DEMs) associated with pigmentation and skin were identified, including pax7, mitf, tyr, tyrp1, etc., and the highest DEGs were detected at 11 days post hatching (dph). In addition, the functional characteristics of mRNAs/miRNAs associated with pteridine and carotenoid pathway were also examined. Furthermore, 65 miRNA-mRNA interaction pairs related to pigmentation, pteridines and carotenoids metabolism were detected between different stages. Interestingly, the largest pairs appeared in the transition from 11 dph to 48 dph, which had the similar trend with DEGs further manifesting the importance of 11 dph. This study produced a comprehensive programme of DEGs/DEMs during color development, which will provide resources to understand the regulation mechanism in color formation. The understanding of genetic basis in color formation might promote the production and breeding of the Koi carp. Copyright © 2017. Published by Elsevier B.V.

Genome-wide identification and expression profiling reveal tissue-specific expression and differentially-regulated genes involved in gibberellin metabolism between Williams banana and its dwarf mutant.

Science.gov (United States)

Chen, Jingjing; Xie, Jianghui; Duan, Yajie; Hu, Huigang; Hu, Yulin; Li, Weiming

2016-05-27

Dwarfism is one of the most valuable traits in banana breeding because semi-dwarf cultivars show good resistance to damage by wind and rain. Moreover, these cultivars present advantages of convenient cultivation, management, and so on. We obtained a dwarf mutant '8818-1' through EMS (ethyl methane sulphonate) mutagenesis of Williams banana 8818 (Musa spp. AAA group). Our research have shown that gibberellins (GAs) content in 8818-1 false stems was significantly lower than that in its parent 8818 and the dwarf type of 8818-1 could be restored by application of exogenous GA3. Although GA exerts important impacts on the 8818-1 dwarf type, our understanding of the regulation of GA metabolism during banana dwarf mutant development remains limited. Genome-wide screening revealed 36 candidate GA metabolism genes were systematically identified for the first time; these genes included 3 MaCPS, 2 MaKS, 1 MaKO, 2 MaKAO, 10 MaGA20ox, 4 MaGA3ox, and 14 MaGA2ox genes. Phylogenetic tree and conserved protein domain analyses showed sequence conservation and divergence. GA metabolism genes exhibited tissue-specific expression patterns. Early GA biosynthesis genes were constitutively expressed but presented differential regulation in different tissues in Williams banana. GA oxidase family genes were mainly transcribed in young fruits, thus suggesting that young fruits were the most active tissue involved in GA metabolism, followed by leaves, bracts, and finally approximately mature fruits. Expression patterns between 8818 and 8818-1 revealed that MaGA20ox4, MaGA20ox5, and MaGA20ox7 of the MaGA20ox gene family and MaGA2ox7, MaGA2ox12, and MaGA2ox14 of the MaGA2ox gene family exhibited significant differential expression and high-expression levels in false stems. These genes are likely to be responsible for the regulation of GAs content in 8818-1 false stems. Overall, phylogenetic evolution, tissue specificity and differential expression analyses of GA metabolism genes can provide a

Temporal, Diagnostic, and Tissue-Specific Regulation of NRG3 Isoform Expression in Human Brain Development and Affective Disorders

Science.gov (United States)

Paterson, Clare; Wang, Yanhong; Hyde, Thomas M.; Weinberger, Daniel R.; Kleinman, Joel E.; Law, Amanda J.

2018-01-01

Objective Genes implicated in schizophrenia are enriched in networks differentially regulated during human CNS development. Neuregulin 3 (NRG3), a brain-enriched neurotrophin, undergoes alternative splicing and is implicated in several neurological disorders with developmental origins. Isoform-specific increases in NRG3 are observed in schizophrenia and associated with rs10748842, a NRG3 risk polymorphism, suggesting NRG3 transcriptional dysregulation as a molecular mechanism of risk. The authors quantitatively mapped the temporal trajectories of NRG3 isoforms (classes I–IV) in the neocortex throughout the human lifespan, examined whether tissue-specific regulation of NRG3 occurs in humans, and determined if abnormalities in NRG3 transcriptomics occur in mood disorders and are genetically determined. Method NRG3 isoform classes I–IV were quantified using quantitative real-time polymerase chain reaction in human postmortem dorsolateral prefrontal cortex from 286 nonpsychiatric control individuals, from gestational week 14 to 85 years old, and individuals diagnosed with either bipolar disorder (N=34) or major depressive disorder (N=69). Tissue-specific mapping was investigated in several human tissues. rs10748842 was genotyped in individuals with mood disorders, and association with NRG3 isoform expression examined. Results NRG3 classes displayed individually specific expression trajectories across human neocortical development and aging; classes I, II, and IV were significantly associated with developmental stage. NRG3 class I was increased in bipolar and major depressive disorder, consistent with observations in schizophrenia. NRG3 class II was increased in bipolar disorder, and class III was increased in major depression. The rs10748842 risk genotype predicted elevated class II and III expression, consistent with previous reports in the brain, with tissue-specific analyses suggesting that classes II and III are brain-specific isoforms of NRG3. Conclusions

Male sex interspecies divergence and down regulation of expression of spermatogenesis genes in Drosophila sterile hybrids.

Science.gov (United States)

Sundararajan, Vignesh; Civetta, Alberto

2011-01-01

Male sex genes have shown a pattern of rapid interspecies divergence at both the coding and gene expression level. A common outcome from crosses between closely-related species is hybrid male sterility. Phenotypic and genetic studies in Drosophila sterile hybrid males have shown that spermatogenesis arrest is postmeiotic with few exceptions, and that most misregulated genes are involved in late stages of spermatogenesis. Comparative studies of gene regulation in sterile hybrids and parental species have mainly used microarrays providing a whole genome representation of regulatory problems in sterile hybrids. Real-time PCR studies can reject or reveal differences not observed in microarray assays. Moreover, differences in gene expression between samples can be dependant on the source of RNA (e.g., whole body vs. tissue). Here we survey expression in D. simulans, D. mauritiana and both intra and interspecies hybrids using a real-time PCR approach for eight genes expressed at the four main stages of sperm development. We find that all genes show a trend toward under expression in the testes of sterile hybrids relative to parental species with only the two proliferation genes (bam and bgcn) and the two meiotic class genes (can and sa) showing significant down regulation. The observed pattern of down regulation for the genes tested can not fully explain hybrid male sterility. We discuss the down regulation of spermatogenesis genes in hybrids between closely-related species within the contest of rapid divergence experienced by the male genome, hybrid sterility and possible allometric changes due to subtle testes-specific developmental abnormalities.

Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

Science.gov (United States)

Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

2012-01-01

Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

International Nuclear Information System (INIS)

Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

2016-01-01

Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

Cell wall composition and lignin biosynthetic gene expression along a developmental gradient in an Australian sugarcane cultivar

Directory of Open Access Journals (Sweden)

William P. Bewg

2017-12-01

Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

Science.gov (United States)

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

Expression patterns of five polymorphic membrane proteins during the Chlamydia abortus developmental cycle.

Science.gov (United States)

Wheelhouse, Nick; Sait, Michelle; Wilson, Kim; Aitchison, Kevin; McLean, Kevin; Smith, David G E; Longbottom, David

2012-12-07

It has been suggested that polymorphic membrane proteins (Pmps) belonging to the Type V autotransporter protein family play an important role in the pathogenesis of Chlamydia abortus (C. abortus; formerly Chlamydophila abortus) infection. In a previous study we demonstrated the expression of all the pmps at the transcriptional level. The purpose of this study was to measure the number of Pmp positive inclusions throughout the C. abortus developmental cycle to investigate heterogeneity in expression patterns. McCoy cells were infected with C. abortus and analysed for Pmp expression over a 72 h period by fluorescent immunocytochemistry. Pmp18D could be detected at all analysed time points, and could only be accurately quantified from 36 hpi while Pmp10G positive inclusions could be visualised from 36hpi. Expression of Pmps 13G, 16G and 17G could only be visualised later in the cycle and within less than half of visualised inclusions. These results indicate that while expression of specific Pmps is constitutive (Pmp18D), the pattern of expression of other Pmps is more variable. This suggests that different members of the Pmp family may play different roles within the developmental cycle of the organism, with some (Pmps10G and 18D) having roles throughout the cycle, while the heterogeneity of expression of others may aid in antigenic variation. Copyright © 2012 Elsevier B.V. All rights reserved.

Developmentally regulated sesquiterpene production confers resistance to Colletotrichum gloeosporioides in ripe pepper fruits.

Directory of Open Access Journals (Sweden)

Sangkyu Park

Full Text Available Sesquiterpenoid capsidiol, exhibiting antifungal activity against pathogenic fungus, is accumulated in infected ripe pepper fruits. In this study, we found a negative relation between the capsidiol level and lesion size in fruits infected with Colletotrichum gloeosporioides, depending on the stage of ripening. To understand the developmental regulation of capsidiol biosynthesis, fungal-induced gene expressions in the isoprenoid biosynthetic pathways were examined in unripe and ripe pepper fruits. The sterol biosynthetic pathway was almost shut down in healthy ripe fruits, showing very low expression of hydroxymethyl glutaryl CoA reductase (HMGR and squalene synthase (SS genes. In contrast, genes in the carotenoid pathway were highly expressed in ripe fruits. In the sesquiterpene pathway, 5-epi-aristolochene synthase (EAS, belonging to a sesquiterpene cyclase (STC family, was significantly induced in the ripe fruits upon fungal infection. Immunoblot and enzyme activity analyses showed that the STCs were induced both in the infected unripe and ripe fruits, while capsidiol was synthesized discriminatively in the ripe fruits, implying diverse enzymatic specificity of multiple STCs. Thereby, to divert sterol biosynthesis into sesquiterpene production, infected fruits were pretreated with an SS inhibitor, zaragozic acid (ZA, resulting in increased levels of capsidiol by more than 2-fold in the ripe fruits, with concurrent reduction of phytosterols. Taken together, the present results suggest that the enhanced expression and activity of EAS in the ripe fruits play an important role in capsidiol production, contributing to the incompatibility between the anthracnose fungus and the ripe pepper fruits.

A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

Science.gov (United States)

Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

2015-03-01

Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Role of developmental factors in hypothalamic function

Directory of Open Access Journals (Sweden)

Jakob eBiran

2015-04-01

Full Text Available The hypothalamus is a brain region which regulates homeostasis by mediating endocrine, autonomic and behavioral functions. It is comprised of several nuclei containing distinct neuronal populations producing neuropeptides and neurotransmitters that regulate fundamental body functions including temperature and metabolic rate, thirst and hunger, sexual behavior and reproduction, circadian rhythm, and emotional responses. The identity, number and connectivity of these neuronal populations are established during the organism’s development and are of crucial importance for normal hypothalamic function. Studies have suggested that developmental abnormalities in specific hypothalamic circuits can lead to obesity, sleep disorders, anxiety, depression and autism. At the molecular level, the development of the hypothalamus is regulated by transcription factors, secreted growth factors, neuropeptides and their receptors. Recent studies in zebrafish and mouse have demonstrated that some of these molecules maintain their expression in the adult brain and subsequently play a role in the physiological functions that are regulated by hypothalamic neurons. Here, we summarize the involvement of some of the key developmental factors in hypothalamic development and function by focusing on the mouse and zebrafish genetic model organisms.

Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

Science.gov (United States)

Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

2011-01-01

Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and

Developmental transcriptomic features of the carcinogenic liver fluke, Clonorchis sinensis.

Directory of Open Access Journals (Sweden)

Won Gi Yoo

2011-06-01

Full Text Available Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs. Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development

Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao

Science.gov (United States)

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-01-01

Witches’ broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant–fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. PMID:25540440

A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

Directory of Open Access Journals (Sweden)

Leonie Alten

Full Text Available The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

Science.gov (United States)

Alten, Leonie; Schuster-Gossler, Karin; Eichenlaub, Michael P; Wittbrodt, Beate; Wittbrodt, Joachim; Gossler, Achim

2012-01-01

The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs) whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC) expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE) upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

Science.gov (United States)

de Oliveira, Rita F.; Wann, John P.

2011-01-01

In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

Environmental regulation of plant gene expression: an RT-qPCR laboratory project for an upper-level undergraduate biochemistry or molecular biology course.

Science.gov (United States)

Eickelberg, Garrett J; Fisher, Alison J

2013-01-01

We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.

Gαo and Gαq regulate the expression of daf-7, a TGFβ-like gene, in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Edith M Myers

Full Text Available Caenorhabditis elegans enter an alternate developmental stage called dauer in unfavorable conditions such as starvation, overcrowding, or high temperature. Several evolutionarily conserved signaling pathways control dauer formation. DAF-7/TGFβ and serotonin, important ligands in these signaling pathways, affect not only dauer formation, but also the expression of one another. The heterotrimeric G proteins GOA-1 (Gα(o and EGL-30 (Gα(q mediate serotonin signaling as well as serotonin biosynthesis in C. elegans. It is not known whether GOA-1 or EGL-30 also affect dauer formation and/or daf-7 expression, which are both modulated in part by serotonin. The purpose of this study is to better understand the relationship between proteins important for neuronal signaling and developmental plasticity in both C. elegans and humans. Using promoter-GFP transgenic worms, it was determined that both goa-1 and egl-30 regulate daf-7 expression during larval development. In addition, the normal daf-7 response to high temperature or starvation was altered in goa-1 and egl-30 mutants. Despite the effect of goa-1 and egl-30 mutations on daf-7 expression in various environmental conditions, there was no effect of the mutations on dauer formation. This paper provides evidence that while goa-1 and egl-30 are important for normal daf-7 expression, mutations in these genes are not sufficient to disrupt dauer formation.

Regulation of Banana Phytoene Synthase (MaPSY) Expression, Characterization and Their Modulation under Various Abiotic Stress Conditions

Science.gov (United States)

Kaur, Navneet; Pandey, Ashutosh; Shivani; Kumar, Prateek; Pandey, Pankaj; Kesarwani, Atul K.; Mantri, Shrikant S.; Awasthi, Praveen; Tiwari, Siddharth

2017-01-01

Phytoene synthase (PSY) is a key regulatory enzyme of carotenoid biosynthesis pathway in plants. The present study examines the role of PSY in carotenogenesis and stress management in banana. Germplasm screening of 10 Indian cultivars showed that Nendran (3011.94 μg/100 g dry weight) and Rasthali (105.35 μg/100 g dry weight) contained the highest and lowest amounts of β-carotene, respectively in ripe fruit-pulp. Nendran ripe pulp also showed significantly higher antioxidant activity as compared to Rasthali. Meta-analysis of three banana PSY genes (MaPSY1, MaPSY2, and MaPSY3) was performed to identify their structural features, subcellular, and chromosomal localization in banana genome. The distinct expression patterns of MaPSY1, MaPSY2, and MaPSY3 genes were observed in various tissues, and fruit developmental stages of these two contrasting cultivars, suggesting differential regulation of the banana PSY genes. A positive correlation was observed between the expression of MaPSY1 and β-carotene accumulation in the ripe fruit-peel and pulp of Nendran. The presence of stress responsive cis-regulatory motifs in promoter region of MaPSY genes were correlated with the expression pattern during various stress (abscisic acid, methyl jasmonate, salicylic acid and dark) treatments. The positive modulation of MaPSY1 noticed under abiotic stresses suggested its role in plant physiological functions and defense response. The amino acid sequence analysis of the PSY proteins in contrasting cultivars revealed that all PSY comprises conserved domains related to enzyme activity. Bacterial complementation assay has validated the functional activity of six PSY proteins and among them PSY1 of Nendran (Nen-PSY1) gave the highest activity. These data provide new insights into the regulation of PSY expression in banana by developmental and stress related signals that can be explored in the banana improvement programs. PMID:28421096

A photo-responsive F-box protein FOF2 regulates floral initiation by promoting FLC expression in Arabidopsis.

Science.gov (United States)

He, Reqing; Li, Xinmei; Zhong, Ming; Yan, Jindong; Ji, Ronghuan; Li, Xu; Wang, Qin; Wu, Dan; Sun, Mengsi; Tang, Dongying; Lin, Jianzhong; Li, Hongyu; Liu, Bin; Liu, Hongtao; Liu, Xuanming; Zhao, Xiaoying; Lin, Chentao

2017-09-01

Floral initiation is regulated by various genetic pathways in response to light, temperature, hormones and developmental status; however, the molecular mechanisms underlying the interactions between different genetic pathways are not fully understood. Here, we show that the photoresponsive gene FOF2 (F-box of flowering 2) negatively regulates flowering. FOF2 encodes a putative F-box protein that interacts specifically with ASK14, and its overexpression results in later flowering under both long-day and short-day photoperiods. Conversely, transgenic plants expressing the F-box domain deletion mutant of FOF2 (FOF2ΔF), or double loss of function mutant of FOF2 and FOL1 (FOF2-LIKE 1) present early flowering phenotypes. The late flowering phenotype of the FOF2 overexpression lines is suppressed by the flc-3 loss-of-function mutation. Furthermore, FOF2 mRNA expression is regulated by autonomous pathway gene FCA, and the repressive effect of FOF2 in flowering can be overcome by vernalization. Interestingly, FOF2 expression is regulated by light. The protein level of FOF2 accumulates in response to light, whereas it is degraded under dark conditions via the 26S proteasome pathway. Our findings suggest a possible mechanistic link between light conditions and the autonomous floral promotion pathway in Arabidopsis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

A Drosophila Genome-Wide Screen Identifies Regulators of Steroid Hormone Production and Developmental Timing

DEFF Research Database (Denmark)

Thomas Danielsen, E.; E. Møller, Morten; Yamanaka, Naoki

2016-01-01

Steroid hormones control important developmental processes and are linked to many diseases. To systematically identify genes and pathways required for steroid production, we performed a Drosophila genome-wide in vivo RNAi screen and identified 1,906 genes with potential roles in steroidogenesis...... and developmental timing. Here, we use our screen as a resource to identify mechanisms regulating intracellular levels of cholesterol, a substrate for steroidogenesis. We identify a conserved fatty acid elongase that underlies a mechanism that adjusts cholesterol trafficking and steroidogenesis with nutrition...... and developmental programs. In addition, we demonstrate the existence of an autophagosomal cholesterol mobilization mechanism and show that activation of this system rescues Niemann-Pick type C1 deficiency that causes a disorder characterized by cholesterol accumulation. These cholesterol-trafficking mechanisms...

Regulation of somatic embryo development in Norway spruce (Picea abies). A molecular approach to the characterization of specific developmental stages

Energy Technology Data Exchange (ETDEWEB)

Sabala, I. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics

1998-12-31

Embryo development is a complex process involving a set of strictly regulated events. The regulation of these events is poorly understood especially during the early stages of embryo development. Somatic embryos go through the same developmental stages as zygotic embryos making them an ideal model system for studying the regulation of embryo development. We have used embryogenic cultures of Picea abies to study some aspects of the regulation of embryo development in gymnosperms. The bottle neck during somatic embryogenesis is the switch from the proliferation stage to the maturation stage. This switch is initiated by giving somatic embryos a maturation treatment i.e. the embryos are treated with abscisic acid (ABA). Somatic embryos which respond to ABA by forming mature somatic embryos were stimulated to secret a 70 kDa protein, AF70. The af70 gene was isolated and characterised. The expression of the af70 gene was constitutive in embryos but was highly ABA-induced in seedlings. Moreover, expression of this gene was stimulated during cold acclimation of Picea abies seedlings. A full length Picea abies cDNA clone Pa18, encoding a protein with the characteristics of plant lipid transfer proteins (LTPs), was isolated and characterised. The Pa18 gene is constitutively expressed in embryogenic cultures of Picea abies representing different stages of development as well as in nonembryogenic callus and seedlings. In situ hybridization showed that Pa18 gene is expressed in all embryonic cells of proliferating somatic embryos but the expression of the gene in mature somatic and zygotic embryos is restricted to the outer cell layer. Southern blot analysis at different stringencies was consistent with a single gene. An alteration in expression of Pa18 causes disturbance in the formation of the proper outer cell layer in the maturing somatic embryos. In addition to its influence on embryo development the Pa18 gene product also inhibits growth of Agrobacterium tumefaciens 195

MiR-495 and miR-218 regulate the expression of the Onecut transcription factors HNF-6 and OC-2

Energy Technology Data Exchange (ETDEWEB)

Simion, Alexandru; Laudadio, Ilaria; Prevot, Pierre-Paul; Raynaud, Peggy; Lemaigre, Frederic P. [Universite catholique de Louvain, de Duve Institute, 75 Avenue Hippocrate 7529, B-1200 Brussels (Belgium); Jacquemin, Patrick, E-mail: patrick.jacquemin@uclouvain.be [Universite catholique de Louvain, de Duve Institute, 75 Avenue Hippocrate 7529, B-1200 Brussels (Belgium)

2010-01-01

MicroRNAs are small, non-coding RNAs that posttranscriptionally regulate gene expression mainly by binding to the 3'UTR of their target mRNAs. Recent data revealed that microRNAs have an important role in pancreas and liver development and physiology. Using cloning and microarray profiling approaches, we show that a unique repertoire of microRNAs is expressed at the onset of liver and pancreas organogenesis, and in pancreas and liver at key stages of cell fate determination. Among the microRNAs that are expressed at these stages, miR-495 and miR-218 were predicted to, respectively, target the Onecut (OC) transcription factors Hepatocyte Nuclear Factor-6 (HNF-6/OC-1) and OC-2, two important regulators of liver and pancreas development. MiR-495 and miR-218 are dynamically expressed in developing liver and pancreas, and by transient transfection, we show that they target HNF-6 and OC-2 3'UTRs. Moreover, when overexpressed in cultured cells, miR-495 and miR-218 decrease the endogenous levels of HNF-6 and OC-2 mRNA. These results indicate that the expression of regulators of liver and pancreas development is modulated by microRNAs. They also suggest a developmental role for miR-495 and miR-218.

MiR-495 and miR-218 regulate the expression of the Onecut transcription factors HNF-6 and OC-2

International Nuclear Information System (INIS)

Simion, Alexandru; Laudadio, Ilaria; Prevot, Pierre-Paul; Raynaud, Peggy; Lemaigre, Frederic P.; Jacquemin, Patrick

2010-01-01

MicroRNAs are small, non-coding RNAs that posttranscriptionally regulate gene expression mainly by binding to the 3'UTR of their target mRNAs. Recent data revealed that microRNAs have an important role in pancreas and liver development and physiology. Using cloning and microarray profiling approaches, we show that a unique repertoire of microRNAs is expressed at the onset of liver and pancreas organogenesis, and in pancreas and liver at key stages of cell fate determination. Among the microRNAs that are expressed at these stages, miR-495 and miR-218 were predicted to, respectively, target the Onecut (OC) transcription factors Hepatocyte Nuclear Factor-6 (HNF-6/OC-1) and OC-2, two important regulators of liver and pancreas development. MiR-495 and miR-218 are dynamically expressed in developing liver and pancreas, and by transient transfection, we show that they target HNF-6 and OC-2 3'UTRs. Moreover, when overexpressed in cultured cells, miR-495 and miR-218 decrease the endogenous levels of HNF-6 and OC-2 mRNA. These results indicate that the expression of regulators of liver and pancreas development is modulated by microRNAs. They also suggest a developmental role for miR-495 and miR-218.

MicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother

Directory of Open Access Journals (Sweden)

Mohammed Alsaweed

2015-10-01

Full Text Available Human milk (HM is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance.

Timing is everything: Reiterative Wnt, BMP and RA signaling regulate developmental competence during endoderm organogenesis.

Science.gov (United States)

Rankin, Scott A; McCracken, Kyle W; Luedeke, David M; Han, Lu; Wells, James M; Shannon, John M; Zorn, Aaron M

2018-02-01

A small number of signaling pathways are used repeatedly during organogenesis, and they can have drastically different effects on the same population of cells depending on the embryonic stage. How cellular competence changes over developmental time is not well understood. Here we used Xenopus, mouse, and human pluripotent stem cells to investigate how the temporal sequence of Wnt, BMP, and retinoic acid (RA) signals regulates endoderm developmental competence and organ induction, focusing on respiratory fate. While Nkx2-1+ lung fate is not induced until late somitogenesis stages, here we show that lung competence is restricted by the gastrula stage as a result of Wnt and BMP-dependent anterior-posterior (A-P) patterning. These early Wnt and BMP signals make posterior endoderm refractory to subsequent RA/Wnt/BMP-dependent lung induction. We further mapped how RA modulates the response to Wnt and BMP in a temporal specific manner. In the gastrula RA promotes posterior identity, however in early somite stages of development RA regulates respiratory versus pharyngeal potential in anterior endoderm and midgut versus hindgut potential in posterior endoderm. Together our data suggest a dynamic and conserved response of vertebrate endoderm during organogenesis, wherein early Wnt/BMP/RA impacts how cells respond to later Wnt/BMP/RA signals, illustrating how reiterative combinatorial signaling can regulate both developmental competence and subsequent fate specification. Copyright © 2017 Elsevier Inc. All rights reserved.

l-Ergothioneine improves the developmental potential of in vitro sheep embryos without influencing OCTN1-mediated cross-membrane transcript expression.

Science.gov (United States)

Mishra, A; Reddy, I J; Dhali, A; Javvaji, P K

2018-04-02

SummaryThe objective of the study was to investigate the effect of l-ergothioneine (l-erg) (5 mM or 10 mM) supplementation in maturation medium on the developmental potential and OCTN1-dependant l-erg-mediated (10 mM) change in mRNA abundance of apoptotic (Bcl2, Bax, Casp3 and PCNA) and antioxidant (GPx, SOD1, SOD2 and CAT) genes in sheep oocytes and developmental stages of embryos produced in vitro. Oocytes matured with l-erg (10 mM) reduced their embryo toxicity by decreasing intracellular ROS and increasing intracellular GSH in matured oocytes that in turn improved developmental potential, resulting in significantly (P l-erg without change in maturation rate. l-Erg (10 mM) treatment did not influence the mRNA abundance of the majority of apoptotic and antioxidant genes studied in the matured oocytes and developmental stages of embryo. A gene expression study found that the SLC22A4 gene that encodes OCTN1, an integral membrane protein and specific transporter of l-erg was not expressed in oocytes and developmental stages of embryos. Therefore it was concluded from the study that although there was improvement in the developmental potential of sheep embryos by l-erg supplementation in maturation medium, there was no change in the expression of the majority of the genes studied due to the absence of the SLC22A4 gene in oocytes and embryos that encode OCTN1, which is responsible for transportation of l-erg across the membrane to alter gene expression.

[Regulation of heat shock gene expression in response to stress].

Science.gov (United States)

Garbuz, D G

2017-01-01

Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

The conserved splicing factor SUA controls alternative splicing of the developmental regulator ABI3 in Arabidopsis.

NARCIS (Netherlands)

Sugliani, M.; Brambilla, V.; Clerkx, E.J.M.; Koornneef, M.; Soppe, W.J.J.

2010-01-01

ABSCISIC ACID INSENSITIVE3 (ABI3) is a major regulator of seed maturation in Arabidopsis thaliana. We detected two ABI3 transcripts, ABI3- and ABI3-ß, which encode full-length and truncated proteins, respectively. Alternative splicing of ABI3 is developmentally regulated, and the ABI3-ß transcript

Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

Science.gov (United States)

Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

2016-05-01

The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

Science.gov (United States)

Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram

2003-12-01

Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana.

Science.gov (United States)

Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott

2016-08-01

Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

Science.gov (United States)

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

International Nuclear Information System (INIS)

Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

1988-01-01

Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

Apoplastic and intracellular plant sugars regulate developmental transitions in witches' broom disease of cacao.

Science.gov (United States)

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-03-01

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Global developmental gene expression and pathway analysis of normal brain development and mouse models of human neuronal migration defects.

Directory of Open Access Journals (Sweden)

Tiziano Pramparo

2011-03-01

Full Text Available Heterozygous LIS1 mutations are the most common cause of human lissencephaly, a human neuronal migration defect, and DCX mutations are the most common cause of X-linked lissencephaly. LIS1 is part of a protein complex including NDEL1 and 14-3-3ε that regulates dynein motor function and microtubule dynamics, while DCX stabilizes microtubules and cooperates with LIS1 during neuronal migration and neurogenesis. Targeted gene mutations of Lis1, Dcx, Ywhae (coding for 14-3-3ε, and Ndel1 lead to neuronal migration defects in mouse and provide models of human lissencephaly, as well as aid the study of related neuro-developmental diseases. Here we investigated the developing brain of these four mutants and wild-type mice using expression microarrays, bioinformatic analyses, and in vivo/in vitro experiments to address whether mutations in different members of the LIS1 neuronal migration complex lead to similar and/or distinct global gene expression alterations. Consistent with the overall successful development of the mutant brains, unsupervised clustering and co-expression analysis suggested that cell cycle and synaptogenesis genes are similarly expressed and co-regulated in WT and mutant brains in a time-dependent fashion. By contrast, focused co-expression analysis in the Lis1 and Ndel1 mutants uncovered substantial differences in the correlation among pathways. Differential expression analysis revealed that cell cycle, cell adhesion, and cytoskeleton organization pathways are commonly altered in all mutants, while synaptogenesis, cell morphology, and inflammation/immune response are specifically altered in one or more mutants. We found several commonly dysregulated genes located within pathogenic deletion/duplication regions, which represent novel candidates of human mental retardation and neurocognitive disabilities. Our analysis suggests that gene expression and pathway analysis in mouse models of a similar disorder or within a common pathway can

EMA: a developmentally regulated cell-surface glycoprotein of CNS neurons that is concentrated at the leading edge of growth cones.

Science.gov (United States)

Baumrind, N L; Parkinson, D; Wayne, D B; Heuser, J E; Pearlman, A L

1992-08-01

To identify cell-surface molecules that mediate interactions between neurons and their environment during neural development, we used monoclonal antibody techniques to define a developmentally regulated antigen in the central nervous system of the mouse. The antibody we produced (2A1) immunolabels cells throughout the central nervous system; we analyzed its distribution in the developing cerebral cortex, where it is expressed on cells very soon after they complete mitosis and leave the periventricular proliferative zone. Expression continues into adult life. The antibody also labels the epithelium of the choroid plexus and the renal proximal tubules, but does not label neurons of the peripheral nervous system in the dorsal root ganglia. In dissociated cell culture of embryonic cerebral cortex, 2A1 labels the surface of neurons but not glia. Immunolabeling of neurons in tissue culture is particularly prominent on the edge of growth cones, including filopodia and the leading edge of lamellipodia, when observed with either immunofluorescence or freeze-etch immunoelectron microscopy. Immunopurification with 2A1 of a CHAPS-extracted membrane preparation from brains of neonatal mice produces a broad (32-36 kD) electrophoretic band and a less prominent 70 kD band that are sensitive to N-glycosidase but not endoglycosidase H. Thus the 2A1 antibody recognizes a developmentally regulated, neuronal cell surface glycoprotein (or glycoproteins) with complex N-linked oligosaccharide side chains. We have termed the glycoprotein antigen EMA because of its prominence on the edge membrane of growth cones. EMA is similar to the M6 antigen (Lagenaur et al: J. Neurobiol. 23:71-88, 1992) in apparent molecular weight, distribution in tissue sections, and immunoreactivity on Western blots, suggesting that the two antigens are similar or identical. Expression of EMA is a very early manifestation of neuronal differentiation; its distribution on growth cones suggests a role in mediating the

Neuroendocrine Regulation of Maternal Behavior

Science.gov (United States)

Bridges, Robert S.

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans

Science.gov (United States)

Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

2016-01-01

Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

Identification of cytochrome P450 differentiated expression related to developmental stages in bromadiolone resistance in rats (Rattus norvegicus)

DEFF Research Database (Denmark)

Markussen, Mette; Heiberg, Ann-Charlotte; Fredholm, Merete

2008-01-01

over-express the Cyp2a1 gene. TGhe altered gene expression has been suggested to be involved in the bromadiolone resistance by facilitating enhanced anticoagulant metabolism. To investigate the gene expression of these cytochrome P450 genes in rats of different developmental stages we compared...... expression profiles, from 8-, 12- and 20-week-old resistant rats of the Danish strain to profiles of anticoagulant-susceptible rats of same ages. The three age-groups were selected to represent a group of pre-pubertal, pubertal and adult rats. We found expression profiles of the pre-pubertal and pubertal...... resistant rats to concur with profiles of the adults suggesting that cytochrome P450 enzymes are involved in the Danish bromadiolone resistance regardless of developmental stage. We also investigated the relative importance of the six cytochrome P450s in the different development stages of the resistant...

Composition and dosage of a multipartite enhancer cluster control developmental expression of Ihh (Indian hedgehog).

Science.gov (United States)

Will, Anja J; Cova, Giulia; Osterwalder, Marco; Chan, Wing-Lee; Wittler, Lars; Brieske, Norbert; Heinrich, Verena; de Villartay, Jean-Pierre; Vingron, Martin; Klopocki, Eva; Visel, Axel; Lupiáñez, Darío G; Mundlos, Stefan

2017-10-01

Copy number variations (CNVs) often include noncoding sequences and putative enhancers, but how these rearrangements induce disease is poorly understood. Here we investigate CNVs involving the regulatory landscape of IHH (encoding Indian hedgehog), which cause multiple, highly localized phenotypes including craniosynostosis and synpolydactyly. We show through transgenic reporter and genome-editing studies in mice that Ihh is regulated by a constellation of at least nine enhancers with individual tissue specificities in the digit anlagen, growth plates, skull sutures and fingertips. Consecutive deletions, resulting in growth defects of the skull and long bones, showed that these enhancers function in an additive manner. Duplications, in contrast, caused not only dose-dependent upregulation but also misexpression of Ihh, leading to abnormal phalanges, fusion of sutures and syndactyly. Thus, precise spatiotemporal control of developmental gene expression is achieved by complex multipartite enhancer ensembles. Alterations in the composition of such clusters can result in gene misexpression and disease.

Social geography of developmental health in the early years.

Science.gov (United States)

Hertzman, Clyde

2010-01-01

What happens to children in their earliest years is critical for their development throughout the life course. The years from zero to school age are foundational for brain and biological development. Attachment and face recognition; impulse control and regulation of physical aggression; executive function in the prefrontal cortex and focused attention; fine and gross motor functions and coordination; receptive and expressive language; and understandings of quantitative concepts are all established during this time and become embedded in the architecture and function of the brain (Doherty 1997; Kolb 2009; McCain and Mustard 1999). Brain and biological development are in turn expressed through three broad domains of development of the whole child: physical, social-emotional and language-cognitive, which together are the basis of "developmental health" (Keating and Hertzman 1999). Developmental health influences many aspects of well-being, including obesity and stunting, mental health, heart disease, competence in literacy and numeracy, criminality and economic participation throughout life (Irwin et al. 2007). Accordingly, developmental health is the central concern of this article.

Developmental and growth temperature regulation of two different microsomal omega-6 desaturase genes in soybeans.

Science.gov (United States)

Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H

1996-01-01

The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990

BMP-2 Induced Expression of Alx3 That Is a Positive Regulator of Osteoblast Differentiation.

Directory of Open Access Journals (Sweden)

Takashi Matsumoto

Full Text Available Bone morphogenetic proteins (BMPs regulate many aspects of skeletal development, including osteoblast and chondrocyte differentiation, cartilage and bone formation, and cranial and limb development. Among them, BMP-2, one of the most potent osteogenic signaling molecules, stimulates osteoblast differentiation, while it inhibits myogenic differentiation in C2C12 cells. To evaluate genes involved in BMP-2-induced osteoblast differentiation, we performed cDNA microarray analyses to compare BMP-2-treated and -untreated C2C12 cells. We focused on Alx3 (aristaless-like homeobox 3 which was clearly induced during osteoblast differentiation. Alx3, a homeobox gene related to the Drosophilaaristaless gene, has been linked to developmental functions in craniofacial structures and limb development. However, little is known about its direct relationship with bone formation. In the present study, we focused on the mechanisms of Alx3 gene expression and function during osteoblast differentiation induced by BMP-2. In C2C12 cells, BMP-2 induced increase of Alx3 gene expression in both time- and dose-dependent manners through the BMP receptors-mediated SMAD signaling pathway. In addition, silencing of Alx3 by siRNA inhibited osteoblast differentiation induced by BMP-2, as showed by the expressions of alkaline phosphatase (Alp, Osteocalcin, and Osterix, while over-expression of Alx3 enhanced osteoblast differentiation induced by BMP-2. These results indicate that Alx3 expression is enhanced by BMP-2 via the BMP receptors mediated-Smad signaling and that Alx3 is a positive regulator of osteoblast differentiation induced by BMP-2.

WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

Science.gov (United States)

Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

2017-03-01

Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

Science.gov (United States)

Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2016-07-01

Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

Science.gov (United States)

Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

2016-01-01

The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

AICD Overexpression in Neuro 2A Cells Regulates Expression of PTCH1 and TRPC5

Directory of Open Access Journals (Sweden)

Mithu Raychaudhuri

2011-01-01

Full Text Available Amyloid precursor protein (APP, implicated in Alzheimer's disease, is a transmembrane protein of undetermined function. APP is cleaved by gamma-secretase that releases the APP intracellular domain (AICD in the cytoplasm. In vitro and in vivo studies have implicated the role of AICD in cell signaling and transcriptional regulation of Gsk3β, KAI1, BACE1, EGFR, and other proteins. In this study, by overexpressing AICD in mouse neuroblastoma cell lines, we have demonstrated the alteration in the expressions of two proteins, patched homolog 1 (PTCH1, a receptor for sonic hedgehog signaling, and transient receptor potential cation channel subfamily C member 5 (TRPC5, a component of receptor-activated nonselective calcium permeant cation channel. Our results indicate the possibility of regulation by AICD in developmental processes as well as in the maintenance of calcium homeostasis at the transcription level.

Integration of tomato reproductive developmental landmarks and expression profiles, and the effect of SUN on fruit shape

Directory of Open Access Journals (Sweden)

Li Dongmei

2009-05-01

Full Text Available Abstract Background Universally accepted landmark stages are necessary to highlight key events in plant reproductive development and to facilitate comparisons among species. Domestication and selection of tomato resulted in many varieties that differ in fruit shape and size. This diversity is useful to unravel underlying molecular and developmental mechanisms that control organ morphology and patterning. The tomato fruit shape gene SUN controls fruit elongation. The most dramatic effect of SUN on fruit shape occurs after pollination and fertilization although a detailed investigation into the timing of the fruit shape change as well as gene expression profiles during critical developmental stages has not been conducted. Results We provide a description of floral and fruit development in a red-fruited closely related wild relative of tomato, Solanum pimpinellifolium accession LA1589. We use established and propose new floral and fruit landmarks to present a framework for tomato developmental studies. In addition, gene expression profiles of three key stages in floral and fruit development are presented, namely floral buds 10 days before anthesis (floral landmark 7, anthesis-stage flowers (floral landmark 10 and fruit landmark 1, and 5 days post anthesis fruit (fruit landmark 3. To demonstrate the utility of the landmarks, we characterize the tomato shape gene SUN in fruit development. SUN controls fruit shape predominantly after fertilization and its effect reaches a maximum at 8 days post-anthesis coinciding with fruit landmark 4 representing the globular embryo stage of seed development. The expression profiles of the NILs that differ at sun show that only 34 genes were differentially expressed and most of them at a less than 2-fold difference. Conclusion The landmarks for flower and fruit development in tomato were outlined and integrated with the effect of SUN on fruit shape. Although we did not identify many genes differentially expressed in

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

Directory of Open Access Journals (Sweden)

Sumedha S Gunewardena

Full Text Available During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth to maturity (60-days after birth. Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2 RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

Directory of Open Access Journals (Sweden)

Taro Tsujimura

2010-12-01

Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Regulation of eucaryotic gene expression

Energy Technology Data Exchange (ETDEWEB)

Brent, R.; Ptashne, M.S

1989-05-23

This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

Thermotolerance and Heat-Shock Protein Gene Expression Patterns in Bemisia tabaci (Hemiptera: Aleyrodidae) Mediterranean in Relation to Developmental Stage.

Science.gov (United States)

Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi

2017-10-01

Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Developmental and sex-specific differences in expression of neuropeptides derived from allatotropin gene in the silkmoth Bombyx mori.

Science.gov (United States)

Bednár, Branislav; Roller, Ladislav; Čižmár, Daniel; Mitrová, Diana; Žitňan, Dušan

2017-05-01

Allatotropin (AT) and related neuropeptides are widespread bioactive molecules that regulate development, food intake and muscle contractions in insects and other invertebrates. In moths, alternative splicing of the at gene generates three mRNA precursors encoding AT with different combinations of three structurally similar AT-like peptides (ATLI-III). We used in situ hybridization and immunohistochemistry to map the differential expression of these transcripts during the postembryonic development of Bombyx mori. Transcript encoding AT alone was expressed in numerous neurons of the central nervous system and frontal ganglion, whereas transcripts encoding AT with ATLs were produced by smaller specific subgroups of neurons in larval stages. Metamorphosis was associated with considerable developmental changes and sex-specific differences in the expression of all transcripts. The most notable was the appearance of AT/ATL transcripts (1) in the brain lateral neurosecretory cells producing prothoracicotropic hormone; (2) in the male-specific cluster of about 20 neurons in the posterior region of the terminal abdominal ganglion; (3) in the female-specific medial neurons in the abdominal ganglia AG2-7. Immunohistochemical staining showed that these neurons produced a mixture of various neuropeptides and innervated diverse peripheral organs. Our data suggest that AT/ATL neuropeptides are involved in multiple stage- and sex-specific functions during the development of B. mori.

Drug-induced regulation of target expression

DEFF Research Database (Denmark)

Iskar, Murat; Campillos, Monica; Kuhn, Michael

2010-01-01

Drug perturbations of human cells lead to complex responses upon target binding. One of the known mechanisms is a (positive or negative) feedback loop that adjusts the expression level of the respective target protein. To quantify this mechanism systems-wide in an unbiased way, drug......-induced differential expression of drug target mRNA was examined in three cell lines using the Connectivity Map. To overcome various biases in this valuable resource, we have developed a computational normalization and scoring procedure that is applicable to gene expression recording upon heterogeneous drug treatments....... In 1290 drug-target relations, corresponding to 466 drugs acting on 167 drug targets studied, 8% of the targets are subject to regulation at the mRNA level. We confirmed systematically that in particular G-protein coupled receptors, when serving as known targets, are regulated upon drug treatment. We...

Changes in miRNA Expression Profiling during Neuronal Differentiation and Methyl Mercury-Induced Toxicity in Human in Vitro Models

Directory of Open Access Journals (Sweden)

Giorgia Pallocca

2014-08-01

Full Text Available MicroRNAs (miRNAs are implicated in the epigenetic regulation of several brain developmental processes, such as neurogenesis, neuronal differentiation, neurite outgrowth, and synaptic plasticity. The main aim of this study was to evaluate whether miRNA expression profiling could be a useful approach to detect in vitro developmental neurotoxicity. For this purpose, we assessed the changes in miRNA expression caused by methyl mercury chloride (MeHgCl, a well-known developmental neurotoxicant, comparing carcinoma pluripotent stem cells (NT-2 with human embryonic stem cells (H9, both analyzed during the early stage of neural progenitor commitment into neuronal lineage. The data indicate the activation of two distinct miRNA signatures, one activated upon neuronal differentiation and another upon MeHgCl-induced toxicity. Particularly, exposure to MeHgCl elicited, in both neural models, the down-regulation of the same six out of the ten most up-regulated neuronal pathways, as shown by the up-regulation of the corresponding miRNAs and further assessment of gene ontology (GO term and pathway enrichment analysis. Importantly, some of these common miRNA-targeted pathways defined in both cell lines are known to play a role in critical developmental processes, specific for neuronal differentiation, such as axon guidance and neurotrophin-regulated signaling. The obtained results indicate that miRNAs expression profiling could be a promising tool to assess developmental neurotoxicity pathway perturbation, contributing towards improved predictive human toxicity testing.

Expression of cytochrome P450 regulators in cynomolgus macaque.

Science.gov (United States)

Uno, Yasuhiro; Yamazaki, Hiroshi

2017-09-11

1. Cytochrome P450 (P450) regulators including nuclear receptors and transcription factors have not been fully investigated in cynomolgus macaques, an important species used in drug metabolism studies. In this study, we analyzed 17 P450 regulators by sequence and phylogenetic analysis, and tissue expression. 2. Gene and genome structures of 17 P450 regulators were similar to the human orthologs, and the deduced amino acid sequences showed high sequence identities (92-95%) and more closely clustered in a phylogenetic tree, with the human orthologs. 3. Many of the P450 regulator mRNAs were preferentially expressed in the liver, kidney, and/or jejunum. Among the P450 regulator mRNAs, PXR was most abundant in the liver and jejunum, and HNF4α in the kidney. In the liver, the expression of most P450 regulator mRNAs did not show significant differential expression (>2.5-fold) between cynomolgus macaques bred in Cambodia, China, and Indonesia, or rhesus macaques. 4. By correlation analysis, most of the P450 regulators were significantly (p < 0.05) correlated to other P450 regulators, and many of them were also significantly (p < 0.05) correlated with P450s. 5. These results suggest that 17 P450 regulators of cynomolgus macaques had similar molecular characteristics to the human orthologs.

One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

Science.gov (United States)

Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

2009-01-01

Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

Targeting developmental regulators of zebrafish exocrine pancreas as a therapeutic approach in human pancreatic cancer

Directory of Open Access Journals (Sweden)

Nelson S. Yee

2012-02-01

Histone deacetylases (HDACs and RNA polymerase III (POLR3 play vital roles in fundamental cellular processes, and deregulation of these enzymes has been implicated in malignant transformation. Hdacs and Polr3 are required for exocrine pancreatic epithelial proliferation during morphogenesis in zebrafish. We aim to test the hypothesis that Hdacs and Polr3 cooperatively control exocrine pancreatic growth, and combined inhibition of HDACs and POLR3 produces enhanced growth suppression in pancreatic cancer. In zebrafish larvae, combination of a Hdac inhibitor (Trichostatin A and an inhibitor of Polr3 (ML-60218 synergistically prohibited the expansion of exocrine pancreas. In human pancreatic adenocarcinoma cells, combination of the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA and ML-60218 produced augmented suppression of colony formation and proliferation, and induction of cell cycle arrest and apoptotic cell death. The enhanced cytotoxicity was associated with supra-additive upregulation of the pro-apoptotic regulator BAX and the cyclin-dependent kinase inhibitor p21CDKN1A. tRNAs have been shown to have pro-proliferative and anti-apoptotic roles, and SAHA-stimulated expression of tRNAs was reversed by ML-60218. These findings demonstrate that chemically targeting developmental regulators of exocrine pancreas can be translated into an approach with potential impact on therapeutic response in pancreatic cancer, and suggest that counteracting the pro-malignant side effect of HDAC inhibitors can enhance their anti-tumor activity.

Developmental Science: Past, Present, and Future

Science.gov (United States)

Lerner, Richard M.

2012-01-01

The goal of developmental science is to describe, explain, and optimize intraindividual changes in adaptive developmental regulations and, as well, interindividual differences in such relations, across life. The history of developmental science is reviewed and its current foci, which are framed by relational developmental systems models that…

Altered cortical expression of GABA-related genes in schizophrenia: illness progression vs developmental disturbance.

Science.gov (United States)

Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A

2015-01-01

Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Developmental changes in hypothalamic oxytocin and oxytocin receptor mRNA expression and their sensitivity to fasting in male and female rats.

Science.gov (United States)

Matsuzaki, Toshiya; Iwasa, Takeshi; Munkhzaya, Munkhsaikhan; Tungalagsuvd, Altankhuu; Kawami, Takako; Murakami, Masahiro; Yamasaki, Mikio; Yamamoto, Yuri; Kato, Takeshi; Kuwahara, Akira; Yasui, Toshiyuki; Irahara, Minoru

2015-04-01

Oxytocin (OT) affects the central nervous system and is involved in a variety of social and non-social behaviors. Recently, the role played by OT in energy metabolism and its organizational effects on estrogen receptor alpha (ER-α) during the neonatal period have gained attention. In this study, the developmental changes in the hypothalamic mRNA levels of OT, the OT receptor (OTR), and ER-α were evaluated in male and female rats. In addition, the fasting-induced changes in the hypothalamic mRNA levels of OT and the OTR were evaluated. Hypothalamic explants were taken from postnatal day (PND) 10, 20, and 30 rats, and the mRNA level of each molecule was measured. Hypothalamic OT mRNA expression increased throughout the developmental period in both sexes. The rats' hypothalamic OTR mRNA levels were highest on PND 10 and decreased throughout the developmental period. In the male rats, the hypothalamic mRNA levels of ER-α were higher on PND 30 than on PND 10. On the other hand, no significant differences in hypothalamic ER-α mRNA expression were detected among the examined time points in the female rats, although hypothalamic ER-α mRNA expression tended to be higher on PND 30 than on PND 10. Significant positive correlations were detected between hypothalamic OT and ER-α mRNA expression in both the male and female rats. Hypothalamic OT mRNA expression was not affected by fasting at any of the examined time points in either sex. These results indicate that hypothalamic OT expression is not sensitive to fasting during the developmental period. In addition, as a positive correlation was detected between hypothalamic OT and ER-α mRNA expression, these two molecules might interact with each other to induce appropriate neuronal development. Copyright © 2015 Elsevier Ltd. All rights reserved.

Calcium regulates caveolin-1 expression at the transcriptional level

International Nuclear Information System (INIS)

Yang, Xiao-Yan; Huang, Cheng-Cheng; Kan, Qi-Ming; Li, Yan; Liu, Dan; Zhang, Xue-Cheng; Sato, Toshinori; Yamagata, Sadako; Yamagata, Tatsuya

2012-01-01

Highlights: ► Caveolin-1 expression is regulated by calcium signaling at the transcriptional level. ► An inhibitor of or siRNA to L-type calcium channel suppressed caveolin-1 expression. ► Cyclosporine A or an NFAT inhibitor markedly reduced caveolin-1 expression. ► Caveolin-1 regulation by calcium signaling is observed in several mouse cell lines. -- Abstract: Caveolin-1, an indispensable component of caveolae serving as a transformation suppressor protein, is highly expressed in poorly metastatic mouse osteosarcoma FBJ-S1 cells while highly metastatic FBJ-LL cells express low levels of caveolin-1. Calcium concentration is higher in FBJ-S1 cells than in FBJ-LL cells; therefore, we investigated the possibility that calcium signaling positively regulates caveolin-1 in mouse FBJ-S1 cells. When cells were treated with the calcium channel blocker nifedipine, cyclosporin A (a calcineurin inhibitor), or INCA-6 (a nuclear factor of activated T-cells [NFAT] inhibitor), caveolin-1 expression at the mRNA and protein levels decreased. RNA silencing of voltage-dependent L-type calcium channel subunit alpha-1C resulted in suppression of caveolin-1 expression. This novel caveolin-1 regulation pathway was also identified in mouse NIH 3T3 cells and Lewis lung carcinoma cells. These results indicate that caveolin-1 is positively regulated at the transcriptional level through a novel calcium signaling pathway mediated by L-type calcium channel/Ca 2+ /calcineurin/NFAT.

Differential expression of calcium/calmodulin-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit.

Science.gov (United States)

Yang, Tianbao; Peng, Hui; Whitaker, Bruce D; Jurick, Wayne M

2013-07-01

Calcium has been shown to enhance stress tolerance, maintain firmness and reduce decay in fruits. Previously we reported that seven tomato SlSRs encode calcium/calmodulin-regulated proteins, and that their expressions are developmentally regulated during fruit development and ripening, and are also responsive to ethylene. To study their expressions in response to stresses encountered during postharvest handling, tomato fruit at the mature-green stage was subjected to chilling and wounding injuries, infected with Botrytis cinerea and treated with salicylic acid or methyl jasmonate. Gene expression studies revealed that the seven SlSRs differentially respond to different stress signals. SlSR2 was the only gene upregulated by all the treatments. SlSR4 acted as a late pathogen-induced gene; it was upregulated by salicylic acid and methyl jasmonate, but downregulated by cold treatment. SlSR3L was cold- and wound-responsive and was also induced by salicylic acid. SlSR1 and SlSR1L were repressed by cold, wounding and pathogen infection, but were upregulated by salicylic acid and methyl jasmonate. Overall, results of these expression studies indicate that individual SlSRs have distinct roles in responses to the specific stress signals, and SlSRs may act as a coordinator(s) connecting calcium-mediated signaling with other stress signal transduction pathways during fruit ripening and storage. © 2013 Scandinavian Plant Physiology Society.

Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

Science.gov (United States)

Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

2017-07-30

The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

Dissecting specific and global transcriptional regulation of bacterial gene expression

NARCIS (Netherlands)

Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

Oxygen-dependent regulation of aquaporin-3 expression

Directory of Open Access Journals (Sweden)

Hoogewijs D

2016-04-01

Full Text Available David Hoogewijs,1,2 Melanie Vogler,3 Eveline Zwenger,3 Sabine Krull,3 Anke Zieseniss3 1Institute of Physiology, University of Duisburg-Essen, Essen, Germany; 2Institute of Physiology, University of Zürich, Zürich, Switzerland; 3Institute of Cardiovascular Physiology, University Medical Center Göttingen, University of Göttingen, Göttingen, GermanyAbstract: The purpose of this study was to investigate whether aquaporin-3 (AQP3 expression is altered in hypoxia and whether hypoxia-inducible transcription factor (HIF-1 regulates the hypoxic expression. AQP3 mRNA expression was studied in L929 fibrosarcoma cells and in several tissues derived from mice that were subjected to hypoxia. Computational analysis of the AQP3 promoter revealed conserved HIF binding sites within close proximity to the translational start site, and chromatin immunoprecipitation assays confirmed binding of HIF-1 to the endogenous hypoxia response elements. Furthermore, hypoxia resulted in increased expression of AQP3 mRNA in L929 fibrosarcoma cells. Consistently, shRNA-mediated knockdown of HIF-1 greatly reduced the hypoxic induction of AQP3. In addition, mRNA analysis of organs from mice exposed to inspiratory hypoxia demonstrated pronounced hypoxia-inducible expression of AQP3 in the kidney. Overall, our findings suggest that AQP3 expression can be regulated at the transcriptional level and that AQP3 represents a novel HIF-1 target gene. Keywords: transcriptional regulation, oxygen, hypoxia-inducible factor, hypoxia response element

Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism.

Directory of Open Access Journals (Sweden)

Xiling Liu

2016-09-01

Full Text Available Cognitive defects in autism spectrum disorder (ASD include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans.

Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

Science.gov (United States)

Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp

2016-01-01

Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

Regulation of meiotic gene expression in plants

Directory of Open Access Journals (Sweden)

Adele eZhou

2014-08-01

Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

Adult-type hypolactasia and regulation of lactase expression

DEFF Research Database (Denmark)

Troelsen, Jesper Thorvald

2005-01-01

, the main carbohydrate in milk. Individuals with adult-type hypolactasia lose their lactase expression before adulthood and consequently often become lactose intolerant with associated digestive problems (e.g. diarrhoea). In contrast, lactase persistent individuals have a lifelong lactase expression......A common genetically determined polymorphism in the human population leads to two distinct phenotypes in adults, lactase persistence and adult-type hypolactasia (lactase non-persistence). All healthy newborn children express high levels of lactase and are able to digest large quantities of lactose...... and are able to digest lactose as adults. Lactase persistence can be regarded as the mutant phenotype since other mammals down-regulate their lactase expression after weaning (the postweaning decline). This phenomenon does not occur in lactase persistent individuals. The regulation of lactase expression...

Effect of Developmental Stimulation Program on the Developmental Measures of Toddlers

Directory of Open Access Journals (Sweden)

Elahe Ghayebie

2018-04-01

Full Text Available Background: The variability in the developmental skills is reduced after the first three years of life; therefore, it is necessary to identify and manage early developmental delays. Aim: The aim of this study was to investigate the effect of developmental stimulation program on the developmental measures of the toddlers. Method: The present randomized controlled clinical trial was conducted on 31 toddlers aged 1-3 years residing at Ali Asghar Foster Care Center within 2016-2017. Developmental interventions were carried out based on the modified guidelines of West Virginia Early Learning Standards Framework for eight weeks (three 2-hour sessions a week. The interventions included a range of age- and developmental-specific activities described in the given guidelines. Child development age was measured based on motor dimensions (i.e., gross and fine and language development (i.e., receptive and expressive before and after the intervention. The data were analyzed in SPSS software (version 11 using independent t-test and Chi-square test. Results: The mean ages of the participants in the control and intervention groups were 19.9±5.5 and 20±6.02, respectively (P=0.62. The mean ages of receptive language development (P=0.003, expressive language development (P

Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

Science.gov (United States)

Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

2004-01-01

This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

Science.gov (United States)

Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

2016-01-01

Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

Directory of Open Access Journals (Sweden)

Zhengkun Qiu

Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

Progranulin regulates neurogenesis in the developing vertebrate retina.

Science.gov (United States)

Walsh, Caroline E; Hitchcock, Peter F

2017-09-01

We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

Gravity-regulated gene expression in Arabidopsis thaliana

Science.gov (United States)

Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

Science.gov (United States)

Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

2013-01-01

MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

Chronic unpredictable stress decreases expression of brain-derived neurotrophic factor (BDNF) in mouse ovaries: relationship to oocytes developmental potential.

Science.gov (United States)

Wu, Li-Min; Hu, Mei-Hong; Tong, Xian-Hong; Han, Hui; Shen, Ni; Jin, Ren-Tao; Wang, Wei; Zhou, Gui-Xiang; He, Guo-Ping; Liu, Yu-Sheng

2012-01-01

Brain-derived neurotropic factor (BDNF) was originally described in the nervous system but has been shown to be expressed in ovary tissues recently, acting as a paracrine/autocrine regulator required for developments of follicles and oocytes. Although it is generally accepted that chronic stress impairs female reproduction and decreases the expression of BDNF in limbic structures of central nervous system, which contributes to mood disorder. However, it is not known whether chronic stress affects oocytes developments, nor whether it affects expression of BDNF in ovary. Mice were randomly assigned into control group, stressed group, BDNF-treated group and BDNF-treated stressed group. The chronic unpredictable mild stress model was used to produce psychosocial stress in mice, and the model was verified by open field test and hypothalamic-pituitary-adrenal (HPA) axis activity. The methods of immunohistochemistry and western blotting were used to detect BDNF protein level and distribution. The number of retrieved oocytes, oocyte maturation, embryo cleavage and the rates of blastocyst formation after parthenogenetic activation were evaluated. Chronic unpredictable stress decreased the BDNF expression in antral follicles, but didn't affect the BDNF expression in primordial, primary and secondary follicles. Chronic unpredictable stress also decreased the number of retrieved oocytes and the rate of blastocyst formation, which was rescued by exogenous BDNF treatment. BDNF in mouse ovaries may be related to the decreased number of retrieved oocytes and impaired oocytes developmental potential induced by chronic unpredictable stress.

Chronic unpredictable stress decreases expression of brain-derived neurotrophic factor (BDNF in mouse ovaries: relationship to oocytes developmental potential.

Directory of Open Access Journals (Sweden)

Li-Min Wu

Full Text Available BACKGROUND: Brain-derived neurotropic factor (BDNF was originally described in the nervous system but has been shown to be expressed in ovary tissues recently, acting as a paracrine/autocrine regulator required for developments of follicles and oocytes. Although it is generally accepted that chronic stress impairs female reproduction and decreases the expression of BDNF in limbic structures of central nervous system, which contributes to mood disorder. However, it is not known whether chronic stress affects oocytes developments, nor whether it affects expression of BDNF in ovary. METHODS: Mice were randomly assigned into control group, stressed group, BDNF-treated group and BDNF-treated stressed group. The chronic unpredictable mild stress model was used to produce psychosocial stress in mice, and the model was verified by open field test and hypothalamic-pituitary-adrenal (HPA axis activity. The methods of immunohistochemistry and western blotting were used to detect BDNF protein level and distribution. The number of retrieved oocytes, oocyte maturation, embryo cleavage and the rates of blastocyst formation after parthenogenetic activation were evaluated. RESULTS: Chronic unpredictable stress decreased the BDNF expression in antral follicles, but didn't affect the BDNF expression in primordial, primary and secondary follicles. Chronic unpredictable stress also decreased the number of retrieved oocytes and the rate of blastocyst formation, which was rescued by exogenous BDNF treatment. CONCLUSION: BDNF in mouse ovaries may be related to the decreased number of retrieved oocytes and impaired oocytes developmental potential induced by chronic unpredictable stress.

TiGER: a database for tissue-specific gene expression and regulation.

Science.gov (United States)

Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

2008-06-09

Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

TiGER: A database for tissue-specific gene expression and regulation

Directory of Open Access Journals (Sweden)

Zack Donald J

2008-06-01

Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

Hormonal regulation and developmental role of Krüppel homolog 1, a repressor of metamorphosis, in the silkworm Bombyx mori.

Science.gov (United States)

Kayukawa, Takumi; Murata, Mika; Kobayashi, Isao; Muramatsu, Daisuke; Okada, Chieko; Uchino, Keiro; Sezutsu, Hideki; Kiuchi, Makoto; Tamura, Toshiki; Hiruma, Kiyoshi; Ishikawa, Yukio; Shinoda, Tetsuro

2014-04-01

Juvenile hormone (JH) has an ability to repress the precocious metamorphosis of insects during their larval development. Krüppel homolog 1 (Kr-h1) is an early JH-inducible gene that mediates this action of JH; however, the fine hormonal regulation of Kr-h1 and the molecular mechanism underlying its antimetamorphic effect are little understood. In this study, we attempted to elucidate the hormonal regulation and developmental role of Kr-h1. We found that the expression of Kr-h1 in the epidermis of penultimate-instar larvae of the silkworm Bombyx mori was induced by JH secreted by the corpora allata (CA), whereas the CA were not involved in the transient induction of Kr-h1 at the prepupal stage. Tissue culture experiments suggested that the transient peak of Kr-h1 at the prepupal stage is likely to be induced cooperatively by JH derived from gland(s) other than the CA and the prepupal surge of ecdysteroid, although involvement of unknown factor(s) could not be ruled out. To elucidate the developmental role of Kr-h1, we generated transgenic silkworms overexpressing Kr-h1. The transgenic silkworms grew normally until the spinning stage, but their development was arrested at the prepupal stage. The transgenic silkworms from which the CA were removed in the penultimate instar did not undergo precocious pupation or larval-larval molt but fell into prepupal arrest. This result demonstrated that Kr-h1 is indeed involved in the repression of metamorphosis but that Kr-h1 alone is incapable of implementing normal larval molt. Moreover, the expression profiles and hormonal responses of early ecdysone-inducible genes (E74, E75, and Broad) in transgenic silkworms suggested that Kr-h1 is not involved in the JH-dependent modulation of these genes, which is associated with the control of metamorphosis. Copyright © 2014 Elsevier Inc. All rights reserved.

Regulated expression of homeobox genes Msx-1 and Msx-2 in mouse mammary gland development suggests a role in hormone action and epithelial-stromal interactions.

Science.gov (United States)

Friedmann, Y; Daniel, C W

1996-07-10

The murine homeobox genes Msx-1 and Msx-2 are related to the Drosophila msh gene and are expressed in a variety of tissues during mouse embryogenesis. We now report the developmentally regulated expression of Msx-1 and Msx-2 in the mouse mammary gland and show that their expression patterns point toward significant functional roles. Msx-1 and Msx-2 transcripts were present in glands of virgin mice and in glands of mice in early pregnancy, but transcripts decreased dramatically during late pregnancy. Low levels of Msx-1 transcripts were detected in glands from lactating animals and during the first days of involution, whereas Msx-2 expression was not detected during lactation or early involution. Expression of both genes increased gradually as involution progressed. Msx-2 but not Msx-1 expression was decreased following ovariectomy or following exposure to anti-estrogen implanted directly into the gland. Hormonal regulation of Msx-2 expression was confirmed when transcripts returned to normal levels after estrogen was administered to ovariectomized animals. In situ molecular hybridization for Msx-1 showed transcripts localized to the mammary epithelium, whereas Msx-2 expression was confined to the periductal stroma. Mammary stroma from which mammary epithelium had been removed did not transcribe detectable amounts of Msx-2, showing that expression is regulated by contiguous mammary epithelium, and indicating a role for these homeobox genes in mesenchymal-epithelial interactions during mammary development.

Clustering gene expression regulators: new approach to disease subtyping.

Directory of Open Access Journals (Sweden)

Mikhail Pyatnitskiy

Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

Preschoolers' Emotion Expression and Regulation: Relations with School Adjustment

Science.gov (United States)

Herndon, Kristina J.; Bailey, Craig S.; Shewark, Elizabeth A.; Denham, Susanne A.; Bassett, Hideko H.

2013-01-01

Children's expression and regulation of emotions are building blocks of their experiences in classrooms. Thus, the authors' primary goal was to investigate whether preschoolers' expression or ability to regulate emotions were associated with teachers' ratings of school adjustment. A secondary goal was to investigate how boys and girls differed…

Inferring gene expression dynamics via functional regression analysis

Directory of Open Access Journals (Sweden)

Leng Xiaoyan

2008-01-01

Full Text Available Abstract Background Temporal gene expression profiles characterize the time-dynamics of expression of specific genes and are increasingly collected in current gene expression experiments. In the analysis of experiments where gene expression is obtained over the life cycle, it is of interest to relate temporal patterns of gene expression associated with different developmental stages to each other to study patterns of long-term developmental gene regulation. We use tools from functional data analysis to study dynamic changes by relating temporal gene expression profiles of different developmental stages to each other. Results We demonstrate that functional regression methodology can pinpoint relationships that exist between temporary gene expression profiles for different life cycle phases and incorporates dimension reduction as needed for these high-dimensional data. By applying these tools, gene expression profiles for pupa and adult phases are found to be strongly related to the profiles of the same genes obtained during the embryo phase. Moreover, one can distinguish between gene groups that exhibit relationships with positive and others with negative associations between later life and embryonal expression profiles. Specifically, we find a positive relationship in expression for muscle development related genes, and a negative relationship for strictly maternal genes for Drosophila, using temporal gene expression profiles. Conclusion Our findings point to specific reactivation patterns of gene expression during the Drosophila life cycle which differ in characteristic ways between various gene groups. Functional regression emerges as a useful tool for relating gene expression patterns from different developmental stages, and avoids the problems with large numbers of parameters and multiple testing that affect alternative approaches.

Expression of Tlx in both stem cells and transit amplifying progenitors regulates stem cell activation and differentiation in the neonatal lateral subependymal zone.

Science.gov (United States)

Obernier, Kirsten; Simeonova, Ina; Fila, Tatiana; Mandl, Claudia; Hölzl-Wenig, Gabriele; Monaghan-Nichols, Paula; Ciccolini, Francesca

2011-09-01

Niche homeostasis in the postnatal subependymal zone of the lateral ventricle (lSEZ) requires coordinated proliferation and differentiation of neural progenitor cells. The mechanisms regulating this balance are scarcely known. Recent observations indicate that the orphan nuclear receptor Tlx is an intrinsic factor essential in maintaining this balance. However, the effect of Tlx on gene expression depends on age and cell-type cues. Therefore, it is essential to establish its expression pattern at different developmental ages. Here, we show for the first time that in the neonatal lSEZ activated neural stem cells (NSCs) and especially transit-amplifying progenitors (TAPs) express Tlx and that its expression may be regulated at the posttranscriptional level. We also provide evidence that in both cell types Tlx affects gene expression in a positive and negative manner. In activated NSCs, but not in TAPs, absence of Tlx leads to overexpression of negative cell cycle regulators and impairment of proliferation. Moreover, in both cell types, the homeobox transcription factor Dlx2 is downregulated in the absence of Tlx. This is paralleled by increased expression of Olig2 in activated NSCs and glial fibrillary acidic protein in TAPs, indicating that in both populations Tlx decreases gliogenesis. Consistent with this, we found a higher proportion of cells expressing glial makers in the neonatal lSEZ of mutant mice than in the wild type counterpart. Thus, Tlx playing a dual role affects the expression of distinct genes in these two lSEZ cell types. Copyright © 2011 AlphaMed Press.

Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

Science.gov (United States)

Arenas-Mena, Cesar; Coffman, James A.

2016-01-01

Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

Science.gov (United States)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

Regulation of SFRP-1 expression in the rat dental follicle.

Science.gov (United States)

Liu, Dawen; Yao, Shaomian; Wise, Gary E

2012-01-01

Tooth eruption requires osteoclastogenesis and subsequent bone resorption. Secreted frizzled-related protein-1 (SFRP-1) negatively regulates osteoclastogenesis. Our previous studies indicated that SFRP-1 is expressed in the rat dental follicle (DF), with reduced expression at days 3 and 9 close to the times for the major and minor bursts of osteoclastogenesis, respectively; but it remains unclear as to what molecules contribute to its reduced expression at these critical times. Thus, it was the aim of this study to determine which molecules regulate the expression of SFRP-1 in the DF. To that end, the DF cells were treated with cytokines that are maximally expressed at days 3 or 9, and SFRP-1 expression was determined. Our study indicated that colony-stimulating factor-1 (CSF-1), a molecule maximally expressed in the DF at day 3, down-regulated SFRP-1 expression. As to endothelial monocyte-activating polypeptide II (EMAP-II), a highly expressed molecule in the DF at day 3, it had no effect on the expression of SFRP-1. However, when EMAP-II was knocked down by siRNA, the expression of SFRP-1 was elevated, and this elevated SFRP-1 expression could be reduced by adding recombinant EMAP-II protein. This suggests that EMAP-II maintained a lower level of SFRP-1 in the DF. TNF-α is a molecule maximally expressed at day 9, and this study indicated that it also down-regulated the expression of SFRP-1 in the DF cells. In conclusion, CSF-1 and EMAP-II may contribute to the reduced SFRP-1 expression seen on day 3, while TNF-α may contribute to the reduced SFRP-1 expression at day 9.

Developmentally regulated expression by Trypanosoma cruzi of molecules that accelerate the decay of complement C3 convertases

International Nuclear Information System (INIS)

Rimoldi, M.T.; Sher, A.; Heiny, A.; Lituchy, A.; Hammer, C.H.; Joiner, K.

1988-01-01

The authors recently showed that culture-derived metacyclic trypomastigotes (CMT), but not epimastigotes (Epi), of the Miranda 99 strain of Trypanosoma cruzi evade lysis by the human alternative complement pathway because of inefficient binding of factor B to complement component C3b on the parasite surface. These results suggested that CMT and tissue-culture-derived trypomastigotes (TCT), which also activate the alternative pathway poorly, might produce a molecule capable of interfering with factor B binding to C3b. They now demonstrate that CMT and TCT lysates, as well as molecules spontaneously shed from CMT and TCT but not Epi, accelerate decay of 125 I-labeled factor Bb from the alternative-pathway C3 convertase (C3bBb) assembled on zymosan or Epi and also accelerate decay of the classical-pathway C3 convertase (C4b2a) on sheep erythrocytes. Parasites metabolically labeled with [ 35 S]methionine spontaneously shed a limited number of radioactive components, ranging in molecular mass from 86 to 155 kDa for trypomastigotes and 25 to 80 kDa for Epi. Decay-accelerating activity within supernatants is inactivated by papain and is coeluted with 35 S-containing polypeptides on FPLC anion-exchange chromatography, suggesting that the active constituents are protein molecules. Molecules with decay-accelerating activity may explain the developmentally regulated resistance to complement-mediated lysis in infective and vertebrate stages for T. cruzi life cycle

The Tomato Hoffman’s Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures

Science.gov (United States)

Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

2016-01-01

Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362

Mas-allatotropin in the developing antennal lobe of the sphinx moth Manduca sexta: distribution, time course, developmental regulation, and colocalization with other neuropeptides.

Science.gov (United States)

Utz, Sandra; Huetteroth, Wolf; Vömel, Matthias; Schachtner, Joachim

2008-01-01

The paired antennal lobes (ALs) of the sphinx moth Manduca sexta serve as a well-established model for studying development of the primary integration centers for odor information in the brain. To further reveal the role of neuropeptides during AL development, we have analyzed cellular distribution, developmental time course, and regulation of the neuropeptide M. sexta allatotropin (Mas-AT). On the basis of morphology and appearance during AL formation, seven major types of Mas-AT-immunoreactive (ir) cells could be distinguished. Mas-AT-ir cells are identified as local, projection, and centrifugal neurons, which are either persisting larval or newly added adult-specific neurons. Complementary immunostaining with antisera against two other neuropeptide families (A-type allatostatins, RFamides) revealed colocalization within three of the Mas-AT-ir cell types. On the basis of this neurochemistry, the most prominent type of Mas-AT-ir neurons, the local AT neurons (LATn), could be divided in three subpopulations. The appearance of the Mas-AT-ir cell types occurring during metamorphosis parallels the rising titer of the developmental hormone 20-hydroxyecdysone (20E). Artificially shifting the 20E titer to an earlier developmental time point resulted in the precocious occurrence of Mas-AT immunostaining. This result supports the hypothesis that the pupal rise of 20E is causative for Mas-AT expression during AL development. Comparing localization and developmental time course of Mas-AT and other neuropeptides with the time course of AL formation suggests various functions for these neuropeptides during development, including an involvement in the formation of the olfactory glomeruli.

Quantitative monitoring of the Chlamydia trachomatis developmental cycle using GFP-expressing bacteria, microscopy and flow cytometry.

Directory of Open Access Journals (Sweden)

François Vromman

Full Text Available Chlamydiae are obligate intracellular bacteria. These pathogens develop inside host cells through a biphasic cycle alternating between two morphologically distinct forms, the infectious elementary body and the replicative reticulate body. Recently, C. trachomatis strains stably expressing fluorescent proteins were obtained. The fluorochromes are expressed during the intracellular growth of the microbe, allowing bacterial visualization by fluorescence microscopy. Whether they are also present in the infectious form, the elementary body, to a detectable level has not been studied. Here, we show that a C. trachomatis strain transformed with a plasmid expressing the green fluorescent protein (GFP accumulates sufficient quantities of the probe in elementary bodies for detection by microscopy and flow cytometry. Adhesion of single bacteria was detected. The precise kinetics of bacterial entry were determined by microscopy using automated procedures. We show that during the intracellular replication phase, GFP is a convenient read-out for bacterial growth with several advantages over current methods. In particular, infection rates within a non-homogenous cell population are easily quantified. Finally, in spite of their small size, individual elementary bodies are detected by flow cytometers, allowing for direct enumeration of a bacterial preparation. In conclusion, GFP-expressing chlamydiae are suitable to monitor, in a quantitative manner, progression throughout the developmental cycle. This will facilitate the identification of the developmental steps targeted by anti-chlamydial drugs or host factors.

Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

Science.gov (United States)

Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

2016-01-01

An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also

N-MYC down-regulated-like proteins regulate meristem initiation by modulating auxin transport and MAX2 expression.

Science.gov (United States)

Mudgil, Yashwanti; Ghawana, Sanjay; Jones, Alan M

2013-01-01

N-MYC down-regulated-like (NDL) proteins interact with the Gβ subunit (AGB1) of the heterotrimeric G protein complex and play an important role in AGB1-dependent regulation of lateral root formation by affecting root auxin transport, auxin gradients and the steady-state levels of mRNA encoding the PIN-FORMED 2 and AUXIN 1 auxin transport facilitators. Auxin transport in aerial tissue follows different paths and utilizes different transporters than in roots; therefore, in the present study, we analyzed whether NDL proteins play an important role in AGB1-dependent, auxin-mediated meristem development. Expression levels of NDL gene family members need to be tightly regulated, and altered expression (both over-expression and down-regulation) confers ectopic growth. Over-expression of NDL1 disrupts vegetative and reproductive organ development. Reduced expression of the NDL gene family members results in asymmetric leaf emergence, twinning of rosette leaves, defects in leaf formation, and abnormal silique distribution. Reduced expression of the NDL genes in the agb1-2 (null allele) mutant rescues some of the abnormal phenotypes, such as silique morphology, silique distribution, and peduncle angle, suggesting that proper levels of NDL proteins are maintained by AGB1. We found that all of these abnormal aerial phenotypes due to altered NDL expression were associated with increases in basipetal auxin transport, altered auxin maxima and altered MAX2 expression within the inflorescence stem. NDL proteins, together with AGB1, act as positive regulators of meristem initiation and branching. AGB1 and NDL1 positively regulate basipetal inflorescence auxin transport and modulate MAX2 expression in shoots, which in turn regulates organ and lateral meristem formation by the establishment and maintenance of auxin gradients.

N-MYC down-regulated-like proteins regulate meristem initiation by modulating auxin transport and MAX2 expression.

Directory of Open Access Journals (Sweden)

Yashwanti Mudgil

Full Text Available N-MYC down-regulated-like (NDL proteins interact with the Gβ subunit (AGB1 of the heterotrimeric G protein complex and play an important role in AGB1-dependent regulation of lateral root formation by affecting root auxin transport, auxin gradients and the steady-state levels of mRNA encoding the PIN-FORMED 2 and AUXIN 1 auxin transport facilitators. Auxin transport in aerial tissue follows different paths and utilizes different transporters than in roots; therefore, in the present study, we analyzed whether NDL proteins play an important role in AGB1-dependent, auxin-mediated meristem development.Expression levels of NDL gene family members need to be tightly regulated, and altered expression (both over-expression and down-regulation confers ectopic growth. Over-expression of NDL1 disrupts vegetative and reproductive organ development. Reduced expression of the NDL gene family members results in asymmetric leaf emergence, twinning of rosette leaves, defects in leaf formation, and abnormal silique distribution. Reduced expression of the NDL genes in the agb1-2 (null allele mutant rescues some of the abnormal phenotypes, such as silique morphology, silique distribution, and peduncle angle, suggesting that proper levels of NDL proteins are maintained by AGB1. We found that all of these abnormal aerial phenotypes due to altered NDL expression were associated with increases in basipetal auxin transport, altered auxin maxima and altered MAX2 expression within the inflorescence stem.NDL proteins, together with AGB1, act as positive regulators of meristem initiation and branching. AGB1 and NDL1 positively regulate basipetal inflorescence auxin transport and modulate MAX2 expression in shoots, which in turn regulates organ and lateral meristem formation by the establishment and maintenance of auxin gradients.

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

Science.gov (United States)

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the

Measuring ability to enhance and suppress emotional expression: The Flexible Regulation of Emotional Expression (FREE) Scale.

Science.gov (United States)

Burton, Charles L; Bonanno, George A

2016-08-01

Flexibility in self-regulatory behaviors has proved to be an important quality for adjusting to stressful life events and requires individuals to have a diverse repertoire of emotion regulation abilities. However, the most commonly used emotion regulation questionnaires assess frequency of behavior rather than ability, with little evidence linking these measures to observable capacity to enact a behavior. The aim of the current investigation was to develop and validate a Flexible Regulation of Emotional Expression (FREE) Scale that measures a person's ability to enhance and suppress displayed emotion across an array of hypothetical contexts. In Studies 1 and 2, a series of confirmatory factor analyses revealed that the FREE Scale consists of 4 first-order factors divided by regulation and emotional valence type that can contribute to 2 higher order factors: expressive enhancement ability and suppression ability. In Study 1, we also compared the FREE Scale to other commonly used emotion regulation measures, which revealed that suppression ability is conceptually distinct from suppression frequency. In Study 3, we compared the FREE Scale with a composite of traditional frequency-based indices of expressive regulation to predict performance in a previously validated emotional modulation paradigm. Participants' enhancement and suppression ability scores on the FREE Scale predicted their corresponding performance on the laboratory task, even when controlling for baseline expressiveness. These studies suggest that the FREE Scale is a valid and flexible measure of expressive regulation ability. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

Directory of Open Access Journals (Sweden)

Michelle N. Arbeitman

2016-07-01

Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

Epigenetic regulation during fetal femur development: DNA methylation matters.

Directory of Open Access Journals (Sweden)

María C de Andrés

Full Text Available Epigenetic modifications are heritable changes in gene expression without changes in DNA sequence. DNA methylation has been implicated in the control of several cellular processes including differentiation, gene regulation, development, genomic imprinting and X-chromosome inactivation. Methylated cytosine residues at CpG dinucleotides are commonly associated with gene repression; conversely, strategic loss of methylation during development could lead to activation of lineage-specific genes. Evidence is emerging that bone development and growth are programmed; although, interestingly, bone is constantly remodelled throughout life. Using human embryonic stem cells, human fetal bone cells (HFBCs, adult chondrocytes and STRO-1(+ marrow stromal cells from human bone marrow, we have examined a spectrum of developmental stages of femur development and the role of DNA methylation therein. Using pyrosequencing methodology we analysed the status of methylation of genes implicated in bone biology; furthermore, we correlated these methylation levels with gene expression levels using qRT-PCR and protein distribution during fetal development evaluated using immunohistochemistry. We found that during fetal femur development DNA methylation inversely correlates with expression of genes including iNOS (NOS2 and COL9A1, but not catabolic genes including MMP13 and IL1B. Furthermore, significant demethylation was evident in the osteocalcin promoter between the fetal and adult developmental stages. Increased TET1 expression and decreased expression of DNA (cytosine-5--methyltransferase 1 (DNMT1 in adult chondrocytes compared to HFBCs could contribute to the loss of methylation observed during fetal development. HFBC multipotency confirms these cells to be an ideal developmental system for investigation of DNA methylation regulation. In conclusion, these findings demonstrate the role of epigenetic regulation, specifically DNA methylation, in bone development

CEREBELLUM: LINKS BETWEEN DEVELOPMENT, DEVELOPMENTAL DISORDERS AND MOTOR LEARNING

Directory of Open Access Journals (Sweden)

Mario U Manto

2012-01-01

Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.

Localization and regulation of dopamine receptor D4 expression in the adult and developing rat retina

DEFF Research Database (Denmark)

Klitten, Laura L; Rath, Martin F; Coon, Steven L

2008-01-01

layers but the nocturnal increase is confined to the photoreceptors. Retinal Drd4 expression is not affected by removal of the sympathetic input to the eye, but triiodothyronine treatment induces Drd4 expression in the photoreceptors. In a developmental series, we show that the expression of Drd4...

Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs.

Directory of Open Access Journals (Sweden)

Mengmeng Xu

Full Text Available Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins and molecular functions (enzyme regulator activity. We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be

Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs.

Science.gov (United States)

Xu, Mengmeng; Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De; Xu, Shengyu

2015-01-01

Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for

A systematic expression analysis implicates Plexin-B2 and its ligand Sema4C in the regulation of the vascular and endocrine system.

Science.gov (United States)

Zielonka, Matthias; Xia, Jingjing; Friedel, Roland H; Offermanns, Stefan; Worzfeld, Thomas

2010-09-10

Plexins serve as receptors for semaphorins and play important roles in the developing nervous system. Plexin-B2 controls decisive developmental programs in the neural tube and cerebellum. However, whether Plexin-B2 also regulates biological functions in adult nonneuronal tissues is unknown. Here we show by two methodologically independent approaches that Plexin-B2 is expressed in discrete cell types of several nonneuronal tissues in the adult mouse. In the vasculature, Plexin-B2 is selectively expressed in functionally specialized endothelial cells. In endocrine organs, Plexin-B2 localizes to the pancreatic islets of Langerhans and to both cortex and medulla of the adrenal gland. Plexin-B2 expression is also detected in certain types of immune and epithelial cells. In addition, we report on a systematic comparison of the expression patterns of Plexin-B2 and its ligand Sema4C, which show complementarity or overlap in some but not all tissues. Furthermore, we demonstrate that Plexin-B2 and its family member Plexin-B1 display largely nonredundant expression patterns. This work establishes Plexin-B2 and Sema4C as potential regulators of the vascular and endocrine system and provides an anatomical basis to understand the biological functions of this ligand-receptor pair. Copyright 2010 Elsevier Inc. All rights reserved.

Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

Directory of Open Access Journals (Sweden)

Byrne Keren A

2007-08-01

Full Text Available Abstract Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60, secondary myogenesis (d 135, as well as beginning (d 195 and final stages (birth of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24 were from Hereford dams and crossed with either Wagyu (high intramuscular fat or Piedmontese (GDF8 mutant sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5 RNA at birth. The developing longissimus muscle of

Trefoil factors are expressed in human and rat endocrine pancreas: differential regulation by growth hormone

DEFF Research Database (Denmark)

Jackerott, Malene; Lee, Ying C; Møllgård, Kjeld

2006-01-01

Trefoil factors (TFFs) 1, 2, and 3 are expressed in mucosal epithelia. TFFs are particular abundant in the intestine in which they play a crucial role in maintenance and restitution of the epithelium. Because pancreas developmentally arises from the primitive foregut, we explored the expression o...

Effect of Kisspeptin on the Developmental Competence and Early Transcript Expression in Porcine Oocytes Parthenogenetically Activated with Different Methods

Directory of Open Access Journals (Sweden)

Islam M. Saadeldin

2018-01-01

Full Text Available Recent studies showed the modulatory effect of kisspeptin (KP on calcium waves through the cell membrane and inside the cell. Spermatozoon can induce similar ooplasmic calcium oscillations at fertilization to trigger meiosis II. Here, we evaluated the effect of KP supplementation with 6-dimethylaminopurine (6-DMAP for 4 h on embryonic development after oocyte activation with single electric pulse, 5 µM ionomycin, or 8% ethanol. Compared to control nonsupplemented groups, KP significantly improved embryo developmental competence electric- and ethanol-activated oocytes in terms of cleavage (75.3% and 58.6% versus 64% and 48%, respectively, p<0.05 and blastocyst development (31.3% and 10% versus 19.3% and 4%, respectively, p<0.05. MOS expression was increased in electrically activated oocytes in presence of KP while it significantly reduced CCNB1 expression. In ionomycin treated group, both MOS and CCNB1 showed significant increase with no difference between KP and control groups. In ethanol-treated group, KP significantly reduced CCNB1 but no effect was observed on MOS expression. The early alterations in MOS and CCNB1 mRNA transcripts caused by KP may explain the significant differences in the developmental competence between the experimental groups. Kisspeptin supplementation may be adopted in protocols for porcine oocyte activation through electric current and ethanol to improve embryonic developmental competence.

Decorin gene expression and its regulation in human keratinocytes

Energy Technology Data Exchange (ETDEWEB)

Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

2011-07-22

Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

Science.gov (United States)

Stiles, Kari A; Van Volkenburgh, Elizabeth

2002-07-01

Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

Science.gov (United States)

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Ambient temperature regulates the expression of a small set of sRNAs influencing plant development through NF-YA2 and YUC2.

Science.gov (United States)

Gyula, Péter; Baksa, Ivett; Tóth, Tamás; Mohorianu, Irina; Dalmay, Tamás; Szittya, György

2018-06-01

Plants substantially alter their developmental program upon changes in the ambient temperature. The 21-24 nt small RNAs (sRNAs) are important gene expression regulators, which play a major role in development and adaptation. However, little is known about how the different sRNA classes respond to changes in the ambient temperature. We profiled the sRNA populations in four different tissues of Arabidopsis thaliana plants grown at 15, 21 and 27 °C. We found that only a small fraction (0.6%) of the sRNA loci are ambient temperature-controlled. We identified thermoresponsive miRNAs and identified their target genes using degradome libraries. We verified that the target of the thermoregulated miR169, NF-YA2, is also ambient temperature-regulated. NF-YA2, as the component of the conserved transcriptional regulator NF-Y complex, binds the promoter of the flowering time regulator FT and the auxin biosynthesis gene YUC2. Other differentially expressed loci include thermoresponsive phased siRNA loci that target various auxin pathway genes and tRNA fragments. Furthermore, a temperature dependent 24-nt heterochromatic siRNA locus in the promoter of YUC2 may contribute to the epigenetic regulation of auxin homeostasis. This holistic approach facilitated a better understanding of the role of different sRNA classes in ambient temperature adaptation of plants. This article is protected by copyright. All rights reserved.

Developmental delays in emotion regulation strategies in preschoolers with autism.

Science.gov (United States)

Nuske, Heather J; Hedley, Darren; Woollacott, Alexandra; Thomson, Phoebe; Macari, Suzanne; Dissanayake, Cheryl

2017-11-01

Children with autism spectrum disorder (ASD) commonly present with difficulty regulating negative emotions, which has been found to impact their behavioral and mental health. Little research has documented the strategies that children with ASD use to regulate their emotion to understand whether they use qualitatively different strategies to children without ASD, whether these are developmentally delayed, or both. Forty-four children with ASD and 29 typically-developing children (2-4 years) were given tasks designed to mimic everyday life experiences requiring children to manage low-level stress (e.g., waiting for a snack) and children's emotion regulation strategies were coded. Parents reported on their child's mental health, wellbeing, and self-development. The results suggest differences in using emotion regulation strategies in children with ASD, reflecting a delay, rather than a deviance when compared to those used by children without ASD. Only children with ASD relied on their family members for physical and communicative soothing; the typically developing children relied on people outside of their family for help regulating their emotion. More frequent approach/less frequent avoidance was related to a higher self-evaluation in both groups, but was only additionally related to higher self-recognition and autonomy in the ASD group. These findings help to identify important emotion regulation intervention targets for this population, including supporting communication with people outside of the family and independence. Autism Res 2017, 10: 1808-1822. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Results suggest that children with autism had more difficulty using communication strategies to manage stress only with people outside the family; they used these strategies with family members as often as children without autism. For all children, more task approach/less avoidance was related to children's higher self-evaluation. These

miRNA-130a regulates C/EBP-ε expression during granulopoiesis

DEFF Research Database (Denmark)

Larsen, Maria T; Häger, Mattias; Glenthøj, Andreas

2014-01-01

cells. In contrast, C/EBP-ε protein is virtually detectable only in the MC/MM population, indicating that expression in more immature cells could be inhibited by microRNAs (miRNAs). We found that miRNA-130a (miR-130a) regulates C/EBP-ε protein expression in both murine and human granulocytic precursors...... target site for miR-130a restored both C/EBP-ε production, expression of Camp and Lcn2, and resulted in the cells having a more mature phenotype. We conclude that miR-130a is important for the regulation of the timed expression of C/EBP-ε during granulopoiesis.......CCAAT/enhancer binding protein-ε (C/EBP-ε) is considered a master transcription factor regulating terminal neutrophil maturation. It is essential for expression of secondary granule proteins, but it also regulates proliferation, cell cycle, and maturation during granulopoiesis. Cebpe(-/-) mice have...

A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships.

Science.gov (United States)

Pucci, Ferdinando; Venneri, Mary Anna; Biziato, Daniela; Nonis, Alessandro; Moi, Davide; Sica, Antonio; Di Serio, Clelia; Naldini, Luigi; De Palma, Michele

2009-07-23

We previously showed that Tie2-expressing monocytes (TEMs) have nonredundant proangiogenic activity in tumors. Here, we compared the gene expression profile of tumor-infiltrating TEMs with that of tumor-associated macrophages (TAMs), spleen-derived Gr1(+)Cd11b(+) neutrophils/myeloid-derived suppressor cells, circulating "inflammatory" and "resident" monocytes, and tumor-derived endothelial cells (ECs) by quantitative polymerase chain reaction-based gene arrays. TEMs sharply differed from ECs and Gr1(+)Cd11b(+) cells but were highly related to TAMs. Nevertheless, several genes were differentially expressed between TEMs and TAMs, highlighting a TEM signature consistent with enhanced proangiogenic/tissue-remodeling activity and lower proinflammatory activity. We validated these findings in models of oncogenesis and transgenic mice expressing a microRNA-regulated Tie2-GFP reporter. Remarkably, resident monocytes and TEMs on one hand, and inflammatory monocytes and TAMs on the other hand, expressed coordinated gene expression profiles, suggesting that the 2 blood monocyte subsets are committed to distinct extravascular fates in the tumor microenvironment. We further showed that a prominent proportion of embryonic/fetal macrophages, which participate in tissue morphogenesis, expressed distinguishing TEM genes. It is tempting to speculate that Tie2(+) embryonic/fetal macrophages, resident blood monocytes, and tumor-infiltrating TEMs represent distinct developmental stages of a TEM lineage committed to execute physiologic proangiogenic and tissue-remodeling programs, which can be co-opted by tumors.

Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

Science.gov (United States)

Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

2016-02-01

Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Environmental contaminants and microRNA regulation: Transcription factors as regulators of toxicant-altered microRNA expression

Energy Technology Data Exchange (ETDEWEB)

Sollome, James; Martin, Elizabeth [Department of Environmental Science & Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States); Sethupathy, Praveen [Department of Genetics, School of Medicine, University of North Carolina, Chapel Hill, NC (United States); Fry, Rebecca C., E-mail: rfry@unc.edu [Department of Environmental Science & Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States); Curriculum in Toxicology, School of Medicine, University of North Carolina, Chapel Hill, NC (United States)

2016-12-01

MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database, genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression.

Environmental contaminants and microRNA regulation: Transcription factors as regulators of toxicant-altered microRNA expression

International Nuclear Information System (INIS)

Sollome, James; Martin, Elizabeth; Sethupathy, Praveen; Fry, Rebecca C.

2016-01-01

MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database, genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression

Emotion regulation in interpersonal problems: the role of cognitive-emotional complexity, emotion regulation goals, and expressivity.

Science.gov (United States)

Coats, Abby Heckman; Blanchard-Fields, Fredda

2008-03-01

Young, middle-aged, and older adults' emotion regulation strategies in interpersonal problems were examined. Participants imagined themselves in anger- or sadness-eliciting situations with a close friend. Factor analyses of a new questionnaire supported a 4-factor model of emotion regulation strategies, including passivity, expressing emotions, seeking emotional information or support, and solving the problem. Results suggest that age differences in emotion regulation (such as older adults' increased endorsement of passive emotion regulation relative to young adults) are partially due to older adults' decreased ability to integrate emotion and cognition, increased prioritization of emotion regulation goals, and decreased tendency to express anger. (c) 2008 APA, all rights reserved.

Profiling and Co-expression Network Analysis of Learned Helplessness Regulated mRNAs and lncRNAs in the Mouse Hippocampus

Directory of Open Access Journals (Sweden)

Chaoqun Li

2018-01-01

Full Text Available Although studies provide insights into the neurobiology of stress and depression, the exact molecular mechanisms underlying their pathologies remain largely unknown. Long non-coding RNA (lncRNA has been implicated in brain functions and behavior. A potential link between lncRNA and psychiatric disorders has been proposed. However, it remains undetermined whether IncRNA regulation, in the brain, contributes to stress or depression pathologies. In this study, we used a valid animal model of depression-like symptoms; namely learned helplessness, RNA-seq, Gene Ontology and co-expression network analyses to profile the expression pattern of lncRNA and mRNA in the hippocampus of mice. We identified 6346 differentially expressed transcripts. Among them, 340 lncRNAs and 3559 protein coding mRNAs were differentially expressed in helpless mice in comparison with control and/or non-helpless mice (inescapable stress resilient mice. Gene Ontology and pathway enrichment analyses indicated that induction of helplessness altered expression of mRNAs enriched in fundamental biological functions implicated in stress/depression neurobiology such as synaptic, metabolic, cell survival and proliferation, developmental and chromatin modification functions. To explore the possible regulatory roles of the altered lncRNAs, we constructed co-expression networks composed of the lncRNAs and mRNAs. Among our differentially expressed lncRNAs, 17% showed significant correlation with genes. Functional co-expression analysis linked the identified lncRNAs to several cellular mechanisms implicated in stress/depression neurobiology. Importantly, 57% of the identified regulatory lncRNAs significantly correlated with 18 different synapse-related functions. Thus, the current study identifies for the first time distinct groups of lncRNAs regulated by induction of learned helplessness in the mouse brain. Our results suggest that lncRNA-directed regulatory mechanisms might contribute to

Profiling and Co-expression Network Analysis of Learned Helplessness Regulated mRNAs and lncRNAs in the Mouse Hippocampus.

Science.gov (United States)

Li, Chaoqun; Cao, Feifei; Li, Shengli; Huang, Shenglin; Li, Wei; Abumaria, Nashat

2017-01-01

Although studies provide insights into the neurobiology of stress and depression, the exact molecular mechanisms underlying their pathologies remain largely unknown. Long non-coding RNA (lncRNA) has been implicated in brain functions and behavior. A potential link between lncRNA and psychiatric disorders has been proposed. However, it remains undetermined whether IncRNA regulation, in the brain, contributes to stress or depression pathologies. In this study, we used a valid animal model of depression-like symptoms; namely learned helplessness, RNA-seq, Gene Ontology and co-expression network analyses to profile the expression pattern of lncRNA and mRNA in the hippocampus of mice. We identified 6346 differentially expressed transcripts. Among them, 340 lncRNAs and 3559 protein coding mRNAs were differentially expressed in helpless mice in comparison with control and/or non-helpless mice (inescapable stress resilient mice). Gene Ontology and pathway enrichment analyses indicated that induction of helplessness altered expression of mRNAs enriched in fundamental biological functions implicated in stress/depression neurobiology such as synaptic, metabolic, cell survival and proliferation, developmental and chromatin modification functions. To explore the possible regulatory roles of the altered lncRNAs, we constructed co-expression networks composed of the lncRNAs and mRNAs. Among our differentially expressed lncRNAs, 17% showed significant correlation with genes. Functional co-expression analysis linked the identified lncRNAs to several cellular mechanisms implicated in stress/depression neurobiology. Importantly, 57% of the identified regulatory lncRNAs significantly correlated with 18 different synapse-related functions. Thus, the current study identifies for the first time distinct groups of lncRNAs regulated by induction of learned helplessness in the mouse brain. Our results suggest that lncRNA-directed regulatory mechanisms might contribute to stress

Biomarkers of adult and developmental neurotoxicity

International Nuclear Information System (INIS)

Slikker, William; Bowyer, John F.

2005-01-01

Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations

Expression of Androgen Receptor Is Negatively Regulated By p53

Directory of Open Access Journals (Sweden)

Fatouma Alimirah

2007-12-01

Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

Rice Gene Network Inferred from Expression Profiling of Plants Overexpressing OsWRKY13,a Positive Regulator of Disease Resistance

Institute of Scientific and Technical Information of China (English)

Deyun Qiu; Jun Xiao; Weibo Xie; Hongbo Liu; Xianghua Li; Lizhong Xiong; Shiping Wang

2008-01-01

Accumulating information indicates that plant disease resistance signaling pathways frequently interact with other pathways regulating developmental processes or abiotic stress responses. However, the molecular mechanisms of these types of crosstalk remain poorly understood in most cases. Here we report that OsWRKY13, an activator of rice resistance to both bacterial and fungal pathogens, appears to function as a convergent point for crosstalk among the pathogen-induced salicylate-dependent defense pathway and five other physiologic pathways. Genome-wide analysis of the expression profiles of OsWRKY13-overexpressing lines suggests that OsWRKY13 directly or indirectly regulates the expression of more than 500 genes that are potentially involved in different physiologic processes according to the classification of the Gene Ontology database. By comparing the expression patterns of genes functioning in known pathways or cellular processes of pathogen infection and the phenotypes between OsWRKY13-overexpressing and wildtype plants, our data suggest that OsWRKY13 is also a regulator of other physiologic processes during pathogen infection. The OsWRKY13-associated disease resistance pathway synergistically interacts via OsWRKY13 with the glutathione/glutaredoxin system and flavonoid biosynthesis pathway to monitor redox homeostasis and to putatively enhance the biosynthesis of antimicrobial flavonoid phytoalexins, respectively, in OsWRKY13-overexpressing lines. Meanwhile, the OsWRKY13-associated disease resistance pathway appears to interact antagonistically with the SNAC1-mediated abiotic stress defense pathway, jasmonic acid signaling pathway, and terpenoid metabolism pathway via OsWRKY13 to suppress salt and cold defense responses as well as to putatively retard rice growth and development.

Expression, regulation and putative nutrient-sensing function of taste GPCRs in the heart.

Directory of Open Access Journals (Sweden)

Simon R Foster

Full Text Available G protein-coupled receptors (GPCRs are critical for cardiovascular physiology. Cardiac cells express >100 nonchemosensory GPCRs, indicating that important physiological and potential therapeutic targets remain to be discovered. Moreover, there is a growing appreciation that members of the large, distinct taste and odorant GPCR families have specific functions in tissues beyond the oronasal cavity, including in the brain, gastrointestinal tract and respiratory system. To date, these chemosensory GPCRs have not been systematically studied in the heart. We performed RT-qPCR taste receptor screens in rodent and human heart tissues that revealed discrete subsets of type 2 taste receptors (TAS2/Tas2 as well as Tas1r1 and Tas1r3 (comprising the umami receptor are expressed. These taste GPCRs are present in cultured cardiac myocytes and fibroblasts, and by in situ hybridization can be visualized across the myocardium in isolated cardiac cells. Tas1r1 gene-targeted mice (Tas1r1(Cre/Rosa26(tdRFP strikingly recapitulated these data. In vivo taste receptor expression levels were developmentally regulated in the postnatal period. Intriguingly, several Tas2rs were upregulated in cultured rat myocytes and in mouse heart in vivo following starvation. The discovery of taste GPCRs in the heart opens an exciting new field of cardiac research. We predict that these taste receptors may function as nutrient sensors in the heart.

Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.

Science.gov (United States)

Aoyagi, N; Wassarman, D A

2001-10-01

In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.

Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

Science.gov (United States)

Tarone, Aaron M; Foran, David R

2011-01-01

Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

Profiling and bioinformatic analysis of circular RNA expression regulated by c-Myc.

Science.gov (United States)

Gou, Qiheng; Wu, Ke; Zhou, Jian-Kang; Xie, Yuxin; Liu, Lunxu; Peng, Yong

2017-09-22

The c-Myc transcription factor is involved in cell proliferation, cell cycle and apoptosis by activating or repressing transcription of multiple genes. Circular RNAs (circRNAs) are widely expressed non-coding RNAs participating in the regulation of gene expression. Using a high-throughput microarray assay, we showed that Myc regulates the expression of certain circRNAs. A total of 309 up- and 252 down-regulated circRNAs were identified. Among them, randomly selected 8 circRNAs were confirmed by real-time PCR. Subsequently, Myc-binding sites were found to generally exist in the promoter regions of differentially expressed circRNAs. Based on miRNA sponge mechanism, we constructed circRNAs/miRNAs network regulated by Myc, suggesting that circRNAs may widely regulate protein expression through miRNA sponge mechanism. Lastly, we took advantage of Gene Ontology and KEGG analyses to point out that Myc-regulated circRNAs could impact cell proliferation through affecting Ras signaling pathway and pathways in cancer. Our study for the first time demonstrated that Myc transcription factor regulates the expression of circRNAs, adding a novel component of the Myc tumorigenic program and opening a window to investigate the function of certain circRNAs in tumorigenesis.

Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence

DEFF Research Database (Denmark)

Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

2004-01-01

Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these......Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus...... for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise...... to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby...

Developmental expression and differentiation-related neuron-specific splicing of metastasis suppressor 1 (Mtss1 in normal and transformed cerebellar cells

Directory of Open Access Journals (Sweden)

Baader Stephan L

2007-10-01

Full Text Available Abstract Background Mtss1 encodes an actin-binding protein, dysregulated in a variety of tumors, that interacts with sonic hedgehog/Gli signaling in epidermal cells. Given the prime importance of this pathway for cerebellar development and tumorigenesis, we assessed expression of Mtss1 in the developing murine cerebellum and human medulloblastoma specimens. Results During development, Mtss1 is transiently expressed in granule cells, from the time point they cease to proliferate to their synaptic integration. It is also expressed by granule cell precursor-derived medulloblastomas. In the adult CNS, Mtss1 is found exclusively in cerebellar Purkinje cells. Neuronal differentiation is accompanied by a switch in Mtss1 splicing. Whereas immature granule cells express a Mtss1 variant observed also in peripheral tissues and comprising exon 12, this exon is replaced by a CNS-specific exon, 12a, in more mature granule cells and in adult Purkinje cells. Bioinformatic analysis of Mtss1 suggests that differential exon usage may affect interaction with Fyn and Src, two tyrosine kinases previously recognized as critical for cerebellar cell migration and histogenesis. Further, this approach led to the identification of two evolutionary conserved nuclear localization sequences. These overlap with the actin filament binding site of Mtss1, and one also harbors a potential PKA and PKC phosphorylation site. Conclusion Both the pattern of expression and splicing of Mtss1 is developmentally regulated in the murine cerebellum. These findings are discussed with a view on the potential role of Mtss1 for cytoskeletal dynamics in developing and mature cerebellar neurons.

Field transcriptome revealed critical developmental and physiological transitions involved in the expression of growth potential in japonica rice

Directory of Open Access Journals (Sweden)

Kamatsuki Kaori

2011-01-01

Full Text Available Abstract Background Plant growth depends on synergistic interactions between internal and external signals, and yield potential of crops is a manifestation of how these complex factors interact, particularly at critical stages of development. As an initial step towards developing a systems-level understanding of the biological processes underlying the expression of overall agronomic potential in cereal crops, a high-resolution transcriptome analysis of rice was conducted throughout life cycle of rice grown under natural field conditions. Results A wide range of gene expression profiles based on 48 organs and tissues at various developmental stages identified 731 organ/tissue specific genes as well as 215 growth stage-specific expressed genes universally in leaf blade, leaf sheath, and root. Continuous transcriptome profiling of leaf from transplanting until harvesting further elucidated the growth-stage specificity of gene expression and uncovered two major drastic changes in the leaf transcriptional program. The first major change occurred before the panicle differentiation, accompanied by the expression of RFT1, a putative florigen gene in long day conditions, and the downregulation of the precursors of two microRNAs. This transcriptome change was also associated with physiological alterations including phosphate-homeostasis state as evident from the behavior of several key regulators such as miR399. The second major transcriptome change occurred just after flowering, and based on analysis of sterile mutant lines, we further revealed that the formation of strong sink, i.e., a developing grain, is not the major cause but is rather a promoter of this change. Conclusions Our study provides not only the genetic basis for functional genomics in rice but also new insight into understanding the critical physiological processes involved in flowering and seed development, that could lead to novel strategies for optimizing crop productivity.

Regulation of renal NaPi-2 expression and tubular phosphate reabsorption by growth hormone in the juvenile rat.

Science.gov (United States)

Woda, Craig B; Halaihel, Nabil; Wilson, Paul V; Haramati, Aviad; Levi, Moshe; Mulroney, Susan E

2004-07-01

Growth hormone (GH) is an important factor in the developmental adaptation to enhance P(i) reabsorption; however, the nephron sites and mechanisms by which GH regulates renal P(i) uptake remain unclear and are the focus of the present study. Micropuncture experiments were performed after acute thyroparathyroidectomy in the presence and absence of parathyroid hormone (PTH) in adult (14- to 17-wk old), juvenile (4-wk old), and GH-suppressed juvenile male rats. While the phosphaturic effect of PTH was blunted in the juvenile rat compared with the adult, suppression of GH in the juvenile restored fractional P(i) excretion to adult levels. In the presence or absence of PTH, GH suppression in the juvenile rat caused a significant increase in the fractional P(i) delivery to the late proximal convoluted (PCT) and early distal tubule, so that delivery was not different from that in adults. These data were confirmed by P(i) uptake studies into brush-border membrane (BBM) vesicles. Immunofluorescence studies indicate increased BBM type IIa NaP(i) cotransporter (NaPi-2) expression in the juvenile compared with adult rat, and GH suppression reduced NaPi-2 expression to levels observed in the adult. GH replacement in the [N-acetyl-Tyr(1)-d-Arg(2)]-GRF-(1-29)-NH(2)-treated juveniles restored high NaPi-2 expression and P(i) uptake. Together, these novel results demonstrate that the presence of GH in the juvenile animal is crucial for the early developmental upregulation of BBM NaPi-2 and, most importantly, describe the enhanced P(i) reabsorption along the PCT and proximal straight nephron segments in the juvenile rat.

Reporter-Based Isolation of Developmental Myogenic Progenitors

Directory of Open Access Journals (Sweden)

Eyemen Kheir

2018-04-01

Full Text Available The formation and activity of mammalian tissues entail finely regulated processes, involving the concerted organization and interaction of multiple cell types. In recent years the prospective isolation of distinct progenitor and stem cell populations has become a powerful tool in the hands of developmental biologists and has rendered the investigation of their intrinsic properties possible. In this protocol, we describe how to purify progenitors with different lineage history and degree of differentiation from embryonic and fetal skeletal muscle by fluorescence-activated cell sorting (FACS. The approach takes advantage of a panel of murine strains expressing fluorescent reporter genes specifically in the myogenic progenitors. We provide a detailed description of the dissection procedures and of the enzymatic dissociation required to maximize the yield of mononucleated cells for subsequent FACS-based purification. The procedure takes ~6–7 h to complete and allows for the isolation and the subsequent molecular and phenotypic characterization of developmental myogenic progenitors.

Identification of microRNAs regulating the developmental pathways of bone marrow derived mast cells.

Directory of Open Access Journals (Sweden)

Yang Xiang

Full Text Available MicroRNAs (miRNAs play important roles in leukocyte differentiation, although those utilised for specific programs and key functions remain incompletely characterised. As a global approach to gain insights into the potential regulatory role of miRNA in mast cell differentiation we characterised expression in BM cultures from the initiation of differentiation. In cultures enriched in differentiating mast cells we characterised miRNA expression and identified miRNA targeting the mRNA of putative factors involved in differentiation pathways and cellular identity. Detailed pathway analysis identified a unique miRNA network that is intimately linked to the mast cell differentiation program.We identified 86 unique miRNAs with expression patterns that were up- or down- regulated at 5-fold or more during bone marrow derived mast cells (BMMC development. By employing TargetScan and MeSH databases, we identified 524 transcripts involved in 30 canonical pathways as potentially regulated by these specific 86 miRNAs. Furthermore, by applying miRanda and IPA analyses, we predict that 7 specific miRNAs of this group are directly associated with the expression of c-Kit and FcεRIα and likewise, that 18 miRNAs promote expression of Mitf, GATA1 and c/EBPα three core transcription factors that direct mast cell differentiation. Furthermore, we have identified 11 miRNAs that may regulate the expression of STATs-3, -5a/b, GATA2 and GATA3 during differentiation, along with 13 miRNAs that target transcripts encoding Ndst2, mMCP4 and mMCP6 and thus may regulate biosynthesis of mast cell secretory mediators.This investigation characterises changes in miRNA expression in whole BM cultures during the differentiation of mast cells and predicts functional links between miRNAs and their target mRNAs for the regulation of development. This information provides an important resource for further investigations of the contributions of miRNAs to mast cell differentiation and

Neuronal MHC Class I Expression Is Regulated by Activity Driven Calcium Signaling.

Directory of Open Access Journals (Sweden)

Dan Lv

Full Text Available MHC class I (MHC-I molecules are important components of the immune system. Recently MHC-I have been reported to also play important roles in brain development and synaptic plasticity. In this study, we examine the molecular mechanism(s underlying activity-dependent MHC-I expression using hippocampal neurons. Here we report that neuronal expression level of MHC-I is dynamically regulated during hippocampal development after birth in vivo. Kainic acid (KA treatment significantly increases the expression of MHC-I in cultured hippocampal neurons in vitro, suggesting that MHC-I expression is regulated by neuronal activity. In addition, KA stimulation decreased the expression of pre- and post-synaptic proteins. This down-regulation is prevented by addition of an MHC-I antibody to KA treated neurons. Further studies demonstrate that calcium-dependent protein kinase C (PKC is important in relaying KA simulation activation signals to up-regulated MHC-I expression. This signaling cascade relies on activation of the MAPK pathway, which leads to increased phosphorylation of CREB and NF-κB p65 while also enhancing the expression of IRF-1. Together, these results suggest that expression of MHC-I in hippocampal neurons is driven by Ca2+ regulated activation of the MAPK signaling transduction cascade.

Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

International Nuclear Information System (INIS)

Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J.; Flaws, Jodi A.; Helferich, William G.; Pan, Yuan-Xiang; Lezmi, Stéphane

2015-01-01

Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

Energy Technology Data Exchange (ETDEWEB)

Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Flaws, Jodi A. [Department of Comparative Biosciences, University of Illinois Urbana-Champaign (United States); Helferich, William G. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Pan, Yuan-Xiang, E-mail: yxpan@illinois.edu [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Lezmi, Stéphane, E-mail: slezmi@illinois.edu [Department of Pathobiology, University of Illinois Urbana-Champaign (United States)

2015-04-15

Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

Energy Technology Data Exchange (ETDEWEB)

Robinson, Joshua F. [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, Maastricht (Netherlands); Verhoef, Aart; Beelen, Vincent A. van; Pennings, Jeroen L.A. [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Piersma, Aldert H., E-mail: aldert.piersma@rivm.nl [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, Utrecht (Netherlands)

2012-10-01

The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing gene expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.

Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

Science.gov (United States)

Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

2015-01-08

Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

Overexpression of LncRNA AC067945.2 Down-Regulates Collagen Expression in Skin Fibroblasts and Possibly Correlates with the VEGF and Wnt Signalling Pathways.

Science.gov (United States)

Chen, Ling; Li, Jingyun; Li, Qian; Li, Xue; Gao, Yanli; Hua, Xiangdong; Zhou, Bei; Li, Jun

2018-01-01

Long non-coding RNAs (lncRNAs) are thought to play crucial roles in human diseases. However, the function of lncRNAs in hypertrophic scar formation remains poorly understood. Utilizing qRT-PCR, we explored the expression changes of AC067945.2. Overexpression of AC067945.2 in normal skin fibroblasts was performed by transient plasmid transfection. Western blot was used to check the proteins' expression changes. Cell Counting Kit-8 (CCK-8) assay and Annexin V/7-AAD staining were used to examine cell proliferation and apoptosis, respectively. mRNA-seq was applied to dissect the differentially expressed mRNAs in AC067945.2 overexpressed cells. We also performed ELISA to detect the VEGF secretion. AC067945.2 was down-regulated in hypertrophic scar tissues. Overexpression of AC067945.2 did not affect cell proliferation, but it mildly promoted early apoptosis in normal skin fibroblasts. Furthermore, AC067945.2 overexpression inhibited the expression of COL1A1, COL1A2, COL3A1 and α-SMA proteins. Transforming growth factor-β1 (TGF-β1) could inhibit the expression of AC067945.2. Based on mRNA-seq data, compared with mRNAs in the control group, 138 mRNAs were differentially expressed, including 14 up-regulated and 124 down-regulated transcripts, in the AC067945.2 overexpression group. Gene ontology and pathway analyses revealed that AC067945.2 overexpression was correlated with developmental processes, binding, extracellular region, and the vascular endothelial cell growth factor (VEGF) and Wnt signalling pathways. ELISA confirmed that AC067945.2 overexpression could repress VEGF secretion. Taken together, our data uncovered the functions of a novel lncRNA AC067945.2, which might help us understand the mechanisms regulated by AC067945.2 in the pathogenesis of hypertrophic scar formation. © 2018 The Author(s). Published by S. Karger AG, Basel.

The evolution of Msx gene function: expression and regulation of a sea urchin Msx class homeobox gene.

Science.gov (United States)

Dobias, S L; Ma, L; Wu, H; Bell, J R; Maxson, R

1997-01-01

Msx- class homeobox genes, characterized by a distinct and highly conserved homeodomain, have been identified in a wide variety of metazoans from vertebrates to coelenterates. Although there is evidence that they participate in inductive tissue interactions that underlie vertebrate organogenesis, including those that pattern the neural crest, there is little information about their function in simple deuterostomes. Both to learn more about the ancient function of Msx genes, and to shed light on the evolution of developmental mechanisms within the lineage that gave rise to vertebrates, we have isolated and characterized Msx genes from ascidians and echinoderms. Here we describe the sequence and expression of a sea urchin (Strongylocentrotus purpouratus) Msx gene whose homeodomain is very similar to that of vertebrate Msx2. This gene, designated SpMsx, is first expressed in blastula stage embryos, apparently in a non-localized manner. Subsequently, during the early phases of gastrulation, SpMsx transcripts are expressed intensely in the invaginating archenteron and secondary mesenchyme, and at reduced levels in the ectoderm. In the latter part of gastrulation, SpMsx transcripts are concentrated in the oral ectoderm and gut, and continue to be expressed at those sites through the remainder of embryonic development. That vertebrate Msx genes are regulated by inductive tissue interactions and growth factors suggested to us that the restriction of SpMsx gene expression to the oral ectoderm and derivatives of the vegetal plate might similarly be regulated by the series of signaling events that pattern these embryonic territories. As a first test of this hypothesis, we examined the influence of exogastrulation and cell-dissociation on SpMsx gene expression. In experimentally-induced exogastrulae, SpMsx transcripts were distributed normally in the oral ectoderm, evaginated gut, and secondary mesenchyme. However, when embryos were dissociated into their component cells, Sp

Prostacyclin synthase expression and epigenetic regulation in nonsmall cell lung cancer.

LENUS (Irish Health Repository)

Cathcart, Mary-Clare

2012-02-01

BACKGROUND: Prostacyclin synthase (PGIS) metabolizes prostaglandin H(2), into prostacyclin. This study aimed to determine the expression profile of PGIS in nonsmall cell lung cancer (NSCLC) and examine potential mechanisms involved in PGIS regulation. METHODS: PGIS expression was examined in human NSCLC and matched controls by reverse transcriptase polymerase chain reaction (RT-PCR), Western analysis, and immunohistochemistry. A 204-patient NSCLC tissue microarray was stained for PGIS and cyclooxygenase 2 (COX2) expression. Staining intensity was correlated with clinical parameters. Epigenetic mechanisms underpinning PGIS promoter expression were examined using RT-PCR, methylation-specific PCR, and chromatin immunoprecipitation analysis. RESULTS: PGIS expression was reduced\\/absent in human NSCLC protein samples (P < .0001), but not mRNA relative to matched controls. PGIS tissue expression was higher in squamous cell carcinoma (P = .004) and in male patients (P < .05). No significant correlation of PGIS or COX2 expression with overall patient survival was observed, although COX2 was prognostic for short-term (2-year) survival (P < .001). PGIS mRNA expression was regulated by DNA CpG methylation and histone acetylation in NSCLC cell lines, with chromatin remodeling taking place directly at the PGIS gene. PGIS mRNA expression was increased by both demethylation agents and histone deacetylase inhibitors. Protein levels were unaffected by demethylation agents, whereas PGIS protein stability was negatively affected by histone deacetylase inhibitors. CONCLUSIONS: PGIS protein expression is reduced in NSCLC, and does not correlate with overall patient survival. PGIS expression is regulated through epigenetic mechanisms. Differences in expression patterns between mRNA and protein levels suggest that PGIS expression and protein stability are regulated post-translationally. PGIS protein stability may have an important therapeutic role in NSCLC.

Expression regulation of design process gene in product design

DEFF Research Database (Denmark)

Li, Bo; Fang, Lusheng; Li, Bo

2011-01-01

To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene...... is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

Regulation of catalase expression in healthy and cancerous cells.

Science.gov (United States)

Glorieux, Christophe; Zamocky, Marcel; Sandoval, Juan Marcelo; Verrax, Julien; Calderon, Pedro Buc

2015-10-01

Catalase is an important antioxidant enzyme that dismutates hydrogen peroxide into water and molecular oxygen. The catalase gene has all the characteristics of a housekeeping gene (no TATA box, no initiator element sequence, high GC content in promoter) and a core promoter that is highly conserved among species. We demonstrate in this review that within this core promoter, the presence of DNA binding sites for transcription factors, such as NF-Y and Sp1, plays an essential role in the positive regulation of catalase expression. Additional transcription factors, such as FoxO3a, are also involved in this regulatory process. There is strong evidence that the protein Akt/PKB in the PI3K signaling pathway plays a major role in the expression of catalase by modulating the activity of FoxO3a. Over the past decade, other transcription factors (PPARγ, Oct-1, etc.), as well as genetic, epigenetic, and posttranscriptional processes, have emerged as crucial contributors to the regulation of catalase expression. Altered expression levels of catalase have been reported in cancer tissues compared to their normal counterparts. Deciphering the molecular mechanisms that regulate catalase expression could, therefore, be of crucial importance for the future development of pro-oxidant cancer chemotherapy. Copyright © 2015. Published by Elsevier Inc.

Developmental expression of Drosophila Wiskott-Aldrich Syndrome family proteins

Science.gov (United States)

Rodriguez-Mesa, Evelyn; Abreu-Blanco, Maria Teresa; Rosales-Nieves, Alicia E.; Parkhurst, Susan M.

2012-01-01

Background Wiskott-Aldrich Syndrome (WASP) family proteins participate in many cellular processes involving rearrangements of the actin cytoskeleton. To the date, four WASP subfamily members have been described in Drosophila: Wash, WASp, SCAR, and Whamy. Wash, WASp, and SCAR are essential during early Drosophila development where they function in orchestrating cytoplasmic events including membrane-cytoskeleton interactions. A mutant for Whamy has not yet been reported. Results We generated monoclonal antibodies that are specific to Drosophila Wash, WASp, SCAR, and Whamy, and use these to describe their spatial and temporal localization patterns. Consistent with the importance of WASP family proteins in flies, we find that Wash, WASp, SCAR, and Whamy are dynamically expressed throughout oogenesis and embryogenesis. For example, we find that Wash accumulates at the oocyte cortex. WASp is highly expressed in the PNS, while SCAR is the most abundantly expressed in the CNS. Whamy exhibits an asymmetric subcellular localization that overlaps with mitochondria and is highly expressed in muscle. Conclusion All four WASP family members show specific expression patterns, some of which reflect their previously known roles and others revealing new potential functions. The monoclonal antibodies developed offer valuable new tools to investigate how WASP family proteins regulate actin cytoskeleton dynamics. PMID:22275148

Itga2b regulation at the onset of definitive hematopoiesis and commitment to differentiation.

Directory of Open Access Journals (Sweden)

Stephanie Dumon

Full Text Available Product of the Itga2b gene, CD41 contributes to hematopoietic stem cell (HSC and megakaryocyte/platelet functions. CD41 expression marks the onset of definitive hematopoiesis in the embryo where it participates in regulating the numbers of multipotential progenitors. Key to platelet aggregation, CD41 expression also characterises their precursor, the megakaryocyte, and is specifically up regulated during megakaryopoiesis. Though phenotypically unique, megakaryocytes and HSC share numerous features, including key transcription factors, which could indicate common sub-regulatory networks. In these respects, Itga2b can serve as a paradigm to study features of both developmental-stage and HSC- versus megakaryocyte-specific regulations. By comparing different cellular contexts, we highlight a mechanism by which internal promoters participate in Itga2b regulation. A developmental process connects epigenetic regulation and promoter switching leading to CD41 expression in HSC. Interestingly, a similar process can be observed at the Mpl locus, which codes for another receptor that defines both HSC and megakaryocyte identities. Our study shows that Itga2b expression is controlled by lineage-specific networks and associates with H4K8ac in megakaryocyte or H3K27me3 in the multipotential hematopoietic cell line HPC7. Correlating with the decrease in H3K27me3 at the Itga2b Iocus, we find that following commitment to megakaryocyte differentiation, the H3K27 demethylase Jmjd3 up-regulation influences both Itga2b and Mpl expression.

MicroRNA expression profiling of the porcine developing brain

DEFF Research Database (Denmark)

Podolska, Agnieszka; Kaczkowski, Bogumil; Busk, Peter Kamp

2011-01-01

MicroRNAs are small, non-coding RNA molecules that regulate gene expression at the post-transcriptional level and play an important role in the control of developmental and physiological processes. In particular, the developing brain contains an impressive diversity of microRNAs. Most micro...... and the growth curve when compared to humans. Considering these similarities, studies examining microRNA expression during porcine brain development could potentially be used to predict the expression profile and role of microRNAs in the human brain....

Intermittent pneumatic compression regulates expression of nitric oxide synthases in skeletal muscles.

Science.gov (United States)

Tan, Xiangling; Qi, Wen-Ning; Gu, Xiaosong; Urbaniak, James R; Chen, Long-En

2006-01-01

This study investigated the effects of intermittent pneumatic compression (IPC) on expression of nitric oxide synthase (NOS) isoforms in compressed (anterior tibialis, AT) and uncompressed (cremaster muscles, CM) skeletal muscles. Following IPC application of 0.5, 1, and 5h on both legs of rats, the endothelial NOS (eNOS) mRNA expression was significantly up-regulated to 1.2-, 1.8, and 2.7-fold from normal, respectively, in both AT and CM, and protein expression increased more than 1.5-fold of normal at each time point. Similarly, neuronal NOS expression was up-regulated, but to a lesser degree. In contrast, inducible NOS expression was significantly and time-dependently down-regulated in both muscles. After IPC cessation, eNOS levels returned to normal in both AT and CM. The results confirm our hypothesis that IPC-induced vasodilation is mediated by regulating expression of NOS isoforms, in particular eNOS, in both compressed and uncompressed skeletal muscles. The results also suggest the importance of precisely characterizing expression of each NOS isoform in tissue pathophysiology.

Genome-wide prediction and functional validation of promoter motifs regulating gene expression in spore and infection stages of Phytophthora infestans.

Directory of Open Access Journals (Sweden)

Sourav Roy

2013-03-01

Full Text Available Most eukaryotic pathogens have complex life cycles in which gene expression networks orchestrate the formation of cells specialized for dissemination or host colonization. In the oomycete Phytophthora infestans, the potato late blight pathogen, major shifts in mRNA profiles during developmental transitions were identified using microarrays. We used those data with search algorithms to discover about 100 motifs that are over-represented in promoters of genes up-regulated in hyphae, sporangia, sporangia undergoing zoosporogenesis, swimming zoospores, or germinated cysts forming appressoria (infection structures. Most of the putative stage-specific transcription factor binding sites (TFBSs thus identified had features typical of TFBSs such as position or orientation bias, palindromy, and conservation in related species. Each of six motifs tested in P. infestans transformants using the GUS reporter gene conferred the expected stage-specific expression pattern, and several were shown to bind nuclear proteins in gel-shift assays. Motifs linked to the appressoria-forming stage, including a functionally validated TFBS, were over-represented in promoters of genes encoding effectors and other pathogenesis-related proteins. To understand how promoter and genome architecture influence expression, we also mapped transcription patterns to the P. infestans genome assembly. Adjacent genes were not typically induced in the same stage, including genes transcribed in opposite directions from small intergenic regions, but co-regulated gene pairs occurred more than expected by random chance. These data help illuminate the processes regulating development and pathogenesis, and will enable future attempts to purify the cognate transcription factors.

Post-transcriptional regulation of gene expression in Yersinia species

Directory of Open Access Journals (Sweden)

Chelsea A Schiano

2012-11-01

Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

Expression of the central growth regulator BIG BROTHER is regulated by multiple cis-elements

Directory of Open Access Journals (Sweden)

Breuninger Holger

2012-03-01

Full Text Available Abstract Background Much of the organismal variation we observe in nature is due to differences in organ size. The observation that even closely related species can show large, stably inherited differences in organ size indicates a strong genetic component to the control of organ size. Despite recent progress in identifying factors controlling organ growth in plants, our overall understanding of this process remains limited, partly because the individual factors have not yet been connected into larger regulatory pathways or networks. To begin addressing this aim, we have studied the upstream regulation of expression of BIG BROTHER (BB, a central growth-control gene in Arabidopsis thaliana that prevents overgrowth of organs. Final organ size and BB expression levels are tightly correlated, implying the need for precise control of its expression. BB expression mirrors proliferative activity, yet the gene functions to limit proliferation, suggesting that it acts in an incoherent feedforward loop downstream of growth activators to prevent over-proliferation. Results To investigate the upstream regulation of BB we combined a promoter deletion analysis with a phylogenetic footprinting approach. We were able to narrow down important, highly conserved, cis-regulatory elements within the BB promoter. Promoter sequences of other Brassicaceae species were able to partially complement the A. thaliana bb-1 mutant, suggesting that at least within the Brassicaceae family the regulatory pathways are conserved. Conclusions This work underlines the complexity involved in precise quantitative control of gene expression and lays the foundation for identifying important upstream regulators that determine BB expression levels and thus final organ size.

Children's Expression and Control of Emotion-Related Behavior: Developmental and Gender Influences on Children's and Parents' Perceptions.

Science.gov (United States)

Dorr, Aimee; And Others

This study examined the developmental and gender influences on children's normative emotional expression and control. The study surveyed 307 pairs of middle-class European-American children who were 7, 11, and 15 years old, and one parent of each child. The results of the survey showed that children were closer to the norm in their expressive…

Coordination of flower development by homeotic master regulators.

Science.gov (United States)

Ito, Toshiro

2011-02-01

Floral homeotic genes encode transcription factors and act as master regulators of flower development. The homeotic protein complex is expressed in a specific whorl of the floral primordium and determines floral organ identity by the combinatorial action. Homeotic proteins continue to be expressed until late in flower development to coordinate growth and organogenesis. Recent genomic studies have shown that homeotic proteins bind thousands of target sites in the genome and regulate the expression of transcription factors, chromatin components and various proteins involved in hormone biosynthesis and signaling and other physiological activities. Further, homeotic proteins program chromatin to direct the developmental coordination of stem cell maintenance and differentiation in shaping floral organs. Copyright © 2010 Elsevier Ltd. All rights reserved.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Meis1 regulates Foxn4 expression during retinal progenitor cell differentiation

Directory of Open Access Journals (Sweden)

Mohammed M. Islam

2013-09-01

The transcription factor forkhead box N4 (Foxn4 is a key regulator in a variety of biological processes during development. In particular, Foxn4 plays an essential role in the genesis of horizontal and amacrine neurons from neural progenitors in the vertebrate retina. Although the functions of Foxn4 have been well established, the transcriptional regulation of Foxn4 expression during progenitor cell differentiation remains unclear. Here, we report that an evolutionarily conserved 129 bp noncoding DNA fragment (Foxn4CR4.2 or CR4.2, located ∼26 kb upstream of Foxn4 transcription start site, functions as a cis-element for Foxn4 regulation. CR4.2 directs gene expression in Foxn4-positive cells, primarily in progenitors, differentiating horizontal and amacrine cells. We further determined that the gene regulatory activity of CR4.2 is modulated by Meis1 binding motif, which is bound and activated by Meis1 transcription factor. Deletion of the Meis1 binding motif or knockdown of Meis1 expression abolishes the gene regulatory activity of CR4.2. In addition, knockdown of Meis1 expression diminishes the endogenous Foxn4 expression and affects cell lineage development. Together, we demonstrate that CR4.2 and its interacting Meis1 transcription factor play important roles in regulating Foxn4 expression during early retinogenesis. These findings provide new insights into molecular mechanisms that govern gene regulation in retinal progenitors and specific cell lineage development.

Plasma Cell Ontogeny Defined by Quantitative Changes in Blimp-1 Expression

Science.gov (United States)

Kallies, Axel; Hasbold, Jhagvaral; Tarlinton, David M.; Dietrich, Wendy; Corcoran, Lynn M.; Hodgkin, Philip D.; Nutt, Stephen L.

2004-01-01

Plasma cells comprise a population of terminally differentiated B cells that are dependent on the transcriptional regulator B lymphocyte–induced maturation protein 1 (Blimp-1) for their development. We have introduced a gfp reporter into the Blimp-1 locus and shown that heterozygous mice express the green fluorescent protein in all antibody-secreting cells (ASCs) in vivo and in vitro. In vitro, these cells display considerable heterogeneity in surface phenotype, immunoglobulin secretion rate, and Blimp-1 expression levels. Importantly, analysis of in vivo ASCs induced by immunization reveals a developmental pathway in which increasing levels of Blimp-1 expression define developmental stages of plasma cell differentiation that have many phenotypic and molecular correlates. Thus, maturation from transient plasmablast to long-lived ASCs in bone marrow is predicated on quantitative increases in Blimp-1 expression. PMID:15492122

Developmental expression of “germline”- and “sex determination”-related genes in the ctenophore Mnemiopsis leidyi

Directory of Open Access Journals (Sweden)

Adam M. Reitzel

2016-08-01

Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for

Characterization of gene expression regulated by human OTK18 ...

Indian Academy of Sciences (India)

ing regulated by interactions with the Tat protein (Carlson et al. 2004a). In contrast, OTK18 is ubiquitously expressed in all normal human tissues, and OTK18 expression in HIV-1 ..... and Social Sciences and the UNK Biology Department.

The developmental expression of fluorescent proteins in organotypic hippocampal slice cultures from transgenic mice and its use in the determination of excitotoxic neurodegeneration

DEFF Research Database (Denmark)

Noraberg, Jens; Jensen, Carsten V; Bonde, Christian

2007-01-01

Transgenic mice, expressing fluorescent proteins in neurons and glia, provide new opportunities for real-time microscopic monitoring of degenerative and regenerative structural changes. We have previously validated and compared a number of quantifiable markers for neuronal damage and cell death...... changes, as well as the opportunity to monitor reversible changes or long-term effects in the event of minor damage. As a first step, we present: a) the developmental expression in organotypic hippocampal brain slice cultures of transgenic fluorescent proteins, useful for the visualisation of neuronal...... transgenic mouse strains which express fluorescent proteins in their neurons and/or astroglial cells. From the time of explantation, and subsequently for up to nine weeks in culture, the transgenic neuronal fluorescence displayed the expected characteristics of a developmental, in vivo-like increase...

DMBT1 expression is down-regulated in breast cancer

International Nuclear Information System (INIS)

Braidotti, P; Pietra, GG; Nuciforo, PG; Mollenhauer, J; Poustka, A; Pellegrini, C; Moro, A; Bulfamante, G; Coggi, G; Bosari, S

2004-01-01

We studied the expression of DMBT1 (deleted in malignant brain tumor 1), a putative tumor suppressor gene, in normal, proliferative, and malignant breast epithelium and its possible relation to cell cycle. Sections from 17 benign lesions and 55 carcinomas were immunostained with anti DMBT1 antibody (DMBTh12) and sections from 36 samples, were double-stained also with anti MCM5, one of the 6 pre-replicative complex proteins with cell proliferation-licensing functions. DMBT1 gene expression at mRNA level was assessed by RT-PCR in frozen tissues samples from 39 patients. Normal glands and hyperplastic epithelium in benign lesions displayed a luminal polarized DMBTh12 immunoreactivity. Normal and hyperplastic epithelium adjacent to carcinomas showed a loss of polarization, with immunostaining present in basal and perinuclear cytoplasmic compartments. DMBT1 protein expression was down-regulated in the cancerous lesions compared to the normal and/or hyperplastic epithelium adjacent to carcinomas (3/55 positive carcinomas versus 33/42 positive normal/hyperplastic epithelia; p = 0.0001). In 72% of cases RT-PCR confirmed immunohistochemical results. Most of normal and hyperplastic mammary cells positive with DMBTh12 were also MCM5-positive. The redistribution and up-regulation of DMBT1 in normal and hyperplastic tissues flanking malignant tumours and its down-regulation in carcinomas suggests a potential role in breast cancer. Moreover, the concomitant expression of DMTB1 and MCM5 suggests its possible association with the cell-cycle regulation

Estrogen regulation of TRPM8 expression in breast cancer cells

International Nuclear Information System (INIS)

Chodon, Dechen; Guilbert, Arnaud; Dhennin-Duthille, Isabelle; Gautier, Mathieu; Telliez, Marie-Sophie; Sevestre, Henri; Ouadid-Ahidouch, Halima

2010-01-01

The calcium-permeable cation channel TRPM8 (melastatin-related transient receptor potential member 8) is over-expressed in several cancers. The present study aimed at investigating the expression, function and potential regulation of TRPM8 channels by ER alpha (estrogen receptor alpha) in breast cancer. RT-PCR, Western blot, immuno-histochemical, and siRNA techniques were used to investigate TRPM8 expression, its regulation by estrogen receptors, and its expression in breast tissue. To investigate the channel activity in MCF-7 cells, we used the whole cell patch clamp and the calcium imaging techniques. TRPM8 channels are expressed at both mRNA and protein levels in the breast cancer cell line MCF-7. Bath application of the potent TRPM8 agonist Icilin (20 μM) induced a strong outwardly rectifying current at depolarizing potentials, which is associated with an elevation of cytosolic calcium concentration, consistent with established TRPM8 channel properties. RT-PCR experiments revealed a decrease in TRPM8 mRNA expression following steroid deprivation for 48 and 72 hours. In steroid deprived medium, addition of 17-beta-estradiol (E 2 , 10 nM) increased both TRPM8 mRNA expression and the number of cells which respond to Icilin, but failed to affect the Ca 2+ entry amplitude. Moreover, silencing ERα mRNA expression with small interfering RNA reduced the expression of TRPM8. Immuno-histochemical examination of the expression of TRPM8 channels in human breast tissues revealed an over-expression of TRPM8 in breast adenocarcinomas, which is correlated with estrogen receptor positive (ER + ) status of the tumours. Taken together, these results show that TRPM8 channels are expressed and functional in breast cancer and that their expression is regulated by ER alpha

Glucose transporters: expression, regulation and cancer

Directory of Open Access Journals (Sweden)

RODOLFO A. MEDINA

2002-01-01

Full Text Available Mammalian cells depend on glucose as a major substrate for energy production. Glucose is transported into the cell via facilitative glucose transporters (GLUT present in all cell types. Many GLUT isoforms have been described and their expression is cell-specific and subject to hormonal and environmental control. The kinetic properties and substrate specificities of the different isoforms are specifically suited to the energy requirements of the particular cell types. Due to the ubiquitousness of these transporters, their differential expression is involved in various disease states such as diabetes, ischemia and cancer. The majority of cancers and isolated cancer cell lines over-express the GLUT family members which are present in the respective tissue of origin under non-cancerous conditions. Moreover, due to the requirement of energy to feed uncontrolled proliferation, cancer cells often express GLUTs which under normal conditions would not be present in these tissues. This over-expression is predominantly associated with the likelihood of metastasis and hence poor patient prognosis. This article presents a review of the current literature on the regulation and expression of GLUT family members and has compiled clinical and research data on GLUT expression in human cancers and in isolated human cancer cell lines.

Developmentalism: An Obscure but Pervasive Restriction

Directory of Open Access Journals (Sweden)

J. E. Stone

1996-04-01

Full Text Available Despite continuing criticism of public education, experimentally demonstrated and field tested teaching methods have been ignored, rejected, and abandoned. Instead of a stable consensus regarding best teaching practices, there seems only an unending succession of innovations. A longstanding educational doctrine appears to underlie this anomalous state of affairs. Termed developmentalism, it presumes "natural" ontogenesis to be optimal and it requires experimentally demonstrated teaching practices to overcome a presumption that they interfere with an optimal developmental trajectory. It also discourages teachers and parents from asserting themselves with children. Instead of effective interventions, it seeks the preservation of a postulated natural perfection. Developmentalism's rich history is expressed in a literature extending over 400 years. Its notable exponents include Jean Jacques Rousseau, John Dewey, and Jean Piaget; and its most recent expressions include "developmentally appropriate practice" and "constructivism." In the years during which it gained ascendance, developmentalism served as a basis for rejecting harsh and inhumane teaching methods. Today it impedes efforts to hold schools accountable for student academic achievement.

Developmental Vitamin D Availability Impacts Hematopoietic Stem Cell Production

Directory of Open Access Journals (Sweden)

Mauricio Cortes

2016-10-01

Full Text Available Vitamin D insufficiency is a worldwide epidemic affecting billions of individuals, including pregnant women and children. Despite its high incidence, the impact of active vitamin D3 (1,25(OHD3 on embryonic development beyond osteo-regulation remains largely undefined. Here, we demonstrate that 1,25(OHD3 availability modulates zebrafish hematopoietic stem and progenitor cell (HSPC production. Loss of Cyp27b1-mediated biosynthesis or vitamin D receptor (VDR function by gene knockdown resulted in significantly reduced runx1 expression and Flk1+cMyb+ HSPC numbers. Selective modulation in vivo and in vitro in zebrafish indicated that vitamin D3 acts directly on HSPCs, independent of calcium regulation, to increase proliferation. Notably, ex vivo treatment of human HSPCs with 1,25(OHD3 also enhanced hematopoietic colony numbers, illustrating conservation across species. Finally, gene expression and epistasis analysis indicated that CXCL8 (IL-8 was a functional target of vitamin D3-mediated HSPC regulation. Together, these findings highlight the relevance of developmental 1,25(OHD3 availability for definitive hematopoiesis and suggest potential therapeutic utility in HSPC expansion.

Signaling pathways in PACAP regulation of VIP gene expression in human neuroblastoma cells

DEFF Research Database (Denmark)

Falktoft, B.; Georg, B.; Fahrenkrug, J.

2009-01-01

Ganglia expressing the neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) innervate vasoactive intestinal peptide (VIP) containing neurons suggesting a role of PACAP in regulating VIP expression. Human NB-1 neuroblastoma cells were applied to study PACAP regulated VIP gene...... in PACAP regulation of the FOS and VIP gene expressions suggest for the first time a role of FOS in PACAP-induced VIP gene expression in human NB-1 neuroblastoma cells. (C) 2009 Elsevier Ltd. All rights reserved Udgivelsesdato: 2009/10...

Regulation of MYCN expression in human neuroblastoma cells

International Nuclear Information System (INIS)

Jacobs, Joannes FM; Bokhoven, Hans van; Leeuwen, Frank N van; Hulsbergen-van de Kaa, Christina A; Vries, I Jolanda M de; Adema, Gosse J; Hoogerbrugge, Peter M; Brouwer, Arjan PM de

2009-01-01

Amplification of the MYCN gene in neuroblastoma (NB) is associated with a poor prognosis. However, MYCN-amplification does not automatically result in higher expression of MYCN in children with NB. We hypothesized that the discrepancy between MYCN gene expression and prognosis in these children might be explained by the expression of either MYCN-opposite strand (MYCNOS) or the shortened MYCN-isoform (ΔMYCN) that was recently identified in fetal tissues. Both MYCNOS and ΔMYCN are potential inhibitors of MYCN either at the mRNA or at the protein level. Expression of MYCN, MYCNOS and ΔMYCN was measured in human NB tissues of different stages. Transcript levels were quantified using a real-time reverse transcriptase polymerase chain reaction assay (QPCR). In addition, relative expression of these three transcripts was compared to the number of MYCN copies, which was determined by genomic real-time PCR (gQPCR). Both ΔMYCN and MYCNOS are expressed in all NBs examined. In NBs with MYCN-amplification, these transcripts are significantly higher expressed. The ratio of MYCN:ΔMYCN expression was identical in all tested NBs. This indicates that ΔMYCN and MYCN are co-regulated, which suggests that ΔMYCN is not a regulator of MYCN in NB. However, the ratio of MYCNOS:MYCN expression is directly correlated with NB disease stage (p = 0.007). In the more advanced NB stages and NBs with MYCN-amplification, relatively more MYCNOS is present as compared to MYCN. Expression of the antisense gene MYCNOS might be relevant to the progression of NB, potentially by directly inhibiting MYCN transcription by transcriptional interference at the DNA level. The MYCNOS:MYCN-ratio in NBs is significantly correlated with both MYCN-amplification and NB-stage. Our data indicate that in NB, MYCN expression levels might be influenced by MYCNOS but not by ΔMYCN

Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

Science.gov (United States)

Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han

2010-09-01

Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology.

Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

International Nuclear Information System (INIS)

Li-Ping, Xiong; Yu-Qiang, Ma; Lei-Han, Tang

2010-01-01

Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology

Impact of developmental lead exposure on splenic factors

International Nuclear Information System (INIS)

Kasten-Jolly, Jane; Heo, Yong; Lawrence, David A.

2010-01-01

Lead (Pb) is known to alter the functions of numerous organ systems, including the hematopoietic and immune systems. Pb can induce anemia and can lower host resistance to bacterial and viral infections. The anemia is due to Pb's inhibition of hemoglobin synthesis and Pb's induction of membrane changes, leading to early erythrocyte senescence. Pb also increases B-cell activation/proliferation and skews T-cell help (Th) toward Th2 subset generation. The specific mechanisms for many of the Pb effects are, as yet, not completely understood. Therefore, we performed gene expression analysis, via microarray, on RNA from the spleens of developmentally Pb-exposed mice, in order to gain further insight into these Pb effects. Splenic RNA microarray analysis indicated strong up-regulation of genes coding for proteolytic enzymes, lipases, amylase, and RNaseA. The data also showed that Pb affected the expression of many genes associated with innate immunity. Analysis of the microarray results via GeneSifter software indicated that Pb increased apoptosis, B-cell differentiation, and Th2 development. Direct up-regulation by Pb of expression of the gene encoding the heme-regulated inhibitor (HRI) suggested that Pb can decrease erythropoiesis by blocking globin mRNA translation. Pb's high elevation of digestive/catabolizing enzymes could generate immunogenic self peptides. With Pb's potential to induce new self-peptides and to enhance the expression of caspases, cytokines, and other immunomodulators, further evaluation of Pb's involvement in autoimmune phenomena, especially Th2-mediated autoantibody production, and alteration of organ system activities is warranted.

Notch-dependent epithelial fold determines boundary formation between developmental fields in the Drosophila antenna.

Science.gov (United States)

Ku, Hui-Yu; Sun, Y Henry

2017-07-01

Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields.

Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle

International Nuclear Information System (INIS)

Sherman, S.J.

1985-01-01

The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel

Conserved patterns of integrated developmental plasticity in a group of polyphenic tropical butterflies.

Science.gov (United States)

van Bergen, Erik; Osbaldeston, Dave; Kodandaramaiah, Ullasa; Brattström, Oskar; Aduse-Poku, Kwaku; Brakefield, Paul M

2017-02-27

Developmental plasticity is thought to have profound macro-evolutionary effects, for example, by increasing the probability of establishment in new environments and subsequent divergence into independently evolving lineages. In contrast to plasticity optimized for individual traits, phenotypic integration, which enables a concerted response of plastic traits to environmental variability, may affect the rate of local adaptation by constraining independent responses of traits to selection. Using a comparative framework, this study explores the evolution of reaction norms for a variety of life history and morphological traits across five related species of mycalesine butterflies from the Old World tropics. Our data indicate that an integrated response of a suite of key traits is shared amongst these species. Interestingly, the traits that make up the functional suite are all known to be regulated by ecdysteroid signalling in Bicyclus anynana, one of the species included in this study, suggesting the same underlying hormonal regulator may be conserved within this group of polyphenic butterflies. We also detect developmental thresholds for the expression of alternative morphs. The phenotypic plasticity of a broad suite of morphological and life history traits is integrated and shared among species from three geographically independent lineages of mycalesine butterflies, despite considerable periods of independent evolution and exposure to disparate environments. At the same time, we have detected examples of evolutionary change where independent traits show different patterns of reaction norms. We argue that the expression of more robust phenotypes may occur by shifting developmental thresholds beyond the boundaries of the typical environmental variation.

Identification of a subpopulation of marrow MSC-derived medullary adipocytes that express osteoclast-regulating molecules: marrow adipocytes express osteoclast mediators.

Directory of Open Access Journals (Sweden)

Vance Holt

Full Text Available Increased marrow medullary adipogenesis and an associated decrease in bone mineral density, usually observed in elderly individuals, is a common characteristic in senile osteoporosis. In this study we investigated whether cells of the medullary adipocyte lineage have the potential to directly support the formation of osteoclasts, whose activity in bone leads to bone degradation. An in vitro mesenchymal stem cell (MSC-derived medullary adipocyte lineage culture model was used to study the expression of the important osteoclast mediators RANKL, M-CSF, SDF-1, and OPG. We further assessed whether adipocytes at a specific developmental stage were capable of supporting osteoclast-like cell formation in culture. In vitro MSC-derived medullary adipocytes showed an mRNA and protein expression profile of M-CSF, RANKL, and OPG that was dependent on its developmental/metabolic stage. Furthermore, RANKL expression was observed in MSC-derived adipocytes that were at a distinct lineage stage and these cells were also capable of supporting osteoclast-like cell formation in co-cultures with peripheral blood mononuclear cells. These results suggest a connection between medullary adipocytes and osteoclast formation in vivo and may have major significance in regards to the mechanisms of decreased bone density in senile osteoporosis.

Tropoelastin regulates chemokine expression in fibroblasts in Costello syndrome

International Nuclear Information System (INIS)

Tatano, Yutaka; Fujinawa, Reiko; Kozutsumi, Yasunori; Takahashi, Tsutomu; Tsuji, Daisuke; Takeuchi, Naohiro; Tsuta, Kohji; Takada, Goro; Sakuraba, Hitoshi; Itoh, Kohji

2008-01-01

Costello syndrome is a multiple congenital anomaly associated with growth and mental retardation, cardiac and skeletal anomalies, and a predisposition to develop neoplasia. Comprehensive expression analysis revealed remarkable up-regulation of several cytokines and chemokines including Gro family proteins, interleukin-1β (IL-1β), IL-8 and MCP-1 but down-regulation of extracellular matrix components including collagens and proteoglycans of skin fibroblasts derived from a Japanese Costello syndrome patient characterized by significantly reduced tropoelastin mRNA, impaired elastogenesis and enhanced cell proliferation. In contrast, decreases in these chemokines and IL-1β expression were observed in Costello fibroblastic cell lines stably expressing the bovine tropoelastin (btEln) gene and in restored elastic fibers. These results strongly suggest that the human TE gene (ELN) transfer could be applicable for the gene therapy of a group of Costello syndrome patients with reduced ELN gene expression

Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma.

Science.gov (United States)

Xi, Ting; Zhang, Guizhi

2017-02-01

Understanding the molecular mechanisms represents an important step in the development of diagnostic and therapeutic measures of esophagus adenocarcinoma (NOS). The objective of this study is to identify the epigenetic regulation on gene expression in NOS, shedding light on the molecular mechanisms of NOS. In this study, 78 patients with NOS were included and the data of mRNA, miRNA and DNA methylation of were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis between NOS and controls was performed in terms of gene expression, miRNA expression, and DNA methylation. Bioinformatic analysis was followed to explore the regulation mechanisms of miRNA and DNA methylationon gene expression. Totally, up to 1320 differentially expressed genes (DEGs) and 32 differentially expressed miRNAs were identified. 240 DEGs that were not only the target genes but also negatively correlated with the screened differentially expressed miRNAs. 101 DEGs were found to be highlymethylated in CpG islands. Then, 8 differentially methylated genes (DMGs) were selected, which showed down-regulated expression in NOS. Among of these genes, 6 genes including ADHFE1, DPP6, GRIA4, CNKSR2, RPS6KA6 and ZNF135 were target genes of differentially expressed miRNAs (hsa-mir-335, hsa-mir-18a, hsa-mir-93, hsa-mir-106b and hsa-mir-21). The identified altered miRNA, genes and DNA methylation site may be applied as biomarkers for diagnosis and prognosis of NOS. Copyright © 2016 Elsevier GmbH. All rights reserved.

Regulation of pyruvate dehydrogenase kinase expression by the farnesoid X receptor

International Nuclear Information System (INIS)

Savkur, Rajesh S.; Bramlett, Kelli S.; Michael, Laura F.; Burris, Thomas P.

2005-01-01

The pyruvate dehydrogenase complex (PDC) functions as an important junction in intermediary metabolism by influencing the utilization of fat versus carbohydrate as a source of fuel. Activation of PDC is achieved by phosphatases, whereas, inactivation is catalyzed by pyruvate dehydrogenase kinases (PDKs). The expression of PDK4 is highly regulated by the glucocorticoid and peroxisome proliferator-activated receptors. We demonstrate that the farnesoid X receptor (FXR; NR1H4), which regulates a variety of genes involved in lipoprotein metabolism, also regulates the expression of PDK4. Treatment of rat hepatoma cells as well as human primary hepatocytes with FXR agonists stimulates the expression of PDK4 to levels comparable to those obtained with glucocorticoids. In addition, treatment of mice with an FXR agonist significantly increased hepatic PDK4 expression, while concomitantly decreasing plasma triglyceride levels. Thus, activation of FXR may suppress glycolysis and enhance oxidation of fatty acids via inactivation of the PDC by increasing PDK4 expression

Developmental programming: gestational bisphenol-A treatment alters trajectory of fetal ovarian gene expression.

Science.gov (United States)

Veiga-Lopez, Almudena; Luense, Lacey J; Christenson, Lane K; Padmanabhan, Vasantha

2013-05-01

Bisphenol-A (BPA), a ubiquitous environmental endocrine disrupting chemical, is a component of polycarbonate plastic and epoxy resins. Because of its estrogenic properties, there is increasing concern relative to risks from exposures during critical periods of early organ differentiation. Prenatal BPA treatment in sheep results in low birth weight, hypergonadotropism, and ovarian cycle disruptions. This study tested the hypothesis that gestational exposure to bisphenol A, at an environmentally relevant dose, induces early perturbations in the ovarian transcriptome (mRNA and microRNA). Pregnant Suffolk ewes were treated with bisphenol A (0.5 mg/kg, sc, daily, produced ∼2.6 ng/mL of unconjugated BPA in umbilical arterial samples of BPA treated fetuses approaching median levels of BPA measured in maternal circulation) from days 30 to 90 of gestation. Expression of steroidogenic enzymes, steroid/gonadotropin receptors, key ovarian regulators, and microRNA biogenesis components were measured by RT-PCR using RNA derived from fetal ovaries collected on gestational days 65 and 90. An age-dependent effect was evident in most steroidogenic enzymes, steroid receptors, and key ovarian regulators. Prenatal BPA increased Cyp19 and 5α-reductase expression in day 65, but not day 90, ovaries. Fetal ovarian microRNA expression was altered by prenatal BPA with 45 down-regulated (>1.5-fold) at day 65 and 11 down-regulated at day 90 of gestation. These included microRNAs targeting Sry-related high-mobility-group box (SOX) family genes, kit ligand, and insulin-related genes. The results of this study demonstrate that exposure to BPA at an environmentally relevant dose alters fetal ovarian steroidogenic gene and microRNA expression of relevance to gonadal differentiation, folliculogenesis, and insulin homeostasis.

Steroidal regulation of Ihh and Gli1 expression in the rat uterus.

Science.gov (United States)

Kubota, Kaiyu; Yamauchi, Nobuhiko; Yamagami, Kazuki; Nishimura, Sho; Gobaru, Takafumi; Yamanaka, Ken-ichi; Wood, Chris; Soh, Tomoki; Takahashi, Masashi; Hattori, Masa-aki

2010-05-01

Ovarian steroid hormones, progesterone (P4), and estradiol (E2) strictly regulate the endometrial tissue remodeling required for successful embryo implantation. Indian hedgehog (Ihh) is up-regulated by P4 and critically mediates uterine receptivity in the mouse. However, the regulation of Ihh expression during the implantation period still remains unclear. The present study was conducted to elucidate the mechanism of the steroidal regulation in the expression of Ihh and Gli1, the mediator of the Ihh pathway. Ihh mRNA was expressed in the rat uterus on 3.5-5.5 days post-coitus (dpc), while Gli1 expression transiently increased at 3.5 dpc but decreased significantly on 5.5 dpc (P Ihh was induced by the implantation-induced E2 treatment in the primed rat uterus. In contrast, expression of Gli1 was significantly decreased by E2 treatment (P = 0.016). In the case of ICI182.780 (ICI) treatment, Ihh expression was eliminated by ICI, whilst Gli1 expression increased. These results suggest that Ihh expression is maintained at a high level until the initiation of implantation, while the expression of Gli1 is decreased just prior to the initiation of implantation depending on the E2 action. This observation aids in the understanding of the Ihh signaling pathway mediating uterine remodeling for implantation.

Regulation of methane genes and genome expression

Energy Technology Data Exchange (ETDEWEB)

John N. Reeve

2009-09-09

At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

Human developmental enhancers conserved between deuterostomes and protostomes.

Directory of Open Access Journals (Sweden)

Shoa L Clarke

Full Text Available The identification of homologies, whether morphological, molecular, or genetic, is fundamental to our understanding of common biological principles. Homologies bridging the great divide between deuterostomes and protostomes have served as the basis for current models of animal evolution and development. It is now appreciated that these two clades share a common developmental toolkit consisting of conserved transcription factors and signaling pathways. These patterning genes sometimes show common expression patterns and genetic interactions, suggesting the existence of similar or even conserved regulatory apparatus. However, previous studies have found no regulatory sequence conserved between deuterostomes and protostomes. Here we describe the first such enhancers, which we call bilaterian conserved regulatory elements (Bicores. Bicores show conservation of sequence and gene synteny. Sequence conservation of Bicores reflects conserved patterns of transcription factor binding sites. We predict that Bicores act as response elements to signaling pathways, and we show that Bicores are developmental enhancers that drive expression of transcriptional repressors in the vertebrate central nervous system. Although the small number of identified Bicores suggests extensive rewiring of cis-regulation between the protostome and deuterostome clades, additional Bicores may be revealed as our understanding of cis-regulatory logic and sample of bilaterian genomes continue to grow.

Regulation of hepatic PPARγ2 and lipogenic gene expression by melanocortin

International Nuclear Information System (INIS)

Poritsanos, Nicole J.; Wong, Davie; Vrontakis, Maria E.; Mizuno, Tooru M.

2008-01-01

The central melanocortin system regulates hepatic lipid metabolism. Hepatic lipogenic gene expression is regulated by transcription factors including sterol regulatory element-binding protein 1c (SREBP-1c), carbohydrate responsive element-binding protein (ChREBP), and peroxisome proliferator-activated receptor γ2 (PPARγ2). However, it is unclear if central melanocortin signaling regulates hepatic lipogenic gene expression through the activation of these transcription factors. To delineate the molecular mechanisms by which the melanocortin system regulates hepatic lipid metabolism, we examined the effect of intracerebroventricular injection of SHU9119, a melanocortin receptor antagonist, on hepatic expression levels of genes involved in lipid metabolism in mice. SHU9119 treatment increased hepatic triglyceride content and mRNA levels of lipogenic genes, SREBP-1c, and PPARγ2, whereas it did not cause any changes in hepatic ChREBP mRNA levels. These findings suggest that reduced central melanocortin signaling increases hepatic lipid deposition by stimulating hepatic lipogenic gene expression at least partly through the activation of SREBP-1c and PPARγ2

Klf8 regulates left-right asymmetric patterning through modulation of Kupffer's vesicle morphogenesis and spaw expression.

Science.gov (United States)

Lin, Che-Yi; Tsai, Ming-Yuan; Liu, Yu-Hsiu; Lu, Yu-Fen; Chen, Yi-Chung; Lai, Yun-Ren; Liao, Hsin-Chi; Lien, Huang-Wei; Yang, Chung-Hsiang; Huang, Chang-Jen; Hwang, Sheng-Ping L

2017-07-17

Although vertebrates are bilaterally symmetric organisms, their internal organs are distributed asymmetrically along a left-right axis. Disruption of left-right axis asymmetric patterning often occurs in human genetic disorders. In zebrafish embryos, Kupffer's vesicle, like the mouse node, breaks symmetry by inducing asymmetric expression of the Nodal-related gene, spaw, in the left lateral plate mesoderm (LPM). Spaw then stimulates transcription of itself and downstream genes, including lft1, lft2, and pitx2, specifically in the left side of the diencephalon, heart and LPM. This developmental step is essential to establish subsequent asymmetric organ positioning. In this study, we evaluated the role of krüppel-like factor 8 (klf8) in regulating left-right asymmetric patterning in zebrafish embryos. Zebrafish klf8 expression was disrupted by both morpholino antisense oligomer-mediated knockdown and a CRISPR-Cas9 system. Whole-mount in situ hybridization was conducted to evaluate gene expression patterns of Nodal signalling components and the positions of heart and visceral organs. Dorsal forerunner cell number was evaluated in Tg(sox17:gfp) embryos and the length and number of cilia in Kupffer's vesicle were analyzed by immunocytochemistry using an acetylated tubulin antibody. Heart jogging, looping and visceral organ positioning were all defective in zebrafish klf8 morphants. At the 18-22 s stages, klf8 morphants showed reduced expression of genes encoding Nodal signalling components (spaw, lft1, lft2, and pitx2) in the left LPM, diencephalon, and heart. Co-injection of klf8 mRNA with klf8 morpholino partially rescued spaw expression. Furthermore, klf8 but not klf8△zf overexpressing embryos showed dysregulated bilateral expression of Nodal signalling components at late somite stages. At the 10s stage, klf8 morphants exhibited reductions in length and number of cilia in Kupffer's vesicle, while at 75% epiboly, fewer dorsal forerunner cells were observed

Emotional Expressivity and Emotion Regulation: Relation to Academic Functioning among Elementary School Children

Science.gov (United States)

Kwon, Kyongboon; Hanrahan, Amanda R.; Kupzyk, Kevin A.

2017-01-01

We examined emotional expressivity (i.e., happiness, sadness, and anger) and emotion regulation (regulation of exuberance, sadness, and anger) as they relate to academic functioning (motivation, engagement, and achievement). Also, we tested the premise that emotional expressivity and emotion regulation are indirectly associated with achievement…

Hemodynamic forces regulate developmental patterning of atrial conduction.

Directory of Open Access Journals (Sweden)

Michael C Bressan

Full Text Available Anomalous action potential conduction through the atrial chambers of the heart can lead to severe cardiac arrhythmia. To date, however, little is known regarding the mechanisms that pattern proper atrial conduction during development. Here we demonstrate that atrial muscle functionally diversifies into at least two heterogeneous subtypes, thin-walled myocardium and rapidly conducting muscle bundles, during a developmental window just following cardiac looping. During this process, atrial muscle bundles become enriched for the fast conduction markers Cx40 and Nav1.5, similar to the precursors of the fast conduction Purkinje fiber network located within the trabeculae of the ventricles. In contrast to the ventricular trabeculae, however, atrial muscle bundles display an increased proliferation rate when compared to the surrounding myocardium. Interestingly, mechanical loading of the embryonic atrial muscle resulted in an induction of Cx40, Nav1.5 and the cell cycle marker Cyclin D1, while decreasing atrial pressure via in vivo ligation of the vitelline blood vessels results in decreased atrial conduction velocity. Taken together, these data establish a novel model for atrial conduction patterning, whereby hemodynamic stretch coordinately induces proliferation and fast conduction marker expression, which in turn promotes the formation of large diameter muscle bundles to serve as preferential routes of conduction.

CDKL5 expression is modulated during neuronal development and its subcellular distribution is tightly regulated by the C-terminal tail.

Science.gov (United States)

Rusconi, Laura; Salvatoni, Lisa; Giudici, Laura; Bertani, Ilaria; Kilstrup-Nielsen, Charlotte; Broccoli, Vania; Landsberger, Nicoletta

2008-10-31

Mutations in the human X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been identified in patients with Rett syndrome (RTT), West syndrome, and X-linked infantile spasms, sharing the common feature of mental retardation and early seizures. CDKL5 is a rather uncharacterized kinase, but its involvement in RTT seems to be explained by the fact that it works upstream of MeCP2, the main cause of Rett syndrome. To understand the role of this kinase for nervous system functions and to address if molecular mechanisms are involved in regulating its distribution and activity, we studied the ontogeny of CDKL5 expression in developing mouse brains by immunostaining and Western blotting. The expression profile of CDKL5 was compared with that of MeCP2. The two proteins share a general expression profile in the adult mouse brain, but CDKL5 levels appear to be highly modulated at the regional level. Its expression is strongly induced in early postnatal stages, and in the adult brain CDKL5 is present in mature neurons, but not in astroglia. Interestingly, the presence of CDKL5 in the cell nucleus varies at the regional level of the adult brain and is developmentally regulated. CDKL5 shuttles between the cytoplasm and the nucleus and the C-terminal tail is involved in localizing the protein to the cytoplasm in a mechanism depending on active nuclear export. Accordingly, Rett derivatives containing disease-causing truncations of the C terminus are constitutively nuclear, suggesting that they might act as gain of function mutations in this cellular compartment.

Identification of developmentally regulated PCP-responsive non-coding RNA, prt6, in the rat thalamus.

Directory of Open Access Journals (Sweden)

Hironao Takebayashi

Full Text Available Schizophrenia and similar psychoses induced by NMDA-type glutamate receptor antagonists, such as phencyclidine (PCP and ketamine, usually develop after adolescence. Moreover, adult-type behavioral disturbance following NMDA receptor antagonist application in rodents is observed after a critical period at around 3 postnatal weeks. These observations suggest that the schizophrenic symptoms caused by and psychotomimetic effects of NMDA antagonists require the maturation of certain brain neuron circuits and molecular networks, which differentially respond to NMDA receptor antagonists across adolescence and the critical period. From this viewpoint, we have identified a novel developmentally regulated phencyclidine-responsive transcript from the rat thalamus, designated as prt6, as a candidate molecule involved in the above schizophrenia-related systems using a DNA microarray technique. The transcript is a non-coding RNA that includes sequences of at least two microRNAs, miR132 and miR212, and is expressed strongly in the brain and testis, with trace or non-detectable levels in the spleen, heart, liver, kidney, lung and skeletal muscle, as revealed by Northern blot analysis. The systemic administration of PCP (7.5 mg/kg, subcutaneously (s.c. significantly elevated the expression of prt6 mRNA in the thalamus at postnatal days (PD 32 and 50, but not at PD 8, 13, 20, or 24 as compared to saline-treated controls. At PD 50, another NMDA receptor antagonist, dizocilpine (0.5 mg/kg, s.c., and a schizophrenomimetic dopamine agonist, methamphetamine (4.8 mg/kg, s.c., mimicked a significant increase in the levels of thalamic prt6 mRNAs, while a D2 dopmamine receptor antagonist, haloperidol, partly inhibited the increasing influence of PCP on thalamic prt6 expression without its own effects. These data indicate that prt6 may be involved in the pathophysiology of the onset of drug-induced schizophrenia-like symptoms and schizophrenia through the possible

A retinoblastoma orthologue is a major regulator of S-phase, mitotic, and developmental gene expression in Dictyostelium.

Directory of Open Access Journals (Sweden)

Kimchi Strasser

Full Text Available The retinoblastoma tumour suppressor, Rb, has two major functions. First, it represses genes whose products are required for S-phase entry and progression thus stabilizing cells in G1. Second, Rb interacts with factors that induce cell-cycle exit and terminal differentiation. Dictyostelium lacks a G1 phase in its cell cycle but it has a retinoblastoma orthologue, rblA.Using microarray analysis and mRNA-Seq transcriptional profiling, we show that RblA strongly represses genes whose products are involved in S phase and mitosis. Both S-phase and mitotic genes are upregulated at a single point in late G2 and again in mid-development, near the time when cell cycling is reactivated. RblA also activates a set of genes unique to slime moulds that function in terminal differentiation.Like its mammalian counterpart Dictyostelium, RblA plays a dual role, regulating cell-cycle progression and transcriptional events leading to terminal differentiation. In the absence of a G1 phase, however, RblA functions in late G2 controlling the expression of both S-phase and mitotic genes.

Interpersonal Stress Regulation and the Development of Anxiety Disorders: An Attachment-Based Developmental Framework

Science.gov (United States)

Nolte, Tobias; Guiney, Jo; Fonagy, Peter; Mayes, Linda C.; Luyten, Patrick

2011-01-01

Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the etiology and maintenance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework. The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety, and activation of the attachment system. This interplay directly affects the development of social–cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualized as the key organizer of a complex interplay between genetic, environmental, and epigenetic contributions to the development of anxiety disorders – a multifactorial etiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterized by hyperactivation strategies in the face of anxiety. The cumulative allostatic load and subsequent “wear and tear” effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments are outlined. PMID

DMBT1 expression is down-regulated in breast cancer

DEFF Research Database (Denmark)

Braidotti, P; Nuciforo, P G; Mollenhauer, J

2004-01-01

and hyperplastic mammary cells positive with DMBTh12 were also MCM5-positive. CONCLUSIONS: The redistribution and up-regulation of DMBT1 in normal and hyperplastic tissues flanking malignant tumours and its down-regulation in carcinomas suggests a potential role in breast cancer. Moreover, the concomitant......BACKGROUND: We studied the expression of DMBT1 (deleted in malignant brain tumor 1), a putative tumor suppressor gene, in normal, proliferative, and malignant breast epithelium and its possible relation to cell cycle. METHODS: Sections from 17 benign lesions and 55 carcinomas were immunostained...... expression was down-regulated in the cancerous lesions compared to the normal and/or hyperplastic epithelium adjacent to carcinomas (3/55 positive carcinomas versus 33/42 positive normal/hyperplastic epithelia; p = 0.0001). In 72% of cases RT-PCR confirmed immunohistochemical results. Most of normal...

SREBP-1c regulates glucose-stimulated hepatic clusterin expression

Energy Technology Data Exchange (ETDEWEB)

Kim, Gukhan [Department of Pharmacology, Asan Medical Center, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Kim, Geun Hyang; Oh, Gyun-Sik; Yoon, Jin [Department of Pharmacology, Asan Medical Center, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Bio-Medical Institute of Technology, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Kim, Hae Won [Department of Pharmacology, Asan Medical Center, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Kim, Min-Seon [Department of Internal Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Kim, Seung-Whan, E-mail: swkim7@amc.seoul.kr [Department of Pharmacology, Asan Medical Center, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of); Bio-Medical Institute of Technology, University of Ulsan College of Medicine, Seoul 138-736 (Korea, Republic of)

2011-05-20

Highlights: {yields} This is the first report to show nutrient-regulated clusterin expression. {yields} Clusterin expression in hepatocytes was increased by high glucose concentration. {yields} SREBP-1c is directly involved in the transcriptional activation of clusterin by glucose. {yields} This glucose-stimulated activation process is mediated through tandem E-box motifs. -- Abstract: Clusterin is a stress-response protein that is involved in diverse biological processes, including cell proliferation, apoptosis, tissue differentiation, inflammation, and lipid transport. Its expression is upregulated in a broad spectrum of diverse pathological states. Clusterin was recently reported to be associated with diabetes, metabolic syndrome, and their sequelae. However, the regulation of clusterin expression by metabolic signals was not addressed. In this study we evaluated the effects of glucose on hepatic clusterin expression. Interestingly, high glucose concentrations significantly increased clusterin expression in primary hepatocytes and hepatoma cell lines, but the conventional promoter region of the clusterin gene did not respond to glucose stimulation. In contrast, the first intronic region was transcriptionally activated by high glucose concentrations. We then defined a glucose response element (GlRE) of the clusterin gene, showing that it consists of two E-box motifs separated by five nucleotides and resembles carbohydrate response element (ChoRE). Unexpectedly, however, these E-box motifs were not activated by ChoRE binding protein (ChREBP), but were activated by sterol regulatory element binding protein-1c (SREBP-1c). Furthermore, we found that glucose induced recruitment of SREBP-1c to the E-box of the clusterin gene intronic region. Taken together, these results suggest that clusterin expression is increased by glucose stimulation, and SREBP-1c plays a crucial role in the metabolic regulation of clusterin.

Sex-Specificity of Mineralocorticoid Target Gene Expression during Renal Development, and Long-Term Consequences

Science.gov (United States)

Dumeige, Laurence; Storey, Caroline; Decourtye, Lyvianne; Nehlich, Melanie; Lhadj, Christophe; Viengchareun, Say; Kappeler, Laurent; Lombès, Marc; Martinerie, Laetitia

2017-01-01

Sex differences have been identified in various biological processes, including hypertension. The mineralocorticoid signaling pathway is an important contributor to early arterial hypertension, however its sex-specific expression has been scarcely studied, particularly with respect to the kidney. Basal systolic blood pressure (SBP) and heart rate (HR) were measured in adult male and female mice. Renal gene expression studies of major players of mineralocorticoid signaling were performed at different developmental stages in male and female mice using reverse transcription quantitative PCR (RT-qPCR), and were compared to those of the same genes in the lung, another mineralocorticoid epithelial target tissue that regulates ion exchange and electrolyte balance. The role of sex hormones in the regulation of these genes was also investigated in differentiated KC3AC1 renal cells. Additionally, renal expression of the 11 β-hydroxysteroid dehydrogenase type 2 (11βHSD2) protein, a regulator of mineralocorticoid specificity, was measured by immunoblotting and its activity was indirectly assessed in the plasma using liquid-chromatography coupled to mass spectrometry in tandem (LC-MSMS) method. SBP and HR were found to be significantly lower in females compared to males. This was accompanied by a sex- and tissue-specific expression profile throughout renal development of the mineralocorticoid target genes serum and glucocorticoid-regulated kinase 1 (Sgk1) and glucocorticoid-induced leucine zipper protein (Gilz), together with Hsd11b2, Finally, the implication of sex hormones in this sex-specific expression profile was demonstrated in vitro, most notably for Gilz mRNA expression. We demonstrate a tissue-specific, sex-dependent and developmentally-regulated pattern of expression of the mineralocorticoid pathway that could have important implications in physiology and pathology. PMID:28230786

Glucose Regulates the Expression of the Apolipoprotein A5 Gene

Energy Technology Data Exchange (ETDEWEB)

Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

2008-04-07

The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

YY1 positively regulates human UBIAD1 expression

International Nuclear Information System (INIS)

Funahashi, Nobuaki; Hirota, Yoshihisa; Nakagawa, Kimie; Sawada, Natumi; Watanabe, Masato; Suhara, Yoshitomo; Okano, Toshio

2015-01-01

Vitamin K is involved in bone formation and blood coagulation. Natural vitamin K compounds are composed of the plant form phylloquinone (vitamin K 1 ) and a series of bacterial menaquionones (MK-n; vitamin K 2 ). Menadione (vitamin K 3 ) is an artificial vitamin K compound. MK-4 contains 4-isoprenyl as a side group in the 2-methyl-1,4-naphthoquinone common structure and has various bioactivities. UbiA prenyltransferase domain containing 1 (UBIAD1 or TERE1) is the menaquinone-4 biosynthetic enzyme. UBIAD1 transcript expression significantly decreases in patients with prostate carcinoma and overexpressing UBIAD1 inhibits proliferation of a tumour cell line. UBIAD1 mRNA expression is ubiquitous in mouse tissues, and higher UBIAD1 mRNA expression levels are detected in the brain, heart, kidneys and pancreas. Several functions of UBIAD1 have been reported; however, regulation of the human UBIAD1 gene has not been elucidated. Here we report cloning and characterisation of the human UBIAD1 promoter. A 5′ rapid amplification of cDNA ends analysis revealed that the main transcriptional start site was 306 nucleotides upstream of the translation initiation codon. Deletion and mutation analyses revealed the functional importance of the YY1 consensus motif. Electrophoretic gel mobility shift and chromatin immunoprecipitation assays demonstrated that YY1 binds the UBIAD1 promoter in vitro and in vivo. In addition, YY1 small interfering RNA decreased endogenous UBIAD1 mRNA expression and UBIAD1 conversion activity. These results suggest that YY1 up-regulates UBIAD1 expression and UBIAD1 conversion activity through the UBIAD1 promoter. - Highlights: • We cloned the human UBIAD1 promoter. • The functional importance of the YY1 motif was identified in the UBIAD1 promoter. • YY1 binds the UBIAD1 promoter in vitro and in vivo. • Knockdown of YY1 significantly decreased UBIAD1 expression. • YY1 up-regulates UBIAD1 conversion activity through the UBIAD1 promoter

YY1 positively regulates human UBIAD1 expression

Energy Technology Data Exchange (ETDEWEB)

Funahashi, Nobuaki, E-mail: nfunahashi@ri.ncgm.go.jp [Department of Hygienic Sciences, Kobe Pharmaceutical University, Kobe (Japan); Department of Metabolic Disorder, Diabetes Research Center, Research Institute, National Center for Global Health and Medicine, Tokyo (Japan); Hirota, Yoshihisa [Department of Hygienic Sciences, Kobe Pharmaceutical University, Kobe (Japan); Faculty of Pharmaceutical Sciences, Suzuka University of Medical Science, Suzuka (Japan); Nakagawa, Kimie; Sawada, Natumi; Watanabe, Masato [Department of Hygienic Sciences, Kobe Pharmaceutical University, Kobe (Japan); Suhara, Yoshitomo [Department of Bioscience and Engineering, Shibaura Institute of Technology, Saitama (Japan); Okano, Toshio [Department of Hygienic Sciences, Kobe Pharmaceutical University, Kobe (Japan)

2015-05-01

Vitamin K is involved in bone formation and blood coagulation. Natural vitamin K compounds are composed of the plant form phylloquinone (vitamin K{sub 1}) and a series of bacterial menaquionones (MK-n; vitamin K{sub 2}). Menadione (vitamin K{sub 3}) is an artificial vitamin K compound. MK-4 contains 4-isoprenyl as a side group in the 2-methyl-1,4-naphthoquinone common structure and has various bioactivities. UbiA prenyltransferase domain containing 1 (UBIAD1 or TERE1) is the menaquinone-4 biosynthetic enzyme. UBIAD1 transcript expression significantly decreases in patients with prostate carcinoma and overexpressing UBIAD1 inhibits proliferation of a tumour cell line. UBIAD1 mRNA expression is ubiquitous in mouse tissues, and higher UBIAD1 mRNA expression levels are detected in the brain, heart, kidneys and pancreas. Several functions of UBIAD1 have been reported; however, regulation of the human UBIAD1 gene has not been elucidated. Here we report cloning and characterisation of the human UBIAD1 promoter. A 5′ rapid amplification of cDNA ends analysis revealed that the main transcriptional start site was 306 nucleotides upstream of the translation initiation codon. Deletion and mutation analyses revealed the functional importance of the YY1 consensus motif. Electrophoretic gel mobility shift and chromatin immunoprecipitation assays demonstrated that YY1 binds the UBIAD1 promoter in vitro and in vivo. In addition, YY1 small interfering RNA decreased endogenous UBIAD1 mRNA expression and UBIAD1 conversion activity. These results suggest that YY1 up-regulates UBIAD1 expression and UBIAD1 conversion activity through the UBIAD1 promoter. - Highlights: • We cloned the human UBIAD1 promoter. • The functional importance of the YY1 motif was identified in the UBIAD1 promoter. • YY1 binds the UBIAD1 promoter in vitro and in vivo. • Knockdown of YY1 significantly decreased UBIAD1 expression. • YY1 up-regulates UBIAD1 conversion activity through the UBIAD1

DMPD: Iron regulation of hepatic macrophage TNFalpha expression. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 11841920 Iron regulation of hepatic macrophage TNFalpha expression. Tsukamoto H. Fr...ee Radic Biol Med. 2002 Feb 15;32(4):309-13. (.png) (.svg) (.html) (.csml) Show Iron regulation of hepatic macrophage... TNFalpha expression. PubmedID 11841920 Title Iron regulation of hepatic macrophage TNFalpha expres

Developmental Deltamethrin Exposure Causes Persistent Changes in Dopaminergic Gene Expression, Neurochemistry, and Locomotor Activity in Zebrafish.

Science.gov (United States)

Kung, Tiffany S; Richardson, Jason R; Cooper, Keith R; White, Lori A

2015-08-01

Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25-0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3-72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Androgen-Dependent Regulation of Human MUC1 Mucin Expression

Directory of Open Access Journals (Sweden)

Stephen Mitchell

2002-01-01

Full Text Available MUC1 mucin is transcriptionally regulated by estrogen, progesterone, and glucocorticoids. Our objective was to determine whether androgen receptor. (20AR activation regulates expression of MUC1. The following breast and prostatic cell lines were phenotyped and grouped according to AR and MUC1protein expression: 1 AR+MUCi + [DAR17+19. (20AR transfectants of DU-145, ZR-75-1, MDA-MB-453, and T47D]; 2 AR-MUCi+ [DZeoi. (20AR- vector control, DU-145, BT20, MDA-MB231, and MCF7]; 3 AIR +MUCi -. (20LNCaP and LNCaP-r. Cell proliferation was determined using the MTT assay in the presence of synthetic androgen R1881, 0.1 pM to 1 µM. Cell surface MUC1expression was determined by flow cytometry in the presence or absence of oestradiol, medroxy progesterone acetate or R1881, with and without 4 hydroxy-flutamide. (204-OH, a nonsteroidal AR antagonist. The functional significance of MUC1expression was investigated with a cell-cell aggregation assay. Only AR+ MUC1 + cell lines showed a significant increase in MUC1expression with AR activation. (20P. (20range =.01 to .0001, reversed in the presence of 4-OHF. Cell proliferation was unaffected. Increased expression of MUC1was associated with a significant. (20P. (20range =.002 to .001 reduction in cell-cell adhesion. To our knowledge, this is the first description of androgen-dependent regulation of MUC1mucin. This is also functionally associated with decreased cell-cell adhesion, a recognised feature of progressive malignancy. These findings have important implications for physiological and pathological processes.

Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

Science.gov (United States)

Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

Transcriptional signatures of ancient floral developmental genetics in avocado (Persea americana; Lauraceae).

Science.gov (United States)

Chanderbali, André S; Albert, Victor A; Leebens-Mack, Jim; Altman, Naomi S; Soltis, Douglas E; Soltis, Pamela S

2009-06-02

The debate on the origin and evolution of flowers has recently entered the field of developmental genetics, with focus on the design of the ancestral floral regulatory program. Flowers can differ dramatically among angiosperm lineages, but in general, male and female reproductive organs surrounded by a sterile perianth of sepals and petals constitute the basic floral structure. However, the basal angiosperm lineages exhibit spectacular diversity in the number, arrangement, and structure of floral organs, whereas the evolutionarily derived monocot and eudicot lineages share a far more uniform floral ground plan. Here we show that broadly overlapping transcriptional programs characterize the floral transcriptome of the basal angiosperm Persea americana (avocado), whereas floral gene expression domains are considerably more organ specific in the model eudicot Arabidopsis thaliana. Our findings therefore support the "fading borders" model for organ identity determination in basal angiosperm flowers and extend it from the action of regulatory genes to downstream transcriptional programs. Furthermore, the declining expression of components of the staminal transcriptome in central and peripheral regions of Persea flowers concurs with elements of a previous hypothesis for developmental regulation in a gymnosperm "floral progenitor." Accordingly, in contrast to the canalized organ-specific regulatory apparatus of Arabidopsis, floral development may have been originally regulated by overlapping transcriptional cascades with fading gradients of influence from focal to bordering organs.

Synergistic and Dose-Controlled Regulation of Cellulase Gene Expression in Penicillium oxalicum.

Science.gov (United States)

Li, Zhonghai; Yao, Guangshan; Wu, Ruimei; Gao, Liwei; Kan, Qinbiao; Liu, Meng; Yang, Piao; Liu, Guodong; Qin, Yuqi; Song, Xin; Zhong, Yaohua; Fang, Xu; Qu, Yinbo

2015-09-01

Filamentous fungus Penicillium oxalicum produces diverse lignocellulolytic enzymes, which are regulated by the combinations of many transcription factors. Here, a single-gene disruptant library for 470 transcription factors was constructed and systematically screened for cellulase production. Twenty transcription factors (including ClrB, CreA, XlnR, Ace1, AmyR, and 15 unknown proteins) were identified to play putative roles in the activation or repression of cellulase synthesis. Most of these regulators have not been characterized in any fungi before. We identified the ClrB, CreA, XlnR, and AmyR transcription factors as critical dose-dependent regulators of cellulase expression, the core regulons of which were identified by analyzing several transcriptomes and/or secretomes. Synergistic and additive modes of combinatorial control of each cellulase gene by these regulatory factors were achieved, and cellulase expression was fine-tuned in a proper and controlled manner. With one of these targets, the expression of the major intracellular β-glucosidase Bgl2 was found to be dependent on ClrB. The Bgl2-deficient background resulted in a substantial gene activation by ClrB and proved to be closely correlated with the relief of repression mediated by CreA and AmyR during cellulase induction. Our results also signify that probing the synergistic and dose-controlled regulation mechanisms of cellulolytic regulators and using it for reconstruction of expression regulation network (RERN) may be a promising strategy for cellulolytic fungi to develop enzyme hyper-producers. Based on our data, ClrB was identified as focal point for the synergistic activation regulation of cellulase expression by integrating cellulolytic regulators and their target genes, which refined our understanding of transcriptional-regulatory network as a "seesaw model" in which the coordinated regulation of cellulolytic genes is established by counteracting activators and repressors.

RpoS induces expression of the Vibrio anguillarum quorum-sensing regulator VanT.

Science.gov (United States)

Weber, Barbara; Croxatto, Antony; Chen, Chang; Milton, Debra L

2008-03-01

In vibrios, regulation of the Vibrio harveyi-like LuxR transcriptional activators occurs post-transcriptionally via small regulatory RNAs (sRNAs) that destabilize the luxR mRNA at a low cell population, eliminating expression of LuxR. Expression of the sRNAs is modulated by the vibrio quorum-sensing phosphorelay systems. However, vanT mRNA, which encodes a LuxR homologue in Vibrio anguillarum, is abundant at low and high cell density, indicating that VanT expression may be regulated via additional mechanisms. In this study, Western analyses showed that VanT was expressed throughout growth with a peak of expression during late exponential growth. VanO induced partial destabilization of vanT mRNA via activation of at least one Qrr sRNA. Interestingly, the sigma factor RpoS significantly stabilized vanT mRNA and induced VanT expression during late exponential growth. This induction was in part due to RpoS repressing expression of Hfq, an RNA chaperone. RpoS is not part of the quorum-sensing regulatory cascade since RpoS did not regulate expression or activity of VanO, and RpoS was not regulated by VanO or VanT. VanT and RpoS were needed for survival following UV irradiation and for pigment and metalloprotease production, suggesting that RpoS works with the quorum-sensing systems to modulate expression of VanT, which regulates survival and stress responses.

Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

Science.gov (United States)

Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

1994-12-20

The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

A tale with a Twist: a developmental gene with potential relevance for metabolic dysfunction and inflammation in adipose tissue

Directory of Open Access Journals (Sweden)

Anca Dana Dobrian

2012-08-01

Full Text Available The Twist proteins (Twist-1 and -2 are highly conserved developmental proteins with key roles for the transcriptional regulation in mesenchymal cell lineages. They belong to the super-family of bHLH proteins and exhibit bi-functional roles as both activators and repressors of gene transcription. The Twist proteins are expressed at low levels in adult tissues but may become abundantly re-expressed in cells undergoing malignant transformation. This observation prompted extensive research on the roles of Twist proteins in cancer progression and metastasis. Very recent studies indicate a novel role for Twist-1 as a potential regulator of adipose tissue remodeling and inflammation. Several studies suggested that developmental genes are important determinants of obesity, fat distribution and remodeling capacity of different adipose depots. Twist-1 is abundantly and selectively expressed in the adult adipose tissue and its constitutive expression is significantly higher in subcutaneous vs. visceral fat in both mice and humans. Moreover, Twist1 expression is strongly correlated with BMI and insulin resistance in humans. However, the functional roles and transcriptional downstream targets of Twist1 in adipose tissue are largely unexplored. The purpose of this review is to highlight the major findings related to Twist1 expression in different fat depots and cellular components of adipose tissue and to discuss the potential mechanisms suggesting a role for Twist1 in adipose tissue metabolism, inflammation and remodeling.

Characterization of cucurbita maxima phloem serpin-1 (CmPS-1). A developmentally regulated elastase inhibitor.

Science.gov (United States)

Yoo, B C; Aoki, K; Xiang, Y; Campbell, L R; Hull, R J; Xoconostle-Cázares, B; Monzer, J; Lee, J Y; Ullman, D E; Lucas, W J

2000-11-10

We report on the molecular, biochemical, and functional characterization of Cucurbita maxima phloem serpin-1 (CmPS-1), a novel 42-kDa serine proteinase inhibitor that is developmentally regulated and has anti-elastase properties. CmPS-1 was purified to near homogeneity from C. maxima (pumpkin) phloem exudate and, based on microsequence analysis, the cDNA encoding CmPS-1 was cloned. The association rate constant (k(a)) of phloem-purified and recombinant His(6)-tagged CmPS-1 for elastase was 3.5 +/- 1.6 x 10(5) and 2.7 +/- 0.4 x 10(5) m(-)(1) s(-)(1), respectively. The fraction of complex-forming CmPS-1, X(inh), was estimated at 79%. CmPS-1 displayed no detectable inhibitory properties against chymotrypsin, trypsin, or thrombin. The elastase cleavage sites within the reactive center loop of CmPS-1 were determined to be Val(347)-Gly(348) and Val(350)-Ser(351) with a 3:2 molar ratio. In vivo feeding assays conducted with the piercing-sucking aphid, Myzus persicae, established a close correlation between the developmentally regulated increase in CmPS-1 within the phloem sap and the reduced ability of these insects to survive and reproduce on C. maxima. However, in vitro feeding experiments, using purified phloem CmPS-1, failed to demonstrate a direct effect on aphid survival. Likely roles of this novel phloem serpin in defense against insects/pathogens are discussed.

Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

Directory of Open Access Journals (Sweden)

Wobus Ulrich

2009-01-01

Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

Regulation of CD93 cell surface expression by protein kinase C isoenzymes.

Science.gov (United States)

Ikewaki, Nobunao; Kulski, Jerzy K; Inoko, Hidetoshi

2006-01-01

Human CD93, also known as complement protein 1, q subcomponent, receptor (C1qRp), is selectively expressed by cells with a myeloid lineage, endothelial cells, platelets, and microglia and was originally reported to be involved in the complement protein 1, q subcomponent (C1q)-mediated enhancement of phagocytosis. The intracellular molecular events responsible for the regulation of its expression on the cell surface, however, have not been determined. In this study, the effect of protein kinases in the regulation of CD93 expression on the cell surface of a human monocyte-like cell line (U937), a human NK-like cell line (KHYG-1), and a human umbilical vein endothelial cell line (HUV-EC-C) was investigated using four types of protein kinase inhibitors, the classical protein kinase C (cPKC) inhibitor Go6976, the novel PKC (nPKC) inhibitor Rottlerin, the protein kinase A (PKA) inhibitor H-89 and the protein tyrosine kinase (PTK) inhibitor herbimycin A at their optimum concentrations for 24 hr. CD93 expression was analyzed using flow cytometry and glutaraldehyde-fixed cellular enzyme-linked immunoassay (EIA) techniques utilizing a CD93 monoclonal antibody (mAb), mNI-11, that was originally established in our laboratory as a CD93 detection probe. The nPKC inhibitor Rottlerin strongly down-regulated CD93 expression on the U937 cells in a dose-dependent manner, whereas the other inhibitors had little or no effect. CD93 expression was down-regulated by Go6976, but not by Rottlerin, in the KHYG-1 cells and by both Rottlerin and Go6976 in the HUV-EC-C cells. The PKC stimulator, phorbol myristate acetate (PMA), strongly up-regulated CD93 expression on the cell surface of all three cell-lines and induced interleukin-8 (IL-8) production by the U937 cells and interferon-gamma (IFN-gamma) production by the KHYG-1 cells. In addition, both Go6976 and Rottlerin inhibited the up-regulation of CD93 expression induced by PMA and IL-8 or IFN-gamma production in the respective cell

Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-α

International Nuclear Information System (INIS)

Tsukasaki, Masayuki; Yamada, Atsushi; Suzuki, Dai; Aizawa, Ryo; Miyazono, Agasa; Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro; Morimura, Naoko; Yamamoto, Matsuo; Kamijo, Ryutaro

2011-01-01

Highlights: → TNF-α inhibits POEM gene expression. → Inhibition of POEM gene expression is caused by NF-κB activation by TNF-α. → Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-α. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-α (TNF-α), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-α-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-κB) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-α in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-α-induced inhibition of osteoblast differentiation. These results suggest that TNF-α inhibits POEM expression through the NF-κB signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-α.

Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}

Energy Technology Data Exchange (ETDEWEB)

Tsukasaki, Masayuki [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Aizawa, Ryo [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyazono, Agasa [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Morimura, Naoko [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)

2011-07-15

Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

Transcription regulation by the Mediator complex.

Science.gov (United States)

Soutourina, Julie

2018-04-01

Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

Developmental retardation, reduced fecundity, and modulated expression of the defensome in the intertidal copepod Tigriopus japonicus exposed to BDE-47 and PFOS

Energy Technology Data Exchange (ETDEWEB)

Han, Jeonghoon; Won, Eun-Ji; Lee, Min-Chul [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Seo, Jung Soo [Pathology Team, National Fisheries Research & Development Institute, Busan 619-902 (Korea, Republic of); Lee, Su-Jae [Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of)

2015-08-15

Highlights: • The repercussions of BDE-47 and PFOS were occurred on development and fecundity. • BDE-47 and PFOS can induce oxidative stress through the generation of ROS. • The expression of defensome was changed in response to BDE-47 and PFOS. • ROS-induced DNA damage in BDE-47 and PFOS exposure lead to apoptosis and DNA repair. - Abstract: 2,2′,4,4′-tetrabromodiphenyl ether (BDE-47) and perfluorooctane sulfonate (PFOS) are widely dispersed persistent organic pollutants (POPs) in the marine ecosystem. However, their toxic effects on marine organisms are still poorly understood. In this study, we investigated the effects of BDE-47 and PFOS on development and reproduction at the organismal level and reactive oxygen species (ROS) production and gene expression patterns of the defensome at the cellular level in the intertidal copepod Tigriopus japonicus. In copepods exposed to BDE-47 and PFOS, we observed developmental retardation and reduced fecundity, suggesting repercussions on in vivo endpoints through alterations to the normal molting and reproduction system of T. japonicus. BDE-47 and PFOS increased levels of ROS in T. japonicus in a concentration-dependent manner, indicating that POPs can induce oxidative stress through the generation of ROS. Additionally, transcript profiles of genes related to detoxification (e.g., CYPs), antioxidant functions (e.g., GST- sigma, catalase, MnSOD), apoptosis (e.g., p53, Rb), and cellular proliferation (e.g., PCNA) were modulated over 72 h in response to BDE-47 (120 μg/L) and PFOS (1000 μg/L). These findings indicate that BDE-47 and PFOS can induce oxidative stress-mediated DNA damage repair systems with transcriptional regulation of detoxification, antioxidant, and apoptosis-related genes, resulting in developmental retardation and reduced fecundity in the copepod T. japonicus.

Developmental retardation, reduced fecundity, and modulated expression of the defensome in the intertidal copepod Tigriopus japonicus exposed to BDE-47 and PFOS

International Nuclear Information System (INIS)

Han, Jeonghoon; Won, Eun-Ji; Lee, Min-Chul; Seo, Jung Soo; Lee, Su-Jae; Lee, Jae-Seong

2015-01-01

Highlights: • The repercussions of BDE-47 and PFOS were occurred on development and fecundity. • BDE-47 and PFOS can induce oxidative stress through the generation of ROS. • The expression of defensome was changed in response to BDE-47 and PFOS. • ROS-induced DNA damage in BDE-47 and PFOS exposure lead to apoptosis and DNA repair. - Abstract: 2,2′,4,4′-tetrabromodiphenyl ether (BDE-47) and perfluorooctane sulfonate (PFOS) are widely dispersed persistent organic pollutants (POPs) in the marine ecosystem. However, their toxic effects on marine organisms are still poorly understood. In this study, we investigated the effects of BDE-47 and PFOS on development and reproduction at the organismal level and reactive oxygen species (ROS) production and gene expression patterns of the defensome at the cellular level in the intertidal copepod Tigriopus japonicus. In copepods exposed to BDE-47 and PFOS, we observed developmental retardation and reduced fecundity, suggesting repercussions on in vivo endpoints through alterations to the normal molting and reproduction system of T. japonicus. BDE-47 and PFOS increased levels of ROS in T. japonicus in a concentration-dependent manner, indicating that POPs can induce oxidative stress through the generation of ROS. Additionally, transcript profiles of genes related to detoxification (e.g., CYPs), antioxidant functions (e.g., GST- sigma, catalase, MnSOD), apoptosis (e.g., p53, Rb), and cellular proliferation (e.g., PCNA) were modulated over 72 h in response to BDE-47 (120 μg/L) and PFOS (1000 μg/L). These findings indicate that BDE-47 and PFOS can induce oxidative stress-mediated DNA damage repair systems with transcriptional regulation of detoxification, antioxidant, and apoptosis-related genes, resulting in developmental retardation and reduced fecundity in the copepod T. japonicus

Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

Science.gov (United States)

Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping

2014-05-01

Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

Science.gov (United States)

Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

2018-05-01

Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

Pyrosequencing of Haliotis diversicolor transcriptomes: insights into early developmental molluscan gene expression.

Directory of Open Access Journals (Sweden)

Zi-Xia Huang

Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.

Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia.

Science.gov (United States)

Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J V; Schulz, Marcel H; Simon, Martin

2015-08-01

Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Linking children's neuropsychological processing of emotion with their knowledge of emotion expression regulation.

Science.gov (United States)

Watling, Dawn; Bourne, Victoria J

2007-09-01

Understanding of emotions has been shown to develop between the ages of 4 and 10 years; however, individual differences exist in this development. While previous research has typically examined these differences in terms of developmental and/or social factors, little research has considered the possible impact of neuropsychological development on the behavioural understanding of emotions. Emotion processing tends to be lateralised to the right hemisphere of the brain in adults, yet this pattern is not as evident in children until around the age of 10 years. In this study 136 children between 5 and 10 years were given both behavioural and neuropsychological tests of emotion processing. The behavioural task examined expression regulation knowledge (ERK) for prosocial and self-presentational hypothetical interactions. The chimeric faces test was given as a measure of lateralisation for processing positive facial emotion. An interaction between age and lateralisation for emotion processing was predictive of children's ERK for only the self-presentational interactions. The relationships between children's ERK and lateralisation for emotion processing changes across the three age groups, emerging as a positive relationship in the 10-year-olds. The 10-years-olds who were more lateralised to the right hemisphere for emotion processing tended to show greater understanding of the need for regulating negative emotions during interactions that would have a self-presentational motivation. This finding suggests an association between the behavioural and neuropsychological development of emotion processing.

Variance heterogeneity in Saccharomyces cerevisiae expression data: trans-regulation and epistasis.

Science.gov (United States)

Nelson, Ronald M; Pettersson, Mats E; Li, Xidan; Carlborg, Örjan

2013-01-01

Here, we describe the results from the first variance heterogeneity Genome Wide Association Study (VGWAS) on yeast expression data. Using this forward genetics approach, we show that the genetic regulation of gene-expression in the budding yeast, Saccharomyces cerevisiae, includes mechanisms that can lead to variance heterogeneity in the expression between genotypes. Additionally, we performed a mean effect association study (GWAS). Comparing the mean and variance heterogeneity analyses, we find that the mean expression level is under genetic regulation from a larger absolute number of loci but that a higher proportion of the variance controlling loci were trans-regulated. Both mean and variance regulating loci cluster in regulatory hotspots that affect a large number of phenotypes; a single variance-controlling locus, mapping close to DIA2, was found to be involved in more than 10% of the significant associations. It has been suggested in the literature that variance-heterogeneity between the genotypes might be due to genetic interactions. We therefore screened the multi-locus genotype-phenotype maps for several traits where multiple associations were found, for indications of epistasis. Several examples of two and three locus genetic interactions were found to involve variance-controlling loci, with reports from the literature corroborating the functional connections between the loci. By using a new analytical approach to re-analyze a powerful existing dataset, we are thus able to both provide novel insights to the genetic mechanisms involved in the regulation of gene-expression in budding yeast and experimentally validate epistasis as an important mechanism underlying genetic variance-heterogeneity between genotypes.

The expression of petunia strigolactone pathway genes is altered as part of the endogenous developmental program

Directory of Open Access Journals (Sweden)

Revel S M Drummond

2012-01-01

Full Text Available Analysis of mutants with increased branching has revealed the strigolactone synthesis/perception pathway which regulates branching in plants. However, whether variation in this well conserved developmental signalling system contributes to the unique plant architectures of different species is yet to be determined. We examined petunia orthologues of the Arabidopsis MAX1 and MAX2 genes to characterise their role in petunia architecture. A single orthologue of MAX1, PhMAX1 which encodes a cytochrome P450, was identified and was able to complement the max1 mutant of Arabidopsis. Petunia has two copies of the MAX2 gene, PhMAX2A and PhMAX2B which encode F-Box proteins. Differences in the transcript levels of these two MAX2-like genes suggest diverging functions. Unlike PhMAX2B, PhMAX2A mRNA levels increase as leaves age. Nonetheless, this gene functionally complements the Arabidopsis max2 mutant indicating that the biochemical activity of the PhMAX2A protein is not significantly different from MAX2. The expression of the petunia strigolactone pathway genes (PhCCD7, PhCCD8, PhMAX1, PhMAX2A, and PhMAX2B was then further investigated throughout the development of wild-type petunia plants. Three of these genes showed changes in mRNA levels over the development series. Alterations to the expression of these genes over time, or in different regions of the plant, may influence the branching growth habit of the plant. Alterations to strigolactone production and/or sensitivity could allow both subtle and dramatic changes to branching within and between species.

ERK1/2 mediates glucose-regulated POMC gene expression in hypothalamic neurons.

Science.gov (United States)

Zhang, Juan; Zhou, Yunting; Chen, Cheng; Yu, Feiyuan; Wang, Yun; Gu, Jiang; Ma, Lian; Ho, Guyu

2015-04-01

Hypothalamic glucose-sensing neurons regulate the expression of genes encoding feeding-related neuropetides POMC, AgRP, and NPY - the key components governing metabolic homeostasis. AMP-activated protein kinase (AMPK) is postulated to be the molecular mediator relaying glucose signals to regulate the expression of these neuropeptides. Whether other signaling mediator(s) plays a role is not clear. In this study, we investigated the role of ERK1/2 using primary hypothalamic neurons as the model system. The primary neurons were differentiated from hypothalamic progenitor cells. The differentiated neurons possessed the characteristic neuronal cell morphology and expressed neuronal post-mitotic markers as well as leptin-regulated orexigenic POMC and anorexigenic AgRP/NPY genes. Treatment of cells with glucose dose-dependently increased POMC and decreased AgRP/NPY expression with a concurrent suppression of AMPK phosphorylation. In addition, glucose treatment dose-dependently increased the ERK1/2 phosphorylation. Blockade of ERK1/2 activity with its specific inhibitor PD98059 partially (approximately 50%) abolished glucose-induced POMC expression, but had little effect on AgRP/NPY expression. Conversely, blockade of AMPK activity with its specific inhibitor produced a partial (approximately 50%) reversion of low-glucose-suppressed POMC expression, but almost completely blunted the low-glucose-induced AgRP/NPY expression. The results indicate that ERK1/2 mediated POMC but not AgRP/NPY expression. Confirming the in vitro findings, i.c.v. administration of PD98059 in rats similarly attenuated glucose-induced POMC expression in the hypothalamus, but again had little effect on AgRP/NPY expression. The results are indicative of a novel role of ERK1/2 in glucose-regulated POMC expression and offer new mechanistic insights into hypothalamic glucose sensing. © 2015 Society for Endocrinology.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

OpenAIRE

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

Synovial DKK1 expression is regulated by local glucocorticoid metabolism in inflammatory arthritis.

Science.gov (United States)

Hardy, Rowan; Juarez, Maria; Naylor, Amy; Tu, Jinwen; Rabbitt, Elizabeth H; Filer, Andrew; Stewart, Paul M; Buckley, Christopher D; Raza, Karim; Cooper, Mark S

2012-10-18

Inflammatory arthritis is associated with increased bone resorption and suppressed bone formation. The Wnt antagonist dickkopf-1 (DKK1) is secreted by synovial fibroblasts in response to inflammation and this protein has been proposed to be a master regulator of bone remodelling in inflammatory arthritis. Local glucocorticoid production is also significantly increased during joint inflammation. Therefore, we investigated how locally derived glucocorticoids and inflammatory cytokines regulate DKK1 synthesis in synovial fibroblasts during inflammatory arthritis. We examined expression and regulation of DKK1 in primary cultures of human synovial fibroblasts isolated from patients with inflammatory arthritis. The effect of TNFα, IL-1β and glucocorticoids on DKK1 mRNA and protein expression was examined by real-time PCR and ELISA. The ability of inflammatory cytokine-induced expression of the glucocorticoid-activating enzyme 11beta-hydroxysteroid dehydrogenase type 1 (11β-HSD1) to sensitise fibroblasts to endogenous glucocorticoids was explored. Global expression of Wnt signalling and target genes in response to TNFα and glucocorticoids was assessed using a custom array. DKK1 expression in human synovial fibroblasts was directly regulated by glucocorticoids but not proinflammatory cytokines. Glucocorticoids, but not TNFα, regulated expression of multiple Wnt agonists and antagonists in favour of inhibition of Wnt signalling. However, TNFα and IL-1β indirectly stimulated DKK1 production through increased expression of 11β-HSD1. These results demonstrate that in rheumatoid arthritis synovial fibroblasts, DKK1 expression is directly regulated by glucocorticoids rather than TNFα. Consequently, the links between synovial inflammation, altered Wnt signalling and bone remodelling are not direct but are dependent on local activation of endogenous glucocorticoids.

Developmental plasticity: re-conceiving the genotype.

Science.gov (United States)

Sultan, Sonia E

2017-10-06

In recent decades, the phenotype of an organism (i.e. its traits and behaviour) has been studied as the outcome of a developmental 'programme' coded in its genotype. This deterministic view is implicit in the Modern Synthesis approach to adaptive evolution as a sorting process among genetic variants. Studies of developmental pathways have revealed that genotypes are in fact differently expressed depending on environmental conditions. Accordingly, the genotype can be understood as a repertoire of potential developmental outcomes or norm of reaction. Reconceiving the genotype as an environmental response repertoire rather than a fixed developmental programme leads to three critical evolutionary insights. First, plastic responses to specific conditions often comprise functionally appropriate trait adjustments, resulting in an individual-level, developmental mode of adaptive variation. Second, because genotypes are differently expressed depending on the environment, the genetic diversity available to natural selection is itself environmentally contingent. Finally, environmental influences on development can extend across multiple generations via cytoplasmic and epigenetic factors transmitted to progeny individuals, altering their responses to their own, immediate environmental conditions and, in some cases, leading to inherited but non-genetic adaptations. Together, these insights suggest a more nuanced understanding of the genotype and its evolutionary role, as well as a shift in research focus to investigating the complex developmental interactions among genotypes, environments and previous environments.

The Rat Homolog of the Schizophrenia Susceptibility Gene ZNF804A Is Highly Expressed during Brain Development, Particularly in Growth Cones

DEFF Research Database (Denmark)

Hinna, Katja Hvid; Rich, Karen; Fex Svenningsen, Åsa

2015-01-01

it decreases towards adult levels. This time point is developmentally the equivalent to the second trimester of fetal development in humans. An exception to this expression pattern is the hippocampus where the expression of Zfp804A appears to increase again in the adult brain. Using laser capture...... developmental mechanisms are suggested in the pathophysiology for schizophrenia, expression of Zfp804A, the rat homolog of ZNF804A, was investigated in the developing rat brain. We found that expression of Zfp804A in most brain regions is developmentally regulated and peaks around birth, where after...... expression was therefore investigated with immunochemistry in such cultures. Interestingly, before day 4, the protein is mostly found in the perinuclear region of the cell but at day 4, ZFP804A was instead found throughout the cell and particularly in the growth cones. In conclusion we demonstrate that Zfp...

Odor memories regulate olfactory receptor expression in the sensory periphery.

Science.gov (United States)

Claudianos, Charles; Lim, Julianne; Young, Melanie; Yan, Shanzhi; Cristino, Alexandre S; Newcomb, Richard D; Gunasekaran, Nivetha; Reinhard, Judith

2014-05-01

Odor learning induces structural and functional modifications throughout the olfactory system, but it is currently unknown whether this plasticity extends to the olfactory receptors (Or) in the sensory periphery. Here, we demonstrate that odor learning induces plasticity in olfactory receptor expression in the honeybee, Apis mellifera. Using quantitative RT-PCR analysis, we show that six putative floral scent receptors were differentially expressed in the bee antennae depending on the scent environment that the bees experienced. Or151, which we characterized using an in vitro cell expression system as a broadly tuned receptor binding floral odorants such as linalool, and Or11, the specific receptor for the queen pheromone 9-oxo-decenoic acid, were significantly down-regulated after honeybees were conditioned with the respective odorants in an olfactory learning paradigm. Electroantennogram recordings showed that the neural response of the antenna was similarly reduced after odor learning. Long-term odor memory was essential for inducing these changes, suggesting that the molecular mechanisms involved in olfactory memory also regulate olfactory receptor expression. Our study demonstrates for the first time that olfactory receptor expression is experience-dependent and modulated by scent conditioning, providing novel insight into how molecular regulation at the periphery contributes to plasticity in the olfactory system. © 2014 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

CFP1 Regulates Histone H3K4 Trimethylation and Developmental Potential in Mouse Oocytes

Directory of Open Access Journals (Sweden)

Chao Yu

2017-08-01

Full Text Available Trimethylation of histone H3 at lysine-4 (H3K4me3 is associated with eukaryotic gene promoters and poises their transcriptional activation during development. To examine the in vivo function of H3K4me3 in the absence of DNA replication, we deleted CXXC finger protein 1 (CFP1, the DNA-binding subunit of the SETD1 histone H3K4 methyltransferase, in developing oocytes. We find that CFP1 is required for H3K4me3 accumulation and the deposition of histone variants onto chromatin during oocyte maturation. Decreased H3K4me3 in oocytes caused global downregulation of transcription activity. Oocytes lacking CFP1 failed to complete maturation and were unable to gain developmental competence after fertilization, due to defects in cytoplasmic lattice formation, meiotic division, and maternal-zygotic transition. Our study highlights the importance of H3K4me3 in continuous histone replacement for transcriptional regulation, chromatin remodeling, and normal developmental progression in a non-replicative system.

Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

Directory of Open Access Journals (Sweden)

Lydia J R Hunter

Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

Interpersonal stress regulation and the development of anxiety disorders: an attachment-based developmental framework

Directory of Open Access Journals (Sweden)

Tobias eNolte

2011-09-01

Full Text Available Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the aetiology and maintainance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework.The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety and activation of the attachment system. This interplay directly affects the development of social cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualised as the key organiser of a complex interplay between genetic, environmental and epigentic contributions to the development of anxiety disorders – a multifactorial aetiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterised by hyperactivation strategies in the face of anxiety.In the model, the cumulative allostatic load and subsequent wear and tear effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments

Serial analysis of gene expression in the silkworm, Bombyx mori.

Science.gov (United States)

Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

2005-08-01

The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

General anaesthetics do not impair developmental expression of the KCC2 potassium-chloride cotransporter in neonatal rats during the brain growth spurt

KAUST Repository

Lacoh, Claudia Marvine

2013-03-26

BackgroundThe developmental transition from depolarizing to hyperpolarizing γ-aminobutyric acid-mediated neurotransmission is primarily mediated by an increase in the amount of the potassium-chloride cotransporter KCC2 during early postnatal life. However, it is not known whether early neuronal activity plays a modulatory role in the expression of total KCC2 mRNA and protein in the immature brain. As general anaesthetics are powerful modulators of neuronal activity, the purpose of this study was to explore how these drugs affect KCC2 expression during the brain growth spurt.MethodsWistar rat pups were exposed to either a single dose or 6 h of midazolam, propofol, or ketamine anaesthesia at postnatal days 0, 5, 10, or 15. KCC2 expression was assessed using immunoblotting, immunohistochemistry, or quantitative polymerase chain reaction analysis up to 3 days post-exposure in the medial prefrontal cortex.ResultsThere was a progressive and steep increase in the expression of KCC2 between birth and 2 weeks of age. Exposure to midazolam, propofol, or ketamine up to 6 h at any investigated stages of the brain growth spurt did not influence the expression of this cotransporter protein.ConclusionI.V. general anaesthetics do not seem to influence developmental expression of KCC2 during the brain growth spurt. © 2013 © The Author [2013].

The relationship between prelinguistic vocalization and later expressive vocabulary in young children with developmental delay.

Science.gov (United States)

McCathren, R B; Yoder, P J; Warren, S F

1999-08-01

This study tested the relationship between prelinguistic vocalization and expressive vocabulary 1 year later in young children with mild to moderate developmental delays. Three vocalization variables were tested: rate of all vocalization, rate of vocalizations with consonants, and rate of vocalizations used interactively. The 58 toddlers in the study were 17-34 months old, not sensory impaired, and had Bayley Mental Development Indices (Bayley, 1969; Bayley, 1993) from 35-85. In addition, the children had fewer than 3 words in their expressive vocabularies and during classroom observation each showed at least one instance of intentional prelinguistic communication before testing. Selected sections of the Communication and Symbolic Behavior Scales procedures (CSBS; Wetherby & Prizant, 1993) were administered at the beginning and at the end of the study. The vocal measures were obtained in the initial CSBS session. One measure of expressive vocabulary was obtained in the CSBS session at the end of the study. In addition, expressive vocabulary was measured in a nonstructured play session at the end of the study. We predicted that rate of vocalization, rate of vocalizations with consonants, and rate of vocalizations used interactively would all be positively related to later expressive vocabulary. The results confirmed the predictions.

Changes in gravitational force affect gene expression in developing organ systems at different developmental times

Directory of Open Access Journals (Sweden)

Moorman Stephen J

2005-05-01

Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.

KNOX1 is expressed and epigenetically regulated during in vitro conditions in Agave spp

Directory of Open Access Journals (Sweden)

De-la-Peña Clelia

2012-11-01

, A. fourcroydes and A. angustifolia clones displayed differential expression of the KNOX1 gene during in vitro conditions, which is epigenetically regulated by the H3K4me3 and H3K9me2 marks. The finding of an epigenetic regulation in key developmental genes will make it important in future studies to identify factors that help to find climate-resistant micropropagated plants.

PPARγ regulates the expression of cholesterol metabolism genes in alveolar macrophages

International Nuclear Information System (INIS)

Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S.; Malur, Achut G.; Thomassen, Mary Jane

2010-01-01

Peroxisome proliferator-activated receptor-gamma (PPARγ) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPARγ has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPARγ regulates cholesterol influx, efflux, and metabolism. PPARγ promotes cholesterol efflux through the liver X receptor-alpha (LXRα) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPARγ knockout (PPARγ KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXRα and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPARγ would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPARγ) to restore PPARγ expression in the alveolar macrophages of PPARγ KO mice. Our results show that the alveolar macrophages of PPARγ KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPARγ (1) induced transcription of LXRα and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPARγ regulates cholesterol metabolism in alveolar macrophages.

Regulation of gene expression in Escherichia coli and its bacteriophage

International Nuclear Information System (INIS)

Higgins, C.F.

1986-01-01

This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

Is transcriptomic regulation of berry development more important at night than during the day?

Science.gov (United States)

Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

2014-01-01

Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far.

Expression and Location of Glucose-regulated Protein 78 in Testis and Epididymis

Directory of Open Access Journals (Sweden)

W Wang

2014-04-01

Full Text Available Objective: To know the role of glucose-regulated protein 78 (GRP78/BiP/HSPA5 in spermatogenesis and its expression and location in the testis and epididymis. Methods: Immunohistochemistry and Western blot were used to detect GRP78 location and expression in the testis and epididymis. Results: Glucose-regulated protein 78 was observed in spermatocytes, round spermatids and interstitial cells of the testis and in principal cells of the epididymis. Glucose-regulated protein 78 was first detected in the rat testis at postnatal day 14. Thereafter, the protein level increased gradually with age and was maintained at a high and stable state after postnatal day 28. In the rat, GRP78 was expressed in the principal cells but not in clear cells of the epididymis. Conclusion: Glucose-regulated protein 78 participates in the process of spermatogenesis.

Methylation status regulates lipoprotein lipase expression in chronic lymphocytic leukemia.

Science.gov (United States)

Abreu, Cecilia; Moreno, Pilar; Palacios, Florencia; Borge, Mercedes; Morande, Pablo; Landoni, Ana Inés; Gabus, Raul; Dighiero, Guillermo; Giordano, Mirta; Gamberale, Romina; Oppezzo, Pablo

2013-08-01

Among different prognostic factors in chronic lymphocytic leukemia (CLL), we previously demonstrated that lipoprotein lipase (LPL) is associated with an unmutated immunoglobulin profile and clinical poor outcome. Despite the usefulness of LPL for CLL prognosis, its functional role and the molecular mechanism regulating its expression are still open questions. Interaction of CLL B-cells with the tissue microenvironment favors disease progression by promoting malignant B-cell growth. Since tissue methylation can be altered by environmental factors, we investigated the methylation status of the LPL gene and the possibility that overexpression could be associated with microenvironment signals. Our results show that a demethylated state of the LPL gene is responsible for its anomalous expression in unmutated CLL cases and that this expression is dependent on microenvironment signals. Overall, this work proposes that an epigenetic mechanism, triggered by the microenvironment, regulates LPL expression in CLL disease.

Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal and postnatal mammary gland development.

Science.gov (United States)

Phippard, D J; Weber-Hall, S J; Sharpe, P T; Naylor, M S; Jayatalake, H; Maas, R; Woo, I; Roberts-Clark, D; Francis-West, P H; Liu, Y H; Maxson, R; Hill, R E; Dale, T C

1996-09-01

Expression of the Msx-1 and Msx-2 homeobox genes have been shown to be coordinately regulated with the Bmp-2 and Bmp-4 ligands in a variety of developing tissues. Here we report that transcripts from all four genes are developmentally regulated during both foetal and postnatal mammary gland development. The location and time-course of the Bmp and Msx expression point to a role for Msx and Bmp gene products in the control of epithelial-mesenchymal interactions. Expression of Msx-2, but not Msx-1, Bmp-2 or Bmp-4 was decreased following ovariectomy, while expression of the human Msx-2 homologue was regulated by 17beta-oestradiol in the MCF-7 breast cancer cell line. The regulation of Msx-2 expression by oestrogen raises the possibility that hormonal regulation of mammary development is mediated through the control of epithelial-mesenchymal interactions.

Multiple upstream modules regulate zebrafish myf5 expression

Directory of Open Access Journals (Sweden)

Weng Chih-Wei

2007-01-01

Full Text Available Abstract Background Myf5 is one member of the basic helix-loop-helix family of transcription factors, and it functions as a myogenic factor that is important for the specification and differentiation of muscle cells. The expression of myf5 is somite- and stage-dependent during embryogenesis through a delicate regulation. However, this complex regulatory mechanism of myf5 is not clearly understood. Results We isolated a 156-kb bacterial artificial chromosome clone that includes an upstream 80-kb region and a downstream 70-kb region of zebrafish myf5 and generated a transgenic line carrying this 156-kb segment fused to a green fluorescent protein (GFP reporter gene. We find strong GFP expression in the most rostral somite and in the presomitic mesoderm during segmentation stages, similar to endogenous myf5 expression. Later, the GFP signals persist in caudal somites near the tail bud but are down-regulated in the older, rostral somites. During the pharyngula period, we detect GFP signals in pectoral fin buds, dorsal rostral myotomes, hypaxial myotomes, and inferior oblique and superior oblique muscles, a pattern that also corresponds well with endogenous myf5 transcripts. To characterize the specific upstream cis-elements that regulate this complex and dynamic expression pattern, we also generated several transgenic lines that harbor various lengths within the upstream 80-kb segment. We find that (1 the -80 kb/-9977 segment contains a fin and cranial muscle element and a notochord repressor; (2 the -9977/-6213 segment contains a strong repressive element that does not include the notochord-specific repressor; (3 the -6212/-2938 segment contains tissue-specific elements for bone and spinal cord; (4 the -2937/-291 segment contains an eye enhancer, and the -2937/-2457 segment is required for notochord and myocyte expression; and (5 the -290/-1 segment is responsible for basal transcription in somites and the presomitic mesoderm. Conclusion We suggest

Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs.

Science.gov (United States)

Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N

2013-10-01

Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

Expression of yeast lipid phosphatase Sac1p is regulated by phosphatidylinositol-4-phosphate

Directory of Open Access Journals (Sweden)

Mayinger Peter

2008-01-01

Full Text Available Abstract Background Phosphoinositides play a central role in regulating processes at intracellular membranes. In yeast, a large number of phospholipid biosynthetic enzymes use a common mechanism for transcriptional regulation. Yet, how the expression of genes encoding lipid kinases and phosphatases is regulated remains unknown. Results Here we show that the expression of lipid phosphatase Sac1p in the yeast Saccharomyces cerevisiae is regulated in response to changes in phosphatidylinositol-4-phosphate (PI(4P concentrations. Unlike genes encoding enzymes involved in phospholipid biosynthesis, expression of the SAC1 gene is independent of inositol levels. We identified a novel 9-bp motif within the 5' untranslated region (5'-UTR of SAC1 that is responsible for PI(4P-mediated regulation. Upregulation of SAC1 promoter activity correlates with elevated levels of Sac1 protein levels. Conclusion Regulation of Sac1p expression via the concentration of its major substrate PI(4P ensures proper maintenance of compartment-specific pools of PI(4P.

Resveratrol inhibits Cdk5 activity through regulation of p35 expression

Directory of Open Access Journals (Sweden)

Kulkarni Ashok B

2011-07-01

Full Text Available Abstract Background We have previously reported that cyclin-dependent kinase 5 (Cdk5 participates in the regulation of nociceptive signaling. Through activation of the ERK1/2 pathway, Tumor Necrosis Factor-α (TNF-α induces expression of Egr-1. This results in the sustained and robust expression of p35, a coactivator of Cdk5, in PC12 cells, thereby increasing Cdk5 kinase activity. The aim of our present study was to test whether resveratrol, a polyphenolic compound with known analgesic activity, can regulate Cdk5/p35 activity. Results Here we used a cell-based assay in which a p35 promoter-luciferase construct was stably transfected in PC12 cells. Our studies demonstrate that resveratrol inhibits p35 promoter activity and also blocks the TNF-α mediated increase in Cdk5 activity in PC12 cells. Resveratrol also inhibits p35 expression and blocks the TNF-α mediated increase in Cdk5 activity in DRG neurons. In the presence of resveratrol, the MEK inhibitor decreased p35 promoter activity, whereas the inhibitors of p38 MAPK, JNK and NF-κB increased p35 promoter activity, indicating that these pathways regulate p35 expression differently. The TNF-α-mediated increase in Egr-1 expression was decreased by resveratrol treatment with a concomitant reduction in p35 expression and protein levels, resulting in reduced Cdk5 kinase activity. Conclusions We demonstrate here that resveratrol regulates p35 promoter activity in PC12 cells and DRG neurons. Most importantly, resveratrol blocks the TNF-α-mediated increase in p35 promoter activity, thereby reducing p35 expression and subsequent Cdk5 kinase activity. This new molecular mechanism adds to the known analgesic effects of resveratrol and confirms the need for identifying new analgesics based on their ability to inhibit Cdk5 activity for effective treatment of pain.

Expression and subcellular localization of antiporter regulating ...

African Journals Online (AJOL)

We examined the expression and subcellular localization of antiporter regulating protein OsARP in a submergence tolerant rice (Oryza sativa L.) cultivar FR13A. In the public databases, this protein was designated as putative Os02g0465900 protein. The cDNA containing the full-length sequence of OsARP gene was ...

DPPC regulates COX-2 expression in monocytes via phosphorylation of CREB

International Nuclear Information System (INIS)

Morris, R.H.K.; Tonks, A.J.; Jones, K.P.; Ahluwalia, M.K.; Thomas, A.W.; Tonks, A.; Jackson, S.K.

2008-01-01

The major phospholipid in pulmonary surfactant dipalmitoyl phosphatidylcholine (DPPC) has been shown to modulate inflammatory responses. Using human monocytes, this study demonstrates that DPPC significantly increased PGE 2 (P < 0.05) production by 2.5-fold when compared to untreated monocyte controls. Mechanistically, this effect was concomitant with an increase in COX-2 expression which was abrogated in the presence of a COX-2 inhibitor. The regulation of COX-2 expression was independent of NF-κB activity. Further, DPPC increased the phosphorylation of the cyclic AMP response element binding protein (CREB; an important nuclear transcription factor important in regulating COX-2 expression). In addition, we also show that changing the fatty acid groups of PC (e.g. using L-α-phosphatidylcholine β-arachidonoyl-γ-palmitoyl (PAPC)) has a profound effect on the regulation of COX-2 expression and CREB activation. This study provides new evidence for the anti-inflammatory activity of DPPC and that this activity is at least in part mediated via CREB activation of COX-2

PERT: A Method for Expression Deconvolution of Human Blood Samples from Varied Microenvironmental and Developmental Conditions

Science.gov (United States)

Csaszar, Elizabeth; Yu, Mei; Morris, Quaid; Zandstra, Peter W.

2012-01-01

The cellular composition of heterogeneous samples can be predicted using an expression deconvolution algorithm to decompose their gene expression profiles based on pre-defined, reference gene expression profiles of the constituent populations in these samples. However, the expression profiles of the actual constituent populations are often perturbed from those of the reference profiles due to gene expression changes in cells associated with microenvironmental or developmental effects. Existing deconvolution algorithms do not account for these changes and give incorrect results when benchmarked against those measured by well-established flow cytometry, even after batch correction was applied. We introduce PERT, a new probabilistic expression deconvolution method that detects and accounts for a shared, multiplicative perturbation in the reference profiles when performing expression deconvolution. We applied PERT and three other state-of-the-art expression deconvolution methods to predict cell frequencies within heterogeneous human blood samples that were collected under several conditions (uncultured mono-nucleated and lineage-depleted cells, and culture-derived lineage-depleted cells). Only PERT's predicted proportions of the constituent populations matched those assigned by flow cytometry. Genes associated with cell cycle processes were highly enriched among those with the largest predicted expression changes between the cultured and uncultured conditions. We anticipate that PERT will be widely applicable to expression deconvolution strategies that use profiles from reference populations that vary from the corresponding constituent populations in cellular state but not cellular phenotypic identity. PMID:23284283

Regulation of Gene Expression in Protozoa Parasites

Directory of Open Access Journals (Sweden)

Consuelo Gomez

2010-01-01

Full Text Available Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

Regulation of gene expression in protozoa parasites.

Science.gov (United States)

Gomez, Consuelo; Esther Ramirez, M; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A

2010-01-01

Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

KAUST Repository

Ariel, Federico D.; Jé gu, Teddy; Latrasse, David; Romero-Barrios, Natali; Christ, Auré lie; Benhamed, Moussa; Crespi, Martí n D.

2014-01-01

The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

KAUST Repository

Ariel, Federico D.

2014-08-01

The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

Developmental retardation, reduced fecundity, and modulated expression of the defensome in the intertidal copepod Tigriopus japonicus exposed to BDE-47 and PFOS.

Science.gov (United States)

Han, Jeonghoon; Won, Eun-Ji; Lee, Min-Chul; Seo, Jung Soo; Lee, Su-Jae; Lee, Jae-Seong

2015-08-01

2,2',4,4'-tetrabromodiphenyl ether (BDE-47) and perfluorooctane sulfonate (PFOS) are widely dispersed persistent organic pollutants (POPs) in the marine ecosystem. However, their toxic effects on marine organisms are still poorly understood. In this study, we investigated the effects of BDE-47 and PFOS on development and reproduction at the organismal level and reactive oxygen species (ROS) production and gene expression patterns of the defensome at the cellular level in the intertidal copepod Tigriopus japonicus. In copepods exposed to BDE-47 and PFOS, we observed developmental retardation and reduced fecundity, suggesting repercussions on in vivo endpoints through alterations to the normal molting and reproduction system of T. japonicus. BDE-47 and PFOS increased levels of ROS in T. japonicus in a concentration-dependent manner, indicating that POPs can induce oxidative stress through the generation of ROS. Additionally, transcript profiles of genes related to detoxification (e.g., CYPs), antioxidant functions (e.g., GST- sigma, catalase, MnSOD), apoptosis (e.g., p53, Rb), and cellular proliferation (e.g., PCNA) were modulated over 72h in response to BDE-47 (120μg/L) and PFOS (1000μg/L). These findings indicate that BDE-47 and PFOS can induce oxidative stress-mediated DNA damage repair systems with transcriptional regulation of detoxification, antioxidant, and apoptosis-related genes, resulting in developmental retardation and reduced fecundity in the copepod T. japonicus. Copyright © 2015 Elsevier B.V. All rights reserved.

Parent emotional expressiveness and children's self-regulation: Associations with abused children's school functioning

Science.gov (United States)

Haskett, Mary E.; Stelter, Rebecca; Proffit, Katie; Nice, Rachel

2012-01-01

Objective Identifying factors associated with school functioning of abused children is important in prevention of long-term negative outcomes associated with school failure. The purpose of this study was to examine the degree to which parent emotional expressiveness and children's self-regulation predicted early school behavior of abused children. Methods The sample included 92 physically abused children ages 4-7 and one of their parents (95.7% mothers). Parents completed a measure of their own emotional expressiveness, and parents and teachers provided reports of children's self-regulatory skills. Children's school functioning was measured by observations of playground aggression and teacher reports of aggression and classroom behavior. Results Parents’ expression of positive and negative emotions was associated with various aspects of children's self-regulation and functioning in the school setting. Links between self-regulation and children's school adjustment were robust; poor self-regulation was associated with higher aggression and lower cooperation and self-directed behavior in the classroom. There was minimal support for a mediating role of children's self-regulation in links between parent expressiveness and children's behavior. Practice implications Findings point to the relevance of parent emotional expressivity and children's self-regulatory processes in understanding physically abused children's functioning at the transition to school. Although further research is needed, findings indicate that increasing parental expression of positive emotion should be a focus in treatment along with reduction in negativity of abusive parents. Further, addressing children's self-regulation could be important in efforts to reduce aggression and enhance children's classroom competence. PMID:22565040

Thyroid hormones regulate selenoprotein expression and selenium status in mice.

Directory of Open Access Journals (Sweden)

Jens Mittag

Full Text Available Impaired expression of selenium-containing proteins leads to perturbed thyroid hormone (TH levels, indicating the central importance of selenium for TH homeostasis. Moreover, critically ill patients with declining serum selenium develop a syndrome of low circulating TH and a central downregulation of the hypothalamus-pituitary-thyroid axis. This prompted us to test the reciprocal effect, i.e., if TH status would also regulate selenoprotein expression and selenium levels. To investigate the TH dependency of selenium metabolism, we analyzed mice expressing a mutant TH receptor α1 (TRα1+m that confers a receptor-mediated hypothyroidism. Serum selenium was reduced in these animals, which was a direct consequence of the mutant TRα1 and not related to their metabolic alterations. Accordingly, hyperthyroidism, genetically caused by the inactivation of TRβ or by oral TH treatment of adult mice, increased serum selenium levels in TRα1+m and controls, thus demonstrating a novel and specific role for TRα1 in selenium metabolism. Furthermore, TH affected the mRNA levels for several enzymes involved in selenoprotein biosynthesis as well as serum selenoprotein P concentrations and the expression of other antioxidative selenoproteins. Taken together, our results show that TH positively affects the serum selenium status and regulates the expression of several selenoproteins. This demonstrates that selenium and TH metabolism are interconnected through a feed-forward regulation, which can in part explain the rapid parallel downregulation of both systems in critical illness.

MicroRNAs in Amoebozoa: deep sequencing of the small RNA population in the social amoeba Dictyostelium discoideum reveals developmentally regulated microRNAs.

Science.gov (United States)

Avesson, Lotta; Reimegård, Johan; Wagner, E Gerhart H; Söderbom, Fredrik

2012-10-01

The RNA interference machinery has served as a guardian of eukaryotic genomes since the divergence from prokaryotes. Although the basic components have a shared origin, silencing pathways directed by small RNAs have evolved in diverse directions in different eukaryotic lineages. Micro (mi)RNAs regulate protein-coding genes and play vital roles in plants and animals, but less is known about their functions in other organisms. Here, we report, for the first time, deep sequencing of small RNAs from the social amoeba Dictyostelium discoideum. RNA from growing single-cell amoebae as well as from two multicellular developmental stages was sequenced. Computational analyses combined with experimental data reveal the expression of miRNAs, several of them exhibiting distinct expression patterns during development. To our knowledge, this is the first report of miRNAs in the Amoebozoa supergroup. We also show that overexpressed miRNA precursors generate miRNAs and, in most cases, miRNA* sequences, whose biogenesis is dependent on the Dicer-like protein DrnB, further supporting the presence of miRNAs in D. discoideum. In addition, we find miRNAs processed from hairpin structures originating from an intron as well as from a class of repetitive elements. We believe that these repetitive elements are sources for newly evolved miRNAs.

INTRINSIC REGULATION OF HEMOGLOBIN EXPRESSION BY VARIABLE SUBUNIT INTERFACE STRENGTHS

Science.gov (United States)

Manning, James M.; Popowicz, Anthony M.; Padovan, Julio C.; Chait, Brian T.; Manning, Lois R.

2012-01-01

SUMMARY The expression of the six types of human hemoglobin subunits over time is currently considered to be regulated mainly by transcription factors that bind to upstream control regions of the gene (the “extrinsic” component of regulation). Here we describe how subunit pairing and further assembly to tetramers in the liganded state is influenced by the affinity of subunits for one another (the “intrinsic” component of regulation). The adult hemoglobin dimers have the strongest subunit interfaces and the embryonic hemoglobins are the weakest with fetal hemoglobins of intermediate strength, corresponding to the temporal order of their expression. These variable subunit binding strengths and the attenuating effects of acetylation contribute to the differences with which these hemoglobin types form functional O2-binding tetramers consistent with gene switching. PMID:22129306

HOXB4 Gene Expression Is Regulated by CDX2 in Intestinal Epithelial Cells

DEFF Research Database (Denmark)

Jørgensen, Steffen; Coshun, Mehmet; Mikkelsen Homburg, Keld

2016-01-01

analysis and expression data from Caco2 cells also suggests a role for CDX2 in the regulation of HOXB4 gene expression in the intestinal epithelium. Thus, the aim of this study was to investigate whether HOXB4 gene expression is regulated by CDX2 in the intestinal epithelium. We demonstrated binding of CDX......The mammalian Caudal-related homeobox transcription factor 2 (CDX2) plays a key role in the homeobox regulatory network and is essential in regulating the expression of several homeobox (HOX) genes during embryonic development, particularly in the gut. Genome-wide CDX2 chromatin immunoprecipitation......2 to four different CDX2 binding sites in an enhancer region located upstream of the HOXB4 transcription start site. Mutations in the CDX2 binding sites reduced HOXB4 gene activity, and knock down of endogenous CDX2 expression by shRNA reduced HOXB4 gene expression. This is the first report...

K-Cl Cotransporter 2-mediated Cl- Extrusion Determines Developmental Stage-dependent Impact of Propofol Anesthesia on Dendritic Spines.

Science.gov (United States)

Puskarjov, Martin; Fiumelli, Hubert; Briner, Adrian; Bodogan, Timea; Demeter, Kornel; Lacoh, Claudia-Marvine; Mavrovic, Martina; Blaesse, Peter; Kaila, Kai; Vutskits, Laszlo

2017-05-01

General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABAA)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABAA)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. The KCC2-dependent developmental increase in the efficacy of GABAA-mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

N-Myc Differentially Regulates Expression of MXI1 Isoforms in Neuroblastoma