The capacity for multistability in small gene regulatory networks

Directory of Open Access Journals (Sweden)

Grotewold Erich

2009-09-01

Full Text Available Abstract Background Recent years have seen a dramatic increase in the use of mathematical modeling to gain insight into gene regulatory network behavior across many different organisms. In particular, there has been considerable interest in using mathematical tools to understand how multistable regulatory networks may contribute to developmental processes such as cell fate determination. Indeed, such a network may subserve the formation of unicellular leaf hairs (trichomes in the model plant Arabidopsis thaliana. Results In order to investigate the capacity of small gene regulatory networks to generate multiple equilibria, we present a chemical reaction network (CRN-based modeling formalism and describe a number of methods for CRN analysis in a parameter-free context. These methods are compared and applied to a full set of one-component subnetworks, as well as a large random sample from 40,680 similarly constructed two-component subnetworks. We find that positive feedback and cooperativity mediated by transcription factor (TF dimerization is a requirement for one-component subnetwork bistability. For subnetworks with two components, the presence of these processes increases the probability that a randomly sampled subnetwork will exhibit multiple equilibria, although we find several examples of bistable two-component subnetworks that do not involve cooperative TF-promoter binding. In the specific case of epidermal differentiation in Arabidopsis, dimerization of the GL3-GL1 complex and cooperative sequential binding of GL3-GL1 to the CPC promoter are each independently sufficient for bistability. Conclusion Computational methods utilizing CRN-specific theorems to rule out bistability in small gene regulatory networks are far superior to techniques generally applicable to deterministic ODE systems. Using these methods to conduct an unbiased survey of parameter-free deterministic models of small networks, and the Arabidopsis epidermal cell

Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

Directory of Open Access Journals (Sweden)

Susanta K Behura

Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

Science.gov (United States)

Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

2015-12-01

Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

Cis-regulatory timers for developmental gene expression.

Directory of Open Access Journals (Sweden)

Lionel Christiaen

2013-10-01

Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.

HPRT deficiency coordinately dysregulates canonical Wnt and presenilin-1 signaling: a neuro-developmental regulatory role for a housekeeping gene?

Directory of Open Access Journals (Sweden)

Tae Hyuk Kang

2011-01-01

Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for

Developmental Risk and Young Children's Regulatory Strategies: Predicting Behavior Problems at Age Five

Science.gov (United States)

Gerstein, Emily D.; Pedersen y Arbona, Anita; Crnic, Keith A.; Ryu, Ehri; Baker, Bruce L.; Blacher, Jan

2011-01-01

Children with early developmental delays are at heightened risk for behavior problems and comorbid psychopathology. This study examined the trajectories of regulatory capabilities and their potentially mediating role in the development of behavior problems for children with and without early developmental delays. A sample of 231 children comprised…

Developmental transcriptome of Aplysia californica'

KAUST Repository

Heyland, Andreas; Vue, Zer; Voolstra, Christian R.; Medina, Mó nica; Moroz, Leonid L.

2010-01-01

developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms

Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

Science.gov (United States)

Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

2015-01-08

Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

The vertebrate Hox gene regulatory network for hindbrain segmentation: Evolution and diversification: Coupling of a Hox gene regulatory network to hindbrain segmentation is an ancient trait originating at the base of vertebrates.

Science.gov (United States)

Parker, Hugo J; Bronner, Marianne E; Krumlauf, Robb

2016-06-01

Hindbrain development is orchestrated by a vertebrate gene regulatory network that generates segmental patterning along the anterior-posterior axis via Hox genes. Here, we review analyses of vertebrate and invertebrate chordate models that inform upon the evolutionary origin and diversification of this network. Evidence from the sea lamprey reveals that the hindbrain regulatory network generates rhombomeric compartments with segmental Hox expression and an underlying Hox code. We infer that this basal feature was present in ancestral vertebrates and, as an evolutionarily constrained developmental state, is fundamentally important for patterning of the vertebrate hindbrain across diverse lineages. Despite the common ground plan, vertebrates exhibit neuroanatomical diversity in lineage-specific patterns, with different vertebrates revealing variations of Hox expression in the hindbrain that could underlie this diversification. Invertebrate chordates lack hindbrain segmentation but exhibit some conserved aspects of this network, with retinoic acid signaling playing a role in establishing nested domains of Hox expression. © 2016 WILEY Periodicals, Inc.

Developmental transcriptome of Aplysia californica'

KAUST Repository

Heyland, Andreas

2010-12-06

Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages-many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization-a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. © 2010 Wiley-Liss, Inc., A Wiley Company.

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

Science.gov (United States)

Guo, Liyuan; Wang, Jing

2018-01-04

Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Inferring dynamic gene regulatory networks in cardiac differentiation through the integration of multi-dimensional data.

Science.gov (United States)

Gong, Wuming; Koyano-Nakagawa, Naoko; Li, Tongbin; Garry, Daniel J

2015-03-07

Decoding the temporal control of gene expression patterns is key to the understanding of the complex mechanisms that govern developmental decisions during heart development. High-throughput methods have been employed to systematically study the dynamic and coordinated nature of cardiac differentiation at the global level with multiple dimensions. Therefore, there is a pressing need to develop a systems approach to integrate these data from individual studies and infer the dynamic regulatory networks in an unbiased fashion. We developed a two-step strategy to integrate data from (1) temporal RNA-seq, (2) temporal histone modification ChIP-seq, (3) transcription factor (TF) ChIP-seq and (4) gene perturbation experiments to reconstruct the dynamic network during heart development. First, we trained a logistic regression model to predict the probability (LR score) of any base being bound by 543 TFs with known positional weight matrices. Second, four dimensions of data were combined using a time-varying dynamic Bayesian network model to infer the dynamic networks at four developmental stages in the mouse [mouse embryonic stem cells (ESCs), mesoderm (MES), cardiac progenitors (CP) and cardiomyocytes (CM)]. Our method not only infers the time-varying networks between different stages of heart development, but it also identifies the TF binding sites associated with promoter or enhancers of downstream genes. The LR scores of experimentally verified ESCs and heart enhancers were significantly higher than random regions (p network inference model identified a region with an elevated LR score approximately -9400 bp upstream of the transcriptional start site of Nkx2-5, which overlapped with a previously reported enhancer region (-9435 to -8922 bp). TFs such as Tead1, Gata4, Msx2, and Tgif1 were predicted to bind to this region and participate in the regulation of Nkx2-5 gene expression. Our model also predicted the key regulatory networks for the ESC-MES, MES-CP and CP

Prediction of regulatory gene pairs using dynamic time warping and gene ontology.

Science.gov (United States)

Yang, Andy C; Hsu, Hui-Huang; Lu, Ming-Da; Tseng, Vincent S; Shih, Timothy K

2014-01-01

Selecting informative genes is the most important task for data analysis on microarray gene expression data. In this work, we aim at identifying regulatory gene pairs from microarray gene expression data. However, microarray data often contain multiple missing expression values. Missing value imputation is thus needed before further processing for regulatory gene pairs becomes possible. We develop a novel approach to first impute missing values in microarray time series data by combining k-Nearest Neighbour (KNN), Dynamic Time Warping (DTW) and Gene Ontology (GO). After missing values are imputed, we then perform gene regulation prediction based on our proposed DTW-GO distance measurement of gene pairs. Experimental results show that our approach is more accurate when compared with existing missing value imputation methods on real microarray data sets. Furthermore, our approach can also discover more regulatory gene pairs that are known in the literature than other methods.

Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

Directory of Open Access Journals (Sweden)

Heying Zhou

Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

Sequence-based model of gap gene regulatory network.

Science.gov (United States)

Kozlov, Konstantin; Gursky, Vitaly; Kulakovskiy, Ivan; Samsonova, Maria

2014-01-01

The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are important for the model output; 3

Inference of cancer-specific gene regulatory networks using soft computing rules.

Science.gov (United States)

Wang, Xiaosheng; Gotoh, Osamu

2010-03-24

Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

Sub-circuits of a gene regulatory network control a developmental epithelial-mesenchymal transition.

Science.gov (United States)

Saunders, Lindsay R; McClay, David R

2014-04-01

Epithelial-mesenchymal transition (EMT) is a fundamental cell state change that transforms epithelial to mesenchymal cells during embryonic development, adult tissue repair and cancer metastasis. EMT includes a complex series of intermediate cell state changes including remodeling of the basement membrane, apical constriction, epithelial de-adhesion, directed motility, loss of apical-basal polarity, and acquisition of mesenchymal adhesion and polarity. Transcriptional regulatory state changes must ultimately coordinate the timing and execution of these cell biological processes. A well-characterized gene regulatory network (GRN) in the sea urchin embryo was used to identify the transcription factors that control five distinct cell changes during EMT. Single transcription factors were perturbed and the consequences followed with in vivo time-lapse imaging or immunostaining assays. The data show that five different sub-circuits of the GRN control five distinct cell biological activities, each part of the complex EMT process. Thirteen transcription factors (TFs) expressed specifically in pre-EMT cells were required for EMT. Three TFs highest in the GRN specified and activated EMT (alx1, ets1, tbr) and the 10 TFs downstream of those (tel, erg, hex, tgif, snail, twist, foxn2/3, dri, foxb, foxo) were also required for EMT. No single TF functioned in all five sub-circuits, indicating that there is no EMT master regulator. Instead, the resulting sub-circuit topologies suggest EMT requires multiple simultaneous regulatory mechanisms: forward cascades, parallel inputs and positive-feedback lock downs. The interconnected and overlapping nature of the sub-circuits provides one explanation for the seamless orchestration by the embryo of cell state changes leading to successful EMT.

Past climate change on Sky Islands drives novelty in a core developmental gene network and its phenotype.

Science.gov (United States)

Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab

2015-09-04

A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our

Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

Science.gov (United States)

Arenas-Mena, Cesar; Coffman, James A.

2016-01-01

Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules

Directory of Open Access Journals (Sweden)

Xiaosheng Wang

2010-03-01

Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

Current approaches to gene regulatory network modelling

Directory of Open Access Journals (Sweden)

Brazma Alvis

2007-09-01

Full Text Available Abstract Many different approaches have been developed to model and simulate gene regulatory networks. We proposed the following categories for gene regulatory network models: network parts lists, network topology models, network control logic models, and dynamic models. Here we will describe some examples for each of these categories. We will study the topology of gene regulatory networks in yeast in more detail, comparing a direct network derived from transcription factor binding data and an indirect network derived from genome-wide expression data in mutants. Regarding the network dynamics we briefly describe discrete and continuous approaches to network modelling, then describe a hybrid model called Finite State Linear Model and demonstrate that some simple network dynamics can be simulated in this model.

An explanatory evo-devo model for the developmental hourglass [v1; ref status: indexed, http://f1000r.es/3s6

Directory of Open Access Journals (Sweden)

Saamer Akhshabi

2014-07-01

Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

An explanatory evo-devo model for the developmental hourglass [v2; ref status: indexed, http://f1000r.es/4x3

Directory of Open Access Journals (Sweden)

Saamer Akhshabi

2014-12-01

Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

Science.gov (United States)

Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

2016-02-01

Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Transcription factor trapping by RNA in gene regulatory elements.

Science.gov (United States)

Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

2015-11-20

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

DREISS: Using State-Space Models to Infer the Dynamics of Gene Expression Driven by External and Internal Regulatory Networks

Science.gov (United States)

Gerstein, Mark

2016-01-01

Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs), cellular growth factors and microRNAs. A subsystem’s gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally–e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org) for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the “state” and “control” in the model refer to its own (internal) and another subsystem’s (external) gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model’s parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation) representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs), seeing the degree to which these can be accounted for by orthologous (internal) versus species-specific (external) TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with

DREISS: Using State-Space Models to Infer the Dynamics of Gene Expression Driven by External and Internal Regulatory Networks.

Directory of Open Access Journals (Sweden)

Daifeng Wang

2016-10-01

Full Text Available Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs, cellular growth factors and microRNAs. A subsystem's gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally-e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the "state" and "control" in the model refer to its own (internal and another subsystem's (external gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model's parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs, seeing the degree to which these can be accounted for by orthologous (internal versus species-specific (external TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with

Regulatory heterochronies and loose temporal scaling between sea star and sea urchin regulatory circuits.

Science.gov (United States)

Gildor, Tsvia; Hinman, Veronica; Ben-Tabou-De-Leon, Smadar

2017-01-01

It has long been argued that heterochrony, a change in relative timing of a developmental process, is a major source of evolutionary innovation. Heterochronic changes of regulatory gene activation could be the underlying molecular mechanism driving heterochronic changes through evolution. Here, we compare the temporal expression profiles of key regulatory circuits between sea urchin and sea star, representative of two classes of Echinoderms that shared a common ancestor about 500 million years ago. The morphologies of the sea urchin and sea star embryos are largely comparable, yet, differences in certain mesodermal cell types and ectodermal patterning result in distinct larval body plans. We generated high resolution temporal profiles of 17 mesodermally-, endodermally- and ectodermally-expressed regulatory genes in the sea star, Patiria miniata, and compared these to their orthologs in the Mediterranean sea urchin, Paracentrotus lividus. We found that the maternal to zygotic transition is delayed in the sea star compared to the sea urchin, in agreement with the longer cleavage stage in the sea star. Interestingly, the order of gene activation shows the highest variation in the relatively diverged mesodermal circuit, while the correlations of expression dynamics are the highest in the strongly conserved endodermal circuit. We detected loose scaling of the developmental rates of these species and observed interspecies heterochronies within all studied regulatory circuits. Thus, after 500 million years of parallel evolution, mild heterochronies between the species are frequently observed and the tight temporal scaling observed for closely related species no longer holds.

Learning gene regulatory networks from gene expression data using weighted consensus

KAUST Repository

Fujii, Chisato; Kuwahara, Hiroyuki; Yu, Ge; Guo, Lili; Gao, Xin

2016-01-01

An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.

Learning gene regulatory networks from gene expression data using weighted consensus

KAUST Repository

Fujii, Chisato

2016-08-25

An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.

Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

Directory of Open Access Journals (Sweden)

Fei Xiao

Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence.

Science.gov (United States)

Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

2004-06-01

Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby influencing the phenotype, illness severity, and adult outcome of tic disorders. Similar developmental processes during adolescence likely determine the phenotype and natural history of a broad range of other complex neuropsychiatric disorders of childhood onset, and they likely contribute to the acquisition of improved self-regulatory capacities that characterize normal adolescent development.

A discrete transition zone organizes the topological and regulatory autonomy of the adjacent tfap2c and bmp7 genes.

Directory of Open Access Journals (Sweden)

Taro Tsujimura

2015-01-01

Full Text Available Despite the well-documented role of remote enhancers in controlling developmental gene expression, the mechanisms that allocate enhancers to genes are poorly characterized. Here, we investigate the cis-regulatory organization of the locus containing the Tfap2c and Bmp7 genes in vivo, using a series of engineered chromosomal rearrangements. While these genes lie adjacent to one another, we demonstrate that they are independently regulated by distinct sets of enhancers, which in turn define non-overlapping regulatory domains. Chromosome conformation capture experiments reveal a corresponding partition of the locus in two distinct structural entities, demarcated by a discrete transition zone. The impact of engineered chromosomal rearrangements on the topology of the locus and the resultant gene expression changes indicate that this transition zone functionally organizes the structural partition of the locus, thereby defining enhancer-target gene allocation. This partition is, however, not absolute: we show that it allows competing interactions across it that may be non-productive for the competing gene, but modulate expression of the competed one. Altogether, these data highlight the prime role of the topological organization of the genome in long-distance regulation of gene expression.

Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

Science.gov (United States)

Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon

2017-07-03

Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

Mural granulosa cell gene expression associated with oocyte developmental competence

Directory of Open Access Journals (Sweden)

Jiang Jin-Yi

2010-03-01

Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

Mutational robustness of gene regulatory networks.

Directory of Open Access Journals (Sweden)

Aalt D J van Dijk

Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

A Regulatory Network Analysis of Orphan Genes in Arabidopsis Thaliana

Science.gov (United States)

Singh, Pramesh; Chen, Tianlong; Arendsee, Zebulun; Wurtele, Eve S.; Bassler, Kevin E.

Orphan genes, which are genes unique to each particular species, have recently drawn significant attention for their potential usefulness for organismal robustness. Their origin and regulatory interaction patterns remain largely undiscovered. Recently, methods that use the context likelihood of relatedness to infer a network followed by modularity maximizing community detection algorithms on the inferred network to find the functional structure of regulatory networks were shown to be effective. We apply improved versions of these methods to gene expression data from Arabidopsis thaliana, identify groups (clusters) of interacting genes with related patterns of expression and analyze the structure within those groups. Focusing on clusters that contain orphan genes, we compare the identified clusters to gene ontology (GO) terms, regulons, and pathway designations and analyze their hierarchical structure. We predict new regulatory interactions and unravel the structure of the regulatory interaction patterns of orphan genes. Work supported by the NSF through Grants DMR-1507371 and IOS-1546858.

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

Science.gov (United States)

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

Identification of putative regulatory motifs in the upstream regions of co-expressed functional groups of genes in Plasmodium falciparum

Directory of Open Access Journals (Sweden)

Joshi NV

2009-01-01

Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.

Genomewide Analysis of Aryl Hydrocarbon Receptor Binding Targets Reveals an Extensive Array of Gene Clusters that Control Morphogenetic and Developmental Programs

Science.gov (United States)

Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro

2009-01-01

Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925

Learning gene regulatory networks from only positive and unlabeled data

Directory of Open Access Journals (Sweden)

Elkan Charles

2010-05-01

Full Text Available Abstract Background Recently, supervised learning methods have been exploited to reconstruct gene regulatory networks from gene expression data. The reconstruction of a network is modeled as a binary classification problem for each pair of genes. A statistical classifier is trained to recognize the relationships between the activation profiles of gene pairs. This approach has been proven to outperform previous unsupervised methods. However, the supervised approach raises open questions. In particular, although known regulatory connections can safely be assumed to be positive training examples, obtaining negative examples is not straightforward, because definite knowledge is typically not available that a given pair of genes do not interact. Results A recent advance in research on data mining is a method capable of learning a classifier from only positive and unlabeled examples, that does not need labeled negative examples. Applied to the reconstruction of gene regulatory networks, we show that this method significantly outperforms the current state of the art of machine learning methods. We assess the new method using both simulated and experimental data, and obtain major performance improvement. Conclusions Compared to unsupervised methods for gene network inference, supervised methods are potentially more accurate, but for training they need a complete set of known regulatory connections. A supervised method that can be trained using only positive and unlabeled data, as presented in this paper, is especially beneficial for the task of inferring gene regulatory networks, because only an incomplete set of known regulatory connections is available in public databases such as RegulonDB, TRRD, KEGG, Transfac, and IPA.

Sparsity in Model Gene Regulatory Networks

International Nuclear Information System (INIS)

Zagorski, M.

2011-01-01

We propose a gene regulatory network model which incorporates the microscopic interactions between genes and transcription factors. In particular the gene's expression level is determined by deterministic synchronous dynamics with contribution from excitatory interactions. We study the structure of networks that have a particular '' function '' and are subject to the natural selection pressure. The question of network robustness against point mutations is addressed, and we conclude that only a small part of connections defined as '' essential '' for cell's existence is fragile. Additionally, the obtained networks are sparse with narrow in-degree and broad out-degree, properties well known from experimental study of biological regulatory networks. Furthermore, during sampling procedure we observe that significantly different genotypes can emerge under mutation-selection balance. All the preceding features hold for the model parameters which lay in the experimentally relevant range. (author)

Memory functions reveal structural properties of gene regulatory networks

Science.gov (United States)

Perez-Carrasco, Ruben

2018-01-01

Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492

Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

Science.gov (United States)

Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

2015-05-15

The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

Human developmental enhancers conserved between deuterostomes and protostomes.

Directory of Open Access Journals (Sweden)

Shoa L Clarke

Full Text Available The identification of homologies, whether morphological, molecular, or genetic, is fundamental to our understanding of common biological principles. Homologies bridging the great divide between deuterostomes and protostomes have served as the basis for current models of animal evolution and development. It is now appreciated that these two clades share a common developmental toolkit consisting of conserved transcription factors and signaling pathways. These patterning genes sometimes show common expression patterns and genetic interactions, suggesting the existence of similar or even conserved regulatory apparatus. However, previous studies have found no regulatory sequence conserved between deuterostomes and protostomes. Here we describe the first such enhancers, which we call bilaterian conserved regulatory elements (Bicores. Bicores show conservation of sequence and gene synteny. Sequence conservation of Bicores reflects conserved patterns of transcription factor binding sites. We predict that Bicores act as response elements to signaling pathways, and we show that Bicores are developmental enhancers that drive expression of transcriptional repressors in the vertebrate central nervous system. Although the small number of identified Bicores suggests extensive rewiring of cis-regulation between the protostome and deuterostome clades, additional Bicores may be revealed as our understanding of cis-regulatory logic and sample of bilaterian genomes continue to grow.

Learning Gene Regulatory Networks Computationally from Gene Expression Data Using Weighted Consensus

KAUST Repository

Fujii, Chisato

2015-04-16

Gene regulatory networks analyze the relationships between genes allowing us to un- derstand the gene regulatory interactions in systems biology. Gene expression data from the microarray experiments is used to obtain the gene regulatory networks. How- ever, the microarray data is discrete, noisy and non-linear which makes learning the networks a challenging problem and existing gene network inference methods do not give consistent results. Current state-of-the-art study uses the average-ranking-based consensus method to combine and average the ranked predictions from individual methods. However each individual method has an equal contribution to the consen- sus prediction. We have developed a linear programming-based consensus approach which uses learned weights from linear programming among individual methods such that the methods have di↵erent weights depending on their performance. Our result reveals that assigning di↵erent weights to individual methods rather than giving them equal weights improves the performance of the consensus. The linear programming- based consensus method is evaluated and it had the best performance on in silico and Saccharomyces cerevisiae networks, and the second best on the Escherichia coli network outperformed by Inferelator Pipeline method which gives inconsistent results across a wide range of microarray data sets.

Creating and validating cis-regulatory maps of tissue-specific gene expression regulation

Science.gov (United States)

O'Connor, Timothy R.; Bailey, Timothy L.

2014-01-01

Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088

Mining Gene Regulatory Networks by Neural Modeling of Expression Time-Series.

Science.gov (United States)

Rubiolo, Mariano; Milone, Diego H; Stegmayer, Georgina

2015-01-01

Discovering gene regulatory networks from data is one of the most studied topics in recent years. Neural networks can be successfully used to infer an underlying gene network by modeling expression profiles as times series. This work proposes a novel method based on a pool of neural networks for obtaining a gene regulatory network from a gene expression dataset. They are used for modeling each possible interaction between pairs of genes in the dataset, and a set of mining rules is applied to accurately detect the subjacent relations among genes. The results obtained on artificial and real datasets confirm the method effectiveness for discovering regulatory networks from a proper modeling of the temporal dynamics of gene expression profiles.

Interactive visualization of gene regulatory networks with associated gene expression time series data

NARCIS (Netherlands)

Westenberg, M.A.; Hijum, van S.A.F.T.; Lulko, A.T.; Kuipers, O.P.; Roerdink, J.B.T.M.; Linsen, L.; Hagen, H.; Hamann, B.

2008-01-01

We present GENeVis, an application to visualize gene expression time series data in a gene regulatory network context. This is a network of regulator proteins that regulate the expression of their respective target genes. The networks are represented as graphs, in which the nodes represent genes,

Developmental gene expression profiles of the human pathogen Schistosoma japonicum

Directory of Open Access Journals (Sweden)

McManus Donald P

2009-03-01

Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.

Deconstructing the pluripotency gene regulatory network

KAUST Repository

Li, Mo

2018-04-04

Pluripotent stem cells can be isolated from embryos or derived by reprogramming. Pluripotency is stabilized by an interconnected network of pluripotency genes that cooperatively regulate gene expression. Here we describe the molecular principles of pluripotency gene function and highlight post-transcriptional controls, particularly those induced by RNA-binding proteins and alternative splicing, as an important regulatory layer of pluripotency. We also discuss heterogeneity in pluripotency regulation, alternative pluripotency states and future directions of pluripotent stem cell research.

Deconstructing the pluripotency gene regulatory network

KAUST Repository

Li, Mo; Belmonte, Juan Carlos Izpisua

2018-01-01

Pluripotent stem cells can be isolated from embryos or derived by reprogramming. Pluripotency is stabilized by an interconnected network of pluripotency genes that cooperatively regulate gene expression. Here we describe the molecular principles of pluripotency gene function and highlight post-transcriptional controls, particularly those induced by RNA-binding proteins and alternative splicing, as an important regulatory layer of pluripotency. We also discuss heterogeneity in pluripotency regulation, alternative pluripotency states and future directions of pluripotent stem cell research.

Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

Science.gov (United States)

Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

2015-04-23

With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

Energy Technology Data Exchange (ETDEWEB)

Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

2003-12-31

Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

Institute of Scientific and Technical Information of China (English)

HSU Heng; Robert L. CHURCH

2004-01-01

During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

A gene regulatory network armature for T-lymphocyte specification

Energy Technology Data Exchange (ETDEWEB)

Fung, Elizabeth-sharon [Los Alamos National Laboratory

2008-01-01

Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.

Evolution and developmental genetics of floral display-A review of progress

Institute of Scientific and Technical Information of China (English)

Qing Ma; Wenheng Zhang; Qiu-Yun (Jenny) Xiang

2017-01-01

Angiosperms evolved a great diversity of ways to display their flowers for reproductive success by variation in floral color,size,shape,scent,arrangements,and flowering time.The various innovations in floral forms and the aggregation of flowers into different kinds of inflorescences can drive new ecological adaptations,speciation,and angiosperm diversification.Evolutionary developmental biology (evo-devo) seeks to uncover the developmental and genetic basis underlying morphological diversification.Advances in the developmental genetics of floral display have provided a foundation for insights into the genetic basis of floral and inflorescence evolution.A number of regulatory genes controlling floral and inflorescence development have been identified in model plants (e.g.,Arabidopsis thaliana,Antirrhinum majus) using forward genetics and conserved functions of many of these genes across diverse non-model species have been revealed by reverse genetics.Gene-regulatory networks that mediated the developmental progresses of floral and inflorescence development have also been established in some plant species.Meanwhile,phylogeny-based comparative analysis of morphological and genetic character has enabled the identification of key evolutionary events that lead to morphological complexity and diversification.Here we review the recent progress on evo-devo studies of floral display including floral symmetry,petal fusion,floral color,floral scent,and inflorescences.We also review the molecular genetic approaches applied to plant evo-devo studies and highlight the future directions of evo-devo.

Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences

Science.gov (United States)

Chandra, Govind; Chater, Keith F

2014-01-01

To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321

Integration of steady-state and temporal gene expression data for the inference of gene regulatory networks.

Science.gov (United States)

Wang, Yi Kan; Hurley, Daniel G; Schnell, Santiago; Print, Cristin G; Crampin, Edmund J

2013-01-01

We develop a new regression algorithm, cMIKANA, for inference of gene regulatory networks from combinations of steady-state and time-series gene expression data. Using simulated gene expression datasets to assess the accuracy of reconstructing gene regulatory networks, we show that steady-state and time-series data sets can successfully be combined to identify gene regulatory interactions using the new algorithm. Inferring gene networks from combined data sets was found to be advantageous when using noisy measurements collected with either lower sampling rates or a limited number of experimental replicates. We illustrate our method by applying it to a microarray gene expression dataset from human umbilical vein endothelial cells (HUVECs) which combines time series data from treatment with growth factor TNF and steady state data from siRNA knockdown treatments. Our results suggest that the combination of steady-state and time-series datasets may provide better prediction of RNA-to-RNA interactions, and may also reveal biological features that cannot be identified from dynamic or steady state information alone. Finally, we consider the experimental design of genomics experiments for gene regulatory network inference and show that network inference can be improved by incorporating steady-state measurements with time-series data.

Finding gene regulatory network candidates using the gene expression knowledge base.

Science.gov (United States)

Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

2014-12-10

Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

Assessment of learning, memory and attention in developmental neurotoxicity regulatory studies: Introduction.

Science.gov (United States)

Makris, Susan L; Vorhees, Charles V

2015-01-01

There are a variety of chemicals, including pharmaceuticals, that alter neurobehavior following developmental exposure and guidelines for the conduct of studies to detect such effects by statute in the United States and Europe. Guidelines for Developmental Neurotoxicity Testing (DNT) studies issued by the U.S. Environmental Protection Agency (EPA) under prevailing law and European Organization for Economic Cooperation and Development (OECD) recommendations to member countries provide that such studies include a series of neurobehavioral and neuropathological assessments. Among these are assessment of cognitive function, specifically learning and memory. After reviewing 69 DNT studies submitted to the EPA, tests of learning and memory were noted to have detected the lowest observed adverse effect level (LOAELs) less frequently than behavioral tests of locomotor activity and acoustic/auditory startle, but slightly more than for the developmental Functional Observational Battery (devFOB; which is less extensive than the full FOB), but the reasons for the lower LOAEL detection rate for learning and memory assessment could not be determined. A major concern identified in the review, however, was the adequacy of the methods employed in these studies rather than on the importance of learning and memory to the proper assessment of brain function. Accordingly, a symposium was conducted to consider how the guidelines for tests of learning and memory might be improved. Four laboratories with established histories investigating the effects of chemical exposures during development on learning, memory, and attention, were invited to review the topic and offer recommendations, both theoretical and practical, on approaches to improve the assessment of these vital CNS functions. Reviewers were asked to recommend methods that are grounded in functional importance to CNS integrity, well-validated, reliable, and amenable to the context of regulatory studies as well as to basic

Prepatterning of developmental gene expression by modified histones before zygotic genome activation

DEFF Research Database (Denmark)

Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.

2011-01-01

A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

Do convergent developmental mechanisms underlie convergent phenotypes?

Science.gov (United States)

Wray, Gregory A.

2002-01-01

Convergence is a pervasive evolutionary process, affecting many aspects of phenotype and even genotype. Relatively little is known about convergence in developmental processes, however, nor about the degree to which convergence in development underlies convergence in anatomy. A switch in the ecology of sea urchins from feeding to nonfeeding larvae illustrates how convergence in development can be associated with convergence in anatomy. Comparisons to more distantly related taxa, however, suggest that this association may be limited to relatively close phylogenetic comparisons. Similarities in gene expression during development provide another window into the association between convergence in developmental processes and convergence in anatomy. Several well-studied transcription factors exhibit likely cases of convergent gene expression in distantly related animal phyla. Convergence in regulatory gene expression domains is probably more common than generally acknowledged, and can arise for several different reasons. Copyright 2002 S. Karger AG, Basel.

Overlapping positive and negative regulatory domains of the human β-interferon gene

International Nuclear Information System (INIS)

Goodbourn, S.; Maniatis, T.

1988-01-01

Virus of poly(I) x poly(C) induction of human β-interferon gene expression requires a 40-base-pair DNA sequence designated the interferon gene regulatory element (IRE). Previous studies have shown that the IRE contains both positive and negative regulatory DNA sequences. To localize these sequences and study their interactions, the authors have examined the effects of a large number of single-base mutations within the IRE on β-interferon gene regulation. They find that the IRE consists of two genetically separable positive regulatory domains and an overlapping negative control sequence. They propose that the β-interferon gene is switched off in uninduced cells by a repressor that blocks the interaction between one of the two positive regulatory sequences and a specific transcription factor. Induction would then lead to inactivation or displacement of the repressor and binding of transcription factors to both positive regulatory domains

Modeling stochasticity and robustness in gene regulatory networks.

Science.gov (United States)

Garg, Abhishek; Mohanram, Kartik; Di Cara, Alessandro; De Micheli, Giovanni; Xenarios, Ioannis

2009-06-15

Understanding gene regulation in biological processes and modeling the robustness of underlying regulatory networks is an important problem that is currently being addressed by computational systems biologists. Lately, there has been a renewed interest in Boolean modeling techniques for gene regulatory networks (GRNs). However, due to their deterministic nature, it is often difficult to identify whether these modeling approaches are robust to the addition of stochastic noise that is widespread in gene regulatory processes. Stochasticity in Boolean models of GRNs has been addressed relatively sparingly in the past, mainly by flipping the expression of genes between different expression levels with a predefined probability. This stochasticity in nodes (SIN) model leads to over representation of noise in GRNs and hence non-correspondence with biological observations. In this article, we introduce the stochasticity in functions (SIF) model for simulating stochasticity in Boolean models of GRNs. By providing biological motivation behind the use of the SIF model and applying it to the T-helper and T-cell activation networks, we show that the SIF model provides more biologically robust results than the existing SIN model of stochasticity in GRNs. Algorithms are made available under our Boolean modeling toolbox, GenYsis. The software binaries can be downloaded from http://si2.epfl.ch/ approximately garg/genysis.html.

Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.

Science.gov (United States)

Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin

2013-09-22

High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.

Semi-supervised prediction of gene regulatory networks using ...

Indian Academy of Sciences (India)

2015-09-28

Sep 28, 2015 ... Use of computational methods to predict gene regulatory networks (GRNs) from gene expression data is a challenging ... two types of methods differ primarily based on whether ..... negligible, allowing us to draw the qualitative conclusions .... research will be conducted to develop additional biologically.

Transcriptional regulatory programs underlying barley germination and regulatory functions of Gibberellin and abscisic acid

Science.gov (United States)

2011-01-01

Background Seed germination is a complex multi-stage developmental process, and mainly accomplished through concerted activities of many gene products and biological pathways that are often subjected to strict developmental regulation. Gibberellins (GA) and abscisic acid (ABA) are two key phytohormones regulating seed germination and seedling growth. However, transcriptional regulatory networks underlying seed germination and its associated biological pathways are largely unknown. Results The studies examined transcriptomes of barley representing six distinct and well characterized germination stages and revealed that the transcriptional regulatory program underlying barley germination was composed of early, late, and post-germination phases. Each phase was accompanied with transcriptional up-regulation of distinct biological pathways. Cell wall synthesis and regulatory components including transcription factors, signaling and post-translational modification components were specifically and transiently up-regulated in early germination phase while histone families and many metabolic pathways were up-regulated in late germination phase. Photosynthesis and seed reserve mobilization pathways were up-regulated in post-germination phase. However, stress related pathways and seed storage proteins were suppressed through the entire course of germination. A set of genes were transiently up-regulated within three hours of imbibition, and might play roles in initiating biological pathways involved in seed germination. However, highly abundant transcripts in dry barley and Arabidopsis seeds were significantly conserved. Comparison with transcriptomes of barley aleurone in response to GA and ABA identified three sets of germination responsive genes that were regulated coordinately by GA, antagonistically by ABA, and coordinately by GA but antagonistically by ABA. Major CHO metabolism, cell wall degradation and protein degradation pathways were up-regulated by both GA and seed

Transcriptional regulatory programs underlying barley germination and regulatory functions of Gibberellin and abscisic acid

Directory of Open Access Journals (Sweden)

Lin Li

2011-06-01

Full Text Available Abstract Background Seed germination is a complex multi-stage developmental process, and mainly accomplished through concerted activities of many gene products and biological pathways that are often subjected to strict developmental regulation. Gibberellins (GA and abscisic acid (ABA are two key phytohormones regulating seed germination and seedling growth. However, transcriptional regulatory networks underlying seed germination and its associated biological pathways are largely unknown. Results The studies examined transcriptomes of barley representing six distinct and well characterized germination stages and revealed that the transcriptional regulatory program underlying barley germination was composed of early, late, and post-germination phases. Each phase was accompanied with transcriptional up-regulation of distinct biological pathways. Cell wall synthesis and regulatory components including transcription factors, signaling and post-translational modification components were specifically and transiently up-regulated in early germination phase while histone families and many metabolic pathways were up-regulated in late germination phase. Photosynthesis and seed reserve mobilization pathways were up-regulated in post-germination phase. However, stress related pathways and seed storage proteins were suppressed through the entire course of germination. A set of genes were transiently up-regulated within three hours of imbibition, and might play roles in initiating biological pathways involved in seed germination. However, highly abundant transcripts in dry barley and Arabidopsis seeds were significantly conserved. Comparison with transcriptomes of barley aleurone in response to GA and ABA identified three sets of germination responsive genes that were regulated coordinately by GA, antagonistically by ABA, and coordinately by GA but antagonistically by ABA. Major CHO metabolism, cell wall degradation and protein degradation pathways were up

Identification of functional elements and regulatory circuits by Drosophila modENCODE.

Science.gov (United States)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis

2010-12-24

To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

Identification and Functional Analysis of Gene Regulatory Sequences Interacting with Colorectal Tumor Suppressors

DEFF Research Database (Denmark)

Dahlgaard, Katja; Troelsen, Jesper

2018-01-01

Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...

Transcriptome profiling reveals regulatory mechanisms underlying Corolla Senescence in Petunia

Science.gov (United States)

Genetic regulatory mechanisms that govern petal natural senescence in petunia is complicated and unclear. To identify key genes and pathways that regulate the process, we initiated a transcriptome analysis in petunia petals at four developmental time points, including petal opening without anthesis ...

Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

Directory of Open Access Journals (Sweden)

Flavia Vischi Winck

Full Text Available The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1 gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF and transcription regulator (TR genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1 and Lcr2 (Low-CO2 response regulator 2, may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome

A guide to approaching regulatory considerations for lentiviral-mediated gene therapies.

Science.gov (United States)

White, Michael; Whittaker, Roger; Stoll, Elizabeth Ann

2017-06-12

Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well-characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is non-pathogenic and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations, and how they are administered in the United Kingdom, although many of the principles will be similar for other regions including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarises the extant regulatory guidance for gene therapies, categorised as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.

Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.

Science.gov (United States)

Huang, Xin; Li, Hao-ming

2009-08-05

Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.

In silico analysis of cis-acting regulatory elements in 5' regulatory regions of sucrose transporter gene families in rice (Oryza sativa Japonica) and Arabidopsis thaliana.

Science.gov (United States)

Ibraheem, Omodele; Botha, Christiaan E J; Bradley, Graeme

2010-12-01

The regulation of gene expression involves a multifarious regulatory system. Each gene contains a unique combination of cis-acting regulatory sequence elements in the 5' regulatory region that determines its temporal and spatial expression. Cis-acting regulatory elements are essential transcriptional gene regulatory units; they control many biological processes and stress responses. Thus a full understanding of the transcriptional gene regulation system will depend on successful functional analyses of cis-acting elements. Cis-acting regulatory elements present within the 5' regulatory region of the sucrose transporter gene families in rice (Oryza sativa Japonica cultivar-group) and Arabidopsis thaliana, were identified using a bioinformatics approach. The possible cis-acting regulatory elements were predicted by scanning 1.5kbp of 5' regulatory regions of the sucrose transporter genes translational start sites, using Plant CARE, PLACE and Genomatix Matinspector professional databases. Several cis-acting regulatory elements that are associated with plant development, plant hormonal regulation and stress response were identified, and were present in varying frequencies within the 1.5kbp of 5' regulatory region, among which are; A-box, RY, CAT, Pyrimidine-box, Sucrose-box, ABRE, ARF, ERE, GARE, Me-JA, ARE, DRE, GA-motif, GATA, GT-1, MYC, MYB, W-box, and I-box. This result reveals the probable cis-acting regulatory elements that possibly are involved in the expression and regulation of sucrose transporter gene families in rice and Arabidopsis thaliana during cellular development or environmental stress conditions. Copyright © 2010 Elsevier Ltd. All rights reserved.

Prioritization of gene regulatory interactions from large-scale modules in yeast

Directory of Open Access Journals (Sweden)

Bringas Ricardo

2008-01-01

Full Text Available Abstract Background The identification of groups of co-regulated genes and their transcription factors, called transcriptional modules, has been a focus of many studies about biological systems. While methods have been developed to derive numerous modules from genome-wide data, individual links between regulatory proteins and target genes still need experimental verification. In this work, we aim to prioritize regulator-target links within transcriptional modules based on three types of large-scale data sources. Results Starting with putative transcriptional modules from ChIP-chip data, we first derive modules in which target genes show both expression and function coherence. The most reliable regulatory links between transcription factors and target genes are established by identifying intersection of target genes in coherent modules for each enriched functional category. Using a combination of genome-wide yeast data in normal growth conditions and two different reference datasets, we show that our method predicts regulatory interactions with significantly higher predictive power than ChIP-chip binding data alone. A comparison with results from other studies highlights that our approach provides a reliable and complementary set of regulatory interactions. Based on our results, we can also identify functionally interacting target genes, for instance, a group of co-regulated proteins related to cell wall synthesis. Furthermore, we report novel conserved binding sites of a glycoprotein-encoding gene, CIS3, regulated by Swi6-Swi4 and Ndd1-Fkh2-Mcm1 complexes. Conclusion We provide a simple method to prioritize individual TF-gene interactions from large-scale transcriptional modules. In comparison with other published works, we predict a complementary set of regulatory interactions which yields a similar or higher prediction accuracy at the expense of sensitivity. Therefore, our method can serve as an alternative approach to prioritization for

Trisomy 21 and facial developmental instability.

Science.gov (United States)

Starbuck, John M; Cole, Theodore M; Reeves, Roger H; Richtsmeier, Joan T

2013-05-01

The most common live-born human aneuploidy is trisomy 21, which causes Down syndrome (DS). Dosage imbalance of genes on chromosome 21 (Hsa21) affects complex gene-regulatory interactions and alters development to produce a wide range of phenotypes, including characteristic facial dysmorphology. Little is known about how trisomy 21 alters craniofacial morphogenesis to create this characteristic appearance. Proponents of the "amplified developmental instability" hypothesis argue that trisomy 21 causes a generalized genetic imbalance that disrupts evolutionarily conserved developmental pathways by decreasing developmental homeostasis and precision throughout development. Based on this model, we test the hypothesis that DS faces exhibit increased developmental instability relative to euploid individuals. Developmental instability was assessed by a statistical analysis of fluctuating asymmetry. We compared the magnitude and patterns of fluctuating asymmetry among siblings using three-dimensional coordinate locations of 20 anatomic landmarks collected from facial surface reconstructions in four age-matched samples ranging from 4 to 12 years: (1) DS individuals (n = 55); (2) biological siblings of DS individuals (n = 55); 3) and 4) two samples of typically developing individuals (n = 55 for each sample), who are euploid siblings and age-matched to the DS individuals and their euploid siblings (samples 1 and 2). Identification in the DS sample of facial prominences exhibiting increased fluctuating asymmetry during facial morphogenesis provides evidence for increased developmental instability in DS faces. We found the highest developmental instability in facial structures derived from the mandibular prominence and lowest in facial regions derived from the frontal prominence. Copyright © 2013 Wiley Periodicals, Inc.

Global Regulatory Differences for Gene- and Cell-Based Therapies

DEFF Research Database (Denmark)

Coppens, Delphi G M; De Bruin, Marie L; Leufkens, Hubert G M

2017-01-01

Gene- and cell-based therapies (GCTs) offer potential new treatment options for unmet medical needs. However, the use of conventional regulatory requirements for medicinal products to approve GCTs may impede patient access and therapeutic innovation. Furthermore, requirements differ between...... jurisdictions, complicating the global regulatory landscape. We provide a comparative overview of regulatory requirements for GCT approval in five jurisdictions and hypothesize on the consequences of the observed global differences on patient access and therapeutic innovation....

Transcriptome analysis elucidates key developmental components of bryozoan lophophore development

KAUST Repository

Wong, Yue Him

2014-10-10

The most recent phylogenomic study suggested that Bryozoa (Ectoprocta), Brachiopoda, and Phoronida are monophyletic, implying that the lophophore of bryozoans, phoronids and brachiopods is a synapomorphy. Understanding the molecular mechanisms of the lophophore development of the Lophophorata clade can therefore provide us a new insight into the formation of the diverse morphological traits in metazoans. In the present study, we profiled the transcriptome of the Bryozoan (Ectoproct) Bugula neritina during the swimming larval stage (SW) and the early (4 h) and late (24 h) metamorphic stages using the Illumina HiSeq2000 platform. Various genes that function in development, the immune response and neurogenesis showed differential expression levels during metamorphosis. In situ hybridization of 23 genes that participate in the Wnt, BMP, Notch, and Hedgehog signaling pathways revealed their regulatory roles in the development of the lophophore and the ancestrula digestive tract. Our findings support the hypothesis that developmental precursors of the lophophore and the ancestrula digestive tract are pre-patterned by the differential expression of key developmental genes according to their fate. This study provides a foundation to better understand the developmental divergence and/or convergence among developmental precursors of the lophophore of bryozoans, branchiopods and phoronids.

SELANSI: a toolbox for simulation of stochastic gene regulatory networks.

Science.gov (United States)

Pájaro, Manuel; Otero-Muras, Irene; Vázquez, Carlos; Alonso, Antonio A

2018-03-01

Gene regulation is inherently stochastic. In many applications concerning Systems and Synthetic Biology such as the reverse engineering and the de novo design of genetic circuits, stochastic effects (yet potentially crucial) are often neglected due to the high computational cost of stochastic simulations. With advances in these fields there is an increasing need of tools providing accurate approximations of the stochastic dynamics of gene regulatory networks (GRNs) with reduced computational effort. This work presents SELANSI (SEmi-LAgrangian SImulation of GRNs), a software toolbox for the simulation of stochastic multidimensional gene regulatory networks. SELANSI exploits intrinsic structural properties of gene regulatory networks to accurately approximate the corresponding Chemical Master Equation with a partial integral differential equation that is solved by a semi-lagrangian method with high efficiency. Networks under consideration might involve multiple genes with self and cross regulations, in which genes can be regulated by different transcription factors. Moreover, the validity of the method is not restricted to a particular type of kinetics. The tool offers total flexibility regarding network topology, kinetics and parameterization, as well as simulation options. SELANSI runs under the MATLAB environment, and is available under GPLv3 license at https://sites.google.com/view/selansi. antonio@iim.csic.es. © The Author(s) 2017. Published by Oxford University Press.

Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.

Science.gov (United States)

Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph

2017-10-01

During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5 , and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.

Synchronous versus asynchronous modeling of gene regulatory networks.

Science.gov (United States)

Garg, Abhishek; Di Cara, Alessandro; Xenarios, Ioannis; Mendoza, Luis; De Micheli, Giovanni

2008-09-01

In silico modeling of gene regulatory networks has gained some momentum recently due to increased interest in analyzing the dynamics of biological systems. This has been further facilitated by the increasing availability of experimental data on gene-gene, protein-protein and gene-protein interactions. The two dynamical properties that are often experimentally testable are perturbations and stable steady states. Although a lot of work has been done on the identification of steady states, not much work has been reported on in silico modeling of cellular differentiation processes. In this manuscript, we provide algorithms based on reduced ordered binary decision diagrams (ROBDDs) for Boolean modeling of gene regulatory networks. Algorithms for synchronous and asynchronous transition models have been proposed and their corresponding computational properties have been analyzed. These algorithms allow users to compute cyclic attractors of large networks that are currently not feasible using existing software. Hereby we provide a framework to analyze the effect of multiple gene perturbation protocols, and their effect on cell differentiation processes. These algorithms were validated on the T-helper model showing the correct steady state identification and Th1-Th2 cellular differentiation process. The software binaries for Windows and Linux platforms can be downloaded from http://si2.epfl.ch/~garg/genysis.html.

The Reconstruction and Analysis of Gene Regulatory Networks.

Science.gov (United States)

Zheng, Guangyong; Huang, Tao

2018-01-01

In post-genomic era, an important task is to explore the function of individual biological molecules (i.e., gene, noncoding RNA, protein, metabolite) and their organization in living cells. For this end, gene regulatory networks (GRNs) are constructed to show relationship between biological molecules, in which the vertices of network denote biological molecules and the edges of network present connection between nodes (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). Biologists can understand not only the function of biological molecules but also the organization of components of living cells through interpreting the GRNs, since a gene regulatory network is a comprehensively physiological map of living cells and reflects influence of genetic and epigenetic factors (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). In this paper, we will review the inference methods of GRN reconstruction and analysis approaches of network structure. As a powerful tool for studying complex diseases and biological processes, the applications of the network method in pathway analysis and disease gene identification will be introduced.

Identifying noncoding risk variants using disease-relevant gene regulatory networks.

Science.gov (United States)

Gao, Long; Uzun, Yasin; Gao, Peng; He, Bing; Ma, Xiaoke; Wang, Jiahui; Han, Shizhong; Tan, Kai

2018-02-16

Identifying noncoding risk variants remains a challenging task. Because noncoding variants exert their effects in the context of a gene regulatory network (GRN), we hypothesize that explicit use of disease-relevant GRNs can significantly improve the inference accuracy of noncoding risk variants. We describe Annotation of Regulatory Variants using Integrated Networks (ARVIN), a general computational framework for predicting causal noncoding variants. It employs a set of novel regulatory network-based features, combined with sequence-based features to infer noncoding risk variants. Using known causal variants in gene promoters and enhancers in a number of diseases, we show ARVIN outperforms state-of-the-art methods that use sequence-based features alone. Additional experimental validation using reporter assay further demonstrates the accuracy of ARVIN. Application of ARVIN to seven autoimmune diseases provides a holistic view of the gene subnetwork perturbed by the combinatorial action of the entire set of risk noncoding mutations.

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

Directory of Open Access Journals (Sweden)

Ishida Betty K

2003-08-01

Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.

Feather development genes and associated regulatory innovation predate the origin of Dinosauria.

Science.gov (United States)

Lowe, Craig B; Clarke, Julia A; Baker, Allan J; Haussler, David; Edwards, Scott V

2015-01-01

The evolution of avian feathers has recently been illuminated by fossils and the identification of genes involved in feather patterning and morphogenesis. However, molecular studies have focused mainly on protein-coding genes. Using comparative genomics and more than 600,000 conserved regulatory elements, we show that patterns of genome evolution in the vicinity of feather genes are consistent with a major role for regulatory innovation in the evolution of feathers. Rates of innovation at feather regulatory elements exhibit an extended period of innovation with peaks in the ancestors of amniotes and archosaurs. We estimate that 86% of such regulatory elements and 100% of the nonkeratin feather gene set were present prior to the origin of Dinosauria. On the branch leading to modern birds, we detect a strong signal of regulatory innovation near insulin-like growth factor binding protein (IGFBP) 2 and IGFBP5, which have roles in body size reduction, and may represent a genomic signature for the miniaturization of dinosaurian body size preceding the origin of flight. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A co-expression gene network associated with developmental regulation of apple fruit acidity.

Science.gov (United States)

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

2015-08-01

Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

Gene regulatory and signaling networks exhibit distinct topological distributions of motifs

Science.gov (United States)

Ferreira, Gustavo Rodrigues; Nakaya, Helder Imoto; Costa, Luciano da Fontoura

2018-04-01

The biological processes of cellular decision making and differentiation involve a plethora of signaling pathways and gene regulatory circuits. These networks in turn exhibit a multitude of motifs playing crucial parts in regulating network activity. Here we compare the topological placement of motifs in gene regulatory and signaling networks and observe that it suggests different evolutionary strategies in motif distribution for distinct cellular subnetworks.

Harnessing diversity towards the reconstructing of large scale gene regulatory networks.

Directory of Open Access Journals (Sweden)

Takeshi Hase

Full Text Available Elucidating gene regulatory network (GRN from large scale experimental data remains a central challenge in systems biology. Recently, numerous techniques, particularly consensus driven approaches combining different algorithms, have become a potentially promising strategy to infer accurate GRNs. Here, we develop a novel consensus inference algorithm, TopkNet that can integrate multiple algorithms to infer GRNs. Comprehensive performance benchmarking on a cloud computing framework demonstrated that (i a simple strategy to combine many algorithms does not always lead to performance improvement compared to the cost of consensus and (ii TopkNet integrating only high-performance algorithms provide significant performance improvement compared to the best individual algorithms and community prediction. These results suggest that a priori determination of high-performance algorithms is a key to reconstruct an unknown regulatory network. Similarity among gene-expression datasets can be useful to determine potential optimal algorithms for reconstruction of unknown regulatory networks, i.e., if expression-data associated with known regulatory network is similar to that with unknown regulatory network, optimal algorithms determined for the known regulatory network can be repurposed to infer the unknown regulatory network. Based on this observation, we developed a quantitative measure of similarity among gene-expression datasets and demonstrated that, if similarity between the two expression datasets is high, TopkNet integrating algorithms that are optimal for known dataset perform well on the unknown dataset. The consensus framework, TopkNet, together with the similarity measure proposed in this study provides a powerful strategy towards harnessing the wisdom of the crowds in reconstruction of unknown regulatory networks.

Establishing neural crest identity: a gene regulatory recipe

Science.gov (United States)

Simões-Costa, Marcos; Bronner, Marianne E.

2015-01-01

The neural crest is a stem/progenitor cell population that contributes to a wide variety of derivatives, including sensory and autonomic ganglia, cartilage and bone of the face and pigment cells of the skin. Unique to vertebrate embryos, it has served as an excellent model system for the study of cell behavior and identity owing to its multipotency, motility and ability to form a broad array of cell types. Neural crest development is thought to be controlled by a suite of transcriptional and epigenetic inputs arranged hierarchically in a gene regulatory network. Here, we examine neural crest development from a gene regulatory perspective and discuss how the underlying genetic circuitry results in the features that define this unique cell population. PMID:25564621

Distinguishing epigenetic marks of developmental and imprinting regulation

Directory of Open Access Journals (Sweden)

McEwen Kirsten R

2010-01-01

Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two

Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.

Directory of Open Access Journals (Sweden)

Xiao-Jian Sun

Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.

Evidence for deep regulatory similarities in early developmental programs across highly diverged insects.

Science.gov (United States)

Kazemian, Majid; Suryamohan, Kushal; Chen, Jia-Yu; Zhang, Yinan; Samee, Md Abul Hassan; Halfon, Marc S; Sinha, Saurabh

2014-09-01

Many genes familiar from Drosophila development, such as the so-called gap, pair-rule, and segment polarity genes, play important roles in the development of other insects and in many cases appear to be deployed in a similar fashion, despite the fact that Drosophila-like "long germband" development is highly derived and confined to a subset of insect families. Whether or not these similarities extend to the regulatory level is unknown. Identification of regulatory regions beyond the well-studied Drosophila has been challenging as even within the Diptera (flies, including mosquitoes) regulatory sequences have diverged past the point of recognition by standard alignment methods. Here, we demonstrate that methods we previously developed for computational cis-regulatory module (CRM) discovery in Drosophila can be used effectively in highly diverged (250-350 Myr) insect species including Anopheles gambiae, Tribolium castaneum, Apis mellifera, and Nasonia vitripennis. In Drosophila, we have successfully used small sets of known CRMs as "training data" to guide the search for other CRMs with related function. We show here that although species-specific CRM training data do not exist, training sets from Drosophila can facilitate CRM discovery in diverged insects. We validate in vivo over a dozen new CRMs, roughly doubling the number of known CRMs in the four non-Drosophila species. Given the growing wealth of Drosophila CRM annotation, these results suggest that extensive regulatory sequence annotation will be possible in newly sequenced insects without recourse to costly and labor-intensive genome-scale experiments. We develop a new method, Regulus, which computes a probabilistic score of similarity based on binding site composition (despite the absence of nucleotide-level sequence alignment), and demonstrate similarity between functionally related CRMs from orthologous loci. Our work represents an important step toward being able to trace the evolutionary history of gene

Evidence for Deep Regulatory Similarities in Early Developmental Programs across Highly Diverged Insects

Science.gov (United States)

Zhang, Yinan; Samee, Md. Abul Hassan; Halfon, Marc S.; Sinha, Saurabh

2014-01-01

Many genes familiar from Drosophila development, such as the so-called gap, pair-rule, and segment polarity genes, play important roles in the development of other insects and in many cases appear to be deployed in a similar fashion, despite the fact that Drosophila-like “long germband” development is highly derived and confined to a subset of insect families. Whether or not these similarities extend to the regulatory level is unknown. Identification of regulatory regions beyond the well-studied Drosophila has been challenging as even within the Diptera (flies, including mosquitoes) regulatory sequences have diverged past the point of recognition by standard alignment methods. Here, we demonstrate that methods we previously developed for computational cis-regulatory module (CRM) discovery in Drosophila can be used effectively in highly diverged (250–350 Myr) insect species including Anopheles gambiae, Tribolium castaneum, Apis mellifera, and Nasonia vitripennis. In Drosophila, we have successfully used small sets of known CRMs as “training data” to guide the search for other CRMs with related function. We show here that although species-specific CRM training data do not exist, training sets from Drosophila can facilitate CRM discovery in diverged insects. We validate in vivo over a dozen new CRMs, roughly doubling the number of known CRMs in the four non-Drosophila species. Given the growing wealth of Drosophila CRM annotation, these results suggest that extensive regulatory sequence annotation will be possible in newly sequenced insects without recourse to costly and labor-intensive genome-scale experiments. We develop a new method, Regulus, which computes a probabilistic score of similarity based on binding site composition (despite the absence of nucleotide-level sequence alignment), and demonstrate similarity between functionally related CRMs from orthologous loci. Our work represents an important step toward being able to trace the evolutionary

Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence

DEFF Research Database (Denmark)

Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

2004-01-01

Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these......Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus...... for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise...... to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby...

Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence

DEFF Research Database (Denmark)

Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

2004-01-01

for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise...... to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby...... influencing the phenotype, illness severity, and adult outcome of tic disorders. Similar developmental processes during adolescence likely determine the phenotype and natural history of a broad range of other complex neuropsychiatric disorders of childhood onset, and they likely contribute to the acquisition...

The search for evolutionary developmental origins of aging in zebrafish: a novel intersection of developmental and senescence biology in the zebrafish model system.

Science.gov (United States)

Kishi, Shuji

2011-09-01

Senescence may be considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena during the process of aging. We investigated whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We conducted experiments to isolate zebrafish mutants expressing an apparent senescence phenotype during embryogenesis (embryonic senescence). Some of the genes we thereby identified had already been associated with cellular senescence and chronological aging in other organisms, but many had not yet been linked to these processes. Complete loss-of-function of developmentally essential genes induce embryonic (or larval) lethality, whereas it seems like their partial loss-of-function (i.e., decrease-of-function by heterozygote or hypomorphic mutations) still remains sufficient to go through the early developmental process because of its adaptive plasticity or rather heterozygote advantage. However, in some cases, such partial loss-of-function of genes compromise normal homeostasis due to haploinsufficiency later in adult life having many environmental stress challenges. By contrast, any heterozygote-advantageous genes might gain a certain benefit(s) (much more fitness) by such partial loss-of-function later in life. Physiological senescence may evolutionarily arise from both genetic and epigenetic drifts as well as from losing adaptive developmental plasticity in face of stress signals from the external environment that interacts with functions of multiple genes rather than effects of only a single gene mutation or defect. Previously uncharacterized developmental genes may thus mediate the aging process and play a pivotal role in senescence. Moreover, unexpected senescence-related genes might also be involved in the early developmental process and

A distinct regulatory region of the Bmp5 locus activates gene expression following adult bone fracture or soft tissue injury.

Science.gov (United States)

Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M

2015-08-01

Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals. Copyright © 2015 Elsevier Inc. All rights reserved.

Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

Science.gov (United States)

Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

2014-12-01

Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

CoryneRegNet 4.0 – A reference database for corynebacterial gene regulatory networks

Directory of Open Access Journals (Sweden)

Baumbach Jan

2007-11-01

Full Text Available Abstract Background Detailed information on DNA-binding transcription factors (the key players in the regulation of gene expression and on transcriptional regulatory interactions of microorganisms deduced from literature-derived knowledge, computer predictions and global DNA microarray hybridization experiments, has opened the way for the genome-wide analysis of transcriptional regulatory networks. The large-scale reconstruction of these networks allows the in silico analysis of cell behavior in response to changing environmental conditions. We previously published CoryneRegNet, an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks. Initially, it was designed to provide methods for the analysis and visualization of the gene regulatory network of Corynebacterium glutamicum. Results Now we introduce CoryneRegNet release 4.0, which integrates data on the gene regulatory networks of 4 corynebacteria, 2 mycobacteria and the model organism Escherichia coli K12. As the previous versions, CoryneRegNet provides a web-based user interface to access the database content, to allow various queries, and to support the reconstruction, analysis and visualization of regulatory networks at different hierarchical levels. In this article, we present the further improved database content of CoryneRegNet along with novel analysis features. The network visualization feature GraphVis now allows the inter-species comparisons of reconstructed gene regulatory networks and the projection of gene expression levels onto that networks. Therefore, we added stimulon data directly into the database, but also provide Web Service access to the DNA microarray analysis platform EMMA. Additionally, CoryneRegNet now provides a SOAP based Web Service server, which can easily be consumed by other bioinformatics software systems. Stimulons (imported from the database, or uploaded by the user can be analyzed in the context of known

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

Science.gov (United States)

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

On the Interplay between Entropy and Robustness of Gene Regulatory Networks

Directory of Open Access Journals (Sweden)

Bor-Sen Chen

2010-05-01

Full Text Available The interplay between entropy and robustness of gene network is a core mechanism of systems biology. The entropy is a measure of randomness or disorder of a physical system due to random parameter fluctuation and environmental noises in gene regulatory networks. The robustness of a gene regulatory network, which can be measured as the ability to tolerate the random parameter fluctuation and to attenuate the effect of environmental noise, will be discussed from the robust H∞ stabilization and filtering perspective. In this review, we will also discuss their balancing roles in evolution and potential applications in systems and synthetic biology.

DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions

Science.gov (United States)

Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.

2011-01-01

The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518

An oscillopathic approach to developmental dyslexia: From genes to speech processing.

Science.gov (United States)

Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio

2017-06-30

Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.

The Composite Regulatory Basis of the Large X-Effect in Mouse Speciation.

Science.gov (United States)

Larson, Erica L; Keeble, Sara; Vanderpool, Dan; Dean, Matthew D; Good, Jeffrey M

2017-02-01

The disruption of meiotic sex chromosome inactivation (MSCI) has been proposed to be a major developmental mechanism underlying the rapid evolution of hybrid male sterility. We tested this idea by analyzing cell-specific gene expression across spermatogenesis in two lineages of house mice and their sterile and fertile reciprocal hybrids. We found pervasive disruption of sex chromosome gene expression in sterile hybrids at every stage of spermatogenesis. Failure of MSCI was developmentally preceded by increased silencing of autosomal genes, supporting the hypothesis that divergence at the hybrid incompatibility gene, Prdm9, results in increased rates of autosomal asynapsis which in turn triggers widespread silencing of unsynapsed chromatin. We also detected opposite patterns of postmeiotic overexpression or hyper-repression of the sex chromosomes in reciprocal hybrids, supporting the hypothesis that genomic conflict has driven functional divergence that leads to deleterious X-Y dosage imbalances in hybrids. Our developmental timeline also exposed more subtle patterns of mitotic misregulation on the X chromosome, a previously undocumented stage of spermatogenic disruption in this cross. These results indicate that multiple hybrid incompatibilities have converged on a common regulatory phenotype, the disrupted expression of the sex chromosomes during spermatogenesis. Collectively, these data reveal a composite regulatory basis to hybrid male sterility in mice that helps resolve the mechanistic underpinnings of the well-documented large X-effect in mice speciation. We propose that the inherent sensitivity of spermatogenesis to X-linked regulatory disruption has the potential to be a major driver of reproductive isolation in species with chromosomal sex determination. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Interrogating the topological robustness of gene regulatory circuits by randomization.

Directory of Open Access Journals (Sweden)

Bin Huang

2017-03-01

Full Text Available One of the most important roles of cells is performing their cellular tasks properly for survival. Cells usually achieve robust functionality, for example, cell-fate decision-making and signal transduction, through multiple layers of regulation involving many genes. Despite the combinatorial complexity of gene regulation, its quantitative behavior has been typically studied on the basis of experimentally verified core gene regulatory circuitry, composed of a small set of important elements. It is still unclear how such a core circuit operates in the presence of many other regulatory molecules and in a crowded and noisy cellular environment. Here we report a new computational method, named random circuit perturbation (RACIPE, for interrogating the robust dynamical behavior of a gene regulatory circuit even without accurate measurements of circuit kinetic parameters. RACIPE generates an ensemble of random kinetic models corresponding to a fixed circuit topology, and utilizes statistical tools to identify generic properties of the circuit. By applying RACIPE to simple toggle-switch-like motifs, we observed that the stable states of all models converge to experimentally observed gene state clusters even when the parameters are strongly perturbed. RACIPE was further applied to a proposed 22-gene network of the Epithelial-to-Mesenchymal Transition (EMT, from which we identified four experimentally observed gene states, including the states that are associated with two different types of hybrid Epithelial/Mesenchymal phenotypes. Our results suggest that dynamics of a gene circuit is mainly determined by its topology, not by detailed circuit parameters. Our work provides a theoretical foundation for circuit-based systems biology modeling. We anticipate RACIPE to be a powerful tool to predict and decode circuit design principles in an unbiased manner, and to quantitatively evaluate the robustness and heterogeneity of gene expression.

Dynamic CRM occupancy reflects a temporal map of developmental progression.

Science.gov (United States)

Wilczyński, Bartek; Furlong, Eileen E M

2010-06-22

Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.

Convergent occurrence of the developmental hourglass in plant and animal embryogenesis?

Science.gov (United States)

Cridge, Andrew G; Dearden, Peter K; Brownfield, Lynette R

2016-04-01

The remarkable similarity of animal embryos at particular stages of development led to the proposal of a developmental hourglass. In this model, early events in development are less conserved across species but lead to a highly conserved 'phylotypic period'. Beyond this stage, the model suggests that development once again becomes less conserved, leading to the diversity of forms. Recent comparative studies of gene expression in animal groups have provided strong support for the hourglass model. How and why might such an hourglass pattern be generated? More importantly, how might early acting events in development evolve while still maintaining a later conserved stage? The discovery that an hourglass pattern may also exist in the embryogenesis of plants provides comparative data that may help us explain this phenomenon. Whether the developmental hourglass occurs in plants, and what this means for our understanding of embryogenesis in plants and animals is discussed. Models by which conserved early-acting genes might change their functional role in the evolution of gene networks, how networks buffer these changes, and how that might constrain, or confer diversity, of the body plan are also discused. Evidence of a morphological and molecular hourglass in plant and animal embryogenesis suggests convergent evolution. This convergence is likely due to developmental constraints imposed upon embryogenesis by the need to produce a viable embryo with an established body plan, controlled by the architecture of the underlying gene regulatory networks. As the body plan is largely laid down during the middle phases of embryo development in plants and animals, then it is perhaps not surprising this stage represents the narrow waist of the hourglass where the gene regulatory networks are the oldest and most robust and integrated, limiting species diversity and constraining morphological space. © The Author 2016. Published by Oxford University Press on behalf of the Annals of

An extended Kalman filtering approach to modeling nonlinear dynamic gene regulatory networks via short gene expression time series.

Science.gov (United States)

Wang, Zidong; Liu, Xiaohui; Liu, Yurong; Liang, Jinling; Vinciotti, Veronica

2009-01-01

In this paper, the extended Kalman filter (EKF) algorithm is applied to model the gene regulatory network from gene time series data. The gene regulatory network is considered as a nonlinear dynamic stochastic model that consists of the gene measurement equation and the gene regulation equation. After specifying the model structure, we apply the EKF algorithm for identifying both the model parameters and the actual value of gene expression levels. It is shown that the EKF algorithm is an online estimation algorithm that can identify a large number of parameters (including parameters of nonlinear functions) through iterative procedure by using a small number of observations. Four real-world gene expression data sets are employed to demonstrate the effectiveness of the EKF algorithm, and the obtained models are evaluated from the viewpoint of bioinformatics.

Fused Regression for Multi-source Gene Regulatory Network Inference.

Directory of Open Access Journals (Sweden)

Kari Y Lam

2016-12-01

Full Text Available Understanding gene regulatory networks is critical to understanding cellular differentiation and response to external stimuli. Methods for global network inference have been developed and applied to a variety of species. Most approaches consider the problem of network inference independently in each species, despite evidence that gene regulation can be conserved even in distantly related species. Further, network inference is often confined to single data-types (single platforms and single cell types. We introduce a method for multi-source network inference that allows simultaneous estimation of gene regulatory networks in multiple species or biological processes through the introduction of priors based on known gene relationships such as orthology incorporated using fused regression. This approach improves network inference performance even when orthology mapping and conservation are incomplete. We refine this method by presenting an algorithm that extracts the true conserved subnetwork from a larger set of potentially conserved interactions and demonstrate the utility of our method in cross species network inference. Last, we demonstrate our method's utility in learning from data collected on different experimental platforms.

Predictive minimum description length principle approach to inferring gene regulatory networks.

Science.gov (United States)

Chaitankar, Vijender; Zhang, Chaoyang; Ghosh, Preetam; Gong, Ping; Perkins, Edward J; Deng, Youping

2011-01-01

Reverse engineering of gene regulatory networks using information theory models has received much attention due to its simplicity, low computational cost, and capability of inferring large networks. One of the major problems with information theory models is to determine the threshold that defines the regulatory relationships between genes. The minimum description length (MDL) principle has been implemented to overcome this problem. The description length of the MDL principle is the sum of model length and data encoding length. A user-specified fine tuning parameter is used as control mechanism between model and data encoding, but it is difficult to find the optimal parameter. In this work, we propose a new inference algorithm that incorporates mutual information (MI), conditional mutual information (CMI), and predictive minimum description length (PMDL) principle to infer gene regulatory networks from DNA microarray data. In this algorithm, the information theoretic quantities MI and CMI determine the regulatory relationships between genes and the PMDL principle method attempts to determine the best MI threshold without the need of a user-specified fine tuning parameter. The performance of the proposed algorithm is evaluated using both synthetic time series data sets and a biological time series data set (Saccharomyces cerevisiae). The results show that the proposed algorithm produced fewer false edges and significantly improved the precision when compared to existing MDL algorithm.

Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

International Nuclear Information System (INIS)

Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

2005-01-01

Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

Mutual information and the fidelity of response of gene regulatory models

International Nuclear Information System (INIS)

Tabbaa, Omar P; Jayaprakash, C

2014-01-01

We investigate cellular response to extracellular signals by using information theory techniques motivated by recent experiments. We present results for the steady state of the following gene regulatory models found in both prokaryotic and eukaryotic cells: a linear transcription-translation model and a positive or negative auto-regulatory model. We calculate both the information capacity and the mutual information exactly for simple models and approximately for the full model. We find that (1) small changes in mutual information can lead to potentially important changes in cellular response and (2) there are diminishing returns in the fidelity of response as the mutual information increases. We calculate the information capacity using Gillespie simulations of a model for the TNF-α-NF-κ B network and find good agreement with the measured value for an experimental realization of this network. Our results provide a quantitative understanding of the differences in cellular response when comparing experimentally measured mutual information values of different gene regulatory models. Our calculations demonstrate that Gillespie simulations can be used to compute the mutual information of more complex gene regulatory models, providing a potentially useful tool in synthetic biology. (paper)

Ancient Pbx-Hox signatures define hundreds of vertebrate developmental enhancers

Directory of Open Access Journals (Sweden)

Parker Hugo J

2011-12-01

Full Text Available Abstract Background Gene regulation through cis-regulatory elements plays a crucial role in development and disease. A major aim of the post-genomic era is to be able to read the function of cis-regulatory elements through scrutiny of their DNA sequence. Whilst comparative genomics approaches have identified thousands of putative regulatory elements, our knowledge of their mechanism of action is poor and very little progress has been made in systematically de-coding them. Results Here, we identify ancient functional signatures within vertebrate conserved non-coding elements (CNEs through a combination of phylogenetic footprinting and functional assay, using genomic sequence from the sea lamprey as a reference. We uncover a striking enrichment within vertebrate CNEs for conserved binding-site motifs of the Pbx-Hox hetero-dimer. We further show that these predict reporter gene expression in a segment specific manner in the hindbrain and pharyngeal arches during zebrafish development. Conclusions These findings evoke an evolutionary scenario in which many CNEs evolved early in the vertebrate lineage to co-ordinate Hox-dependent gene-regulatory interactions that pattern the vertebrate head. In a broader context, our evolutionary analyses reveal that CNEs are composed of tightly linked transcription-factor binding-sites (TFBSs, which can be systematically identified through phylogenetic footprinting approaches. By placing a large number of ancient vertebrate CNEs into a developmental context, our findings promise to have a significant impact on efforts toward de-coding gene-regulatory elements that underlie vertebrate development, and will facilitate building general models of regulatory element evolution.

Computational challenges in modeling gene regulatory events.

Science.gov (United States)

Pataskar, Abhijeet; Tiwari, Vijay K

2016-10-19

Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

Gene Circuit Analysis of the Terminal Gap Gene huckebein

Science.gov (United States)

Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

2009-01-01

The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network. PMID:19876378

Developmental regulation of Xenopus 5S RNA genes

International Nuclear Information System (INIS)

Wormington, W.M.; Schlissel, M.; Brown, D.D.

1983-01-01

In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

International Nuclear Information System (INIS)

Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.

2008-01-01

The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

Science.gov (United States)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

Energy Technology Data Exchange (ETDEWEB)

Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

2003-06-01

OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

The Evolution of Lineage-Specific Regulatory Activities in the Human Embryonic Limb

OpenAIRE

Cotney, Justin; Leng, Jing; Yin, Jun; Reilly, Steven K.; DeMare, Laura E.; Emera, Deena; Ayoub, Albert E.; Rakic, Pasko; Noonan, James P.

2013-01-01

The evolution of human anatomical features likely involved changes in gene regulation during development. However, the nature and extent of human-specific developmental regulatory functions remain unknown. We obtained a genome-wide view of cis-regulatory evolution in human embryonic tissues by comparing the histone modification H3K27ac, which provides a quantitative readout of promoter and enhancer activity, during human, rhesus, and mouse limb development. Based on increased H3K27ac, we find...

Comparative analysis of chromatin landscape in regulatory regions of human housekeeping and tissue specific genes

Directory of Open Access Journals (Sweden)

Dasgupta Dipayan

2005-05-01

Full Text Available Abstract Background Global regulatory mechanisms involving chromatin assembly and remodelling in the promoter regions of genes is implicated in eukaryotic transcription control especially for genes subjected to spatial and temporal regulation. The potential to utilise global regulatory mechanisms for controlling gene expression might depend upon the architecture of the chromatin in and around the gene. In-silico analysis can yield important insights into this aspect, facilitating comparison of two or more classes of genes comprising of a large number of genes within each group. Results In the present study, we carried out a comparative analysis of chromatin characteristics in terms of the scaffold/matrix attachment regions, nucleosome formation potential and the occurrence of repetitive sequences, in the upstream regulatory regions of housekeeping and tissue specific genes. Our data show that putative scaffold/matrix attachment regions are more abundant and nucleosome formation potential is higher in the 5' regions of tissue specific genes as compared to the housekeeping genes. Conclusion The differences in the chromatin features between the two groups of genes indicate the involvement of chromatin organisation in the control of gene expression. The presence of global regulatory mechanisms mediated through chromatin organisation can decrease the burden of invoking gene specific regulators for maintenance of the active/silenced state of gene expression. This could partially explain the lower number of genes estimated in the human genome.

Inference of gene regulatory networks with sparse structural equation models exploiting genetic perturbations.

Directory of Open Access Journals (Sweden)

Xiaodong Cai

Full Text Available Integrating genetic perturbations with gene expression data not only improves accuracy of regulatory network topology inference, but also enables learning of causal regulatory relations between genes. Although a number of methods have been developed to integrate both types of data, the desiderata of efficient and powerful algorithms still remains. In this paper, sparse structural equation models (SEMs are employed to integrate both gene expression data and cis-expression quantitative trait loci (cis-eQTL, for modeling gene regulatory networks in accordance with biological evidence about genes regulating or being regulated by a small number of genes. A systematic inference method named sparsity-aware maximum likelihood (SML is developed for SEM estimation. Using simulated directed acyclic or cyclic networks, the SML performance is compared with that of two state-of-the-art algorithms: the adaptive Lasso (AL based scheme, and the QTL-directed dependency graph (QDG method. Computer simulations demonstrate that the novel SML algorithm offers significantly better performance than the AL-based and QDG algorithms across all sample sizes from 100 to 1,000, in terms of detection power and false discovery rate, in all the cases tested that include acyclic or cyclic networks of 10, 30 and 300 genes. The SML method is further applied to infer a network of 39 human genes that are related to the immune function and are chosen to have a reliable eQTL per gene. The resulting network consists of 9 genes and 13 edges. Most of the edges represent interactions reasonably expected from experimental evidence, while the remaining may just indicate the emergence of new interactions. The sparse SEM and efficient SML algorithm provide an effective means of exploiting both gene expression and perturbation data to infer gene regulatory networks. An open-source computer program implementing the SML algorithm is freely available upon request.

Toward understanding the evolution of vertebrate gene regulatory networks: comparative genomics and epigenomic approaches.

Science.gov (United States)

Martinez-Morales, Juan R

2016-07-01

Vertebrates, as most animal phyla, originated >500 million years ago during the Cambrian explosion, and progressively radiated into the extant classes. Inferring the evolutionary history of the group requires understanding the architecture of the developmental programs that constrain the vertebrate anatomy. Here, I review recent comparative genomic and epigenomic studies, based on ChIP-seq and chromatin accessibility, which focus on the identification of functionally equivalent cis-regulatory modules among species. This pioneer work, primarily centered in the mammalian lineage, has set the groundwork for further studies in representative vertebrate and chordate species. Mapping of active regulatory regions across lineages will shed new light on the evolutionary forces stabilizing ancestral developmental programs, as well as allowing their variation to sustain morphological adaptations on the inherited vertebrate body plan. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

Energy Technology Data Exchange (ETDEWEB)

Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

2005-01-05

A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

Simple mathematical models of gene regulatory dynamics

CERN Document Server

Mackey, Michael C; Tyran-Kamińska, Marta; Zeron, Eduardo S

2016-01-01

This is a short and self-contained introduction to the field of mathematical modeling of gene-networks in bacteria. As an entry point to the field, we focus on the analysis of simple gene-network dynamics. The notes commence with an introduction to the deterministic modeling of gene-networks, with extensive reference to applicable results coming from dynamical systems theory. The second part of the notes treats extensively several approaches to the study of gene-network dynamics in the presence of noise—either arising from low numbers of molecules involved, or due to noise external to the regulatory process. The third and final part of the notes gives a detailed treatment of three well studied and concrete examples of gene-network dynamics by considering the lactose operon, the tryptophan operon, and the lysis-lysogeny switch. The notes contain an index for easy location of particular topics as well as an extensive bibliography of the current literature. The target audience of these notes are mainly graduat...

Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

Science.gov (United States)

Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

2005-02-01

cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

Fractal gene regulatory networks for robust locomotion control of modular robots

DEFF Research Database (Denmark)

Zahadat, Payam; Christensen, David Johan; Schultz, Ulrik Pagh

2010-01-01

Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed and the ......Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed...

Identifying time-delayed gene regulatory networks via an evolvable hierarchical recurrent neural network.

Science.gov (United States)

Kordmahalleh, Mina Moradi; Sefidmazgi, Mohammad Gorji; Harrison, Scott H; Homaifar, Abdollah

2017-01-01

The modeling of genetic interactions within a cell is crucial for a basic understanding of physiology and for applied areas such as drug design. Interactions in gene regulatory networks (GRNs) include effects of transcription factors, repressors, small metabolites, and microRNA species. In addition, the effects of regulatory interactions are not always simultaneous, but can occur after a finite time delay, or as a combined outcome of simultaneous and time delayed interactions. Powerful biotechnologies have been rapidly and successfully measuring levels of genetic expression to illuminate different states of biological systems. This has led to an ensuing challenge to improve the identification of specific regulatory mechanisms through regulatory network reconstructions. Solutions to this challenge will ultimately help to spur forward efforts based on the usage of regulatory network reconstructions in systems biology applications. We have developed a hierarchical recurrent neural network (HRNN) that identifies time-delayed gene interactions using time-course data. A customized genetic algorithm (GA) was used to optimize hierarchical connectivity of regulatory genes and a target gene. The proposed design provides a non-fully connected network with the flexibility of using recurrent connections inside the network. These features and the non-linearity of the HRNN facilitate the process of identifying temporal patterns of a GRN. Our HRNN method was implemented with the Python language. It was first evaluated on simulated data representing linear and nonlinear time-delayed gene-gene interaction models across a range of network sizes and variances of noise. We then further demonstrated the capability of our method in reconstructing GRNs of the Saccharomyces cerevisiae synthetic network for in vivo benchmarking of reverse-engineering and modeling approaches (IRMA). We compared the performance of our method to TD-ARACNE, HCC-CLINDE, TSNI and ebdbNet across different network

The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism

Science.gov (United States)

Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong

2011-01-01

Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…

Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes

KAUST Repository

Othoum, Ghofran K

2013-05-01

Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using

Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes

KAUST Repository

Othoum, Ghofran K

2013-01-01

Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using

Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

Science.gov (United States)

Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

2007-08-01

Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

Applying a Developmental Framework to the Self-Regulatory Difficulties of Young Children with Prenatal Alcohol Exposure: A Review.

Science.gov (United States)

Reid, Natasha; Petrenko, Christie L M

2018-06-01

Prenatal alcohol exposure (PAE) can be associated with significant difficulties in self-regulatory abilities. As such, interventions have been developed that focus on improving varying aspects of self-regulation for this population. The application of a multilevel theoretical framework that describes the development of self-regulation during early childhood could further advance the field. First, this framework could assist in elucidating mechanisms in the trajectories of early adjustment problems in this population and, second, informing the development of more precise assessment and interventions for those affected by PAE. The aims of the current review were to provide an overview of the self-regulatory framework proposed by Calkins and colleagues (e.g., Calkins, 2007; Calkins and Fox, 2002); examine the self-regulatory difficulties that are commonly experienced during infancy (i.e., 0 to 2 years) and early childhood (i.e., 3 to 8 years) in children with PAE in the context of the developmental framework; and describe how the framework can inform the development of future assessment and intervention provision for young children with PAE. The application of a developmental framework, such as proposed by Calkins and colleagues, allows for a systematic and theoretically driven approach to assessment and intervention programs for young children with PAE. Copyright © 2018 by the Research Society on Alcoholism.

Transcriptomic Analysis of Long Non-Coding RNAs and Coding Genes Uncovers a Complex Regulatory Network That Is Involved in Maize Seed Development

Directory of Open Access Journals (Sweden)

Ming Zhu

2017-10-01

Full Text Available Long non-coding RNAs (lncRNAs have been reported to be involved in the development of maize plant. However, few focused on seed development of maize. Here, we identified 753 lncRNA candidates in maize genome from six seed samples. Similar to the mRNAs, lncRNAs showed tissue developmental stage specific and differential expression, indicating their putative role in seed development. Increasing evidence shows that crosstalk among RNAs mediated by shared microRNAs (miRNAs represents a novel layer of gene regulation, which plays important roles in plant development. Functional roles and regulatory mechanisms of lncRNAs as competing endogenous RNAs (ceRNA in plants, particularly in maize seed development, are unclear. We combined analyses of consistently altered 17 lncRNAs, 840 mRNAs and known miRNA to genome-wide investigate potential lncRNA-mediated ceRNA based on “ceRNA hypothesis”. The results uncovered seven novel lncRNAs as potential functional ceRNAs. Functional analyses based on their competitive coding-gene partners by Gene Ontology (GO and KEGG biological pathway demonstrated that combined effects of multiple ceRNAs can have major impacts on general developmental and metabolic processes in maize seed. These findings provided a useful platform for uncovering novel mechanisms of maize seed development and may provide opportunities for the functional characterization of individual lncRNA in future studies.

Gene regulatory network inference by point-based Gaussian approximation filters incorporating the prior information.

Science.gov (United States)

Jia, Bin; Wang, Xiaodong

2013-12-17

: The extended Kalman filter (EKF) has been applied to inferring gene regulatory networks. However, it is well known that the EKF becomes less accurate when the system exhibits high nonlinearity. In addition, certain prior information about the gene regulatory network exists in practice, and no systematic approach has been developed to incorporate such prior information into the Kalman-type filter for inferring the structure of the gene regulatory network. In this paper, an inference framework based on point-based Gaussian approximation filters that can exploit the prior information is developed to solve the gene regulatory network inference problem. Different point-based Gaussian approximation filters, including the unscented Kalman filter (UKF), the third-degree cubature Kalman filter (CKF3), and the fifth-degree cubature Kalman filter (CKF5) are employed. Several types of network prior information, including the existing network structure information, sparsity assumption, and the range constraint of parameters, are considered, and the corresponding filters incorporating the prior information are developed. Experiments on a synthetic network of eight genes and the yeast protein synthesis network of five genes are carried out to demonstrate the performance of the proposed framework. The results show that the proposed methods provide more accurate inference results than existing methods, such as the EKF and the traditional UKF.

Comparison of evolutionary algorithms in gene regulatory network model inference.

LENUS (Irish Health Repository)

2010-01-01

ABSTRACT: BACKGROUND: The evolution of high throughput technologies that measure gene expression levels has created a data base for inferring GRNs (a process also known as reverse engineering of GRNs). However, the nature of these data has made this process very difficult. At the moment, several methods of discovering qualitative causal relationships between genes with high accuracy from microarray data exist, but large scale quantitative analysis on real biological datasets cannot be performed, to date, as existing approaches are not suitable for real microarray data which are noisy and insufficient. RESULTS: This paper performs an analysis of several existing evolutionary algorithms for quantitative gene regulatory network modelling. The aim is to present the techniques used and offer a comprehensive comparison of approaches, under a common framework. Algorithms are applied to both synthetic and real gene expression data from DNA microarrays, and ability to reproduce biological behaviour, scalability and robustness to noise are assessed and compared. CONCLUSIONS: Presented is a comparison framework for assessment of evolutionary algorithms, used to infer gene regulatory networks. Promising methods are identified and a platform for development of appropriate model formalisms is established.

Singular Perturbation Analysis and Gene Regulatory Networks with Delay

Science.gov (United States)

Shlykova, Irina; Ponosov, Arcady

2009-09-01

There are different ways of how to model gene regulatory networks. Differential equations allow for a detailed description of the network's dynamics and provide an explicit model of the gene concentration changes over time. Production and relative degradation rate functions used in such models depend on the vector of steeply sloped threshold functions which characterize the activity of genes. The most popular example of the threshold functions comes from the Boolean network approach, where the threshold functions are given by step functions. The system of differential equations becomes then piecewise linear. The dynamics of this system can be described very easily between the thresholds, but not in the switching domains. For instance this approach fails to analyze stationary points of the system and to define continuous solutions in the switching domains. These problems were studied in [2], [3], but the proposed model did not take into account a time delay in cellular systems. However, analysis of real gene expression data shows a considerable number of time-delayed interactions suggesting that time delay is essential in gene regulation. Therefore, delays may have a great effect on the dynamics of the system presenting one of the critical factors that should be considered in reconstruction of gene regulatory networks. The goal of this work is to apply the singular perturbation analysis to certain systems with delay and to obtain an analog of Tikhonov's theorem, which provides sufficient conditions for constracting the limit system in the delay case.

Transcriptional signatures of ancient floral developmental genetics in avocado (Persea americana; Lauraceae).

Science.gov (United States)

Chanderbali, André S; Albert, Victor A; Leebens-Mack, Jim; Altman, Naomi S; Soltis, Douglas E; Soltis, Pamela S

2009-06-02

The debate on the origin and evolution of flowers has recently entered the field of developmental genetics, with focus on the design of the ancestral floral regulatory program. Flowers can differ dramatically among angiosperm lineages, but in general, male and female reproductive organs surrounded by a sterile perianth of sepals and petals constitute the basic floral structure. However, the basal angiosperm lineages exhibit spectacular diversity in the number, arrangement, and structure of floral organs, whereas the evolutionarily derived monocot and eudicot lineages share a far more uniform floral ground plan. Here we show that broadly overlapping transcriptional programs characterize the floral transcriptome of the basal angiosperm Persea americana (avocado), whereas floral gene expression domains are considerably more organ specific in the model eudicot Arabidopsis thaliana. Our findings therefore support the "fading borders" model for organ identity determination in basal angiosperm flowers and extend it from the action of regulatory genes to downstream transcriptional programs. Furthermore, the declining expression of components of the staminal transcriptome in central and peripheral regions of Persea flowers concurs with elements of a previous hypothesis for developmental regulation in a gymnosperm "floral progenitor." Accordingly, in contrast to the canalized organ-specific regulatory apparatus of Arabidopsis, floral development may have been originally regulated by overlapping transcriptional cascades with fading gradients of influence from focal to bordering organs.

The gene regulatory network for breast cancer: Integrated regulatory landscape of cancer hallmarks

Directory of Open Access Journals (Sweden)

Frank eEmmert-Streib

2014-02-01

Full Text Available In this study, we infer the breast cancer gene regulatory network from gene expression data. This network is obtained from the application of the BC3Net inference algorithm to a large-scale gene expression data set consisting of $351$ patient samples. In order to elucidate the functional relevance of the inferred network, we are performing a Gene Ontology (GO analysis for its structural components. Our analysis reveals that most significant GO-terms we find for the breast cancer network represent functional modules of biological processes that are described by known cancer hallmarks, including translation, immune response, cell cycle, organelle fission, mitosis, cell adhesion, RNA processing, RNA splicing and response to wounding. Furthermore, by using a curated list of census cancer genes, we find an enrichment in these functional modules. Finally, we study cooperative effects of chromosomes based on information of interacting genes in the beast cancer network. We find that chromosome $21$ is most coactive with other chromosomes. To our knowledge this is the first study investigating the genome-scale breast cancer network.

Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues.

Directory of Open Access Journals (Sweden)

Daifeng Cheng

Full Text Available To accurately assess gene expression levels, it is essential to normalize real-time quantitative PCR (RT-qPCR data with suitable internal reference genes. For the red imported fire ant, Solenopsis invicta, reliable reference genes to assess the transcript expression levels of the target genes have not been previously investigated. In this study, we examined the expression levels of five candidate reference genes (rpl18, ef1-beta, act, GAPDH, and tbp in different developmental stages, castes and tissues of S. invicta. To evaluate the suitability of these genes as endogenous controls, three software-based approaches (geNorm, BestKeeper and NormFinder and one web-based comprehensive tool (RefFinder were used to analyze and rank the tested genes. Furthermore, the optimal number of reference gene(s was determined by the pairwise variation value. Our data showed that two of the five candidate genes, rpl18 and ef1-beta, were the most suitable reference genes because they have the most stable expression among different developmental stages, castes and tissues in S. invicta. Although widely used as reference gene in other species, in S. invicta the act gene has high variation in expression and was consequently excluded as a reliable reference gene. The two validated reference genes, rpl18 and ef1-beta, can be widely used for quantification of target gene expression with RT-qPCR technology in S. invicta.

An integer optimization algorithm for robust identification of non-linear gene regulatory networks

Directory of Open Access Journals (Sweden)

Chemmangattuvalappil Nishanth

2012-09-01

Full Text Available Abstract Background Reverse engineering gene networks and identifying regulatory interactions are integral to understanding cellular decision making processes. Advancement in high throughput experimental techniques has initiated innovative data driven analysis of gene regulatory networks. However, inherent noise associated with biological systems requires numerous experimental replicates for reliable conclusions. Furthermore, evidence of robust algorithms directly exploiting basic biological traits are few. Such algorithms are expected to be efficient in their performance and robust in their prediction. Results We have developed a network identification algorithm to accurately infer both the topology and strength of regulatory interactions from time series gene expression data in the presence of significant experimental noise and non-linear behavior. In this novel formulism, we have addressed data variability in biological systems by integrating network identification with the bootstrap resampling technique, hence predicting robust interactions from limited experimental replicates subjected to noise. Furthermore, we have incorporated non-linearity in gene dynamics using the S-system formulation. The basic network identification formulation exploits the trait of sparsity of biological interactions. Towards that, the identification algorithm is formulated as an integer-programming problem by introducing binary variables for each network component. The objective function is targeted to minimize the network connections subjected to the constraint of maximal agreement between the experimental and predicted gene dynamics. The developed algorithm is validated using both in silico and experimental data-sets. These studies show that the algorithm can accurately predict the topology and connection strength of the in silico networks, as quantified by high precision and recall, and small discrepancy between the actual and predicted kinetic parameters

Inferring nonlinear gene regulatory networks from gene expression data based on distance correlation.

Directory of Open Access Journals (Sweden)

Xiaobo Guo

Full Text Available Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs. It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC curve and the precision-recall (PR curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference.

Gene duplication as a major force in evolution

Indian Academy of Sciences (India)

Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

International STakeholder NETwork (ISTNET): creating a developmental neurotoxicity (DNT) testing road map for regulatory purposes.

Science.gov (United States)

Bal-Price, Anna; Crofton, Kevin M; Leist, Marcel; Allen, Sandra; Arand, Michael; Buetler, Timo; Delrue, Nathalie; FitzGerald, Rex E; Hartung, Thomas; Heinonen, Tuula; Hogberg, Helena; Bennekou, Susanne Hougaard; Lichtensteiger, Walter; Oggier, Daniela; Paparella, Martin; Axelstad, Marta; Piersma, Aldert; Rached, Eva; Schilter, Benoît; Schmuck, Gabriele; Stoppini, Luc; Tongiorgi, Enrico; Tiramani, Manuela; Monnet-Tschudi, Florianne; Wilks, Martin F; Ylikomi, Timo; Fritsche, Ellen

2015-02-01

A major problem in developmental neurotoxicity (DNT) risk assessment is the lack of toxicological hazard information for most compounds. Therefore, new approaches are being considered to provide adequate experimental data that allow regulatory decisions. This process requires a matching of regulatory needs on the one hand and the opportunities provided by new test systems and methods on the other hand. Alignment of academically and industrially driven assay development with regulatory needs in the field of DNT is a core mission of the International STakeholder NETwork (ISTNET) in DNT testing. The first meeting of ISTNET was held in Zurich on 23-24 January 2014 in order to explore the concept of adverse outcome pathway (AOP) to practical DNT testing. AOPs were considered promising tools to promote test systems development according to regulatory needs. Moreover, the AOP concept was identified as an important guiding principle to assemble predictive integrated testing strategies (ITSs) for DNT. The recommendations on a road map towards AOP-based DNT testing is considered a stepwise approach, operating initially with incomplete AOPs for compound grouping, and focussing on key events of neurodevelopment. Next steps to be considered in follow-up activities are the use of case studies to further apply the AOP concept in regulatory DNT testing, making use of AOP intersections (common key events) for economic development of screening assays, and addressing the transition from qualitative descriptions to quantitative network modelling.

Influence of the experimental design of gene expression studies on the inference of gene regulatory networks: environmental factors

Directory of Open Access Journals (Sweden)

Frank Emmert-Streib

2013-02-01

Full Text Available The inference of gene regulatory networks gained within recent years a considerable interest in the biology and biomedical community. The purpose of this paper is to investigate the influence that environmental conditions can exhibit on the inference performance of network inference algorithms. Specifically, we study five network inference methods, Aracne, BC3NET, CLR, C3NET and MRNET, and compare the results for three different conditions: (I observational gene expression data: normal environmental condition, (II interventional gene expression data: growth in rich media, (III interventional gene expression data: normal environmental condition interrupted by a positive spike-in stimulation. Overall, we find that different statistical inference methods lead to comparable, but condition-specific results. Further, our results suggest that non-steady-state data enhance the inferability of regulatory networks.

CONDOR: a database resource of developmentally associated conserved non-coding elements

Directory of Open Access Journals (Sweden)

Smith Sarah

2007-08-01

Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

Self-Regulatory Skill Among Children with and without Developmental Coordination Disorder: An Exploratory Study.

Science.gov (United States)

Sangster Jokić, Claire A; Whitebread, David

2016-11-01

Children with developmental coordination disorder (DCD) experience difficulty learning and performing everyday motor tasks due to poor motor coordination. Recent research applying a cognitive learning paradigm has argued that children with DCD have less effective cognitive and metacognitive skills with which to effectively acquire motor skills. However, there is currently limited research examining individual differences in children's use of self-regulatory and metacognitive skill during motor learning. This exploratory study aimed to compare the self-regulatory performance of children with and without DCD. Using a mixed methods approach, this study observed and compared the self-regulatory behavior of 15 children with and without DCD, aged between 7 and 9 years, during socially mediated motor practice. Observation was conducted using a quantitative coding scheme and qualitative analysis of video-recorded sessions. This paper will focus on the results of quantitative analysis, while data arising from the qualitative analysis will be used to support quantitative findings. In general, findings indicate that children with DCD exhibit less independent and more ineffective self-regulatory skill during motor learning than their typically developing peers. In addition, children with DCD rely more heavily on external support for effective regulation and are more likely to exhibit negative patterns of motivational regulation. These findings provide further support for the notion that children with DCD experience difficulty effectively self-regulating motor learning. Implications for practice and directions for future research are discussed.

Identification of sparsely distributed clusters of cis-regulatory elements in sets of co-expressed genes

OpenAIRE

Kreiman, Gabriel

2004-01-01

Sequence information and high‐throughput methods to measure gene expression levels open the door to explore transcriptional regulation using computational tools. Combinatorial regulation and sparseness of regulatory elements throughout the genome allow organisms to control the spatial and temporal patterns of gene expression. Here we study the organization of cis‐regulatory elements in sets of co‐regulated genes. We build an algorithm to search for combinations of transcription factor binding...

Inferring the conservative causal core of gene regulatory networks

Directory of Open Access Journals (Sweden)

Emmert-Streib Frank

2010-09-01

Full Text Available Abstract Background Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. Results In this paper, we introduce a novel gene regulatory network inference (GRNI algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. Conclusions For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.

Inferring the conservative causal core of gene regulatory networks.

Science.gov (United States)

Altay, Gökmen; Emmert-Streib, Frank

2010-09-28

Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. In this paper, we introduce a novel gene regulatory network inference (GRNI) algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.

Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

Directory of Open Access Journals (Sweden)

Allan Andrew C

2008-07-01

Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

The R2R3-MYB-like regulatory factor EOBI, acting downstream of EOBII, regulates scent production by activating ODO1 and structural scent-related genes in petunia.

Science.gov (United States)

Spitzer-Rimon, Ben; Farhi, Moran; Albo, Boaz; Cna'ani, Alon; Ben Zvi, Michal Moyal; Masci, Tania; Edelbaum, Orit; Yu, Yixun; Shklarman, Elena; Ovadis, Marianna; Vainstein, Alexander

2012-12-01

Flower scent is a highly dynamic trait, under developmental, spatial, and diurnal regulation. The mechanism governing scent production is only beginning to be unraveled. In petunia (Petunia hybrida), EMISSION OF BENZENOIDS II (EOBII) controls transcription of both the shikimate pathway-regulating MYB factor ODORANT1 (ODO1) and phenylpropanoid scent-related structural genes. A promoter-activation screen identified an R2R3-MYB-like regulatory factor of phenylpropanoid volatile biosynthesis acting downstream of EOBII, designated EOBI. EOBI silencing led to downregulation of ODO1 and numerous structural scent-related genes from both the shikimate and phenylpropanoid pathways. The ability of EOBI to directly activate ODO1, as revealed by electrophoretic mobility shift assay and yeast one-hybrid analysis, place EOBI upstream of ODO1 in regulating substrate availability for volatile biosynthesis. Interestingly, ODO1-silenced transgenic petunia flowers accumulated higher EOBI transcript levels than controls, suggesting a complex feedback loop between these regulatory factors. The accumulation pattern of EOBI transcript relative to EOBII and ODO1, and the effect of up/downregulation of EOBII on transcript levels of EOBI and ODO1, further support these factors' hierarchical relationships. The dependence of scent production on EOBI expression and its direct interaction with both regulatory and structural genes provide evidence for EOBI's wide-ranging involvement in the production of floral volatiles.

Rapid male-specific regulatory divergence and down regulation of spermatogenesis genes in Drosophila species hybrids.

Directory of Open Access Journals (Sweden)

Jennifer Ferguson

Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.

Conservation and co-option in developmental programmes: the importance of homology relationships

Directory of Open Access Journals (Sweden)

Becker May-Britt

2005-10-01

Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.

Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida

DEFF Research Database (Denmark)

Bojanovic, Klara

evolved numerous mechanisms to controlgene expression in response to specific environmental signals. In addition to two-component systems, small regulatory RNAs (sRNAs) have emerged as major regulators of gene expression. The majority of sRNAs bind to mRNA and regulate their expression. They often have...... multiple targets and are incorporated into large regulatory networks and the RNA chaper one Hfq in many cases facilitates interactions between sRNAs and their targets. Some sRNAs also act by binding to protein targets and sequestering their function. In this PhD thesis we investigated the transcriptional....... Detailed insights into the mechanisms through which P. putida responds to different stress conditions and increased understanding of bacterial adaptation in natural and industrial settings were gained. Additionally, we identified genome-wide transcription start sites, andmany regulatory RNA elements...

Trichomes: different regulatory networks lead to convergent structures.

Science.gov (United States)

Serna, Laura; Martin, Cathie

2006-06-01

Sometimes, proteins, biological structures or even organisms have similar functions and appearances but have evolved through widely divergent pathways. There is experimental evidence to suggest that different developmental pathways have converged to produce similar outgrowths of the aerial plant epidermis, referred to as trichomes. The emerging picture suggests that trichomes in Arabidopsis thaliana and, perhaps, in cotton develop through a transcriptional regulatory network that differs from those regulating trichome formation in Antirrhinum and Solanaceous species. Several lines of evidence suggest that the duplication of a gene controlling anthocyanin production and subsequent divergence might be the major force driving trichome formation in Arabidopsis, whereas the multicellular trichomes of Antirrhinum and Solanaceous species appear to have a different regulatory origin.

Limb development: a paradigm of gene regulation.

Science.gov (United States)

Petit, Florence; Sears, Karen E; Ahituv, Nadav

2017-04-01

The limb is a commonly used model system for developmental biology. Given the need for precise control of complex signalling pathways to achieve proper patterning, the limb is also becoming a model system for gene regulation studies. Recent developments in genomic technologies have enabled the genome-wide identification of regulatory elements that control limb development, yielding insights into the determination of limb morphology and forelimb versus hindlimb identity. The modulation of regulatory interactions - for example, through the modification of regulatory sequences or chromatin architecture - can lead to morphological evolution, acquired regeneration capacity or limb malformations in diverse species, including humans.

Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

Science.gov (United States)

Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

2018-02-01

The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

Multiple regulatory roles of the mouse transmembrane adaptor protein NTAL in gene transcription and mast cell physiology.

Directory of Open Access Journals (Sweden)

Iva Polakovicova

Full Text Available Non-T cell activation linker (NTAL; also called LAB or LAT2 is a transmembrane adaptor protein that is expressed in a subset of hematopoietic cells, including mast cells. There are conflicting reports on the role of NTAL in the high affinity immunoglobulin E receptor (FcεRI signaling. Studies carried out on mast cells derived from mice with NTAL knock out (KO and wild type mice suggested that NTAL is a negative regulator of FcεRI signaling, while experiments with RNAi-mediated NTAL knockdown (KD in human mast cells and rat basophilic leukemia cells suggested its positive regulatory role. To determine whether different methodologies of NTAL ablation (KO vs KD have different physiological consequences, we compared under well defined conditions FcεRI-mediated signaling events in mouse bone marrow-derived mast cells (BMMCs with NTAL KO or KD. BMMCs with both NTAL KO and KD exhibited enhanced degranulation, calcium mobilization, chemotaxis, tyrosine phosphorylation of LAT and ERK, and depolymerization of filamentous actin. These data provide clear evidence that NTAL is a negative regulator of FcεRI activation events in murine BMMCs, independently of possible compensatory developmental alterations. To gain further insight into the role of NTAL in mast cells, we examined the transcriptome profiles of resting and antigen-activated NTAL KO, NTAL KD, and corresponding control BMMCs. Through this analysis we identified several genes that were differentially regulated in nonactivated and antigen-activated NTAL-deficient cells, when compared to the corresponding control cells. Some of the genes seem to be involved in regulation of cholesterol-dependent events in antigen-mediated chemotaxis. The combined data indicate multiple regulatory roles of NTAL in gene expression and mast cell physiology.

The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes

Science.gov (United States)

Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

2018-01-01

Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203

The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.

Science.gov (United States)

Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

2018-04-01

The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.

Asymmetrical distribution of non-conserved regulatory sequences at PHOX2B is reflected at the ENCODE loci and illuminates a possible genome-wide trend

Directory of Open Access Journals (Sweden)

McCallion Andrew S

2009-01-01

Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in

CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

Science.gov (United States)

Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

2012-07-01

Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

Genotet: An Interactive Web-based Visual Exploration Framework to Support Validation of Gene Regulatory Networks.

Science.gov (United States)

Yu, Bowen; Doraiswamy, Harish; Chen, Xi; Miraldi, Emily; Arrieta-Ortiz, Mario Luis; Hafemeister, Christoph; Madar, Aviv; Bonneau, Richard; Silva, Cláudio T

2014-12-01

Elucidation of transcriptional regulatory networks (TRNs) is a fundamental goal in biology, and one of the most important components of TRNs are transcription factors (TFs), proteins that specifically bind to gene promoter and enhancer regions to alter target gene expression patterns. Advances in genomic technologies as well as advances in computational biology have led to multiple large regulatory network models (directed networks) each with a large corpus of supporting data and gene-annotation. There are multiple possible biological motivations for exploring large regulatory network models, including: validating TF-target gene relationships, figuring out co-regulation patterns, and exploring the coordination of cell processes in response to changes in cell state or environment. Here we focus on queries aimed at validating regulatory network models, and on coordinating visualization of primary data and directed weighted gene regulatory networks. The large size of both the network models and the primary data can make such coordinated queries cumbersome with existing tools and, in particular, inhibits the sharing of results between collaborators. In this work, we develop and demonstrate a web-based framework for coordinating visualization and exploration of expression data (RNA-seq, microarray), network models and gene-binding data (ChIP-seq). Using specialized data structures and multiple coordinated views, we design an efficient querying model to support interactive analysis of the data. Finally, we show the effectiveness of our framework through case studies for the mouse immune system (a dataset focused on a subset of key cellular functions) and a model bacteria (a small genome with high data-completeness).

DMPD: Type I interferon [corrected] gene induction by the interferon regulatory factorfamily of transcription factors. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 16979567 Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...ng) (.svg) (.html) (.csml) Show Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...orrected] gene induction by the interferon regulatory factorfamily of transcription factors. Authors Honda K

Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

Science.gov (United States)

Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

2010-05-16

Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

Effectively identifying regulatory hotspots while capturing expression heterogeneity in gene expression studies

Science.gov (United States)

2014-01-01

Expression quantitative trait loci (eQTL) mapping is a tool that can systematically identify genetic variation affecting gene expression. eQTL mapping studies have shown that certain genomic locations, referred to as regulatory hotspots, may affect the expression levels of many genes. Recently, studies have shown that various confounding factors may induce spurious regulatory hotspots. Here, we introduce a novel statistical method that effectively eliminates spurious hotspots while retaining genuine hotspots. Applied to simulated and real datasets, we validate that our method achieves greater sensitivity while retaining low false discovery rates compared to previous methods. PMID:24708878

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Science.gov (United States)

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Directory of Open Access Journals (Sweden)

Daniel Meier

Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Evolution of New cis-Regulatory Motifs Required for Cell-Specific Gene Expression in Caenorhabditis.

Directory of Open Access Journals (Sweden)

Michalis Barkoulas

2016-09-01

Full Text Available Patterning of C. elegans vulval cell fates relies on inductive signaling. In this induction event, a single cell, the gonadal anchor cell, secretes LIN-3/EGF and induces three out of six competent precursor cells to acquire a vulval fate. We previously showed that this developmental system is robust to a four-fold variation in lin-3/EGF genetic dose. Here using single-molecule FISH, we find that the mean level of expression of lin-3 in the anchor cell is remarkably conserved. No change in lin-3 expression level could be detected among C. elegans wild isolates and only a low level of change-less than 30%-in the Caenorhabditis genus and in Oscheius tipulae. In C. elegans, lin-3 expression in the anchor cell is known to require three transcription factor binding sites, specifically two E-boxes and a nuclear-hormone-receptor (NHR binding site. Mutation of any of these three elements in C. elegans results in a dramatic decrease in lin-3 expression. Yet only a single E-box is found in the Drosophilae supergroup of Caenorhabditis species, including C. angaria, while the NHR-binding site likely only evolved at the base of the Elegans group. We find that a transgene from C. angaria bearing a single E-box is sufficient for normal expression in C. elegans. Even a short 58 bp cis-regulatory fragment from C. angaria with this single E-box is able to replace the three transcription factor binding sites at the endogenous C. elegans lin-3 locus, resulting in the wild-type expression level. Thus, regulatory evolution occurring in cis within a 58 bp lin-3 fragment, results in a strict requirement for the NHR binding site and a second E-box in C. elegans. This single-cell, single-molecule, quantitative and functional evo-devo study demonstrates that conserved expression levels can hide extensive change in cis-regulatory site requirements and highlights the evolution of new cis-regulatory elements required for cell-specific gene expression.

‘Developmental Delay’ Reconsidered: The Critical Role of Age-Dependent, Co-variant Development

Directory of Open Access Journals (Sweden)

Yonata Levy

2018-04-01

Full Text Available In memory of Annette Karmiloff-Smith.This paper reviews recent neurobiological research reporting structural co-variance and temporal dependencies in age-dependent gene expression, parameters of cortical maturation, long range connectivity and interaction of the biological network with the environment. This research suggests that age by size trajectories of brain structures relate to functional properties more than absolute sizes. In line with these findings, recent behavioral studies of typically developing children whose language development was delayed reported long term consequences of such delays. As for neurodevelopmental disorders, disrupted developmental timing and slow acquisitional pace are hallmarks of these populations. It is argued that these behavioral and neuro-biological results highlight the need to commit to a developmental model which will reflect the fact that temporal dependencies overseeing structural co-variance among developmental components are major regulatory factors of typical development of the brain/mind network. Consequently, the concept of ‘developmental delay’ in developmental theorizing needs to be reconsidered.

Ribosomal protein gene knockdown causes developmental defects in zebrafish.

Directory of Open Access Journals (Sweden)

Tamayo Uechi

Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

The nomenclature of MHC class I gene regulatory regions - the case of two different downstream regulatory elements

Czech Academy of Sciences Publication Activity Database

Hatina, J.; Jansa, Petr; Forejt, Jiří

2001-01-01

Roč. 37, 12-13 (2001), s. 799-800 ISSN 0161-5890 Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC I gene regulatory elements Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.973, year: 2001

A Meta-Analysis of Multiple Matched Copy Number and Transcriptomics Data Sets for Inferring Gene Regulatory Relationships

Science.gov (United States)

Newton, Richard; Wernisch, Lorenz

2014-01-01

Inferring gene regulatory relationships from observational data is challenging. Manipulation and intervention is often required to unravel causal relationships unambiguously. However, gene copy number changes, as they frequently occur in cancer cells, might be considered natural manipulation experiments on gene expression. An increasing number of data sets on matched array comparative genomic hybridisation and transcriptomics experiments from a variety of cancer pathologies are becoming publicly available. Here we explore the potential of a meta-analysis of thirty such data sets. The aim of our analysis was to assess the potential of in silico inference of trans-acting gene regulatory relationships from this type of data. We found sufficient correlation signal in the data to infer gene regulatory relationships, with interesting similarities between data sets. A number of genes had highly correlated copy number and expression changes in many of the data sets and we present predicted potential trans-acted regulatory relationships for each of these genes. The study also investigates to what extent heterogeneity between cell types and between pathologies determines the number of statistically significant predictions available from a meta-analysis of experiments. PMID:25148247

The PaPsr1 and PaWhi2 genes are members of the regulatory network that connect stationary phase to mycelium differentiation and reproduction in Podospora anserina.

Science.gov (United States)

Timpano, Hélène; Chan Ho Tong, Laetitia; Gautier, Valérie; Lalucque, Hervé; Silar, Philippe

2016-09-01

In filamentous fungi, entrance into stationary phase is complex as it is accompanied by several differentiation and developmental processes, including the synthesis of pigments, aerial hyphae, anastomoses and sporophores. The regulatory networks that control these processes are still incompletely known. The analysis of the "Impaired in the development of Crippled Growth (IDC)" mutants of the model filamentous ascomycete Podospora anserina has already yielded important information regarding the pathway regulating entrance into stationary phase. Here, the genes affected in two additional IDC mutants are identified as orthologues of the Saccharomyces cerevisiae WHI2 and PSR1 genes, known to regulate stationary phase in this yeast, arguing for a conserved role of these proteins throughout the evolution of ascomycetes. Copyright © 2016 Elsevier Inc. All rights reserved.

Construction of an integrated gene regulatory network link to stress-related immune system in cattle.

Science.gov (United States)

Behdani, Elham; Bakhtiarizadeh, Mohammad Reza

2017-10-01

The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.

On the dynamics of a gene regulatory network

International Nuclear Information System (INIS)

Grammaticos, B; Carstea, A S; Ramani, A

2006-01-01

We examine the dynamics of a network of genes focusing on a periodic chain of genes, of arbitrary length. We show that within a given class of sigmoids representing the equilibrium probability of the binding of the RNA polymerase to the core promoter, the system possesses a single stable fixed point. By slightly modifying the sigmoid, introducing 'stiffer' forms, we show that it is possible to find network configurations exhibiting bistable behaviour. Our results do not depend crucially on the length of the chain considered: calculations with finite chains lead to similar results. However, a realistic study of regulatory genetic networks would require the consideration of more complex topologies and interactions

Identification of functional elements and regulatory circuits by Drosophila modENCODE

Energy Technology Data Exchange (ETDEWEB)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

2010-12-22

To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

Statistical identification of gene association by CID in application of constructing ER regulatory network

Directory of Open Access Journals (Sweden)

Lien Huang-Chun

2009-03-01

Full Text Available Abstract Background A variety of high-throughput techniques are now available for constructing comprehensive gene regulatory networks in systems biology. In this study, we report a new statistical approach for facilitating in silico inference of regulatory network structure. The new measure of association, coefficient of intrinsic dependence (CID, is model-free and can be applied to both continuous and categorical distributions. When given two variables X and Y, CID answers whether Y is dependent on X by examining the conditional distribution of Y given X. In this paper, we apply CID to analyze the regulatory relationships between transcription factors (TFs (X and their downstream genes (Y based on clinical data. More specifically, we use estrogen receptor α (ERα as the variable X, and the analyses are based on 48 clinical breast cancer gene expression arrays (48A. Results The analytical utility of CID was evaluated in comparison with four commonly used statistical methods, Galton-Pearson's correlation coefficient (GPCC, Student's t-test (STT, coefficient of determination (CoD, and mutual information (MI. When being compared to GPCC, CoD, and MI, CID reveals its preferential ability to discover the regulatory association where distribution of the mRNA expression levels on X and Y does not fit linear models. On the other hand, when CID is used to measure the association of a continuous variable (Y against a discrete variable (X, it shows similar performance as compared to STT, and appears to outperform CoD and MI. In addition, this study established a two-layer transcriptional regulatory network to exemplify the usage of CID, in combination with GPCC, in deciphering gene networks based on gene expression profiles from patient arrays. Conclusion CID is shown to provide useful information for identifying associations between genes and transcription factors of interest in patient arrays. When coupled with the relationships detected by GPCC, the

Syndromes associated with Homo sapiens pol II regulatory genes.

Science.gov (United States)

Bina, M; Demmon, S; Pares-Matos, E I

2000-01-01

The molecular basis of human characteristics is an intriguing but an unresolved problem. Human characteristics cover a broad spectrum, from the obvious to the abstract. Obvious characteristics may include morphological features such as height, shape, and facial form. Abstract characteristics may be hidden in processes that are controlled by hormones and the human brain. In this review we examine exaggerated characteristics presented as syndromes. Specifically, we focus on human genes that encode transcription factors to examine morphological, immunological, and hormonal anomalies that result from deletion, insertion, or mutation of genes that regulate transcription by RNA polymerase II (the Pol II genes). A close analysis of abnormal phenotypes can give clues into how sequence variations in regulatory genes and changes in transcriptional control may give rise to characteristics defined as complex traits.

A flood-based information flow analysis and network minimization method for gene regulatory networks.

Science.gov (United States)

Pavlogiannis, Andreas; Mozhayskiy, Vadim; Tagkopoulos, Ilias

2013-04-24

Biological networks tend to have high interconnectivity, complex topologies and multiple types of interactions. This renders difficult the identification of sub-networks that are involved in condition- specific responses. In addition, we generally lack scalable methods that can reveal the information flow in gene regulatory and biochemical pathways. Doing so will help us to identify key participants and paths under specific environmental and cellular context. This paper introduces the theory of network flooding, which aims to address the problem of network minimization and regulatory information flow in gene regulatory networks. Given a regulatory biological network, a set of source (input) nodes and optionally a set of sink (output) nodes, our task is to find (a) the minimal sub-network that encodes the regulatory program involving all input and output nodes and (b) the information flow from the source to the sink nodes of the network. Here, we describe a novel, scalable, network traversal algorithm and we assess its potential to achieve significant network size reduction in both synthetic and E. coli networks. Scalability and sensitivity analysis show that the proposed method scales well with the size of the network, and is robust to noise and missing data. The method of network flooding proves to be a useful, practical approach towards information flow analysis in gene regulatory networks. Further extension of the proposed theory has the potential to lead in a unifying framework for the simultaneous network minimization and information flow analysis across various "omics" levels.

An overview of the gene regulatory network controlling trichome development in the model plant, Arabidopsis

Directory of Open Access Journals (Sweden)

Sitakanta ePattanaik

2014-06-01

Full Text Available Trichomes are specialized epidermal cells located on aerial parts of plants and are associated with a wide array of biological processes. Trichomes protect plants from adverse conditions including UV light and herbivore attack and are also an important source of a number of phytochemicals. The simple unicellular trichomes of Arabidopsis serve as an excellent model to study molecular mechanism of cell differentiation and pattern formation in plants. The emerging picture suggests that the developmental process is controlled by a transcriptional network involving three major groups of transcription factors: the R2R3 MYB, basic helix-loop-helix (bHLH and WD40 repeat (WDR protein. These regulatory proteins form a trimeric activator complex that positively regulates trichome development. The single repeat R3 MYBs act as negative regulators of trichome development. They compete with the R2R3 MYBs to bind the bHLH factor and form a repressor complex. In addition to activator-repressor mechanism, a depletion mechanism may operate in parallel during trichome development. In this mechanism, the bHLH factor traps the WDR protein which results in depletion of WDR protein in neighboring cells. Consequently, the cells with high levels of bHLH and WDR proteins are developed into trichomes. A group of C2H2 zinc finger TFs has also been implicated in trichome development. Phytohormones, including gibberellins and jasmonic acid, play significant roles in this developmental process. Recently, microRNAs have been shown to be involved in trichome development. Furthermore, it has been demonstrated that the activities of the key regulatory proteins involved in trichome development are controlled by the 26S/ubiquitin proteasome system (UPS, highlighting the complexity of the regulatory network controlling this developmental process. To complement several excellent recent relevant reviews, this review focuses on the transcriptional network and hormonal interplay

The R2R3-MYB–Like Regulatory Factor EOBI, Acting Downstream of EOBII, Regulates Scent Production by Activating ODO1 and Structural Scent-Related Genes in Petunia[C][W

Science.gov (United States)

Spitzer-Rimon, Ben; Farhi, Moran; Albo, Boaz; Cna’ani, Alon; Ben Zvi, Michal Moyal; Masci, Tania; Edelbaum, Orit; Yu, Yixun; Shklarman, Elena; Ovadis, Marianna; Vainstein, Alexander

2012-01-01

Flower scent is a highly dynamic trait, under developmental, spatial, and diurnal regulation. The mechanism governing scent production is only beginning to be unraveled. In petunia (Petunia hybrida), EMISSION OF BENZENOIDS II (EOBII) controls transcription of both the shikimate pathway-regulating MYB factor ODORANT1 (ODO1) and phenylpropanoid scent-related structural genes. A promoter-activation screen identified an R2R3-MYB–like regulatory factor of phenylpropanoid volatile biosynthesis acting downstream of EOBII, designated EOBI. EOBI silencing led to downregulation of ODO1 and numerous structural scent-related genes from both the shikimate and phenylpropanoid pathways. The ability of EOBI to directly activate ODO1, as revealed by electrophoretic mobility shift assay and yeast one-hybrid analysis, place EOBI upstream of ODO1 in regulating substrate availability for volatile biosynthesis. Interestingly, ODO1-silenced transgenic petunia flowers accumulated higher EOBI transcript levels than controls, suggesting a complex feedback loop between these regulatory factors. The accumulation pattern of EOBI transcript relative to EOBII and ODO1, and the effect of up/downregulation of EOBII on transcript levels of EOBI and ODO1, further support these factors' hierarchical relationships. The dependence of scent production on EOBI expression and its direct interaction with both regulatory and structural genes provide evidence for EOBI’s wide-ranging involvement in the production of floral volatiles. PMID:23275577

An approach for reduction of false predictions in reverse engineering of gene regulatory networks.

Science.gov (United States)

Khan, Abhinandan; Saha, Goutam; Pal, Rajat Kumar

2018-05-14

A gene regulatory network discloses the regulatory interactions amongst genes, at a particular condition of the human body. The accurate reconstruction of such networks from time-series genetic expression data using computational tools offers a stiff challenge for contemporary computer scientists. This is crucial to facilitate the understanding of the proper functioning of a living organism. Unfortunately, the computational methods produce many false predictions along with the correct predictions, which is unwanted. Investigations in the domain focus on the identification of as many correct regulations as possible in the reverse engineering of gene regulatory networks to make it more reliable and biologically relevant. One way to achieve this is to reduce the number of incorrect predictions in the reconstructed networks. In the present investigation, we have proposed a novel scheme to decrease the number of false predictions by suitably combining several metaheuristic techniques. We have implemented the same using a dataset ensemble approach (i.e. combining multiple datasets) also. We have employed the proposed methodology on real-world experimental datasets of the SOS DNA Repair network of Escherichia coli and the IMRA network of Saccharomyces cerevisiae. Subsequently, we have experimented upon somewhat larger, in silico networks, namely, DREAM3 and DREAM4 Challenge networks, and 15-gene and 20-gene networks extracted from the GeneNetWeaver database. To study the effect of multiple datasets on the quality of the inferred networks, we have used four datasets in each experiment. The obtained results are encouraging enough as the proposed methodology can reduce the number of false predictions significantly, without using any supplementary prior biological information for larger gene regulatory networks. It is also observed that if a small amount of prior biological information is incorporated here, the results improve further w.r.t. the prediction of true positives

Learning a Markov Logic network for supervised gene regulatory network inference.

Science.gov (United States)

Brouard, Céline; Vrain, Christel; Dubois, Julie; Castel, David; Debily, Marie-Anne; d'Alché-Buc, Florence

2013-09-12

Gene regulatory network inference remains a challenging problem in systems biology despite the numerous approaches that have been proposed. When substantial knowledge on a gene regulatory network is already available, supervised network inference is appropriate. Such a method builds a binary classifier able to assign a class (Regulation/No regulation) to an ordered pair of genes. Once learnt, the pairwise classifier can be used to predict new regulations. In this work, we explore the framework of Markov Logic Networks (MLN) that combine features of probabilistic graphical models with the expressivity of first-order logic rules. We propose to learn a Markov Logic network, e.g. a set of weighted rules that conclude on the predicate "regulates", starting from a known gene regulatory network involved in the switch proliferation/differentiation of keratinocyte cells, a set of experimental transcriptomic data and various descriptions of genes all encoded into first-order logic. As training data are unbalanced, we use asymmetric bagging to learn a set of MLNs. The prediction of a new regulation can then be obtained by averaging predictions of individual MLNs. As a side contribution, we propose three in silico tests to assess the performance of any pairwise classifier in various network inference tasks on real datasets. A first test consists of measuring the average performance on balanced edge prediction problem; a second one deals with the ability of the classifier, once enhanced by asymmetric bagging, to update a given network. Finally our main result concerns a third test that measures the ability of the method to predict regulations with a new set of genes. As expected, MLN, when provided with only numerical discretized gene expression data, does not perform as well as a pairwise SVM in terms of AUPR. However, when a more complete description of gene properties is provided by heterogeneous sources, MLN achieves the same performance as a black-box model such as a

Inferring Drosophila gap gene regulatory network: Pattern analysis of simulated gene expression profiles and stability analysis

OpenAIRE

Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.

2009-01-01

Abstract Background Inference of gene regulatory networks (GRNs) requires accurate data, a method to simulate the expression patterns and an efficient optimization algorithm to estimate the unknown parameters. Using this approach it is possible to obtain alternative circuits without making any a priori assumptions about the interactions, which all simulate the observed patterns. It is important to analyze the properties of the circuits. Findings We have analyzed the simulated gene expression ...

Conserved-peptide upstream open reading frames (CPuORFs are associated with regulatory genes in angiosperms

Directory of Open Access Journals (Sweden)

Richard A Jorgensen

2012-08-01

Full Text Available Upstream open reading frames (uORFs are common in eukaryotic transcripts, but those that encode conserved peptides (CPuORFs occur in less than 1% of transcripts. The peptides encoded by three plant CPuORF families are known to control translation of the downstream ORF in response to a small signal molecule (sucrose, polyamines and phosphocholine. In flowering plants, transcription factors are statistically over-represented among genes that possess CPuORFs, and in general it appeared that many CPuORF genes also had other regulatory functions, though the significance of this suggestion was uncertain (Hayden and Jorgensen, 2007. Five years later the literature provides much more information on the functions of many CPuORF genes. Here we reassess the functions of 27 known CPuORF gene families and find that 22 of these families play a variety of different regulatory roles, from transcriptional control to protein turnover, and from small signal molecules to signal transduction kinases. Clearly then, there is indeed a strong association of CPuORFs with regulatory genes. In addition, 16 of these families play key roles in a variety of different biological processes. Most strikingly, the core sucrose response network includes three different CPuORFs, creating the potential for sophisticated balancing of the network in response to three different molecular inputs. We propose that the function of most CPuORFs is to modulate translation of a downstream major ORF (mORF in response to a signal molecule recognized by the conserved peptide and that because the mORFs of CPuORF genes generally encode regulatory proteins, many of them centrally important in the biology of plants, CPuORFs play key roles in balancing such regulatory networks.

Robust Identification of Developmentally Active Endothelial Enhancers in Zebrafish Using FANS-Assisted ATAC-Seq.

Science.gov (United States)

Quillien, Aurelie; Abdalla, Mary; Yu, Jun; Ou, Jianhong; Zhu, Lihua Julie; Lawson, Nathan D

2017-07-18

Identification of tissue-specific and developmentally active enhancers provides insights into mechanisms that control gene expression during embryogenesis. However, robust detection of these regulatory elements remains challenging, especially in vertebrate genomes. Here, we apply fluorescent-activated nuclei sorting (FANS) followed by Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) to identify developmentally active endothelial enhancers in the zebrafish genome. ATAC-seq of nuclei from Tg(fli1a:egfp) y1 transgenic embryos revealed expected patterns of nucleosomal positioning at transcriptional start sites throughout the genome and association with active histone modifications. Comparison of ATAC-seq from GFP-positive and -negative nuclei identified more than 5,000 open elements specific to endothelial cells. These elements flanked genes functionally important for vascular development and that displayed endothelial-specific gene expression. Importantly, a majority of tested elements drove endothelial gene expression in zebrafish embryos. Thus, FANS-assisted ATAC-seq using transgenic zebrafish embryos provides a robust approach for genome-wide identification of active tissue-specific enhancer elements. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

A retrotransposon insertion in the 5' regulatory domain of Ptf1a results in ectopic gene expression and multiple congenital defects in Danforth's short tail mouse.

Directory of Open Access Journals (Sweden)

Francesca Lugani

Full Text Available Danforth's short tail mutant (Sd mouse, first described in 1930, is a classic spontaneous mutant exhibiting defects of the axial skeleton, hindgut, and urogenital system. We used meiotic mapping in 1,497 segregants to localize the mutation to a 42.8-kb intergenic segment on chromosome 2. Resequencing of this region identified an 8.5-kb early retrotransposon (ETn insertion within the highly conserved regulatory sequences upstream of Pancreas Specific Transcription Factor, 1a (Ptf1a. This mutation resulted in up to tenfold increased expression of Ptf1a as compared to wild-type embryos at E9.5 but no detectable changes in the expression levels of other neighboring genes. At E9.5, Sd mutants exhibit ectopic Ptf1a expression in embryonic progenitors of every organ that will manifest a developmental defect: the notochord, the hindgut, and the mesonephric ducts. Moreover, at E 8.5, Sd mutant mice exhibit ectopic Ptf1a expression in the lateral plate mesoderm, tail bud mesenchyme, and in the notochord, preceding the onset of visible defects such as notochord degeneration. The Sd heterozygote phenotype was not ameliorated by Ptf1a haploinsufficiency, further suggesting that the developmental defects result from ectopic expression of Ptf1a. These data identify disruption of the spatio-temporal pattern of Ptf1a expression as the unifying mechanism underlying the multiple congenital defects in Danforth's short tail mouse. This striking example of an enhancer mutation resulting in profound developmental defects suggests that disruption of conserved regulatory elements may also contribute to human malformation syndromes.

Direct activation of EXPANSIN14 by LBD18 in the gene regulatory network of lateral root formation in Arabidopsis.

Science.gov (United States)

Kim, Jungmook; Lee, Han Woo

2013-02-01

Root system architecture is important for plants to adapt to a changing environment. The major determinant of the root system is lateral roots originating from the primary root. The developmental process of lateral root formation can be divided into priming, initiation, primordium development and the emergence of lateral roots, and is well characterized in Arabidopsis. The hormone auxin plays a critical role in lateral root development, and several auxin response modules involving AUXIN RESPONSE FACTORS (ARFs), transcriptional regulators of auxin-regulated genes and Aux/IAA, negative regulators of ARFs, regulate lateral root formation. The LATERAL ORGAN BOUNDARIES DOMAIN/ASYMMETRIC LEAVES2-LIKE (LBD/ASL) gene family encodes a unique class of transcription factors harbouring a conserved plant-specific lateral organ boundary domain and plays a role in lateral organ development of plants including lateral root formation. In our previous study, we showed that LBD18 stimulates lateral root formation in combination with LBD16 downstream of ARF7 and ARF19 during the auxin response. We have recently demonstrated that LBD18 activates expression of EXP14, a gene encoding the cell-wall loosening factor, by directly binding to the EXP14 promoter to promote lateral root emergence. Here we present the molecular function of LBD18 and its gene regulatory network during lateral root formation.

Postinduction represssion of the β-interferon gene is mediated through two positive regulatory domains

International Nuclear Information System (INIS)

Whittemore, L.A.; Maniatis, T.

1990-01-01

Virus induction of the human β-interferon (β-IFN) gene results in an increase in the rate of β-IFN mRNA synthesis, followed by a rapid postinduction decrease. In this paper, the authors show that two β-IFN promoter elements, positive regulatory domains I and II (PRDI and PRDII), which are required for virus induction of the β-IFN gene are also required for the postinduction turnoff. Although protein synthesis is not necessary for activation, it is necessary for repression of these promoter elements. Examination of nuclear extracts from cells infected with virus reveals the presence of virus-inducible, cycloheximide-sensitive, DNA-binding activities that interact specifically with PRDI or PRDII. They propose that the postinduction repression of β-IFN gene transcription involves virus inducible repressors that either bind directly to the positive regulatory elements of the β-IFN promoter or inactivate the positive regulatory factors bound to PRDI and PRDII

Predictive modelling of gene expression from transcriptional regulatory elements.

Science.gov (United States)

Budden, David M; Hurley, Daniel G; Crampin, Edmund J

2015-07-01

Predictive modelling of gene expression provides a powerful framework for exploring the regulatory logic underpinning transcriptional regulation. Recent studies have demonstrated the utility of such models in identifying dysregulation of gene and miRNA expression associated with abnormal patterns of transcription factor (TF) binding or nucleosomal histone modifications (HMs). Despite the growing popularity of such approaches, a comparative review of the various modelling algorithms and feature extraction methods is lacking. We define and compare three methods of quantifying pairwise gene-TF/HM interactions and discuss their suitability for integrating the heterogeneous chromatin immunoprecipitation (ChIP)-seq binding patterns exhibited by TFs and HMs. We then construct log-linear and ϵ-support vector regression models from various mouse embryonic stem cell (mESC) and human lymphoblastoid (GM12878) data sets, considering both ChIP-seq- and position weight matrix- (PWM)-derived in silico TF-binding. The two algorithms are evaluated both in terms of their modelling prediction accuracy and ability to identify the established regulatory roles of individual TFs and HMs. Our results demonstrate that TF-binding and HMs are highly predictive of gene expression as measured by mRNA transcript abundance, irrespective of algorithm or cell type selection and considering both ChIP-seq and PWM-derived TF-binding. As we encourage other researchers to explore and develop these results, our framework is implemented using open-source software and made available as a preconfigured bootable virtual environment. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

Science.gov (United States)

Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

2014-03-07

To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

Science.gov (United States)

Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik

2014-01-01

Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

Regulatory structures for gene therapy medicinal products in the European Union.

Science.gov (United States)

Klug, Bettina; Celis, Patrick; Carr, Melanie; Reinhardt, Jens

2012-01-01

Taking into account the complexity and technical specificity of advanced therapy medicinal products: (gene and cell therapy medicinal products and tissue engineered products), a dedicated European regulatory framework was needed. Regulation (EC) No. 1394/2007, the "ATMP Regulation" provides tailored regulatory principles for the evaluation and authorization of these innovative medicines. The majority of gene or cell therapy product development is carried out by academia, hospitals, and small- and medium-sized enterprises (SMEs). Thus, acknowledging the particular needs of these types of sponsors, the legislation also provides incentives for product development tailored to them. The European Medicines Agency (EMA) and, in particular, its Committee for Advanced Therapies (CAT) provide a variety of opportunities for early interaction with developers of ATMPs to enable them to have early regulatory and scientific input. An important tool to promote innovation and the development of new medicinal products by micro-, small-, and medium-sized enterprises is the EMA's SME initiative launched in December 2005 to offer financial and administrative assistance to smaller companies. The European legislation also foresees the involvement of stakeholders, such as patient organizations, in the development of new medicines. Considering that gene therapy medicinal products are developed in many cases for treatment of rare diseases often of monogenic origin, the involvement of patient organizations, which focus on rare diseases and genetic and congenital disorders, is fruitful. Two such organizations are represented in the CAT. Research networks play another important role in the development of gene therapy medicinal products. The European Commission is funding such networks through the EU Sixth Framework Program. Copyright © 2012 Elsevier Inc. All rights reserved.

Mutations in the newly identified RAX regulatory sequence are not a frequent cause of micro/anophthalmia.

Science.gov (United States)

Chassaing, Nicolas; Vigouroux, Adeline; Calvas, Patrick

2009-06-01

Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (SOX2, OTX2, RAX, and CHX10) have been implicated in isolated micro/anophthalmia, but causative mutations of these genes explain less than a quarter of these developmental defects. A specifically conserved SOX2/OTX2-mediated RAX expression regulatory sequence has recently been identified. We postulated that mutations in this sequence could lead to micro/anophthalmia, and thus we performed molecular screening of this regulatory element in patients suffering from micro/anophthalmia. Fifty-one patients suffering from nonsyndromic microphthalmia (n = 40) or anophthalmia (n = 11) were included in this study after negative molecular screening for SOX2, OTX2, RAX, and CHX10 mutations. Mutation screening of the RAX regulatory sequence was performed by direct sequencing for these patients. No mutations were identified in the highly conserved RAX regulatory sequence in any of the 51 patients. Mutations in the newly identified RAX regulatory sequence do not represent a frequent cause of nonsyndromic micro/anophthalmia.

Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

Science.gov (United States)

Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

2017-07-30

The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

Plasticity of gene-regulatory networks controlling sex determination: of masters, slaves, usual suspects, newcomers, and usurpators.

Science.gov (United States)

Herpin, Amaury; Schartl, Manfred

2015-10-01

Sexual dimorphism is one of the most pervasive and diverse features of animal morphology, physiology, and behavior. Despite the generality of the phenomenon itself, the mechanisms controlling how sex is determined differ considerably among various organismic groups, have evolved repeatedly and independently, and the underlying molecular pathways can change quickly during evolution. Even within closely related groups of organisms for which the development of gonads on the morphological, histological, and cell biological level is undistinguishable, the molecular control and the regulation of the factors involved in sex determination and gonad differentiation can be substantially different. The biological meaning of the high molecular plasticity of an otherwise common developmental program is unknown. While comparative studies suggest that the downstream effectors of sex-determining pathways tend to be more stable than the triggering mechanisms at the top, it is still unclear how conserved the downstream networks are and how all components work together. After many years of stasis, when the molecular basis of sex determination was amenable only in the few classical model organisms (fly, worm, mouse), recently, sex-determining genes from several animal species have been identified and new studies have elucidated some novel regulatory interactions and biological functions of the downstream network, particularly in vertebrates. These data have considerably changed our classical perception of a simple linear developmental cascade that makes the decision for the embryo to develop as male or female, and how it evolves. © 2015 The Authors.

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

Science.gov (United States)

Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

2015-11-14

FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

Inferring Drosophila gap gene regulatory network: Pattern analysis of simulated gene expression profiles and stability analysis

NARCIS (Netherlands)

Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.

2009-01-01

Background: Inference of gene regulatory networks (GRNs) requires accurate data, a method to simulate the expression patterns and an efficient optimization algorithm to estimate the unknown parameters. Using this approach it is possible to obtain alternative circuits without making any a priori

Characterization of regulatory pathways in Xylella fastidiosa: genes and phenotypes controlled by algU.

Science.gov (United States)

Shi, Xiang Yang; Dumenyo, C Korsi; Hernandez-Martinez, Rufina; Azad, Hamid; Cooksey, Donald A

2007-11-01

Many virulence genes in plant bacterial pathogens are coordinately regulated by "global" regulatory genes. Conducting DNA microarray analysis of bacterial mutants of such genes, compared with the wild type, can help to refine the list of genes that may contribute to virulence in bacterial pathogens. The regulatory gene algU, with roles in stress response and regulation of the biosynthesis of the exopolysaccharide alginate in Pseudomonas aeruginosa and many other bacteria, has been extensively studied. The role of algU in Xylella fastidiosa, the cause of Pierce's disease of grapevines, was analyzed by mutation and whole-genome microarray analysis to define its involvement in aggregation, biofilm formation, and virulence. In this study, an algU::nptII mutant had reduced cell-cell aggregation, attachment, and biofilm formation and lower virulence in grapevines. Microarray analysis showed that 42 genes had significantly lower expression in the algU::nptII mutant than in the wild type. Among these are several genes that could contribute to cell aggregation and biofilm formation, as well as other physiological processes such as virulence, competition, and survival.

A systems biology approach to construct the gene regulatory network of systemic inflammation via microarray and databases mining

Directory of Open Access Journals (Sweden)

Lan Chung-Yu

2008-09-01

Full Text Available Abstract Background Inflammation is a hallmark of many human diseases. Elucidating the mechanisms underlying systemic inflammation has long been an important topic in basic and clinical research. When primary pathogenetic events remains unclear due to its immense complexity, construction and analysis of the gene regulatory network of inflammation at times becomes the best way to understand the detrimental effects of disease. However, it is difficult to recognize and evaluate relevant biological processes from the huge quantities of experimental data. It is hence appealing to find an algorithm which can generate a gene regulatory network of systemic inflammation from high-throughput genomic studies of human diseases. Such network will be essential for us to extract valuable information from the complex and chaotic network under diseased conditions. Results In this study, we construct a gene regulatory network of inflammation using data extracted from the Ensembl and JASPAR databases. We also integrate and apply a number of systematic algorithms like cross correlation threshold, maximum likelihood estimation method and Akaike Information Criterion (AIC on time-lapsed microarray data to refine the genome-wide transcriptional regulatory network in response to bacterial endotoxins in the context of dynamic activated genes, which are regulated by transcription factors (TFs such as NF-κB. This systematic approach is used to investigate the stochastic interaction represented by the dynamic leukocyte gene expression profiles of human subject exposed to an inflammatory stimulus (bacterial endotoxin. Based on the kinetic parameters of the dynamic gene regulatory network, we identify important properties (such as susceptibility to infection of the immune system, which may be useful for translational research. Finally, robustness of the inflammatory gene network is also inferred by analyzing the hubs and "weak ties" structures of the gene network

Reconstructing gene regulatory networks from knock-out data using Gaussian Noise Model and Pearson Correlation Coefficient.

Science.gov (United States)

Mohamed Salleh, Faridah Hani; Arif, Shereena Mohd; Zainudin, Suhaila; Firdaus-Raih, Mohd

2015-12-01

A gene regulatory network (GRN) is a large and complex network consisting of interacting elements that, over time, affect each other's state. The dynamics of complex gene regulatory processes are difficult to understand using intuitive approaches alone. To overcome this problem, we propose an algorithm for inferring the regulatory interactions from knock-out data using a Gaussian model combines with Pearson Correlation Coefficient (PCC). There are several problems relating to GRN construction that have been outlined in this paper. We demonstrated the ability of our proposed method to (1) predict the presence of regulatory interactions between genes, (2) their directionality and (3) their states (activation or suppression). The algorithm was applied to network sizes of 10 and 50 genes from DREAM3 datasets and network sizes of 10 from DREAM4 datasets. The predicted networks were evaluated based on AUROC and AUPR. We discovered that high false positive values were generated by our GRN prediction methods because the indirect regulations have been wrongly predicted as true relationships. We achieved satisfactory results as the majority of sub-networks achieved AUROC values above 0.5. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comprehensive survey of carapacial ridge-specific genes in turtle implies co-option of some regulatory genes in carapace evolution.

Science.gov (United States)

Kuraku, Shigehiro; Usuda, Ryo; Kuratani, Shigeru

2005-01-01

The turtle shell is an evolutionary novelty in which the developmental pattern of the ribs is radically modified. In contrast to those of other amniotes, turtle ribs grow laterally into the dorsal dermis to form a carapace. The lateral margin of carapacial primordium is called the carapacial ridge (CR), and is thought to play an essential role in carapace patterning. To reveal the developmental mechanisms underlying this structure, we systematically screened for genes expressed specifically in the CR of the Chinese soft-shelled turtle, Pelodiscus sinensis, using microbead-based differential cDNA analysis and real-time reverse transcription-polymerase chain reaction. We identified orthologs of Sp5, cellular retinoic acid-binding protein-I (CRABP-I), adenomatous polyposis coli down-regulated 1 (APCDD1), and lymphoid enhancer-binding factor-1 (LEF-1). Although these genes are conserved throughout the major vertebrate lineages, comparison of their expression patterns with those in chicken and mouse indicated that these genes have acquired de novo expression in the CR in the turtle lineage. In association with the expression of LEF-1, the nuclear localization of beta-catenin protein was detected in the CR ectoderm, suggesting that the canonical Wnt signaling triggers carapace development. These findings indicate that the acquisition of the turtle shell did not involve the creation of novel genes, but was based on the co-option of pre-existing genes.

Cell wall composition and lignin biosynthetic gene expression along a developmental gradient in an Australian sugarcane cultivar

Directory of Open Access Journals (Sweden)

William P. Bewg

2017-12-01

Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.

A big data pipeline: Identifying dynamic gene regulatory networks from time-course Gene Expression Omnibus data with applications to influenza infection.

Science.gov (United States)

Carey, Michelle; Ramírez, Juan Camilo; Wu, Shuang; Wu, Hulin

2018-07-01

A biological host response to an external stimulus or intervention such as a disease or infection is a dynamic process, which is regulated by an intricate network of many genes and their products. Understanding the dynamics of this gene regulatory network allows us to infer the mechanisms involved in a host response to an external stimulus, and hence aids the discovery of biomarkers of phenotype and biological function. In this article, we propose a modeling/analysis pipeline for dynamic gene expression data, called Pipeline4DGEData, which consists of a series of statistical modeling techniques to construct dynamic gene regulatory networks from the large volumes of high-dimensional time-course gene expression data that are freely available in the Gene Expression Omnibus repository. This pipeline has a consistent and scalable structure that allows it to simultaneously analyze a large number of time-course gene expression data sets, and then integrate the results across different studies. We apply the proposed pipeline to influenza infection data from nine studies and demonstrate that interesting biological findings can be discovered with its implementation.

Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

Science.gov (United States)

Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

2006-07-01

Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

Directory of Open Access Journals (Sweden)

Qiusheng Kong

Full Text Available Gene expression analysis in watermelon (Citrullus lanatus fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC, β-actin (ClACT, and alpha tubulin 5 (ClTUA5 as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1, a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

Science.gov (United States)

Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong

2015-01-01

Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

Science.gov (United States)

Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

2014-01-01

Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

A Systems’ Biology Approach to Study MicroRNA-Mediated Gene Regulatory Networks

Directory of Open Access Journals (Sweden)

Xin Lai

2013-01-01

Full Text Available MicroRNAs (miRNAs are potent effectors in gene regulatory networks where aberrant miRNA expression can contribute to human diseases such as cancer. For a better understanding of the regulatory role of miRNAs in coordinating gene expression, we here present a systems biology approach combining data-driven modeling and model-driven experiments. Such an approach is characterized by an iterative process, including biological data acquisition and integration, network construction, mathematical modeling and experimental validation. To demonstrate the application of this approach, we adopt it to investigate mechanisms of collective repression on p21 by multiple miRNAs. We first construct a p21 regulatory network based on data from the literature and further expand it using algorithms that predict molecular interactions. Based on the network structure, a detailed mechanistic model is established and its parameter values are determined using data. Finally, the calibrated model is used to study the effect of different miRNA expression profiles and cooperative target regulation on p21 expression levels in different biological contexts.

A complex regulatory network coordinating cell cycles during C. elegans development is revealed by a genome-wide RNAi screen.

Science.gov (United States)

Roy, Sarah H; Tobin, David V; Memar, Nadin; Beltz, Eleanor; Holmen, Jenna; Clayton, Joseph E; Chiu, Daniel J; Young, Laura D; Green, Travis H; Lubin, Isabella; Liu, Yuying; Conradt, Barbara; Saito, R Mako

2014-02-28

The development and homeostasis of multicellular animals requires precise coordination of cell division and differentiation. We performed a genome-wide RNA interference screen in Caenorhabditis elegans to reveal the components of a regulatory network that promotes developmentally programmed cell-cycle quiescence. The 107 identified genes are predicted to constitute regulatory networks that are conserved among higher animals because almost half of the genes are represented by clear human orthologs. Using a series of mutant backgrounds to assess their genetic activities, the RNA interference clones displaying similar properties were clustered to establish potential regulatory relationships within the network. This approach uncovered four distinct genetic pathways controlling cell-cycle entry during intestinal organogenesis. The enhanced phenotypes observed for animals carrying compound mutations attest to the collaboration between distinct mechanisms to ensure strict developmental regulation of cell cycles. Moreover, we characterized ubc-25, a gene encoding an E2 ubiquitin-conjugating enzyme whose human ortholog, UBE2Q2, is deregulated in several cancers. Our genetic analyses suggested that ubc-25 acts in a linear pathway with cul-1/Cul1, in parallel to pathways employing cki-1/p27 and lin-35/pRb to promote cell-cycle quiescence. Further investigation of the potential regulatory mechanism demonstrated that ubc-25 activity negatively regulates CYE-1/cyclin E protein abundance in vivo. Together, our results show that the ubc-25-mediated pathway acts within a complex network that integrates the actions of multiple molecular mechanisms to control cell cycles during development. Copyright © 2014 Roy et al.

Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

Science.gov (United States)

Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

2016-02-01

Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

Molecular evidence for increased regulatory conservation during metamorphosis, and against deleterious cascading effects of hybrid breakdown in Drosophila

Directory of Open Access Journals (Sweden)

Artieri Carlo G

2010-03-01

Full Text Available Abstract Background Speculation regarding the importance of changes in gene regulation in determining major phylogenetic patterns continues to accrue, despite a lack of broad-scale comparative studies examining how patterns of gene expression vary during development. Comparative transcriptional profiling of adult interspecific hybrids and their parental species has uncovered widespread divergence of the mechanisms controlling gene regulation, revealing incompatibilities that are masked in comparisons between the pure species. However, this has prompted the suggestion that misexpression in adult hybrids results from the downstream cascading effects of a subset of genes improperly regulated in early development. Results We sought to determine how gene expression diverges over development, as well as test the cascade hypothesis, by profiling expression in males of Drosophila melanogaster, D. sechellia, and D. simulans, as well as the D. simulans (♀ × D. sechellia (♂ male F1 hybrids, at four different developmental time points (3rd instar larval, early pupal, late pupal, and newly-emerged adult. Contrary to the cascade model of misexpression, we find that there is considerable stage-specific autonomy of regulatory breakdown in hybrids, with the larval and adult stages showing significantly more hybrid misexpression as compared to the pupal stage. However, comparisons between pure species indicate that genes expressed during earlier stages of development tend to be more conserved in terms of their level of expression than those expressed during later stages, suggesting that while Von Baer's famous law applies at both the level of nucleotide sequence and expression, it may not apply necessarily to the underlying overall regulatory network, which appears to diverge over the course of ontogeny and which can only be ascertained by combining divergent genomes in species hybrids. Conclusion Our results suggest that complex integration of regulatory

Regulatory Architecture of Gene Expression Variation in the Threespine Stickleback Gasterosteus aculeatus

Directory of Open Access Journals (Sweden)

Victoria L. Pritchard

2017-01-01

Full Text Available Much adaptive evolutionary change is underlain by mutational variation in regions of the genome that regulate gene expression rather than in the coding regions of the genes themselves. An understanding of the role of gene expression variation in facilitating local adaptation will be aided by an understanding of underlying regulatory networks. Here, we characterize the genetic architecture of gene expression variation in the threespine stickleback (Gasterosteus aculeatus, an important model in the study of adaptive evolution. We collected transcriptomic and genomic data from 60 half-sib families using an expression microarray and genotyping-by-sequencing, and located expression quantitative trait loci (eQTL underlying the variation in gene expression in liver tissue using an interval mapping approach. We identified eQTL for several thousand expression traits. Expression was influenced by polymorphism in both cis- and trans-regulatory regions. Trans-eQTL clustered into hotspots. We did not identify master transcriptional regulators in hotspot locations: rather, the presence of hotspots may be driven by complex interactions between multiple transcription factors. One observed hotspot colocated with a QTL recently found to underlie salinity tolerance in the threespine stickleback. However, most other observed hotspots did not colocate with regions of the genome known to be involved in adaptive divergence between marine and freshwater habitats.

Gene expression regulation in photomorphogenesis from the perspective of the central dogma.

Science.gov (United States)

Wu, Shu-Hsing

2014-01-01

Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

Science.gov (United States)

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

Regulatory Considerations for Gene Therapy Products in the US, EU, and Japan.

Science.gov (United States)

Halioua-Haubold, Celine-Lea; Peyer, James G; Smith, James A; Arshad, Zeeshaan; Scholz, Matthew; Brindley, David A; MacLaren, Robert E

2017-12-01

Developers of gene therapy products (GTPs) must adhere to additional regulation beyond that of traditional small-molecule therapeutics, due to the unique mechanism-of-action of GTPs and the subsequent novel risks arisen. We have provided herein a summary of the regulatory structure under which GTPs fall in the United States, the European Union, and Japan, and a comprehensive overview of the regulatory guidance applicable to the developer of GTP. Understanding the regulatory requirements for seeking GTP market approval in these major jurisdictions is crucial for an effective and expedient path to market. The novel challenges facing GTP developers is highlighted by a case study of alipogene tiparvovec (Glybera).

Functional evolution of cis-regulatory modules at a homeotic gene in Drosophila.

Directory of Open Access Journals (Sweden)

Margaret C W Ho

2009-11-01

Full Text Available It is a long-held belief in evolutionary biology that the rate of molecular evolution for a given DNA sequence is inversely related to the level of functional constraint. This belief holds true for the protein-coding homeotic (Hox genes originally discovered in Drosophila melanogaster. Expression of the Hox genes in Drosophila embryos is essential for body patterning and is controlled by an extensive array of cis-regulatory modules (CRMs. How the regulatory modules functionally evolve in different species is not clear. A comparison of the CRMs for the Abdominal-B gene from different Drosophila species reveals relatively low levels of overall sequence conservation. However, embryonic enhancer CRMs from other Drosophila species direct transgenic reporter gene expression in the same spatial and temporal patterns during development as their D. melanogaster orthologs. Bioinformatic analysis reveals the presence of short conserved sequences within defined CRMs, representing gap and pair-rule transcription factor binding sites. One predicted binding site for the gap transcription factor KRUPPEL in the IAB5 CRM was found to be altered in Superabdominal (Sab mutations. In Sab mutant flies, the third abdominal segment is transformed into a copy of the fifth abdominal segment. A model for KRUPPEL-mediated repression at this binding site is presented. These findings challenge our current understanding of the relationship between sequence evolution at the molecular level and functional activity of a CRM. While the overall sequence conservation at Drosophila CRMs is not distinctive from neighboring genomic regions, functionally critical transcription factor binding sites within embryonic enhancer CRMs are highly conserved. These results have implications for understanding mechanisms of gene expression during embryonic development, enhancer function, and the molecular evolution of eukaryotic regulatory modules.

NIMEFI: gene regulatory network inference using multiple ensemble feature importance algorithms.

Directory of Open Access Journals (Sweden)

Joeri Ruyssinck

Full Text Available One of the long-standing open challenges in computational systems biology is the topology inference of gene regulatory networks from high-throughput omics data. Recently, two community-wide efforts, DREAM4 and DREAM5, have been established to benchmark network inference techniques using gene expression measurements. In these challenges the overall top performer was the GENIE3 algorithm. This method decomposes the network inference task into separate regression problems for each gene in the network in which the expression values of a particular target gene are predicted using all other genes as possible predictors. Next, using tree-based ensemble methods, an importance measure for each predictor gene is calculated with respect to the target gene and a high feature importance is considered as putative evidence of a regulatory link existing between both genes. The contribution of this work is twofold. First, we generalize the regression decomposition strategy of GENIE3 to other feature importance methods. We compare the performance of support vector regression, the elastic net, random forest regression, symbolic regression and their ensemble variants in this setting to the original GENIE3 algorithm. To create the ensemble variants, we propose a subsampling approach which allows us to cast any feature selection algorithm that produces a feature ranking into an ensemble feature importance algorithm. We demonstrate that the ensemble setting is key to the network inference task, as only ensemble variants achieve top performance. As second contribution, we explore the effect of using rankwise averaged predictions of multiple ensemble algorithms as opposed to only one. We name this approach NIMEFI (Network Inference using Multiple Ensemble Feature Importance algorithms and show that this approach outperforms all individual methods in general, although on a specific network a single method can perform better. An implementation of NIMEFI has been made

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

Energy Technology Data Exchange (ETDEWEB)

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)

2016-08-15

Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

International Nuclear Information System (INIS)

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-01-01

Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

Science.gov (United States)

Mitchison, A

1997-01-01

In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

Directory of Open Access Journals (Sweden)

Conforto Tara L

2012-04-01

Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.

Science.gov (United States)

Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R

2018-06-01

Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.

Medusa structure of the gene regulatory network: dominance of transcription factors in cancer subtype classification.

Science.gov (United States)

Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui

2011-05-01

Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Mutual inactivation of Notch receptors and ligands facilitates developmental patterning.

Directory of Open Access Journals (Sweden)

David Sprinzak

2011-06-01

Full Text Available Developmental patterning requires juxtacrine signaling in order to tightly coordinate the fates of neighboring cells. Recent work has shown that Notch and Delta, the canonical metazoan juxtacrine signaling receptor and ligand, mutually inactivate each other in the same cell. This cis-interaction generates mutually exclusive sending and receiving states in individual cells. It generally remains unclear, however, how this mutual inactivation and the resulting switching behavior can impact developmental patterning circuits. Here we address this question using mathematical modeling in the context of two canonical pattern formation processes: boundary formation and lateral inhibition. For boundary formation, in a model motivated by Drosophila wing vein patterning, we find that mutual inactivation allows sharp boundary formation across a broader range of parameters than models lacking mutual inactivation. This model with mutual inactivation also exhibits robustness to correlated gene expression perturbations. For lateral inhibition, we find that mutual inactivation speeds up patterning dynamics, relieves the need for cooperative regulatory interactions, and expands the range of parameter values that permit pattern formation, compared to canonical models. Furthermore, mutual inactivation enables a simple lateral inhibition circuit architecture which requires only a single downstream regulatory step. Both model systems show how mutual inactivation can facilitate robust fine-grained patterning processes that would be difficult to implement without it, by encoding a difference-promoting feedback within the signaling system itself. Together, these results provide a framework for analysis of more complex Notch-dependent developmental systems.

A Kalman-filter based approach to identification of time-varying gene regulatory networks.

Directory of Open Access Journals (Sweden)

Jie Xiong

Full Text Available MOTIVATION: Conventional identification methods for gene regulatory networks (GRNs have overwhelmingly adopted static topology models, which remains unchanged over time to represent the underlying molecular interactions of a biological system. However, GRNs are dynamic in response to physiological and environmental changes. Although there is a rich literature in modeling static or temporally invariant networks, how to systematically recover these temporally changing networks remains a major and significant pressing challenge. The purpose of this study is to suggest a two-step strategy that recovers time-varying GRNs. RESULTS: It is suggested in this paper to utilize a switching auto-regressive model to describe the dynamics of time-varying GRNs, and a two-step strategy is proposed to recover the structure of time-varying GRNs. In the first step, the change points are detected by a Kalman-filter based method. The observed time series are divided into several segments using these detection results; and each time series segment belonging to two successive demarcating change points is associated with an individual static regulatory network. In the second step, conditional network structure identification methods are used to reconstruct the topology for each time interval. This two-step strategy efficiently decouples the change point detection problem and the topology inference problem. Simulation results show that the proposed strategy can detect the change points precisely and recover each individual topology structure effectively. Moreover, computation results with the developmental data of Drosophila Melanogaster show that the proposed change point detection procedure is also able to work effectively in real world applications and the change point estimation accuracy exceeds other existing approaches, which means the suggested strategy may also be helpful in solving actual GRN reconstruction problem.

Bulimia: A Self-Psychological and Ego-Developmental View.

Science.gov (United States)

Brenner-Liss, Deborah

1986-01-01

Discusses key clinical issues in the treatment of bulimia with clinical examples from a self-psychological and ego-developmental point of view. Identifies three developmental issues for bulimia: self-regulatory, differentiation, and self-esteem. (Author/ABB)

Integrated analysis of microRNA and gene expression profiles reveals a functional regulatory module associated with liver fibrosis.

Science.gov (United States)

Chen, Wei; Zhao, Wenshan; Yang, Aiting; Xu, Anjian; Wang, Huan; Cong, Min; Liu, Tianhui; Wang, Ping; You, Hong

2017-12-15

Liver fibrosis, characterized with the excessive accumulation of extracellular matrix (ECM) proteins, represents the final common pathway of chronic liver inflammation. Ever-increasing evidence indicates microRNAs (miRNAs) dysregulation has important implications in the different stages of liver fibrosis. However, our knowledge of miRNA-gene regulation details pertaining to such disease remains unclear. The publicly available Gene Expression Omnibus (GEO) datasets of patients suffered from cirrhosis were extracted for integrated analysis. Differentially expressed miRNAs (DEMs) and genes (DEGs) were identified using GEO2R web tool. Putative target gene prediction of DEMs was carried out using the intersection of five major algorithms: DIANA-microT, TargetScan, miRanda, PICTAR5 and miRWalk. Functional miRNA-gene regulatory network (FMGRN) was constructed based on the computational target predictions at the sequence level and the inverse expression relationships between DEMs and DEGs. DAVID web server was selected to perform KEGG pathway enrichment analysis. Functional miRNA-gene regulatory module was generated based on the biological interpretation. Internal connections among genes in liver fibrosis-related module were determined using String database. MiRNA-gene regulatory modules related to liver fibrosis were experimentally verified in recombinant human TGFβ1 stimulated and specific miRNA inhibitor treated LX-2 cells. We totally identified 85 and 923 dysregulated miRNAs and genes in liver cirrhosis biopsy samples compared to their normal controls. All evident miRNA-gene pairs were identified and assembled into FMGRN which consisted of 990 regulations between 51 miRNAs and 275 genes, forming two big sub-networks that were defined as down-network and up-network, respectively. KEGG pathway enrichment analysis revealed that up-network was prominently involved in several KEGG pathways, in which "Focal adhesion", "PI3K-Akt signaling pathway" and "ECM

Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency.

Science.gov (United States)

Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina

2009-09-01

Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

OpenAIRE

Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha

2017-01-01

During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

OpenAIRE

Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip

2017-01-01

ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

Ancestral regulatory circuits governing ectoderm patterning downstream of Nodal and BMP2/4 revealed by gene regulatory network analysis in an echinoderm.

Directory of Open Access Journals (Sweden)

Alexandra Saudemont

2010-12-01

Full Text Available Echinoderms, which are phylogenetically related to vertebrates and produce large numbers of transparent embryos that can be experimentally manipulated, offer many advantages for the analysis of the gene regulatory networks (GRN regulating germ layer formation. During development of the sea urchin embryo, the ectoderm is the source of signals that pattern all three germ layers along the dorsal-ventral axis. How this signaling center controls patterning and morphogenesis of the embryo is not understood. Here, we report a large-scale analysis of the GRN deployed in response to the activity of this signaling center in the embryos of the Mediterranean sea urchin Paracentrotus lividus, in which studies with high spatial resolution are possible. By using a combination of in situ hybridization screening, overexpression of mRNA, recombinant ligand treatments, and morpholino-based loss-of-function studies, we identified a cohort of transcription factors and signaling molecules expressed in the ventral ectoderm, dorsal ectoderm, and interposed neurogenic ("ciliary band" region in response to the known key signaling molecules Nodal and BMP2/4 and defined the epistatic relationships between the most important genes. The resultant GRN showed a number of striking features. First, Nodal was found to be essential for the expression of all ventral and dorsal marker genes, and BMP2/4 for all dorsal genes. Second, goosecoid was identified as a central player in a regulatory sub-circuit controlling mouth formation, while tbx2/3 emerged as a critical factor for differentiation of the dorsal ectoderm. Finally, and unexpectedly, a neurogenic ectoderm regulatory circuit characterized by expression of "ciliary band" genes was triggered in the absence of TGF beta signaling. We propose a novel model for ectoderm regionalization, in which neural ectoderm is the default fate in the absence of TGF beta signaling, and suggest that the stomodeal and neural subcircuits that we

A systems level approach reveals new gene regulatory modules in the developing ear

OpenAIRE

Chen, Jingchen; Tambalo, Monica; Barembaum, Meyer; Ranganathan, Ramya; Simões-Costa, Marcos; Bronner, Marianne E.; Streit, Andrea

2017-01-01

The inner ear is a complex vertebrate sense organ, yet it arises from a simple epithelium, the otic placode. Specification towards otic fate requires diverse signals and transcriptional inputs that act sequentially and/or in parallel. Using the chick embryo, we uncover novel genes in the gene regulatory network underlying otic commitment and reveal dynamic changes in gene expression. Functional analysis of selected transcription factors reveals the genetic hierarchy underlying the transition ...

Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities

Science.gov (United States)

Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.

2017-01-01

Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

Directory of Open Access Journals (Sweden)

Shutao Zhang

Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

Neurogenic gene regulatory pathways in the sea urchin embryo.

Science.gov (United States)

Wei, Zheng; Angerer, Lynne M; Angerer, Robert C

2016-01-15

During embryogenesis the sea urchin early pluteus larva differentiates 40-50 neurons marked by expression of the pan-neural marker synaptotagmin B (SynB) that are distributed along the ciliary band, in the apical plate and pharyngeal endoderm, and 4-6 serotonergic neurons that are confined to the apical plate. Development of all neurons has been shown to depend on the function of Six3. Using a combination of molecular screens and tests of gene function by morpholino-mediated knockdown, we identified SoxC and Brn1/2/4, which function sequentially in the neurogenic regulatory pathway and are also required for the differentiation of all neurons. Misexpression of Brn1/2/4 at low dose caused an increase in the number of serotonin-expressing cells and at higher dose converted most of the embryo to a neurogenic epithelial sphere expressing the Hnf6 ciliary band marker. A third factor, Z167, was shown to work downstream of the Six3 and SoxC core factors and to define a branch specific for the differentiation of serotonergic neurons. These results provide a framework for building a gene regulatory network for neurogenesis in the sea urchin embryo. © 2016. Published by The Company of Biologists Ltd.

Regulatory Architecture of Gene Expression Variation in the Threespine Stickleback Gasterosteus aculeatus.

Science.gov (United States)

Pritchard, Victoria L; Viitaniemi, Heidi M; McCairns, R J Scott; Merilä, Juha; Nikinmaa, Mikko; Primmer, Craig R; Leder, Erica H

2017-01-05

Much adaptive evolutionary change is underlain by mutational variation in regions of the genome that regulate gene expression rather than in the coding regions of the genes themselves. An understanding of the role of gene expression variation in facilitating local adaptation will be aided by an understanding of underlying regulatory networks. Here, we characterize the genetic architecture of gene expression variation in the threespine stickleback (Gasterosteus aculeatus), an important model in the study of adaptive evolution. We collected transcriptomic and genomic data from 60 half-sib families using an expression microarray and genotyping-by-sequencing, and located expression quantitative trait loci (eQTL) underlying the variation in gene expression in liver tissue using an interval mapping approach. We identified eQTL for several thousand expression traits. Expression was influenced by polymorphism in both cis- and trans-regulatory regions. Trans-eQTL clustered into hotspots. We did not identify master transcriptional regulators in hotspot locations: rather, the presence of hotspots may be driven by complex interactions between multiple transcription factors. One observed hotspot colocated with a QTL recently found to underlie salinity tolerance in the threespine stickleback. However, most other observed hotspots did not colocate with regions of the genome known to be involved in adaptive divergence between marine and freshwater habitats. Copyright © 2017 Pritchard et al.

Systems genetics identifies a convergent gene network for cognition and neurodevelopmental disease.

Science.gov (United States)

Johnson, Michael R; Shkura, Kirill; Langley, Sarah R; Delahaye-Duriez, Andree; Srivastava, Prashant; Hill, W David; Rackham, Owen J L; Davies, Gail; Harris, Sarah E; Moreno-Moral, Aida; Rotival, Maxime; Speed, Doug; Petrovski, Slavé; Katz, Anaïs; Hayward, Caroline; Porteous, David J; Smith, Blair H; Padmanabhan, Sandosh; Hocking, Lynne J; Starr, John M; Liewald, David C; Visconti, Alessia; Falchi, Mario; Bottolo, Leonardo; Rossetti, Tiziana; Danis, Bénédicte; Mazzuferi, Manuela; Foerch, Patrik; Grote, Alexander; Helmstaedter, Christoph; Becker, Albert J; Kaminski, Rafal M; Deary, Ian J; Petretto, Enrico

2016-02-01

Genetic determinants of cognition are poorly characterized, and their relationship to genes that confer risk for neurodevelopmental disease is unclear. Here we performed a systems-level analysis of genome-wide gene expression data to infer gene-regulatory networks conserved across species and brain regions. Two of these networks, M1 and M3, showed replicable enrichment for common genetic variants underlying healthy human cognitive abilities, including memory. Using exome sequence data from 6,871 trios, we found that M3 genes were also enriched for mutations ascertained from patients with neurodevelopmental disease generally, and intellectual disability and epileptic encephalopathy in particular. M3 consists of 150 genes whose expression is tightly developmentally regulated, but which are collectively poorly annotated for known functional pathways. These results illustrate how systems-level analyses can reveal previously unappreciated relationships between neurodevelopmental disease-associated genes in the developed human brain, and provide empirical support for a convergent gene-regulatory network influencing cognition and neurodevelopmental disease.

Dose response relationship in anti-stress gene regulatory networks.

Science.gov (United States)

Zhang, Qiang; Andersen, Melvin E

2007-03-02

To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products) in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear) depends on changes in the specific values of local response coefficients (gains) distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear, and depending on

Dose response relationship in anti-stress gene regulatory networks.

Directory of Open Access Journals (Sweden)

Qiang Zhang

2007-03-01

Full Text Available To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear depends on changes in the specific values of local response coefficients (gains distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear

Regulatory divergence of X-linked genes and hybrid male sterility in mice.

Science.gov (United States)

Oka, Ayako; Shiroishi, Toshihiko

2014-01-01

Postzygotic reproductive isolation is the reduction of fertility or viability in hybrids between genetically diverged populations. One example of reproductive isolation, hybrid male sterility, may be caused by genetic incompatibility between diverged genetic factors in two distinct populations. Genetic factors involved in hybrid male sterility are disproportionately located on the X chromosome. Recent studies showing the evolutionary divergence in gene regulatory networks or epigenetic effects suggest that the genetic incompatibilities occur at much broader levels than had previously been thought (e.g., incompatibility of protein-protein interactions). The latest studies suggest that evolutionary divergence of transcriptional regulation causes genetic incompatibilities in hybrid animals, and that such incompatibilities preferentially involve X-linked genes. In this review, we focus on recent progress in understanding hybrid sterility in mice, including our studies, and we discuss the evolutionary significance of regulatory divergence for speciation.

The silkworm (Bombyx mori microRNAs and their expressions in multiple developmental stages.

Directory of Open Access Journals (Sweden)

Xiaomin Yu

Full Text Available BACKGROUND: MicroRNAs (miRNAs play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. METHODOLOGY/PRINCIPAL FINDINGS: We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs and 14 novel miRNAs (including 11 predicted novel miRNAs. Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5' and/or 3' ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. CONCLUSIONS/SIGNIFICANCE: Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over

Transcriptomics-based identification of developmental toxicants through their interference with cardiomyocyte differentiation of embryonic stem cells

International Nuclear Information System (INIS)

Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Schooten, Frederik J. van; Piersma, Aldert H.

2010-01-01

The embryonic stem cell test (EST) predicts developmental toxicity based on the inhibition of cardiomyocyte differentiation of embryonic stem cells (ESC). The subjective endpoint, the long culture duration together with the undefined applicability domain and related predictivity need further improvement to facilitate implementation of the EST into regulatory strategies. These aspects may be improved by studying gene expression changes in the ESC differentiation cultures and their modulation by compound exposure using transcriptomics. Here, we tested the developmental toxicants monobutyl phthalate and 6-aminonicotinamide. ESC were allowed to differentiated, and cardiomyocyte differentiation was assessed after 10 days of culture. RNA of solvent controls was collected after 0, 24, 48, 72 and 96 h of exposure, and RNA of developmental-toxicant-exposed cultures was collected after 24 and 96 h. Samples were hybridized to DNA microarrays, and 1355 genes were found differentially expressed among the unexposed experimental groups. These regulated genes were involved in differentiation-related processes, and Principal Component Analysis (PCA) based on these genes showed that the unexposed experimental groups appeared in chronological order in the PCA, which can therefore be regarded as a continuous representation of the differentiation track. The developmental-toxicant-exposed cultures appeared to deviate significantly from this differentiation track, which confirms the compound-modulating effects on the differentiation process. The incorporation of transcriptomics in the EST is expected to provide a more informative and improved endpoint in the EST as compared with morphology, allowing early detection of differentiation modulation. Furthermore, this approach may improve the definition of the applicability domain and predictivity of the EST.

Regulatory focus and the family-work interface : the role of regulatory fit between cohabiting partners

NARCIS (Netherlands)

Demerouti, E.; Bakker, A.B.; Tetrick, L.

2014-01-01

The aim of the present study was to examine the impact of regulatory focus in goal pursuit and regulatory fit between marital partners on family conditions and the family–work interface. We hypothesized that when both partners are high on promotion focus (fit) they experience higher developmental

Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

Science.gov (United States)

Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

2015-08-01

The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

Bottom-up GGM algorithm for constructing multiple layered hierarchical gene regulatory networks

Science.gov (United States)

Multilayered hierarchical gene regulatory networks (ML-hGRNs) are very important for understanding genetics regulation of biological pathways. However, there are currently no computational algorithms available for directly building ML-hGRNs that regulate biological pathways. A bottom-up graphic Gaus...

Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

Science.gov (United States)

Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

2005-07-15

A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

Science.gov (United States)

Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

1988-01-01

We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

A Simulation Study of Mutations in the Genetic Regulatory Hierarchy for Butterfly Eyespot Focus Determination

OpenAIRE

Marcus, Jeffrey M.; Evans, Travis M.

2008-01-01

The color patterns on the wings of butterflies have been an important model system in evolutionary developmental biology. A recent computational model tested genetic regulatory hierarchies hypothesized to underlie the formation of butterfly eyespot foci (Evans and Marcus, 2006). The computational model demonstrated that one proposed hierarchy was incapable of reproducing the known patterns of gene expression associated with eyespot focus determination in wild-type butterflies, but that two sl...

Analysis of a Gene Regulatory Cascade Mediating Circadian Rhythm in Zebrafish

Science.gov (United States)

Wang, Haifang; Du, Jiulin; Yan, Jun

2013-01-01

In the study of circadian rhythms, it has been a puzzle how a limited number of circadian clock genes can control diverse aspects of physiology. Here we investigate circadian gene expression genome-wide using larval zebrafish as a model system. We made use of a spatial gene expression atlas to investigate the expression of circadian genes in various tissues and cell types. Comparison of genome-wide circadian gene expression data between zebrafish and mouse revealed a nearly anti-phase relationship and allowed us to detect novel evolutionarily conserved circadian genes in vertebrates. We identified three groups of zebrafish genes with distinct responses to light entrainment: fast light-induced genes, slow light-induced genes, and dark-induced genes. Our computational analysis of the circadian gene regulatory network revealed several transcription factors (TFs) involved in diverse aspects of circadian physiology through transcriptional cascade. Of these, microphthalmia-associated transcription factor a (mitfa), a dark-induced TF, mediates a circadian rhythm of melanin synthesis, which may be involved in zebrafish's adaptation to daily light cycling. Our study describes a systematic method to discover previously unidentified TFs involved in circadian physiology in complex organisms. PMID:23468616

Primetime for Learning Genes.

Science.gov (United States)

Keifer, Joyce

2017-02-11

Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene ( BDNF ), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be "poised" for rapid response to activate or repress gene expression depending on environmental stimuli.

Gene expression profiles of immune-regulatory genes in whole blood of cattle with a subclinical infection of Mycobacterium avium subsp. paratuberculosis.

Directory of Open Access Journals (Sweden)

Hyun-Eui Park

Full Text Available Johne's disease is a chronic wasting disease of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP, resulting in inflammation of intestines and persistent diarrhea. The initial host response against MAP infections is mainly regulated by the Th1 response, which is characterized by the production of IFN-γ. With the progression of disease, MAP can survive in the host through the evasion of the host's immune response by manipulating the host immune response. However, the host response during subclinical phases has not been fully understood. Immune regulatory genes, including Th17-derived cytokines, interferon regulatory factors, and calcium signaling-associated genes, are hypothesized to play an important role during subclinical phases of Johne's disease. Therefore, the present study was conducted to analyze the expression profiles of immune regulatory genes during MAP infection in whole blood. Different expression patterns of genes were identified depending on the infection stages. Downregulation of IL-17A, IL-17F, IL-22, IL-26, HMGB1, and IRF4 and upregulation of PIP5K1C indicate suppression of the Th1 response due to MAP infection and loss of granuloma integrity. In addition, increased expression of IRF5 and IRF7 suggest activation of IFN-α/β signaling during subclinical stages, which induced indoleamine 2,3-dioxygenase mediated depletion of tryptophan metabolism. Increased expression of CORO1A indicate modulation of calcium signaling, which enhanced the survival of MAP. Taken together, distinct host gene expression induced by MAP infection indicates enhanced survival of MAP during subclinical stages.

Regulatory Oversight of Cell and Gene Therapy Products in Canada.

Science.gov (United States)

Ridgway, Anthony; Agbanyo, Francisca; Wang, Jian; Rosu-Myles, Michael

2015-01-01

Health Canada regulates gene therapy products and many cell therapy products as biological drugs under the Canadian Food and Drugs Act and its attendant regulations. Cellular products that meet certain criteria, including minimal manipulation and homologous use, may be subjected to a standards-based approach under the Safety of Human Cells, Tissues and Organs for Transplantation Regulations. The manufacture and clinical testing of cell and gene therapy products (CGTPs) presents many challenges beyond those for protein biologics. Cells cannot be subjected to pathogen removal or inactivation procedures and must frequently be administered shortly after final formulation. Viral vector design and manufacturing control are critically important to overall product quality and linked to safety and efficacy in patients through concerns such as replication competence, vector integration, and vector shedding. In addition, for many CGTPs, the value of nonclinical studies is largely limited to providing proof of concept, and the first meaningful data relating to appropriate dosing, safety parameters, and validity of surrogate or true determinants of efficacy must come from carefully designed clinical trials in patients. Addressing these numerous challenges requires application of various risk mitigation strategies and meeting regulatory expectations specifically adapted to the product types. Regulatory cooperation and harmonisation at an international level are essential for progress in the development and commercialisation of these products. However, particularly in the area of cell therapy, new regulatory paradigms may be needed to harness the benefits of clinical progress in situations where the resources and motivation to pursue a typical drug product approval pathway may be lacking.

Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

OpenAIRE

Zhong , Lei; Yu , Xiaomu; Tong , Jingou

2006-01-01

Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

A model of gene expression based on random dynamical systems reveals modularity properties of gene regulatory networks.

Science.gov (United States)

Antoneli, Fernando; Ferreira, Renata C; Briones, Marcelo R S

2016-06-01

Here we propose a new approach to modeling gene expression based on the theory of random dynamical systems (RDS) that provides a general coupling prescription between the nodes of any given regulatory network given the dynamics of each node is modeled by a RDS. The main virtues of this approach are the following: (i) it provides a natural way to obtain arbitrarily large networks by coupling together simple basic pieces, thus revealing the modularity of regulatory networks; (ii) the assumptions about the stochastic processes used in the modeling are fairly general, in the sense that the only requirement is stationarity; (iii) there is a well developed mathematical theory, which is a blend of smooth dynamical systems theory, ergodic theory and stochastic analysis that allows one to extract relevant dynamical and statistical information without solving the system; (iv) one may obtain the classical rate equations form the corresponding stochastic version by averaging the dynamic random variables (small noise limit). It is important to emphasize that unlike the deterministic case, where coupling two equations is a trivial matter, coupling two RDS is non-trivial, specially in our case, where the coupling is performed between a state variable of one gene and the switching stochastic process of another gene and, hence, it is not a priori true that the resulting coupled system will satisfy the definition of a random dynamical system. We shall provide the necessary arguments that ensure that our coupling prescription does indeed furnish a coupled regulatory network of random dynamical systems. Finally, the fact that classical rate equations are the small noise limit of our stochastic model ensures that any validation or prediction made on the basis of the classical theory is also a validation or prediction of our model. We illustrate our framework with some simple examples of single-gene system and network motifs. Copyright © 2016 Elsevier Inc. All rights reserved.

Stochastic Boolean networks: An efficient approach to modeling gene regulatory networks

Directory of Open Access Journals (Sweden)

Liang Jinghang

2012-08-01

Full Text Available Abstract Background Various computational models have been of interest due to their use in the modelling of gene regulatory networks (GRNs. As a logical model, probabilistic Boolean networks (PBNs consider molecular and genetic noise, so the study of PBNs provides significant insights into the understanding of the dynamics of GRNs. This will ultimately lead to advances in developing therapeutic methods that intervene in the process of disease development and progression. The applications of PBNs, however, are hindered by the complexities involved in the computation of the state transition matrix and the steady-state distribution of a PBN. For a PBN with n genes and N Boolean networks, the complexity to compute the state transition matrix is O(nN22n or O(nN2n for a sparse matrix. Results This paper presents a novel implementation of PBNs based on the notions of stochastic logic and stochastic computation. This stochastic implementation of a PBN is referred to as a stochastic Boolean network (SBN. An SBN provides an accurate and efficient simulation of a PBN without and with random gene perturbation. The state transition matrix is computed in an SBN with a complexity of O(nL2n, where L is a factor related to the stochastic sequence length. Since the minimum sequence length required for obtaining an evaluation accuracy approximately increases in a polynomial order with the number of genes, n, and the number of Boolean networks, N, usually increases exponentially with n, L is typically smaller than N, especially in a network with a large number of genes. Hence, the computational efficiency of an SBN is primarily limited by the number of genes, but not directly by the total possible number of Boolean networks. Furthermore, a time-frame expanded SBN enables an efficient analysis of the steady-state distribution of a PBN. These findings are supported by the simulation results of a simplified p53 network, several randomly generated networks and a

Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

Directory of Open Access Journals (Sweden)

Junhua Li

2014-01-01

Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

Regulatory regions in the rat lactase-phlorizin hydrolase gene that control cell-specific expression

NARCIS (Netherlands)

Verhave, Menno; Krasinski, Stephen D.; Christian, Sara I.; van Schaik, Sandrijn; van den Brink, Gijs R.; Doting, Edwina M. H.; Maas, Saskia M.; Wolthers, Katja C.; Grand, Richard J.; Montgomery, Robert K.

2004-01-01

OBJECTIVES: Lactase-phlorizin hydrolase (LPH) is an enterocyte-specific gene whose expression has been well-characterized, not only developmentally but also along the crypt-villus axis and along the length of the small bowel. Previous studies from the authors' laboratory have demonstrated that 2 kb

Molecular and Chemical Genetic Approaches to Developmental Origins of Aging and Disease in Zebrafish

Science.gov (United States)

Sasaki, Tomoyuki; Kishi, Shuji

2013-01-01

The incidence of diseases increases rapidly with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but mostly inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states in response to different environmental or genetic perturbations. On the one hand, we hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds of adaptive plasticity by chemical genetic approaches, we have been investigating whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during embryogenesis (“embryonic senescence”), subsequently showing shortened lifespan in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins

Distinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation.

Science.gov (United States)

Savic, Daniel; Ramaker, Ryne C; Roberts, Brian S; Dean, Emma C; Burwell, Todd C; Meadows, Sarah K; Cooper, Sara J; Garabedian, Michael J; Gertz, Jason; Myers, Richard M

2016-07-11

The liver X receptors (LXRs, NR1H2 and NR1H3) and peroxisome proliferator-activated receptor gamma (PPARG, NR1C3) nuclear receptor transcription factors (TFs) are master regulators of energy homeostasis. Intriguingly, recent studies suggest that these metabolic regulators also impact tumor cell proliferation. However, a comprehensive temporal molecular characterization of the LXR and PPARG gene regulatory responses in tumor cells is still lacking. To better define the underlying molecular processes governing the genetic control of cellular growth in response to extracellular metabolic signals, we performed a comprehensive, genome-wide characterization of the temporal regulatory cascades mediated by LXR and PPARG signaling in HT29 colorectal cancer cells. For this analysis, we applied a multi-tiered approach that incorporated cellular phenotypic assays, gene expression profiles, chromatin state dynamics, and nuclear receptor binding patterns. Our results illustrate that the activation of both nuclear receptors inhibited cell proliferation and further decreased glutathione levels, consistent with increased cellular oxidative stress. Despite a common metabolic reprogramming, the gene regulatory network programs initiated by these nuclear receptors were widely distinct. PPARG generated a rapid and short-term response while maintaining a gene activator role. By contrast, LXR signaling was prolonged, with initial, predominantly activating functions that transitioned to repressive gene regulatory activities at late time points. Through the use of a multi-tiered strategy that integrated various genomic datasets, our data illustrate that distinct gene regulatory programs elicit common phenotypic effects, highlighting the complexity of the genome. These results further provide a detailed molecular map of metabolic reprogramming in cancer cells through LXR and PPARG activation. As ligand-inducible TFs, these nuclear receptors can potentially serve as attractive therapeutic

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

Science.gov (United States)

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design.

Science.gov (United States)

Smith, Robin P; Riesenfeld, Samantha J; Holloway, Alisha K; Li, Qiang; Murphy, Karl K; Feliciano, Natalie M; Orecchia, Lorenzo; Oksenberg, Nir; Pollard, Katherine S; Ahituv, Nadav

2013-07-18

Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries.

Overexpression of maize anthocyanin regulatory gene Lc affects rice fertility.

Science.gov (United States)

Li, Yuan; Zhang, Tao; Shen, Zhong-Wei; Xu, Yu; Li, Jian-Yue

2013-01-01

Seventeen independent transgenic rice plants with the maize anthocyanin regulatory gene Lc under control of the CaMV 35S promoter were obtained and verified by molecular identification. Ten plants showed red spikelets during early development of florets, and the degenerate florets were still red after heading. Additionally, these plants exhibited intense pigmentation on the surface of the anther and the bottom of the ovary. They were unable to properly bloom and were completely sterile. Following pollination with normal pollen, these plants yielded red caryopses but did not mature normally. QRT-PCR analysis indicated that mRNA accumulation of the CHS-like gene encoding a chalcone synthase-related protein was increased significantly in the sterile plant. This is the first report to suggest that upregulation of the CHS gene expression may result in rice sterility and affect the normal development of rice seeds.

Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

Directory of Open Access Journals (Sweden)

Farré Domènec

2007-12-01

Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

A contribution to the study of plant development evolution based on gene co-expression networks

Directory of Open Access Journals (Sweden)

Francisco J. Romero-Campero

2013-08-01

Full Text Available Phototrophic eukaryotes are among the most successful organisms on Earth due to their unparalleled efficiency at capturing light energy and fixing carbon dioxide to produce organic molecules. A conserved and efficient network of light-dependent regulatory modules could be at the bases of this success. This regulatory system conferred early advantages to phototrophic eukaryotes that allowed for specialization, complex developmental processes and modern plant characteristics. We have studied light-dependent gene regulatory modules from algae to plants employing integrative-omics approaches based on gene co-expression networks. Our study reveals some remarkably conserved ways in which eukaryotic phototrophs deal with day length and light signaling. Here we describe how a family of Arabidopsis transcription factors involved in photoperiod response has evolved from a single algal gene according to the innovation, amplification and divergence theory of gene evolution by duplication. These modifications of the gene co-expression networks from the ancient unicellular green algae Chlamydomonas reinhardtii to the modern brassica Arabidopsis thaliana may hint on the evolution and specialization of plants and other organisms.

Neural model of gene regulatory network: a survey on supportive meta-heuristics.

Science.gov (United States)

Biswas, Surama; Acharyya, Sriyankar

2016-06-01

Gene regulatory network (GRN) is produced as a result of regulatory interactions between different genes through their coded proteins in cellular context. Having immense importance in disease detection and drug finding, GRN has been modelled through various mathematical and computational schemes and reported in survey articles. Neural and neuro-fuzzy models have been the focus of attraction in bioinformatics. Predominant use of meta-heuristic algorithms in training neural models has proved its excellence. Considering these facts, this paper is organized to survey neural modelling schemes of GRN and the efficacy of meta-heuristic algorithms towards parameter learning (i.e. weighting connections) within the model. This survey paper renders two different structure-related approaches to infer GRN which are global structure approach and substructure approach. It also describes two neural modelling schemes, such as artificial neural network/recurrent neural network based modelling and neuro-fuzzy modelling. The meta-heuristic algorithms applied so far to learn the structure and parameters of neutrally modelled GRN have been reviewed here.

Sterol regulatory element binding protein-1 (SREBP1) gene expression is similarly increased in polycystic ovary syndrome and endometrial cancer.

Science.gov (United States)

Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William

2017-05-01

Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression was significantly positively correlated with triglyceride in both polycystic ovary syndrome and endometrial cancer (p = 0.028 and p = 0.027, respectively). Quantitative serum sterol regulatory element

Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

Science.gov (United States)

Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

1994-12-20

The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs.

Science.gov (United States)

Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V

2016-05-19

Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.

Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

Directory of Open Access Journals (Sweden)

Vanessa C McFadden

2017-02-01

Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

Regulatory RNAs in Bacillus subtilis : a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

NARCIS (Netherlands)

Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.; van Dijl, Jan Maarten

2016-01-01

Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5= untranslated region. Thus far, most regulatory RNA research has focused on

Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

Directory of Open Access Journals (Sweden)

Ram Prakash Gupta

2017-11-01

Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.

EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

Directory of Open Access Journals (Sweden)

Runko Suzan J

2005-10-01

Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and

Plasticity of the cis-regulatory input function of a gene.

Directory of Open Access Journals (Sweden)

Avraham E Mayo

2006-04-01

Full Text Available The transcription rate of a gene is often controlled by several regulators that bind specific sites in the gene's cis-regulatory region. The combined effect of these regulators is described by a cis-regulatory input function. What determines the form of an input function, and how variable is it with respect to mutations? To address this, we employ the well-characterized lac operon of Escherichia coli, which has an elaborate input function, intermediate between Boolean AND-gate and OR-gate logic. We mapped in detail the input function of 12 variants of the lac promoter, each with different point mutations in the regulator binding sites, by means of accurate expression measurements from living cells. We find that even a few mutations can significantly change the input function, resulting in functions that resemble Pure AND gates, OR gates, or single-input switches. Other types of gates were not found. The variant input functions can be described in a unified manner by a mathematical model. The model also lets us predict which functions cannot be reached by point mutations. The input function that we studied thus appears to be plastic, in the sense that many of the mutations do not ruin the regulation completely but rather result in new ways to integrate the inputs.

Developmental expression of the alpha-skeletal actin gene

Directory of Open Access Journals (Sweden)

Vonk Freek J

2008-06-01

Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

Science.gov (United States)

MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

Integration of TP53, DREAM, MMB-FOXM1 and RB-E2F target gene analyses identifies cell cycle gene regulatory networks.

Science.gov (United States)

Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A

2016-07-27

Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Extensive evolutionary changes in regulatory element activity during human origins are associated with altered gene expression and positive selection.

Directory of Open Access Journals (Sweden)

Yoichiro Shibata

2012-06-01

Full Text Available Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species.

Emotion and Cognition: An Intricately Bound Developmental Process

Science.gov (United States)

Bell, Martha Ann; Wolfe, Christy D.

2004-01-01

Regulatory aspects of development can best be understood by research that conceptualizes relations between cognition and emotion. The neural mechanisms associated with regulatory processes may be the same as those associated with higher order cognitive processes. Thus, from a developmental cognitive neuroscience perspective, emotion and cognition…

Ground rules of the pluripotency gene regulatory network.

KAUST Repository

Li, Mo

2017-01-03

Pluripotency is a state that exists transiently in the early embryo and, remarkably, can be recapitulated in vitro by deriving embryonic stem cells or by reprogramming somatic cells to become induced pluripotent stem cells. The state of pluripotency, which is stabilized by an interconnected network of pluripotency-associated genes, integrates external signals and exerts control over the decision between self-renewal and differentiation at the transcriptional, post-transcriptional and epigenetic levels. Recent evidence of alternative pluripotency states indicates the regulatory flexibility of this network. Insights into the underlying principles of the pluripotency network may provide unprecedented opportunities for studying development and for regenerative medicine.

Ground rules of the pluripotency gene regulatory network.

KAUST Repository

Li, Mo; Belmonte, Juan Carlos Izpisua

2017-01-01

Pluripotency is a state that exists transiently in the early embryo and, remarkably, can be recapitulated in vitro by deriving embryonic stem cells or by reprogramming somatic cells to become induced pluripotent stem cells. The state of pluripotency, which is stabilized by an interconnected network of pluripotency-associated genes, integrates external signals and exerts control over the decision between self-renewal and differentiation at the transcriptional, post-transcriptional and epigenetic levels. Recent evidence of alternative pluripotency states indicates the regulatory flexibility of this network. Insights into the underlying principles of the pluripotency network may provide unprecedented opportunities for studying development and for regenerative medicine.

ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera

Directory of Open Access Journals (Sweden)

James J. Lewis

2016-09-01

Full Text Available Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

Energy Technology Data Exchange (ETDEWEB)

Hsieh, Ru-Lan [Department of Physical Medicine and Rehabilitation, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Physical Medicine and Rehabilitation, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taoyuan, Taiwan (China); Chen, Wei-Jen; Huang, Shiau-Rung [School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Division of Family Medicine, School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Ming-I; Mu, Shu-Chi [Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chen, Ray-Jade [Department of Digestive Surgery, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)

2017-04-15

Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA

Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

International Nuclear Information System (INIS)

Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei

2017-01-01

Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT

Simulation study on effects of signaling network structure on the developmental increase in complexity

Energy Technology Data Exchange (ETDEWEB)

Keranen, Soile V.E.

2003-04-02

The developmental increase in structural complexity in multicellular life forms depends on local, often non-periodic differences in gene expression. These depend on a network of gene-gene interactions coded within the organismal genome. To better understand how genomic information generates complex expression patterns, I have modeled the pattern forming behavior of small artificial genomes in virtual blastoderm embryos. I varied several basic properties of these genomic signaling networks, such as the number of genes, the distributions of positive (inductive) and negative (repressive) interactions, and the strengths of gene-gene interactions, and analyzed their effects on developmental pattern formation. The results show how even simple genomes can generate complex non-periodic patterns under suitable conditions. They also show how the frequency of complex patterns depended on the numbers and relative arrangements of positive and negative interactions. For example, negative co-regulation of signaling pathway components increased the likelihood of (complex) patterns relative to differential negative regulation of the pathway components. Interestingly, neither quantitative differences either in strengths of signaling interactions nor multiple response thresholds to signal concentration (as in morphogen gradients) were essential for formation of multiple, spatially unique cell types. Thus, with combinatorial code of gene regulation and hierarchical signaling interactions, it is theoretically possible to organize metazoan embryogenesis with just a small fraction of the metazoan genome. Because even small networks can generate complex patterns when they contain a suitable set of connections, evolution of metazoan complexity may have depended more on selection for favourable configurations of signaling interactions than on the increase in numbers of regulatory genes.

Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

Science.gov (United States)

Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

2001-12-01

Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the

DNA-binding site of major regulatory protein alpha 4 specifically associated with promoter-regulatory domains of alpha genes of herpes simplex virus type 1.

OpenAIRE

Kristie, T M; Roizman, B

1986-01-01

Herpes simplex virus type 1 genes form at least five groups (alpha, beta 1, beta 2, gamma 1, and gamma 2) whose expression is coordinately regulated and sequentially ordered in a cascade fashion. Previous studies have shown that functional alpha 4 gene product is essential for the transition from alpha to beta protein synthesis and have suggested that alpha 4 gene expression is autoregulatory. We have previously reported that labeled DNA fragments containing promoter-regulatory domains of thr...

Inflammatory gene regulatory networks in amnion cells following cytokine stimulation: translational systems approach to modeling human parturition.

Directory of Open Access Journals (Sweden)

Ruth Li

Full Text Available A majority of the studies examining the molecular regulation of human labor have been conducted using single gene approaches. While the technology to produce multi-dimensional datasets is readily available, the means for facile analysis of such data are limited. The objective of this study was to develop a systems approach to infer regulatory mechanisms governing global gene expression in cytokine-challenged cells in vitro, and to apply these methods to predict gene regulatory networks (GRNs in intrauterine tissues during term parturition. To this end, microarray analysis was applied to human amnion mesenchymal cells (AMCs stimulated with interleukin-1β, and differentially expressed transcripts were subjected to hierarchical clustering, temporal expression profiling, and motif enrichment analysis, from which a GRN was constructed. These methods were then applied to fetal membrane specimens collected in the absence or presence of spontaneous term labor. Analysis of cytokine-responsive genes in AMCs revealed a sterile immune response signature, with promoters enriched in response elements for several inflammation-associated transcription factors. In comparison to the fetal membrane dataset, there were 34 genes commonly upregulated, many of which were part of an acute inflammation gene expression signature. Binding motifs for nuclear factor-κB were prominent in the gene interaction and regulatory networks for both datasets; however, we found little evidence to support the utilization of pathogen-associated molecular pattern (PAMP signaling. The tissue specimens were also enriched for transcripts governed by hypoxia-inducible factor. The approach presented here provides an uncomplicated means to infer global relationships among gene clusters involved in cellular responses to labor-associated signals.

A comparative study of covariance selection models for the inference of gene regulatory networks.

Science.gov (United States)

Stifanelli, Patrizia F; Creanza, Teresa M; Anglani, Roberto; Liuzzi, Vania C; Mukherjee, Sayan; Schena, Francesco P; Ancona, Nicola

2013-10-01

The inference, or 'reverse-engineering', of gene regulatory networks from expression data and the description of the complex dependency structures among genes are open issues in modern molecular biology. In this paper we compared three regularized methods of covariance selection for the inference of gene regulatory networks, developed to circumvent the problems raising when the number of observations n is smaller than the number of genes p. The examined approaches provided three alternative estimates of the inverse covariance matrix: (a) the 'PINV' method is based on the Moore-Penrose pseudoinverse, (b) the 'RCM' method performs correlation between regression residuals and (c) 'ℓ(2C)' method maximizes a properly regularized log-likelihood function. Our extensive simulation studies showed that ℓ(2C) outperformed the other two methods having the most predictive partial correlation estimates and the highest values of sensitivity to infer conditional dependencies between genes even when a few number of observations was available. The application of this method for inferring gene networks of the isoprenoid biosynthesis pathways in Arabidopsis thaliana allowed to enlighten a negative partial correlation coefficient between the two hubs in the two isoprenoid pathways and, more importantly, provided an evidence of cross-talk between genes in the plastidial and the cytosolic pathways. When applied to gene expression data relative to a signature of HRAS oncogene in human cell cultures, the method revealed 9 genes (p-value<0.0005) directly interacting with HRAS, sharing the same Ras-responsive binding site for the transcription factor RREB1. This result suggests that the transcriptional activation of these genes is mediated by a common transcription factor downstream of Ras signaling. Software implementing the methods in the form of Matlab scripts are available at: http://users.ba.cnr.it/issia/iesina18/CovSelModelsCodes.zip. Copyright © 2013 The Authors. Published by

NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

Directory of Open Access Journals (Sweden)

Xingguo Zhu

Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

Connected Gene Communities Underlie Transcriptional Changes in Cornelia de Lange Syndrome.

Science.gov (United States)

Boudaoud, Imène; Fournier, Éric; Baguette, Audrey; Vallée, Maxime; Lamaze, Fabien C; Droit, Arnaud; Bilodeau, Steve

2017-09-01

Cornelia de Lange syndrome (CdLS) is a complex multisystem developmental disorder caused by mutations in cohesin subunits and regulators. While its precise molecular mechanisms are not well defined, they point toward a global deregulation of the transcriptional gene expression program. Cohesin is associated with the boundaries of chromosome domains and with enhancer and promoter regions connecting the three-dimensional genome organization with transcriptional regulation. Here, we show that connected gene communities, structures emerging from the interactions of noncoding regulatory elements and genes in the three-dimensional chromosomal space, provide a molecular explanation for the pathoetiology of CdLS associated with mutations in the cohesin-loading factor NIPBL and the cohesin subunit SMC1A NIPBL and cohesin are important constituents of connected gene communities that are centrally positioned at noncoding regulatory elements. Accordingly, genes deregulated in CdLS are positioned within reach of NIPBL- and cohesin-occupied regions through promoter-promoter interactions. Our findings suggest a dynamic model where NIPBL loads cohesin to connect genes in communities, offering an explanation for the gene expression deregulation in the CdLS. Copyright © 2017 by the Genetics Society of America.

De novo deletion of HOXB gene cluster in a patient with failure to thrive, developmental delay, gastroesophageal reflux and bronchiectasis.

Science.gov (United States)

Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin

2015-01-01

We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors.

Science.gov (United States)

Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E S

2013-06-01

A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks.

Recurrent neural network based hybrid model for reconstructing gene regulatory network.

Science.gov (United States)

Raza, Khalid; Alam, Mansaf

2016-10-01

One of the exciting problems in systems biology research is to decipher how genome controls the development of complex biological system. The gene regulatory networks (GRNs) help in the identification of regulatory interactions between genes and offer fruitful information related to functional role of individual gene in a cellular system. Discovering GRNs lead to a wide range of applications, including identification of disease related pathways providing novel tentative drug targets, helps to predict disease response, and also assists in diagnosing various diseases including cancer. Reconstruction of GRNs from available biological data is still an open problem. This paper proposes a recurrent neural network (RNN) based model of GRN, hybridized with generalized extended Kalman filter for weight update in backpropagation through time training algorithm. The RNN is a complex neural network that gives a better settlement between biological closeness and mathematical flexibility to model GRN; and is also able to capture complex, non-linear and dynamic relationships among variables. Gene expression data are inherently noisy and Kalman filter performs well for estimation problem even in noisy data. Hence, we applied non-linear version of Kalman filter, known as generalized extended Kalman filter, for weight update during RNN training. The developed model has been tested on four benchmark networks such as DNA SOS repair network, IRMA network, and two synthetic networks from DREAM Challenge. We performed a comparison of our results with other state-of-the-art techniques which shows superiority of our proposed model. Further, 5% Gaussian noise has been induced in the dataset and result of the proposed model shows negligible effect of noise on results, demonstrating the noise tolerance capability of the model. Copyright © 2016 Elsevier Ltd. All rights reserved.

Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

Science.gov (United States)

Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

2016-03-01

The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

Science.gov (United States)

Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.

2016-01-01

SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798

Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression.

Science.gov (United States)

Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten

2016-12-01

Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

A robust approach to identifying tissue-specific gene expression regulatory variants using personalized human induced pluripotent stem cells.

Directory of Open Access Journals (Sweden)

Je-Hyuk Lee

2009-11-01

Full Text Available Normal variation in gene expression due to regulatory polymorphisms is often masked by biological and experimental noise. In addition, some regulatory polymorphisms may become apparent only in specific tissues. We derived human induced pluripotent stem (iPS cells from adult skin primary fibroblasts and attempted to detect tissue-specific cis-regulatory variants using in vitro cell differentiation. We used padlock probes and high-throughput sequencing for digital RNA allelotyping and measured allele-specific gene expression in primary fibroblasts, lymphoblastoid cells, iPS cells, and their differentiated derivatives. We show that allele-specific expression is both cell type and genotype-dependent, but the majority of detectable allele-specific expression loci remains consistent despite large changes in the cell type or the experimental condition following iPS reprogramming, except on the X-chromosome. We show that our approach to mapping cis-regulatory variants reduces in vitro experimental noise and reveals additional tissue-specific variants using skin-derived human iPS cells.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

Science.gov (United States)

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Biomarkers of adult and developmental neurotoxicity

International Nuclear Information System (INIS)

Slikker, William; Bowyer, John F.

2005-01-01

Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations

PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

Directory of Open Access Journals (Sweden)

Huang Hsien-Da

2008-11-01

Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

Gene expression profiles of Bapx1 expressing FACS sorted cells from wildtype and Bapx1-EGFP null mouse embryos

Directory of Open Access Journals (Sweden)

Sumantra Chatterjee

2015-09-01

Full Text Available The data described in this article refers to Chatterjee et al. (2015 “In vivo genome-wide analysis of multiple tissues identifies gene regulatory networks, novel functions and downstream regulatory genes for Bapx1 and its co-regulation with Sox9 in the mammalian vertebral column” (GEO GSE35649 [1]. Transcriptional profiling combined with genome wide binding data is a powerful tool to elucidate the molecular mechanism behind vertebrate organogenesis. It also helps to uncover multiple roles of a single gene in different organs. In the above mentioned report we reveal the function of the homeobox gene Bapx1 during the embryogenesis of five distinct organs (vertebral column, spleen, gut, forelimb and hindlimb at a relevant developmental stage (E12.5, microarray analysis of isolated wildtype and mutant cells in is compared in conjunction with ChIP-Seq analysis. We also analyzed the development of the vertebral column by comparing microarray and ChIP-Seq data for Bapx1 with similarly generated data sets for Sox9 to generate a gene regulatory network controlling various facets of the organogenesis.

Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

Science.gov (United States)

Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

2016-05-01

The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

An integrated strategy for analyzing the unique developmental programs of different myoblast subtypes.

Directory of Open Access Journals (Sweden)

2006-02-01

Full Text Available An important but largely unmet challenge in understanding the mechanisms that govern the formation of specific organs is to decipher the complex and dynamic genetic programs exhibited by the diversity of cell types within the tissue of interest. Here, we use an integrated genetic, genomic, and computational strategy to comprehensively determine the molecular identities of distinct myoblast subpopulations within the Drosophila embryonic mesoderm at the time that cell fates are initially specified. A compendium of gene expression profiles was generated for primary mesodermal cells purified by flow cytometry from appropriately staged wild-type embryos and from 12 genotypes in which myogenesis was selectively and predictably perturbed. A statistical meta-analysis of these pooled datasets--based on expected trends in gene expression and on the relative contribution of each genotype to the detection of known muscle genes--provisionally assigned hundreds of differentially expressed genes to particular myoblast subtypes. Whole embryo in situ hybridizations were then used to validate the majority of these predictions, thereby enabling true-positive detection rates to be estimated for the microarray data. This combined analysis reveals that myoblasts exhibit much greater gene expression heterogeneity and overall complexity than was previously appreciated. Moreover, it implicates the involvement of large numbers of uncharacterized, differentially expressed genes in myogenic specification and subsequent morphogenesis. These findings also underscore a requirement for considerable regulatory specificity for generating diverse myoblast identities. Finally, to illustrate how the developmental functions of newly identified myoblast genes can be efficiently surveyed, a rapid RNA interference assay that can be scored in living embryos was developed and applied to selected genes. This integrated strategy for examining embryonic gene expression and function provides

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

Directory of Open Access Journals (Sweden)

Seong Hwan Park

2013-01-01

Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

Science.gov (United States)

Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

2013-01-01

Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

Identification of a new gene regulatory circuit involving B cell receptor activated signaling using a combined analysis of experimental, clinical and global gene expression data

Science.gov (United States)

Schrader, Alexandra; Meyer, Katharina; Walther, Neele; Stolz, Ailine; Feist, Maren; Hand, Elisabeth; von Bonin, Frederike; Evers, Maurits; Kohler, Christian; Shirneshan, Katayoon; Vockerodt, Martina; Klapper, Wolfram; Szczepanowski, Monika; Murray, Paul G.; Bastians, Holger; Trümper, Lorenz; Spang, Rainer; Kube, Dieter

2016-01-01

To discover new regulatory pathways in B lymphoma cells, we performed a combined analysis of experimental, clinical and global gene expression data. We identified a specific cluster of genes that was coherently expressed in primary lymphoma samples and suppressed by activation of the B cell receptor (BCR) through αIgM treatment of lymphoma cells in vitro. This gene cluster, which we called BCR.1, includes numerous cell cycle regulators. A reduced expression of BCR.1 genes after BCR activation was observed in different cell lines and also in CD10+ germinal center B cells. We found that BCR activation led to a delayed entry to and progression of mitosis and defects in metaphase. Cytogenetic changes were detected upon long-term αIgM treatment. Furthermore, an inverse correlation of BCR.1 genes with c-Myc co-regulated genes in distinct groups of lymphoma patients was observed. Finally, we showed that the BCR.1 index discriminates activated B cell-like and germinal centre B cell-like diffuse large B cell lymphoma supporting the functional relevance of this new regulatory circuit and the power of guided clustering for biomarker discovery. PMID:27166259

Pyrosequencing of Haliotis diversicolor transcriptomes: insights into early developmental molluscan gene expression.

Directory of Open Access Journals (Sweden)

Zi-Xia Huang

Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.

Quantitative inference of dynamic regulatory pathways via microarray data

Directory of Open Access Journals (Sweden)

Chen Bor-Sen

2005-03-01

Full Text Available Abstract Background The cellular signaling pathway (network is one of the main topics of organismic investigations. The intracellular interactions between genes in a signaling pathway are considered as the foundation of functional genomics. Thus, what genes and how much they influence each other through transcriptional binding or physical interactions are essential problems. Under the synchronous measures of gene expression via a microarray chip, an amount of dynamic information is embedded and remains to be discovered. Using a systematically dynamic modeling approach, we explore the causal relationship among genes in cellular signaling pathways from the system biology approach. Results In this study, a second-order dynamic model is developed to describe the regulatory mechanism of a target gene from the upstream causality point of view. From the expression profile and dynamic model of a target gene, we can estimate its upstream regulatory function. According to this upstream regulatory function, we would deduce the upstream regulatory genes with their regulatory abilities and activation delays, and then link up a regulatory pathway. Iteratively, these regulatory genes are considered as target genes to trace back their upstream regulatory genes. Then we could construct the regulatory pathway (or network to the genome wide. In short, we can infer the genetic regulatory pathways from gene-expression profiles quantitatively, which can confirm some doubted paths or seek some unknown paths in a regulatory pathway (network. Finally, the proposed approach is validated by randomly reshuffling the time order of microarray data. Conclusion We focus our algorithm on the inference of regulatory abilities of the identified causal genes, and how much delay before they regulate the downstream genes. With this information, a regulatory pathway would be built up using microarray data. In the present study, two signaling pathways, i.e. circadian regulatory

Developmental Transcriptome Analysis and Identification of Genes Involved in Larval Metamorphosis of the Razor Clam, Sinonovacula constricta.

Science.gov (United States)

Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale

2016-04-01

The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.

Regulation of signaling genes by TGFβ during entry into dauer diapause in C. elegans

Directory of Open Access Journals (Sweden)

Patterson Garth I

2004-09-01

Full Text Available Abstract Background When resources are scant, C. elegans larvae arrest as long-lived dauers under the control of insulin/IGF- and TGFβ-related signaling pathways. However, critical questions remain regarding the regulation of this developmental event. How do three dozen insulin-like proteins regulate one tyrosine kinase receptor to control complex events in dauer, metabolism and aging? How are signals from the TGFβ and insulin/IGF pathways integrated? What gene expression programs do these pathways regulate, and how do they control complex downstream events? Results We have identified genes that show different levels of expression in a comparison of wild-type L2 or L3 larvae (non-dauer to TGFβ mutants at similar developmental stages undergoing dauer formation. Many insulin/IGF pathway and other known dauer regulatory genes have changes in expression that suggest strong positive feedback by the TGFβ pathway. In addition, many insulin-like ligand and novel genes with similarity to the extracellular domain of insulin/IGF receptors have altered expression. We have identified a large group of regulated genes with putative binding sites for the FOXO transcription factor, DAF-16. Genes with DAF-16 sites upstream of the transcription start site tend to be upregulated, whereas genes with DAF-16 sites downstream of the coding region tend to be downregulated. Finally, we also see strong regulation of many novel hedgehog- and patched-related genes, hormone biosynthetic genes, cell cycle genes, and other regulatory genes. Conclusions The feedback regulation of insulin/IGF pathway and other dauer genes that we observe would be predicted to amplify signals from the TGFβ pathway; this amplification may serve to ensure a decisive choice between "dauer" and "non-dauer", even if environmental cues are ambiguous. Up and down regulation of insulin-like ligands and novel genes with similarity to the extracellular domain of insulin/IGF receptors suggests opposing

Engineering nucleases for gene targeting: safety and regulatory considerations.

Science.gov (United States)

Pauwels, Katia; Podevin, Nancy; Breyer, Didier; Carroll, Dana; Herman, Philippe

2014-01-25

Nuclease-based gene targeting (NBGT) represents a significant breakthrough in targeted genome editing since it is applicable from single-celled protozoa to human, including several species of economic importance. Along with the fast progress in NBGT and the increasing availability of customized nucleases, more data are available about off-target effects associated with the use of this approach. We discuss how NBGT may offer a new perspective for genetic modification, we address some aspects crucial for a safety improvement of the corresponding techniques and we also briefly relate the use of NBGT applications and products to the regulatory oversight. Copyright © 2013 Elsevier B.V. All rights reserved.

Generic Properties of Random Gene Regulatory Networks.

Science.gov (United States)

Li, Zhiyuan; Bianco, Simone; Zhang, Zhaoyang; Tang, Chao

2013-12-01

Modeling gene regulatory networks (GRNs) is an important topic in systems biology. Although there has been much work focusing on various specific systems, the generic behavior of GRNs with continuous variables is still elusive. In particular, it is not clear typically how attractors partition among the three types of orbits: steady state, periodic and chaotic, and how the dynamical properties change with network's topological characteristics. In this work, we first investigated these questions in random GRNs with different network sizes, connectivity, fraction of inhibitory links and transcription regulation rules. Then we searched for the core motifs that govern the dynamic behavior of large GRNs. We show that the stability of a random GRN is typically governed by a few embedding motifs of small sizes, and therefore can in general be understood in the context of these short motifs. Our results provide insights for the study and design of genetic networks.

Reduce, reuse, and recycle: developmental evolution of trait diversification.

Science.gov (United States)

Preston, Jill C; Hileman, Lena C; Cubas, Pilar

2011-03-01

A major focus of evolutionary developmental (evo-devo) studies is to determine the genetic basis of variation in organismal form and function, both of which are fundamental to biological diversification. Pioneering work on metazoan and flowering plant systems has revealed conserved sets of genes that underlie the bauplan of organisms derived from a common ancestor. However, the extent to which variation in the developmental genetic toolkit mirrors variation at the phenotypic level is an active area of research. Here we explore evidence from the angiosperm evo-devo literature supporting the frugal use of genes and genetic pathways in the evolution of developmental patterning. In particular, these examples highlight the importance of genetic pleiotropy in different developmental modules, thus reducing the number of genes required in growth and development, and the reuse of particular genes in the parallel evolution of ecologically important traits.

State of the Art of Fuzzy Methods for Gene Regulatory Networks Inference

Directory of Open Access Journals (Sweden)

Tuqyah Abdullah Al Qazlan

2015-01-01

Full Text Available To address one of the most challenging issues at the cellular level, this paper surveys the fuzzy methods used in gene regulatory networks (GRNs inference. GRNs represent causal relationships between genes that have a direct influence, trough protein production, on the life and the development of living organisms and provide a useful contribution to the understanding of the cellular functions as well as the mechanisms of diseases. Fuzzy systems are based on handling imprecise knowledge, such as biological information. They provide viable computational tools for inferring GRNs from gene expression data, thus contributing to the discovery of gene interactions responsible for specific diseases and/or ad hoc correcting therapies. Increasing computational power and high throughput technologies have provided powerful means to manage these challenging digital ecosystems at different levels from cell to society globally. The main aim of this paper is to report, present, and discuss the main contributions of this multidisciplinary field in a coherent and structured framework.

Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

Directory of Open Access Journals (Sweden)

Walker Angela M

2009-04-01

Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

Cis-regulatory signatures of orthologous stress-associated bZIP transcription factors from rice, sorghum and Arabidopsis based on phylogenetic footprints

Directory of Open Access Journals (Sweden)

Xu Fuyu

2012-09-01

Full Text Available Abstract Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa formed ten clusters of orthologous groups (COG with genes from the monocot sorghum (Sorghum bicolor and dicot Arabidopsis (Arabidopsis thaliana. The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in

Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

Directory of Open Access Journals (Sweden)

Lamprini G Kalampoki

Full Text Available Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN. The Paracentrotus lividus Coup-TF gene (PlCoup-TF is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232, was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3 within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1 or ectopic expression (RE2, RE3. It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

Science.gov (United States)

Kück, Ulrich

2005-10-01

Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

Directed partial correlation: inferring large-scale gene regulatory network through induced topology disruptions.

Directory of Open Access Journals (Sweden)

Yinyin Yuan

Full Text Available Inferring regulatory relationships among many genes based on their temporal variation in transcript abundance has been a popular research topic. Due to the nature of microarray experiments, classical tools for time series analysis lose power since the number of variables far exceeds the number of the samples. In this paper, we describe some of the existing multivariate inference techniques that are applicable to hundreds of variables and show the potential challenges for small-sample, large-scale data. We propose a directed partial correlation (DPC method as an efficient and effective solution to regulatory network inference using these data. Specifically for genomic data, the proposed method is designed to deal with large-scale datasets. It combines the efficiency of partial correlation for setting up network topology by testing conditional independence, and the concept of Granger causality to assess topology change with induced interruptions. The idea is that when a transcription factor is induced artificially within a gene network, the disruption of the network by the induction signifies a genes role in transcriptional regulation. The benchmarking results using GeneNetWeaver, the simulator for the DREAM challenges, provide strong evidence of the outstanding performance of the proposed DPC method. When applied to real biological data, the inferred starch metabolism network in Arabidopsis reveals many biologically meaningful network modules worthy of further investigation. These results collectively suggest DPC is a versatile tool for genomics research. The R package DPC is available for download (http://code.google.com/p/dpcnet/.

Developmental Pathways Are Blueprints for Designing Successful Crops

Directory of Open Access Journals (Sweden)

Ben Trevaskis

2018-06-01

Full Text Available Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene–gene or gene–environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted.

Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

Science.gov (United States)

Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P

2012-03-01

The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

Integration of Genome-Wide TF Binding and Gene Expression Data to Characterize Gene Regulatory Networks in Plant Development.

Science.gov (United States)

Chen, Dijun; Kaufmann, Kerstin

2017-01-01

Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.

Gene Therapy With Regulatory T Cells: A Beneficial Alliance

Directory of Open Access Journals (Sweden)

Moanaro Biswas

2018-03-01

Full Text Available Gene therapy aims to replace a defective or a deficient protein at therapeutic or curative levels. Improved vector designs have enhanced safety, efficacy, and delivery, with potential for lasting treatment. However, innate and adaptive immune responses to the viral vector and transgene product remain obstacles to the establishment of therapeutic efficacy. It is widely accepted that endogenous regulatory T cells (Tregs are critical for tolerance induction to the transgene product and in some cases the viral vector. There are two basic strategies to harness the suppressive ability of Tregs: in vivo induction of adaptive Tregs specific to the introduced gene product and concurrent administration of autologous, ex vivo expanded Tregs. The latter may be polyclonal or engineered to direct specificity to the therapeutic antigen. Recent clinical trials have advanced adoptive immunotherapy with Tregs for the treatment of autoimmune disease and in patients receiving cell transplants. Here, we highlight the potential benefit of combining gene therapy with Treg adoptive transfer to achieve a sustained transgene expression. Furthermore, techniques to engineer antigen-specific Treg cell populations, either through reprogramming conventional CD4+ T cells or transferring T cell receptors with known specificity into polyclonal Tregs, are promising in preclinical studies. Thus, based upon these observations and the successful use of chimeric (IgG-based antigen receptors (CARs in antigen-specific effector T cells, different types of CAR-Tregs could be added to the repertoire of inhibitory modalities to suppress immune responses to therapeutic cargos of gene therapy vectors. The diverse approaches to harness the ability of Tregs to suppress unwanted immune responses to gene therapy and their perspectives are reviewed in this article.

SCNS: a graphical tool for reconstructing executable regulatory networks from single-cell genomic data.

Science.gov (United States)

Woodhouse, Steven; Piterman, Nir; Wintersteiger, Christoph M; Göttgens, Berthold; Fisher, Jasmin

2018-05-25

Reconstruction of executable mechanistic models from single-cell gene expression data represents a powerful approach to understanding developmental and disease processes. New ambitious efforts like the Human Cell Atlas will soon lead to an explosion of data with potential for uncovering and understanding the regulatory networks which underlie the behaviour of all human cells. In order to take advantage of this data, however, there is a need for general-purpose, user-friendly and efficient computational tools that can be readily used by biologists who do not have specialist computer science knowledge. The Single Cell Network Synthesis toolkit (SCNS) is a general-purpose computational tool for the reconstruction and analysis of executable models from single-cell gene expression data. Through a graphical user interface, SCNS takes single-cell qPCR or RNA-sequencing data taken across a time course, and searches for logical rules that drive transitions from early cell states towards late cell states. Because the resulting reconstructed models are executable, they can be used to make predictions about the effect of specific gene perturbations on the generation of specific lineages. SCNS should be of broad interest to the growing number of researchers working in single-cell genomics and will help further facilitate the generation of valuable mechanistic insights into developmental, homeostatic and disease processes.

Heterologous expression of the Aspergillus nidulans regulatory gene nirA in Fusarium oxysporum.

Science.gov (United States)

Daboussi, M J; Langin, T; Deschamps, F; Brygoo, Y; Scazzocchio, C; Burger, G

1991-12-20

We have isolated strains of Fusarium oxysporum carrying mutations conferring a phenotype characteristic of a loss of function in the regulatory gene of nitrate assimilation (nirA in Aspergillus nidulans, nit-4 in Neurospora crassa). One of these nir- mutants was successfully transformed with a plasmid containing the nirA gene of A. nidulans. The nitrate reductase of the transformants is still inducible, although the maximum activity is lower than in the wild type. Single and multiple integration events were found, as well as a strict correlation between the presence of the nirA gene and the Nir+ phenotype of the F. oxysporum transformants. We also investigated how the A. nidulans structural gene (niaD) is regulated in F. oxysporum. Enzyme assays and Northern experiments show that the niaD gene is subject to nitrate induction and that it responds to nitrogen metabolite repression in a F. oxysporum genetic background. This indicates that both the mechanisms of specific induction, mediated by a gene product isofunctional to nirA, and nitrogen metabolite repression, presumably mediated by a gene product isofunctional to the homologous gene of A. nidulans, are operative in F. oxysporum.

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

Science.gov (United States)

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

Functional comparison of the nematode Hox gene lin-39 in C. elegans and P. pacificus reveals evolutionary conservation of protein function despite divergence of primary sequences

OpenAIRE

Grandien, Kaj; Sommer, Ralf J.

2001-01-01

Hox transcription factors have been implicated in playing a central role in the evolution of animal morphology. Many studies indicate the evolutionary importance of regulatory changes in Hox genes, but little is known about the role of functional changes in Hox proteins. In the nematodes Pristionchus pacificus and Caenorhabditis elegans, developmental processes can be compared at the cellular, genetic, and molecular levels and differences in gene function can be identified. The Hox gene lin-3...

Evaluation of artificial time series microarray data for dynamic gene regulatory network inference.

Science.gov (United States)

Xenitidis, P; Seimenis, I; Kakolyris, S; Adamopoulos, A

2017-08-07

High-throughput technology like microarrays is widely used in the inference of gene regulatory networks (GRNs). We focused on time series data since we are interested in the dynamics of GRNs and the identification of dynamic networks. We evaluated the amount of information that exists in artificial time series microarray data and the ability of an inference process to produce accurate models based on them. We used dynamic artificial gene regulatory networks in order to create artificial microarray data. Key features that characterize microarray data such as the time separation of directly triggered genes, the percentage of directly triggered genes and the triggering function type were altered in order to reveal the limits that are imposed by the nature of microarray data on the inference process. We examined the effect of various factors on the inference performance such as the network size, the presence of noise in microarray data, and the network sparseness. We used a system theory approach and examined the relationship between the pole placement of the inferred system and the inference performance. We examined the relationship between the inference performance in the time domain and the true system parameter identification. Simulation results indicated that time separation and the percentage of directly triggered genes are crucial factors. Also, network sparseness, the triggering function type and noise in input data affect the inference performance. When two factors were simultaneously varied, it was found that variation of one parameter significantly affects the dynamic response of the other. Crucial factors were also examined using a real GRN and acquired results confirmed simulation findings with artificial data. Different initial conditions were also used as an alternative triggering approach. Relevant results confirmed that the number of datasets constitutes the most significant parameter with regard to the inference performance. Copyright © 2017 Elsevier

An algebra-based method for inferring gene regulatory networks.

Science.gov (United States)

Vera-Licona, Paola; Jarrah, Abdul; Garcia-Puente, Luis David; McGee, John; Laubenbacher, Reinhard

2014-03-26

The inference of gene regulatory networks (GRNs) from experimental observations is at the heart of systems biology. This includes the inference of both the network topology and its dynamics. While there are many algorithms available to infer the network topology from experimental data, less emphasis has been placed on methods that infer network dynamics. Furthermore, since the network inference problem is typically underdetermined, it is essential to have the option of incorporating into the inference process, prior knowledge about the network, along with an effective description of the search space of dynamic models. Finally, it is also important to have an understanding of how a given inference method is affected by experimental and other noise in the data used. This paper contains a novel inference algorithm using the algebraic framework of Boolean polynomial dynamical systems (BPDS), meeting all these requirements. The algorithm takes as input time series data, including those from network perturbations, such as knock-out mutant strains and RNAi experiments. It allows for the incorporation of prior biological knowledge while being robust to significant levels of noise in the data used for inference. It uses an evolutionary algorithm for local optimization with an encoding of the mathematical models as BPDS. The BPDS framework allows an effective representation of the search space for algebraic dynamic models that improves computational performance. The algorithm is validated with both simulated and experimental microarray expression profile data. Robustness to noise is tested using a published mathematical model of the segment polarity gene network in Drosophila melanogaster. Benchmarking of the algorithm is done by comparison with a spectrum of state-of-the-art network inference methods on data from the synthetic IRMA network to demonstrate that our method has good precision and recall for the network reconstruction task, while also predicting several of the

Functional and topological characteristics of mammalian regulatory domains

Science.gov (United States)

Symmons, Orsolya; Uslu, Veli Vural; Tsujimura, Taro; Ruf, Sandra; Nassari, Sonya; Schwarzer, Wibke; Ettwiller, Laurence; Spitz, François

2014-01-01

Long-range regulatory interactions play an important role in shaping gene-expression programs. However, the genomic features that organize these activities are still poorly characterized. We conducted a large operational analysis to chart the distribution of gene regulatory activities along the mouse genome, using hundreds of insertions of a regulatory sensor. We found that enhancers distribute their activities along broad regions and not in a gene-centric manner, defining large regulatory domains. Remarkably, these domains correlate strongly with the recently described TADs, which partition the genome into distinct self-interacting blocks. Different features, including specific repeats and CTCF-binding sites, correlate with the transition zones separating regulatory domains, and may help to further organize promiscuously distributed regulatory influences within large domains. These findings support a model of genomic organization where TADs confine regulatory activities to specific but large regulatory domains, contributing to the establishment of specific gene expression profiles. PMID:24398455

Data Integration for Microarrays: Enhanced Inference for Gene Regulatory Networks

Directory of Open Access Journals (Sweden)

Alina Sîrbu

2015-05-01

Full Text Available Microarray technologies have been the basis of numerous important findings regarding gene expression in the few last decades. Studies have generated large amounts of data describing various processes, which, due to the existence of public databases, are widely available for further analysis. Given their lower cost and higher maturity compared to newer sequencing technologies, these data continue to be produced, even though data quality has been the subject of some debate. However, given the large volume of data generated, integration can help overcome some issues related, e.g., to noise or reduced time resolution, while providing additional insight on features not directly addressed by sequencing methods. Here, we present an integration test case based on public Drosophila melanogaster datasets (gene expression, binding site affinities, known interactions. Using an evolutionary computation framework, we show how integration can enhance the ability to recover transcriptional gene regulatory networks from these data, as well as indicating which data types are more important for quantitative and qualitative network inference. Our results show a clear improvement in performance when multiple datasets are integrated, indicating that microarray data will remain a valuable and viable resource for some time to come.

Data Integration for Microarrays: Enhanced Inference for Gene Regulatory Networks.

Science.gov (United States)

Sîrbu, Alina; Crane, Martin; Ruskin, Heather J

2015-05-14

Microarray technologies have been the basis of numerous important findings regarding gene expression in the few last decades. Studies have generated large amounts of data describing various processes, which, due to the existence of public databases, are widely available for further analysis. Given their lower cost and higher maturity compared to newer sequencing technologies, these data continue to be produced, even though data quality has been the subject of some debate. However, given the large volume of data generated, integration can help overcome some issues related, e.g., to noise or reduced time resolution, while providing additional insight on features not directly addressed by sequencing methods. Here, we present an integration test case based on public Drosophila melanogaster datasets (gene expression, binding site affinities, known interactions). Using an evolutionary computation framework, we show how integration can enhance the ability to recover transcriptional gene regulatory networks from these data, as well as indicating which data types are more important for quantitative and qualitative network inference. Our results show a clear improvement in performance when multiple datasets are integrated, indicating that microarray data will remain a valuable and viable resource for some time to come.

GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

Science.gov (United States)

Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

2013-09-01

GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

Science.gov (United States)

Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

2016-03-12

Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

Developmental psychopathology in an era of molecular genetics and neuroimaging: A developmental neurogenetics approach.

Science.gov (United States)

Hyde, Luke W

2015-05-01

The emerging field of neurogenetics seeks to model the complex pathways from gene to brain to behavior. This field has focused on imaging genetics techniques that examine how variability in common genetic polymorphisms predict differences in brain structure and function. These studies are informed by other complimentary techniques (e.g., animal models and multimodal imaging) and have recently begun to incorporate the environment through examination of Imaging Gene × Environment interactions. Though neurogenetics has the potential to inform our understanding of the development of psychopathology, there has been little integration between principles of neurogenetics and developmental psychopathology. The paper describes a neurogenetics and Imaging Gene × Environment approach and how these approaches have been usefully applied to the study of psychopathology. Six tenets of developmental psychopathology (the structure of phenotypes, the importance of exploring mechanisms, the conditional nature of risk, the complexity of multilevel pathways, the role of development, and the importance of who is studied) are identified, and how these principles can further neurogenetics applications to understanding the development of psychopathology is discussed. A major issue of this piece is how neurogenetics and current imaging and molecular genetics approaches can be incorporated into developmental psychopathology perspectives with a goal of providing models for better understanding pathways from among genes, environments, the brain, and behavior.

Cooperative adaptive responses in gene regulatory networks with many degrees of freedom.

Science.gov (United States)

Inoue, Masayo; Kaneko, Kunihiko

2013-04-01

Cells generally adapt to environmental changes by first exhibiting an immediate response and then gradually returning to their original state to achieve homeostasis. Although simple network motifs consisting of a few genes have been shown to exhibit such adaptive dynamics, they do not reflect the complexity of real cells, where the expression of a large number of genes activates or represses other genes, permitting adaptive behaviors. Here, we investigated the responses of gene regulatory networks containing many genes that have undergone numerical evolution to achieve high fitness due to the adaptive response of only a single target gene; this single target gene responds to changes in external inputs and later returns to basal levels. Despite setting a single target, most genes showed adaptive responses after evolution. Such adaptive dynamics were not due to common motifs within a few genes; even without such motifs, almost all genes showed adaptation, albeit sometimes partial adaptation, in the sense that expression levels did not always return to original levels. The genes split into two groups: genes in the first group exhibited an initial increase in expression and then returned to basal levels, while genes in the second group exhibited the opposite changes in expression. From this model, genes in the first group received positive input from other genes within the first group, but negative input from genes in the second group, and vice versa. Thus, the adaptation dynamics of genes from both groups were consolidated. This cooperative adaptive behavior was commonly observed if the number of genes involved was larger than the order of ten. These results have implications in the collective responses of gene expression networks in microarray measurements of yeast Saccharomyces cerevisiae and the significance to the biological homeostasis of systems with many components.

A relative variation-based method to unraveling gene regulatory networks.

Directory of Open Access Journals (Sweden)

Yali Wang

Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

Gene dosage compensation calibrates four regulatory RNAs to control Vibrio cholerae quorum sensing

DEFF Research Database (Denmark)

Svenningsen, Sine L; Tu, Kimberly C; Bassler, Bonnie L

2009-01-01

the quorum regulatory RNAs 1-4 (Qrr1-4). The four Qrr sRNAs are functionally redundant. That is, expression of any one of them is sufficient for wild-type quorum-sensing behaviour. Here, we show that the combined action of two feedback loops, one involving the sRNA-activator LuxO and one involving the sRNA......Quorum sensing is a mechanism of cell-to-cell communication that allows bacteria to coordinately regulate gene expression in response to changes in cell-population density. At the core of the Vibrio cholerae quorum-sensing signal transduction pathway reside four homologous small RNAs (sRNAs), named......-target HapR, promotes gene dosage compensation between the four qrr genes. Gene dosage compensation adjusts the total Qrr1-4 sRNA pool and provides the molecular mechanism underlying sRNA redundancy. The dosage compensation mechanism is exquisitely sensitive to small perturbations in Qrr levels. Precisely...

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

Science.gov (United States)

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana.

Science.gov (United States)

Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott

2016-08-01

Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.

The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.

Science.gov (United States)

Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C

2013-09-01

The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.

Evolutionary changes of Hox genes and relevant regulatory factors provide novel insights into mammalian morphological modifications.

Science.gov (United States)

Li, Kui; Sun, Xiaohui; Chen, Meixiu; Sun, Yingying; Tian, Ran; Wang, Zhengfei; Xu, Shixia; Yang, Guang

2018-01-01

The diversity of body plans of mammals accelerates the innovation of lifestyles and the extensive adaptation to different habitats, including terrestrial, aerial and aquatic habitats. However, the genetic basis of those phenotypic modifications, which have occurred during mammalian evolution, remains poorly explored. In the present study, we synthetically surveyed the evolutionary pattern of Hox clusters that played a powerful role in the morphogenesis along the head-tail axis of animal embryos and the main regulatory factors (Mll, Bmi1 and E2f6) that control the expression of Hox genes. A deflected density of repetitive elements and lineage-specific radical mutations of Mll have been determined in marine mammals with morphological changes, suggesting that evolutionary changes may alter Hox gene expression in these lineages, leading to the morphological modification of these lineages. Although no positive selection was detected at certain ancestor nodes of lineages, the increased ω values of Hox genes implied the relaxation of functional constraints of these genes during the mammalian evolutionary process. More importantly, 49 positively-selected sites were identified in mammalian lineages with phenotypic modifications, indicating adaptive evolution acting on Hox genes and regulatory factors. In addition, 3 parallel amino acid substitutions in some Hox genes were examined in marine mammals, which might be responsible for their streamlined body. © 2017 The Authors. Integrative Zoology published by International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements

Science.gov (United States)

Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.

2016-01-01

The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646

Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

International Nuclear Information System (INIS)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

2011-01-01

Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

OpenAIRE

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

Algebraic model checking for Boolean gene regulatory networks.

Science.gov (United States)

Tran, Quoc-Nam

2011-01-01

We present a computational method in which modular and Groebner bases (GB) computation in Boolean rings are used for solving problems in Boolean gene regulatory networks (BN). In contrast to other known algebraic approaches, the degree of intermediate polynomials during the calculation of Groebner bases using our method will never grow resulting in a significant improvement in running time and memory space consumption. We also show how calculation in temporal logic for model checking can be done by means of our direct and efficient Groebner basis computation in Boolean rings. We present our experimental results in finding attractors and control strategies of Boolean networks to illustrate our theoretical arguments. The results are promising. Our algebraic approach is more efficient than the state-of-the-art model checker NuSMV on BNs. More importantly, our approach finds all solutions for the BN problems.

Semi-supervised prediction of gene regulatory networks using machine learning algorithms.

Science.gov (United States)

Patel, Nihir; Wang, Jason T L

2015-10-01

Use of computational methods to predict gene regulatory networks (GRNs) from gene expression data is a challenging task. Many studies have been conducted using unsupervised methods to fulfill the task; however, such methods usually yield low prediction accuracies due to the lack of training data. In this article, we propose semi-supervised methods for GRN prediction by utilizing two machine learning algorithms, namely, support vector machines (SVM) and random forests (RF). The semi-supervised methods make use of unlabelled data for training. We investigated inductive and transductive learning approaches, both of which adopt an iterative procedure to obtain reliable negative training data from the unlabelled data. We then applied our semi-supervised methods to gene expression data of Escherichia coli and Saccharomyces cerevisiae, and evaluated the performance of our methods using the expression data. Our analysis indicated that the transductive learning approach outperformed the inductive learning approach for both organisms. However, there was no conclusive difference identified in the performance of SVM and RF. Experimental results also showed that the proposed semi-supervised methods performed better than existing supervised methods for both organisms.

Molecular characterization of a novel X-linked syndrome involving developmental delay and deafness.

Science.gov (United States)

Hildebrand, Michael S; de Silva, Michelle G; Tan, Tiong Yang; Rose, Elizabeth; Nishimura, Carla; Tolmachova, Tanya; Hulett, Joanne M; White, Susan M; Silver, Jeremy; Bahlo, Melanie; Smith, Richard J H; Dahl, Hans-Henrik M

2007-11-01

X-linked syndromes associated with developmental delay and sensorineural hearing loss (SNHL) have been characterized at the molecular level, including Mohr-Tranebjaerg syndrome and Norrie disease. In this study we report on a novel X-linked recessive, congenital syndrome in a family with developmental delay and SNHL that maps to a locus associated with mental retardation (MR) for which no causative gene has been identified. The X-linked recessive inheritance and congenital nature of the syndrome was confirmed by detailed clinical investigation and the family history. Linkage mapping of the X-chromosome was conducted to ascertain the disease locus and candidate genes were screened by direct sequencing and STRP analysis. The recessive syndrome was mapped to Xp11.3-q21.32 and a deletion was identified in a regulatory region upstream of the POU3F4 gene in affected family members. Since mutations in POU3F4 cause deafness at the DFN3 locus, the deletion is the likely cause of the SNHL in this family. The choroideremia (CHM) gene was also screened and a novel missense change was identified. The alteration changes the serine residue at position 89 in the Rab escort 1 protein (REP-1) to a cysteine (S89C). Prenylation of Rab proteins was investigated in patients and the location of REP-1 expression in the brain determined. However, subsequent analysis revealed that this change in CHM was polymorphic having no effect on REP-1 function. Although the causative gene at the MR locus in this family has not been identified, there are a number of genes involved in syndromic and nonsyndromic forms of MR that are potential candidates. Copyright 2007 Wiley-Liss, Inc.