TRANSPORT PROPERTIES FOR REFRIGERANT MIXTURES

Directory of Open Access Journals (Sweden)

V. Geller

2014-06-01

Full Text Available A set of models to predict viscosity and thermal conductivity of refrigerant mixtures is developed. A general model for viscosity and thermal conductivity use the three contributions sum form (the dilute-gas terms, the residual terms, and the liquid terms. The corresponding states model is recommended to predict the dense gas transport properties over a range of reduced density from 0 to 2. It is shown that the RHS model provides the most reliable results for the saturated-liquid and the compressed-liquid transport properties over a range of given temperatures from 0,5 to 0,95.

Charge transport properties of metal/metal-phthalocyanine/n-Si structures

Energy Technology Data Exchange (ETDEWEB)

Hussain, Afzal

2010-12-16

In present work the charge transport properties of metal/metal-phthalocyanine/n-Si structures with low (N{sub D} = 4 x 10{sup 14} cm{sup -3}), medium (N{sub D}=1 x 10{sup 16} cm{sup -3}) and high (N{sub D}=2 x 10{sup 19} cm{sup -3}) doped n-Si as injecting electrode and the effect of air exposure of the vacuum evaporated metal-phthalocyanine film in these structures is investigated. The results obtained through temperature dependent electrical characterizations of the structures suggest that in terms of dominant conduction mechanism in the corresponding devices Schottky-type conduction mechanism dominates the charge transport in low-bias region of these devices up to 0.8 V, 0.302 V and 0.15 V in case of low, medium and high doped n-Silicon devices. For higher voltages, in each case of devices, the space-charge-limited conduction, controlled by exponential trap distribution, is found to dominate the charge transport properties of the devices. The interface density of states at the CuPc/n-Si interface of the devices are found to be lower in case of lower work function difference at the CuPc/n-Si interface of the devices. The results also suggest that the work function difference at the CuPc/n-Si interface of these devices causes charge transfer at the interface and these phenomena results in formation of interface dipole. The width of the Schottky depletion region at the CuPc/n-Si interface of these devices is found to be higher with higher work function difference at the interface. The investigation of charge transport properties of Al/ZnPc/medium n-Si and Au/ZnPc/ medium n-Si devices suggest that the Schottky depletion region formed at the ZnPc/n-Si interface of these devices determines the charge transport in the low-bias region of both the devices. Therefore, the Schottky-type (injection limited) and the space-charge-limited (bulk limited) conduction are observed in the low and the high bias regions of these devices, respectively. The determined width of the

Transport and Phase Equilibria Properties for Steam Flooding of Heavy Oils

Energy Technology Data Exchange (ETDEWEB)

Gabitto, Jorge; Barrufet, Maria

2002-11-20

The objectives of this research included experimental determination and rigorous modeling and computation of phase equilibrium diagrams, volumetric, and transport properties of hydrocarbon/CO2/water mixtures at pressures and temperatures typical of steam injection processes for thermal recovery of heavy oils.

Coupled light transport-heat diffusion model for laser dosimetry with dynamic optical properties

International Nuclear Information System (INIS)

London, R.A.; Glinsky, M.E.; Zimmerman, G.B.; Eder, D.C.; Jacques, S.L.

1995-01-01

The effect of dynamic optical properties on the spatial distribution of light in laser therapy is studied via numerical simulations. A two-dimensional, time dependent computer program called LATIS is used. Laser light transport is simulated with a Monte Carlo technique including anisotropic scattering and absorption. Thermal heat transport is calculated with a finite difference algorithm. Material properties are specified on a 2-D mesh and can be arbitrary functions of space and time. Arrhenius rate equations are solved for tissue damage caused by elevated temperatures. Optical properties are functions of tissue damage, as determined by previous measurements. Results are presented for the time variation of the light distribution and damage within the tissue as the optical properties of the tissue are altered

Thermodynamic and transport properties of two-temperature SF6 plasmas

International Nuclear Information System (INIS)

Wang Weizong; Rong Mingzhe; Wu Yi; Spencer, Joseph W.; Yan, Joseph D.; Mei, DanHua

2012-01-01

This paper deals with thermodynamic and transport properties of SF 6 plasmas in a two-temperature model for both thermal equilibrium and non-equilibrium conditions. The species composition and thermodynamic properties are numerically determined using the two-temperature Saha equation and Guldberg-Waage equation according to deviation of van de Sanden et al. Transport properties including diffusion coefficient, viscosity, thermal conductivity, and electrical conductivity are calculated with most recent collision interaction potentials by adopting Devoto’s electron and heavy particle decoupling approach but expanded to the third-order approximation (second-order for viscosity) in the frame of Chapman–Enskog method. The results are computed for various values of pressures from 0.1 atm to 10 atm and ratios of the electron temperature to the heavy particle temperature from 1 to 20 with electron temperature range from 300 to 40 000 K. In the local thermodynamic equilibrium regime, results are compared with available results of previously published studies.

A non-Linear transport model for determining shale rock characteristics

Science.gov (United States)

Ali, Iftikhar; Malik, Nadeem

2016-04-01

Unconventional hydrocarbon reservoirs consist of tight porous rocks which are characterised by nano-scale size porous networks with ultra-low permeability [1,2]. Transport of gas through them is not well understood at the present time, and realistic transport models are needed in order to determine rock properties and for estimating future gas pressure distribution in the reservoirs. Here, we consider a recently developed non-linear gas transport equation [3], ∂p-+ U ∂p- = D ∂2p-, t > 0, (1) ∂t ∂x ∂x2 complimented with suitable initial and boundary conditions, in order to determine shale rock properties such as the permeability K, the porosity φ and the tortuosity, τ. In our new model, the apparent convection velocity, U = U(p,px), and the apparent diffusivity D = D(p), are both highly non-linear functions of the pressure. The model incorporate various flow regimes (slip, surface diffusion, transition, continuum) based upon the Knudsen number Kn, and also includes Forchchiemers turbulence correction terms. In application, the model parameters and associated compressibility factors are fully pressure dependent, giving the model more realism than previous models. See [4]. Rock properties are determined by solving an inverse problem, with model parameters adjustment to minimise the error between the model simulation and available data. It is has been found that the proposed model performs better than previous models. Results and details of the model will be presented at the conference. Corresponding author: namalik@kfupm.edu.sa and nadeem_malik@cantab.net References [1] Cui, X., Bustin, A.M. and Bustin, R., "Measurements of gas permeability and diffusivity of tight reservoir rocks: different approaches and their applications", Geofluids 9, 208-223 (2009). [2] Chiba R., Fomin S., Chugunov V., Niibori Y. and Hashida T., "Numerical Simulation of Non Fickian Diffusion and Advection in a Fractured Porous Aquifer", AIP Conference Proceedings 898, 75 (2007

Transport properties of molecular junctions

CERN Document Server

Zimbovskaya, Natalya A

2013-01-01

A comprehensive overview of the physical mechanisms that control electron transport and the characteristics of metal-molecule-metal (MMM) junctions is presented. As far as possible, methods and formalisms presented elsewhere to analyze electron transport through molecules are avoided. This title introduces basic concepts—a description of the electron transport through molecular junctions—and briefly describes relevant experimental methods. Theoretical methods commonly used to analyze the electron transport through molecules are presented. Various effects that manifest in the electron transport through MMMs, as well as the basics of density-functional theory and its applications to electronic structure calculations in molecules are presented. Nanoelectronic applications of molecular junctions and similar systems are discussed as well. Molecular electronics is a diverse and rapidly growing field. Transport Properties of Molecular Junctions presents an up-to-date survey of the field suitable for researchers ...

Modeling the transport properties of epitaxially grown thermoelectric oxide thin films using spectroscopic ellipsometry

KAUST Repository

Sarath Kumar, S. R.

2012-02-01

The influence of oxygen vacancies on the transport properties of epitaxial thermoelectric (Sr,La)TiO3 thin films is determined using electrical and spectroscopic ellipsometry (SE) measurements. Oxygen vacancy concentration was varied by ex-situ annealing in Ar and Ar/H2. All films exhibited degenerate semiconducting behavior, and electrical conductivity decreased (258–133 S cm−1) with increasing oxygen content. Similar decrease in the Seebeck coefficient is observed and attributed to a decrease in effective mass (7.8–3.2 me ), as determined by SE. Excellent agreement between transport properties deduced from SE and direct electrical measurements suggests that SE is an effective tool for studying oxide thin film thermoelectrics.

Modeling the transport properties of epitaxially grown thermoelectric oxide thin films using spectroscopic ellipsometry

KAUST Repository

Sarath Kumar, S. R.; Abutaha, Anas I.; Hedhili, Mohamed N.; Alshareef, Husam N.

2012-01-01

The influence of oxygen vacancies on the transport properties of epitaxial thermoelectric (Sr,La)TiO3 thin films is determined using electrical and spectroscopic ellipsometry (SE) measurements. Oxygen vacancy concentration was varied by ex-situ annealing in Ar and Ar/H2. All films exhibited degenerate semiconducting behavior, and electrical conductivity decreased (258–133 S cm−1) with increasing oxygen content. Similar decrease in the Seebeck coefficient is observed and attributed to a decrease in effective mass (7.8–3.2 me ), as determined by SE. Excellent agreement between transport properties deduced from SE and direct electrical measurements suggests that SE is an effective tool for studying oxide thin film thermoelectrics.

Experimental Determination of Hydraulic Properties of Unsaturated Calcarenites

Science.gov (United States)

Turturro, Antonietta Celeste; Andriani, Gioacchino Francesco; Clementina Caputo, Maria; Maggi, Sabino

2013-04-01

Understanding hydraulic properties is essential in the modeling of flow and solute transport through the vadose zone, to which problems of soil and groundwater pollution are related. The vadose zone, in fact, is of great importance in controlling groundwater recharge and transport of contaminants into and through the subsoil. The aim of this work is to determine experimentally in laboratory the hydraulic properties of unsaturated calcarenites using an approach including petrophysical determinations and methods for measuring water retention. For this purpose, samples of calcarenites belonging to the Calcarenite di Gravina Fm.(Pliocene-early Pleistocene), came from two different quarry districts located in Southern Italy (Canosa di Puglia and Massafra), were utilized. The water retention function, θ(h), which binds the water content, θ, to water potential, h, was determined in the laboratory by means two different experimental methods: the WP4-T psychrometer and the suction table. At last, a simple mathematical equation represented by van Genuchten's model is fitted to the experimental data and the unknown empirical parameters of this model are determined. Textural analysis on thin sections using optical petrographic microscopy and evaluation of total and effective porosity by means of standard geotechnical laboratory tests, mercury intrusion porosimetry and image analysis were also performed. In particular, a comparison between mercury porosimetry data and results of photomicrograph computer analysis through the methods of quantitative stereology was employed for providing pore size distributions. The results of this study identify the relationship between the hydraulic behavior, described by the water retention function, and pore size distribution for the calcarenites that are not easy to hydraulically characterize. This relationship could represent a useful tool to infer the unsaturated hydraulic properties of calcarenites and in general this approach could be

Cell Membrane Transport Mechanisms: Ion Channels and Electrical Properties of Cell Membranes.

Science.gov (United States)

Kulbacka, Julita; Choromańska, Anna; Rossowska, Joanna; Weżgowiec, Joanna; Saczko, Jolanta; Rols, Marie-Pierre

2017-01-01

Cellular life strongly depends on the membrane ability to precisely control exchange of solutes between the internal and external (environmental) compartments. This barrier regulates which types of solutes can enter and leave the cell. Transmembrane transport involves complex mechanisms responsible for passive and active carriage of ions and small- and medium-size molecules. Transport mechanisms existing in the biological membranes highly determine proper cellular functions and contribute to drug transport. The present chapter deals with features and electrical properties of the cell membrane and addresses the questions how the cell membrane accomplishes transport functions and how transmembrane transport can be affected. Since dysfunctions of plasma membrane transporters very often are the cause of human diseases, we also report how specific transport mechanisms can be modulated or inhibited in order to enhance the therapeutic effect.

CET89 - CHEMICAL EQUILIBRIUM WITH TRANSPORT PROPERTIES, 1989

Science.gov (United States)

Mcbride, B.

1994-01-01

Scientists and engineers need chemical equilibrium composition data to calculate the theoretical thermodynamic properties of a chemical system. This information is essential in the design and analysis of equipment such as compressors, turbines, nozzles, engines, shock tubes, heat exchangers, and chemical processing equipment. The substantial amount of numerical computation required to obtain equilibrium compositions and transport properties for complex chemical systems led scientists at NASA's Lewis Research Center to develop CET89, a program designed to calculate the thermodynamic and transport properties of these systems. CET89 is a general program which will calculate chemical equilibrium compositions and mixture properties for any chemical system with available thermodynamic data. Generally, mixtures may include condensed and gaseous products. CET89 performs the following operations: it 1) obtains chemical equilibrium compositions for assigned thermodynamic states, 2) calculates dilute-gas transport properties of complex chemical mixtures, 3) obtains Chapman-Jouguet detonation properties for gaseous species, 4) calculates incident and reflected shock properties in terms of assigned velocities, and 5) calculates theoretical rocket performance for both equilibrium and frozen compositions during expansion. The rocket performance function allows the option of assuming either a finite area or an infinite area combustor. CET89 accommodates problems involving up to 24 reactants, 20 elements, and 600 products (400 of which may be condensed). The program includes a library of thermodynamic and transport properties in the form of least squares coefficients for possible reaction products. It includes thermodynamic data for over 1300 gaseous and condensed species and transport data for 151 gases. The subroutines UTHERM and UTRAN convert thermodynamic and transport data to unformatted form for faster processing. The program conforms to the FORTRAN 77 standard, except for

Transport processes in partially saturate concrete: Testing and liquid properties

Science.gov (United States)

Villani, Chiara

The measurement of transport properties of concrete is considered by many to have the potential to serve as a performance criterion that can be related to concrete durability. However, the sensitivity of transport tests to several parameters combined with the low permeability of concrete complicates the testing. Gas permeability and diffusivity test methods are attractive due to the ease of testing, their non-destructive nature and their potential to correlate to in-field carbonation of reinforced concrete structures. This work was aimed at investigating the potential of existing gas transport tests as a way to reliably quantify transport properties in concrete. In this study gas permeability and diffusivity test methods were analyzed comparing their performance in terms of repeatability and variability. The influence of several parameters was investigated such as moisture content, mixture proportions and gas flow. A closer look to the influence of pressure revealed an anomalous trend of permeability with respect to pressure. An alternative calculation is proposed in an effort to move towards the determination of intrinsic material properties that can serve as an input for service life prediction models. The impact of deicing salts exposure was also analyzed with respect to their alteration of the degree of saturation as this may affect gas transport in cementitious materials. Limited information were previously available on liquid properties over a wide range of concentrations. To overcome this limitation, this study quantified surface tension, viscosity in presence of deicing salts in a broad concentration range and at different temperatures. Existing models were applied to predict the change of fluid properties during drying. Vapor desorption isotherms were obtained to investigate the influence of deicing salts presence on the non-linear moisture diffusion coefficient. Semi-empirical models were used to quantify the initiation and the rate of drying using liquid

Thermodynamic and transport properties of gaseous tetrafluoromethane in chemical equilibrium

Science.gov (United States)

Hunt, J. L.; Boney, L. R.

1973-01-01

Equations and in computer code are presented for the thermodynamic and transport properties of gaseous, undissociated tetrafluoromethane (CF4) in chemical equilibrium. The computer code calculates the thermodynamic and transport properties of CF4 when given any two of five thermodynamic variables (entropy, temperature, volume, pressure, and enthalpy). Equilibrium thermodynamic and transport property data are tabulated and pressure-enthalpy diagrams are presented.

Transport properties site descriptive model. Guidelines for evaluation and modelling

International Nuclear Information System (INIS)

Berglund, Sten; Selroos, Jan-Olof

2004-04-01

This report describes a strategy for the development of Transport Properties Site Descriptive Models within the SKB Site Investigation programme. Similar reports have been produced for the other disciplines in the site descriptive modelling (Geology, Hydrogeology, Hydrogeochemistry, Rock mechanics, Thermal properties, and Surface ecosystems). These reports are intended to guide the site descriptive modelling, but also to provide the authorities with an overview of modelling work that will be performed. The site descriptive modelling of transport properties is presented in this report and in the associated 'Strategy for the use of laboratory methods in the site investigations programme for the transport properties of the rock', which describes laboratory measurements and data evaluations. Specifically, the objectives of the present report are to: Present a description that gives an overview of the strategy for developing Site Descriptive Models, and which sets the transport modelling into this general context. Provide a structure for developing Transport Properties Site Descriptive Models that facilitates efficient modelling and comparisons between different sites. Provide guidelines on specific modelling issues where methodological consistency is judged to be of special importance, or where there is no general consensus on the modelling approach. The objectives of the site descriptive modelling process and the resulting Transport Properties Site Descriptive Models are to: Provide transport parameters for Safety Assessment. Describe the geoscientific basis for the transport model, including the qualitative and quantitative data that are of importance for the assessment of uncertainties and confidence in the transport description, and for the understanding of the processes at the sites. Provide transport parameters for use within other discipline-specific programmes. Contribute to the integrated evaluation of the investigated sites. The site descriptive modelling of

Two-temperature thermodynamic and transport properties of SF6–Cu plasmas

International Nuclear Information System (INIS)

Wu, Yi; Chen, Zhexin; Yang, Fei; Rong, Mingzhe; Sun, Hao; Cressault, Yann; Murphy, Anthony B; Guo, Anxiang; Liu, Zirui

2015-01-01

SF 6 and Cu are widely adopted in electrical equipment as a dielectric medium and for conductive components, respectively. SF 6 –Cu plasmas are frequently formed, particularly in high-voltage circuit breaker arcs and fault current arcs, due to erosion of the Cu components. In this paper, calculated values of the thermodynamic and transport properties of plasmas in SF 6 –Cu mixtures are presented for both thermal equilibrium and non-equilibrium conditions. The composition is determined by the two-temperature Saha equation and Guldberg–Waage equation in the form derived by van de Sanden. The composition and the thermodynamic properties are evaluated through a classical statistical mechanics approach. For the transport coefficients, the simplified Chapman–Enskog method developed by Devoto, which decouples the electrons and heavy species, has been applied using the most recent collision integrals. The thermodynamic and transport properties are calculated for different electron temperatures (300–40 000 K), ratios of electron to heavy-species temperature (1–10), pressures (0.1–10 atm) and copper molar proportions (0–50%). It is found that deviations from thermal equilibrium strongly affect the thermodynamic and transport properties of the SF 6 –Cu plasmas. Further, the presence of copper has different effects on some of the properties for plasmas in and out of thermal equilibrium. The main reason for these changes is that dissociation reactions are delayed for non-thermal equilibrium plasmas, which in turn influences the ionization reactions that occur. (paper)

Simultaneous measurements of transport and poroelastic properties of rocks.

Science.gov (United States)

Hasanov, Azar K; Prasad, Manika; Batzle, Michael L

2017-12-01

A novel laboratory apparatus has been developed for simultaneous measurements of transport and poroelastic rock properties. These transport and poroelastic properties at reservoir pressure and temperature conditions are required inputs for various geoscience applications, such as reservoir simulation, basin modeling, or modeling of pore pressure generation. Traditionally, the transport and poroelastic properties are measured separately using, for example, the oscillating pore pressure method to measure hydraulic transport properties, static strain measurements for elastic properties, and pore volumometry for storage capacity. In addition to time, the separate set of measurements require either aliquot cores or subjecting the same core to multiple pressure tests. We modified the oscillating pore pressure method to build an experimental setup, capable of measuring permeability, storage capacity, and pseudo-bulk modulus of rocks simultaneously. We present here the test method, calibration measurements (capillary tube), and sample measurements (sandstone) of permeability and storage capacity at reservoir conditions. We establish that hydraulically measured storage capacities were overestimated by an order of magnitude when compared to elastically derived ones. Our concurrent measurement of elastic properties during the hydraulic experiment provides an independent constraint on storage capacity.

Transport Gap and exciton binding energy determination in organic semiconductors

Energy Technology Data Exchange (ETDEWEB)

Krause, Stefan; Schoell, Achim; Reinert, Friedrich; Umbach, Eberhard [University of Wuerzburg (Germany). Experimental Physics II; Casu, Benedetta [Inst. f. Physik. u. Theor. Chemie, Tuebingen (Germany)

2008-07-01

The transport gap of an organic semiconductor is defined as the energy difference between the HOMO and LUMO levels in the presence of a hole or electron, respectively, after relaxation has occurred. Its knowledge is mandatory for the optimisation of electronic devices based on these materials. UV photoelectron spectroscopy (UPS) and inverse photoelectron spectroscopy (IPES) are routinely applied to measure these molecular levels. However, the precise determination of the transport gap on the basis of the respective data is not an easy task. It involves fundamental questions about the properties of organic molecules and their condensates, about their reaction on the experimental probe, and on the evaluation of the spectroscopic data. In particular electronic relaxation processes, which occur on the time scale of the photo excitation, have to be considered adequately. We determined the transport gap for the organic semiconductors PTCDA, Alq3, DIP, CuPc, and PBI-H4. After careful data analysis and comparison to the respective values for the optical gap we obtain values for the exciton binding energies between 0.1-0.5 eV. This is considerably smaller than commonly believed and indicates a significant delocalisation of the excitonic charge over various molecular units.

Optical and transport properties of polyaniline films

International Nuclear Information System (INIS)

Tzamalis, Georgios

2002-01-01

This thesis presents the results of a comprehensive study on the transport and optical properties of polyaniline (PANI) films. The films are derived by protonation (doping) of the emeraldine base form of polyaniline, as synthesized in Durham, with either 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPSA) or 10-camphorsulfonic acid. Thus, two distinct PANI systems are obtained: PANI-CSA and PANI-AMPSA. The variation of the doping level can affect the metallic properties of the final system, so that samples close to the boundary as well as samples at either side of a disorder induced metal-insulator can be obtained. The relation between the doping level and the degree of disorder, along with the existence of an inherently metallic behaviour in PANI, are investigated through a series of experiments. Temperature dependent dc conductivity measurements ranging from 10-295 K are performed using a closed loop helium cryostat under dynamic vacuum (∼10 -5 mbar). From the conductivity data curves, typical fingerprints of the metallic behaviour are detected for certain samples and an initial estimate of the degree of disorder is implicitly attained. More specific information regarding the microscopic contributions to the transport mechanisms is obtained via low temperature (down to 1.5 K) magnetoconductance measurements on selected samples. The magnetic field dependence of conductivity for fields up to 14 T is measured and the suitability of the localization-interaction model for the understanding of the transport mechanism in PANI is examined. Infrared reflectivity (20-9000 cm -1 ) measurements on samples of both PANI systems are performed. The experimental configuration permits the determination of the sample's absolute reflectivity. The optical constants are deduced from Kramers-Kronig analysis of the reflectivity data. Typical features of metallic behaviour are examined and analysed in the context of the localization modified Drude model. The results are shown to be

Magnetoelectric and transport properties of (GaMn)Sb thin films: A ferrimagnetic phase in dilute alloys

Energy Technology Data Exchange (ETDEWEB)

Calderón, Jorge A. [Universidad Nacional de Colombia – Bogotá, Dpto. de Física, Grupo de Materiales Nanoestructurados y sus Aplicaciones, Cra. 30 No. 45-03 Edificio 404 Lab. 121C Ciudad Universitaria, Bogotá (Colombia); Mesa, F., E-mail: fredy.mesa@urosario.edu.co [Grupo NanoTech, Facultad de Ciencias Naturales y Matemáticas, Universidad del Rosario, Cra. 24 No. 63C-69, Bogotá (Colombia); Dussan, A. [Universidad Nacional de Colombia – Bogotá, Dpto. de Física, Grupo de Materiales Nanoestructurados y sus Aplicaciones, Cra. 30 No. 45-03 Edificio 404 Lab. 121C Ciudad Universitaria, Bogotá (Colombia)

2017-02-28

Highlights: • (GaMn)Sb thin films were fabricated using the direct current (DC) magnetron co-sputtering. • Presence of ferrimagnetic (Mn{sub 2}Sb) and ferromagnetic (Mn{sub 2}Sb{sub 2}) phases. • A minor difference of 1% was found with respect to percolation theory, which confirmed the validity of the diffusional model in semiconductor alloys with magnetic properties. • Increase in the localized states density (N{sub F}) with increasing substrate temperature. - Abstract: We studied the electrical, magnetic, and transport properties of (GaMn)Sb thin films fabricated by the direct current magnetron co-sputtering method. Using X-ray powder diffraction measurements, we identified the presence of ferrimagnetic (Mn{sub 2}Sb) and ferromagnetic (Mn{sub 2}Sb{sub 2}) phases within the films. We also measured the magnetization of the films versus an applied magnetic field as well as their hysteresis curves at room temperature. We determined the electrical and transport properties of the films through temperature-dependent resistivity measurements using the Van Der Pauw method. The main contribution to the transport process was variable range hopping. Hopping parameters were calculated using percolation theory and refined using the diffusional model. In addition, we determined that all samples had p type semiconductor behavior, that there was an increase in the density of localized states near the Fermi level, and that the binary magnetic phases influenced the electrical properties and transport mechanisms.

DETERMINANTS DESTRUCTIVE TO BUSINESS CONDUCT TRANSPORT

Directory of Open Access Journals (Sweden)

Natalia Anatol’evna Loginova

2017-03-01

Full Text Available The article examines the determinants of destructive behavior in the transport business with the aim to identify their causes and to clarify the features of influence on them by all business stakeholders in transport. It is shown that the key determinants are: submission to the will of one business entity to another, the implementation of state support only in distressed periods of functioning of transport organizations, business obligations to the state are often perceived as a back-breaking businessmen, unfair, unnecessary. The main conclusions of the work are reduced to the following recommendations: to form a focused pulse of the state in support of the transport business; improve enforcement culture; more efficient use of the transport business capital. The goal – to identify the cause of the destructive business behavior and clarify the characteristics of their research on the part of all stakeholders in the transport sector. Method or methodology of work: in the article used analytical methods, and statistical analysis methods. Results for: received informative pictures that describe deterministic minanaty-destructive conduct business on the road, on the basis of which developed recommendations to neutralize their influence on the behavior of entrepreneurs. Application of results: the results the expediency applied differently businesses and government agencies operating in the field of transport.

Anomalous solute transport in saturated porous media: Relating transport model parameters to electrical and nuclear magnetic resonance properties

Science.gov (United States)

Swanson, Ryan D; Binley, Andrew; Keating, Kristina; France, Samantha; Osterman, Gordon; Day-Lewis, Frederick D.; Singha, Kamini

2015-01-01

The advection-dispersion equation (ADE) fails to describe commonly observed non-Fickian solute transport in saturated porous media, necessitating the use of other models such as the dual-domain mass-transfer (DDMT) model. DDMT model parameters are commonly calibrated via curve fitting, providing little insight into the relation between effective parameters and physical properties of the medium. There is a clear need for material characterization techniques that can provide insight into the geometry and connectedness of pore spaces related to transport model parameters. Here, we consider proton nuclear magnetic resonance (NMR), direct-current (DC) resistivity, and complex conductivity (CC) measurements for this purpose, and assess these methods using glass beads as a control and two different samples of the zeolite clinoptilolite, a material that demonstrates non-Fickian transport due to intragranular porosity. We estimate DDMT parameters via calibration of a transport model to column-scale solute tracer tests, and compare NMR, DC resistivity, CC results, which reveal that grain size alone does not control transport properties and measured geophysical parameters; rather, volume and arrangement of the pore space play important roles. NMR cannot provide estimates of more-mobile and less-mobile pore volumes in the absence of tracer tests because these estimates depend critically on the selection of a material-dependent and flow-dependent cutoff time. Increased electrical connectedness from DC resistivity measurements are associated with greater mobile pore space determined from transport model calibration. CC was hypothesized to be related to length scales of mass transfer, but the CC response is unrelated to DDMT.

Investigation of electronic transport properties of some liquid transition metals

Science.gov (United States)

Patel, H. P.; Sonvane, Y. A.; Thakor, P. B.

2018-04-01

We investigated electronic transport properties of some liquid transition metals (V, Cr, Mn, Fe, Co and Pt) using Ziman formalism. Our parameter free model potential which is realized on ionic and atomic radius has been incorporated with the Hard Sphere Yukawa (HSY) reference system to study the electronic transport properties like electrical resistivity (ρ), thermal conductivity (σ) and thermo electrical power (Q). The screening effect on aforesaid properties has been studied by using different screening functions. The correlations of our results and others data with in addition experimental values are profoundly promising to the researchers working in this field. Also, we conclude that our newly constructed parameter free model potential is capable to explain the aforesaid electronic transport properties.

Fluctuation theory for transport properties in multicomponent mixtures: thermodiffusion and heat conductivity

DEFF Research Database (Denmark)

Shapiro, Alexander

2004-01-01

The theory of transport properties in multicomponent gas and liquid mixtures, which was previously developed for diffusion coefficients, is extended onto thermodiffusion coefficients and heat conductivities. The derivation of the expressions for transport properties is based on the general statis...... of the heat conductivity coefficient for ideal gas. (C) 2003 Elsevier B.V. All rights reserved.......The theory of transport properties in multicomponent gas and liquid mixtures, which was previously developed for diffusion coefficients, is extended onto thermodiffusion coefficients and heat conductivities. The derivation of the expressions for transport properties is based on the general...

Enhancement of transport properties of a Brownian particle due to quantum effects: Smoluchowski limit

International Nuclear Information System (INIS)

Shit, Anindita; Chattopadhyay, Sudip; Chaudhuri, Jyotipratim Ray

2012-01-01

Graphical abstract: By invoking physically motivated coordinate transformation into quantum Smoluchowski equation, we have presented a transparent treatment for the determination of the effective diffusion coefficient and current of a quantum Brownian particle. Substantial enhancement in the efficiency of the diffusive transport is envisaged due to the quantum correction effects. Highlights:: ► Transport of a quantum Brownian particle in a periodic potential has been addressed. ► Governing quantum Smoluchowski equation (QSE) includes state dependent diffusion. ► A coordinate transformation is used to recast QSE with constant diffusion. ► Transport properties increases in comparison to the corresponding classical result. ► This enhancement is purely a quantum effect. - Abstract: The transport property of a quantum Brownian particle that interacts strongly with a bath (in which a typical damping constant by far exceeds a characteristic frequency of the isolated system) under the influence of a tilted periodic potential has been studied by solving quantum Smoluchowski equation (QSE). By invoking physically motivated coordinate transformation into QSE, we have presented a transparent treatment for the determination of the effective diffusion coefficient of a quantum Brownian particle and the current (the average stationary velocity). Substantial enhancement in the efficiency of the diffusive transport is envisaged due to the quantum correction effects only if the bath temperature hovers around an appropriate range of intermediate values. Our findings also confirm the results obtained in the classical cases.

Oxygen transport properties estimation by DSMC-CT simulations

Energy Technology Data Exchange (ETDEWEB)

Bruno, Domenico [Istituto di Metodologie Inorganiche e dei Plasmi, Consiglio Nazionale delle Ricerche - Via G. Amendola, 122 - 70125 Bari (Italy); Frezzotti, Aldo; Ghiroldi, Gian Pietro [Dipartimento di Scienze e Tecnologie Aerospaziali, Politecnico di Milano - Via La Masa, 34 - 20156 Milano (Italy)

2014-12-09

Coupling DSMC simulations with classical trajectories calculations is emerging as a powerful tool to improve predictive capabilities of computational rarefied gas dynamics. The considerable increase of computational effort outlined in the early application of the method (Koura,1997) can be compensated by running simulations on massively parallel computers. In particular, GPU acceleration has been found quite effective in reducing computing time (Ferrigni,2012; Norman et al.,2013) of DSMC-CT simulations. The aim of the present work is to study rarefied Oxygen flows by modeling binary collisions through an accurate potential energy surface, obtained by molecular beams scattering (Aquilanti, et al.,1999). The accuracy of the method is assessed by calculating molecular Oxygen shear viscosity and heat conductivity following three different DSMC-CT simulation methods. In the first one, transport properties are obtained from DSMC-CT simulations of spontaneous fluctuation of an equilibrium state (Bruno et al, Phys. Fluids, 23, 093104, 2011). In the second method, the collision trajectory calculation is incorporated in a Monte Carlo integration procedure to evaluate the Taxman’s expressions for the transport properties of polyatomic gases (Taxman,1959). In the third, non-equilibrium zero and one-dimensional rarefied gas dynamic simulations are adopted and the transport properties are computed from the non-equilibrium fluxes of momentum and energy. The three methods provide close values of the transport properties, their estimated statistical error not exceeding 3%. The experimental values are slightly underestimated, the percentage deviation being, again, few percent.

Transport properties of quasi-free Fermions

CERN Document Server

Aschbacher, W; Pautrat, Y; Pillet, C A

2006-01-01

Using the scattering approach to the construction of Non-Equilibrium Steady States proposed by Ruelle we study the transport properties of systems of independent electrons. We show that Landauer-Buttiker and Green-Kubo formulas hold under very general conditions.

Structural properties of the Chinese air transportation multilayer network

International Nuclear Information System (INIS)

Hong, Chen; Zhang, Jun; Cao, Xian-Bin; Du, Wen-Bo

2016-01-01

Highlights: • We investigate the structural properties of the Chinese air transportation multilayer network (ATMN). • We compare two main types of layers corresponding to major and low-cost airlines. • It is found that small-world property and rich-club effect of the Chinese ATMN are mainly caused by major airlines. - Abstract: Recently multilayer networks are attracting great attention because the properties of many real-world systems cannot be well understood without considering their different layers. In this paper, we investigate the structural properties of the Chinese air transportation multilayer network (ATMN) by progressively merging layers together, where each commercial airline (company) defines a layer. The results show that the high clustering coefficient, short characteristic path length and large collection of reachable destinations of the Chinese ATMN can only emerge when several layers are merged together. Moreover, we compare two main types of layers corresponding to major and low-cost airlines. It is found that the small-world property and the rich-club effect of the Chinese ATMN are mainly caused by those layers corresponding to major airlines. Our work will highlight a better understanding of the Chinese air transportation network.

Anisotropic bias dependent transport property of defective phosphorene layer

Science.gov (United States)

Umar Farooq, M.; Hashmi, Arqum; Hong, Jisang

2015-01-01

Phosphorene is receiving great research interests because of its peculiar physical properties. Nonetheless, no systematic studies on the transport properties modified due to defects have been performed. Here, we present the electronic band structure, defect formation energy and bias dependent transport property of various defective systems. We found that the defect formation energy is much less than that in graphene. The defect configuration strongly affects the electronic structure. The band gap vanishes in single vacancy layers, but the band gap reappears in divacancy layers. Interestingly, a single vacancy defect behaves like a p-type impurity for transport property. Unlike the common belief, we observe that the vacancy defect can contribute to greatly increasing the current. Along the zigzag direction, the current in the most stable single vacancy structure was significantly increased as compared with that found in the pristine layer. In addition, the current along the armchair direction was always greater than along the zigzag direction and we observed a strong anisotropic current ratio of armchair to zigzag direction. PMID:26198318

Effective Heat and Mass Transport Properties of Anisotropic Porous Ceria for Solar Thermochemical Fuel Generation

Directory of Open Access Journals (Sweden)

Sophia Haussener

2012-01-01

Full Text Available High-resolution X-ray computed tomography is employed to obtain the exact 3D geometrical configuration of porous anisotropic ceria applied in solar-driven thermochemical cycles for splitting H2O and CO2. The tomography data are, in turn, used in direct pore-level numerical simulations for determining the morphological and effective heat/mass transport properties of porous ceria, namely: porosity, specific surface area, pore size distribution, extinction coefficient, thermal conductivity, convective heat transfer coefficient, permeability, Dupuit-Forchheimer coefficient, and tortuosity and residence time distributions. Tailored foam designs for enhanced transport properties are examined by means of adjusting morphologies of artificial ceria samples composed of bimodal distributed overlapping transparent spheres in an opaque medium.

Low temperature carrier transport properties in isotopically controlled germanium

Energy Technology Data Exchange (ETDEWEB)

Itoh, Kohei [Univ. of California, Berkeley, CA (United States)

1994-12-01

Investigations of electronic and optical properties of semiconductors often require specimens with extremely homogeneous dopant distributions and precisely controlled net-carrier concentrations and compensation ratios. The previous difficulties in fabricating such samples are overcome as reported in this thesis by growing high-purity Ge single crystals of controlled ⁷⁵Ge and ⁷⁰Ge isotopic compositions, and doping these crystals by the neutron transmutation doping (NTD) technique. The resulting net-impurity concentrations and the compensation ratios are precisely determined by the thermal neutron fluence and the [⁷⁴Ge]/[⁷⁰Ge] ratios of the starting Ge materials, respectively. This method also guarantees unprecedented doping uniformity. Using such samples the authors have conducted four types of electron (hole) transport studies probing the nature of (1) free carrier scattering by neutral impurities, (2) free carrier scattering by ionized impurities, (3) low temperature hopping conduction, and (4) free carrier transport in samples close to the metal-insulator transition.

Node-node correlations and transport properties in scale-free networks

Science.gov (United States)

Obregon, Bibiana; Guzman, Lev

2011-03-01

We study some transport properties of complex networks. We focus our attention on transport properties of scale-free and small-world networks and compare two types of transport: Electric and max-flow cases. In particular, we construct scale-free networks, with a given degree sequence, to estimate the distribution of conductances for different values of assortative/dissortative mixing. For the electric case we find that the distributions of conductances are affect ed by the assortative mixing of the network whereas for the max-flow case, the distributions almost do not show changes when node-node correlations are altered. Finally, we compare local and global transport in terms of the average conductance for the small-world (Watts-Strogatz) model

Moisture transport properties of mortar and mortar joint: A NMR study

OpenAIRE

Brocken, H.J.P.; Adant, O.C.G.; Pel, L.

1997-01-01

The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick laying, curing conditions of mortar in mortar joint differ from curing conditions of separately cured mortar. Consequently, the moisture transport properties of mortar joint differ. In addition to the ...

Moisture transport properties of mortar and mortar joint: a NMR study

OpenAIRE

Brocken, H.J.P.; Adan, O.C.G.; Pel, L.

1997-01-01

The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick laying, curing conditions of mortar in mortar joint differ from curing conditions of separately cured mortar. Consequently, the moisture transport properties of mortar joint differ. In addition to the ...

Operando XRD studies as a tool for determination of transport parameters of mobile ions in electrode materials

Science.gov (United States)

Kondracki, Łukasz; Kulka, Andrzej; Świerczek, Konrad; Ziąbka, Magdalena; Molenda, Janina

2017-11-01

In this work a detailed operando XRD investigations of structural properties of LixMn2O4 manganese spinel are shown to be a complementary, successful method of determination of diffusion coefficient D and surface exchange coefficient k in the working electrode. Kinetics of lithium ions transport are estimated on the basis of rate of structural changes of the cathode material during a relaxation stage after a high current charge, i.e. during structural relaxation of the material. The presented approach seems to be applicable as a complementary method of determination of transport coefficients for all intercalation-type electrode materials.

Prediction of transport and other physical properties of fluids

CERN Document Server

Bretsznajder, S

1971-01-01

Prediction of Transport and Other Physical Properties of Fluids reviews general methods for predicting the transport and other physical properties of fluids such as gases and liquids. Topics covered range from the theory of corresponding states and methods for estimating the surface tension of liquids to some basic concepts of the kinetic theory of gases. Methods of estimating liquid viscosity based on the principle of additivity are also described. This volume is comprised of eight chapters and opens by presenting basic information on gases and liquids as well as intermolecular forces and con

Atomistic Force Field for Pyridinium-Based Ionic Liquids: Reliable Transport Properties

DEFF Research Database (Denmark)

Voroshylova, I. V.; Chaban, V. V.

2014-01-01

Reliable force field (FF) is a central issue in successful prediction of physical chemical properties via computer simulations. This work introduces refined FF parameters for six popular ionic liquids (ILs) of the pyridinium family (butylpyridinium tetrafluoroborate, bis(trifluoromethanesulfonyl)......Reliable force field (FF) is a central issue in successful prediction of physical chemical properties via computer simulations. This work introduces refined FF parameters for six popular ionic liquids (ILs) of the pyridinium family (butylpyridinium tetrafluoroborate, bis......(trifluoromethanesulfonyl)imide, dicyanamide, hexafluorophosphate, triflate, chloride). We elaborate a systematic procedure, which allows accounting for specific cationanion interactions in the liquid phase. Once these interactions are described accurately, all experimentally determined transport properties can be reproduced. We prove...... and elevated temperature. The developed atomistic models provide a systematic refinement upon the well-known Canongia LopesPadua (CL&P) FF. Together with the original CL&P parameters the present models foster a computational investigation of ionic liquids....

Electron Transport Properties of Ge nanowires

Science.gov (United States)

Hanrath, Tobias; Khondaker, Saiful I.; Yao, Zhen; Korgel, Brian A.

2003-03-01

Electron Transport Properties of Ge nanowires Tobias Hanrath*, Saiful I. Khondaker, Zhen Yao, Brian A. Korgel* *Dept. of Chemical Engineering, Dept. of Physics, Texas Materials Institute, and Center for Nano- and Molecular Science and Technology University of Texas at Austin, Austin, Texas 78712-1062 e-mail: korgel@mail.che.utexas.edu Germanium (Ge) nanowires with diameters ranging from 6 to 50 nm and several micrometer in length were grown via a supercritical fluid-liquid-solid synthesis. Parallel electron energy loss spectroscopy (PEELS) was employed to study the band structure and electron density in the Ge nanowires. The observed increase in plasmon peak energy and peak width with decreasing nanowire diameter is attributed to quantum confinement effects. For electrical characterization, Ge nanowires were deposited onto a patterned Si/SiO2 substrate. E-beam lithography was then used to form electrode contacts to individual nanowires. The influence of nanowire diameter, surface chemistry and crystallographic defects on electron transport properties were investigated and the comparison of Ge nanowire conductivity with respect to bulk, intrinsic Ge will be presented.

The phase diagram and transport properties of MgO from theory and experiment

Science.gov (United States)

Shulenburger, Luke

2013-06-01

Planetary structure and the formation of terrestrial planets have received tremendous interest due to the discovery of so called super-earth exoplanets. MgO is a major constituent of Earth's mantle, the rocky cores of gas giants and is a likely component of the interiors of many of these exoplanets. The high pressure - high temperature behavior of MgO directly affects equation of state models for planetary structure and formation. In this work, we examine MgO under extreme conditions using experimental and theoretical methods to determine its phase diagram and transport properties. Using plate impact experiments on Sandia's Z facility the solid-solid phase transition from B1 to B2 is clearly determined. The melting transition, on the other hand, is subtle, involving little to no signal in us-up space. Theoretical work utilizing density functional theory (DFT) provides a complementary picture of the phase diagram. The solid-solid phase transition is identified through a series of quasi-harmonic phonon calculations and thermodynamic integration, while the melt boundary is found using phase coexistence calculations. One issue of particular import is the calculation of reflectivity along the Hugoniot and the influence of the ionic structure on the transport properties. Particular care is necessary because of the underestimation of the band gap and attendant overestimation of transport properties due to the use of semi-local density functional theory. We will explore the impact of this theoretical challenge and its potential solutions in this talk. The integrated use of DFT simulations and high-accuracy shock experiments together provide a comprehensive understanding of MgO under extreme conditions. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Company, for the U.S. DOE's National Nuclear Security Administration under contract DE-AC04-94AL85000.

Strategy for the use of laboratory methods in the site investigations programme for the transport properties of the rock

International Nuclear Information System (INIS)

Widestrand, Henrik; Byegaard, Johan; Ohlsson, Yvonne; Tullborg, Eva-Lena

2003-06-01

This report comprises a strategy for the handling of laboratory investigations of diffusivity and sorption characteristics within the discipline-specific programme 'Transport Properties of the Rock' in the SKB site investigations. The aim of the transport programme is to investigate the solute transport properties at a site in order to acquire data that are required for an assessment of the long-term performance and radiological safety of the deep repository. The result of the transport programme is the Transport Properties Site Descriptive Model, i.e. a description of the site-specific properties for the transport of solutes in the groundwater at a site. A strategy for the methodology, control of sampling and characterisation programme and interpretation of the results, is proposed. The basis for the laboratory investigations is a conceptual geological model based on the geological model produced in the geology programme. Major and minor types of rock and fractures are defined and characterised according to the quality of the general database and site-specific needs. The selection of samples and analyses is determined in close co-operation with the geology, hydrogeology, hydrogeochemistry and rock mechanics programmes. The result of the laboratory investigations is a retardation model, which is used as an input in the Transport Properties Site Descriptive Model. The interpretation and production of a retardation model is described and exemplified. Lastly, method-specific strategies and recommendations are given, including strategies for the selection of tracers in the experiments and for the treatment of the sampled geologic materials

Strategy for the use of laboratory methods in the site investigations programme for the transport properties of the rock

Energy Technology Data Exchange (ETDEWEB)

Widestrand, Henrik; Byegaard, Johan [Geosigma AB, Kungaelv (Sweden); Ohlsson, Yvonne [SWECO VIAK AB, Stockholm (Sweden); Tullborg, Eva-Lena [Terralogica AB, Graabo (Sweden)

2003-06-01

This report comprises a strategy for the handling of laboratory investigations of diffusivity and sorption characteristics within the discipline-specific programme 'Transport Properties of the Rock' in the SKB site investigations. The aim of the transport programme is to investigate the solute transport properties at a site in order to acquire data that are required for an assessment of the long-term performance and radiological safety of the deep repository. The result of the transport programme is the Transport Properties Site Descriptive Model, i.e. a description of the site-specific properties for the transport of solutes in the groundwater at a site. A strategy for the methodology, control of sampling and characterisation programme and interpretation of the results, is proposed. The basis for the laboratory investigations is a conceptual geological model based on the geological model produced in the geology programme. Major and minor types of rock and fractures are defined and characterised according to the quality of the general database and site-specific needs. The selection of samples and analyses is determined in close co-operation with the geology, hydrogeology, hydrogeochemistry and rock mechanics programmes. The result of the laboratory investigations is a retardation model, which is used as an input in the Transport Properties Site Descriptive Model. The interpretation and production of a retardation model is described and exemplified. Lastly, method-specific strategies and recommendations are given, including strategies for the selection of tracers in the experiments and for the treatment of the sampled geologic materials.

Thermodynamic properties and transport coefficients of a two-temperature polytetrafluoroethylene vapor plasma for ablation-controlled discharge applications

International Nuclear Information System (INIS)

Wang, Haiyan; Qi, Haiyang; Wang, Weizong; Yan, Joseph D; Geng, Jinyue; Wu, Yaowu

2017-01-01

Ablation-controlled plasmas have been used in a range of technical applications where local thermodynamic equilibrium (LTE) is often violated near the wall due to the strong cooling effect caused by the ablation of wall materials. The thermodynamic and transport properties of ablated polytetrafluoroethylene (PTFE) vapor, which determine the flowing plasma behavior in such applications, are calculated based on a two-temperature model at atmospheric pressure. To our knowledge, no data for PTFE have been reported in the literature. The species composition and thermodynamic properties are numerically determined using the two-temperature Saha equation and the Guldberg–Waage equation according to van de Sanden et al ’s derivation. The transport coefficients, including viscosity, thermal conductivity and electrical conductivity, are calculated with the most recent collision interaction potentials using Devoto’s electron and heavy-particle decoupling approach but expanded to the third-order approximation (second-order for viscosity) in the frame of the Chapman–Enskog method. Results are computed for different degrees of thermal non-equilibrium, i.e. the ratio of electron to heavy-particle temperatures, from 1 to 10, with electron temperature ranging from 300 to 40 000 K. Plasma transport properties in the LTE state obtained from the present work are compared with existing published results and the causes for the discrepancy analyzed. The two-temperature plasma properties calculated in the present work enable the modeling of wall ablation-controlled plasma processes. (paper)

Thermodynamic properties and transport coefficients of a two-temperature polytetrafluoroethylene vapor plasma for ablation-controlled discharge applications

Science.gov (United States)

Wang, Haiyan; Wang, Weizong; Yan, Joseph D.; Qi, Haiyang; Geng, Jinyue; Wu, Yaowu

2017-10-01

Ablation-controlled plasmas have been used in a range of technical applications where local thermodynamic equilibrium (LTE) is often violated near the wall due to the strong cooling effect caused by the ablation of wall materials. The thermodynamic and transport properties of ablated polytetrafluoroethylene (PTFE) vapor, which determine the flowing plasma behavior in such applications, are calculated based on a two-temperature model at atmospheric pressure. To our knowledge, no data for PTFE have been reported in the literature. The species composition and thermodynamic properties are numerically determined using the two-temperature Saha equation and the Guldberg-Waage equation according to van de Sanden et al’s derivation. The transport coefficients, including viscosity, thermal conductivity and electrical conductivity, are calculated with the most recent collision interaction potentials using Devoto’s electron and heavy-particle decoupling approach but expanded to the third-order approximation (second-order for viscosity) in the frame of the Chapman-Enskog method. Results are computed for different degrees of thermal non-equilibrium, i.e. the ratio of electron to heavy-particle temperatures, from 1 to 10, with electron temperature ranging from 300 to 40 000 K. Plasma transport properties in the LTE state obtained from the present work are compared with existing published results and the causes for the discrepancy analyzed. The two-temperature plasma properties calculated in the present work enable the modeling of wall ablation-controlled plasma processes.

Density functional theory calculations of charge transport properties ...

Indian Academy of Sciences (India)

ZIRAN CHEN

2017-08-04

Aug 4, 2017 ... properties of 'plate-like' coronene topological structures ... Keywords. Organic semiconductors; density functional theory; charge carrier mobility; ambipolar transport; ..... nology Department of Sichuan Province (Grant Number.

Ionic structures and transport properties of hot dense W and U plasmas

Science.gov (United States)

Hou, Yong; Yuan, Jianmin

2016-10-01

We have combined the average-atom model with the hyper-netted chain approximation (AAHNC) to describe the electronic and ionic structure of uranium and tungsten in the hot dense matter regime. When the electronic structure is described within the average-atom model, the effects of others ions on the electronic structure are considered by the correlation functions. And the ionic structure is calculated though using the hyper-netted chain (HNC) approximation. The ion-ion pair potential is calculated using the modified Gordon-Kim model based on the electronic density distribution in the temperature-depended density functional theory. And electronic and ionic structures are determined self-consistently. On the basis of the ion-ion pair potential, we perform the classical (CMD) and Langevin (LMD) molecular dynamics to simulate the ionic transport properties, such as ionic self-diffusion and shear viscosity coefficients, through the ionic velocity correlation functions. Due that the free electrons become more and more with increasing the plasma temperature, the influence of the electron-ion collisions on the transport properties become more and more important.

Laser patterning: A new approach to measure local magneto-transport properties in multifilamentary superconducting tapes

International Nuclear Information System (INIS)

Sanchez Valdes, C.F.; Perez-Penichet, C.; Noda, C.; Arronte, M.; Batista-Leyva, A.J.; Haugen, O.; Johansen, T.H.; Han, Z.; Altshuler, E.

2007-01-01

The determination of inter- and intra-filament characteristics in superconducting composites such as BSCCO-Ag tapes is of great importance for material evaluation towards applications. Most attempts to separate the two contributions have relied on indirect methods based on magnetic measurements such as SQUID or magneto-optic imaging techniques. Here we show that laser patterning of superconducting BSCCO-Ag tapes constitutes a simple approach to measure local transport properties in a direct way, even able to separate inter- and intra-filament contributions to the overall transport behavior of the sample

Fluid and ionic transport properties of deformed salt rock

International Nuclear Information System (INIS)

Peach, C.J.; Spiers, C.J.; Tankink, A.J.; Zwart, H.J.

1987-01-01

This is a final report on work done on the transport properties of salt during the period 1 January 1984 to 30 June 1985. This work was directed largely at the measurement of creep-induced permeability in salt rock, at determining the permeability persistence/decay characteristics of creep-dilated salt rock under hydrostatic conditions, and at ion migration/retention experiments on both deformed and undeformed material. The permeability work was carried out using both gas (argon) and brine, and involved the design and construction of corresponding permeametry systems for use in conjunction with dilatometric triaxial testing apparatus. Ion migration/retention studies involved the use of contaminant species such as Sr 2+ , Cs + , Fe 3+ and TcO 4

Transport properties and specific heat of UTe and USb

International Nuclear Information System (INIS)

Ochiai, A.; Suzuki, Y.; Shikama, T.; Suzuki, K.; Hotta, E.; Haga, Y.; Suzuki, T.

1994-01-01

Uranium monochalcogenides and monopnictides crystallize in the NaCl-type structure and exhibit ferromagnetic and antiferromagnetic order, respectively. These series reveal interesting properties such as Kondo behavior of UTe. However, such interesting properties are much sample dependent. We grew single crystals of USb and UTe with high purity using the Bridgman technique, and measured transport properties and specific heat. ((orig.))

Electronic, magnetic and transport properties of graphene ribbons terminated by nanotubes

International Nuclear Information System (INIS)

Akhukov, M A; Yuan Shengjun; Fasolino, A; Katsnelson, M I

2012-01-01

We study, by density functional and large-scale tight-binding transport calculations, the electronic structure, magnetism and transport properties of the recently proposed graphene ribbons with edges rolled to form nanotubes. Edges with armchair nanotubes present magnetic moments localized either in the tube or the ribbon and of metallic or half-metallic character, depending on the symmetry of the junction. These properties have potential for spin valve and spin filter devices with advantages over other proposed systems. Edges with zigzag nanotubes are either metallic or semiconducting without affecting the intrinsic mobility of the ribbon. Varying the type and size of the nanotubes and ribbons offers the possibility to tailor the magnetic and transport properties, making these systems very promising for applications. (paper)

Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

KAUST Repository

Xu, Guangwei; Gao, Nan; Lu, Congyan; Wang, Wei; Ji, Zhuoyu; Bi, Chong; Han, Zhiheng; Lu, Nianduan; Yang, Guanhua; Li, Yuan; Liu, Qi; Li, Ling; Liu, Ming

2018-01-01

, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I

Predicting Soil-Air and Soil-Water Transport Properties During Soil Vapor Extraction

DEFF Research Database (Denmark)

Poulsen, Tjalfe

Increased application of in-situ technology for control and removal of volatile organic compounds (VOC) in the subsurface has made the understanding of soil physical properties and their impact upon contaminant transport even more important. Knowledge of contaminant transport is important when...... properties of undisturbed soil from more easily measurable soil properties are developed. The importance of soil properties with respect to contaminant migration during remediation by soil vapor extraction (SVE) in the unsaturated zone was investigated using numerical simulations....

Comparison of Themodynamic and Transport Property Models for Computing Equilibrium High Enthalpy Flows

Science.gov (United States)

Ramasahayam, Veda Krishna Vyas; Diwakar, Anant; Bodi, Kowsik

2017-11-01

To study the flow of high temperature air in vibrational and chemical equilibrium, accurate models for thermodynamic state and transport phenomena are required. In the present work, the performance of a state equation model and two mixing rules for determining equilibrium air thermodynamic and transport properties are compared with that of curve fits. The thermodynamic state model considers 11 species which computes flow chemistry by an iterative process and the mixing rules considered for viscosity are Wilke and Armaly-Sutton. The curve fits of Srinivasan, which are based on Grabau type transition functions, are chosen for comparison. A two-dimensional Navier-Stokes solver is developed to simulate high enthalpy flows with numerical fluxes computed by AUSM+-up. The accuracy of state equation model and curve fits for thermodynamic properties is determined using hypersonic inviscid flow over a circular cylinder. The performance of mixing rules and curve fits for viscosity are compared using hypersonic laminar boundary layer prediction on a flat plate. It is observed that steady state solutions from state equation model and curve fits match with each other. Though curve fits are significantly faster the state equation model is more general and can be adapted to any flow composition.

Electronic transport properties of copper and gold at atomic scale

Energy Technology Data Exchange (ETDEWEB)

Mohammadzadeh, Saeideh

2010-11-23

The factors governing electronic transport properties of copper and gold atomic-size contacts are theoretically examined in the present work. A two-terminal conductor using crystalline electrodes is adopted. The non-equilibrium Green's function combined with the density functional tight-binding method is employed via gDFTB simulation tool to calculate the transport at both equilibrium and non-equilibrium conditions. The crystalline orientation, length, and arrangement of electrodes have very weak influence on the electronic characteristics of the considered atomic wires. The wire width is found to be the most effective geometric aspect determining the number of conduction channels. The obtained conductance oscillation and linear current-voltage curves are interpreted. To analyze the conduction mechanism in detail, the transmission channels and their decomposition to the atomic orbitals are calculated in copper and gold single point contacts. The presented results offer a possible explanation for the relation between conduction and geometric structure. Furthermore, the results are in good agreement with available experimental and theoretical studies. (orig.)

Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

International Nuclear Information System (INIS)

Barea, Eva M.; Garcia-Belmonte, Germa; Sommer, Michael; Huettner, Sven; Bolink, Henk J.; Thelakkat, Mukundan

2010-01-01

Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between ∼ 10 -8 and 10 -6 cm 2 V -1 s -1 are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

Novel electrical transport properties in conducting polymers such as polythiophene and Poly(3-Methylthiophene)

International Nuclear Information System (INIS)

Kazama, Shigeo; Masubuchi, Shin-ichi; Matsuyama, Tomochika; Matsushita, Rokuji.

1994-01-01

Electric transport properties in most of the conducting organic polymers have provided a riddle that prevents a thorough physical understanding of the conduction mechanism. Major difficulties for approaching the most substantial aspect in the electrical transport properties underlie in complicated higher order structure inherent to polymeric materials consisting of crystalline regions entangled with disordered amorphous regions. In order to clearly understand the origin of the metallic nature of conducting polymers, we have to extract the proper transport properties characteristics of the ordered crystalline regions. We have made a series of experimental studies of the transport properties in conductive polythiophene and poly(3-methylthiophene) obtained with the electrochemical polymerization. For polythiophene, we have investigated both the as-grown samples and the ones that contain controlled amount of dopant species exchanged after the neutralization aiming to see the effect of dopant concentration on the transport properties. (author)

Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

KAUST Repository

Xu, Guangwei

2018-02-22

Charge transport governs the operation and performance of organic diodes. Illuminating the charge-transfer/transport processes across the interfaces and the bulk organic semiconductors is at the focus of intensive investigations. Traditionally, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I–V characteristics, still represents a major challenge. Here, the electrical potential distribution in planar organic diodes is investigated by using the scanning Kelvin probe force microscopy technique, a method that can clearly separate the contact and bulk regimes of charge transport. Interestingly, by applying to devices based on novel, high mobility organic materials, the space-charge-limited-current-like I–V curves, which are previously believed to be a result of the bulk transport, are surprisingly but unambiguously demonstrated to be caused by contact-limited conduction. A model accounting is developed for the transport properties of both the two metal/organic interfaces and the bulk. The results indicate that pure interface-dominated transport can indeed give rise to I–V curves similar to those caused by bulk transport. These findings provide a new insight into the charge injection and transport processes in organic diodes.

Computer program for calculating thermodynamic and transport properties of fluids

Science.gov (United States)

Hendricks, R. C.; Braon, A. K.; Peller, I. C.

1975-01-01

Computer code has been developed to provide thermodynamic and transport properties of liquid argon, carbon dioxide, carbon monoxide, fluorine, helium, methane, neon, nitrogen, oxygen, and parahydrogen. Equation of state and transport coefficients are updated and other fluids added as new material becomes available.

Charge carrier transport properties in layer structured hexagonal boron nitride

Directory of Open Access Journals (Sweden)

T. C. Doan

2014-10-01

Full Text Available Due to its large in-plane thermal conductivity, high temperature and chemical stability, large energy band gap (˜ 6.4 eV, hexagonal boron nitride (hBN has emerged as an important material for applications in deep ultraviolet photonic devices. Among the members of the III-nitride material system, hBN is the least studied and understood. The study of the electrical transport properties of hBN is of utmost importance with a view to realizing practical device applications. Wafer-scale hBN epilayers have been successfully synthesized by metal organic chemical deposition and their electrical transport properties have been probed by variable temperature Hall effect measurements. The results demonstrate that undoped hBN is a semiconductor exhibiting weak p-type at high temperatures (> 700 °K. The measured acceptor energy level is about 0.68 eV above the valence band. In contrast to the electrical transport properties of traditional III-nitride wide bandgap semiconductors, the temperature dependence of the hole mobility in hBN can be described by the form of μ ∝ (T/T0−α with α = 3.02, satisfying the two-dimensional (2D carrier transport limit dominated by the polar optical phonon scattering. This behavior is a direct consequence of the fact that hBN is a layer structured material. The optical phonon energy deduced from the temperature dependence of the hole mobility is ħω = 192 meV (or 1546 cm-1, which is consistent with values previously obtained using other techniques. The present results extend our understanding of the charge carrier transport properties beyond the traditional III-nitride semiconductors.

Transport Properties Of Van Der Waals Hybrid Heterostructures.

Science.gov (United States)

Pacheco, M.; Orellana, P. A.; Felix, A. B.; Latge, A.

Here we study transport properties of van der Waals heterostructures composed of carbon nanotubes adsorbed on nanoribbons of distinct 2D materials. Calculations of the electronic density of states and conductance of the hybrid systems are obtained in single band tight-binding approximation in the Green function formalism by adopting real-space renormalization schemes. We show that an analytical approach may be derived when both systems are formed by the same type of atoms. In the coupled structures the different electronic paths along the ribbons and finite nanotubes lead to quantum interference effects which are reflected as Fano antiresonances in the conductance. The electronic and transport properties of these materials are modulated by changing geometrical and structural parameters, such as the nanotube diameter and the widths and edge type of the ribbons. FONDECYT 1151316-1140571.

Impact of carbonation on water transport properties of cement-based materials

International Nuclear Information System (INIS)

Auroy, M.; Poyet, S.; Le Bescop, P.; Torrenti, J.M.

2015-01-01

Cement-based materials would be commonly used for nuclear waste management and, particularly for geological disposal vaults as well as containers in France. Under service conditions, the structures would be subjected to simultaneous drying and carbonation. Carbonation relates to the reaction between CO 2 and the hydrated cement phases (mainly portlandite and C-S-H). It induces mineralogical and microstructural changes (due to hydrates dissolution and calcium carbonate precipitation). It results in transport properties modifications, which can have important consequences on the durability of reinforced concrete structures. Concrete durability is greatly influenced by water: water is necessary for chemical reactions to occur and significantly impacts transport. The evaluation of the unsaturated water transport properties in carbonated materials is then an important issue. That is the aim of this study. A program has been established to assess the water transport properties in carbonated materials. In this context, four mature hardened cement pastes (CEM I, CEM III/A, CEM V/A according to European standards and a Low-pH blend) are carbonated. Accelerated carbonation tests are performed in a specific device, controlling environmental conditions: (i) CO 2 content of 3%, to ensure representativeness of the mineralogical evolution compared to natural carbonation and (ii) 25 C. degrees and 55% RH, to optimize carbonation rate. After carbonation, the data needed to describe water transport are evaluated in the framework of simplified approach. Three physical parameters are required: (1) the concrete porosity, (2) the water retention curve and, (3) the effective permeability. The obtained results allow creating link between water transport properties of non-carbonated materials to carbonated ones. They also provide a better understanding of the effect of carbonation on water transport in cementitious materials and thus, complement literature data. (authors)

Transport properties of a discrete helical electrostatic quadrupole

International Nuclear Information System (INIS)

Meitzler, C.R.; Antes, K.; Datte, P.; Huson, F.R.; Xiu, L.

1991-01-01

The helical electrostatic quadrupole (HESQ) lens has been proposed as a low energy beam transport system which permits intense H - beams to be focused into an RFQ without seriously increasing the beam's emittance. A stepwise continuous HESQ lens has been constructed, and preliminary tests have shown that the structure does provide focusing. In order to understand the transport properties of this device, further detailed studies have been performed. Emittances were measured 3.5 cm from the end of the HESQ at two different voltages on the HESQ electrodes. A comparison of these experimental results with a linear model of the HESQ beam transport is made. 4 refs., 5 figs

Investigation of transport properties of colossal magnetoresistive materials

International Nuclear Information System (INIS)

Kaurav, Netram

2006-01-01

The transport properties, i.e. resistivity, heat capacity, thermal conductivity and optical conductivity have been theoretically analysed for colossal magnetoresistive materials within the framework of double exchange mechanism. Following an effective interaction potential, we deduce acoustic (optical) phonon modes, coupling strength for electron-phonon and phonon-impurities, the phonon (magnon) scattering rate and constants characterise the scattering of charge and heat carriers with various disorders in the crystal. The theoretical models have been developed to account the anomalies observed in the transport phenomenon. It is noticed that electron-electron, electron-phonon and electron-magnon interactions are essential in discussing the transport behaviour of doped magnetites. (author)

Establishing the transport properties of QCD with heavy ion reactions. Final Scientific Report for DE-FG02-07ER41524

International Nuclear Information System (INIS)

Teaney, Derek

2008-01-01

During the time period from 9/1/07 - 3/1/08 the principle investigator was awarded a federal grant from the Department of Energy (DE-FG02-07ER41524) to establish the transport properties of QCD through heavy ion reactions. A relativistic viscous hydrodynamic computer code was developed in 2+1 dimensions which is suitable for extracting the shear viscosity from available heavy ion data. In addition, the transport coefficients of heavy mesons in strongly coupled N = 4 plasmas were determined using the gauge gravity duality. These transport coefficients are suppressed by 1/N c 2 which stymied previous efforts to determine the kinetics of these mesons.

Electronic, Magnetic, and Transport Properties of Polyacrylonitrile-Based Carbon Nanofibers of Various Widths: Density-Functional Theory Calculations

Science.gov (United States)

Partovi-Azar, P.; Panahian Jand, S.; Kaghazchi, P.

2018-01-01

Edge termination of graphene nanoribbons is a key factor in determination of their physical and chemical properties. Here, we focus on nitrogen-terminated zigzag graphene nanoribbons resembling polyacrylonitrile-based carbon nanofibers (CNFs) which are widely studied in energy research. In particular, we investigate magnetic, electronic, and transport properties of these CNFs as functions of their widths using density-functional theory calculations together with the nonequilibrium Green's function method. We report on metallic behavior of all the CNFs considered in this study and demonstrate that the narrow CNFs show finite magnetic moments. The spin-polarized electronic states in these fibers exhibit similar spin configurations on both edges and result in spin-dependent transport channels in the narrow CNFs. We show that the partially filled nitrogen dangling-bond bands are mainly responsible for the ferromagnetic spin ordering in the narrow samples. However, the magnetic moment becomes vanishingly small in the case of wide CNFs where the dangling-bond bands fall below the Fermi level and graphenelike transport properties arising from the π orbitals are recovered. The magnetic properties of the CNFs as well as their stability have also been discussed in the presence of water molecules and the hexagonal boron nitride substrate.

Thermal Transport Properties of Dry Spun Carbon Nanotube Sheets

Directory of Open Access Journals (Sweden)

Heath E. Misak

2016-01-01

Full Text Available The thermal properties of carbon nanotube- (CNT- sheet were explored and compared to copper in this study. The CNT-sheet was made from dry spinning CNTs into a nonwoven sheet. This nonwoven CNT-sheet has anisotropic properties in in-plane and out-of-plane directions. The in-plane direction has much higher thermal conductivity than the out-of-plane direction. The in-plane thermal conductivity was found by thermal flash analysis, and the out-of-plane thermal conductivity was found by a hot disk method. The thermal irradiative properties were examined and compared to thermal transport theory. The CNT-sheet was heated in the vacuum and the temperature was measured with an IR Camera. The heat flux of CNT-sheet was compared to that of copper, and it was found that the CNT-sheet has significantly higher specific heat transfer properties compared to those of copper. CNT-sheet is a potential candidate to replace copper in thermal transport applications where weight is a primary concern such as in the automobile, aircraft, and space industries.

Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers

Science.gov (United States)

Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco

2011-03-01

The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.

Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

Energy Technology Data Exchange (ETDEWEB)

Barea, Eva M. [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Garcia-Belmonte, Germa, E-mail: garciag@uji.e [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Sommer, Michael; Huettner, Sven [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany); Bolink, Henk J. [Molecular Science Institute-Universitat de Valencia, Poligon La Coma s/n, 46980 Paterna, Valencia (Spain); Thelakkat, Mukundan, E-mail: mukundan.thelakkat@uni-bayreuth.d [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany)

2010-04-02

Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between {approx} 10{sup -8} and 10{sup -6} cm{sup 2} V{sup -1} s{sup -1} are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

Calculations of the transport properties within the PAW formalism

Energy Technology Data Exchange (ETDEWEB)

Mazevet, S.; Torrent, M.; Recoules, V.; Jollet, F. [CEA Bruyeres-le-Chatel, DIF, 91 (France)

2010-07-01

We implemented the calculation of the transport properties within the PAW formalism in the ABINIT code. This feature allows the calculation of the electrical and optical properties, including the XANES spectrum, as well as the electronic contribution to the thermal conductivity. We present here the details of the implementation and results obtained for warm dense aluminum plasma. (authors)

Impact of carbonation on the durability of cementitious materials: water transport properties characterization

Directory of Open Access Journals (Sweden)

Le Bescop P.

2013-07-01

Full Text Available Within the context of long-lived intermediate level radioactive waste geological disposal, reinforced concrete would be used. In service life conditions, the concrete structures would be subjected to drying and carbonation. Carbonation relates to the reaction between carbon dioxide (CO2 and the main hydrates of the cement paste (portlandite and C-S-H. Beyond the fall of the pore solution pH, indicative of steel depassivation, carbonation induces mineralogical and microstructural changes (due to portlandite and C-S-H dissolution and calcium carbonate precipitation. This results in the modification of the transport properties, which can impact the structure durability. Because concrete durability depends on water transport, this study focuses on the influence of carbonation on water transport properties. In fact, the transport properties of sound materials are known but they still remain to be assessed for carbonated ones. An experimental program has been designed to investigate the transport properties in carbonated materials. Four hardened cement pastes, differing in mineralogy, are carbonated in an accelerated carbonation device (in controlled environmental conditions at CO2 partial pressure of about 3%. Once fully carbonated, all the data needed to describe water transport, using a simplified approach, will be evaluated.

Measurement of gas transport properties for chemical vapor infiltration

Energy Technology Data Exchange (ETDEWEB)

Starr, T.L.; Hablutzel, N. [Georgia Inst. of Tech., Atlanta, GA (United States). School of Materials Science and Engineering

1996-12-01

In the chemical vapor infiltration (CVI) process for fabricating ceramic matrix composites (CMCs), transport of gas phase reactant into the fiber preform is a critical step. The transport can be driven by pressure or by concentration. This report describes methods for measuring this for CVI preforms and partially infiltrated composites. Results are presented for Nicalon fiber cloth layup preforms and composites, Nextel fiber braid preforms and composites, and a Nicalon fiber 3-D weave composite. The results are consistent with a percolating network model for gas transport in CVI preforms and composites. This model predicts inherent variability in local pore characteristics and transport properties, and therefore, in local densification during processing; this may lead to production of gastight composites.

Wentzel-Bardeen singularity in coupled Luttinger liquids: Transport properties

International Nuclear Information System (INIS)

Martin, T.

1994-01-01

The recent progress on 1 D interacting electrons systems and their applications to study the transport properties of quasi one dimensional wires is reviewed. We focus on strongly correlated elections coupled to low energy acoustic phonons in one dimension. The exponents of various response functions are calculated, and their striking sensitivity to the Wentzel-Bardeen singularity is discussed. For the Hubbard model coupled to phonons the equivalent of a phase diagram is established. By increasing the filling factor towards half filling the WB singularity is approached. This in turn suppresses antiferromagnetic fluctuations and drives the system towards the superconducting regime, via a new intermediate (metallic) phase. The implications of this phenomenon on the transport properties of an ideal wire as well as the properties of a wire with weak or strong scattering are analyzed in a perturbative renormalization group calculation. This allows to recover the three regimes predicted from the divergence criteria of the response functions

Relaxation and transport properties of liquid n-triacontane

International Nuclear Information System (INIS)

Kondratyuk, N D; Lankin, A V; Norman, G E; Stegailov, V V

2015-01-01

Molecular modelling is used to calculate transport properties and to study relaxation of liquid n-triacontane (C 30 H 62 ). The problem is important in connection with the behavior of liquid isolators in a pre-breakdown state. Two all-atom models and a united-atom model are used. Shear viscosity is calculated using the Green-Kubo formula. The force fields are compared with each other using the following criteria: the required time for one molecular dynamics step, the compliance of the main physical and transport properties with experimental values. The problem of the system equilibration is considered. The united-atom potential is used to model the n-triacontane liquid with an initial directional orientation. The time of relaxation to the disordered state, when all molecules orientations are randomized, are obtained. The influence of the molecules orientations on the shear viscosity value and the shear viscosity relaxation are treated. (paper)

Transport properties in GaTe under hydrostatic pressure

International Nuclear Information System (INIS)

Gouskov, L.; Carvalho, M.

1980-01-01

First results of the resistivity rho(perpendicular) and rho(parallel)(perpendicular and parallel to the normal to the cleavage plane) under hydrostatic pressure (1 bar <= P <= 3 kbar) on GaTe grown by the Bridgman method, are given and discussed. The analysis of electrical transport properties of GaTe under pressure, indicates a complex nature of the acceptor level in this material. The activation energy Esub(a) has a negative pressure coefficient which is sample dependent. The comparison of the variations of rho(parallel) and rho(perpendicular) versus pressure shows that the activation energy E of the rho(parallel)/rho(perpendicular) ratio has also a negative pressure coefficient which can be justified in the frame of a one-dimensional disorder model proposed by Maschke and Schmid, in order to explain the transport properties in the direction of the normal to the cleavage plane. (author)

A comparative study of the proton transport properties of metal (IV ...

Indian Academy of Sciences (India)

Unknown

study the transport properties of these materials.5,6 The mechanism of diffusion and ionic transport in crystalline ... Cu-Kα radiation with a nickel filter. Chemical ... All the tungstates were hard and white except TiW which is yellow. The chemical.

Ab Initio Calculations of Transport Properties of Vanadium Oxides

Science.gov (United States)

Lamsal, Chiranjivi; Ravindra, N. M.

2018-04-01

The temperature-dependent transport properties of vanadium oxides have been studied near the Fermi energy using the Kohn-Sham band structure approach combined with Boltzmann transport equations. V2O5 exhibits significant thermoelectric properties, which can be attributed to its layered structure and stability. Highly anisotropic electrical conduction in V2O5 is clearly manifested in the calculations. Due to specific details of the band structure and anisotropic electron-phonon interactions, maxima and crossovers are also seen in the temperature-dependent Seebeck coefficient of V2O5. During the phase transition of VO2, the Seebeck coefficient changes by 18.9 µV/K, which is close to (within 10% of) the observed discontinuity of 17.3 µV/K.

Methodology for determining time-dependent mechanical properties of tuff subjected to near-field repository conditions

International Nuclear Information System (INIS)

Blacic, J.D.; Andersen, R.

1983-01-01

We have established a methodology to determine the time dependence of strength and transport properties of tuff under conditions appropriate to a nuclear waste repository. Exploratory tests to determine the approximate magnitudes of thermomechanical property changes are nearly complete. In this report we describe the capabilities of an apparatus designed to precisely measure the time-dependent deformation and permeability of tuff at simulated repository conditions. Preliminary tests with this new apparatus indicate that microclastic creep failure of tuff occurs over a narrow strain range with little precursory Tertiary creep behavior. In one test, deformation under conditions of slowly decreasing effective pressure resulted in failure, whereas some strain indicators showed a decreasing rate of strain

Methodology for determining time-dependent mechanical properties of tuff subjected to near-field repository conditions

Energy Technology Data Exchange (ETDEWEB)

Blacic, J.D.; Andersen, R.

1983-01-01

We have established a methodology to determine the time dependence of strength and transport properties of tuff under conditions appropriate to a nuclear waste repository. Exploratory tests to determine the approximate magnitudes of thermomechanical property changes are nearly complete. In this report we describe the capabilities of an apparatus designed to precisely measure the time-dependent deformation and permeability of tuff at simulated repository conditions. Preliminary tests with this new apparatus indicate that microclastic creep failure of tuff occurs over a narrow strain range with little precursory Tertiary creep behavior. In one test, deformation under conditions of slowly decreasing effective pressure resulted in failure, whereas some strain indicators showed a decreasing rate of strain.

Research Update: Structural and transport properties of (Ca,La)FeAs{sub 2} single crystal

Energy Technology Data Exchange (ETDEWEB)

Caglieris, F.; Pallecchi, I.; Lamura, G.; Putti, M. [CNR-SPIN and Università di Genova, Via Dodecaneso 33, I-16146 Genova (Italy); Sala, A. [CNR-SPIN and Università di Genova, Via Dodecaneso 33, I-16146 Genova (Italy); Department of Applied Chemistry, The University of Tokyo, Bunkyo, Tokyo 113-8656 (Japan); National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8565 (Japan); Fujioka, M. [National Institute for Materials Science (NIMS), Tsukuba, Ibaraki 305-0047 (Japan); Hokkaido University, Sapporo, Hokkaido 001-0020 (Japan); Hummel, F.; Johrendt, D. [Ludwig-Maximilians-Universität München, Department Chemie, Butenandtstr. 5-13, 81377 München (Germany); Takano, Y. [National Institute for Materials Science (NIMS), Tsukuba, Ibaraki 305-0047 (Japan); Ishida, S.; Iyo, A.; Eisaki, H. [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8565 (Japan); Ogino, H.; Yakita, H. [Department of Applied Chemistry, The University of Tokyo, Bunkyo, Tokyo 113-8656 (Japan); Shimoyama, J. [Department of Applied Chemistry, The University of Tokyo, Bunkyo, Tokyo 113-8656 (Japan); Department of Physics and Mathematics, Aoyama Gakuin University, 5-10-1 Fuchinobe, Chuo-ku, Sagamihara 252-5258 (Japan)

2016-02-01

Structural and transport properties in the normal and superconducting states are investigated in a Ca{sub 0.8}La{sub 0.2}FeAs{sub 2} single crystal with T{sub c} = 27 K, belonging to the newly discovered 112 family of iron based superconductors. The transport critical current density J{sub c} for both field directions measured in a focused ion beam patterned microbridge reveals a weakly field dependent and low anisotropic behaviour with a low temperature value as high as J{sub c}(B = 0) ∼ 10{sup 5} A/cm{sup 2}. This demonstrates not only bulk superconductivity but also the potential of 112 superconductors towards applications. Interestingly, this superconducting compound undergoes a structural transition below 100 K which is evidenced by temperature-dependent X-ray diffraction measurements. Data analysis of Hall resistance and magnetoresistivity indicate that magnetotransport properties are largely dominated by an electron band, with a change of regime observed in correspondence of the onset of a structural transition. In the low temperature regime, the contribution of a hole band to transport is suggested, possibly playing a role in determining the superconducting state.

Electronic structure and transport properties of quasi-one-dimensional carbon nanomaterials

Directory of Open Access Journals (Sweden)

Y. N. Wu

2017-09-01

Full Text Available Based on the density functional theory combined with the nonequilibrium Green’s function, the influence of the wrinkle on the electronic structures and transport properties of quasi-one-dimensional carbon nanomaterials have been investigated, in which the wrinkled armchair graphene nanoribbons (wAGNRs and the composite of AGNRs and single walled carbon nanotubes (SWCNTs were considered with different connection of ripples. The wrinkle adjusts the electronic structures and transport properties of AGNRs. With the change of the strain, the wAGNRs for three width families reveal different electrical behavior. The band gap of AGNR(6 increases in the presence of the wrinkle, which is opposite to that of AGNR(5 and AGNR(7. The transport of AGNRs with the widths 6 or 7 has been modified by the wrinkle, especially by the number of isolated ripples, but it is insensitive to the strain. The nanojunctions constructed by AGNRs and SWCNTs can form the quantum wells, and some specific states are confined in wAGNRs. Although these nanojunctions exhibit the metallic, they have poor conductance due to the wrinkle. The filling of C20 into SWCNT has less influence on the electronic structure and transport of the junctions. The width and connection type of ripples have greatly influenced on the electronic structures and transport properties of quasi-one-dimensional nanomaterials.

Electronic structure and transport properties of quasi-one-dimensional carbon nanomaterials

Science.gov (United States)

Wu, Y. N.; Cheng, P.; Wu, M. J.; Zhu, H.; Xiang, Q.; Ni, J.

2017-09-01

Based on the density functional theory combined with the nonequilibrium Green's function, the influence of the wrinkle on the electronic structures and transport properties of quasi-one-dimensional carbon nanomaterials have been investigated, in which the wrinkled armchair graphene nanoribbons (wAGNRs) and the composite of AGNRs and single walled carbon nanotubes (SWCNTs) were considered with different connection of ripples. The wrinkle adjusts the electronic structures and transport properties of AGNRs. With the change of the strain, the wAGNRs for three width families reveal different electrical behavior. The band gap of AGNR(6) increases in the presence of the wrinkle, which is opposite to that of AGNR(5) and AGNR(7). The transport of AGNRs with the widths 6 or 7 has been modified by the wrinkle, especially by the number of isolated ripples, but it is insensitive to the strain. The nanojunctions constructed by AGNRs and SWCNTs can form the quantum wells, and some specific states are confined in wAGNRs. Although these nanojunctions exhibit the metallic, they have poor conductance due to the wrinkle. The filling of C20 into SWCNT has less influence on the electronic structure and transport of the junctions. The width and connection type of ripples have greatly influenced on the electronic structures and transport properties of quasi-one-dimensional nanomaterials.

Magnetothermoelectric transport properties in phosphorene

Science.gov (United States)

Ma, R.; Liu, S. W.; Deng, M. X.; Sheng, L.; Xing, D. Y.; Sheng, D. N.

2018-02-01

We numerically study the electrical and thermoelectric transport properties in phosphorene in the presence of both a magnetic field and disorder. The quantized Hall conductivity is similar to that of a conventional two-dimensional electron gas, but the positions of all the Hall plateaus shift to the left due to the spectral asymmetry, in agreement with the experimental observations. The thermoelectric conductivity and Nernst signal exhibit remarkable anisotropy, and the thermopower is nearly isotropic. When a bias voltage is applied between top and bottom layers of phosphorene, both thermopower and Nernst signal are enhanced and their peak values become large.

Transport properties of organic liquids

CERN Document Server

Latini, G; Passerini, G

2006-01-01

The liquid state is possibly the most difficult and intriguing state of matter to model. Organic liquids are required, mainly as working fluids, in almost all industrial activities and in most appliances (e.g. in air conditioning). Transport properties (namely dynamic viscosity and thermal conductivity) are possibly the most important properties for the design of devices and appliances. The aim of this book is to present both theoretical approaches and the latest experimental advances on the issue, and to merge them into a wider approach. It concentrates on applicability of models.This book is organized into five chapters plus a data collection. The chapters discuss the following topics: the liquid state and some well-know theories able to explain the behaviour of liquids; a rather complete review of models, based on theoretical assumptions and/or upon physical paradigms, to evaluate heat transfer in organic liquids; a review of several well-known semi-empirical methods to predict the thermal conductivity coe...

Applications of asymmetric nanotextured parylene surface using its wetting and transport properties

Science.gov (United States)

Sekeroglu, Koray

In this thesis, basic digital fluidics devices were introduced using polymeric nanorods (nano-PPX) inspired from nature. Natural inspiration ignited this research by observing butterfly wings, water strider legs, rye grass leaves, and their asymmetric functions. Nano-PPX rods, manufactured by an oblique angle polymerization (OAP) method, are asymmetrically aligned structures that have unidirectional wetting properties. Nano-PPX demonstrates similar functions to the directional textured surfaces of animals and plants in terms of wetting, adhesion, and transport. The water pin-release mechanism on the asymmetric nano-PPX surface with adhesion function provides a great transport property. How the asymmetry causes transport is discussed in terms of hysteresis and interface contact of water droplets. In this study, the transport property of nano-PPX rods is used to guide droplets as well as transporting cargo such as microgels. With the addition of tracks on the nano-PPX rods, the surfaces were transformed into basic digital fluidics devices. The track-assisted nano-PPX has been employed to applications (i.e. sorting, mixing, and carrying cargo particles). Thus, digital fluidics devices fabricated on nano-PPX surface is a promising pathway to assemble microgels in the field of bioengineering. The characterization of the nano textured surface was completed using methods such as Scanning Electron Microscopy, Atomic Force Microscopy, Contact Angle Goniometry, and Fourier Transform Infra-Red Spectroscopy. These methods helped to understand the physical and chemical properties of nano-PPX. Parameters such as advancing and receding contact angles, nanorod tilt angle, and critical drop volumes were utilized to investigate the anisotropic wetting properties of nano-PPX surface. This investigation explained the directional wetting behavior of the surface as well as approaching new design parameters for adjusting surface properties. The nanorod tilt angle was a key parameter

Impact of carbonation on water transport properties of cementitious materials

International Nuclear Information System (INIS)

Auroy, Martin

2014-01-01

Carbonation is a very well-known cementitious materials pathology. It is the major cause of reinforced concrete structures degradation. It leads to rebar corrosion and consequent concrete cover cracking. In the framework of radioactive waste management, cement-based materials used as building materials for structures or containers would be simultaneously submitted to drying and atmospheric carbonation. Although scientific literature regarding carbonating is vast, it is clearly lacking information about the influence of carbonation on water transport properties. This work then aimed at studying and understanding the change in water transport properties induced by carbonation. Simultaneously, the representativeness of accelerated carbonation (in the laboratory) was also studied. (author) [fr

EFFECT OF SANDSTONE ANISOTROPY ON ITS HEAT AND MOISTURE TRANSPORT PROPERTIES

Directory of Open Access Journals (Sweden)

Jan Fořt

2015-09-01

Full Text Available Each type of natural stone has its own geological history, formation conditions, different chemical and mineralogical composition, which influence its possible anisotropy. Knowledge in the natural stones anisotropy represents crucial information for the process of stone quarrying, its correct usage and arrangement in building applications. Because of anisotropy, many natural stones exhibit different heat and moisture transport properties in various directions. The main goal of this study is to analyse several anisotropy indices and their effect on heat transport and capillary absorption. For the experimental determination of the anisotropy effect, five types of sandstone coming from different operating quarries in the Czech Republic are chosen. These materials are often used for restoration of culture heritage monuments as well as for other building applications where they are used as facing slabs, facade panels, decoration stones, paving, etc. For basic characterization of studied materials, determination of their bulk density, matrix density and total open porosity is done. Chemical composition of particular sandstones is analysed by X-Ray Fluorescence. Anisotropy is examined by the non-destructive measurement of velocity of ultrasonic wave propagation. On the basis of ultrasound testing data, the relative anisotropy, total anisotropy and anisotropy coefficient are calculated. Then, the measurement of thermal conductivity and thermal diffusivity in various directions of samples orientation is carried out. The obtained results reveal significant differences between the parameters characterizing the heat transport in various directions, whereas these values are in accordance with the indices of anisotropy. Capillary water transport is described by water absorption coefficient measured using a sorption experiment, which is performed for distilled water and 1M NaCl water solution.  The measured data confirm the effect of anisotropy which is

Moisture transport properties of mortar and mortar joint: A NMR study

NARCIS (Netherlands)

Brocken, H.J.P.; Adant, O.C.G.; Pel, L.

1997-01-01

The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick

Moisture transport properties of mortar and mortar joint: a NMR study

NARCIS (Netherlands)

Brocken, H.J.P.; Adan, O.C.G.; Pel, L.

1997-01-01

The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick

Core transport properties in JT-60U and JET identity plasmas

NARCIS (Netherlands)

Litaudon, X.; Sakamoto, Y.; de Vries, P. C.; Salmi, A.; Tala, T.; Angioni, C.; Benkadda, S.; Beurskens, M. N. A.; Bourdelle, C.; Brix, M.; Crombe, K.; Fujita, T.; Futatani, S.; Garbet, X.; Giroud, C.; Hawkes, N. C.; Hayashi, N.; Hoang, G. T.; Hogeweij, G. M. D.; Matsunaga, G.; Nakano, T.; Oyama, N.; Parail, V.; Shinohara, K.; Suzuki, T.; Takechi, M.; Takenaga, H.; Takizuka, T.; Urano, H.; Voitsekhovitch, I.; Yoshida, M.

2011-01-01

The paper compares the transport properties of a set of dimensionless identity experiments performed between JET and JT-60U in the advanced tokamak regime with internal transport barrier, ITB. These International Tokamak Physics Activity, ITPA, joint experiments were carried out with the same plasma

Experimental characterization of the water transport properties of PEM fuel cells diffusion media

Science.gov (United States)

Ramos-Alvarado, Bladimir; Sole, Joshua D.; Hernandez-Guerrero, Abel; Ellis, Michael W.

2012-11-01

A full experimental characterization of the liquid water transport properties of Toray TGP-090 paper is carried out in this work. Porosity, capillary pressure curves (capillary pressure-saturation relationships), absolute permeability, and relative permeability are obtained via experimental procedures. Porosity was determined using two methods, both aimed to obtain the solid volume of the network of fibers comprising the carbon paper. Capillary pressure curves were obtained using a gas displacement porosimeter where liquid water is injected using a syringe pump and the capillary pressure is recorded using a differential pressure transducer. Absolute and relative permeability were also measured with an apparatus designed at Virginia Tech. Absolute permeability was calculated at different flow rates using nitrogen. On the other hand, relative permeability was a more complicated task to carry out giving the complexity (two-phase flow condition) of this property. All of the water transport properties of Toray TGP-090 were studied under the effects of wet-proofing (PTFE treatment) and compression. Some observations were that wet-proofing reduces the porosity of the raw material, increases the hydrophobicity (Pc-S curves), and reduces the permeability of the material. Similar effects were observed for compression, where compressed material exhibited trends similar to those of wet-proofing effects. The results presented here will allow a more accurate modeling of PEMFCs, providing an experimentally verified alternative to the assumptions frequently employed.

Spin-polarized transport properties of a pyridinium-based molecular spintronics device

Science.gov (United States)

Zhang, J.; Xu, B.; Qin, Z.

2018-05-01

By applying a first-principles approach based on non-equilibrium Green's functions combined with density functional theory, the transport properties of a pyridinium-based "radical-π-radical" molecular spintronics device are investigated. The obvious negative differential resistance (NDR) and spin current polarization (SCP) effect, and abnormal magnetoresistance (MR) are obtained. Orbital reconstruction is responsible for novel transport properties such as that the MR increases with bias and then decreases and that the NDR being present for both parallel and antiparallel magnetization configurations, which may have future applications in the field of molecular spintronics.

Review and assessment of thermodynamic and transport properties for the CONTAIN Code

International Nuclear Information System (INIS)

Valdez, G.D.

1988-12-01

A study was carried out to review available data and correlations on the thermodynamic and transport properties of materials applicable to the CONTAIN computer code. CONTAIN is the NRC's best-estimate, mechanistic computer code for modeling containment response to a severe accident. Where appropriate, recommendations have been made for suitable approximations for material properties of interests. Based on a modified Benedict-Webb-Rubin (BWR) equation of state, a procedure is introduced for calculating thermodynamic properties for common gases in the CONTAIN code. These gases are nitrogen, oxygen, hydrogen, carbon dioxide, carbon monoxide, steam, helium, and argon. The thermodynamic equations for density, currently represented in CONTAIN by relatively simple fits, were independently checked and are recommended to be replaced by the Lee-Kesler equation of state which substantially improves accuracy without too much sacrifice in computational efficiency. The accuracy of the calculated values have been found to be generally acceptable. Various correlations and models for single component gas transport properties, viscosity and thermal conductivity, were also assessed with available experimental data. When a suitable correlation or model was not available, transport properties were obtained by performing least-squares fit on experimental data. 50 refs., 126 figs., 3 tabs

Identifying the Critical Links in Road Transportation Networks: Centrality-based approach utilizing structural properties

Energy Technology Data Exchange (ETDEWEB)

Chinthavali, Supriya [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2016-04-01

Surface transportation road networks share structural properties similar to other complex networks (e.g., social networks, information networks, biological networks, and so on). This research investigates the structural properties of road networks for any possible correlation with the traffic characteristics such as link flows those determined independently. Additionally, we define a criticality index for the links of the road network that identifies the relative importance in the network. We tested our hypotheses with two sample road networks. Results show that, correlation exists between the link flows and centrality measures of a link of the road (dual graph approach is followed) and the criticality index is found to be effective for one test network to identify the vulnerable nodes.

Fabrication and Transport Properties of Manganite-Polyacrylamide-Based Composites

Directory of Open Access Journals (Sweden)

Viorel Sandu

2009-01-01

Full Text Available We present the fabrication and transport properties of a series of composites made of La2/3Sr1/3MnO3 and acrylamide-based copolymers. The most important result is the very narrow transition, of only 27 K, displayed by the peak that appears around the metal-insulator transition of the composites made with poly(acrylamide-vinylacetate. Although the amount of polymer is rather low, different copolymers change drastically the electric transport characteristics.

System-wide organization of actin cytoskeleton determines organelle transport in hypocotyl plant cells

Science.gov (United States)

Nowak, Jacqueline; Ivakov, Alexander; Somssich, Marc; Persson, Staffan; Nikoloski, Zoran

2017-01-01

The actin cytoskeleton is an essential intracellular filamentous structure that underpins cellular transport and cytoplasmic streaming in plant cells. However, the system-level properties of actin-based cellular trafficking remain tenuous, largely due to the inability to quantify key features of the actin cytoskeleton. Here, we developed an automated image-based, network-driven framework to accurately segment and quantify actin cytoskeletal structures and Golgi transport. We show that the actin cytoskeleton in both growing and elongated hypocotyl cells has structural properties facilitating efficient transport. Our findings suggest that the erratic movement of Golgi is a stable cellular phenomenon that might optimize distribution efficiency of cell material. Moreover, we demonstrate that Golgi transport in hypocotyl cells can be accurately predicted from the actin network topology alone. Thus, our framework provides quantitative evidence for system-wide coordination of cellular transport in plant cells and can be readily applied to investigate cytoskeletal organization and transport in other organisms. PMID:28655850

Communication: Electronic and transport properties of molecular junctions under a finite bias: A dual mean field approach

International Nuclear Information System (INIS)

Liu, Shuanglong; Feng, Yuan Ping; Zhang, Chun

2013-01-01

We show that when a molecular junction is under an external bias, its properties cannot be uniquely determined by the total electron density in the same manner as the density functional theory for ground state properties. In order to correctly incorporate bias-induced nonequilibrium effects, we present a dual mean field (DMF) approach. The key idea is that the total electron density together with the density of current-carrying electrons are sufficient to determine the properties of the system. Two mean fields, one for current-carrying electrons and the other one for equilibrium electrons can then be derived. Calculations for a graphene nanoribbon junction show that compared with the commonly used ab initio transport theory, the DMF approach could significantly reduce the electric current at low biases due to the non-equilibrium corrections to the mean field potential in the scattering region

Low-temperature localization in the transport properties of self ...

Indian Academy of Sciences (India)

Transport properties; scattering mechanisms; low temperature localization. 1. Introduction ... Mn4+ appears in these compounds due to the La defi- ciency, leading ... microscopy (SEM) image in figure 1 shows the size and mor- phology of the ...

Influence of deformation on the fluid transport properties of salt rocks

NARCIS (Netherlands)

Peach, C.J.

1991-01-01

While the fluid transport properties of rocks are well understood under hydrostatic conditions, little is known regarding these properties in rocks undergoing crystal plastic deformation. However, such data are needed as input in the field of radioactive waste disposal in salt formations. They

Bayesian estimation of the hydraulic and solute transport properties of a small-scale unsaturated soil column

Directory of Open Access Journals (Sweden)

Moreira Paulo H. S.

2016-03-01

Full Text Available In this study the hydraulic and solute transport properties of an unsaturated soil were estimated simultaneously from a relatively simple small-scale laboratory column infiltration/outflow experiment. As governing equations we used the Richards equation for variably saturated flow and a physical non-equilibrium dual-porosity type formulation for solute transport. A Bayesian parameter estimation approach was used in which the unknown parameters were estimated with the Markov Chain Monte Carlo (MCMC method through implementation of the Metropolis-Hastings algorithm. Sensitivity coefficients were examined in order to determine the most meaningful measurements for identifying the unknown hydraulic and transport parameters. Results obtained using the measured pressure head and solute concentration data collected during the unsaturated soil column experiment revealed the robustness of the proposed approach.

Theoretical approaches to determining the financial provision of public transportation

Directory of Open Access Journals (Sweden)

O.A. Vygovska

2018-03-01

Full Text Available The work is devoted to the improvement of theoretical approaches in determining the financial provision of transportation by public transport at the regional level. The author summarizes the concept of the «financial security» and defines the main difference from the term «financing». The systematization of key differences in the financial provision of a transport company from other financial entities of the economic sector at the national and regional levels is carried out. The disadvantages and advantages of sources of financial support are analyzed. The purpose of the article is to study theoretical approaches in determining the financial provision of transportation by public transport at the regional level. The prospects for further scientific research are the need to identify new scientific approaches and techniques to substantiate and elaborate the concept of the «financial provision of transportation by public transport». The practical application of the research should be formed in a detailed analysis of cash flow streams in the system of «state – regional authority – economic entity». The financial provision of transportation by public transport at the regional level has not been given the sufficient attention in the scientific research within the country. This fact confirms the need for a thorough analysis of the transport industry as a whole.

Electrical Transport Properties of Polycrystalline Monolayer Molybdenum Disulfide

Science.gov (United States)

2014-07-14

Lou, Sina Najmaei, Matin Amani, Matthew L. Chin, Zheng Se. TASK NUMBER Liu Sf. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAMES AND ADDRESSES 8...Transport Properties of Polycrystalline Monolayer Molybdenum Disulfide Sina Najmaei,t.§ Matin Ama ni,M Matthew L. Chin,* Zhe ng liu/ ·"·v: A. Gle n

Influence of deformation on the fluid transport properties of salt rocks

NARCIS (Netherlands)

Peach, C.J.

1991-01-01

While the fluid transport properties of rocks are well understood under hydrostatic conditions, little is known regarding these properties in rocks undergoing crystal plastic deformation. However, such data are needed as input in the field of radioactive waste disposal in salt formations. They are

Electronic transport properties of pentacene single crystals upon exposure to air

NARCIS (Netherlands)

Jurchescu, OD; Baas, J; Palstra, TTM; Jurchescu, Oana D.

2005-01-01

We report the effect of air exposure on the electronic properties of pentacene single crystals. Air can diffuse reversibly in and out of the crystals and influences the physical properties. We discern two competing mechanisms that modulate the electronic transport. The presence of oxygen increases

Electronic transport properties of nano-scale Si films: an ab initio study

Science.gov (United States)

Maassen, Jesse; Ke, Youqi; Zahid, Ferdows; Guo, Hong

2010-03-01

Using a recently developed first principles transport package, we study the electronic transport properties of Si films contacted to heavily doped n-type Si leads. The quantum transport analysis is carried out using density functional theory (DFT) combined with nonequilibrium Green's functions (NEGF). This particular combination of NEGF-DFT allows the investigation of Si films with thicknesses in the range of a few nanometers and lengths up to tens of nanometers. We calculate the conductance, the momentum resolved transmission, the potential profile and the screening length as a function of length, thickness, orientation and surface structure. Moreover, we compare the properties of Si films with and without a top surface passivation by hydrogen.

Identifying the molecular functions of electron transport proteins using radial basis function networks and biochemical properties.

Science.gov (United States)

Le, Nguyen-Quoc-Khanh; Nguyen, Trinh-Trung-Duong; Ou, Yu-Yen

2017-05-01

The electron transport proteins have an important role in storing and transferring electrons in cellular respiration, which is the most proficient process through which cells gather energy from consumed food. According to the molecular functions, the electron transport chain components could be formed with five complexes with several different electron carriers and functions. Therefore, identifying the molecular functions in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. This work includes two phases for discriminating electron transport proteins from transport proteins and classifying categories of five complexes in electron transport proteins. In the first phase, the performances from PSSM with AAIndex feature set were successful in identifying electron transport proteins in transport proteins with achieved sensitivity of 73.2%, specificity of 94.1%, and accuracy of 91.3%, with MCC of 0.64 for independent data set. With the second phase, our method can approach a precise model for identifying of five complexes with different molecular functions in electron transport proteins. The PSSM with AAIndex properties in five complexes achieved MCC of 0.51, 0.47, 0.42, 0.74, and 1.00 for independent data set, respectively. We suggest that our study could be a power model for determining new proteins that belongs into which molecular function of electron transport proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

A numerical model of non-equilibrium thermal plasmas. I. Transport properties

Energy Technology Data Exchange (ETDEWEB)

Zhang XiaoNing; Xia WeiDong [Department of Thermal Science and Energy Engineering, University of Science and Technology of China, Hefei, Anhui Province 230026 (China); Li HePing [Department of Engineering Physics, Tsinghua University, Beijing 100084 (China); Murphy, Anthony B. [CSIRO Materials Science and Engineering, PO Box 218, Lindfield NSW 2070 (Australia)

2013-03-15

A self-consistent and complete numerical model for investigating the fundamental processes in a non-equilibrium thermal plasma system consists of the governing equations and the corresponding physical properties of the plasmas. In this paper, a new kinetic theory of the transport properties of two-temperature (2-T) plasmas, based on the solution of the Boltzmann equation using a modified Chapman-Enskog method, is presented. This work is motivated by the large discrepancies between the theories for the calculation of the transport properties of 2-T plasmas proposed by different authors in previous publications. In the present paper, the coupling between electrons and heavy species is taken into account, but reasonable simplifications are adopted, based on the physical fact that m{sub e}/m{sub h} Much-Less-Than 1, where m{sub e} and m{sub h} are, respectively, the masses of electrons and heavy species. A new set of formulas for the transport coefficients of 2-T plasmas is obtained. The new theory has important physical and practical advantages over previous approaches. In particular, the diffusion coefficients are complete and satisfy the mass conversation law due to the consideration of the coupling between electrons and heavy species. Moreover, this essential requirement is satisfied without increasing the complexity of the transport coefficient formulas. Expressions for the 2-T combined diffusion coefficients are obtained. The expressions for the transport coefficients can be reduced to the corresponding well-established expressions for plasmas in local thermodynamic equilibrium for the case in which the electron and heavy-species temperatures are equal.

A numerical model of non-equilibrium thermal plasmas. I. Transport properties

Science.gov (United States)

Zhang, Xiao-Ning; Li, He-Ping; Murphy, Anthony B.; Xia, Wei-Dong

2013-03-01

A self-consistent and complete numerical model for investigating the fundamental processes in a non-equilibrium thermal plasma system consists of the governing equations and the corresponding physical properties of the plasmas. In this paper, a new kinetic theory of the transport properties of two-temperature (2-T) plasmas, based on the solution of the Boltzmann equation using a modified Chapman-Enskog method, is presented. This work is motivated by the large discrepancies between the theories for the calculation of the transport properties of 2-T plasmas proposed by different authors in previous publications. In the present paper, the coupling between electrons and heavy species is taken into account, but reasonable simplifications are adopted, based on the physical fact that me/mh ≪ 1, where me and mh are, respectively, the masses of electrons and heavy species. A new set of formulas for the transport coefficients of 2-T plasmas is obtained. The new theory has important physical and practical advantages over previous approaches. In particular, the diffusion coefficients are complete and satisfy the mass conversation law due to the consideration of the coupling between electrons and heavy species. Moreover, this essential requirement is satisfied without increasing the complexity of the transport coefficient formulas. Expressions for the 2-T combined diffusion coefficients are obtained. The expressions for the transport coefficients can be reduced to the corresponding well-established expressions for plasmas in local thermodynamic equilibrium for the case in which the electron and heavy-species temperatures are equal.

Transport and Fatigue Properties of Ferroelectric Polymer P(VDF-TrFE) For Nonvolatile Memory Applications

KAUST Repository

Hanna, Amir

2012-01-01

injection and transport are believed to affect various properties of ferroelectric films such as remnant polarization values and polarization fatigue behavior.. Thus, this thesis aims to study charge injection in P(VDF-TrFE) and its transport properties as a

First-Principles Calculations of Electronic, Optical, and Transport Properties of Materials for Energy Applications

Science.gov (United States)

Shi, Guangsha

theoretical upper limit of the figure of merit. I also determined the electronic structures and thermoelectric properties of Mg2Si, Mg2Ge, and Mg2Sn, a family of Earth-abundant thermoelectric compounds. I uncovered the importance of quasiparticle corrections and the proper treatment of pseudopotentials in the determination of the band gaps and the thermoelectric transport properties at high temperatures. The methods and codes I developed in my research form a general predictive toolbox for the design and optimization of the functional properties of materials for energy applications.

Elastic and transport properties of topological semimetal ZrTe

Science.gov (United States)

Guo, San-Dong; Wang, Yue-Hua; Lu, Wan-Li

2017-11-01

Topological semimetals may have substantial applications in electronics, spintronics, and quantum computation. Recently, ZrTe was predicted as a new type of topological semimetal due to the coexistence of Weyl fermions and massless triply degenerate nodal points. In this work, the elastic and transport properties of ZrTe are investigated by combining the first-principles calculations and semiclassical Boltzmann transport theory. Calculated elastic constants prove the mechanical stability of ZrTe, and the bulk modulus, shear modulus, Young’s modulus, and Poisson’s ratio also are calculated. It is found that spin-orbit coupling (SOC) has slightly enhanced effects on the Seebeck coefficient, which along the a(b) and c directions for pristine ZrTe at 300 K is 46.26 μVK-1 and 80.20 μVK-1, respectively. By comparing the experimental electrical conductivity of ZrTe (300 K) with the calculated value, the scattering time is determined as 1.59 × 10-14 s. The predicted room-temperature electronic thermal conductivity along the a(b) and c directions is 2.37 {{Wm}}-1{{{K}}}-1 and 2.90 {{Wm}}-1{{{K}}}-1, respectively. The room-temperature lattice thermal conductivity is predicted as 17.56 {{Wm}}-1{{{K}}}-1 and 43.08 {{Wm}}-1{{{K}}}-1 along the a(b) and c directions, showing very strong anisotropy. Calculated results show that isotope scattering produces an observable effect on lattice thermal conductivity. To observably reduce lattice thermal conductivity by nanostructures, the characteristic length should be smaller than 70 nm, based on cumulative lattice thermal conductivity with respect to the phonon mean free path (MFP) at 300 K. It is noted that the average room-temperature lattice thermal conductivity of ZrTe is slightly higher than that of isostructural MoP, which is due to larger phonon lifetimes and smaller Grüneisen parameters. Finally, the total thermal conductivity as a function of temperature is predicted for pristine ZrTe. Our works provide valuable

Tuning transport properties of graphene three-terminal structures by mechanical deformation

Science.gov (United States)

Torres, V.; Faria, D.; Latgé, A.

2018-04-01

Straintronic devices made of carbon-based materials have been pushed up due to the graphene high mechanical flexibility and the possibility of interesting changes in transport properties. Properly designed strained systems have been proposed to allow optimized transport responses that can be explored in experimental realizations. In multiterminal systems, comparisons between schemes with different geometries are important to characterize the modifications introduced by mechanical deformations, especially if the deformations are localized at a central part of the system or extended in a large region. Then, in the present analysis, we study the strain effects on the transport properties of triangular and hexagonal graphene flakes, with zigzag and armchair edges, connected to three electronic terminals, formed by semi-infinite graphene nanoribbons. Using the Green's function formalism with circular renormalization schemes, and a single band tight-binding approximation, we find that resonant tunneling transport becomes relevant and is more affected by localized deformations in the hexagonal graphene flakes. Moreover, triangular systems with deformation extended to the leads, like longitudinal three-folded type, are shown as an interesting scenario for building nanoscale waveguides for electronic current.

State-specific transport properties of electronically excited Ar and C

Science.gov (United States)

Istomin, V. A.; Kustova, E. V.

2018-05-01

In the present study, a theoretical model of state-resolved transport properties in electronically excited atomic species developed earlier is applied to argon and carbon atomic species. It is shown that for Ar and C, similarly to the case of atomic nitrogen and oxygen, the Slater-like models can be applied to calculate diameters of electronically excited atoms. Using the Slater-like model it is shown that for half-filled N (2 px1py1pz1) and full-filled Ar (3 px2py2pz2) electronic shells the growth of atomic radius goes slowly compared to C (2 px1py1) and O (2 px2py1pz1). The effect of collision diameters on the transport properties of Ar and C is evaluated. The influence of accounted number of electronic levels on the transport coefficients is examined for the case of Boltzmann distributions over electronic energy levels. It is emphasized that in the temperature range 1000-14000 K, for Boltzmann-like distributions over electronic states the number of accounted electronic levels do not influence the transport coefficients. Contrary to this, for higher temperatures T > 14000 K this effect becomes of importance, especially for argon.

Determination of transport properties and optimization of lithium-ion batteries

Science.gov (United States)

Stewart, Sarah Grace

We have adapted the method of restricted diffusion to measure diffusion coefficients in lithium-battery electrolytes using Ultra-Violent-Visible (UV-Vis) absorption. The use of UV-Vis absorption reduces the likelihood of side reactions. Here we describe the measurement of the diffusion coefficient in lithium-battery electrolytic solutions. The diffusion coefficient is seen to decrease with increasing concentration according to the following: D = 3.018·10-5 exp(-0.357c), for LiPF 6 in acetonitrile and D = 2.582·10-5 exp(-2.856c) for LiPF6 in EC:DEC (with D in cm2/s and c in moles per liter). This technique may be useful for any liquid solution with a UV-active species of D greater than 10-6 cm2/s. Activity coefficients were measured in concentration cell and melting-point-depression experiments. Results from concentration-cell experiments are presented for solutions of lithium hexafluorophosphate (LiPF6) in propylene carbonate (PC) as well as in a 1:1 by weight solution of ethylene carbonate (EC) and ethyl methyl carbonate (EMC). Heat capacity results are also presented. The thermodynamic factor of LiPF6 solutions in EC varies between ca. 1.33 and ca. 6.10 in the concentration range ca. 0.06 to 1.25 M (which appears to be a eutectic point). We show that the solutions of LiPF6 investigated are not ideal but that an assumption of ideality for these solutions may overestimate the specific energy of a lithium-ion cell by only 0.6%. The thermodynamic and transport properties that we have measured are used in a system model. We have used this model to optimize the design of an asymmetric-hybrid system. This technology attempts to bridge the gap in energy density between a battery and supercapacitor. In this system, the positive electrode stores charge through a reversible, nonfaradaic adsorption of anions on the surface. The negative electrode is nanostructured Li4Ti 5O12, which reversibly intercalates lithium. We use the properties that we have measured in a system

Formulation of confinement matrices and characterization of their transport properties from solid to melt state

International Nuclear Information System (INIS)

Grandjean, A.

2006-07-01

The author gives an overview of his research activity during which she worked on three main subjects. The first one dealt with the investigation of transport mechanisms in metal alloys (experimental investigation of diffusion in amorphous alloys, oxidation mechanism of Zircaloy-4 under temperature and in water or in dry oxygen). The second one dealt with the synthesis and properties of specific confinement matrices (effect of chemical composition on sintering of a carbonate powder, effect of microstructure of high Mo and P content vitro-crystals on lixiviation properties, incorporation of fluorine compounds in the case of borosilicate systems). The third one dealt with the transport in borosilicate glasses and melts (ionic transport, properties, and electrical transport glass-RuO 2 particles composites)

Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

Science.gov (United States)

Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

2014-11-01

The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

Characterizing the transplanar and in-plane water transport properties of fabrics under different sweat rate: Forced Flow Water Transport Tester

Science.gov (United States)

Tang, K. P. M.; Chau, K. H.; Kan, C. W.; Fan, J. T.

2015-11-01

The water absorption and transport properties of fabrics are critical to wear comfort, especially for sportswear and protective clothing. A new testing apparatus, namely Forced Flow Water Transport Tester (FFWTT), was developed for characterizing the transplanar and in-plane wicking properties of fabrics based on gravimetric and image analysis technique. The uniqueness of this instrument is that the rate of water supply is adjustable to simulate varying sweat rates with reference to the specific end-use conditions ranging from sitting, walking, running to other strenuous activities. This instrument is versatile in terms of the types of fabrics that can be tested. Twenty four types of fabrics with varying constructions and surface finishes were tested. The results showed that FFWTT was highly sensitive and reproducible in differentiating these fabrics and it suggests that water absorption and transport properties of fabrics are sweat rate-dependent. Additionally, two graphic methods were proposed to map the direction of liquid transport and its relation to skin wetness, which provides easy and direct comparison among different fabrics. Correlation analysis showed that FFWTT results have strong correlation with subjective wetness sensation, implying validity and usefulness of the instrument.

Thermophysical Properties of Ammonium-Based Bis{(trifluoromethyl)sulfonyl}imide Ionic Liquids: Volumetric and Transport Properties

Czech Academy of Sciences Publication Activity Database

Machanová, Karolina; Boisset, A.; Sedláková, Zuzana; Anouti, M.; Bendová, Magdalena; Jacquemin, J.

2012-01-01

Roč. 57, č. 8 (2012), s. 2227-2235 ISSN 0021-9568. [European Conference on Thermophysical Properties /19./. Thessaloniki, 28.08.2011-01.09.2011] R&D Projects: GA ČR GP203/09/P141; GA MŠk(CZ) MEB021009 Grant - others:Égide PHC(FR) 22000XB Institutional support: RVO:67985858 Keywords : ionic liquids * density * transport properties Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.004, year: 2012

Influence of biofilms on transport properties in porous media

Science.gov (United States)

Davit, Y.

2015-12-01

Microbial activity and biofilm growth in porous media can drastically modify transport properties such as permeability, longitudinal and transverse dispersion or effective reaction rates. Understanding these effects has proven to be a considerable challenge. Advances in this field have been hindered by the difficulty of modeling and visualizing these multi-phase non-linear effects across a broad range of spatial and temporal scales. To address these issues, we are developing a strategy that combines imaging techniques based on x-ray micro-tomography with homogenization of pore-scale transport equations. Here, we review recent progress in x-ray imaging of biofilms in porous media, with a particular focus on the contrast agents that are used to differentiate between the fluid and biofilm phases. We further show how the 3D distribution of the different phases can be used to extract specific information about the biofilm and how effective properties can be calculated via the resolution of closure problems. These closure problems are obtained using the method of volume averaging and must be adapted to the problem of interest. In hydrological systems, we show that a generic formulation for reactive solute transport is based on a domain decomposition approach at the micro-scale yielding macro-scale models reminiscent of multi-rate mass transfer approaches.

Interface and transport properties of GaN/graphene junction in GaN-based LEDs

International Nuclear Information System (INIS)

Wang Liancheng; Zhang Yiyun; Liu Zhiqiang; Guo Enqing; Yi Xiaoyan; Wang Junxi; Wang Guohong; Li Xiao; Zhu Hongwei

2012-01-01

A normalized circular transmission line method pattern with uniform interface area was developed to obtain contact resistances of p-, u-, n-GaN/graphene contacts (p, u and n represent p-type doped, unintentionally doped and n-type doped, respectively) and N-polar u-, n-GaN/graphene contacts in GaN-based LEDs. The resistances of the graphene/GaN contacts were mainly determined by the work function gap and the carrier concentration in GaN. Annealing caused diffusion of metal atoms and significantly influenced the interface transport properties.

Fundamental investigation of the transport properties of superacids in aqueous and non-aqueous media

Science.gov (United States)

Suarez, Sophia

In the quest to develop more efficient energy providers one of the main focus of research has been on the improvement of ion transport. In lithium battery research this has led to the incorporation of various lithium salts, ceramics and plasticizers into the poly(ethylene)oxide (PEO) matrix, the polymer most used In Proton Conduction Membrane (PCM) fuel cell research this has led to the development of new membranes, which are designed with to replicate Nafion's ((c)DuPont) proton transport but also improve upon its deficiency of transporting intact fuel molecules and its dependence upon the presence of solvating water molecules. To better understand the process of ion transport, NMR was used to investigate dynamic properties such as D (self-diffusion coefficient) and T1 (spin-lattice relaxation time) of various proton and lithium ion-conducting systems. Ionic conductivity and viscosity measurements were also performed. The systems studied includes aqueous superacid solutions (trifluoromethanesulfonic (TFSA), para-toluenesulfonic (PTSA) and bis(trifluoromethanesulfonyl)imide (TFSI)); nano-porous (NP-) PCM's incorporating various ceramics and 3M fuel/2M H2SO4 solutions; and P(EO)20LiBETI (LiN(SO 2CF2CF3)2 composite incorporating SiO 2 ceramic nano particles. The objective of the study of the superacid solutions was to determine the effect of concentration on the transport. It was found that beyond the ionic conductivity maximum, fluctuations in both D and T1 supports the existence of local ordering in the ionic network, caused by the reduced solvent dielectric coefficient and increasing viscosity. Of the three superacids TFSA was the most conductive and most affected by reduced solvent concentration. For the P(EO)20LiBETI composite the aim was to determine the effect of the ceramic on the ion transport of the composite in a solvent free environment. Results show that the ceramic causes only modest increase in the lithium transport below 90°C. The objective in the

The study of thermodynamic properties and transport properties of multicomponent systems with chemical reactions

Directory of Open Access Journals (Sweden)

Samujlov E.

2013-04-01

Full Text Available In case of system with chemical reaction the most important properties are heat conductivity and heat capacity. In this work we have considered the equation for estimate the component of these properties caused by chemical reaction and ionization processes. We have evaluated the contribution of this part in heat conductivity and heat capacity too. At the high temperatures contribution in heat conductivity from ionization begins to play an important role. We have created a model, which describe partial and full ionization of gases and gas mixtures. In addition, in this work we present the comparison of our result with experimental data and data from numerical simulation. We was used the data about transport properties of middle composition of Russian coals and the data of thermophysical properties of natural gas for comparison.

Electronic transport properties of 4f shell elements of liquid metal using hard sphere Yukawa system

Science.gov (United States)

Patel, H. P.; Sonvane, Y. A.; Thakor, P. B.

2018-04-01

The electronic transport properties are analyzed for 4f shell elements of liquid metals. To examine the electronic transport properties like electrical resistivity (ρ), thermal conductivity (σ) and thermo electrical power (Q), we used our own parameter free model potential with the Hard Sphere Yukawa (HSY) reference system. The screening effect on aforesaid properties has been examined by using different screening functions like Hartree (H), Taylor (T) and Sarkar (S). The correlations of our resultsand other data with available experimental values are intensely promising. Also, we conclude that our newly constructed parameter free model potential is capable of explaining the above mentioned electronic transport properties.

Theoretical prediction of the electronic transport properties of the Al-Cu alloys based on the first-principle calculation and Boltzmann transport equation

Science.gov (United States)

Choi, Garam; Lee, Won Bo

Metal alloys, especially Al-based, are commonly-used materials for various industrial applications. In this paper, the Al-Cu alloys with varying the Al-Cu ratio were investigated based on the first-principle calculation using density functional theory. And the electronic transport properties of the Al-Cu alloys were carried out using Boltzmann transport theory. From the results, the transport properties decrease with Cu-containing ratio at the temperature from moderate to high, but with non-linearity. It is inferred by various scattering effects from the calculation results with relaxation time approximation. For the Al-Cu alloy system, where it is hard to find the reliable experimental data for various alloys, it supports understanding and expectation for the thermal electrical properties from the theoretical prediction. Theoretical and computational soft matters laboratory.

Hydration effect on the electronic transport properties of oligomeric phenylene ethynylene molecular junctions

International Nuclear Information System (INIS)

Zong-Liang, Li; Huai-Zhi, Li; Yong, Ma; Guang-Ping, Zhang; Chuan-Kui, Wang

2010-01-01

A first-principles computational method based on the hybrid density functional theory is developed to simulate the electronic transport properties of oligomeric phenylene ethynylene molecular junctions with H 2 O molecules accumulated in the vicinity as recently reported by Na et al. [Nanotechnology 18 424001 (2007)]. The numerical results show that the hydrogen bonds between the oxygen atoms of the oligomeric phenylene ethynylene molecule and H 2 O molecules result in the localisation of the molecular orbitals and lead to the lower transition peaks. The H 2 O molecular chains accumulated in the vicinity of the molecular junction can not only change the electronic structure of the molecular junctions, but also open additional electronic transport pathways. The obvious influence of H 2 O molecules on the electronic structure of the molecular junction and its electronic transport properties is thus demonstrated. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Determination of prerequisites for the estimation of transportation cost of spent fuels

International Nuclear Information System (INIS)

Choi, Heui Joo; Lee, Jong Youl; Kim, Seong Ki; Cha, Jeong Hoon; Choi, Jong Won

2007-10-01

The cost for the spent fuel management includes the costs for the interim storage, the transportation, and the permanent disposal of the spent fuels. The scope of this report is limited to the cost for the spent fuel transportation. KAERI is developing a cost estimation method for the spent fuel transportation through a joint study with the French AREVA TN. Several prerequisites should be fixed in order to estimate the cost for the spent fuel transportation properly. In this report we produced them considering the Korean current status on the management of spent fuels. The representative characteristics of a spent fuel generated from the six nuclear reactors at the YG site were determined. Total 7,200 tons of spent fuels are projected with the lifespan of 60 years. As the transportation mode, sea transportation and road transportation is recommended considering the location of the YG site and the hypothetical Centralized Interim Storage Facility (CISF) and Final Repository (FR). The sea route and transportation time were analyzed by using a sea distance analysis program which the NORI (National Oceanographic Research Institute) supplies on a web. Based on the results of the analysis, the shipping rates were determined. The regulations related to the spent fuel transportation were reviewed. The characteristics of the transportation vessel and a trailer were suggested. The handling and transportation systems at the YG site, Centralized Interim Storage Facility, and the Final Repository were described in detail for the purpose of the cost estimation of the spent fuel transportation. From the detail description the major components of the transportation system were determined for the conceptual design. It is believed that the conceptual design of the transportation system developed in this report will be used for the analysis of transportation logistics and the cost estimation of spent fuels

Determining the nature of transported material

International Nuclear Information System (INIS)

Wykes, J.S.; Surzyn, P.M.; Croke, G.M.; Adsley, I.

1980-01-01

An improved method is described of determining the nature of a coal/stone mixture, transported on a conveyor, by measuring the relative transmission of two different energy x-ray beams. Details are given of the collimation, scintillation counters and shielding required to obtain the necessary accuracy to obtain information on the mass and the nature of the material being monitored. Compensation is provided for background radioactivity. (U.K.)

Elastic properties and electron transport in InAs nanowires

Energy Technology Data Exchange (ETDEWEB)

Migunov, Vadim

2013-02-22

The electron transport and elastic properties of InAs nanowires grown by chemical vapor deposition on InAs (001) substrate were studied experimentally, in-situ in a transmission electron microscope (TEM). A TEM holder allowing the measurement of a nanoforce while simultaneous imaging nanowire bending was used. Diffraction images from local areas of the wire were recorded to correlate elastic properties with the atomic structure of the nanowires. Another TEM holder allowing the application of electrical bias between the nanowire and an apex of a metallic needle while simultaneous imaging the nanowire in TEM or performing electron holography was used to detect mechanical vibrations in mechanical study or holographical observation of the nanowire inner potential in the electron transport studies. The combination of the scanning probe methods with TEM allows to correlate the measured electric and elastic properties of the nanowires with direct identification of their atomic structure. It was found that the nanowires have different atomic structures and different stacking fault defect densities that impacts critically on the elastic properties and electric transport. The unique methods, that were applied in this work, allowed to obtain dependencies of resistivity and Young's modulus of left angle 111 right angle -oriented InAs nanowires on defect density and diameter. It was found that the higher is the defect density the higher are the resistivity and the Young's modulus. Regarding the resistivity, it was deduced that the stacking faults increase the scattering of the electrons in the nanowire. These findings are consistent with the literature, however, the effect described by the other groups is not so pronounced. This difference can be attributed to the significant incompleteness of the physical models used for the data analysis. Regarding the elastic modulus, there are several mechanisms affecting the elasticity of the nanowires discussed in the thesis. It

Humidity effects on the electronic transport properties in carbon based nanoscale device

International Nuclear Information System (INIS)

He, Jun; Chen, Ke-Qiu

2012-01-01

By applying nonequilibrium Green's functions in combination with the density functional theory, we investigate the effect of humidity on the electronic transport properties in carbon based nanoscale device. The results show that different humidity may form varied localized potential barrier, which is a very important factor to affect the stability of electronic transport in the nanoscale system. A mechanism for the humidity effect is suggested. -- Highlights: ► Electronic transport in carbon based nanoscale device. ► Humidity affects the stability of electronic transport. ► Different humidity may form varied localized potential barrier.

First-principles-based study of transport properties of Fe thin films on Cu surfaces

Energy Technology Data Exchange (ETDEWEB)

Kishi, Tomoya [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Kasai, Hideaki [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Nakanishi, Hiroshi [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Dino, Wilson Agerico [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Komori, Fumio [Institute for Solid State Physics, University of Tokyo, Kashiwa, Chiba 277-8587 (Japan)

2004-12-08

We investigate the transport properties of Fe thin films on Cu(111) based on first principles calculation. We calculate the electron current through these Fe thin films, which can be observed by using a double-tipped scanning tunnelling microscope. We find that the conductance is majority spin polarized. On the basis of the band structures for this system, we discuss the origin of these interesting transport properties.

First-principles-based study of transport properties of Fe thin films on Cu surfaces

International Nuclear Information System (INIS)

Kishi, Tomoya; Kasai, Hideaki; Nakanishi, Hiroshi; Dino, Wilson Agerico; Komori, Fumio

2004-01-01

We investigate the transport properties of Fe thin films on Cu(111) based on first principles calculation. We calculate the electron current through these Fe thin films, which can be observed by using a double-tipped scanning tunnelling microscope. We find that the conductance is majority spin polarized. On the basis of the band structures for this system, we discuss the origin of these interesting transport properties

High-pressure transport properties of CrB{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Regnat, Alexander; Becker, Julian; Spallek, Jan; Bauer, Andreas; Chacon, Alfonso; Ritz, Robert; Pfleiderer, Christian [Physik-Department, Technische Universitaet Muenchen, D-85748 Garching (Germany); Blum, Christian; Wurmehl, Sabine [Leibniz Institute for Solid State and Materials Research IFW, D-01171 Dresden (Germany)

2015-07-01

High quality single crystals of the itinerant antiferromagnet CrB{sub 2}, T{sub N} = 88 K, were grown by means of optical float zoning. Bulk, transport and de Haas-van Alphen measurements were carried out. Here, we present a comprehensive study of the high-pressure transport properties. Samples were investigated under hydrostatic, uniaxial and quasi-hydrostatic conditions. As a result we are able to attribute contradictory reports for the pressure dependence of T{sub N} to uniaxial strain. Perhaps most interestingly, we find a pronounced low temperature resistivity anomaly around 3 GPa in the quasi-hydrostatic case.

Evaluating the hydraulic and transport properties of peat soil using pore network modeling and X-ray micro computed tomography

Science.gov (United States)

Gharedaghloo, Behrad; Price, Jonathan S.; Rezanezhad, Fereidoun; Quinton, William L.

2018-06-01

Micro-scale properties of peat pore space and their influence on hydraulic and transport properties of peat soils have been given little attention so far. Characterizing the variation of these properties in a peat profile can increase our knowledge on the processes controlling contaminant transport through peatlands. As opposed to the common macro-scale (or bulk) representation of groundwater flow and transport processes, a pore network model (PNM) simulates flow and transport processes within individual pores. Here, a pore network modeling code capable of simulating advective and diffusive transport processes through a 3D unstructured pore network was developed; its predictive performance was evaluated by comparing its results to empirical values and to the results of computational fluid dynamics (CFD) simulations. This is the first time that peat pore networks have been extracted from X-ray micro-computed tomography (μCT) images of peat deposits and peat pore characteristics evaluated in a 3D approach. Water flow and solute transport were modeled in the unstructured pore networks mapped directly from μCT images. The modeling results were processed to determine the bulk properties of peat deposits. Results portray the commonly observed decrease in hydraulic conductivity with depth, which was attributed to the reduction of pore radius and increase in pore tortuosity. The increase in pore tortuosity with depth was associated with more decomposed peat soil and decreasing pore coordination number with depth, which extended the flow path of fluid particles. Results also revealed that hydraulic conductivity is isotropic locally, but becomes anisotropic after upscaling to core-scale; this suggests the anisotropy of peat hydraulic conductivity observed in core-scale and field-scale is due to the strong heterogeneity in the vertical dimension that is imposed by the layered structure of peat soils. Transport simulations revealed that for a given solute, the effective

Magneto-transport properties of a random distribution of few-layer graphene patches

International Nuclear Information System (INIS)

Iacovella, Fabrice; Mitioglu, Anatolie; Pierre, Mathieu; Raquet, Bertrand; Goiran, Michel; Plochocka, Paulina; Escoffier, Walter; Trinsoutrot, Pierre; Vergnes, Hugues; Caussat, Brigitte; Conédéra, Véronique

2014-01-01

In this study, we address the electronic properties of conducting films constituted of an array of randomly distributed few layer graphene patches and investigate on their most salient galvanometric features in the moderate and extreme disordered limit. We demonstrate that, in annealed devices, the ambipolar behaviour and the onset of Landau level quantization in high magnetic field constitute robust hallmarks of few-layer graphene films. In the strong disorder limit, however, the magneto-transport properties are best described by a variable-range hopping behaviour. A large negative magneto-conductance is observed at the charge neutrality point, in consistency with localized transport regime

Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

International Nuclear Information System (INIS)

Bierwagen, O.

2007-01-01

Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

Energy Technology Data Exchange (ETDEWEB)

Bierwagen, O.

2007-12-20

Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the <110> directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

Elastic and transport properties in polycrystals of crackedgrains: Cross-property relations and microstructure

Energy Technology Data Exchange (ETDEWEB)

Berryman, J.G.

2007-10-02

Some arguments of Bristow (1960) concerning the effects of cracks on elastic and transport (i.e., electrical or thermal conduction) properties of cold-worked metals are reexamined. The discussion is posed in terms of a modern understanding of bounds and estimates for physical properties of polycrystals--in contrast to Bristow's approach using simple mixture theory. One type of specialized result emphasized here is the cross-property estimates and bounds that can be obtained using the methods presented. Our results ultimately agree with those of Bristow, i.e., confirming that microcracking is not likely to be the main cause of the observed elastic behavior of cold-worked metals. However, it also becomes clear that the mixture theory approach to the analysis is too simple and that crack-crack interactions are necessary for proper quantitative study of Bristow's problem.

Dc-transport properties of ferromagnetic (Ga,Mn)As semiconductors

Czech Academy of Sciences Publication Activity Database

Jungwirth, Tomáš; Sinova, J.; Wang, K. Y.; Edmonds, K. W.; Campion, R. P.; Gallagher, B. L.; Foxon, C. T.; Niu, Q.; MacDonald, A. H.

2003-01-01

Roč. 83, č. 2 (2003), s. 320-322 ISSN 0003-6951 R&D Projects: GA ČR GA202/02/0912 Institutional research plan: CEZ:AV0Z1010914 Keywords : ferromagnetic semiconductors * dc transport properties * (Ga, Mn)As Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.049, year: 2003

DETERMINATION AND ANALYSIS OF CHANGE POWER CHARACTER AND POWER PARAMETERS OF EARTHMOVING- TRANSPORT WORKING PROCESS MACHINES OF CYCLIC ACTION

Directory of Open Access Journals (Sweden)

KHMARA L. A.

2017-05-01

Full Text Available Summary. Raising of problem. Efficiency of implementation working process an earthmoving-transport machine on digging of soil depends on complete realization of power equipment and hauling properties working equipment during implementation this operation. Most effective will be the mode of digging when from his beginning to the final stage a power equipment will realize nominal power, and working equipment maximal KKD at that skidding of mover does not exceed the defined possible value. However, for the traditional constructions of earthmoving-transport machines cyclic action, for such, as a drag shovel, bulldozer, realizing these terms is heavy. The feature of process digging consists in the increase of resistance to digging soil from the ego of the initial stage to eventual when hauling possibilities of machine will be maximally realized. Therefore the calculation of power equipment takes into account the power indexes of machine on the final stage of digging. Thus the unstationarity of working process results in the under exploitation of power equipment machine and hereupon appearance her bits and pieces. The size of bits and pieces power depends on the stage digging of soil, his physical and mechanical properties, terms cooperation of working equipment with the surface of motion. One of methods realization surplus power, this use it for the drive intensifiers working process of earthmoving-transport machines. Therefore for the effective choice parameters of intensifier, his office hours it is necessary to know the size of bits and pieces of power and character her change during digging of soil. The purpose of the article. Development of methodology determination remaining power equipment an earthmoving-transport machine on the example self-propelled drags hovel, character her change at digging of soil taking into account physical and mechanical properties of soil and terms cooperation working equipment with the surface of motion. Conclusion

D2O, Computation of Thermodynamic and Transport Properties of Heavy Water

International Nuclear Information System (INIS)

Durmayaz, Ahmet

2000-01-01

1 - Description of program or function: A computer program for the fast computation of the thermodynamic and transport properties of heavy water (D 2 O) at saturation, in subcooled liquid and superheated vapor states. Specific volume (or density), specific enthalpy, specific entropy, constant-pressure specific heat and temperature at saturation are calculated by a number of piecewise continuous approximation functions of (and their derivatives are calculated with respect to) pressure whereas pressure at saturation is calculated by a piecewise continuous approximation function of temperature for heavy water. Density in subcooled liquid state, specific volume in super-heated vapor state, specific enthalpy, specific entropy and constant-pressure specific heat in both of these states are calculated by some piecewise continuous approximation functions of pressure and temperature for heavy water. The correlations used in the calculation of these thermodynamic properties of heavy water were derived by fitting some appropriate curves to the data given in the steam tables by Hill et al (1981). The whole set of correlations and the approximation method used in their derivation are presented by Durmayaz (1997). Dynamic viscosity and thermal conductivity for heavy water are calculated as functions of temperature and density with the correlations given by Hill et al (1981), by Matsunaga and Nagashima (1983) and by Kestin et al (1984). Surface tension for heavy water is calculated as a function of temperature with the correlation given by Crabtree and Siman-Tov (1993). 2 - Methods: A group of pressure-enthalpy (P-h) pairs can be given in an input data file or assigned in the main program without knowing the state in which fluid takes place. In this case, first, the enthalpies at saturation corresponding to the given pressure are computed. Second, the state is determined by comparing the given enthalpy to the saturation enthalpies. Then, the properties are computed. Program D 2 O

Which key properties controls the preferential transport in the vadose zone under transient hydrological conditions

Science.gov (United States)

Groh, J.; Vanderborght, J.; Puetz, T.; Gerke, H. H.; Rupp, H.; Wollschlaeger, U.; Stumpp, C.; Priesack, E.; Vereecken, H.

2015-12-01

Understanding water flow and solute transport in the unsaturated zone is of great importance for an appropriate land use management strategy. The quantification and prediction of water and solute fluxes through the vadose zone can help to improve management practices in order to limit potential risk on our fresh water resources. Water related solute transport and residence time is strongly affected by preferential flow paths in the soil. Water flow in soils depends on soil properties and site factors (climate or experiment conditions, land use) and are therefore important factors to understand preferential solute transport in the unsaturated zone. However our understanding and knowledge of which on-site properties or conditions define and enhance preferential flow and transport is still poor and mostly limited onto laboratory experimental conditions (small column length and steady state boundary conditions). Within the TERENO SOILCan lysimeter network, which was designed to study the effects of climate change on soil functions, a bromide tracer was applied on 62 lysimeter at eight different test sites between Dec. 2013 and Jan. 2014. The TERENO SOILCan infrastructure offers the unique possibility to study the occurrence of preferential flow and transport of various soil types under different natural transient hydrological conditions and land use (crop, bare and grassland) at eight TERENO SOILCan observatories. Working with lysimeter replicates at each observatory allows defining the spatial variability of preferential transport and flow. Additionally lysimeters in the network were transferred within and between observatories in order to subject them to different rainfall and temperature regimes and enable us to relate the soil type susceptibility of preferential flow and transport not only to site specific physical and land use properties, but also to different transient boundary conditions. Comparison and statistical analysis between preferential flow indicators 5

MASS TRANSPORT PROPERTIES OF A FLOW-THROUGH ELECTROLYTIC REACTOR USING A POROUS ELECTRODE: PERFORMANCE AND FIGURES OF MERIT FOR Pb(II REMOVAL

Directory of Open Access Journals (Sweden)

Bertazzoli R.

1998-01-01

Full Text Available The removal of lead from an acid borate-nitrate solution containing Pb(II was used to characterize the mass transport properties of an electrolytic reactor with reticulated vitreous carbon cathodes, operated in the flow-through mode. Current potential curves recorded at a rotating vitreous carbon disc electrode were used to determine the diffusion coefficient for Pb(II under the conditions of the experiments. The performance and figures of merit of the electrolytic reactor were investigated by using different flowrates and cathode porosities. Dimensionless Sherwood and Reynolds numbers were correlated to characterize the mass transport properties of the reactor, and they were fitted to the equation Sh=24Re0.32Sc0.33.

Electronic transport properties of phenylacetylene molecular junctions

International Nuclear Information System (INIS)

Liu Wen; Cheng Jie; Yan Cui-Xia; Li Hai-Hong; Wang Yong-Juan; Liu De-Sheng

2011-01-01

Electronic transport properties of a kind of phenylacetylene compound— (4-mercaptophenyl)-phenylacetylene are calculated by the first-principles method in the framework of density functional theory and the nonequilibrium Green's function formalism. The molecular junction shows an obvious rectifying behaviour at a bias voltage larger than 1.0 V. The rectification effect is attributed to the asymmetry of the interface contacts. Moreover, at a bias voltage larger than 2.0 V, which is not referred to in a relevant experiment [Fang L, Park J Y, Ma H, Jen A K Y and Salmeron M 2007 Langmuir 23 11522], we find a negative differential resistance phenomenon. The negative differential resistance effect may originate from the change of the delocalization degree of the molecular orbitals induced by the bias. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

78 FR 9451 - Academy Express, L.L.C.-Acquisition of Property-Golden Ring Travel & Transportation, Inc.

Science.gov (United States)

2013-02-08

..., L.L.C.--Acquisition of Property--Golden Ring Travel & Transportation, Inc. AGENCY: Surface... authority under 49 U.S.C. 14303 to acquire the property of Golden Ring Travel & Transportation, Inc. (Golden... approximately 400 motor coaches and more than 500 drivers. Academy is indirectly controlled by the Tedesco...

Transport properties of electrons in fractal magnetic-barrier structures

Science.gov (United States)

Sun, Lifeng; Fang, Chao; Guo, Yong

2010-09-01

Quantum transport properties in fractal magnetically modulated structures are studied by the transfer-matrix method. It is found that the transmission spectra depend sensitively not only on the incident energy and the direction of the wave vector but also on the stage of the fractal structures. Resonance splitting, enhancement, and position shift of the resonance peaks under different magnetic modulation are observed at four different fractal stages, and the relationship between the conductance in the fractal structure and magnetic modulation is also revealed. The results indicate the spectra of the transmission can be considered as fingerprints for the fractal structures, which show the subtle correspondence between magnetic structures and transport behaviors.

Transport properties through graphene grain boundaries: strain effects versus lattice symmetry

Science.gov (United States)

Hung Nguyen, V.; Hoang, Trinh X.; Dollfus, P.; Charlier, J.-C.

2016-06-01

As most materials available at the macroscopic scale, graphene samples usually appear in a polycrystalline form and thus contain grain boundaries. In the present work, the effect of uniaxial strain on the electronic transport properties through graphene grain boundaries is investigated using atomistic simulations. A systematic picture of transport properties with respect to the strain and lattice symmetry of graphene domains on both sides of the boundary is provided. In particular, it is shown that strain engineering can be used to open a finite transport gap in all graphene systems where the two domains are arranged in different orientations. This gap value is found to depend on the strain magnitude, on the strain direction and on the lattice symmetry of graphene domains. By choosing appropriately the strain direction, a large transport gap of a few hundred meV can be achieved when applying a small strain of only a few percents. For a specific class of graphene grain boundary systems, strain engineering can also be used to reduce the scattering on defects and thus to significantly enhance the conductance. With a large strain-induced gap, these graphene heterostructures are proposed to be promising candidates for highly sensitive strain sensors, flexible electronic devices and p-n junctions with non-linear I-V characteristics.

Thermoelectric transport properties of BaBiTe{sub 3}-based materials

Energy Technology Data Exchange (ETDEWEB)

Zhou, Yiming; Zhao, Li-Dong, E-mail: zhaolidong@buaa.edu.cn

2017-05-15

BaBiTe{sub 3}, a material with low thermal conductivity, is an inferior thermoelectric material due to the poor electrical properties originated from its narrow band gap. We choose two types of dopants, K and La, trying to optimize its electrical transport properties. The minority carriers, which harm the Seebeck coefficient in this system, are suppressed by La doping. With the increase of both electrical conductivity and Seebeck coefficient, the power factor of 3% La doped BaBiTe{sub 3} reaches 3.7 μW cm{sup −1} K{sup −2} which increased by 40% from undoped BaBiTe{sub 3}. Besides high power factor, the thermal conductivity is also reduced in it. Eventually, a high ZT value, 0.25 at 473 K, for n-type BaBiTe{sub 3} is achieved in 3% La doped BaBiTe{sub 3}. - Graphical abstract: BaBiTe{sub 3} possesses a low thermal conductivity. However, it is an inferior thermoelectric material due to the poor electrical properties originated from its narrow band gap. A high ZT value of 0.25 at 473 K for n-type BaBiTe{sub 3} can be achieved through optimizing electrical transport properties via La doping. - Highlights: • BaBiTe{sub 3} is an analogue of these promising thermoelectric materials: such as CsBi{sub 4}Te{sub 6} and K{sub 2}Bi{sub 8}Se{sub 13}, etc. • BaBiTe{sub 3} possesses a low thermal conductivity. • La is an effective dopant to enhance electrical transport properties. • A high ZT value of 0.25 at 473 K can be achieved in n-type La-doped BaBiTe{sub 3}.

Magnetic and transport properties of Co–Cu microwires with granular structure

Energy Technology Data Exchange (ETDEWEB)

Zhukova, V., E-mail: valentina.zhukova@ehu.es [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); Garcia, C. [Bogazici Univ., Dept Phys, TR-34342 Istanbul (Turkey); Departamento de Fisica, Universidad Técnica Federico Santa María, P.O. Box 110-V, Valparaiso (Chile); Val, J.J. del; Ilyn, M. [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); Granovsky, A. [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); Moscow State University, Moscow, Phys. Faculty, 119991 (Russian Federation); Zhukov, A. [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); IKERBASQUE, Basque Foundation for Science, 48011 Bilbao (Spain)

2013-09-30

Magnetic, transport and structural properties of granular Co{sub x}–Cu{sub 100−x} (5 < x < 40 at.%) glass-coated microwires were studied. Co–Cu microwires exhibited giant magnetoresistance (GMR) effect. For x = 5% we observed the resistivity minimum at 40 K associated with the Kondo effect. For x > 10 partial evidences of granular structure have been observed. For x ≥ 30 anisotropic contribution to GMR has been observed giving rise to non-monotonic dependence of GMR on the field. Temperature dependence of magnetization measured during a cooling regime without external magnetic field and in the presence of the field shows considerable difference at low temperatures, being attributed to the presence of small Co grains embedded in the Cu matrix. By X-ray diffraction we found, that the structure of the metallic nucleus is granular consisting of two phases: fcc Cu appearing in all the samples and fcc α-Co presented only in microwires with higher Co content. For low Co content (x ≤ 10%) X-ray diffraction technique indicates that Co atoms are distributed within the Cu crystals. The quantity and the crystallite size of the formed phases strongly depend on the geometry of the microwire. The structure, magnetic and transport properties were affected by the glass coating inducing the internal stresses and affecting the quenching rate. - Highlights: ► Systematic study of magnetic and transport properties of Co-Cu microwires. ► Observation of Giant Magnetoresistance effect in Co{sub x}Cu100{sub −x} microwires. ► Observation of Kondo-like behavior in Co{sub x}Cu100{sub −x} at lower Co content (5%). ► Discussions of the effect of internal stresses on the properties of Co-Cu microwires. ► Discussion of the effect of composition on the properties of Co-Cu microwires.

Transport characteristics of n-ZnO/p-Si heterojunction as determined from temperature dependent current–voltage measurements

Energy Technology Data Exchange (ETDEWEB)

Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.

2016-01-01

Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.

Transport properties of magnetic atom bridges controlled by a scanning tunneling microscope

International Nuclear Information System (INIS)

Nakanishi, H.; Kishi, T.; Kasai, H.; Komori, F.; Okiji, A.

2003-01-01

We have investigated the transport and magnetic properties of the atom bridge made from magnetic materials, which is the atom-scale wire constructed between a scanning tunneling microscope (STM) tip and a solid surface, by the use of ab initio calculations. In the case of the twisted ladder structure atom bridge made of Fe, we have found that the magnetic state of the bridge changes from ferromagnetic to paramagnetic, as we compress the bridge in length. We report the spin dependent quantized conductance of the bridge. And we discuss the origin of a change in transport properties as we compress the bridge in length

Computer program for calculation of complex chemical equilibrium compositions and applications. Supplement 1: Transport properties

Science.gov (United States)

Gordon, S.; Mcbride, B.; Zeleznik, F. J.

1984-01-01

An addition to the computer program of NASA SP-273 is given that permits transport property calculations for the gaseous phase. Approximate mixture formulas are used to obtain viscosity and frozen thermal conductivity. Reaction thermal conductivity is obtained by the same method as in NASA TN D-7056. Transport properties for 154 gaseous species were selected for use with the program.

Effect of Fast Neutron Irradiation on Current Transport Properties of HTS Materials

CERN Document Server

Ballarino, A; Kruglov, V S; Latushkin, S T; Lubimov, A N; Ryazanov, A I; Shavkin, S V; Taylor, T M; Volkov, P V

2004-01-01

The effect of fast neutron irradiation with energy up to 35 MeV and integrated fluence of up to 5 x 10**15 cm-2 on the current transport properties of HTS materials Bi-2212 and Bi-2223 has been studied, both at liquid nitrogen and at room temperatures. The samples irradiated were selected after verification of the stability of their superconducting properties after temperature cycling in the range of 77 K - 293 K. It has been found that the irradiation by fast neutrons up to the above dose does not produce a significant degradation of critical current. The effect of room temperature annealing on the recovery of transport properties of the irradiated samples is also reported, as is a preliminary microstructure investigation of the effect of irradiation on the soldered contacts.

Transport properties of the topological Kondo insulator SmB6 under the irradiation of light

International Nuclear Information System (INIS)

Zhu Guo-Bao; Yang Hui-Min

2016-01-01

In this paper, we study transport properties of the X point in the Brillouin zone of the topological Kondo insulator SmB 6 under the application of a circularly polarized light. The transport properties at high-frequency regime and low-frequency regime as a function of the ratio ( κ ) of the Dresselhaus-like and Rashba-like spin–orbit parameter are studied based on the Floquet theory and Boltzmann equation respectively. The sign of Hall conductivity at high-frequency regime can be reversed by the ratio κ and the amplitude of the light. The amplitude of the current can be enhanced by the ratio κ . Our findings provide a way to control the transport properties of the Dirac materials at low-frequency regime. (paper)

A review of reaction rates and thermodynamic and transport properties for an 11-species air model for chemical and thermal nonequilibrium calculations to 30000 K

Science.gov (United States)

Gupta, Roop N.; Yos, Jerrold M.; Thompson, Richard A.; Lee, Kam-Pui

1990-01-01

Reaction rate coefficients and thermodynamic and transport properties are reviewed and supplemented for the 11-species air model which can be used for analyzing flows in chemical and thermal nonequilibrium up to temperatures of 3000 K. Such flows will likely occur around currently planned and future hypersonic vehicles. Guidelines for determining the state of the surrounding environment are provided. Curve fits are given for the various species properties for their efficient computation in flowfield codes. Approximate and more exact formulas are provided for computing the properties of partially ionized air mixtures in a high energy environment. Limitations of the approximate mixing laws are discussed for a mixture of ionized species. An electron number-density correction for the transport properties of the charged species is obtained. This correction has been generally ignored in the literature.

Mathematical foundations of transport theory

International Nuclear Information System (INIS)

Ershov, Yu.I.; Shikhov, S.B.

1985-01-01

Foundations of mathematical transport theory are presented. Definitions and theorems of functional analysis are given. Linear kinetic equation of neutron transport in multiplication media is derived. A model of neutron interaction with nuclei of medium determining completely the coefficient properties in transport equation is described. Non-stationary problems regarding and without regard of d=e layed neutrons are analyzed. Results of solving Cauchy problem are discussed

The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.

Science.gov (United States)

Experton, Juliette; Martin, Charles R

2018-05-01

Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Thermodynamic and transport properties of liquid gallium

International Nuclear Information System (INIS)

Park, H.Y.; Jhon, M.S.

1982-01-01

The significant structure theory of liquids has been successfully applied to liquid gallium. In this work, we have assumed that two structures exist simultaneously in liquid gallium. One is considerec as loosely close packed β-Ga-like structure and the other is remainder of solid α-Ga or α-Ga-like structure. This two structural model is introduced to construct the liquid partition function. Using the partition function, the thermodynamic and transport properties are calculated ever a wide temperature range. The calculated results are quite satisfactory when compared with the experimental results. (Author)

Flow and transport in unsaturated fractured rock: Effects of multiscale heterogeneity of hydrogeologic properties

International Nuclear Information System (INIS)

Zhou, Quanlin; Liu, Hui-Hai; Bodvarsson, Gudmundur S.; Oldenburg, Curtis M.

2002-01-01

The heterogeneity of hydrogeologic properties at different scales may have different effects on flow and transport processes in a subsurface system. A model for the unsaturated zone of Yucca Mountain, Nevada, is developed to represent complex heterogeneity at two different scales: (1) layer scale corresponding to geologic layering and (2) local scale. The layer-scale hydrogeologic properties are obtained using inverse modeling, based on the available measurements collected from the Yucca Mountain site. Calibration results show a significant lateral and vertical variability in matrix and fracture properties. Hydrogeologic property distributions in a two-dimensional, vertical cross section of the site are generated by combining the average layer-scale matrix and fracture properties with local-scale perturbations generated using a stochastic simulation method. The unsaturated water flow and conservative (nonsorbing) tracer transport through the cross section are simulated for different sets of matrix and fracture property fields. Comparison of simulation results indicates that the local-scale heterogeneity of matrix and fracture properties has a considerable effect on unsaturated flow processes, leading to fast flow paths in fractures and the matrix. These paths shorten the travel time of a conservative tracer from the source (repository) horizon in the unsaturated zone to the water table for small fractions of total released tracer mass. As a result, the local-scale heterogeneity also has a noticeable effect on global tracer transport processes, characterized by an average breakthrough curve at the water table, especially at the early arrival time of tracer mass. However, the effect is not significant at the later time after 20 percent tracer mass reaches the water table. The simulation results also verify that matrix diffusion plays an important role in overall solute transport processes in the unsaturated zone at Yucca Mountain

Effective interactions, transport properties, and elementary excitations in helium three-helium four mixtures

International Nuclear Information System (INIS)

Hsu, W.

1984-01-01

A unified theory of effective interaction, elementary excitations, transport properties, and possible superfluidity of 3 He- 4 He mixtures was developed. The basic approach is patterned after that of Aldrich and Pines (AP) for pure 4 He and 3 He, in which the consequence of the strong interactions in 3 He and 4 He is described in terms of self-consistent fields. The strength of these fields are determined by physical arguments, static measurement, and sum rule considerations. A set of pseudopotentials was developed to describe the 3 He- 3 He and 3 He- 4 He interactions. In the long wavelength and zero concentration limit, these potentials are obtained by the thermodynamic argument of Bardeen, Baym, and Pines. At finite concentration and finite momentum transfer, these potentials are obtained with the aids of a scaling law and the AP pseudopotential theory. From these pseudopotentials, the scattering amplitudes, transport coefficients, and normal-superfluid transition temperature are calculated as functions of 3 He concentration. Good agreement is obtained between theory and experiment for low temperature transport coefficients, and the 3 He superfluid transition temperature is predicted to be approx. -80 K. The change in the density fluctuation excitation spectrum of 4 He atoms in 3 He- 4 He mixtures is calculated

Electronic structure and quantum transport properties of metallic and semiconducting nanowires

Science.gov (United States)

Simbeck, Adam J.

The future of the semiconductor industry hinges upon new developments to combat the scaling issues that currently afflict two main chip components: transistors and interconnects. For transistors this means investigating suitable materials to replace silicon for both the insulating gate and the semiconducting channel in order to maintain device performance with decreasing size. For interconnects this equates to overcoming the challenges associated with copper when the wire dimensions approach the confinement limit, as well as continuing to develop low-k dielectric materials that can assure minimal cross-talk between lines. In addition, such challenges make it increasingly clear that device design must move from a top-down to a bottom-up approach in which the desired electronic characteristics are tailored from first-principles. It is with such fundamental hurdles in mind that ab initio calculations on the electronic and quantum transport properties of nanoscale metallic and semiconducting wires have been performed. More specifically, this study seeks to elaborate on the role played by confinement, contacts, dielectric environment, edge decoration, and defects in altering the electronic and transport characteristics of such systems. As experiments continue to achieve better control over the synthesis and design of nanowires, these results are expected to become increasingly more important for not only the interpretation of electronic and transport trends, but also in engineering the electronic structure of nanowires for the needs of the devices of the future. For the metallic atomic wires, the quantum transport properties are first investigated by considering finite, single-atom chains of aluminum, copper, gold, and silver sandwiched between gold contacts. Non-equilibrium Green's function based transport calculations reveal that even in the presence of the contact the conductivity of atomic-scale aluminum is greater than that of the other metals considered. This is

Response matrix method for neutron transport in reactor lattices using group symmetry properties

International Nuclear Information System (INIS)

Mund, E.H.

1991-01-01

This paper describes a response matrix method for the approximate solution of one-velocity, multi-dimensional transport problems in reactor lattices, with isotropic neutron scattering. The transport equation is solved on a homogeneous cell by using a Petrov-Galerkin technique based on a set of trial and test functions (including polynomials and exponential functions) closely related to transport problems in infinite media. The number of non-zero elements of the response matrices reduces to a minimum when the symmetry properties of the cell are included ab initio in the span of the basis functions. To include these properties, use is made of projection operations which are performed very efficiently on symbolic manipulation programs. Numerical results of model problems in square geometry show a good agreement with reference solutions

Synthesis, transport and dielectric properties of polyaniline/Co3O4 ...

Indian Academy of Sciences (India)

TECS

Synthesis, transport and dielectric properties of polyaniline/Co3O4 composites ... Initial increment in conductivity is due to extended chain length of polyaniline where polarons possess .... Figure 3 displays the scanning electron micrograph of.

Multi-length scale tomography for the determination and optimization of the effective microstructural properties in novel hierarchical solid oxide fuel cell anodes

Science.gov (United States)

Lu, Xuekun; Taiwo, Oluwadamilola O.; Bertei, Antonio; Li, Tao; Li, Kang; Brett, Dan J. L.; Shearing, Paul R.

2017-11-01

Effective microstructural properties are critical in determining the electrochemical performance of solid oxide fuel cells (SOFCs), particularly when operating at high current densities. A novel tubular SOFC anode with a hierarchical microstructure, composed of self-organized micro-channels and sponge-like regions, has been fabricated by a phase inversion technique to mitigate concentration losses. However, since pore sizes span over two orders of magnitude, the determination of the effective transport parameters using image-based techniques remains challenging. Pioneering steps are made in this study to characterize and optimize the microstructure by coupling multi-length scale 3D tomography and modeling. The results conclusively show that embedding finger-like micro-channels into the tubular anode can improve the mass transport by 250% and the permeability by 2-3 orders of magnitude. Our parametric study shows that increasing the porosity in the spongy layer beyond 10% enhances the effective transport parameters of the spongy layer at an exponential rate, but linearly for the full anode. For the first time, local and global mass transport properties are correlated to the microstructure, which is of wide interest for rationalizing the design optimization of SOFC electrodes and more generally for hierarchical materials in batteries and membranes.

Statistical properties of turbulent transport and fluctuations in tokamak and stellarator devices

Energy Technology Data Exchange (ETDEWEB)

Hidalgo, C; Pedrosa, M A; Milligen, B Van; Sanchez, E; Balbin, R; Garcia-Cortes, I [Euratom-CIEMAT Association, Madrid (Spain); Bleuel, J; Giannone, L.; Niedermeyer, H [Euratom-IPP Association, Garching (Germany)

1997-05-01

The statistical properties of fluctuations and turbulent transport have been studied in the plasma boundary region of stellarator (TJ-IU, W7-AS) and tokamak (TJ-I) devices. The local flux probability distribution function shows the bursty character of the flux and presents a systematic change as a function of the radial location. There exist large amplitude transport bursts that account for a significant part of the total flux. There is a strong similarity between the statistical properties of the turbulent fluxes in different devices. The value of the radial coherence associated with fluctuations and turbulent transport is strongly intermittent. This result emphasizes the importance of measurements with time resolution in understanding the interplay between the edge and the core regions in the plasma. For measurements in the plasma edge region of the TJ-IU torsatron, the turbulent flux does not, in general, show a larger radial coherence than the one associated with the fluctuations. (author). 14 refs, 6 figs.

The Determination of Some Mechanical Properties of Scheffe's ...

African Journals Online (AJOL)

The work determined some mechanical properties of fresh and matured concrete. These properties include Slump, Compressive Strength, Static modulus of elasticity and Modulus of rigidity. It applied Scheffe's optimization theory to determine the ratio of the combined constituents of the concrete mix. The results showed that ...

Structural and robustness properties of smart-city transportation networks

International Nuclear Information System (INIS)

Zhang Zhen-Gang; Ding Zhuo; Fan Jing-Fang; Chen Xiao-Song; Meng Jun; Ye Fang-Fu; Ding Yi-Min

2015-01-01

The concept of smart city gives an excellent resolution to construct and develop modern cities, and also demands infrastructure construction. How to build a safe, stable, and highly efficient public transportation system becomes an important topic in the process of city construction. In this work, we study the structural and robustness properties of transportation networks and their sub-networks. We introduce a complementary network model to study the relevance and complementarity between bus network and subway network. Our numerical results show that the mutual supplement of networks can improve the network robustness. This conclusion provides a theoretical basis for the construction of public traffic networks, and it also supports reasonable operation of managing smart cities. (rapid communication)

Electron transport properties of indium oxide - indium nitride metal-oxide-semiconductor heterostructures

International Nuclear Information System (INIS)

Wang, C.Y.; Hauguth, S.; Polyakov, V.; Schwierz, F.; Cimalla, V.; Kups, T.; Himmerlich, M.; Schaefer, J.A.; Krischok, S.; Ambacher, O.; Morales, F.M.; Lozano, J.G.; Gonzalez, D.; Lebedev, V.

2008-01-01

The structural, chemical and electron transport properties of In 2 O 3 /InN heterostructures and oxidized InN epilayers are reported. It is shown that the accumulation of electrons at the InN surface can be manipulated by the formation of a thin surface oxide layer. The epitaxial In 2 O 3 /InN heterojunctions show an increase in the electron concentration due to the increasing band banding at the heterointerface. The oxidation of InN results in improved transport properties and in a reduction of the sheet carrier concentration of the InN epilayer very likely caused by a passivation of surface donors. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Transport properties in monolayer-bilayer-monolayer graphene planar junctions

Institute of Scientific and Technical Information of China (English)

Kai-Long Chu; Zi-Bo Wang; Jiao-Jiao Zhou; Hua Jiang

2017-01-01

The transport study of graphene based junctions has become one of the focuses in graphene research.There are two stacking configurations for monolayer-bilayer-monolayer graphene planar junctions.One is the two monolayer graphene contacting the same side of the bilayer graphene,and the other is the two-monolayer graphene contacting the different layers of the bilayer graphene.In this paper,according to the Landauer-Büttiker formula,we study the transport properties of these two configurations.The influences of the local gate potential in each part,the bias potential in bilayer graphene,the disorder and external magnetic field on conductance are obtained.We find the conductances of the two configurations can be manipulated by all of these effects.Especially,one can distinguish the two stacking configurations by introducing the bias potential into the bilayer graphene.The strong disorder and the external magnetic field will make the two stacking configurations indistinguishable in the transport experiment.

Studies on transport properties of copper doped tungsten diselenide single crystals

Science.gov (United States)

Deshpande, M. P.; Parmar, M. N.; Pandya, Nilesh N.; Chaki, Sunil; Bhatt, Sandip V.

2012-02-01

During recent years, transition metal dichalcogenides of groups IVB, VB and VIB have received considerable attention because of the great diversity in their transport properties. 2H-WSe 2 (Tungsten diselenide) is an interesting member of the transition metal dichalcogenide (TMDC's) family and known to be a semiconductor useful for photovoltaic and optoelectronic applications. The anisotropy usually observed in this diamagnetic semiconductor material is a result of the sandwich structure of Se-W-Se layers interacting with each other, loosely bonded by the weak Van der Waals forces. Recent efforts in studying the influence of the anisotropic electrical and optical properties of this layered-type transition metal dichalcogenides have been implemented by doping the samples with different alkali group elements. Unfortunately, little work is reported on doping of metals in WSe 2. Therefore, it is proposed in this work to carry out a systematic growth of single crystals of WSe 2 by doping it with copper in different proportions i.e. Cu xWSe 2 ( x=0, 0.5, 1.0) by direct vapour transport technique. Transport properties like low and high temperature resistivity measurements, high pressure resistivity, Seebeck coefficient measurements at low temperature and Hall Effect at room temperature were studied in detail on all these samples. These measurements show that tungsten diselenide single crystals are p-type whereas doped with copper makes it n-type in nature. The results obtained and their implications are discussed in this paper.

Tuning the Transport Properties of Layered Materials for Thermoelectric Applications using First-Principles Calculations

KAUST Repository

Saeed, Yasir

2014-05-11

Thermoelectric materials can convert waste heat into electric power and thus provide a way to reduce the dependence on fossil fuels. Our aim is to model the underlying materials properties and, in particular, the transport as controlled by electrons and lattice vibrations. The goal is to develop an understanding of the thermoelectric properties of selected materials at a fundamental level. The structural, electronic, optical, and phononic properties are studied in order to tune the transport, focusing on KxRhO2, NaxRhO2, PtSb2 and Bi2Se3. The investigations are based on density functional theory as implemented in the all electron linearized augmented plane wave plus local orbitals WIEN2k and pseudo potential Quantum-ESPRESSO codes. The thermoelectric properties are derived from Boltzmann transport theory under the constant relaxation time approximation, using the BoltzTraP code. We will discuss first the changes in the electronic band structure under variation of the cation concentration in layered KxRhO2 in the 2H phase and NaxRhO2 in the 3R phase. We will also study the hydrated phase. The deformations of the RhO6 octahedra turn out to govern the thermoelectric properties, where the high Seebeck coefficient results from ”pudding mold" bands. We investigate the thermoelectric properties of electron and hole doped PtSb2, which is not a layered material but shares “pudding mold" bands. PtSb2 has a high Seebeck coefficient at room temperature, which increases significantly under As alloying by bandgap opening and reduction of the lattice thermal conductivity. Bi2Se3 (bulk and thin film) has a larger bandgap then the well-known thermoelectric material Bi2Te3, which is important at high temperature. The structural stability, electronic structure, and transport properties of one to six quintuple layers of Bi2Se3 will be discussed. We also address the effect of strain on a single quintuple layer by phonon band structures. We will analyze the electronic and transport

Theoretical study of electronic transport properties of a graphene-silicene bilayer

Energy Technology Data Exchange (ETDEWEB)

Berdiyorov, G. R. [Qatar Environment and Energy Research Institute, Qatar Foundation, P.O. Box 5825, Doha (Qatar); Bahlouli, H. [Department of Physics, King Fahd University of Petroleum and Minerals, 31261 Dhahran (Saudi Arabia); Saudi Center for Theoretical Physics, 31261 Dhahran (Saudi Arabia); Peeters, F. M. [Departement Fysica, Universiteit Antwerpen, Groenenborgerlaan 171, B-2020 Antwerpen (Belgium)

2015-06-14

Electronic transport properties of a graphene-silicene bilayer system are studied using density-functional theory in combination with the nonequilibrium Green's function formalism. Depending on the energy of the electrons, the transmission can be larger in this system as compared to the sum of the transmissions of separated graphene and silicene monolayers. This effect is related to the increased electron density of states in the bilayer sample. At some energies, the electronic states become localized in one of the layers, resulting in the suppression of the electron transmission. The effect of an applied voltage on the transmission becomes more pronounced in the layered sample as compared to graphene due to the larger variation of the electrostatic potential profile. Our findings will be useful when creating hybrid nanoscale devices where enhanced transport properties will be desirable.

Transport, Structural and Mechanical Properties of Quaternary FeVTiAl Alloy

Science.gov (United States)

Bhat, Tahir Mohiuddin; Gupta, Dinesh C.

2016-11-01

The electronic, structural, magnetic and transport properties of FeVTiAl quaternary alloy have been investigated within the framework of density functional theory. The material is a completely spin-polarized half-metallic ferromagnet in its ground state with F-43m structure. The structural stability was further confirmed by elastic constants in the cubic phase with high Young's modulus and brittle nature. The present study predicts an energy band gap of 0.72 eV in a localized minority spin channel at equilibrium lattice parameter of 6.00 Å. The transport properties of the material are discussed based on the Seebeck coefficient, and electrical and thermal conductivity coefficients. The alloy presents large values of Seebeck coefficients, ~39 μV K-1 at room temperature (300 K), and has an excellent thermoelectric performance with ZT = ~0.8.

Transport properties of partially-filled Ce{sub y}Co{sub 4}Sb{sub 12}

Energy Technology Data Exchange (ETDEWEB)

Uher, C; Chen, B; Hu, S; Morelli, D T; Meisner, G P

1997-07-01

The authors have investigated the magnetic and transport properties of Ce{sub y}Co{sub 4}Sb{sub 12} filled skutterudites with the filling fraction y {le} 0.1. These compounds are n-type materials that develop a magnetic moment upon the presence of trivalent cerium. Cerium has a strong influence on all transport properties and even in small amounts it drastically reduces the lattice thermal conductivity. The resulting figures of merit are comparable to the values established previously for the p-type filled skutterudites.

Synthesis, structure, thermal, transport and magnetic properties of VN ceramics

Czech Academy of Sciences Publication Activity Database

Huber, Š.; Jankovský, O.; Sedmidubský, D.; Luxa, J.; Klimová, K.; Hejtmánek, Jiří; Sofer, Z.

2016-01-01

Roč. 42, č. 16 (2016), s. 18779-18784 ISSN 0272-8842 R&D Projects: GA ČR GA13-20507S Institutional support: RVO:68378271 Keywords : vanadium mononitride * phase transition * electronic structure * heat capacity * transport properties Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.986, year: 2016

TRANSPORT PROPERTIES OF THE STRONGLY CORRELATED SYSTEMS

Directory of Open Access Journals (Sweden)

T.Domanski

2004-01-01

Full Text Available The transport properties of various systems are studied here in the context of three different models. These are: - the disordered Hubbard model applicable to correlated binary alloys with a general disorder, - the Anderson model used in describing the Kondo physics of a quantum dot connected to the external superconducting leads, and - the Ranninger-Robaszkiewicz model applied to the study of optical properties of the system with preformed electron pairs above the temperature of transition to the superconducting state. We calculate the density of states, specific heat, the Wilson ratio and conductivity of the correlated binary alloy with off-diagonal disorder. We investigate the conditions under which the Kondo peak appears in the density of states and in the conductance of a dot coupled to the external superconducting leads. We analyze the effect of the pseudogap on the optical spectra in the high temperature superconductors described by the boson-fermion model.

Tuning of Transport and Magnetic Properties in Epitaxial LaMnO3+δ Thin Films

Directory of Open Access Journals (Sweden)

J. Chen

2014-01-01

Full Text Available The effect of compressive strain on the transport and magnetic properties of epitaxial LaMnO3+δ thin films has been investigated. It is found that the transport and magnetic properties of the LaMnO3+δ thin films grown on the LaAlO3 substrates can be tuned by the compressive strain through varying film thickness. And the insulator-metal transition, charge/orbital ordering transition, and paramagnetic-ferromagnetic transition are suppressed by the compressive strain. Consequently, the related electronic and magnetic transition temperatures decrease with an increase in the compressive strain. The present results can be explained by the strain-controlled lattice deformation and the consequent orbital occupation. It indicates that the lattice degree of freedom is crucial for understanding the transport and magnetic properties of the strongly correlated LaMnO3+δ.

A new methodology for determination of macroscopic transport parameters in drying porous media

Science.gov (United States)

Attari Moghaddam, A.; Kharaghani, A.; Tsotsas, E.; Prat, M.

2015-12-01

Two main approaches have been used to model the drying process: The first approach considers the partially saturated porous medium as a continuum and partial differential equations are used to describe the mass, momentum and energy balances of the fluid phases. The continuum-scale models (CM) obtained by this approach involve constitutive laws which require effective material properties, such as the diffusivity, permeability, and thermal conductivity which are often determined by experiments. The second approach considers the material at the pore scale, where the void space is represented by a network of pores (PN). Micro- or nanofluidics models used in each pore give rise to a large system of ordinary differential equations with degrees of freedom at each node of the pore network. In this work, the moisture transport coefficient (D), the pseudo desorption isotherm inside the network and at the evaporative surface are estimated from the post-processing of the three-dimensional pore network drying simulations for fifteen realizations of the pore space geometry from a given probability distribution. A slice sampling method is used in order to extract these parameters from PN simulations. The moisture transport coefficient obtained in this way is shown in Fig. 1a. The minimum of average D values demonstrates the transition between liquid dominated moisture transport region and vapor dominated moisture transport region; a similar behavior has been observed in previous experimental findings. A function is fitted to the average D values and then is fed into the non-linear moisture diffusion equation. The saturation profiles obtained from PN and CM simulations are shown in Fig. 1b. Figure 1: (a) extracted moisture transport coefficient during drying for fifteen realizations of the pore network, (b) average moisture profiles during drying obtained from PN and CM simulations.

Electronic and transport properties of kinked graphene

DEFF Research Database (Denmark)

Rasmussen, Jesper Toft; Gunst, Tue; Bøggild, Peter

2013-01-01

Local curvature, or bending, of a graphene sheet is known to increase the chemical reactivity presenting an opportunity for templated chemical functionalisation. Using first-principles calculations based on density functional theory (DFT), we investigate the reaction barrier reduction for the ads......Local curvature, or bending, of a graphene sheet is known to increase the chemical reactivity presenting an opportunity for templated chemical functionalisation. Using first-principles calculations based on density functional theory (DFT), we investigate the reaction barrier reduction...... for the adsorption of atomic hydrogen at linear bends in graphene. We find a significant barrier lowering (≈15%) for realistic radii of curvature (≈20 Å) and that adsorption along the linear bend leads to a stable linear kink. We compute the electronic transport properties of individual and multiple kink lines......, and demonstrate how these act as efficient barriers for electron transport. In particular, two parallel kink lines form a graphene pseudo-nanoribbon structure with a semimetallic/semiconducting electronic structure closely related to the corresponding isolated ribbons; the ribbon band gap translates...

Tunable electronic transport properties of silicon-fullerene-linked nanowires: Semiconductor, conducting wire, and tunnel diode

OpenAIRE

Nishio, Kengo; Ozaki, Taisuke; Morishita, Tetsuya; Mikami, Masuhiro

2010-01-01

We explore the possibility of controllable tuning of the electronic transport properties of silicon-fullerene-linked nanowires by encapsulating guest atoms into their cages. Our first-principles calculations demonstrate that the guest-free nanowires are semiconductors, and do not conduct electricity. The iodine or sodium doping improves the transport properties, and makes the nanowires metallic. In the junctions of I-doped and Na-doped NWs, the current travels through the boundary by quantum ...

Transport properties of valsartan, sacubitril and its active metabolite (LBQ657) as determinants of disposition.

Science.gov (United States)

Hanna, Imad; Alexander, Natalya; Crouthamel, Matthew H; Davis, John; Natrillo, Adrienne; Tran, Phi; Vapurcuyan, Arpine; Zhu, Bing

2018-03-01

1. The potential for drug-drug interactions of LCZ696 (a novel, crystalline complex comprising sacubitril and valsartan) was investigated in vitro. 2. Sacubitril was shown to be a highly permeable P-glycoprotein (P-gp) substrate and was hydrolyzed to the active anionic metabolite LBQ657 by human carboxylesterase 1 (CES1b and 1c). The multidrug resistance-associated protein 2 (MRP2) was shown to be capable of LBQ657 and valsartan transport that contributes to the elimination of either compound. 3. LBQ657 and valsartan were transported by OAT1, OAT3, OATP1B1 and OATP1B3, whereas no OAT- or OATP-mediated sacubitril transport was observed. 4. The contribution of OATP1B3 to valsartan transport (73%) was appreciably higher than that by OATP1B1 (27%), Alternatively, OATP1B1 contribution to the hepatic uptake of LBQ657 (∼70%) was higher than that by OATP1B3 (∼30%). 5. None of the compounds inhibited OCT1/OCT2, MATE1/MATE2-K, P-gp, or BCRP. Sacubitril and LBQ657 inhibited OAT3 but not OAT1, and valsartan inhibited the activity of both OAT1 and OAT3. Sacubitril and valsartan inhibited OATP1B1 and OATP1B3, whereas LBQ657 weakly inhibited OATP1B1 but not OATP1B3. 6. Drug interactions due to the inhibition of transporters are unlikely due to the redundancy of the available transport pathways (LBQ657: OATP1B1/OAT1/3 and valsartan: OATP1B3/OAT1/3) and the low therapeutic concentration of the LCZ696 analytes.

Edge modulation of electronics and transport properties of cliff-edge phosphorene nanoribbons

Science.gov (United States)

Guo, Caixia; Wang, Tianxing; Xia, Congxin; Liu, Yufang

2017-12-01

Based on the first-principles calculations, we study the electronic structures and transport properties of cliff-like edge phosphorene nanoribbons (CPNRs), considering different types of edge passivation. The band structures of bare CPNRs possess the metallic features; while hydrogen (H), fluorine (F), chlorine (Cl) and oxygen (O) atoms-passivated CPNRs are semiconductor materials, and the band gap values monotonically decrease when the ribbon width increases. Moreover, the H and F-passivated CPNRs exhibit the direct band gap characteristics, while the Cl and O-passivated cases show the features of indirect band gap. In addition, the edge passivated CPNRs are more energetically stable than bare edge case. Meanwhile, our results also show that the transport properties of the CPNRs can be obviously influenced by the different edge passivation.

Transport Studies and Modeling in PEM Fuel Cells

Energy Technology Data Exchange (ETDEWEB)

Mittelsteadt, Cortney K. [Giner, Inc., Auburndale, MA (United States); Xu, Hui [Giner, Inc., Auburndale, MA (United States); Brawn, Shelly [Giner, Inc., Auburndale, MA (United States)

2014-07-30

This project’s aim was to develop fuel cell components (i.e. membranes, gas-diffusion media (GDM), bipolar plates and flow fields) that possess specific properties (i.e. water transport and conductivity). A computational fluid dynamics model was developed to elucidate the effect of certain parameters on these specific properties. Ultimately, the model will be used to determine sensitivity of fuel cell performance to component properties to determine limiting components and to guide research. We have successfully reached our objectives and achieved most of the milestones of this project. We have designed and synthesized a variety of hydrocarbon block polymer membranes with lower equivalent weight, structure, chemistry, phase separation and process conditions. These membranes provide a broad selection with optimized water transport properties. We have also designed and constructed a variety of devices that are capable of accurately measuring the water transport properties (water uptake, water diffusivity and electro-osmatic drag) of these membranes. These transport properties are correlated to the membranes’ structures derived from X-ray and microscopy techniques to determine the structure-property relationship. We successfully integrated hydrocarbon membrane MEAs with a current distribution board (CBD) to study the impact of hydrocarbon membrane on water transport in fuel cells. We have designed and fabricated various GDM with varying substrate, diffusivity and micro-porous layers (MPL) and characterized their pore structure, tortuosity and hydrophobicity. We have derived a universal chart (MacMullin number as function of wet proofing and porosity) that can be used to characterize various GDM. The abovementioned GDMs have been evaluated in operating fuel cells; their performance is correlated to various pore structure, tortuosity and hydrophobicity of the GDM. Unfortunately, determining a universal relationship between the MacMullin number and these properties

Transport Properties of operational gas mixtures used at LHC

CERN Document Server

Assran, Yasser

2011-01-01

This report summarizes some useful data on the transport characteristics of gas mixtures which are required for detection of charged particles in gas detectors. We try to replace Freon used for RPC detector in the CMS experiment with another gas while maintaining the good properties of the Freon gas mixture unchanged. We try to switch to freonless gas mixture because Freon is not a green gas, it is very expensive and its availability is decreasing. Noble gases like Ar, He, Ne and Xe (with some quenchers like carbon dioxide, methane, ethane and isobutene) are investigated. Transport parameters like drift velocity, diffusion, Townsend coefficient, attachment coefficient and Lorentz angle are computed using Garfield software for different gas mixtures and compared with experimental data.

Spatial and temporal variations of the callus mechanical properties during bone transport

Energy Technology Data Exchange (ETDEWEB)

Mora-Macias, J.; Reina-Romo, E.; Pajares, A.; Miranda, P.; Dominguez, J.

2016-07-01

Nanoindentation allows obtaining the elastic modulus and the hardness of materials point by point. This technique has been used to assess the mechanical propeties of the callus during fracture healing. However, as fas as the authors know, the evaluation of mechanical properties by this technique of the distraction and the docking-site calluses generated during bone transport have not been reported yet. Therefore, the aim of this work is using nanoindentation to assess the spatial and temporal variation of the elastic modulus of the woven bone generated during bone transport. Nanoindentation measurements were carried out using 6 samples from sheep sacrificed at different stages of the bone transport experiments. The results obtained show an important heterogeneity of the elastic modulus of the woven bone without spatial trends. In the case of temporal variation, a clear increase of the mean elastic modulus with time after surgery was observed (from 7±2GPa 35 days after surgery to 14±2GPa 525 days after surgery in the distraction callus and a similar increase in the docking site callus). Comparison with the evolution of the elastic modulus in the woven bone generated during fracture healing shows that mechanical properties increase slower in the case of the woven bone generated during bone transport. (Author)

Linear elastic properties derivation from microstructures representative of transport parameters.

Science.gov (United States)

Hoang, Minh Tan; Bonnet, Guy; Tuan Luu, Hoang; Perrot, Camille

2014-06-01

It is shown that three-dimensional periodic unit cells (3D PUC) representative of transport parameters involved in the description of long wavelength acoustic wave propagation and dissipation through real foam samples may also be used as a standpoint to estimate their macroscopic linear elastic properties. Application of the model yields quantitative agreement between numerical homogenization results, available literature data, and experiments. Key contributions of this work include recognizing the importance of membranes and properties of the base material for the physics of elasticity. The results of this paper demonstrate that a 3D PUC may be used to understand and predict not only the sound absorbing properties of porous materials but also their transmission loss, which is critical for sound insulation problems.

Growth and quantum transport properties of vertical Bi2Se3 nanoplate films on Si substrates.

Science.gov (United States)

Li, M Z; Wang, Z H; Yang, L; Pan, D S; Li, Da; Gao, Xuan; Zhang, Zhi-Dong

2018-05-14

Controlling the growth direction (planar vs. vertical) and surface-to-bulk ratio can lead to lots of unique properties for two-dimensional (2D) layered materials. We report a simple method to fabricate continuous films of vertical Bi2Se3 nanoplates on Si substrate and investigate the quantum transport properties of such films. In contrast to (001) oriented planar Bi2Se3 nanoplate film, vertical Bi2Se3 nanoplate films are enclosed by (015) facets, which possess high surface-to-bulk ratio that can enhance the quantum transport property of topological surface states. And by controlling the compactness of vertical Bi2Se3 nanoplates, we realized an effective tuning of the weak antilocalization (WAL) effect from topological surface states in Bi2Se3 films. Our work paves a way for exploring the unique transport properties of this unconventional structure topological insulator film. © 2018 IOP Publishing Ltd.

Charge transport properties of a twisted DNA molecule: A renormalization approach

Energy Technology Data Exchange (ETDEWEB)

Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2016-10-20

In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

Interface disorder and transport properties in HTC/CMR superlattices

International Nuclear Information System (INIS)

Haberkorn, N.; Guimpel, J.; Sirena, M.; Steren, L.B.; Campillo, G.; Saldarriaga, W.; Gomez, M.E.

2004-01-01

The physical properties of superlattices are affected by interface disorder, like roughness and interdiffusion. X-ray diffraction allows its measurement through modeling and structure refinement. The high-T c RBa 2 Cu 3 O 7 (RBCO) and colossal magnetoresistance La x A 1-x MnO 3 (LAMO) perovskites are interesting superlattice partners given their similar lattice parameters and because the combination of magnetic and superconducting properties is interesting for both basic and applied research. We have investigated the structural and transport properties of YBCO/La 2/3 Ca 1/3 MnO 3 and GdBCO/La 0.6 Sr 0.04 MnO 3 superlattices grown by sputtering on (1 0 0)MgO. We find a roughness of 1 RBCO unit cell and a 30% interdiffusion in the same length from the interfaces for all samples. The superconducting behavior is found strongly dependent on the LAMO layer thickness

Electronic band structure, magnetic, transport and thermodynamic properties of In-filled skutterudites InxCo4Sb12

International Nuclear Information System (INIS)

Leszczynski, J; Da Ros, V; Lenoir, B; Dauscher, A; Candolfi, C; Masschelein, P; Hejtmanek, J; Kutorasinski, K; Tobola, J; Smith, R I; Stiewe, C; Müller, E

2013-01-01

The thermoelectric and thermodynamic properties of polycrystalline In x Co 4 Sb 12 (0.0 ⩽ x ⩽ 0.26) skutterudites were investigated and analysed between 2 and 800 K by means of electrical resistivity, thermopower, thermal conductivity and specific heat measurements. Hall effect, sound velocity and thermal expansion measurements were also made in order to gain insights into the transport and elastic properties of these compounds. The impact of the In filling on the crystal structure as well as the thermal dynamics of the In atoms were tracked down to 4 K using powder neutron diffraction experiments. Analyses of the transport data were compared with the evolution of the electronic band structure with x determined theoretically within the Korringa–Kohn–Rostoker method with the coherent potential approximation. These calculations indicate that In gives rise to a remarkably large p-like density of states located at the conduction band edge. The electrical properties show typical trends of heavily doped semiconductors regardless of the In content. The thermal transport in CoSb 3 is strongly influenced by the presence of In in the voids of the crystal structure resulting in a drop in the lattice thermal conductivity values in the whole temperature range. The low value of the Grüneisen parameter suggests that this decrease mainly originates from enhanced mass-fluctuations and point-defect scattering mechanisms. The highest thermoelectric figure of merit ZT ∼ 1.0 at 750 K was achieved at the maximum In filling fraction, i.e. for x = 0.26. (paper)

Risk methodology for geologic disposal of radioactive waste: asymptotic properties of the environmental transport model

International Nuclear Information System (INIS)

Helton, J.C.; Brown, J.B.; Iman, R.L.

1981-02-01

The Environmental Transport Model is a compartmental model developed to represent the surface movement of radionuclides. The purpose of the present study is to investigate the asymptotic behavior of the model and to acquire insight with respect to such behavior and the variables which influence it. For four variations of a hypothetical river receiving a radionuclide discharge, the following properties are considered: predicted asymptotic values for environmental radionuclide concentrations and time required for environmental radionuclide concentrations to reach 90% of their predicted asymptotic values. Independent variables of two types are used to define each variation of the river: variables which define physical properties of the river system (e.g., soil depth, river discharge and sediment resuspension) and variables which summarize radionuclide properties (i.e., distribution coefficients). Sensitivity analysis techniques based on stepwise regression are used to determine the dominant variables influencing the behavior of the model. This work constitutes part of a project at Sandia National Laboratories funded by the Nuclear Regulatory Commission to develop a methodology to assess the risk associated with geologic disposal of radioactive waste

Approximations for transport parameters and self-averaging properties for point-like injections in heterogeneous media

International Nuclear Information System (INIS)

Eberhard, Jens

2004-01-01

We focus on transport parameters in heterogeneous media with a flow modelled by an ensemble of periodic and Gaussian random fields. The parameters are determined by ensemble averages. We study to what extent these averages represent the behaviour in a single realization. We calculate the centre-of-mass velocity and the dispersion coefficient using approximations based on a perturbative expansion for the transport equation, and on the iterative solution of the Langevin equation. Compared with simulations, the perturbation theory reproduces the numerical results only poorly, whereas the iterative solution yields good results. Using these approximations, we investigate the self-averaging properties. The ensemble average of the velocity characterizes the behaviour of a realization for large times in both ensembles. The dispersion coefficient is not self-averaging in the ensemble of periodic fields. For the Gaussian ensemble the asymptotic dispersion coefficient is self-averaging. For finite times, however, the fluctuations are so large that the average does not represent the behaviour in a single realization

Conduction band splitting and transport properties of Bi2Se3

Czech Academy of Sciences Publication Activity Database

Navrátil, Jiří; Horák, Jaromír; Plecháček, T.; Kamba, Stanislav; Lošťák, P.; Dyck, J. S.; Chen, W.; Uher, C.

2004-01-01

Roč. 177, č. 4-5 (2004), s. 1704-1712 ISSN 0022-4596 R&D Projects: GA AV ČR KSK2050602; GA AV ČR KSK1010104 Keywords : transport properties * carrier scattering Subject RIV: CA - Inorganic Chemistry Impact factor: 1.815, year: 2004

Study of structural and electronic transport properties of Ce-doped ...

Indian Academy of Sciences (India)

Abstract. The structural and electronic transport properties of La1−x Cex MnO3 (x =0.0–1.0) have been studied. All the samples exhibit orthorhombic crystal symmetry and the unit cell volume de- creases with Ce doping. They also make a metal–insulator transition (MIT) and transition temper- ature increases with increase in ...

Molecular dynamics studies of transport properties and equation of state of supercritical fluids

Science.gov (United States)

Nwobi, Obika C.

Many chemical propulsion systems operate with one or more of the reactants above the critical point in order to enhance their performance. Most of the computational fluid dynamics (CFD) methods used to predict these flows require accurate information on the transport properties and equation of state at these supercritical conditions. This work involves the determination of transport coefficients and equation of state of supercritical fluids by equilibrium molecular dynamics (MD) simulations on parallel computers using the Green-Kubo formulae and the virial equation of state, respectively. MD involves the solution of equations of motion of a system of molecules that interact with each other through an intermolecular potential. Provided that an accurate potential can be found for the system of interest, MD can be used regardless of the phase and thermodynamic conditions of the substances involved. The MD program uses the effective Lennard-Jones potential, with system sizes of 1000-1200 molecules and, simulations of 2,000,000 time-steps for computing transport coefficients and 200,000 time-steps for pressures. The computer code also uses linked cell lists for efficient sorting of molecules, periodic boundary conditions, and a modified velocity Verlet algorithm for particle displacement. Particle decomposition is used for distributing the molecules to different processors of a parallel computer. Simulations have been carried out on pure argon, nitrogen, oxygen and ethylene at various supercritical conditions, with self-diffusion coefficients, shear viscosity coefficients, thermal conductivity coefficients and pressures computed for most of the conditions. Results compare well with experimental and the National Institute of Standards and Technology (NIST) values. The results show that the number of molecules and the potential cut-off radius have no significant effect on the computed coefficients, while long-time integration is necessary for accurate determination of the

Transport properties of chiral fermions

Energy Technology Data Exchange (ETDEWEB)

Puhr, Matthias

2017-04-26

Anomalous transport phenomena have their origin in the chiral anomaly, the anomalous non-conservation of the axial charge, and can arise in systems with chiral fermions. The anomalous transport properties of free fermions are well understood, but little is known about possible corrections to the anomalous transport coefficients that can occur if the fermions are strongly interacting. The main goal of this thesis is to study anomalous transport effects in media with strongly interacting fermions. In particular, we investigate the Chiral Magnetic Effect (CME) in a Weyl Semimetal (WSM) and the Chiral Separation Effect (CSE) in finite-density Quantum Chromodynamics (QCD). The recently discovered WSMs are solid state crystals with low-energy excitations that behave like Weyl fermions. The inter-electron interaction in WSMs is typically very strong and non-perturbative calculations are needed to connect theory and experiment. To realistically model an interacting, parity-breaking WSM we use a tight-binding lattice Hamiltonian with Wilson-Dirac fermions. This model features a non-trivial phase diagram and has a phase (Aoki phase/axionic insulator phase) with spontaneously broken CP symmetry, corresponding to the phase with spontaneously broken chiral symmetry for interacting continuum Dirac fermions. We use a mean-field ansatz to study the CME in spatially modulated magnetic fields and find that it vanishes in the Aoki phase. Moreover, our calculations show that outside of the Aoki phase the electron interaction has only a minor influence on the CME. We observe no enhancement of the magnitude of the CME current. For our non-perturbative study of the CSE in QCD we use the framework of lattice QCD with overlap fermions. We work in the quenched approximation to avoid the sign problem that comes with introducing a finite chemical potential on the lattice. The overlap operator calls for the evaluation of the sign function of a matrix with a dimension proportional to the volume

Structural and robustness properties of smart-city transportation networks

Science.gov (United States)

Zhang, Zhen-Gang; Ding, Zhuo; Fan, Jing-Fang; Meng, Jun; Ding, Yi-Min; Ye, Fang-Fu; Chen, Xiao-Song

2015-09-01

The concept of smart city gives an excellent resolution to construct and develop modern cities, and also demands infrastructure construction. How to build a safe, stable, and highly efficient public transportation system becomes an important topic in the process of city construction. In this work, we study the structural and robustness properties of transportation networks and their sub-networks. We introduce a complementary network model to study the relevance and complementarity between bus network and subway network. Our numerical results show that the mutual supplement of networks can improve the network robustness. This conclusion provides a theoretical basis for the construction of public traffic networks, and it also supports reasonable operation of managing smart cities. Project supported by the Major Projects of the China National Social Science Fund (Grant No. 11 & ZD154).

A review of reaction rates and thermodynamic and transport properties for the 11-species air model for chemical and thermal nonequilibrium calculations to 30000 K

Science.gov (United States)

Gupta, Roop N.; Yos, Jerrold M.; Thompson, Richard A.

1989-01-01

Reaction rate coefficients and thermodynamic and transport properties are provided for the 11-species air model which can be used for analyzing flows in chemical and thermal nonequilibrium. Such flows will likely occur around currently planned and future hypersonic vehicles. Guidelines for determining the state of the surrounding environment are provided. Approximate and more exact formulas are provided for computing the properties of partially ionized air mixtures in such environments.

Determination of properties of clean coal technology post-process residue

Directory of Open Access Journals (Sweden)

Agnieszka Klupa

2016-01-01

Full Text Available This article presents the possibilities of using modern measuring devices to determine the properties of process residues (Polish acronym: UPP. UPP was taken from the combustion process from a power plant in Silesia. Determining the properties of UPP is the basis for making decisions about its practical application, for example, as a raw material to obtain useful products such as: pozzolan, cenosphere or zeolite, for which there is demand. The development of advanced technology and science has given rise to modern and precise research tools that contribute to the development of appropriate methods to assess the properties of post-process residue. For this study the following were used: scanning electron microscope with EDS microanalysis and an analyzer for particle size-, shape- and number- analysis. The study conducted confirms the effectiveness of SEM analysis to determine the properties of post-process residue from Clean Coal Technologies (CCT. The results obtained are an introduction to further research on the determination of properties of CCT post-process residue. Research to determine the properties of CCT post-process residue only began relatively recently.

Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations

DEFF Research Database (Denmark)

Fürst, Joachim Alexander; Hashemi, J.; Markussen, Troels

2009-01-01

Fullerene functionalized carbon nanotubes-NanoBuds-form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab init...

40 CFR 93.106 - Content of transportation plans and timeframe of conformity determinations.

Science.gov (United States)

2010-07-01

... transportation analysis in use by the MPO. Transit facilities, equipment, and services envisioned for the future... plans which meet those requirements. Otherwise, the transportation system envisioned for the future must... determination; (iv) The last year of the transportation plan's forecast period must be a horizon year; and (v...

Links between soil properties and steady-state solute transport through cultivated topsoil at the field scale

Science.gov (United States)

Koestel, J. K.; Norgaard, T.; Luong, N. M.; Vendelboe, A. L.; Moldrup, P.; Jarvis, N. J.; Lamandé, M.; Iversen, B. V.; Wollesen de Jonge, L.

2013-02-01

It is known that solute transport through soil is heterogeneous at all spatial scales. However, little data are available to allow quantification of these heterogeneities at the field scale or larger. In this study, we investigated the spatial patterns of soil properties, hydrologic state variables, and tracer breakthrough curves (BTCs) at the field scale for the inert solute transport under a steady-state irrigation rate which produced near-saturated conditions. Sixty-five undisturbed soil columns approximately 20 cm in height and diameter were sampled from the loamy topsoil of an agricultural field site in Silstrup (Denmark) at a sampling distance of approximately 15 m (with a few exceptions), covering an area of approximately 1 ha (60 m × 165 m). For 64 of the 65 investigated soil columns, we observed BTC shapes indicating a strong preferential transport. The strength of preferential transport was positively correlated with the bulk density and the degree of water saturation. The latter suggests that preferential macropore transport was the dominating transport process. Increased bulk densities were presumably related with a decrease in near-saturated hydraulic conductivities and as a consequence to larger water saturation and the activation of larger macropores. Our study provides further evidence that it should be possible to estimate solute transport properties from soil properties such as soil texture or bulk density. We also demonstrated that estimation approaches established for the column scale have to be upscaled when applied to the field scale or larger.

Transport due to ion pressure gradient turbulence

International Nuclear Information System (INIS)

Connor, J.W.

1986-01-01

Turbulent transport due to the ion pressure gradient (or temperature drift) instability is thought to be significant when etasub(i)=d(ln Tsub(i))/d(ln n)>1. The invariance properties of the governing equations under scale transformations are used to discuss the characteristics of this turbulence. This approach not only clarifies the relationships between earlier treatments but also, in certain limits, completely determines the scaling properties of the fluctuations and the consequent thermal transport. (author)

Spintronic and transport properties of linear atomic strings of transition metals (Fe, Co, Ni)

Energy Technology Data Exchange (ETDEWEB)

Tyagi, Neha, E-mail: nehatyagi.phy@gmail.com [Department of Applied Physics, Delhi Technological University, New Delhi (India); Jaiswal, Neeraj K. [Discipline of Physics, PDPM-Indian Institute of Information Technology, Design & Manufacturing, Jabalpur (India); Srivastava, Pankaj [Nanomaterials Research Group, ABV-Indian Institute of Information Technology & Management, Gwalior (India)

2016-05-06

In the present work, first-principles investigations have been performed to study the spintronic and transport properties of linear atomic strings of Fe, Co and Ni. The structural stabilities of the considered strings were compared on the basis of binding energies which revealed that all the strings are energetically feasible to be achieved. Further, all the considered strings are found to be ferromagnetic and the observed magnetic moment ranges from 1.38 to 1.71 μ{sub B}. The observed transport properties and high spin polarization points towards their potential for nano interconnects and spintronic applications.

CMT for transport in porous media

Energy Technology Data Exchange (ETDEWEB)

Schwartz, L. [Schlumberger-Doll Research, Ridgefield, CT (United States)

1997-02-01

This session is comprised of an outline of uses for x-ray microtomography in the field of petroleum geology. Calculations, diagrams, and color photomicrographs depict the many applications of synchrotron x-ray microtomograpy in determining transport properties and fluid flow characteristics of reservoir rocks, micro-porosity in carbonates, and aspects of multi-phase transport.

Oxygen transport properties estimation by classical trajectory–direct simulation Monte Carlo

Energy Technology Data Exchange (ETDEWEB)

Bruno, Domenico, E-mail: domenico.bruno@cnr.it [Istituto di Metodologie Inorganiche e dei Plasmi, Consiglio Nazionale delle Ricerche– Via G. Amendola 122, 70125 Bari (Italy); Frezzotti, Aldo, E-mail: aldo.frezzotti@polimi.it; Ghiroldi, Gian Pietro, E-mail: gpghiro@gmail.com [Dipartimento di Scienze e Tecnologie Aerospaziali, Politecnico di Milano–Via La Masa 34, 20156 Milano (Italy)

2015-05-15

Coupling direct simulation Monte Carlo (DSMC) simulations with classical trajectory calculations is a powerful tool to improve predictive capabilities of computational dilute gas dynamics. The considerable increase in computational effort outlined in early applications of the method can be compensated by running simulations on massively parallel computers. In particular, Graphics Processing Unit acceleration has been found quite effective in reducing computing time of classical trajectory (CT)-DSMC simulations. The aim of the present work is to study dilute molecular oxygen flows by modeling binary collisions, in the rigid rotor approximation, through an accurate Potential Energy Surface (PES), obtained by molecular beams scattering. The PES accuracy is assessed by calculating molecular oxygen transport properties by different equilibrium and non-equilibrium CT-DSMC based simulations that provide close values of the transport properties. Comparisons with available experimental data are presented and discussed in the temperature range 300–900 K, where vibrational degrees of freedom are expected to play a limited (but not always negligible) role.

A specific interdomain interaction preserves the structural and binding properties of the ModA protein from the phytopathogen Xanthomonas citri domain interaction and transport in ModA.

Science.gov (United States)

Santacruz-Perez, Carolina; Pegos, Vanessa Rodrigues; Honorato, Rodrigo V; Verli, Hugo; Lindahl, Erik; Barbosa, João Alexandre Ribeiro Gonçalves; Balan, Andrea

2013-11-01

The periplasmic-binding proteins in ATP-binding cassette systems (ABC Transporters) are responsible for the capture and delivery of ligands to their specific transporters, triggering a series of ATP-driven conformational changes that leads to the transport of the ligand. Structurally consisting of two lobes, the proteins change conformation after interaction with the ligand. The structure of the molybdate-binding protein (ModA) from Xanthomonas citri, bound to molybdate, was previously solved by our group and an interdomain interaction, mediated by a salt bridge between K127 and D59, apparently supports the binding properties and keeps the domains closed. To determinate the importance of this interaction, we built two ModA mutants, K127S and D59A, and analysed their functional and structural properties. Based on a set of spectroscopic experiments, crystallisation trials, structure determination and molecular dynamics (MD) simulations, we showed that the salt bridge is essential to maintain the structure and binding properties. Additionally, the MD simulations revealed that this mutant adopted a more compact structure that packed down the ligand-binding pocket. From the closed bound to open structure, the positioning of the helices forming the dipole and the salt bridge are essential to induce an intermediate state. Copyright © 2013 Elsevier Inc. All rights reserved.

Thermophysical properties of uranium dioxide

International Nuclear Information System (INIS)

Fink, J.K.

2000-01-01

Experimental data on thermodynamic and transport properties of solid and liquid UO 2 have been reviewed and analyzed to obtain consistent equations for the thermophysical properties. Thermodynamic properties that have been assessed include enthalpy, heat capacity, enthalpy of fusion, thermal expansion, density, surface tension and vapor pressure. Transport properties that have been assessed are thermal diffusivity, thermal conductivity, viscosity, emissivity and optical constants. The assessments include a review of the experiments and data, review of previous recommendations, analysis of data to obtain new recommendations, determination of uncertainties in the recommended values, and comparisons of new recommendations with data and previous recommendations

Investigation of thermodynamic and transport properties of liquid transition metals using Wills-Harrison potentials

International Nuclear Information System (INIS)

Khaleque, M.A.; Bhuiyan, G.M.; Rashid, R.I.M.A.

1998-01-01

Thermodynamic properties such as entropy, specific heat capacity at constant pressure and isothermal compressibility have been calculated for liquid 3d, 4d and 5d transition metals near melting temperature. The hard sphere diameter for all such systems is estimated from the potential profile generated from the Wills and Harrison's prescription using linearized WCA theory of liquid. Evaluated values of entropy and specific heat capacity are found to be in good agreement with the experimental data. Transport property like shear viscosity for these liquid metals is obtained using the same potential profile. Lack of experimental data at melting temperatures hampers detailed comparison for all such systems. However, for the case of transport property, the results obtained are found to compare qualitatively well with the available experimental data. (author)

Links between soil properties and steady-state solute transport through cultivated topsoil at the field scale

DEFF Research Database (Denmark)

Koestel, J. K.; Nørgaard, Trine; Loung, N. M.

2013-01-01

It is known that solute transport through soil is heterogeneous at all spatial scales. However, little data are available to allow quantification of these heterogeneities at the field scale or larger. In this study, we investigated the spatial patterns of soil properties, hydrologic state variables......, and tracer breakthrough curves (BTCs) at the field scale for the inert solute transport under a steady-state irrigation rate which produced near-saturated conditions. Sixty-five undisturbed soil columns approximately 20 cm in height and diameter were sampled from the loamy topsoil of an agricultural field...... to larger water saturation and the activation of larger macropores. Our study provides further evidence that it should be possible to estimate solute transport properties from soil properties such as soil texture or bulk density. We also demonstrated that estimation approaches established for the column...

Interface disorder and transport properties in HTC/CMR superlattices

Energy Technology Data Exchange (ETDEWEB)

Haberkorn, N.; Guimpel, J.; Sirena, M.; Steren, L.B.; Campillo, G.; Saldarriaga, W.; Gomez, M.E

2004-08-01

The physical properties of superlattices are affected by interface disorder, like roughness and interdiffusion. X-ray diffraction allows its measurement through modeling and structure refinement. The high-T{sub c} RBa{sub 2}Cu{sub 3}O{sub 7} (RBCO) and colossal magnetoresistance La{sub x}A{sub 1-x}MnO{sub 3} (LAMO) perovskites are interesting superlattice partners given their similar lattice parameters and because the combination of magnetic and superconducting properties is interesting for both basic and applied research. We have investigated the structural and transport properties of YBCO/La{sub 2/3}Ca{sub 1/3}MnO{sub 3} and GdBCO/La{sub 0.6}Sr{sub 0.04}MnO{sub 3} superlattices grown by sputtering on (1 0 0)MgO. We find a roughness of 1 RBCO unit cell and a 30% interdiffusion in the same length from the interfaces for all samples. The superconducting behavior is found strongly dependent on the LAMO layer thickness.

Mixing rules for optical and transport properties of warm, dense matter

International Nuclear Information System (INIS)

Kress, Joel D.; Horner, Daniel A.; Collins, Lee A.

2009-01-01

The warm, dense matter (WDM) regime requires a sophisticated treatment since neither ideal gas laws or fully ionized plasma models apply. Mixtures represent the predominant form of matter throughout the universe and the ability to predict the properties of a mixture, though direct simulation or from convolution of the properties of the constituents is both a challenging prospect and an important goal. Through quantum molecular dynamics (QMD), we accurately simulate WDM and compute equations of state, transport, and optical properties of such materials, including mixtures, in a self-consistent manner from a single simulation. With the ability to directly compute the mixture properties, we are able to validate mixing rules for combining the optical and dynamical properties of Li and H separately to predict the properties of lithium hydride (LiH). We have examined two such mixing rules and extend them to morphologies beyond a simple liquid alloy. We have also studied a mixture of polyethylene and aluminum at T = 1 eV.

Determination of Transport Properties From Flowing Fluid Temperature Logging In Unsaturated Fractured Rocks: Theory And Semi-Analytical Solution

International Nuclear Information System (INIS)

Mukhopadhyay, Sumit; Tsang, Yvonne W.

2008-01-01

Flowing fluid temperature logging (FFTL) has been recently proposed as a method to locate flowing fractures. We argue that FFTL, backed up by data from high-precision distributed temperature sensors, can be a useful tool in locating flowing fractures and in estimating the transport properties of unsaturated fractured rocks. We have developed the theoretical background needed to analyze data from FFTL. In this paper, we present a simplified conceptualization of FFTL in unsaturated fractured rock, and develop a semianalytical solution for spatial and temporal variations of pressure and temperature inside a borehole in response to an applied perturbation (pumping of air from the borehole). We compare the semi-analytical solution with predictions from the TOUGH2 numerical simulator. Based on the semi-analytical solution, we propose a method to estimate the permeability of the fracture continuum surrounding the borehole. Using this proposed method, we estimated the effective fracture continuum permeability of the unsaturated rock hosting the Drift Scale Test (DST) at Yucca Mountain, Nevada. Our estimate compares well with previous independent estimates for fracture permeability of the DST host rock. The conceptual model of FFTL presented in this paper is based on the assumptions of single-phase flow, convection-only heat transfer, and negligible change in system state of the rock formation. In a sequel paper (Mukhopadhyay et al., 2008), we extend the conceptual model to evaluate some of these assumptions. We also perform inverse modeling of FFTL data to estimate, in addition to permeability, other transport parameters (such as porosity and thermal conductivity) of unsaturated fractured rocks

Static transport properties of random alloys: Vertex corrections in conserving approximations

Czech Academy of Sciences Publication Activity Database

Turek, Ilja

2016-01-01

Roč. 93, č. 24 (2016), 245114-1-245114-6 ISSN 2469-9950 R&D Projects: GA ČR GA15-13436S Institutional support: RVO:68081723 Keywords : transport properties * random alloys * coherent-potential approximation Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.836, year: 2016

Controlling In–Ga–Zn–O thin films transport properties through density changes

Energy Technology Data Exchange (ETDEWEB)

Kaczmarski, Jakub, E-mail: kaczmarski@ite.waw.pl [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Boll, Torben [Department of Applied Physics, Chalmers University of Technology, Fysikgränd 3, SE-412 96 Gothenburg (Sweden); Borysiewicz, Michał A. [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Taube, Andrzej [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Institute of Microelectronics & Optoelectronics, Warsaw University of Technology, ul. Koszykowa 75, 00-662 Warsaw (Poland); Thuvander, Mattias; Law, Jia Yan [Department of Applied Physics, Chalmers University of Technology, Fysikgränd 3, SE-412 96 Gothenburg (Sweden); Kamińska, Eliana [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Stiller, Krystyna [Department of Applied Physics, Chalmers University of Technology, Fysikgränd 3, SE-412 96 Gothenburg (Sweden)

2016-06-01

In the following study we investigate the effect of the magnetron cathode current (I{sub c}) during reactive sputtering of In–Ga–Zn–O (a-IGZO) on thin-films nanostructure and transport properties. All fabricated films are amorphous, according to X-ray diffraction measurements. However, High Resolution Transmission Electron Microscopy revealed the a-IGZO fabricated at I{sub C} = 70 mA to contain randomly-oriented nanocrystals dispersed in amorphous matrix, which disappear in films deposited at higher cathode current. These nanocrystals have the same composition as the amorphous matrix. One can observe that, while I{sub C} is increased from 70 to 150 mA, the carrier mobility improves from μ{sub Hall} = 6.9 cm{sup 2}/Vs to μ{sub Hall} = 9.1 cm{sup 2}/Vs. Additionally, the increase of I{sub C} caused a reduction of the depletion region trap states density of the Ru–Si–O/In–Ga–Zn–O Schottky barrier. This enhancement in transport properties is attributed to the greater overlapping of s-orbitals of the film-forming cations caused by increased density, evidenced by X-ray reflectivity, at a fixed chemical composition, regardless nanostructure of thin films. - Highlights: • Magnetron cathode current (I{sub C}) controls the transport properties of In–Ga–Zn–O (IGZO). • Low I{sub C} results in IGZO films with nanocrystalline inclusions in amorphous matrix. • High I{sub C} reduces the number of trap states in depletion region of Schottky contacts.

Poly(o-aminophenol) film electrodes synthesis, transport properties and practical applications

CERN Document Server

Tucceri, Ricardo

2014-01-01

This review book is concerned with the synthesis, charge transport properties and practical applications of poly (o-aminophenol) (POAP) film electrodes. It is divided into three parts. The first one has a particular emphasis on problems of synthesis and structure of POAP. The second part deals with the mechanism of charge transfer and charge transport processes occurring in the course of the redox reactions of POAP. The third part describes the promising applications of POAP in the different fields of sensors, electrocatalysis, bioelectrochemistry, corrosion protection, among others. This review covers the literature on POAP in the time period comprised between 1987 and 2013.

Determination of chemical solute transport parameters effecting radiostrontium interbed sediments

International Nuclear Information System (INIS)

Hemming, C.; Bunde, R.L.; Rosentreter, J.J.

1993-01-01

The extent to which radionuclides migrate in an aquifer system is a function of various physical, chemical, and biological processes. A measure of this migration rate is of primary concern when locating suitable storage sites for such species. Parameters including water-rock interactions, infiltration rates, chemical phase modification, and biochemical reactions all affect solute transport. While these different types of chemical reactions can influence solute transport in subsurface waters, distribution coefficients (Kd) can be send to effectively summarize the net chemical factors which dictate transport efficiency. This coefficient describes the partitioning of the solute between the solution and solid phase. Methodology used in determining and interpreting the distribution coefficient for radiostrontium in well characterized sediments will be presented

Determining Complementary Properties with Quantum Clones

Science.gov (United States)

Thekkadath, G. S.; Saaltink, R. Y.; Giner, L.; Lundeen, J. S.

2017-08-01

In a classical world, simultaneous measurements of complementary properties (e.g., position and momentum) give a system's state. In quantum mechanics, measurement-induced disturbance is largest for complementary properties and, hence, limits the precision with which such properties can be determined simultaneously. It is tempting to try to sidestep this disturbance by copying the system and measuring each complementary property on a separate copy. However, perfect copying is physically impossible in quantum mechanics. Here, we investigate using the closest quantum analog to this copying strategy, optimal cloning. The coherent portion of the generated clones' state corresponds to "twins" of the input system. Like perfect copies, both twins faithfully reproduce the properties of the input system. Unlike perfect copies, the twins are entangled. As such, a measurement on both twins is equivalent to a simultaneous measurement on the input system. For complementary observables, this joint measurement gives the system's state, just as in the classical case. We demonstrate this experimentally using polarized single photons.

Transport properties of a ladder with two random dimer chains

International Nuclear Information System (INIS)

Hu Dong-Sheng; Zhu Chen-Ping; Zhang Yong-Mei

2011-01-01

We investigate the transport properties of a ladder with two random dimer (RD) chains. It is found that there are two extended states in the ladder with identical RD chains and a critical state regarded as an extended state in the ladder with pairing RD chains. Such a critical state is caused by the chiral symmetry. The ladder with identical RD chains can be decoupled into two isolated RD chains and the ladder with pairing RD chains can not. The analytic expressions of the extended states are presented for the ladder with identical RD chains. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Transport Properties of the Metallic State of TMTSF-DMTCNQ

DEFF Research Database (Denmark)

Bechgaard, Klaus; Andersen, Jan Rud; Andrieux, A.

1979-01-01

The authors report the transport properties (longitudinal and transverse conductivity, magnetoresistance and thermopower) of TMTSF-DMTCNQ for pressures up to 13 kbar and temperatures down to 1.2K together with the phase diagram which results from these measurements. The most striking results...... at any temperature (σ∥≳105 (Ωcm)-1) and an enormous magnetoresistance Δρ/ρ≈15) is found for a field of 75 kOe perpendicular to the conducting chains...

Determining the Mechanical Properties of Lattice Block Structures

Science.gov (United States)

Wilmoth, Nathan

2013-01-01

Lattice block structures and shape memory alloys possess several traits ideal for solving intriguing new engineering problems in industries such as aerospace, military, and transportation. Recent testing at the NASA Glenn Research Center has investigated the material properties of lattice block structures cast from a conventional aerospace titanium alloy as well as lattice block structures cast from nickel-titanium shape memory alloy. The lattice block structures for both materials were sectioned into smaller subelements for tension and compression testing. The results from the cast conventional titanium material showed that the expected mechanical properties were maintained. The shape memory alloy material was found to be extremely brittle from the casting process and only compression testing was completed. Future shape memory alloy lattice block structures will utilize an adjusted material composition that will provide a better quality casting. The testing effort resulted in baseline mechanical property data from the conventional titanium material for comparison to shape memory alloy materials once suitable castings are available.

Nanostructured ZnO films: A study of molecular influence on transport properties by impedance spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Sappia, Luciano D.; Trujillo, Matias R. [Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET, Chacabuco 461, T4000ILI San Miguel de Tucumán (Argentina); Laboratorio de Medios e Interfases (LAMEIN), Departamento de Bioingeniería, Fac. de Cs. Exactas y Tecnología, Universidad Nacional de Tucumán, Av. Independencia 1800, 4000 San Miguel de Tucumán (Argentina); Lorite, Israel [Division of Superconductivity and Magnetism, Institute for Experimental Physics II, University of Leipzig, Linnéstrasse 5, 04103 Leipzig (Germany); Madrid, Rossana E., E-mail: rmadrid@herrera.unt.edu.ar [Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET, Chacabuco 461, T4000ILI San Miguel de Tucumán (Argentina); Laboratorio de Medios e Interfases (LAMEIN), Departamento de Bioingeniería, Fac. de Cs. Exactas y Tecnología, Universidad Nacional de Tucumán, Av. Independencia 1800, 4000 San Miguel de Tucumán (Argentina); Tirado, Monica [NanoProject and Laboratorio de Nanomateriales y Propiedades Dieléctricas, Departamento de Física, Universidad Nacional de Tucumán, Avenida Independencia 1800, Tucumán (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) (Argentina); and others

2015-10-15

Graphical abstract: - Highlights: • We study electrical transport in nanostructured ZnO films by impedance spectroscopy. • Bioaggregates on the surface produce strong changes in film transport properties. • This behavior is explained by modeling data with RC parallel circuits. • Electrical responses of ZnO films to aggregates are promising for biosensing. - Abstract: Nanomaterials based on ZnO have been used to build glucose sensors due to its high isoelectric point, which is important when a protein like Glucose Oxidase (GOx) is attached to a surface. It also creates a biologically friendly environment to preserve the activity of the enzyme. In this work we study the electrical transport properties of ZnO thin films (TFs) and single crystals (SC) in contact with different solutions by using impedance spectroscopy. We have found that the composition of the liquid, by means of the charge of the ions, produces strong changes in the transport properties of the TF. The enzyme GOx and phosphate buffer solutions have the major effect in the conduction through the films, which can be explained by the entrapment of carriers at the grain boundaries of the TFs. These results can help to design a new concept in glucose biosensing.

Psychometric properties of the assessment of quality of working life scale in the urban transport sector

Directory of Open Access Journals (Sweden)

Hernán Alberto Figueroa-Chaves

2017-12-01

Full Text Available Introduction: The Quality of Working Life (QWL is the degree of satisfaction, physical, mental and social well-being experienced by people in their working environment; it contains the objective and subjective dimensions. For this study, the subjective dimension of the QWL was addressed, which is formed by occupational health, labor welfare and perception of the work. Objective: To determine the psychometric properties of the assessment of quality of life scale at work in the transport sector. Materials and methods: A quantitative descriptive-instrumental study of the scale was made, which consists of 108 items and was applied to 468 drivers of the strategic system of public transport in the city of San Juan de Pasto. The evidence of Kaiser Meyer Olkin and roundness of Bartlett, the factorial analysis and Cronbach Alpha were calculated. Results: The scale presented appropriate features of validity and reliability. It evaluates two factors: labor welfare and healthy life styles, and the respective scales to be applied are presented. Conclusions: The factorial analysis allows us to affirm that the Scale of Quality of Working Life in the transport sector can be applied in subsequent studies.

40 CFR 93.122 - Procedures for determining regional transportation-related emissions.

Science.gov (United States)

2010-07-01

... of transit currently is anticipated to be a significant factor in satisfying transportation demand... in the latest conforming TIP) with design concept and scope adequate to determine its contribution to... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Procedures for determining regional...

Determination of prestress and elastic properties of virus capsids

Science.gov (United States)

Aggarwal, Ankush

2018-03-01

Virus capsids are protein shells that protect the virus genome, and determination of their mechanical properties has been a topic of interest because of their potential use in nanotechnology and therapeutics. It has been demonstrated that stresses exist in virus capsids, even in their equilibrium state, due to their construction. These stresses, termed "prestresses" in this study, closely affect the capsid's mechanical behavior. Three methods—shape-based metric, atomic force microscope indentation, and molecular dynamics—have been proposed to determine the capsid elastic properties without fully accounting for prestresses. In this paper, we theoretically analyze the three methods used for mechanical characterization of virus capsids and numerically investigate how prestresses affect the capsid's mechanical properties. We consolidate all the results and propose that by using these techniques collectively, it is possible to accurately determine both the mechanical properties and prestresses in capsids.

Detecting the local transport properties and the dimensionality of transport of epitaxial graphene by a multi-point probe approach

DEFF Research Database (Denmark)

Barreto, Lucas; Perkins, Edward; Johannsen, Jens

2013-01-01

The electronic transport properties of epitaxial monolayer graphene (MLG) and hydrogen-intercalated quasi free-standing bilayer graphene (QFBLG) on SiC(0001) are investigated by micro multi-point probes. Using a probe with 12 contacts, we perform four-point probe measurements with the possibility...

Spin-polarized transport properties of Fe atomic chain adsorbed on zigzag graphene nanoribbons

International Nuclear Information System (INIS)

Zhang, Z L; Chen, Y P; Xie, Y E; Zhang, M; Zhong, J X

2011-01-01

The spin-polarized transport properties of Fe atomic chain adsorbed on zigzag graphene nanoribbons (ZGNRs) are investigated using the density-functional theory in combination with the nonequilibrium Green's function method. We find that the Fe chain has drastic effects on spin-polarized transport properties of ZGNRs compared with a single Fe atom adsorbed on the ZGNRs. When the Fe chain is adsorbed on the centre of the ZGNR, the original semiconductor transforms into metal, showing a very wide range of spin-polarized transport. Particularly, the spin polarization around the Fermi level is up to 100%. This is because the adsorbed Fe chain not only induces many localized states but also has effects on the edge states of ZGNR, which can effectively modulate the spin-polarized transports. The spin polarization of ZGNRs is sensitive to the adsorption site of the Fe chain. When the Fe chain is adsorbed on the edge of ZGNR, the spin degeneracy of conductance is completely broken. The spin polarization is found to be more pronounced because the edge state of one edge is destroyed by the additional Fe chain. These results have direct implications for the control of the spin-dependent conductance in ZGNRs with the adsorption of Fe chains.

Structural and transport properties of Sn-Mg alloys

International Nuclear Information System (INIS)

Meydaneri, F.; Saatci, E.; Oezdemir, M.; Ari, M.; Durmus, S.

2010-01-01

The structural and temperature dependence transport of Sn-Mg alloys have been investigated for five different samples (Pure Sn, Sn-1.0 wt % Mg , Sn-2.0 wt % Mg , Sn-6.0 wt.% Mg and Pure Mg). Scanning Electron Microscopy (SEM), x-ray diffraction (XRD) and Energy Dispersive x-ray Analysis (EDX) measurements were carried out in order to clarify the structural properties of the samples. It has been found that, the samples have tetragonal crystal symmetry except the pure Mg which has hexagonal crystal symmetry. The cell parameters decrease slightly with addition of Mg element. The SEM micrographs of the samples show that, the samples have smooth surfaces with clear grain boundary. There is no crack, porosity or defects on the surfaces. The electrical resistivity of the samples increases almost linearly with the increasing temperature, which were measured by four-point probe technique. The thermal conductivity values are in between 0.60-1.00 W/Km, which are decrease slightly with temperature and increase with composition of Mg. The thermal conductivity values of the alloys are in between the values of the pure samples. Thermal conductivity results of the alloys have been compared with available other studies and a good agreement has been seen between the results. In addition, the temperature coefficients of electrical resistivity and thermal conductivity have been determined, which are independent with the compositions of alloying elements

Optimizing sales areas of combined transport chains

Directory of Open Access Journals (Sweden)

Philip Michalk

2013-12-01

Full Text Available Background: Combined transport chains (such as intermodal transport, have certain advantages. The main advantage from customer points of view is the possibility to bundle freight and thereby decrease transport costs. On the other hand, a combined transport chain can cause longer transport times, due to the necessary transshipment processes. Methods: The area around a terminal, in which a combined service has favourable properties to a customer in comparison to a direct transport, can be understood as a sales-area, in which a combined transport product is marketable. The aim of this paper was to find a method to determine the best shape and size of this area. Results and conclusions: The paper at hand lined out a method in order to calculate such a sales area and determine which geographical points around a terminal have an advantage in comparison to a direct transport service.

Investigating the effect of acene-fusion and trifluoroacetyl substitution on the electronic and charge transport properties by density functional theory

Directory of Open Access Journals (Sweden)

Ahmad Irfan

2016-05-01

Full Text Available We designed novel derivatives of 4,6-di(thiophen-2-ylpyrimidine (DTP. Two benchmark strategies including mesomerically deactivating group, as well as the extension of π-conjugation bridge (acene-fusion have been employed to enhance the electrical and charge transport properties. The density functional theory (DFT and time dependent DFT methods have been used to get optimized geometries in ground and first excited state, respectively. The structural properties (geometric parameters, electronic properties (frontier molecular orbitals; highest occupied and lowest unoccupied molecular orbitals, photophysical properties (absorption, fluorescence and phosphorescence, and important charge transport properties are discussed to establish a molecular level structure–property relationship among these derivatives. Our calculated electronic spectra i.e., absorption, fluorescence and phosphorescence have been found in good semi-quantitative agreement with available experimental data. All the newly designed derivatives displayed significantly improved electron injection ability than those of the parent molecule. The values of reorganization energy and transfer integral elucidate that DTP is a potential hole transport material. Based on our present investigation, it is expected that the naphtho and anthra derivatives of DTP are better hole transporters than those of some well-known charge transporter materials like naphthalene, anthracene, tetracene and pentacene.

Transport properties of hydrogen passivated silicon nanotubes and silicon nanotube field effect transistors

KAUST Repository

Montes Muñ oz, Enrique; Schwingenschlö gl, Udo

2017-01-01

We investigate the electronic transport properties of silicon nanotubes attached to metallic electrodes from first principles, using density functional theory and the non-equilibrium Green's function method. The influence of the surface termination

Effect of spin-orbit interactions on the structural stability, thermodynamic properties, and transport properties of lead under pressure

Science.gov (United States)

Smirnov, N. A.

2018-03-01

The paper investigates the role of spin-orbit interaction in the prediction of structural stability, lattice dynamics, elasticity, thermodynamic and transport properties (electrical resistivity and thermal conductivity) of lead under pressure with the FP-LMTO (full-potential linear-muffin-tin orbital) method for the first-principles band structure calculations. Our calculations were carried out for three polymorphous lead modifications (fcc, hcp, and bcc) in generalized gradient approximation with the exchange-correlation functional PBEsol. They suggest that compared to the scalar-relativistic calculation, the account for the SO effects insignificantly influences the compressibility of Pb. At the same time, in the calculation of phonon spectra and transport properties, the role of SO interaction is important, at least, for P ≲150 GPa. At higher pressures, the contribution from SO interaction reduces but not vanishes. As for the relative structural stability, our studies show that SO effects influence weakly the pressure of the fcc →hcp transition and much higher the pressure of the hcp →bcc transition.

Characterization of transport properties in uranium dioxide: the case of the oxygen auto-diffusion

International Nuclear Information System (INIS)

Fraczkiewicz, M.; Baldinozzi, G.

2008-01-01

Point defects in uranium dioxide which control the transport phenomena are still badly known. The aim of this work is to show how in carrying out several experimental techniques, it is possible to demonstrate both the existence and to determine the nature (charge and localization) of predominant defects responsible of the transport phenomena in a fluorite-type structure oxide. The oxygen diffusion in the uranium dioxide illustrates this. In the first part of this work, the accent is put on the electric properties of uranium dioxide and more particularly on the variation laws of the electric conductivity in terms of temperature, of oxygen potential and of the impurities amounts present in the material. These evolutions are connected to point and charged complex defects models and the pertinence of these models is discussed. Besides, it is shown how the electric conductivity measurements can allow to define oxygen potential domains in which the concentrations in electronic carriers are controlled. This characterization being made, it is shown that the determination of the oxygen intrinsic diffusion coefficient and particularly its dependence to the oxygen potential and to the amount of impurity, allows to determine the main defect responsible to the atomic diffusion as well as its nature and its charge. In the second part, the experimental techniques to determine the oxygen diffusion coefficient are presented: there are the isotopic exchange technique for introducing the tracer in the material, and two techniques to characterize the diffusion profiles (SIMS and NRA). Examples of preliminary results are given for mono and polycrystalline samples. At last, from this methodology on uranium dioxide, studies considered to quantify the thermal and physicochemical effects are presented. Experiments considered with the aim to characterize the radiation diffusion in uranium dioxide are presented too. (O.M.)

From Cell to Tissue Properties-Modeling Skin Electroporation With Pore and Local Transport Region Formation.

Science.gov (United States)

Dermol-Cerne, Janja; Miklavcic, Damijan

2018-02-01

Current models of tissue electroporation either describe tissue with its bulk properties or include cell level properties, but model only a few cells of simple shapes in low-volume fractions or are in two dimensions. We constructed a three-dimensional model of realistically shaped cells in realistic volume fractions. By using a 'unit cell' model, the equivalent dielectric properties of whole tissue could be calculated. We calculated the dielectric properties of electroporated skin. We modeled electroporation of single cells by pore formation on keratinocytes and on the papillary dermis which gave dielectric properties of the electroporated epidermis and papillary dermis. During skin electroporation, local transport regions are formed in the stratum corneum. We modeled local transport regions and increase in their radii or density which affected the dielectric properties of the stratum corneum. The final model of skin electroporation accurately describes measured electric current and voltage drop on the skin during electroporation with long low-voltage pulses. The model also accurately describes voltage drop on the skin during electroporation with short high-voltage pulses. However, our results indicate that during application of short high-voltage pulses additional processes may occur which increase the electric current. Our model connects the processes occurring at the level of cell membranes (pore formation), at the level of a skin layer (formation of local transport region in the stratum corneum) with the tissue (skin layers) and even level of organs (skin). Using a similar approach, electroporation of any tissue can be modeled, if the morphology of the tissue is known.

On the statistical and transport properties of a non-dissipative Fermi-Ulam model

Science.gov (United States)

Livorati, André L. P.; Dettmann, Carl P.; Caldas, Iberê L.; Leonel, Edson D.

2015-10-01

The transport and diffusion properties for the velocity of a Fermi-Ulam model were characterized using the decay rate of the survival probability. The system consists of an ensemble of non-interacting particles confined to move along and experience elastic collisions with two infinitely heavy walls. One is fixed, working as a returning mechanism of the colliding particles, while the other one moves periodically in time. The diffusion equation is solved, and the diffusion coefficient is numerically estimated by means of the averaged square velocity. Our results show remarkably good agreement of the theory and simulation for the chaotic sea below the first elliptic island in the phase space. From the decay rates of the survival probability, we obtained transport properties that can be extended to other nonlinear mappings, as well to billiard problems.

Seasonal transport - A study to determine the seasonal effects of transporting fish from the Snake River to optimize a transportation strategy

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The goal of this U.S. Army Corps of Engineers (USACE) - funded study that began in 2004 is to determine if the smolt-to-adult return rates (SARs), transport/in-river...

Electron transport properties in InAs four-terminal ballistic junctions under weak magnetic fields

International Nuclear Information System (INIS)

Koyama, M.; Fujiwara, K.; Amano, N.; Maemoto, T.; Sasa, S.; Inoue, M.

2009-01-01

We report on the electron transport properties based on ballistic electrons under magnetic fields in four-terminal ballistic junctions fabricated on an InAs/AlGaSb heterostructure. The four-terminal junction structure is composed of two longitudinal stems with two narrow wires slanted with 30 degree from the perpendicular axis. The electron focusing peak was obtained with the bend resistance measurement. Then it was investigated the nonlinear electron transport property of potential difference between longitudinal stems due to ballistic electrons with applying direct current from narrow wires. Observed nonlinearity showed clear rectification effects which have negative polarity regardless of input voltage polarity. Although this nonlinearity was qualitatively changed due to the Lorentz force under magnetic fields, the degradation of ballistic effects on nonlinear properties were observed when the current increased to higher strength. (copyright 2009 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Influence of substitutional disorder on the electrical transport and the superconducting properties of Fe1+zTe1−x−ySexSy

International Nuclear Information System (INIS)

Rodríguez, M.G.; Polla, G.; Ramos, C.P.; Acha, C.

2015-01-01

We have carried out an investigation of the structural, magnetic, transport and superconducting properties of Fe 1+z Te 1−x−y Se x S y ceramic compounds, for z = 0 and some specific Se (0 ≤ x ≤ 0.5) and S (0 ≤ y ≤ 0.12) contents. The incorporation of Se and S to the FeTe structure produces a progressive reduction of the crystallographic parameters as well as different degrees of structural disorder associated with the differences of the ionic radius of the substituting cations. In the present study, we measure transport properties of this family of compounds and we show the direct influence of disorder in the normal and superconductor states. We notice that the structural disorder correlates with a variable range hopping conducting regime observed at temperatures T > 200 K. At lower temperatures, all the samples except the one with the highest degree of disorder show a crossover to a metallic-like regime, probably related to the transport of resilient-quasi-particles associated with the proximity of a Fermi liquid state at temperatures below the superconducting transition. Moreover, the superconducting properties are depressed only for that particular sample, in accordance to the condition that superconductivity is affected by disorder when the electronic localization length ξ L becomes smaller than the coherence length ξ SC . - Highlights: • New Fe(1 + z)Te(1−x−y)Se(x)S(y) ceramic samples were synthesized. • Structural, magnetic, transport and superconducting properties are presented. • Nonmagnetic disorder determines a VRH conduction regime near room temperature. • Superconductivity is affected by disorder

Literature Survey of Crude Oil Properties Relevant to Handling and Fire Safety in Transport.

Energy Technology Data Exchange (ETDEWEB)

Lord, David [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Luketa, Anay [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Wocken, Chad [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Schlasner, Steve [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Aulich, Ted [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Allen, Ray [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Rudeen, David Keith [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2015-03-01

Several fiery rail accidents in 2013-2015 in the U.S. and Canada carrying crude oil produced from the Bakken region of North Dakota have raised questions at many levels on the safety of transporting this, and other types of crude oil, by rail. Sandia National Laboratories was commissioned by the U.S. Department of Energy to investigate the material properties of crude oils, and in particular the so-called "tight oils" like Bakken that comprise the majority of crude oil rail shipments in the U.S. at the current time. The current report is a literature survey of public sources of information on crude oil properties that have some bearing on the likelihood or severity of combustion events that may occur around spills associated with rail transport. The report also contains background information including a review of the notional "tight oil" field operating environment, as well a basic description of crude oils and potential combustion events in rail transport. This page intentionally blank

Acropetal Auxin Transport Inhibition Is Involved in Indeterminate But Not Determinate Nodule Formation

Directory of Open Access Journals (Sweden)

Jason L. P. Ng

2018-02-01

Full Text Available Legumes enter into a symbiotic relationship with nitrogen-fixing rhizobia, leading to nodule development. Two main types of nodules have been widely studied, indeterminate and determinate, which differ in the location of the first cell division in the root cortex, and persistency of the nodule meristem. Here, we compared the control of auxin transport, content, and response during the early stages of indeterminate and determinate nodule development in the model legumes Medicago truncatula and Lotus japonicus, respectively, to investigate whether differences in auxin transport control could explain the differences in the location of cortical cell divisions. While auxin responses were activated in dividing cortical cells during nodulation of both nodule types, auxin (indole-3-acetic acid content at the nodule initiation site was transiently increased in M. truncatula, but transiently reduced in L. japonicus. Root acropetal auxin transport was reduced in M. truncatula at the very start of nodule initiation, in contrast to a prolonged increase in acropetal auxin transport in L. japonicus. The auxin transport inhibitors 2,3,5-triiodobenzoic acid and 1-N-naphthylphthalamic acid (NPA only induced pseudonodules in legume species forming indeterminate nodules, but failed to elicit such structures in a range of species forming determinate nodules. The development of these pseudonodules in M. truncatula exhibited increased auxin responses in a small primordium formed from the pericycle, endodermis, and inner cortex, similar to rhizobia-induced nodule primordia. In contrast, a diffuse cortical auxin response and no associated cortical cell divisions were found in L. japonicus. Collectively, we hypothesize that a step of acropetal auxin transport inhibition is unique to the process of indeterminate nodule development, leading to auxin responses in pericycle, endodermis, and inner cortex cells, while increased auxin responses in outer cortex cells likely

Microstructural effects on the magnetic and magneto-transport properties of electrodeposited Ni nanowire arrays

International Nuclear Information System (INIS)

Chen, Shu-Fang; Wei, Hao Han; Liu, Chuan-Pu; Hsu, C Y; Huang, J C A

2010-01-01

The magnetic and magneto-transport properties of Ni nanowire (NW) arrays, fabricated by electrodeposition in anodic-aluminum-oxide (AAO) templates, have been investigated. The AAO pores have diameters ranging from 35 to 75 nm, and the crystallinity of the Ni NW arrays could change from poly-crystalline to single-crystalline with the [111] and [110] orientations based on the electrodeposition potential. Notably, double switching magnetization loops and double-peaked magnetoresistance curves were observed in [110]-oriented NWs. The crystalline orientation of the Ni NW arrays is found to influence the corresponding magnetic and magneto-transport properties significantly. These magnetic behaviors are dominated by the competition between the magneto-crystalline and shape anisotropy.

Influence of the introduction and formation of artificial pinning centers on the transport properties of nanostructured Nb{sub 3}Sn superconducting wires

Energy Technology Data Exchange (ETDEWEB)

Da Silva, L B S; Rodrigues, C A; Bormio-Nunes, C; Oliveira, N F Jr; Rodrigues, D Jr, E-mail: lucas_sarno@ppgem.eel.usp.b, E-mail: durval@demar.eel.usp.b [Superconductivity Group, Department of Materials Engineering (DEMAR) Escola de Engenharia de Lorena (EEL), Universidade de Sao Paulo - USP Polo Urbo-Industrial, Gleba AI-6 - PO Box 116 - Lorena, SP (Brazil)

2009-05-01

The formation of nanostructures projected to act as pinning centers is presented as a highly promising technique for the transport properties optimization of superconductors. However, due to the necessity of nanometric dimensions of these pinning centers, the heat treatment (HT) profiles must be carefully analyzed. The present work describes a methodology to optimize the HT profiles in respect to diffusion, reaction and formation of the superconducting phases. After the HT, samples were removed for micro structural characterization. Measurements of transport properties were performed to analyze the influence of the introduction of artificial pinning centers (APC) on the superconducting phase and to find the flux pinning mechanism acting in these wires. Fitting the volumetric pinning force vs. applied magnetic field (F{sub p} vs. mu{sub o}H) curves of transport properties, we could determine the type and influence of flux pinning mechanism acting in the global behavior of the samples. It was concluded that the maximum current densities were obtained when normal phases (due to the introduction of the APCs) are the most efficient pinning centers in the global behavior of the samples. The use of HT with profile 220{sup 0}C/100h+575{sup 0}C/50h+650{sup 0}C/100h was found as the best treatment for these nanostructured superconducting wires.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

The influence of Ga{sup +} irradiation on the transport properties of mesoscopic conducting thin films

Energy Technology Data Exchange (ETDEWEB)

Barzola-Quiquia, J; Dusari, S; Bridoux, G; Bern, F; Molle, A; Esquinazi, P, E-mail: j.barzola@physik.uni-leipzig.de, E-mail: esquin@physik.uni-leipzig.de [Division of Superconductivity and Magnetism, Universitaet Leipzig, Linnestrasse 5, D-04103 Leipzig (Germany)

2010-04-09

We studied the influence of 30 keV Ga{sup +}-ions-commonly used in focused-ion-beam (FIB) devices-on the transport properties of thin crystalline graphite flakes, and La{sub 0.7}Ca{sub 0.3}MnO{sub 3} and Co thin films. The changes in electrical resistance were measured in situ during irradiation and also the temperature and magnetic field dependence before and after irradiation. Our results show that the transport properties of these materials strongly change at Ga{sup +} fluences much below those used for patterning and ion-beam-induced deposition (IBID), seriously limiting the use of FIB when the intrinsic properties of the materials of interest are of importance. We present a method that can be used to protect the sample as well as to produce selectively irradiation-induced changes.

Human skeletal muscle drug transporters determine local exposure and toxicity of statins.

Science.gov (United States)

Knauer, Michael J; Urquhart, Bradley L; Meyer zu Schwabedissen, Henriette E; Schwarz, Ute I; Lemke, Christopher J; Leake, Brenda F; Kim, Richard B; Tirona, Rommel G

2010-02-05

The 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors, or statins, are important drugs used in the treatment and prevention of cardiovascular disease. Although statins are well tolerated, many patients develop myopathy manifesting as muscle aches and pain. Rhabdomyolysis is a rare but severe toxicity of statins. Interindividual differences in the activities of hepatic membrane drug transporters and metabolic enzymes are known to influence statin plasma pharmacokinetics and risk for myopathy. Interestingly, little is known regarding the molecular determinants of statin distribution into skeletal muscle and its relevance to toxicity. We sought to identify statin transporters in human skeletal muscle and determine their impact on statin toxicity in vitro. We demonstrate that the uptake transporter OATP2B1 (human organic anion transporting polypeptide 2B1) and the efflux transporters, multidrug resistance-associated protein (MRP)1, MRP4, and MRP5 are expressed on the sarcolemmal membrane of human skeletal muscle fibers and that atorvastatin and rosuvastatin are substrates of these transporters when assessed using a heterologous expression system. In an in vitro model of differentiated, primary human skeletal muscle myoblast cells, we demonstrate basal membrane expression and drug efflux activity of MRP1, which contributes to reducing intracellular statin accumulation. Furthermore, we show that expression of human OATP2B1 in human skeletal muscle myoblast cells by adenoviral vectors increases intracellular accumulation and toxicity of statins and such effects were abrogated when cells overexpressed MRP1. These results identify key membrane transporters as modulators of skeletal muscle statin exposure and toxicity.

Enhancement in transport properties of seeded melt-textured YBCO by Cu-site doping

Energy Technology Data Exchange (ETDEWEB)

Zhou, Yu X. [Department of Physics, Hong Kong Baptist University, Kowloon (China); Texas Center for Superconductivity and Department of Mechanical Engineering, University of Houston, Houston, TX (United States); Lo, W.; Salama, Kamel [Texas Center for Superconductivity and Department of Mechanical Engineering, University of Houston, Houston, TX (United States); Tang, Tong B. [Department of Physics, Hong Kong Baptist University, Kowloon (China)

2002-05-01

A significant research effort has been made worldwide to introduce nanometre-scale weak superconducting regions into seeded melt-textured superconductors to enhance their critical current density, trapped magnetic field and levitation force. The enhancement in these properties is dependent on the pinning forces exerted on the magnetic flux lines. In this paper we present a substantial improvement in the transport properties of these materials by optimizing the fabrication conditions, controlling the oxygen deficiency, as well as adjusting the doping level of Zn in YBa{sub 2}(Cu{sub 1-x}Zn{sub x}){sub 3}O{sub 7-}{delta} large grains. The enhancement is found to be as much as 30% by doping between about x=0.001 25 and 0.002 53. The results strongly indicate that the introduction of local nanometre-scale weak superconducting regions by Zn substitution for Cu in the CuO{sub 2} plane enhances the transport properties. Due to the simplicity of the processing conditions, these doping techniques can have a significant potential for a variety of engineering applications. (author)

Studies on groundwater transport in fractured crystalline rock under controlled conditions using nonradioactive tracers

International Nuclear Information System (INIS)

Gustafsson, E.; Klockars, C.-E.

1981-04-01

The purpose of the investigation has been study the following parameters along existing fractures between two boreholes: hydraulic properties of rock mass and fractures; adsorptive properties of some selected tracers during transport along fractures; dispersivity and dilution of tracers during transport in fractures; kinematic porosity of fractured bedrock. The procedure has been to determine the hydraulic properties of a rock mass by means of conventional hydraulic testing methods in 100 m deep boreholes, and to study transport mechanisms and properties of selected tracers in a selected fracture zone between two boreholes. (Auth.)

Proton transport properties in zwitterion blends with Brønsted acids.

Science.gov (United States)

Yoshizawa-Fujita, Masahiro; Byrne, Nolene; Forsyth, Maria; MacFarlane, Douglas R; Ohno, Hiroyuki

2010-12-16

We describe zwitterion, 3-(1-butyl-1H-imidazol-3-ium-3-yl)propane-1-sulfonate (Bimps), mixtures with 1,1,1-trifluoro-N-(trifluoromethylsulfonyl)methanesulfoneamide (HN(Tf)(2)) as new proton transport electrolytes. We report proton transport mechanisms in the mixtures based on results from several methods including thermal analyses, the complex-impedance method, and the pulsed field gradient spin echo NMR (pfg-NMR) method. The glass transition temperature (Tg) of the mixtures decreased with increasing HN(Tf)(2) concentration up to 50 mol %. The Tg remained constant at -55 °C with further acid doping. The ionic conductivity of HN(Tf)(2) mixtures increased with the HN(Tf)(2) content up to 50 mol %. Beyond that ratio, the mixtures showed no increase in ionic conductivity (10(-4) S cm(-1) at room temperature). This tendency agrees well with that of Tg. However, the self-diffusion coefficients obtained from the pfg-NMR method increased with HN(Tf)(2) content even above 50 mol % for all component ions. At HN(Tf)(2) 50 mol %, the proton diffusion of HN(Tf)(2) was the fastest in the mixture. These results suggest that Bimps cannot dissociate excess HN(Tf)(2), that is, the excess HN(Tf)(2) exists as molecular HN(Tf)(2) in the mixtures. The zwitterion, Bimps, forms a 1:1 complex with HN(Tf)(2) and the proton transport property in this mixture is superior to those of other mixing ratios. Furthermore, CH(3)SO(3)H and CF(3)SO(3)H were mixed with Bimps for comparison. Both systems showed a similar tendency, which differed from that of the HN(Tf)(2) system. The Tg decreased linearly with increasing acid content for every mixing ratio, while the ionic conductivity increased linearly. Proton transport properties in zwitterion/acid mixtures were strongly affected by the acid species added.

Structural, magnetic and magneto-transport properties of thermally evaporated Fe/Cu multilayers

Energy Technology Data Exchange (ETDEWEB)

Bouziane, K.; Al-Busaidi, M.; Gismelseed, A.; Al-Rawas, A. [Physics Department, College of Science, Sultan Qabos University, P. O. Box 36, Postal Code 123, Al-Khodh, Muscat (Oman)

2004-05-01

Structural, magnetic and magneto-transport properties of thermally evaporated Fe/Cu multilayers (MLs) have been investigated. Although multilayered structure has been successfully obtained, a substantial interfacial roughness ranging from 0.6 nm to 1.2 nm has been determined. All Fe/Cu MLs were polycrystalline with an average grain size of about 10 nm. Fe was bcc and textured (110) whereas Cu was fcc(111). Transmission electron microscopy analysis showed that the fcc Cu layer was rather textured (110) and (100) at least in the first stage of growth of the Fe/Cu MLs. Conversion electron Moessbauer (CEMS) measurements indicated the existence of three phases. Two of them were magnetic with a dominant bcc Fe phase, followed by fcc Fe phase. The third phase was superparamagnetic. The CEMS results were explained in terms of the partial diffusion of Fe into Cu with three different zones. The small magnetoresistance (MR<0.2%) was correlated to Fe clusters located at Fe-Cu interfaces. (Abstract Copyright [2004], Wiley Periodicals, Inc.)

Spin-dependent transport properties of oleic acid molecule self-assembled La0.7Sr0.3MnO3 nanoparticles

International Nuclear Information System (INIS)

Xi, L.; Du, J.H.; Ma, J.H.; Wang, Z.; Zuo, Y.L.; Xue, D.S.

2013-01-01

Highlights: ► Spin-dependent transport property of LSMO/oleic acid nanoparticles is investigated. ► Transport properties and MR measured by Cu/nanoparticle assembly/elargol device. ► Non-linear I–V curve indicates a tunneling type transport properties. ► Tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting I–V curves. ► LFMR of LSMO/oleic acid molecules value reaches −18% with current of 0.1 μA at 10 K. - Abstract: Spin-dependent transport property through molecules is investigated using a monolayer of oleic acid molecule self-assembled half metallic La 0.7 Sr 0.3 MnO 3 (LSMO) nanoparticles, which was synthesized using a coprecipitation method. Fourier transform infrared spectroscopy was used to confirm that one-monolayer oleic acid molecules chemically bond to the LSMO nanoparticles. The transport properties and magnetoresistance (MR) effect of the oleic acid molecule coated LSMO nanoparticles were measured by a direct current four probes method using a Cu/nanoparticle assembly/elargol electrode sandwich device with various temperatures and bias voltages. The non-linear I–V curve indicates a tunneling type transport properties. The tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting the I–V curve according to the Simmons equation. The magnetoresistance curves can be divided to high-field MR and low-field MR (LFMR) parts. The former is ascribed to the influence of spin disorder or canting within the LSMO nanoparticle surface and the latter one with strong bias dependence is attributed to the spin-dependent tunneling effect through the insulating surface layer of LSMO and oleic acid molecules. The enhanced LFMR effect for oleic acid coated LSMO with respect to the bare LSMO was attributed to the enhanced tunneling transport and weak spin scattering in oleic acid molecule barrier.

Transport Properties of the Organic Conductor (TMTSF)2BrO4: Evidence of Variable Range Hopping

DEFF Research Database (Denmark)

Mortensen, Kell; Jacobsen, Claus Schelde; Bechgaard, Klaus

1984-01-01

A study of d.c. and microwave conductivity and thermoelectric power of the organic conductor (TMTSF)2BrO4 is presented. The transport properties are in qualitative agreement with charge transport via variable-range hopping among localized states. The localization is attributed to the anions, which...

Influence of structural properties on ballistic transport in nanoscale epitaxial graphene cross junctions

International Nuclear Information System (INIS)

Bock, Claudia; Weingart, Sonja; Karaissaridis, Epaminondas; Kunze, Ulrich; Speck, Florian; Seyller, Thomas

2012-01-01

In this paper we investigate the influence of material and device properties on the ballistic transport in epitaxial monolayer graphene and epitaxial quasi-free-standing monolayer graphene. Our studies comprise (a) magneto-transport in two-dimensional (2D) Hall bars, (b) temperature- and magnetic-field-dependent bend resistance of unaligned and step-edge-aligned orthogonal cross junctions, and (c) the influence of the lead width of the cross junctions on ballistic transport. We found that ballistic transport is highly sensitive to scattering at the step edges of the silicon carbide substrate. A suppression of the ballistic transport is observed if the lead width of the cross junction is reduced from 50 nm to 30 nm. In a 50 nm wide device prepared on quasi-free-standing graphene we observe a gradual transition from the ballistic into the diffusive transport regime if the temperature is increased from 4.2 to about 50 K, although 2D Hall bars show a temperature-independent mobility. Thus, in 1D devices additional temperature-dependent scattering mechanisms play a pivotal role. (paper)

Red cell properties after different modes of blood transportation

Directory of Open Access Journals (Sweden)

Asya Makhro

2016-07-01

Full Text Available Transportation of blood samples is unavoidable for assessment of specific parameters in blood of patients with rare anemias, blood doping testing or for research purposes. Despite the awareness that shipment may substantially alter multiple parameters, no study of that extend has been performed to assess these changes and optimize shipment conditions to reduce transportation-related artifacts. Here we investigate the changes in multiple parameters in blood of healthy donors over 72 hours of simulated shipment conditions. Three different anticoagulants (K3EDTA, Sodium Heparin and citrate-based CPDA for two temperatures (4oC and room temperature were tested to define the optimal transportation conditions. Parameters measured cover common cytology and biochemistry parameters (complete blood count, hematocrit, morphological examination, red blood cell (RBC volume, ion content and density, membrane properties and stability (hemolysis, osmotic fragility, membrane heat stability, patch-clamp investigations and formation of micro vesicles, Ca2+ handling, RBC metabolism, activity of numerous enzymes and O2 transport capacity. Our findings indicate that individual sets of parameter may require different shipment settings (anticoagulants, temperature. Most of the parameters except for ion (Na+, K+, Ca2+ handling and, possibly, reticulocytes counts, tend to favor transportation at 4oC. Whereas plasma and intraerythrocytic Ca2+ cannot be accurately measured in the presence of chelators such as citrate and EDTA, majority of Ca2+-dependent parameters are stabilized in CPDA samples. Even in blood samples from healthy donors transported using optimized shipment protocol the majority of parameters were stable within 24 hours, the condition that may not hold for the samples of patients with rare anemias. This implies for the as short as possible shipping using fast courier services to the closest expert laboratory at reach. Mobile laboratories or the travel of the

Effect of surface roughness scattering on the transport properties of a 2DEG

International Nuclear Information System (INIS)

Yarar, Z.

2004-01-01

In this work surface roughness scattering of electrons in a two dimensional electron gas (2DEG) formed at heterojunction interfaces is investigated for various auto-correlation functions. Gaussian, exponential and Lorentzian auto-correlation functions are used to represent surface roughness. Poisson and Schrodinger equations are solved self consistently at the hetero interface to find the energy levels, the wave functions corresponding to each level and electron concentrations at each level. Using these wave functions and the auto-correlation functions mentioned above, the scattering rates due to surface roughness are calculated. Scattering rates resulting from acoustic and optical phonons are also calculated. These rates are used to study the transport properties of the two dimensional electrons using ensemble Monte Carlo method at various temperatures. Emphasis is given to the effect of surface roughness scattering on the transport properties of the electrons

Determination of Matrix Diffusion Properties of Granite

International Nuclear Information System (INIS)

Holtta, Pirkko; Siitari-Kauppi, Marja; Huittinen, Nina; Poteri, Antti

2007-01-01

Rock-core column experiments were introduced to estimate the diffusion and sorption properties of Kuru Grey granite used in block-scale experiments. The objective was to examine the processes causing retention in solute transport through rock fractures, especially matrix diffusion. The objective was also to estimate the importance of retention processes during transport in different scales and flow conditions. Rock-core columns were constructed from cores drilled into the fracture and were placed inside tubes to form flow channels in the 0.5 mm gap between the cores and the tube walls. Tracer experiments were performed using uranin, HTO, 36 Cl, 131 I, 22 Na and 85 Sr at flow rates of 1-50 μL.min -1 . Rock matrix was characterized using 14 C-PMMA method, scanning electron microscopy (SEM), energy dispersive X-ray micro analysis (EDX) and the B.E.T. method. Solute mass flux through a column was modelled by applying the assumption of a linear velocity profile and molecular diffusion. Coupling of the advection and diffusion processes was based on the model of generalised Taylor dispersion in the linear velocity profile. Experiments could be modelled applying a consistent parameterization and transport processes. The results provide evidence that it is possible to investigate matrix diffusion at the laboratory scale. The effects of matrix diffusion were demonstrated on the slightly-sorbing tracer breakthrough curves. Based on scoping calculations matrix diffusion begins to be clearly observable for non-sorbing tracer when the flow rate is 0.1 μL.min -1 . The experimental results presented here cannot be transferred directly to the spatial and temporal scales that prevail in an underground repository. However, the knowledge and understanding of transport and retention processes gained from this study is transferable to different scales from laboratory to in-situ conditions. (authors)

An Assessment of Transport Property Estimation Methods for Ammonia–Water Mixtures and Their Influence on Heat Exchanger Size

DEFF Research Database (Denmark)

Kærn, Martin Ryhl; Modi, Anish; Jensen, Jonas Kjær

2015-01-01

Transport properties of fluids are indispensable for heat exchanger design. The methods for estimating the transport properties of ammonia–water mixtures are not well established in the literature. The few existent methods are developed from none or limited, sometimes inconsistent experimental...... of ammonia–water mixtures. Firstly, the different methods are introduced and compared at various temperatures and pressures. Secondly, their individual influence on the required heat exchanger size (surface area) is investigated. For this purpose, two case studies related to the use of the Kalina cycle...... the interpolative methods in contrast to the corresponding state methods. Nevertheless, all possible mixture transport property combinations used herein resulted in a heat exchanger size within 4.3 % difference for the flue-gas heat recovery boiler, and within 12.3 % difference for the oil-based boiler....

1D-transport properties of single superconducting lead nanowires

DEFF Research Database (Denmark)

Michotte, S.; Mátéfi-Tempfli, Stefan; Piraux, L.

2003-01-01

of the nanowire is small enough to ensure a 1D superconducting regime in a wide temperature range below T. The non-zero resistance in the superconducting state and its variation caused by fluctuations of the superconducting order parameter were measured versus temperature, magnetic field, and applied DC current......We report on the transport properties of single superconducting lead nanowires grown by an electrodeposition technique, embedded in a nanoporous track-etched polymer membrane. The nanowires are granular, have uniform diameter of ̃40 nm and a very large aspect ratio (̃500). The diameter...

Reference dataset of volcanic ash physicochemical and optical properties for atmospheric measurement retrievals and transport modelling

Science.gov (United States)

Vogel, Andreas; Durant, Adam; Sytchkova, Anna; Diplas, Spyros; Bonadonna, Costanza; Scarnato, Barbara; Krüger, Kirstin; Kylling, Arve; Kristiansen, Nina; Stohl, Andreas

2016-04-01

Explosive volcanic eruptions emit up to 50 wt.% (total erupted mass) of fine ash particles (estimates of the volcanic source term and the nature of the constituent volcanic ash properties. Consequently, it is important to include a quantitative assessment of measurement uncertainties of ash properties to provide realistic ash forecast uncertainty. Currently, information on volcanic ash physicochemical and optical properties is derived from a small number of somewhat dated publications. In this study, we provide a reference dataset for physical (size distribution and shape), chemical (bulk vs. surface chemistry) and optical properties (complex refractive index in the UV-vis-NIR range) of a representative selection of volcanic ash samples from 10 different volcanic eruptions covering the full variability in silica content (40-75 wt.% SiO2). Through the combination of empirical analytical methods (e.g., image analysis, Energy Dispersive Spectroscopy, X-ray Photoelectron Spectroscopy, Transmission Electron Microscopy and UV/Vis/NIR/FTIR Spectroscopy) and theoretical models (e.g., Bruggeman effective medium approach), it was possible to fully capture the natural variability of ash physicochemical and optical characteristics. The dataset will be applied in atmospheric measurement retrievals and atmospheric transport modelling to determine the sensitivity to uncertainty in ash particle characteristics.

Study of transport properties of bodies with a perovskite structure: application to the MgSiO3 perovskite

International Nuclear Information System (INIS)

Kapusta, Benedicte

1990-01-01

After some recalls on transport in ionic solids (Nernst-Einstein relationship, variation of ionic conductivity, hybrid conduction, fast ionic conduction), this research thesis presents the physical properties of perovskites and more particularly the structure and stability of the MgSiO 3 perovskite: structure and elastic properties, electric conductivity and transport properties in compounds with a perovskite structure. Then, the author reports the experimental study of the KZnF 3 perovskite (a structural analogous of MgSiO 3 ): measurements of electric conductivity under pressure, measurements under atmospheric pressure, result discussion. The next part addresses the numerical simulation of MgSiO 3 : simulation techniques (generalities on molecular dynamics, model description), investigation of structural, elastic and thermodynamic properties, diffusion properties in quadratic phase [fr

Transport Properties of the Nuclear Pasta Phase with Quantum Molecular Dynamics

Science.gov (United States)

Nandi, Rana; Schramm, Stefan

2018-01-01

We study the transport properties of nuclear pasta for a wide range of density, temperature, and proton fractions, relevant for different astrophysical scenarios adopting a quantum molecular dynamics model. In particular, we estimate the values of shear viscosity as well as electrical and thermal conductivities by calculating the static structure factor S(q) using simulation data. In the density and temperature range where the pasta phase appears, the static structure factor shows irregular behavior. The presence of a slab phase greatly enhances the peak in S(q). However, the effect of irregularities in S(q) on the transport coefficients is not very dramatic. The values of all three transport coefficients are found to have the same orders of magnitude as found in theoretical calculations for the inner crust matter of neutron stars without the pasta phase; therefore, the values are in contrast to earlier speculations that a pasta layer might be highly resistive, both thermally and electrically.

Ballistic transport and electronic structure

NARCIS (Netherlands)

Schep, Kees M.; Kelly, Paul J.; Bauer, Gerrit E.W.

1998-01-01

The role of the electronic structure in determining the transport properties of ballistic point contacts is studied. The conductance in the ballistic regime is related to simple geometrical projections of the Fermi surface. The essential physics is first clarified for simple models. For real

Transport phenomena

International Nuclear Information System (INIS)

Kirczenow, G.; Marro, J.

1974-01-01

Some simple remarks on the basis of transport theory. - Entropy, dynamics and scattering theory. - Response, relaxation and fluctuation. - Fluctuating hydrodynamics and renormalization of susceptibilities and transport coefficients. - Irreversibility of the transport equations. - Ergodic theory and statistical mechanics. - Correlation functions in Heisenberg magnets. - On the Enskog hard-sphere kinetic eqquation and the transport phenomena of dense simple gases. - What can one learn from Lorentz models. - Conductivity in a magnetic field. - Transport properties in gases in presence of external fields. - Transport properties of dilute gases with internal structure. (orig.) [de

Children's GPS-determined versus self-reported transport in leisure time and associations with parental perceptions of the neighborhood environment

DEFF Research Database (Denmark)

Vanwolleghem, Griet; Schipperijn, Jasper; Gheysen, Freja

2016-01-01

measured transport in leisure time and filled out a diary to assess self-reported transport in leisure time. Parents completed a questionnaire to assess parental perceptions of the neighborhood environment. Pearson correlations and t-tests were used to test for concurrent validity and differences between...... GPS-determined and self-reported transport in leisure time. Generalized linear models were used to determine the associations between the parental perceptions of the neighborhood environment and GPS-determined transport in leisure time. RESULTS: Overall, children under-reported their walking......BACKGROUND: This study aimed to examine both GPS-determined and self-reported walking, cycling and passive transport in leisure time during week- and weekend-days among 10 to 12-year old children. Comparisons between GPS-determined and self-reported transport in leisure time were investigated...

Notification determining details of technical standards concerning transport of radioisotopes or goods contaminated by radioisotopes in works or enterprises

International Nuclear Information System (INIS)

1981-01-01

This rule is established under the provisions of the regulation for the execution of the law on the prevention of radiation injuries by radioisotopes. Terms are used in this rule for the same meanings as in the regulation. The limit of the concentration of radioisotopes in the goods contaminated by these isotopes which are not required to be sealed in containers defined by the Director General of the Science and Technology Agency is 1/10,000 of the value A 2 under the notification determining the details of technical standards concerning the transport of radioisotopes or the goods contaminated by radioisotopes outside works or enterprises. The application for the permission of transporting the goods which are highly difficult to be sealed in containers shall list names and addresses, the kinds, quantities, shapes and properties of the transported goods contaminated by radioisotopes, etc. The radiation dose rate of transported goods and vehicles under the regulation is 200 milli-rem an hour on the surfaces of these goods, vehicles and containers, and 10 milli-rem an hour at the distance of 1 meter from their surfaces. The permissible exposure dose of the persons engaging in transport is 1.5 rem a year. Dangerous goods, signs, and the application for the approval of special measures are specified, respectively. (Okada, K.)

The electronic transport properties of defected bilayer sliding armchair graphene nanoribbons

Science.gov (United States)

Mohammadi, Amin; Haji-Nasiri, Saeed

2018-04-01

By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of perfect and defected bilayer armchair graphene nanoribbons (BAGNRs) under finite bias. Two typical defects which are placed in the middle of top layer (i.e. single vacancy (SV) and stone wale (SW) defects) are examined. The results reveal that in both perfect and defected bilayers, the maximum current refers to β-AB, AA and α-AB stacking orders, respectively, since the intermolecular interactions are stronger in them. Moreover it is observed that a SV decreases the current in all stacking orders, but the effects of a SW defect is nearly unpredictable. Besides, we introduced a sequential switching behavior and the effects of defects on the switching performance is studied as well. We found that a SW defect can significantly improve the switching behavior of a bilayer system. Transmission spectrum, band structure, molecular energy spectrum and molecular projected self-consistent Hamiltonian (MPSH) are analyzed subsequently to understand the electronic transport properties of these bilayer devices which can be used in developing nano-scale bilayer systems.

Molecular structure, photoluminescent and electroluminescent properties of bis(2-(4-methyl-2-hydroxyphenyl)benzothiazolate) zinc with excellent electron-transport characteristics

International Nuclear Information System (INIS)

Xu Huixia; Xu Bingshe; Fang Xiaohong; Yue Yan; Chen Liuqing; Wang Hua; Hao Yuying

2011-01-01

Highlights: → The synthesis, crystal structure and photophysical properties of Zn(4-MeBTZ) 2 were reported. → The electron-transport property was investigated by theoretical calculations and experimental. → We found that Zn(4-MeBTZ) 2 has a higher electron mobility than that of [Zn(BTZ) 2 ] 2 and the devices based on it have a lower turn-on voltage. - Abstract: In this article, the molecular structure, photoluminescent and electroluminescent properties of bis(2-(4-methyl-2-hydroxyphenyl) benzothiazolate) zinc (Zn(4-MeBTZ) 2 ) with good electron-transport characteristics were reported. This complex was identified as triclinic structure with the strong intermolecular π-π stacking interactions between the benzothiazolate/phenoxido rings and weak intramolecular hydrogen bonds by X-ray single-crystal diffraction. Quantum chemical method has been employed to investigate electron structure and charge transport property. The blue-green light emission was observed by fabricating double-layer devices using Zn(4-MeBTZ) 2 as electron-transport and NPB as hole-transport material. The performance of organic light-emitting devices based on Zn(4-MeBTZ) 2 is much better than that of the devices based on [Zn(BTZ) 2 ] 2 .

Determination of the transport levels in thin films of organic semiconductors

Energy Technology Data Exchange (ETDEWEB)

Krause, Stefan

2009-07-27

The approach of using the combination of Ultraviolet (UPS) and Inverse Photoemission (IPS) to determine the transport levels in thin films of organic semiconductors is the scope of this work. For this matter all influences on the peak position and width in Photoelectron Spectroscopy are discussed with a special focus on organic semiconductors. Many of these influences are shown with experimental results of the investigation of diindenoperylene on Ag(111). These findings are applied to inorganic semiconductors silicon in order to establish the use of UPS and IPS on a well-understood system. Finally, the method is used to determine the transport level of several organic semiconductors (PTCDA, Alq3, CuPc, DIP, PBI-H4) and the corresponding exciton binding energies are calculated by comparison to optical absorption data. (orig.)

Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

Science.gov (United States)

Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

2016-02-01

Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

Pressure tuning of the electrical transport properties of the Weyl semimetal NbP

Energy Technology Data Exchange (ETDEWEB)

Reis, Ricardo dos; Ajeesh, M.O.; Sun, Yan; Shekhar, Chandra; Schmidt, Marcus; Felser, Claudia; Yan, Binghai; Nicklas, Michael [Max Planck Institute for Chemical Physics of Solids, Dresden (Germany)

2016-07-01

Recently enormous attention has been given to a class of material called Weyl semimetal (WSM) due to the prediction of many exotic phenomena, in particular exceptional transport properties, making these systems not only interesting for fundamental research, but also promising materials for novel applications. WSM can be viewed as the hybrid of 3D graphene and topological insulators. The band crossing point, the so-called Weyl point, acts as a magnetic monopole (a singular point of Berry curvature) in momentum space, which always comes in a pairs. If the time-reversal and inversion symmetries are respected, a pair of Weyl points is degenerate in energy, forming another topological phase called Dirac semimetal. Owing this complex band structure the details of the electronic structure can play a significant role in the electrical transport properties of these materials. In this context, external pressure is an important control parameter to effectively tune lattice structures and the corresponding electronic states in a systematic fashion, avoiding the complexity brought by chemical doping. Here, we present a high pressure study of the magnetotransport properties of the Weyl semimetal NbP, which are particularly important to explore novel phenomena and understand the physics behind.

Calculation of thermophysical properties of sodium

International Nuclear Information System (INIS)

Fink, J.K.; Leibowitz, L.

1981-01-01

The thermodynamic properties of sodium previously recommended by Padilla have been updated. As much as possible, the approach described by Padilla has been used. For sodium in the states of saturated liquid and vapor, subcooled liquid and superheated vapor, the following thermodynamic properties were determined: enthalpy, heat capacity (constant pressure and constant volume), pressure, density, thermal-expansion coefficient, and compressibility (adiabatic and isothermal). In addition to the above properties, thermodynamic properties including heat of fusion, heat of vaporization, surface tension, speed of sound and transport properties of themal conductivity, thermal diffusivity, emissivity, and viscosity were determined for saturated sodium

Modeling silica aerogel optical performance by determining its radiative properties

Directory of Open Access Journals (Sweden)

Lin Zhao

2016-02-01

Full Text Available Silica aerogel has been known as a promising candidate for high performance transparent insulation material (TIM. Optical transparency is a crucial metric for silica aerogels in many solar related applications. Both scattering and absorption can reduce the amount of light transmitted through an aerogel slab. Due to multiple scattering, the transmittance deviates from the Beer-Lambert law (exponential attenuation. To better understand its optical performance, we decoupled and quantified the extinction contributions of absorption and scattering separately by identifying two sets of radiative properties. The radiative properties are deduced from the measured total transmittance and reflectance spectra (from 250 nm to 2500 nm of synthesized aerogel samples by solving the inverse problem of the 1-D Radiative Transfer Equation (RTE. The obtained radiative properties are found to be independent of the sample geometry and can be considered intrinsic material properties, which originate from the aerogel’s microstructure. This finding allows for these properties to be directly compared between different samples. We also demonstrate that by using the obtained radiative properties, we can model the photon transport in aerogels of arbitrary shapes, where an analytical solution is difficult to obtain.

Modeling silica aerogel optical performance by determining its radiative properties

Science.gov (United States)

Zhao, Lin; Yang, Sungwoo; Bhatia, Bikram; Strobach, Elise; Wang, Evelyn N.

2016-02-01

Silica aerogel has been known as a promising candidate for high performance transparent insulation material (TIM). Optical transparency is a crucial metric for silica aerogels in many solar related applications. Both scattering and absorption can reduce the amount of light transmitted through an aerogel slab. Due to multiple scattering, the transmittance deviates from the Beer-Lambert law (exponential attenuation). To better understand its optical performance, we decoupled and quantified the extinction contributions of absorption and scattering separately by identifying two sets of radiative properties. The radiative properties are deduced from the measured total transmittance and reflectance spectra (from 250 nm to 2500 nm) of synthesized aerogel samples by solving the inverse problem of the 1-D Radiative Transfer Equation (RTE). The obtained radiative properties are found to be independent of the sample geometry and can be considered intrinsic material properties, which originate from the aerogel's microstructure. This finding allows for these properties to be directly compared between different samples. We also demonstrate that by using the obtained radiative properties, we can model the photon transport in aerogels of arbitrary shapes, where an analytical solution is difficult to obtain.

Investigation of transport properties of FeTe compound

Science.gov (United States)

Lodhi, Pavitra Devi; Solanki, Neha; Choudhary, K. K.; Kaurav, Netram

2018-05-01

Transport properties of FeTe parent compound has been investigated by measurements of electrical resistivity, magnetic susceptibility and Seebeck coefficient. The sample was synthesized through a standard solid state reaction route via vacuum encapsulation and characterized by x-ray diffraction, which indicated a tetragonal phase with space group P4/nmm. The parent FeTe compound does not exhibit superconductivity but shows an anomaly in the resistivity measurement at around 67 K, which corresponds to a structural phase transition along with in the vicinity of a magnetic phase transition. In the low temperature regime, Seebeck coefficient, S(T), exhibited an anomalous dip feature and negative throughout the temperature range, indicating electron-like charge carrier conduction mechanism.

In-Plane Magnetic Field Effect on the Transport Properties in a Quasi-3D Quantum Well Structure

International Nuclear Information System (INIS)

Brooks, J.; Clark, R.; Lumpkin, N.; O'Brien, J.; Reno, J.; Simmons, J.; Wang, Z.; Zhang, B.

1999-01-01

The transport properties of a quasi-three-dimensional, 200 layer quantum well structure are investigated at integer filling in the quantum Hall state. We find that the transverse magnetoresistance R xx , the Hall resistance R xy , and the vertical resistance R zz all follow a similar behavior with both temperature and in-plane magnetic field. A general feature of the influence of increasing in-plane field B in is that the Hall conductance quantization first improves, but above a characteristic value B C in , the quantization is systematically removed. We consider the interplay of the chid edge state transport and the bulk (quantum Hall) transport properties. This mechanism may arise from the competition of the cyclotron energy with the superlattice band structure energies. A comparison of the resuIts with existing theories of the chiral edge state transport with in-plane field is also discussed

The obtaining and properties of asymmetric ion transport membrane for separating of oxygen from air

Science.gov (United States)

Solovieva, A. A.; Kulbakin, I. V.

2018-04-01

The bilayer oxygen-permeable membrane, consisting of a thin-film dense composite based on Co3O4 - 36 wt. % Bi2O3, and of a porous ceramic substrate of Co2SiO4, was synthesized and characterized. The way for obtaining of porous ceramic based on cobalt silicate was found, while the microstructure and the mechanical properties of porous ceramic were studied. Layered casting with post-pressing was used to cover the surface of porous support of Co2SiO4 by the Co3O4 - 36 wt. % Bi2O3 - based film. Transport properties of the asymmetric membrane have been studied, the kinetic features of oxygen transport have been established, and the characteristic thickness of the membrane has been estimated. The methods to prevent the high-temperature creep of ion transport membranes based on solid/molten oxides, which are the promising ones for obtaining of pure oxygen from air, are proposed and discussed.

Electronic Structure and Transport in Solids from First Principles

Science.gov (United States)

Mustafa, Jamal Ibrahim

The focus of this dissertation is the determination of the electronic structure and trans- port properties of solids. We first review some of the theory and computational methodology used in the calculation of electronic structure and materials properties. Throughout the dissertation, we make extensive use of state-of-the-art software packages that implement density functional theory, density functional perturbation theory, and the GW approximation, in addition to specialized methods for interpolating matrix elements for extremely accurate results. The first application of the computational framework introduced is the determination of band offsets in semiconductor heterojunctions using a theory of quantum dipoles at the interface. This method is applied to the case of heterojunction formed between a new metastable phase of silicon, with a rhombohedral structure, and cubic silicon. Next, we introduce a novel method for the construction of localized Wannier functions, which we have named the optimized projection functions method (OPFM). We illustrate the method on a variety of systems and find that it can reliably construct localized Wannier functions with minimal user intervention. We further develop the OPFM to investigate a class of materials called topological insulators, which are insulating in the bulk but have conductive surface states. These properties are a result of a nontrivial topology in their band structure, which has interesting effects on the character of the Wannier functions. In the last sections of the main text, the noble metals are studied in great detail, including their electronic properties and carrier dynamics. In particular, we investigate, the Fermi surface properties of the noble metals, specifically electron-phonon scattering lifetimes, and subsequently the transport properties determined by carriers on the Fermi surface. To achieve this, a novel sampling technique is developed, with wide applicability to transport calculations

Direct Simulation of Transport Properties from Three-Dimensional (3D) Reconstructed Solid-Oxide Fuel-Cell (SOFC) Electrode Microstructures

International Nuclear Information System (INIS)

Gunda, Naga Siva Kumar; Mitra, Sushanta K

2012-01-01

A well-known approach to develop a high efficiency solid-oxide fuel-cell (SOFC) consists of extracting the microstructure and transport properties such as volume fractions, internal surface area, geometric connectivity, effective gas diffusivity, effective electronic conductivity and geometric tortuosities from three-dimensional (3D) microstructure of the SOFC electrodes; thereafter, performing the SOFC efficiency calculations using previously mentioned quantities. In the present work, dual-beam focused ion beam - scanning electron microscopy (FIB-SEM) is applied on one of the SOFC cathodes, a lanthanum strontium manganite (LSM) electrode, to estimate the aforementioned properties. A framework for calculating transport properties is presented in this work. 3D microstructures of LSM electrode are reconstructed from a series of two-dimensional (2D) cross-sectional FIB-SEM images. Volume percentages of connected, isolated and dead-ends networks of pore and LSM phases are estimated. Different networks of pore and LSM phases are discretized with tetrahedral elements. Finally, the finite element method (FEM) is applied to calculate effective gas diffusivity and electronic conductivity of pore and LSM phases, respectively. Geometric tortuosities are estimated from the porosity and effective transport properties. The results obtained using FEM are compared with the finite volume method (FVM) results obtained by Gunda et al. [J. Power Sources, 196(7), 35929(2011)] and other numerical results obtained on randomly generated porous medium. Effect of consideration of dead-ends and isolated-ends networks on calculation of effective transport properties is studied.

Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes.

Science.gov (United States)

Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

2016-11-10

We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS 2 ) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS 2 and pentacene. The pentacene/MoS 2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

Electronic transport properties of (fluorinated) metal phthalocyanine

KAUST Repository

Fadlallah, M M; Eckern, U; Romero, A H; Schwingenschlö gl, Udo

2015-01-01

The magnetic and transport properties of the metal phthalocyanine (MPc) and F16MPc (M = Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn and Ag) families of molecules in contact with S–Au wires are investigated by density functional theory within the local density approximation, including local electronic correlations on the central metal atom. The magnetic moments are found to be considerably modified under fluorination. In addition, they do not depend exclusively on the configuration of the outer electronic shell of the central metal atom (as in isolated MPc and F16MPc) but also on the interaction with the leads. Good agreement between the calculated conductance and experimental results is obtained. For M = Ag, a high spin filter efficiency and conductance is observed, giving rise to a potentially high sensitivity for chemical sensor applications.

Electronic transport properties of (fluorinated) metal phthalocyanine

KAUST Repository

Fadlallah, M M

2015-12-21

The magnetic and transport properties of the metal phthalocyanine (MPc) and F16MPc (M = Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn and Ag) families of molecules in contact with S–Au wires are investigated by density functional theory within the local density approximation, including local electronic correlations on the central metal atom. The magnetic moments are found to be considerably modified under fluorination. In addition, they do not depend exclusively on the configuration of the outer electronic shell of the central metal atom (as in isolated MPc and F16MPc) but also on the interaction with the leads. Good agreement between the calculated conductance and experimental results is obtained. For M = Ag, a high spin filter efficiency and conductance is observed, giving rise to a potentially high sensitivity for chemical sensor applications.

Electrical transport and pinning properties of Nb films with washboard-like nanostructures

Energy Technology Data Exchange (ETDEWEB)

Dobrovolskiy, Oleksandr V. [Physikalisches Institut Goethe-University, Frankfurt am Main (Germany); Department of Physics, Kharkiv National University (Ukraine); Begun, Evgeniya; Huth, Michael [Physikalisches Institut Goethe-University, Frankfurt am Main (Germany); Shklovskij, Valerij A. [Department of Physics, Kharkiv National University (Ukraine); Institute for Theoretical Physics NSC-KIPT, Kharkiv (Ukraine)

2013-07-01

A careful analysis of the magneto-transport properties of epitaxial nanostructured Nb thin films in the normal and the mixed state is performed. The nanopatterns were prepared by focused ion beam (FIB) milling. They provide a washboard-like pinning potential landscape for vortices in the mixed state and simultaneously cause a resistivity anisotropy in the normal state. Two matching magnetic fields for the vortex lattice with the underlying nanostructures have been observed. By applying these fields, the most likely pinning sites along which the flux lines move through the samples have been selected. By this, either the background isotropic pinning of the pristine film or the enhanced isotropic pinning originating from the nanoprocessing have been probed. Via an Arrhenius analysis of the resistivity data the pinning activation energies for three vortex lattice parameters have been quantified. The changes in the electrical transport and the pinning properties have been correlated with the results of the microstructural and topographical characterization of the FIB-patterned samples. The obtained results provide further insight into the pinning mechanisms at work in FIB-nanopatterned superconductors for fluxonic applications.

Gas transport in the bentonite barrier of AGP and their interfaces; Transporte de gas en la barrera de bentonita de un AGP y sus interfases

Energy Technology Data Exchange (ETDEWEB)

Gutierrez Rodrigo, V.; Villar Gelicia, M. V.; Martin Martin, P. L.; Romero Alvarez, F. J.

2014-07-01

The research of gas transport processes through the barriers is of great relevance in the assessment of the behaviour of the repository. The main objective of this study is to determine the properties of gas transport in saturated bentonite samples and the interfaces between them. (Author)

Determination of Weight Suspension Rigidity in the Transport-Erector Aggregates

Directory of Open Access Journals (Sweden)

V. A. Zverev

2016-01-01

Full Text Available The aim is to determine weight suspension rigidity in aggregates designed to perform technological transport-erector operations at the miscellaneous launch complexes.We consider the weight suspension comprising the following distinctive structural components: the executive weight-lowering mechanism, polyspast mechanism, rope, traverse, and rods. A created structural dynamic model of suspension allowed us to define weight suspension rigidity. Within the framework of design analysis of a dynamic model we determined the rigidity of its structural units, i.e. traverse, rope, and polyspast.Known analytical relationships were used to calculate the rope rigidity. To determine rigidity of polyspast and traverse have been created special models based on the finite element method. For each model deformation in the specific points under the test load have been defined. Data obtained were used to determine trigidity of traverses and polyspast, and also rigidity of suspension in total. The rigidity models of polispast mechanism and traverse have been developed and calculated using the software complex "Zenit-95".As the research results, the paper presents a dynamic model of the weight suspension of the transport-erector aggregate, the finite element models of the polispast mechanism and traverse, an algorithm for determining the weight suspension rigidity and relevant analytical relationships.Independent calculation of weight suspension rigidity enables us to simplify further dynamic calculation of the aggregate-weight system because it allows attaining a simpler model of the aggregate-weight system that uses the weight suspension model as an element of equivalent rigidity. Despite this simplification the model allows us to determine correctly weight movement parameters and overloads in the aggregate-weight system in the process of technical operations.

Transport properties of Lu.sub.2./sub.Fe.sub.17./sub. single crystals under extreme conditions

Czech Academy of Sciences Publication Activity Database

Skorokhod, Yuriy; Arnold, Zdeněk; Kamarád, Jiří; Andreev, Alexander V.

2004-01-01

Roč. 11, č. 3 (2004), s. 471-475 ISSN 1027-5495 R&D Projects: GA ČR(CZ) GA106/02/0943 Institutional research plan: CEZ:AV0Z1010914 Keywords : transport properties * magnetotransport properties * pressure effect * single crystals * intermetallic compounds Subject RIV: BM - Solid Matter Physics ; Magnetism

Determination of atmospheric aerosol properties over land using satellite measurements

NARCIS (Netherlands)

Kokhanovsky, A.A.; Leeuw, G. de

2009-01-01

Mostly, aerosol properties are poorly understood because the aerosol properties are very sparse. The first workshop on the determination of atmospheric aerosol properties over land using satellite measurements is convened in Bremen, Germany. In this workshop, the topics of discussions included a

Size distribution and optical properties of mineral dust aerosols transported in the western Mediterranean

Directory of Open Access Journals (Sweden)

C. Denjean

2016-02-01

Full Text Available This study presents in situ aircraft measurements of Saharan mineral dust transported over the western Mediterranean basin in June–July 2013 during the ChArMEx/ADRIMED (the Chemistry-Aerosol Mediterranean Experiment/Aerosol Direct Radiative Impact on the regional climate in the MEDiterranean region airborne campaign. Dust events differing in terms of source region (Algeria, Tunisia and Morocco, time of transport (1–5 days and height of transport were sampled. Mineral dust were transported above the marine boundary layer, which conversely was dominated by pollution and marine aerosols. The dust vertical structure was extremely variable and characterized by either a single layer or a more complex and stratified structure with layers originating from different source regions. Mixing of mineral dust with pollution particles was observed depending on the height of transport of the dust layers. Dust layers carried a higher concentration of pollution particles below 3 km above sea level (a.s.l. than above 3 km a.s.l., resulting in a scattering Ångström exponent up to 2.2 below 3 km a.s.l. However, the optical properties of the dust plumes remained practically unchanged with respect to values previously measured over source regions, regardless of the altitude. Moderate absorption of light by the dust plumes was observed with values of aerosol single scattering albedo at 530 nm ranging from 0.90 to 1.00. Concurrent calculations from the aerosol chemical composition revealed a negligible contribution of pollution particles to the absorption properties of the dust plumes that was due to a low contribution of refractory black carbon in regards to the fraction of dust and sulfate particles. This suggests that, even in the presence of moderate pollution, likely a persistent feature in the Mediterranean, the optical properties of the dust plumes could be assumed similar to those of native dust in radiative transfer simulations, modelling

Pressure and irradiation effects on transport properties of samarium compounds with instable valence

International Nuclear Information System (INIS)

Morillo, J.

1981-01-01

Electron transport properties in samarium compounds with instable valence are studied in this thesis: from SmS in its integer valence phases at common pressure to SmB 6 compound IV at common pressure through SmSsub(1-x)Psub(x) (x 6 is presented [fr

Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.

Science.gov (United States)

Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J

2018-03-21

Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.

Equation of state and transport properties of uranium and plutonium carbides in the liquid region

International Nuclear Information System (INIS)

Sheth, A.; Leibowitz, L.

1975-09-01

By the use of available low-temperature data for various thermophysical and transport properties for uranium and plutonium carbides, values above the melting point were estimated. Sets of recommended values have been prepared for the compounds UC, PuC, and (U,Pu)C. The properties that have been evaluated are density, heat capacity, enthalpy, vapor pressure, thermal conductivity, viscosity, and emissivity

Electrical and thermal transport properties of uranium and plutonium carbides

International Nuclear Information System (INIS)

Lewis, H.D.; Kerrisk, J.F.

1976-09-01

Contributions of many authors are outlined with respect to the experimental measurement methods used and characteristics of the sample materials. Discussions treat the qualitative effects of sample material composition; oxygen, nitrogen, and nickel concentrations; porosity; microstructural variations; and the variability in transport property values obtained by the various investigators. Temperature-dependent values are suggested for the electrical resistivities and thermal conductivities of selected carbide compositions based on a comparative evaluation of the available data and the effects of variation in the characteristics of sample materials

Optical and transport properties of single crystal rubrene: A theoretical study

Energy Technology Data Exchange (ETDEWEB)

Chen, Lipeng [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Lu, Jing [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Faculty of Chemistry, Northeast Normal University, Changchun (China); Long, Guankui; Zheng, Fulu [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Zhang, Jingping [Faculty of Chemistry, Northeast Normal University, Changchun (China); Zhao, Yang, E-mail: YZhao@ntu.edu.sg [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore)

2016-12-20

Optical and charge transport properties of single crystal rubrene are investigated using the multi-mode Brownian oscillator (MBO) model, the charge hopping model with quantum nuclear tunneling, and the Munn–Silbey approach. The MBO model is adopted to calculate absorption and photoluminescence spectra, yielding results in excellent agreement with measurements. In addition, temperature dependence of zero phonon lines (ZPL) and phonon sidebands (PSBs) of absorption spectra is also examined using the MBO model, revealing a nearly linear dependence of line widths of the ZPL and the PSBs on temperature. Model parameters obtained from MBO fitting and TD-DFT computation are then utilized for hole mobility calculations. It is found that temperature dependence of the calculated mobility is in general agreement with measurements, exhibiting “band-like” transport behavior.

Physical transport properties of marine microplastic pollution

Science.gov (United States)

Ballent, A.; Purser, A.; Mendes, P. de Jesus; Pando, S.; Thomsen, L.

2012-12-01

Given the complexity of quantitative collection, knowledge of the distribution of microplastic pollution in many regions of the world ocean is patchy, both spatially and temporally, especially for the subsurface environment. However, with knowledge of typical hydrodynamic behavior of waste plastic material, models predicting the dispersal of pelagic and benthic plastics from land sources into the ocean are possible. Here we investigate three aspects of plastic distribution and transport in European waters. Firstly, we assess patterns in the distribution of plastics found in fluvial strandlines of the North Sea and how distribution may be related to flow velocities and distance from source. Second, we model transport of non-buoyant preproduction pellets in the Nazaré Canyon of Portugal using the MOHID system after assessing the density, settling velocity, critical and depositional shear stress characteristics of such waste plastics. Thirdly, we investigate the effect of surface turbulences and high pressures on a range of marine plastic debris categories (various densities, degradation states and shapes tested) in an experimental water column simulator tank and pressure laboratory. Plastics deposited on North Sea strandlines varied greatly spatially, as a function of material composition and distance from source. Model outputs indicated that such dense production pellets are likely transported up and down canyon as a function of tidal forces, with only very minor net down canyon movement. Behaviour of plastic fragments under turbulence varied greatly, with the dimensions of the material, as well as density, playing major determining roles. Pressure was shown to affect hydrodynamic behaviours of only low density foam plastics at pressures ≥ 60 bar.

Physical, Hydraulic, and Transport Properties of Sediments and Engineered Materials Associated with Hanford Immobilized Low-Activity Waste

Energy Technology Data Exchange (ETDEWEB)

Rockhold, Mark L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Zhang, Z. F. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Meyer, Philip D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Thomle, Jonathan N. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2015-02-28

Current plans for treatment and disposal of immobilized low-activity waste (ILAW) from Hanford’s underground waste storage tanks include vitrification and storage of the glass waste form in a nearsurface disposal facility. This Integrated Disposal Facility (IDF) is located in the 200 East Area of the Hanford Central Plateau. Performance assessment (PA) of the IDF requires numerical modeling of subsurface flow and reactive transport processes over very long periods (thousands of years). The models used to predict facility performance require parameters describing various physical, hydraulic, and transport properties. This report provides updated estimates of physical, hydraulic, and transport properties and parameters for both near- and far-field materials, intended for use in future IDF PA modeling efforts. Previous work on physical and hydraulic property characterization for earlier IDF PA analyses is reviewed and summarized. For near-field materials, portions of this document and parameter estimates are taken from an earlier data package. For far-field materials, a critical review is provided of methodologies used in previous data packages. Alternative methods are described and associated parameters are provided.

Stacking dependence of carrier transport properties in multilayered black phosphorous

Science.gov (United States)

Sengupta, A.; Audiffred, M.; Heine, T.; Niehaus, T. A.

2016-02-01

We present the effect of different stacking orders on carrier transport properties of multi-layer black phosphorous. We consider three different stacking orders AAA, ABA and ACA, with increasing number of layers (from 2 to 6 layers). We employ a hierarchical approach in density functional theory (DFT), with structural simulations performed with generalized gradient approximation (GGA) and the bandstructure, carrier effective masses and optical properties evaluated with the meta-generalized gradient approximation (MGGA). The carrier transmission in the various black phosphorous sheets was carried out with the non-equilibrium green’s function (NEGF) approach. The results show that ACA stacking has the highest electron and hole transmission probabilities. The results show tunability for a wide range of band-gaps, carrier effective masses and transmission with a great promise for lattice engineering (stacking order and layers) in black phosphorous.

Non-interferometric determination of optical anisotropy in highly-oriented fibres using transport intensity equation technique

Science.gov (United States)

Sokkar, T. Z. N.; El-Farahaty, K. A.; El-Bakary, M. A.; Raslan, M. I.; Omar, E. Z.; Hamza, A. A.

2018-03-01

The optical setup of the transport intensity equation (TIE) technique is developed to be valid for measuring the optical properties of the highly-oriented anisotropic fibres. This development is based on the microstructure models of the highly-oriented anisotropic fibres and the principle of anisotropy. We provide the setup of TIE technique with polarizer which is controlled via stepper motor. This developed technique is used to investigate the refractive indices in the parallel and perpendicular polarization directions of light for the highly-oriented poly (ethylene terephthalate) (PET) fibres and hence its birefringence. The obtained results through the developed TIE technique for PET fibre are compared with that determined experimentally using the Mach-Zehnder interferometer under the same conditions. The comparison shows a good agreement between the obtained results from the developed technique and that obtained from the Mach-Zehnder interferometer technique.

Determination of physical properties of fibrous thermal insulation

Directory of Open Access Journals (Sweden)

Jeandel G.

2012-10-01

Full Text Available The objective of this study is to characterize both experimentally and theoretically, conductive and radiative heat transfer within polyester batting. This material is derived from recycled bottles (PET with fibres of constant diameters. Two other mineral and plant fibrous insulation materials, (glass wool and hemp wool are also characterized for comparative purposes. To determine the overall thermophysical properties of the tested materials, heat flux measurement are carried out using a device developed in house. The radiative properties of the material are determined by an inverse method based on measurements of transmittance and reflectance using a FTIR spectrometer and by solving the equation of radiative heat transfer. These measures are compared to results of numerical simulations.

Equilibrium and Transport Properties of Primary, Secondary and Tertiary Amines by Molecular Simulation

International Nuclear Information System (INIS)

Orozco, Gustavo A.; Nieto-Draghi, Carlos; Lachet, Veronique; Mackie, Allan D.

2014-01-01

Using molecular simulation techniques such as Monte Carlo (MC) and molecular dynamics (MD), we present several simulation results of thermodynamic and transport properties for primary, secondary and tertiary amines. These calculations are based on a recently proposed force field for amines that follows the Anisotropic United Atom approach (AUA). Different amine molecules have been studied, including n-Butylamine, di-n-Butylamine, tri-n-Butylamine and 1,4-Butanediamine for primary, secondary, tertiary and multi-functional amines respectively. For the transport properties, we have calculated the viscosity coefficients as a function of temperature using the isothermal-isobaric (NPT) ensemble. In the case of the pure components, we have investigated different thermodynamic properties using NVT Gibbs ensemble simulations such as liquid-vapor phase equilibrium diagrams, vaporization enthalpies, vapor pressures, normal boiling points, critical temperatures and critical densities. We have also calculated the excess enthalpies for water-n-Butylamine and n-heptane-n-Butylamine mixtures using Monte Carlo simulations in the NPT ensemble. In addition, we present the calculation of liquid-vapor surface tensions of n-Butylamine using a two-phase NVT simulation as well as the radial distribution functions. Finally, we have investigated the physical Henry constants of nitrous oxide (N 2 O) and nitrogen (N 2 ) in an aqueous solutions of n-Butylamine. In general, we found a good agreement between the available experimental information and our simulation results for all the studied properties, ratifying the predictive capability of the AUA force field for amines. (authors)

The ESASSI-08 cruise in the South Scotia Ridge region: An inverse model property-transport analysis over the Ridge

Science.gov (United States)

Palmer, Margarita; Gomis, Damià; Del Mar Flexas, Maria; Jordà, Gabriel; Naveira-Garabato, Alberto; Jullion, Loic; Tsubouchi, Takamasa

2010-05-01

The ESASSI-08 oceanographic cruise carried out in January 2008 was the most significant milestone of the ESASSI project. ESASSI is the Spanish component of the Synoptic Antarctic Shelf-Slope Interactions (SASSI) study, one of the core projects of the International Polar Year. Hydrographical and biochemical (oxygen, CFCs, nutrients, chlorophyll content, alkalinity, pH, DOC) data were obtained along 11 sections in the South Scotia Ridge (SSR) region, between Elephant and South Orkney Islands. One of the aims of the ESASSI project is to determine the northward outflow of cold and ventilated waters from the Weddell Sea into the Scotia Sea. For that purpose, the accurate estimation of mass, heat, salt, and oxygen transport over the Ridge is requested. An initial analysis of transports across the different sections was first obtained from CTD and ADCP data. The following step has been the application of an inverse method, in order to obtain a better estimation of the net flow for the different water masses present in the region. The set of property-conservation equations considered by the inverse model includes mass, heat and salinity fluxes. The "box" is delimited by the sections along the northern flank of the SSR, between Elephant Island and 50°W, the southern flank of the Ridge, between 51.5°W and 50°W, the 50°W meridian and a diagonal line between Elephant Island and 51.5°W, 61.75°S. Results show that the initial calculations of transports suffered of a significant volume imbalance, due to the inherent errors of ship-ADCP data, the complicated topography and the presence of strong tidal currents in some sections. We present the post-inversion property transports across the rim of the box (and their error bars) for the different water masses.

Transport properties of a piecewise linear transformation and deterministic Levy flights

International Nuclear Information System (INIS)

Miyaguchi, Tomoshige

2006-01-01

The transport properties of a 1-dimensional piecewise linear dynamical system are investigated through the spectrum of its Frobenius-Perron operator. For a class of initial densities, eigenvalues and eigenfunctions of the Frobenius-Perron operator are obtained explicitly. It is also found that in the long length wave limit, this system exhibits normal diffusion and super diffusion called Levy flight. The diffusion constant and stable index are derived from the eigenvalues. (author)

Functional size of photosynthetic electron transport chain determined by radiation inactivation

International Nuclear Information System (INIS)

Pan, R.S.; Chen, L.F.; Wang, M.Y.; Tsal, M.Y.; Pan, R.L.; Hsu, B.D.

1987-01-01

Radiation inactivation technique was employed to determine the functional size of photosynthetic electron transport chain of spinach chloroplasts. The functional size for photosystem I+II(H 2 O to methylviologen) was 623 +/- 37 kilodaltons; for photosystem II (H 2 O to dimethylquinone/ferricyanide), 174 +/- 11 kilodaltons; and for photosystem I (reduced diaminodurene to methylviologen), 190 +/- 11 kilodaltons. The difference between 364 +/- 22 (the sum of 174 +/- 11 and 190 +/- 11) kilodaltons and 623 +/- 37 kilodaltons is partially explained to be due to the presence of two molecules of cytochrome b 6 /f complex of 280 kilodaltons. The molecular mass for other partial reactions of photosynthetic electron flow, also measured by radiation inactivation, is reported. The molecular mass obtained by this technique is compared with that determined by other conventional biochemical methods. A working hypothesis for the composition, stoichiometry, and organization of polypeptides for photosynthetic electron transport chain is proposed

On the effects of pressure and irradiation on the transport properties of samarium compounds with unstable valence

International Nuclear Information System (INIS)

Morillo, J.

1983-06-01

We present the first extensive study of electronic transport properties of ''quasi-stoichiometric'' SmS as a function of pressure P, temperature T, magnetic field B and defect concentration C. SmS which is a semiconductor, undergoes with increasing P a first order transition towards an homogeneous intermediate valence state. In the semiconducting phase (s.c.), the energie epsilon(f) necessary to delocalize a 4f electron increases greatly with T and is about 250meV at 300K. The phase diagram for the first order electronic transition Sm 2 + →Smsup(2+epsilon) with P has been determined for T 6 has been investigated by resistivity measurements under irradiation at 21K. The threshold energy Ed for displacement of Sm in SmS has been determined: Ed(Sm) = 20 +- 2 eV, and the observed effects of irradiation have been associated to samarium displacements (vacancies and interstitials) [fr

Transport properties of ultrathin black phosphorus on hexagonal boron nitride

Energy Technology Data Exchange (ETDEWEB)

Doganov, Rostislav A.; Özyilmaz, Barbaros [Centre for Advanced 2D Materials and Graphene Research Centre, National University of Singapore, 6 Science Drive 2, 117546 Singapore (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); Graduate School for Integrative Sciences and Engineering (NGS), National University of Singapore, 28 Medical Drive, 117456 Singapore (Singapore); Koenig, Steven P.; Yeo, Yuting [Centre for Advanced 2D Materials and Graphene Research Centre, National University of Singapore, 6 Science Drive 2, 117546 Singapore (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); Watanabe, Kenji; Taniguchi, Takashi [National Institute for Materials Science, 1-1 Namiki, Tsukuba 305-0044 (Japan)

2015-02-23

Ultrathin black phosphorus, or phosphorene, is a two-dimensional material that allows both high carrier mobility and large on/off ratios. Similar to other atomic crystals, like graphene or layered transition metal dichalcogenides, the transport behavior of few-layer black phosphorus is expected to be affected by the underlying substrate. The properties of black phosphorus have so far been studied on the widely utilized SiO{sub 2} substrate. Here, we characterize few-layer black phosphorus field effect transistors on hexagonal boron nitride—an atomically smooth and charge trap-free substrate. We measure the temperature dependence of the field effect mobility for both holes and electrons and explain the observed behavior in terms of charged impurity limited transport. We find that in-situ vacuum annealing at 400 K removes the p-doping of few-layer black phosphorus on both boron nitride and SiO{sub 2} substrates and reduces the hysteresis at room temperature.

Size Effect on Transport Properties of Gaseous Argon: A Molecular Dynamics Simulation Study

International Nuclear Information System (INIS)

Lee, Songhi

2014-01-01

We have carried out a series of equilibrium molecular dynamics (EMD) simulations of gaseous argon at 273.15 K and 1.00 atm for the calculation of transport properties as a function of the number of argon molecules (N). While the diffusion coefficients (D) of gaseous argon approach to the experimental measure with increasing N, the viscosities (η) and thermal conductivities (λ) obtained for N = 432 are unreliable due to the high fluctuation of the time correlation functions and those for N = 1728 are rather acceptable. Increasing further to N = 6912 has improved the MD results a little closer to the experimental measures for η and λ. Both the EMD results for η and λ for N = 6912 underestimate the experimental measures and it is not expected that the more increasing N makes the closer results to the experimental measures. One possible explanation for the large disagreement between MD results and the experimental measures for η and λ may be due to the use of LJ parameters which were used for liquid argon. In a recent study, we have examined the Green-Kubo formula for the calculation of transport properties (diffusion coefficient, viscosity, and thermal conductivity) of noble gases (He, Ne, Ar, Kr, and Xe) by carrying out a series of equilibrium molecular dynamics (EMD) simulations for the system of N=1728 at 273.15 K and 1.00 atm.1 While the diffusion coefficients (D) of noble gases were obtained through the original Green-Kubo formula, the viscosities (η) and thermal conductivities (λ) were obtained by utilizing the revised Green-Kubo formulas. The structural and dynamic properties of gaseous argon are completely different from those of liquid argon at 94.4 K and 1.374 g/cm 3 . The results for transport properties (D, η, and λ) at 273.15 K and 1.00 atm obtained from our EMD simulations are in general agreement with the experimental data and superior to the rigorous results of the kinetic theory

Modification of Local Urban Aerosol Properties by Long-Range Transport of Biomass Burning Aerosol

Directory of Open Access Journals (Sweden)

Iwona S. Stachlewska

2018-03-01

Full Text Available During August 2016, a quasi-stationary high-pressure system spreading over Central and North-Eastern Europe, caused weather conditions that allowed for 24/7 observations of aerosol optical properties by using a complex multi-wavelength PollyXT lidar system with Raman, polarization and water vapour capabilities, based at the European Aerosol Research Lidar Network (EARLINET network urban site in Warsaw, Poland. During 24–30 August 2016, the lidar-derived products (boundary layer height, aerosol optical depth, Ångström exponent, lidar ratio, depolarization ratio were analysed in terms of air mass transport (HYSPLIT model, aerosol load (CAMS data and type (NAAPS model and confronted with active and passive remote sensing at the ground level (PolandAOD, AERONET, WIOS-AQ networks and aboard satellites (SEVIRI, MODIS, CATS sensors. Optical properties for less than a day-old fresh biomass burning aerosol, advected into Warsaw’s boundary layer from over Ukraine, were compared with the properties of long-range transported 3–5 day-old aged biomass burning aerosol detected in the free troposphere over Warsaw. Analyses of temporal changes of aerosol properties within the boundary layer, revealed an increase of aerosol optical depth and Ångström exponent accompanied by an increase of surface PM10 and PM2.5. Intrusions of advected biomass burning particles into the urban boundary layer seem to affect not only the optical properties observed but also the top height of the boundary layer, by moderating its increase.

Electronic contributions to the transport properties and specific heat of solid UO2: an empirical, self-consistent analysis

International Nuclear Information System (INIS)

Hyland, G.J.; Ralph, J.

1982-07-01

From an empirical, self-consistent analysis of new high temperature data on the thermo-electric Seebeck coefficient and d.c. electrical conductivity, the value of the free energy controlling the equilibrium of the thermally induced reaction, 2U 4+ reversible U 3+ + U 5+ is determined (treating the U 3+ and U 5+ as small polarons) and used to calculate the contribution of the process to the high temperature thermal conductivity and specific heat of UO 2 . It is found that the transport properties can be completely accounted for in this way, but not the anomalous rise in specific heat - the origin of which remains obscure. (U.K.)

Lateral electrical transport, optical properties and photocurrent measurements in two-dimensional arrays of silicon nanocrystals embedded in SiO2

Directory of Open Access Journals (Sweden)

Gardelis Spiros

2011-01-01

Full Text Available Abstract In this study we investigate the electronic transport, the optical properties, and photocurrent in two-dimensional arrays of silicon nanocrystals (Si NCs embedded in silicon dioxide, grown on quartz and having sizes in the range between less than 2 and 20 nm. Electronic transport is determined by the collective effect of Coulomb blockade gaps in the Si NCs. Absorption spectra show the well-known upshift of the energy bandgap with decreasing NC size. Photocurrent follows the absorption spectra confirming that it is composed of photo-generated carriers within the Si NCs. In films containing Si NCs with sizes less than 2 nm, strong quantum confinement and exciton localization are observed, resulting in light emission and absence of photocurrent. Our results show that Si NCs are useful building blocks of photovoltaic devices for use as better absorbers than bulk Si in the visible and ultraviolet spectral range. However, when strong quantum confinement effects come into play, carrier transport is significantly reduced due to strong exciton localization and Coulomb blockade effects, thus leading to limited photocurrent.

Dynamic response analysis as a tool for investigating transport mechanisms

International Nuclear Information System (INIS)

Dudok de Wit, Th.; Joye, B.; Lister, J.B.; Moret, J.M.

1990-01-01

Dynamic response analysis provides an attractive method for studying transport mechanisms in tokamak plasmas. The analysis of the radial response has already been widely used for heat and particle transport studies. The frequency dependence of the dynamic response, which is often omitted, reveals further properties of the dominant transport mechanisms. Extended measurements of the soft X-ray emission were carried out on the TCA tokamak in order to determine the underlying transport processes. (author) 5 refs., 2 figs

Thermophysical properties of sodium

International Nuclear Information System (INIS)

Harant, M.

1978-01-01

Substitution, inverse and substitution inverse relations in form of regression polynomials were used in calculating saturation pressure and density for thermodynamic and transport properties determination of sodium. Program UNISOAUT/A3 was used in calculating regression polynomials coefficients. (J.P.)

Structural, electronic and transport properties of armorphous/crystalline silicon heterojunctions

Energy Technology Data Exchange (ETDEWEB)

Schulze, Tim Ferdinand

2011-06-15

The present dissertation is concerned with the physical aspects of the a-Si:H/c-Si heterojunction in the context of PV research. In a first step, the technological development which took place in the framework of the thesis is summarized. Its main constituent was the development and implementation of ultrathin ({<=}10 nm) undoped a-Si:H[(i)a-Si:H] layers to improve the passivation of the c-Si surface with the goal of increasing the open-circuit voltage of the solar cell. It is shown that the effect of (i)a-Si:H interlayers depends on the c-Si substrate doping type, and that challenges exist particularly on the technologically more relevant (n)c-Si substrate. A precise optimization of (i)a-Si:H thickness and the doping level of the following a-Si:H top layers is required to realize an efficiency gain in the solar cell. In this chapter, the key scientific questions to be tackled in the main part of the thesis are brought up by the technological development. In the next chapter, the charge carrier transport through a-Si:H/c-Si heterojunctions is investigated making use of current-voltage (I/V) characteristics taken at different temperatures. The dominant transport mechanisms in a-Si:H/c-Si heterojunctions are identified, and the relevance for solar cell operation is discussed. It is found that in the bias regime relevant for solar cell operation, the theoretical framework for the description of carrier transport in classical c-Si solar cells applies as well, which enables to use I/V curves for a simple characterization of a-Si:H/c-Si structures. The next chapter deals with the microscopic characterization of ultrathin a-Si:H layers. Employing infrared spectroscopy, spectroscopic ellipsometry, photoelectron spectroscopy and secondary ion mass spectroscopy, the structural, electronic and optical properties of (i)a-Si:H are analyzed. It is found that ultrathin a-Si:H essentially behaves like layers of 10..100 times the thickness. This represents the basis for the

Studies of energy transport in Jet H-modes

International Nuclear Information System (INIS)

Keilhacker, M.; Balet, B.; Cordey, J.; Gottardi, N.; Muir, D.; Thomsen, K.; Watkins, M.

1989-01-01

The local heat transport properties in the interior of ohmic, L- and H-phases of 2MA discharges, are determined. Time dependent energy balance code, TRANSP, and timeslice code, QFLUX are used. The global confinement properties of higher current discharges (≤ 3.8MA) are analyzed. The results indicate that during the L-phase of JET single null X-point discharges, the total heat transport coefficient in the plasma decreases to a level close to the ohmic value. Moreover, confinement during the H-phase continues to improve with current (up to 3.8MA), but degrades with increasing neutral beam power

Transport properties in a monolayer graphene modulated by the realistic magnetic field and the Schottky metal stripe

Science.gov (United States)

Lu, Jian-Duo; Li, Yun-Bao; Liu, Hong-Yu; Peng, Shun-Jin; Zhao, Fei-Xiang

2016-09-01

Based on the transfer-matrix method, a systematic investigation of electron transport properties is done in a monolayer graphene modulated by the realistic magnetic field and the Schottky metal stripe. The strong dependence of the electron transmission and the conductance on the incident angle of carriers is clearly seen. The height, position as well as width of the barrier also play an important role on the electron transport properties. These interesting results are very useful for understanding the tunneling mechanism in the monolayer graphene and helpful for designing the graphene-based electrical device modulated by the realistic magnetic field and the electrical barrier.

Influence of short range ordering and clustering on transport properties

International Nuclear Information System (INIS)

Vigier, G.; Pelletier, J.M.

1982-01-01

The influence of short range ordering and clustering phenomena on the electrical resistivity p and the thermopower S is investigated both theoretically and experimentally. According to the considered alloys either increases or decreases of transport properties may be observed when deviations from a random distribution of solute atoms occur. These observations are explained with a model based on free electrons and Born approximations the importance of the potential choice is underlined; two kinds of description of the structure factor are investigated. A good semiquantitative agreement is obtained between computed results and experimental observations

Soil properties and preferential solute transport at the field scale

DEFF Research Database (Denmark)

Koestel, J K; Minh, Luong Nhat; Nørgaard, Trine

An important fraction of water flow and solute transport through soil takes place through preferential flow paths. Although this had been already observed in the nineteenth century, it had been forgotten by the scientific community until it was rediscovered during the 1970s. The awareness...... of the relevance of preferential flow was broadly re-established in the community by the early 1990s. However, since then, the notion remains widespread among soil scientists that the occurrence and strength of preferential flow cannot be predicted from measurable proxy variables such as soil properties or land...

Isothermal transport properties and majority-type defects of BaCo(0.70)Fe(0.22)Nb(0.08)O(3-δ).

Science.gov (United States)

Lee, Taewon; Cho, Deok-Yong; Kwon, Hyung-Soon; Yoo, Han-Ill

2015-01-28

(Ba,Sr)(Co,Fe)O3-δ based mixed conducting oxides, e.g. (Ba0.5Sr0.5)(Co1-xFex)O3-δ and Ba(Co0.7Fe0.3-xNbx)O3-δ, are promising candidates for oxygen permeable membranes and SOFC cathodes due to their excellent ambipolar conductivities. Despite these excellent properties, however, their mass/charge transport properties have not been fully characterized and hence, their defect structure has not been clearly elucidated. Until now, the majority types of ionic and electronic defects have been regarded as oxygen vacancies and localized holes. Holes, whether localized or not, are acceptable as majority electronic carriers on the basis of the as-measured total conductivity, which is essentially electronic, and electronic thermopower. On the other hand, the proposal of oxygen vacancies as majority ionic carriers lacks solid evidence. In this work, we document all the isothermal transport properties of Ba(Co0.70Fe0.22Nb0.08)O3-δ in terms of a 2 × 2 Onsager transport coefficient matrix and its steady-state electronic thermopower against oxygen activity at elevated temperatures, and determine the valences of Co and Fe via soft X-ray absorption spectroscopy. It turns out that the ionic and electronic defects in majority should be oxygen interstitials and at least two kinds of holes, one free and the other trapped. Furthermore, the lattice molecule should be Ba(Co0.7Fe0.3-xNbx)O2+δ, not Ba(Co0.7Fe0.3-xNbx)O3-δ, to be consistent with all the results observed.

The use of modern data about the composition and properties of soils for the development of transport infrastructure of Tyumen

Science.gov (United States)

Eremin, Dmitry

2017-10-01

Sedimentary properties territory Tura-Pyshma interfluve, where Tyumen is located are determined by the general course of ancient and especially the newest tectonic movements. Active development of the transport network on the territory of the Tour-Pyshma interfluve has created the need for a contemporary study of regional peculiarities of grounds. This will allow you to create roads with the quality meet the international standards. The use of average values of indicators of the properties of silty-clay soils during the development of the transport infrastructure projects of the city of Tyumen and its environs is ineffective due to the genetic characteristics of the rocks located at the depth of 1.5-5.0 meters. Detailed analysis showed that the studied soil belongs to the covering carbonate loams and clays, differing in its characteristics from loess-like sediments of the European part of Russia. The thickness of the covering rocks is not more than 5 meters. It’s low-carbonate, non-saline and often has a layered structure. The upper three meters of sediments contain the minimum quantity of water-soluble salts (dry residue less than 0.1%). Studied covering loams are characterized by favorable physical properties: the density of the bulk and the particle is 1.44 to 1.62 and 2.70-2.78 g/cm3, respectively. Water permeability is high - the filtration coefficient varies from 3.4 to 6.4 m/day, the minimum water velocity observed in the clay types of soil. The presence of sand layers adversely affects the permeability of soil. Therefore, the design and construction of transport infrastructure of the city and the surrounding territories it is necessary to consider regional features of grounds.

Influence of intermartensitic transitions on transport properties of Ni$_{2.16}Mn_{0.84}$Ga alloy

CERN Document Server

Khovailo, V V; Wedel, C; Takagi, T; Abe, T; Sugiyama, K

2004-01-01

Magnetic, transport, and x-ray diffraction measurements of ferromagnetic shape memory alloy Ni$_{2.16}$Mn$_{0.84}$Ga revealed that this alloy undergoes an intermartensitic transition upon cooling, whereas no such a transition is observed upon subsequent heating. The difference in the modulation of the martensite forming upon cooling from the high-temperature austenitic state [5-layered (5M) martensite], and the martensite forming upon the intermartensitic transition [7-layered (7M) martensite] strongly affects the magnetic and transport properties of the alloy and results in a large thermal hysteresis of the resistivity $\\rho$ and magnetization $M$. The intermartensitic transition has an especially marked influence on the transport properties, as is evident from a large difference in the resistivity of the 5M and 7M martensite, $(\\rho_{\\mathrm{5M}} - \\rho_{\\mathrm{7M}})/\\rho _{\\mathrm{5M}} \\approx 15%$, which is larger than the jump of resistivity at the martensitic transition from the cubic austenitic phase ...

Efficient calculation of dissipative quantum transport properties in semiconductor nanostructures

Energy Technology Data Exchange (ETDEWEB)

Greck, Peter

2012-11-26

We present a novel quantum transport method that follows the non-equilibrium Green's function (NEGF) framework but side steps any self-consistent calculation of lesser self-energies by replacing them by a quasi-equilibrium expression. We termed this method the multi-scattering Buettiker-Probe (MSB) method. It generalizes the so-called Buettiker-Probe model but takes into account all relevant individual scattering mechanisms. It is orders of magnitude more efficient than a fully selfconsistent non-equilibrium Green's function calculation for realistic devices, yet accurately reproduces the results of the latter method as well as experimental data. This method is fairly easy to implement and opens the path towards realistic three-dimensional quantum transport calculations. In this work, we review the fundamentals of the non-equilibrium Green's function formalism for quantum transport calculations. Then, we introduce our novel MSB method after briefly reviewing the original Buettiker-Probe model. Finally, we compare the results of the MSB method to NEGF calculations as well as to experimental data. In particular, we calculate quantum transport properties of quantum cascade lasers in the terahertz (THz) and the mid-infrared (MIR) spectral domain. With a device optimization algorithm based upon the MSB method, we propose a novel THz quantum cascade laser design. It uses a two-well period with alternating barrier heights and complete carrier thermalization for the majority of the carriers within each period. We predict THz laser operation for temperatures up to 250 K implying a new temperature record.

Molecular Dynamics Simulation for Surface and Transport Properties of Fluorinated Silica Nanoparticles in Water or Decane: Application to Gas Recovery Enhancement

Directory of Open Access Journals (Sweden)

Sepehrinia Kazem

2017-05-01

Full Text Available Determination of surface and transport properties of nanoparticles (NPs is essential for a variety of applications in enhanced oil and gas recoveries. In this paper, the impact of the surface chemistry of silica NPs on their hydro- and oleo-phobic properties as well as their transport properties are investigated in water or decane using molecular dynamics simulation. Trifluoromethyl or pentafluoroethyl groups as water and oil repellents are placed on the NPs. It is found that the density and residence time of liquid molecules around the NPs are modulated considerably with the existence of the functional groups on the NPs’ surfaces. Also, much larger density fluctuations for liquids close to the surface of the NPs are observed when the number of the groups on the NPs increases, indicating increased hydrophobicity. In addition, the diffusion coefficient of the NPs in either water or decane increases with increasing the number or length of the fluorocarbon chains, demonstrating non-Brownian behavior for the NPs. The surface chemistry imparts a considerable contribution on the diffusion coefficient of the NPs. Finally, potential of mean force calculations are undertaken. It is observed that the free energy of adsorption of the NPs on a mineral surface is more favorable than that of the aggregation of the NPs, which suggests the NPs adsorb preferably on the mineral surface.

Interfacial and transport properties of nanoconstrained inorganic and organic materials

Science.gov (United States)

Kocherlakota, Lakshmi Suhasini

Nanoscale constraints impact the material properties of both organic and inorganic systems. The systems specifically studied here are (i) nanoconstrained polymeric systems, poly(l-trimethylsilyl-1-propyne) (PTMSP) and poly(ethylene oxide) (PEO) relevant to gas separation membranes (ii) Zwitterionic polymers poly(sulfobetaine methacrylate)(pSBMA), poly(carboxybetaine acrylamide) (pCBAA), and poly(oligo(ethylene glycol) methyl methacrylate) (PEGMA) brushes critical for reducing bio-fouling (iii) Surface properties of N-layer graphene sheets. Interfacial constraints in ultrathin poly(l-trimethylsilyl-1-propyne) (PTMSP) membranes yielded gas permeabilities and CO2/helium selectivities that exceed bulk PTMSP membrane transport properties by up to three-fold for membranes of submicrometer thickness. Indicative of a free volume increase, a molecular energetic mobility analysis (involving intrinsic friction analysis) revealed enhanced methyl side group mobilities in thin PTMSP membranes with maximum permeation, compared to bulk films. Aging studies conducted over the timescales relevant to the conducted experiments signify that the free volume states in the thin film membranes are highly unstable in the presence of sorbing gases such as CO2. To maintain this high free volume configuration of polymer while improving the temporal stability an "inverse" architecture to conventional polymer nanocomposites was investigated, in which the polymer phase of PTMSP and PEO were interfacially and dimensionally constrained in nanoporous anodic aluminum oxide (AAO) membranes. While with this architecture the benefits of nanocomposite and ultrathin film membranes of PTMSP could be reproduced and improved upon, also the temporal stability could be enhanced substantially. The PEO-AAO nanocomposite membranes also revealed improved gas selectivity properties of CO2 over helium. In the thermal transition studies of zwitterionic pSBMA brushes a reversible critical transition temperature of 60

Determinants of satisfaction with campus transportation services: Implications for service quality

Directory of Open Access Journals (Sweden)

Felix Charbatzadeh

2016-04-01

Full Text Available Background: In a number of countries, buses are a critical element of public transportation, providing the most inclusive and sustainable mode of transportation to all forms of citizenry, including staff and students of universities. Objectives: The study examines the determinants of satisfaction with campus bus transportation. The article is primarily discursive and based on the synthesis of existing service literature supported by data obtained from a survey of 847 respondents. Method: Structural equation modelling is undertaken using AMOS 19, allowing for the examination of compound relationships between service engagement variables. Results: Results show statistically significant differences between perceived service quality and travel routes. The authors argue that managerial attention to service user experiences does not only hold the key to ongoing competitive success in campus transportation services but also that those services can be significantly enriched through greater managerial attention to the interface between risk of financial loss (which increases when the campus bus transportation service provider becomes less able to compete and service quality. Conclusion: The authors argue that if providers of campus bus transportation services are to rise to their service delivery challenges and also maintain or improve upon their market positions, they must conceptualise their services in a manner that takes into consideration the two-way interrelationship between risk of financial loss and service quality. It must also be noted that, although this study may have relevance for firm–firm scenarios, its focus is primarily on service supplier firm–customer service engagements. Keywords: Modelling; Transportation; Service

The role of free carbon in the transport and magnetic properties of boron carbide

International Nuclear Information System (INIS)

Bandyopadhyay, A.K.; Beuneu, F.; Zuppiroli, L.; Beauvy, M.

1984-01-01

Boron carbide is a ceramic which has a wide field of application because of its mechanical and nuclear properties. This material is difficult to characterise due to the presence of different levels of disorder and inhomogeneities which are found in the usual available samples. The transport and magnetic properties of several samples of boron carbide have been measured from liquid helium to room temperature as a function of temperature and composition. We have attempted to attribute the different features of these properties to the different levels of disorder. The role of free carbon, in form of thin layers of graphite within the disordered semi-conducting matrix, was investigated in particular details, because it was either ignored or neglected by others. Free carbon is found to dominate the D.C. transport when its concentration is larger than 5%; while the principal features of the electron spin resonance (E.S.R.) line show a dominance of free carbon when the concentration is larger than 3.5%. Below these concentrations conductivities as well as spin relaxation rates do not depend very much on free carbon; neither these have been found to be correlated in a simple way to the stoichiometry. (author)

Effect of spin reorientation on magnetocaloric and transport properties of NdAl{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Souza, M.V. de, E-mail: marcos_vinicios@hotmail.com [Núcleo de Pós-Graduação em Física, Campus Prof. José Aloísio de Campos, UFS, 49100-000 São Cristóvão, SE (Brazil); Silva, J.A. da [Núcleo de Pós-Graduação em Física, Campus Prof. José Aloísio de Campos, UFS, 49100-000 São Cristóvão, SE (Brazil); Silva, L.S. [Núcleo de Pós-Graduação em Física, Campus Prof. José Aloísio de Campos, UFS, 49100-000 São Cristóvão, SE (Brazil); Instituto Federal de Tocantins, IFTO – Campus Colinas do Tocantins, AV. Bernardo Sayao S/N, Chácara Raio de Sol, Setor Santa Maria, CEP 77760-000 Colinas do Tocantins, TO (Brazil)

2017-01-01

We report the magneto-thermal and resistive properties of rare-earth dialuminide NdAl{sub 2}, including spin reorientation transition. To this purpose, we used a theoretical model that considers the interactions of exchange and Zeeman, besides the anisotropy due to the electrical crystal field. The theoretical results obtained were compared to experimental data of the NdAl{sub 2} in single crystal and bulk forms. Explicitly, we have calculated the anisotropic variation of magnetic entropy with the magnetic field oriented along the three principal crystallographic directions: [100], [110], and [111] of NdAl{sub 2} single crystal, where a signature of the spin reorientation is observed in the [110] and [111] directions. Moreover, of magnetoresistivity we consider the applied magnetic field along the crystallographic directions [100] and [110]. In turn, for the polycrystalline form, the good agreement between theory and experiment confirms the presence of spin reorientation, which was predicted theoretically in magnetization curves. - Highlights: • Modeling of the thermodynamics quantities in NdAl{sub 2} single crystal and policrystal. • Modeling of the transport properties in NdAl{sub 2} single crystal. • Effect of reorientation of spin on caloric and transport properties.

Fibonacci Identities via the Determinant Sum Property

Science.gov (United States)

Spivey, Michael

2006-01-01

We use the sum property for determinants of matrices to give a three-stage proof of an identity involving Fibonacci numbers. Cassini's and d'Ocagne's Fibonacci identities are obtained at the ends of stages one and two, respectively. Catalan's Fibonacci identity is also a special case.

Confinement and transport properties during current ramps in the ASDEX Upgrade tokamak

Science.gov (United States)

Fable, E.; Angioni, C.; Hobirk, J.; Pereverzev, G.; Fietz, S.; Hein, T.; ASDEX Upgrade Team

2011-04-01

A detailed analysis of experimental data from the ASDEX Upgrade tokamak is carried out to shed light on the properties of confinement and transport in the current ramp-up and ramp-down phases of the plasma discharge. The experimental database is used to identify the relevant ranges of parameters explored during the ramp-up and the ramp-down. The energy confinement time observed in the two ramps displays interesting evolution, in many cases attaining different values at the same current level between ramp-up and ramp-down. The possible reasons for this behaviour are investigated. Interpretative transport simulations are used as a tool to clarify the interplay between different parameters, which are coupled in a non-linear way. In addition, a theory-based transport model is used to understand the behaviour of confinement as observed in the experiment, evidencing the role of both turbulent and neoclassical transport. Linear gyrokinetic calculations are performed to identify the relevant turbulence regime, showing that a broad range of frequencies, in the trapped electron modes (TEMs) and in the ion temperature gradient modes (ITGs) regimes, is explored during both the ramp-up and ramp-down. In the same framework, a quasi-linear model is applied to calculate the value of the local logarithmic density gradient and compare it with the experimental value. Finally, first non-linear simulations of heat transport during the current ramps are presented.

Using Contaminant Transport Modeling to Determine Historical Discharges at the Surface

Science.gov (United States)

Fogwell, T. W.

2013-12-01

When it is determined that a contaminated site needs to be remediated, the issue of who is going to pay for that remediation is an immediate concern. This means that there needs to be a determination of who the responsible parties are for the existing contamination. Seldom is it the case that records have been made and kept of the surface contaminant discharges. In many cases it is possible to determine the relative amount of contaminant discharge at the surface of the various responsible parties by employing a careful analysis of the history of contaminant transport through the surface, through the vadose zone, and within the saturated zone. The process begins with the development of a dynamic conceptual site model that takes into account the important features of the transport of the contaminants through the vadose zone and in the groundwater. The parameters for this model can be derived from flow data available for the site. The resulting contaminant transport model is a composite of the vadose zone transport model, together with the saturated zone (groundwater) flow model. Any calibration of the model should be carefully employed in order to avoid using information about the conclusions of the relative discharge amounts of the responsible parties in determining the calibrated parameters. Determination of the leading edge of the plume is an important first step. It is associated with the first discharges from the surface of the site. If there were several discharging parties at the same time, then it is important to establish a chemical or isotopic signature of the chemicals that were discharged. The time duration of the first discharger needs to be determined as accurately as possible in order to establish the appropriate characterization of the leading portion of the resulting plume in the groundwater. The information about the first discharger and the resulting part of the plume associated with this discharger serves as a basis for the determination of the

Demand Elasticity on the Transport Market

OpenAIRE

Teodor Perić; Nada Štrumberger

2002-01-01

The elasticity of demand for traffic se1vices is the adaptationof traffic supply to traffic demand. The elasticity of suchdemand is low which is specific of the transport market, especiallyfrom the aspect of designing traffic demand.The essence of the problem of low elasticity can be noticedin three basic properties:First, in the change of place which determines the traffic demandor traffic relation.Second is the continuity of the need to transport goods andpassengers.Third, the needs for tra...

Study on tracking system for radioactive material transport

Energy Technology Data Exchange (ETDEWEB)

Watanabe, F.; Igarashi, M.; Nomura, T. [Nuclear Emergency Assistance and Training Center, Japan Nuclear Cycle Development Inst., Ibaraki (Japan); Nakagome, Y. [Research Reactor Inst., Kyoto Univ., Osaka (Japan)

2004-07-01

When a transportation accident occurs, all entities including the shipper, the transportation organization, local governments, and emergency response organizations must have organized and planned for civil safety, property, and environmental protection. When a transportation accident occurs, many related organizations will be involved, and their cooperation determines the success or failure of the response. The point where the accident happens cannot be pinpointed in advance. Nuclear fuel transportation also requires a quick response from a viewpoint of security. A tracking system for radioactive material transport is being developed for use in Japan. The objective of this system is, in the rare event of an accident, for communication capabilities to share specific information among relevant organizations, the transporter, and so on.

Study on tracking system for radioactive material transport

International Nuclear Information System (INIS)

Watanabe, F.; Igarashi, M.; Nomura, T.; Nakagome, Y.

2004-01-01

When a transportation accident occurs, all entities including the shipper, the transportation organization, local governments, and emergency response organizations must have organized and planned for civil safety, property, and environmental protection. When a transportation accident occurs, many related organizations will be involved, and their cooperation determines the success or failure of the response. The point where the accident happens cannot be pinpointed in advance. Nuclear fuel transportation also requires a quick response from a viewpoint of security. A tracking system for radioactive material transport is being developed for use in Japan. The objective of this system is, in the rare event of an accident, for communication capabilities to share specific information among relevant organizations, the transporter, and so on

Transport and Fatigue Properties of Ferroelectric Polymer P(VDF-TrFE) For Nonvolatile Memory Applications

KAUST Repository

Hanna, Amir

2012-06-01

Organic ferroelectrics polymers have recently received much interest for use in nonvolatile memory devices. The ferroelectric copolymer poly(vinylidene fluoride- trifluoroethylene) , P(VDF-TrFE), is a promising candidate due to its relatively high remnant polarization, low coercive field, fast switching times, easy processability, and low Curie transition. However, no detailed study of charge injection and current transport properties in P(VDF-TrFE) have been reported in the literature yet. Charge injection and transport are believed to affect various properties of ferroelectric films such as remnant polarization values and polarization fatigue behavior.. Thus, this thesis aims to study charge injection in P(VDF-TrFE) and its transport properties as a function of electrode material. Injection was studied for Al, Ag, Au and Pt electrodes. Higher work function metals such as Pt have shown less leakage current compared to lower work function metals such as Al for more than an order of magnitude. That implied n-type conduction behavior for P(VDF-TrFE), as well as electrons being the dominant injected carrier type. Charge transport was also studied as a function of temperature, and two major transport regimes were identified: 1) Thermionic emission over a Schottky barrier for low fields (E < 25 MV/m). 2) Space-Charge-Limited regime at higher fields (25 < E <120 MV/m). We have also studied the optical imprint phenomenon, the polarization fatigue resulting from a combination of broad band optical illumination and DC bias near the switching field. A setup was designed for the experiment, and validated by reproducing the reported effect in polycrystalline Pb(Zr,Ti)O3 , PZT, film. On the other hand, P(VDF-TrFE) film showed no polarization fatigue as a result of optical imprint test, which could be attributed to the large band gap of the material, and the low intensity of the UV portion of the arc lamp white light used for the experiment. Results suggest using high work

Methylxanthines: properties and determination in various objects

Science.gov (United States)

Andreeva, Elena Yu; Dmitrienko, Stanislava G.; Zolotov, Yurii A.

2012-05-01

Published data on the properties and determination of caffeine, theophylline, theobromine and some other methylxanthines in various objects are surveyed and described systematically. Different sample preparation procedures such as liquid extraction from solid matrices and liquid-liquid, supercritical fluid and solid-phase extraction are compared. The key methods of analysis including chromatography, electrophoresis, spectrometry and electrochemical methods are discussed. Examples of methylxanthine determination in plants, food products, energy beverages, pharmaceuticals, biological fluids and natural and waste waters are given. The bibliography includes 393 references.

Methylxanthines: properties and determination in various objects

International Nuclear Information System (INIS)

Andreeva, Elena Yu; Dmitrienko, Stanislava G; Zolotov, Yurii A

2012-01-01

Published data on the properties and determination of caffeine, theophylline, theobromine and some other methylxanthines in various objects are surveyed and described systematically. Different sample preparation procedures such as liquid extraction from solid matrices and liquid–liquid, supercritical fluid and solid-phase extraction are compared. The key methods of analysis including chromatography, electrophoresis, spectrometry and electrochemical methods are discussed. Examples of methylxanthine determination in plants, food products, energy beverages, pharmaceuticals, biological fluids and natural and waste waters are given. The bibliography includes 393 references.

Empirical investigation of topological and weighted properties of a bus transport network from China

Science.gov (United States)

Shu-Min, Feng; Bao-Yu, Hu; Cen, Nie; Xiang-Hao, Shen; Yu-Sheng, Ci

2016-03-01

Many bus transport networks (BTNs) have evolved into directed networks. A new representation model for BTNs is proposed, called directed-space P. The bus transport network of Harbin (BTN-H) is described as a directed and weighted complex network by the proposed representation model and by giving each node weights. The topological and weighted properties are revealed in detail. In-degree and out-degree distributions, in-weight and out-weight distributions are presented as an exponential law, respectively. There is a strong relation between in-weight and in-degree (also between out-weight and out-degree), which can be fitted by a power function. Degree-degree and weight-weight correlations are investigated to reveal that BTN-H has a disassortative behavior as the nodes have relatively high degree (or weight). The disparity distributions of out-degree and in-degree follow an approximate power-law. Besides, the node degree shows a near linear increase with the number of routes that connect to the corresponding station. These properties revealed in this paper can help public transport planners to analyze the status quo of the BTN in nature. Project supported by the National High Technology Research and Development Program of China (Grant No. 2014AA110304).

Calculation of the coherent transport properties of a symmetric spin nanocontact

International Nuclear Information System (INIS)

Bourahla, B.; Khater, A.; Tigrine, R.

2009-01-01

A theoretical study is presented for the coherent transport properties of a magnetic nanocontact. In particular, we study a symmetric nanocontact between two identical waveguides composed of semi-infinite spin ordered ferromagnetic chains. The coherent transmission and reflection scattering cross sections via the nanocontact, for spin waves incident from the bulk waveguide, are calculated with the use of the matching method. The inter-atomic magnetic exchange on the nanocontact is allowed to vary to investigate the consequences of magnetic softening and hardening for the calculated spectra. Transmission spectra underline the filtering properties of the nanocontact. The localized spin density of states in the nanocontact domain is also calculated, and analyzed. The results yield an understanding of the relationship between coherent conductance and the structural configuration of the nanocontact.

On calculating phase shifts and performing fits to scattering cross sections or transport properties

International Nuclear Information System (INIS)

Hepburn, J.W.; Roy, R.J. Le

1978-01-01

Improved methods of calculating quantum mechanical phase shifts and for performing least-squares fits to scattering cross sections or transport properties, are described. Their use in a five-parameter fit to experimental differential cross sections reduces the computer time by a factor of 4-7. (Auth.)

Serotonin transporter activity of imidazolidine-2,4-dione and imidazo[2,1-f]purine-2,4-dione derivatives in aspect of their acid-base properties.

Science.gov (United States)

Zagórska, Agnieszka; Czopek, Anna; Pawłowski, Maciej; Dybała, Małgorzata; Siwek, Agata; Nowak, Gabriel

2012-11-01

Affinities of arylpiperazinylalkyl derivatives of imidazo[2,1-f]purine-2,4-dione and imidazolidine-2,4-dione for serotonin transporter and their acid-base properties were evaluated. The dissociation constant (pK(a)) of compounds 1-22 were determinated by potentiometric titration and calculated using pKalc 3.1 module of the Pallas system. The data from experimental methods and computational calculations were compared and suitable conclusions were reached.

Transport properties and Raman spectra of impurity substituted MgB2

International Nuclear Information System (INIS)

Masui, T.

2007-01-01

Recent advances in the study of MgB 2 are reviewed, with focus on the transport properties and Raman scattering measurements for impurity substituted crystals. Carbon and Aluminium substitution change band filling, introduce intraband and interband scattering. These effects are seen in the temperature dependence of resistivity, Hall coefficients, and phonon peak of Raman spectra. Manganese substitution introduces magnetic scattering, that increases resistivity but gives little change in Raman spectra. The effect of disorder in neutron irradiated samples is also discussed

Symmetry-Dependent Spin Transport Properties and Spin-Filter Effects in Zigzag-Edged Germanene Nanoribbons

Directory of Open Access Journals (Sweden)

Can Cao

2015-01-01

Full Text Available We performed the first-principles calculations to investigate the spin-dependent electronic transport properties of zigzag-edged germanium nanoribbons (ZGeNRs. We choose of ZGeNRs with odd and even widths of 5 and 6, and the symmetry-dependent transport properties have been found, although the σ mirror plane is absent in ZGeNRs. Furthermore, even-N and odd-N ZGeNRs have very different current-voltage relationships. We find that the even 6-ZGeNR shows a dual spin-filter effect in antiparallel (AP magnetism configuration, but the odd 5-ZGeNR behaves as conventional conductors with linear current-voltage dependence. It is found that when the two electrodes are in parallel configuration, the 6-ZGeNR system is in a low resistance state, while it can switch to a much higher resistance state when the electrodes are in AP configuration, and the magnetoresistance of 270% can be observed.

Thermodynamic and transport properties of nitrogen fluid: Molecular theory and computer simulations

Science.gov (United States)

Eskandari Nasrabad, A.; Laghaei, R.

2018-04-01

Computer simulations and various theories are applied to compute the thermodynamic and transport properties of nitrogen fluid. To model the nitrogen interaction, an existing potential in the literature is modified to obtain a close agreement between the simulation results and experimental data for the orthobaric densities. We use the Generic van der Waals theory to calculate the mean free volume and apply the results within the modified Cohen-Turnbull relation to obtain the self-diffusion coefficient. Compared to experimental data, excellent results are obtained via computer simulations for the orthobaric densities, the vapor pressure, the equation of state, and the shear viscosity. We analyze the results of the theory and computer simulations for the various thermophysical properties.

Anisotropic surface hole-transport property of triphenylamine-derivative single crystal prepared by solution method

Energy Technology Data Exchange (ETDEWEB)

Umeda, Minoru, E-mail: mumeda@vos.nagaokaut.ac.jp [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Katagiri, Mitsuhiko; Shironita, Sayoko [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Nagayama, Norio [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Ricoh Company, Ltd., Nishisawada, Numazu, Shizuoka 410-0007 (Japan)

2016-12-01

Highlights: • A hole transport molecule was investigated based on its electrochemical redox characteristics. • The solubility and supersolubility curves of the molecule were measured in order to prepare a large crystal. • The polarization micrograph and XRD results revealed that a single crystal was obtained. • An anisotropic surface conduction, in which the long-axis direction exceeds that of the amorphous layer, was observed. • The anisotropic surface conduction was well explained by the molecular stacked structure. - Abstract: This paper reports the anisotropic hole transport at the triphenylamine-derivative single crystal surface prepared by a solution method. Triphenylamine derivatives are commonly used in a hole-transport material for organic photoconductors of laser-beam printers, in which the materials are used as an amorphous form. For developing organic photovoltaics using the photoconductor’s technology, preparation of a single crystal seems to be a specific way by realizing the high mobility of an organic semiconductor. In this study, a single crystal of 4-(2,2-diphenylethenyl)-N,N-bis(4-methylphenyl)-benzenamine (TPA) was prepared and its anisotropic hole-transport property measured. First, the hole-transport property of the TPA was investigated based on its chemical structure and electrochemical redox characteristics. Next, a large-scale single crystal formation at a high rate was developed by employing a solution method based on its solubility and supersolubility curves. The grown TPA was found to be a single crystal based on the polarization micrograph observation and crystallographic analysis. For the TPA single crystal, an anisotropic surface conduction was found, which was well explained by its molecular stack structure. The measured current in the long-axis direction is one order of magnitude greater than that of amorphous TPA.

Polarization and charge-transfer effect on the transport properties in two-dimensional electron gases/LaNiO3 heterostructure

Science.gov (United States)

Chen, M. J.; Ning, X. K.; Wang, Z. J.; Liu, P.; Wang, S. F.; Wang, J. L.; Fu, G. S.; Ma, S.; Liu, W.; Zhang, Z. D.

2018-01-01

The film thickness dependent transport properties of the LaNiO3 (LNO) layer epitaxially grown on LaAlO3/SrTiO3 (LAO) 2-dimensional electronic gas (2DEG) have been investigated. The ultrathin LNO films grown on the 2DEG have a sheet resistance below the values of h/e2 in all temperature ranges. The electron density is enhanced by more than one order of magnitude by capping LNO films. X-ray photoelectron spectroscopy shows that the interface undergoes unambiguous charge transfer and electronic reconstruction, leading to modulation doping of such atomically engineered complex oxide heterointerfaces. The polar-catastrophe of the 2DEG is directly linked to the electronic structure and transport properties of the LNO. The transport properties can be well modulated by the thickness of the LAO in the 2DEG, and the data can be well fitted with the polar-catastrophe scenario. These results suggest a general approach to tunable functional films in oxide heterostructures with the 2DEG.

Effects of interfacial Fe electronic structures on magnetic and electronic transport properties in oxide/NiFe/oxide heterostructures

International Nuclear Information System (INIS)

Liu, Qianqian; Chen, Xi; Zhang, Jing-Yan; Yang, Meiyin; Li, Xu-Jing; Jiang, Shao-Long; Liu, Yi-Wei; Cao, Yi; Wu, Zheng-Long; Feng, Chun; Ding, Lei; Yu, Guang-Hua

2015-01-01

Highlights: • The magnetic and transport properties of oxide/NiFe/oxide films were studied. • The oxide (SiO 2 , MgO and HfO 2 ) has different elemental electronegativity. • Redox reaction at different NiFe/oxide interface is dependent on the oxide layer. • Different interfacial electronic structures shown by XPS influence the properties. - Abstract: We report that the magnetic and electronic transport properties in oxide/NiFe(2 nm)/oxide film (oxide = SiO 2 , MgO or HfO 2 ) are strongly influenced by the electronic structure of NiFe/oxide interface. Magnetic measurements show that there exist magnetic dead layers in the SiO 2 sandwiched film and MgO sandwiched film, whereas there is no magnetic dead layer in the HfO 2 sandwiched film. Furthermore, in the ultrathin SiO 2 sandwiched film no magnetoresistance (MR) is detected, while in the ultrathin MgO sandwiched film and HfO 2 sandwiched film the MR ratios reach 0.35% and 0.88%, respectively. The investigation by X-ray photoelectron spectroscopy reveals that the distinct interfacial redox reactions, which are dependent on the oxide layers, lead to the variation of magnetic and transport properties in different oxide/NiFe/oxide heterostructures

Blue emitting 1,8-naphthalimides with electron transport properties for organic light emitting diode applications

Science.gov (United States)

Ulla, Hidayath; Kiran, M. Raveendra; Garudachari, B.; Ahipa, T. N.; Tarafder, Kartick; Adhikari, Airody Vasudeva; Umesh, G.; Satyanarayan, M. N.

2017-09-01

In this article, the synthesis, characterization and use of two novel naphthalimides as electron-transporting emitter materials for organic light emitting diode (OLED) applications are reported. The molecules were obtained by substituting electron donating chloro-phenoxy group at the C-4 position. A detailed optical, thermal, electrochemical and related properties were systematically studied. Furthermore, theoretical calculations (DFT) were performed to get a better understanding of the electronic structures. The synthesized molecules were used as electron transporters and emitters in OLEDs with three different device configurations. The devices with the molecules showed blue emission with efficiencies of 1.89 cdA-1, 0.98 lmW-1, 0.71% at 100 cdm-2. The phosphorescent devices with naphthalimides as electron transport materials displayed better performance in comparison to the device without any electron transporting material and were analogous with the device using standard electron transporting material, Alq3. The results demonstrate that the naphthalimides could play a significant part in the progress of OLEDs.

NUMERICALLY DETERMINED TRANSPORT LAWS FOR FINGERING ('THERMOHALINE') CONVECTION IN ASTROPHYSICS

International Nuclear Information System (INIS)

Traxler, A.; Garaud, P.; Stellmach, S.

2011-01-01

We present the first three-dimensional simulations of fingering convection performed at parameter values approaching those relevant for astrophysics. Our simulations reveal the existence of simple asymptotic scaling laws for turbulent heat and compositional transport, which can be straightforwardly extrapolated from our numerically tractable values to the true astrophysical regime. Our investigation also indicates that thermo-compositional 'staircases', a key consequence of fingering convection in the ocean, cannot form spontaneously in the fingering regime in stellar interiors. Our proposed empirically determined transport laws thus provide simple prescriptions for mixing by fingering convection in a variety of astrophysical situations, and should, from here on, be used preferentially over older and less accurate parameterizations. They also establish that fingering convection does not provide sufficient extra-mixing to explain observed chemical abundances in red giant branch stars.

Thermal transport properties of niobium and some niobium-based alloys from 80 to 1600 K

Energy Technology Data Exchange (ETDEWEB)

Moore, J P; Graves, R S; Williams, R K [Oak Ridge National Lab., TN (USA)

1980-01-01

The electric resistivity, rho, and Seebeck coefficient, S, of 99.8 at% niobium, and Nb-4.8 at% W, Nb-5 at% Mo, Nb-10 at% Mo, and Nb-2.4 at% Mo-2.4 at% Zr alloys were measured from 80 to 1600 K, and the thermal conductivity, lambda, of the niobium and the Nb-5 at% W alloy was measured from 80 to 1300 K. A technique is described for measuring rho and S of a specimen during radial-heat-flow measurements of lambda. The transport property results, which had uncertainties of +-0.4% for rho and +-1.4% for lambda, showed the influence of tungsten and molybdenum solutes on the transport properties of niobium and were used to obtain the electronic Lorenz function of pure niobium, which was found to approach the Sommerfeld value at high temperatures.

Composition control of low-volatile solids through chemical vapor transport reactions. III. The example of gallium monoselenide: Control of the polytypic structure, non-stoichiometry and properties

International Nuclear Information System (INIS)

Zavrazhnov, A.; Naumov, A.; Sidey, V.; Pervov, V.

2012-01-01

Highlights: ► This work is devoted to the composition control of solids with selective CVT method. ► Phase identity and non-stoichiometry of solids (GaSe, etc.) depend on CVT-temperatures. ► The interrelation between the properties of GaSe and CVT conditions is also found. ► For iodide transporting system the diagram of phase stability of solids is adjusted. ► High temperatures and Se-rich non-stoichiometry are necessary for γ-GaSe stability. - Abstract: By means of particular examples, the present work demonstrates the possibility of directed delicate non-destructive control of structure, composition and properties of inorganic solids using the method of selective chemical vapor transport (SCVT). Gallium monoselenide GaSe is the main model object. Additional, though less detailed, explanation is given by the example of gallium monosulfide GaS. Experimental evidences on the possibility of the control of polytypic structure, non-stoichiometry and properties of gallium monoselenide were obtained in non-isothermal variant of selective chemical vapor transport which has non-destructive character. Diagnostics of the phase (polytypic) composition and non-stoichiometry of GaSe was performed with the use of X-ray diffractometry as well as with the use of cathode luminescence spectra. It was experimentally found that there exists a connection of non-stoichiometry and the properties of gallium selenides with the determining conditions of selective chemical vapor transport: temperature of controlled sample (T 2 ) and the difference of temperatures between the hot and cold zones (ΔT). It is shown that the phase diagram of Ga–Se system needs to be partially revised near the composition of Ga 1 Se 1 . The reason for such revision is the fact that two polytypes (ε-GaSe and γ-GaSe) exist on this phase diagram as independent phases.

Electrical conductivity and transport properties of cement-based materials measured by impedance spectroscopy

Science.gov (United States)

Shane, John David

The use of Impedance Spectroscopy (IS) as a tool to evaluate the electrical and transport properties of cement-based materials was critically evaluated. Emphasis was placed on determining the efficacy of IS by applying it as a tool to investigate several families of cement-based materials. Also, the functional aspects of electroding and null corrections were also addressed. The technique was found to be advantageous for these analyses, especially as a non-destructive, in-situ, rapid test. Moreover, key insights were gained into several cement-based systems (e.g., cement mortars and oil-well grouts) as well as the effect that certain testing techniques can have on materials (e.g., the rapid chloride permeability test). However, some limitations of IS were identified. For instance, improper electroding of samples can lead to erroneous results and incorrect interpretations for both two-point and multi-point measurements. This is an area of great importance, but it has received very little attention in the literature. Although the analysis of cement/electrode techniques is in its infancy, much progress was made in gaining a full understand of how to properly and reliably connect electrodes to cement-based materials. Through the application of IS to materials such as oil-well grouts, cement mortars and concretes, a great deal of valuable information about the effectiveness of IS has been gained. Oil-well cementing is somewhat limited by the inability to make measurements in the well-bore. By applying IS to oil-well grouts in a laboratory environment, it was demonstrated that IS is a viable technique with which to test the electrical and transport properties of these materials in-situ. Also, IS was shown to have the ability to measure the electrical conductivity of cement mortars with such accuracy, that very subtle changes in properties can be monitored and quantified. Through the use of IS and theoretical models, the complex interplay between the interfacial transition

The local structure, magnetic, and transport properties of Cr-doped In2O3 films

International Nuclear Information System (INIS)

Wang Shiqi; An Yukai; Feng Deqiang; Liu Jiwen; Wu Zhonghua

2013-01-01

Cr-doped In 2 O 3 films were deposited on Si (100) substrates by RF-magnetron sputtering technique. The local structure, magnetic, and transport properties of films are investigated by X-ray diffraction, X-ray photoelectron spectroscopy, X-ray absorption fine structure, Hall effect, R-T, and magnetic measurements. Structural analysis clearly indicates that Cr ions substitute for In 3+ sites of the In 2 O 3 lattice in the valence of +2 states and Cr-related secondary phases or clusters as the source of ferromagnetism is safely ruled out. The films with low Cr concentration show a crossover from semiconducting to metallic transport behavior, whereas only semiconducting behavior is observed in high Cr concentration films. The transport property of all films is governed by Mott variable range hopping behavior, suggesting that the carriers are strongly localized. Magnetic characterizations show that the saturated magnetization of films increases first, and then decreases with Cr doping, while carrier concentration n c decreases monotonically, implying that the ferromagnetism is not directly induced by the mediated carriers. It can be concluded the ferromagnetism of films is intrinsic and originates from electrons bound in defect states associated with oxygen vacancies.

Transport properties of dense matter

International Nuclear Information System (INIS)

Itoh, Naoki; Mitake, Shinichi; Iyetomi, Hiroshi; Ichimaru, Setsuo

1983-01-01

Transport coefficients, electrical and thermal conductivities in particular, are essential physical quantities for the theories of stellar structure. Since the discoveries of pulsars and X-ray stars, an accurate evaluation of the transport coefficients in the dense matter has become indispensable to the quantitative understanding of the observed neutron stars. The authors present improved calculations of the electrical and thermal conductivities of the dense matter in the liquid metal phase, appropriate to white dwarfs and neutron stars. (Auth.)

Local charge transport properties of hydrazine reduced monolayer graphene oxide sheets prepared under pressure condition

DEFF Research Database (Denmark)

Ryuzaki, Sou; Meyer, Jakob Abild Stengaard; Petersen, Søren Vermehren

2014-01-01

Charge transport properties of chemically reduced graphene oxide (RGO) sheets prepared by treatment with hydrazine were examined using conductive atomic force microscopy. The current-voltage (I-V) characteristics of monolayer RGO sheets prepared under atmospheric pressure followed an exponentially...

The shielding properties of the newly developed container for transport of samples contaminated with CBRN substances

International Nuclear Information System (INIS)

Fisera, O.; Kares, J.

2014-01-01

A container for transport of environmental samples to the analytical laboratory is being developed as part of the development of system for collection and transport of samples contaminated with chemical, biological, radioactive and nuclear (CBRN) substances after CBRN incidents. The proposed system corresponds with current requirements of NATO publication AEP-66. The proposed container will meet the requirements of mechanical stability and tightness for the packaging of the chemical, biological and radioactive substances. Verification of shielding properties and satisfaction of requirements of radiation protection during transport of potentially relatively high active samples was the aim of this part of research. The results, together with a wall thickness of the inner steel container, the inner lining and the outer transport package, give excellent assumption that the radiation protection requirements for the proposed container and transport package will be satisfied. (authors)

First thermochemical property of Seaborgium determined

Energy Technology Data Exchange (ETDEWEB)

Tuerler, A. for a LBNL Berkeley - Univ. Bern - FLNR Dubna -GSI Darmstadt - TU Dresden - Chalmers Univ. of Technology Goeteborg - GH Kassel - ITS and LLNL Livermore - Univ. Mainz - Univ. Oslo - FZ Rossendorf - JAERI Tokai - PSI Villigen collaboration

1997-09-01

The chemical properties of SgO{sub 2}Cl{sub 2} (element 106 = Seaborgium, Sg) were successfully studied using the On-line Gas Chromatography Apparatus (OLGA III). After chemical separation of Sg the nuclides {sup 265}Sg and {sup 266}Sg were unambiguously identified and their half-lives were determined for the first time. The Sg nuclides were produced from the {sup 248}Cm({sup 22}Ne,4,5n){sup 266,265}Sg reaction at the GSI Darmstadt UNILAC accelerator. Simultaneously, short-lived W nuclides were produced from a small admixture of {sup 152}Gd to the Cm target material. As predicted by relativistic calculations and by extrapolations of chemical properties, it was demonstrated that Sg oxychlorides are indeed less volatile than their lighter homologue Mo- and equally or less volatile than W-oxychlorides. (author) 1 fig., 1 tab., 4 refs.

Effect of hole injection layer/hole transport layer polymer and device structure on the properties of white OLED.

Science.gov (United States)

Cho, Ho Young; Park, Eun Jung; Kim, Jin-Hoo; Park, Lee Soon

2008-10-01

Copolymers containing carbazole and aromatic amine unit were synthesized by using Pd-catalyzed polycondensation reaction. The polymers were characterized in terms of their molecular weight and thermal stability and their UV and PL properties in solution and film state. The band gap energy of the polymers was also determined by the UV absorption and HOMO energy level data. The polymers had high HOMO energy level of 5.19-5.25 eV and work function close to that of ITO. The polymers were thus tested as hole injection/transport layer in the white organic light emitting diodes (OLED) by using 4,4'-bis(2,2-diphenyl-ethen-1-yl)diphenyl (DPVBi) as blue emitting material and 5,6,11,12-tetraphenylnaphthacene (Rubrene) as orange emitting dopant. The synthesized polymer, poly bis[6-bromo-N-(2-ethylhexyl)-carbazole-3-yl] was found to be useful as hole injection layer/hole transport layer (HIL/HTL) multifunctional material with high luminance efficiency and stable white color coordinate in the wide range of applied voltage.

The application of radioactive tracers for determination of bed-load transport in alluvial rivers

International Nuclear Information System (INIS)

Thomsen, T.

1980-01-01

Radioactive isotopes have been applied for determining the transport rate of bed load in an alluvial river on the basis of: centroid velocity of the tracer particles, size and material-transporting width of mobile layer. These parameters were found by detailed measurements in the field. Computed values were produced on the basis of Engelund and Fredsoee's model on sediment transport and on the propagation of bed forms. When comparing measured and computed values, the difference was about 25%. Finally, the applicability of tracer methods for solving practical problem is discussed. (author)

Transition phenomena and thermal transport property in LHD plasmas with an electron internal transport barrier

International Nuclear Information System (INIS)

Shimozuma, T.; Kubo, S.; Idei, H.

2005-01-01

Two kinds of improved core confinement were observed during centrally focused Electron Cyclotron Heating (ECH) into plasmas sustained by Counter (CNTR) and Co Neutral Beam Injections (NBI) in the Large Helical Device (LHD). One shows transition phenomena to the high-electron-temperature state and has a clear electron Internal Transport Barrier (eITB) in CNTR NBI plasma. Another has no clear transition and no ECH power threshold, but shows a broad high temperature profiles with moderate temperature gradient, which indicates the improved core confinement with additional ECH in Co NBI plasma. The electron heat transport characteristics of these plasmas were directly investigated by using the heat pulse propagation excited by Modulated ECH (MECH). The difference of the features could be caused by the existence of the m/n=2/1 rational surface or island determined by the direction of NBI beam-driven current. (author)

Identification of the key determinant of the transport promiscuity in Na+-translocating rhodopsins.

Science.gov (United States)

Mamedov, Adalyat M; Bertsova, Yulia V; Anashkin, Viktor A; Mamedov, Mahir D; Baykov, Alexander A; Bogachev, Alexander V

2018-05-15

Bacterial Na + -transporting rhodopsins convert solar energy into transmembrane ion potential difference. Typically, they are strictly specific for Na + , but some can additionally transport H + . To determine the structural basis of cation promiscuity in Na + -rhodopsins, we compared their primary structures and found a single position that harbors a cysteine in strictly specific Na + -rhodopsins and a serine in the promiscuous Krokinobacter eikastus Na + -rhodopsin (Kr2). A Cys253Ser variant of the strictly specific Dokdonia sp. PRO95 Na + -rhodopsin (NaR) was indeed found to transport both Na + and H + in a light-dependent manner when expressed in retinal-producing Escherichia coli cells. The dual specificity of the NaR variant was confirmed by analysis of its photocycle, which revealed an acceleration of the cation-capture step by comparison with the wild-type NaR in a Na + -deficient medium. The structural basis for the dependence of the Na + /H + specificity in Na + -rhodopsin on residue 253 remains to be determined. Copyright © 2018 Elsevier Inc. All rights reserved.

Local transport properties, morphology and microstructure of ZnO decorated SiO{sub 2} nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Van Nostrand, Joseph E [Air Force Research Laboratory, Information Directorate, Rome, NY (United States); Cortez, Rebecca [Union College, Schenectady, NY (United States); Rice, Zachary P; Cady, Nathaniel C; Bergkvist, Magnus, E-mail: Joseph.VanNostrand@rl.af.mil [Albany College of Nanoscale Science and Engineering, Albany, NY (United States)

2010-10-15

We report on a novel, surfactant free method for achieving nanocrystalline ZnO decoration of an SiO{sub 2} nanoparticle at ambient temperature. The size distributions of the naked and decorated SiO{sub 2} nanoparticles are measured by means of dynamic light scattering, and a monodisperse distribution is observed for each. The morphology and microstructure of the nanoparticles are explored using atomic force microscopy and high resolution transmission electron microscopy. Investigation of the optical properties of the ZnO decorated SiO{sub 2} nanoparticles shows absorption at 350 nm. This blue shift in absorption as compared to bulk ZnO is shown to be consistent with quantum confinement effects due to the small size of the ZnO nanocrystals. Finally, the local electronic transport properties of the nanoparticles are explored by scanning conductance atomic force microscopy. A memristive hysteresis in the transport properties of the individual ZnO decorated SiO{sub 2} nanoparticles is observed. Optical absorption measurements suggest the presence of oxygen vacancies, whose migration and annihilation appear to contribute to the dynamic conduction properties of the ZnO decorated nanoparticles. We believe this to be the first demonstration of a ZnO decorated SiO{sub 2} nanoparticle, and this represents a simple yet powerful way of achieving the optical and electrical properties of ZnO in combination with the simplicity of SiO{sub 2} synthesis.

Semiquantum molecular dynamics simulation of thermal properties and heat transport in low-dimensional nanostructures

Science.gov (United States)

Savin, Alexander V.; Kosevich, Yuriy A.; Cantarero, Andres

2012-08-01

We present a detailed description of semiquantum molecular dynamics simulation of stochastic dynamics of a system of interacting particles. Within this approach, the dynamics of the system is described with the use of classical Newtonian equations of motion in which the effects of phonon quantum statistics are introduced through random Langevin-like forces with a specific power spectral density (the color noise). The color noise describes the interaction of the molecular system with the thermostat. We apply this technique to the simulation of thermal properties and heat transport in different low-dimensional nanostructures. We describe the determination of temperature in quantum lattice systems, to which the equipartition limit is not applied. We show that one can determine the temperature of such a system from the measured power spectrum and temperature- and relaxation-rate-independent density of vibrational (phonon) states. We simulate the specific heat and heat transport in carbon nanotubes, as well as the heat transport in molecular nanoribbons with perfect (atomically smooth) and rough (porous) edges, and in nanoribbons with strongly anharmonic periodic interatomic potentials. We show that the effects of quantum statistics of phonons are essential for the carbon nanotube in the whole temperature range T<500K, in which the values of the specific heat and thermal conductivity of the nanotube are considerably less than that obtained within the description based on classical statistics of phonons. This conclusion is also applicable to other carbon-based materials and systems with high Debye temperature like graphene, graphene nanoribbons, fullerene, diamond, diamond nanowires, etc. We show that the existence of rough edges and quantum statistics of phonons change drastically the low-temperature thermal conductivity of the nanoribbon in comparison with that of the nanoribbon with perfect edges and classical phonon dynamics and statistics. The semiquantum molecular

Electrical properties of zirconium diselenide single crystals grown by iodine transport method

International Nuclear Information System (INIS)

Patel, S.G.; Agarwal, M.K.; Batra, N.M.; Lakshminarayana, D.

1998-01-01

Single crystals of zirconium diselenide (ZrSe 2 ) were grown by chemical vapour transport method using iodine as the transporting agent. The crystals were found to exhibit metallic behaviour in the temperature range 77-300 K and semiconducting nature in 300-443 K range. The measurements of thermoelectric power and conductivity enabled the determination of both carrier mobility and carrier concentration. The variation of carrier mobility and carrier concentration with temperature indicates the presence of deep trapping centres and their reduction with temperature in these crystals. (author)

The Effect of Reactive Ionic Liquid or Plasticizer Incorporation on the Physicochemical and Transport Properties of Cellulose Acetate Propionate-Based Membranes

Directory of Open Access Journals (Sweden)

Edyta Rynkowska

2018-01-01

Full Text Available Pervaporation is a membrane-separation technique which uses polymeric and/or ceramic membranes. In the case of pervaporation processes applied to dehydration, the membrane should transport water molecules preferentially. Reactive ionic liquid (RIL (3-(1,3-diethoxy-1,3-dioxopropan-2-yl-1-methyl-1H-imidazol-3-ium was used to prepare novel dense cellulose acetate propionate (CAP based membranes, applying the phase-inversion method. The designed polymer-ionic liquid system contained ionic liquid partially linked to the polymeric structure via the transesterification reaction. The various physicochemical, mechanical, equilibrium and transport properties of CAP-RIL membranes were determined and compared with the properties of CAP membranes modified with plasticizers, i.e., tributyl citrate (TBC and acetyl tributyl citrate (ATBC. Thermogravimetric analysis (TGA testified that CAP-RIL membranes as well as CAP membranes modified with TBC and ATBC are thermally stable up to at least 120 °C. Tensile tests of the membranes revealed improved mechanical properties reflected by reduced brittleness and increased elongation at break achieved for CAP-RIL membranes in contrast to pristine CAP membranes. RIL plasticizes the CAP matrix, and CAP-RIL membranes possess preferable mechanical properties in comparison to membranes with other plasticizers investigated. The incorporation of RIL into CAP membranes tuned the surface properties of the membranes, enhancing their hydrophilic character. Moreover, the addition of RIL into CAP resulted in an excellent improvement of the separation factor, in comparison to pristine CAP membranes, in pervaporation dehydration of propan-2-ol. The separation factor β increased from ca. 10 for pristine CAP membrane to ca. 380 for CAP-16.7-RIL membranes contacting an azeotropic composition of water-propan-2-ol mixture (i.e., 12 wt % water.

How Are Property Investment Returns Determined? : Estimating the Micro-Structure of Asset Prices, Property Income, and Discount Rates

OpenAIRE

Shimizu, Chihiro

2014-01-01

How exactly should one estimate property investment returns? Investors in property aim to maximize capital gains from price increases and income generated by the property. How are the returns on investment in property determined based on its characteristics, and what kind of market characteristics does it have? Focusing on the Tokyo commercial property market and residential property market, the purpose of this paper was to break down and measure the micro-structure of property investment ret...

Transport properties of metal-metal and metal-insulator heterostructures

Energy Technology Data Exchange (ETDEWEB)

Fadlallah Elabd, Mohamed Mostafa

2010-06-09

In this study we present results of electronic structure and transport calculations for metallic and metal-insulator interfaces, based on density functional theory and the non-equilibrium Green's function method. Starting from the electronic structure of bulk Al, Cu, Ag, and Au interfaces, we study the effects of different kinds of interface roughness on the transmission coefficient (T(E)) and the I-V characteristic. In particular, we compare prototypical interface distortions, including vacancies, metallic impurities, non-metallic impurities, interlayer, and interface alloy. We find that vacancy sites have a huge effect on transmission coefficient. The transmission coefficient of non-metallic impurity systems has the same behaviour as the transmission coefficient of vacancy system, since these systems do not contribute to the electronic states at the Fermi energy. We have also studied the transport properties of Au-MgO-Au tunnel junctions. In particular, we have investigated the influence of the thickness of the MgO interlayer, the interface termination, the interface spacing, and O vacancies. Additional interface states appear in the O-terminated configuration due to the formation of Au-O bonds. An increasing interface spacing suppresses the Au-O bonding. Enhancement of T(E) depends on the position and density of the vacancies (the number of vacancies per unit cell). (orig.)

Probabilistic finite-size transport models for fusion: Anomalous transport and scaling laws

International Nuclear Information System (INIS)

Milligen, B.Ph. van; Sanchez, R.; Carreras, B.A.

2004-01-01

Transport in fusion plasmas in the low confinement mode is characterized by several remarkable properties: the anomalous scaling of transport with system size, stiff (or 'canonical') profiles, power degradation, and rapid transport phenomena. The present article explores the possibilities of constructing a unified transport model, based on the continuous-time random walk, in which all these phenomena are handled adequately. The resulting formalism appears to be sufficiently general to provide a sound starting point for the development of a full-blown plasma transport code, capable of incorporating the relevant microscopic transport mechanisms, and allowing predictions of confinement properties

Thermal transport properties of niobium and some niobium base alloys from 80 to 16000K

International Nuclear Information System (INIS)

Moore, J.P.; Graves, R.S.; Williams, R.K.

1980-01-01

The electrical resistivities and absolute Seebeck coefficients of 99.8 at. % niobium with a RRR of 36, Nb-4.8 at. % W, Nb-5 at. % Mo, Nb-10 at. % Mo, and Nb-2.4 at. % Mo-2.4 at. % Zr were measured from 80 to 1600 0 K, and the thermal conductivities of the niobium and Nb-5 at. % W were measured from 80 to 1300 0 K. A technique is described for measuring the electrical resistivity and Seebeck coefficient of a specimen during radial heat flow measurements of the thermal conductivity. The transport property results, which had uncertainties of +-0.4%for electrical resistivity and +-1.4% for thermal conductivity, showed the influence of tungsten and molybdenum solutes on the transport properties of niobium and were used to obtain the electronic Lorenz function of pure niobium, which was found to approach the Sommerfeld value at high temperatures

properties of the SN - equivalent integral transport operator in slab geometry and the iterative acceleration of neutron transport methods

International Nuclear Information System (INIS)

Massimiliano, Rosa; Azmy, Y.Y.; Morel, J.E.

2005-01-01

The general expressions for the matrix elements of the discrete Sn-equivalent integral transport operator have been derived in slab geometry. Their asymptotic behavior has been investigated both for a homogeneous slab and for a heterogeneous slab characterized by a periodic material discontinuity wherein each optically thick cell is surrounded by two optically thin cells in a repeating pattern. In the case of a homogeneous slab, the asymptotic analysis conducted in a diffusive limit obtained as the thick limit of computational cell size for a highly scattering medium, has shown that the discretized integral transport operator is approximated by a sparse matrix characterized by a tri-diagonal diffusion-like coupling stencil. Also, the tri-diagonal matrix structure, characteristic of the diffusion coupling stencil, is approached at a fast exponential rate. In the case of periodically heterogeneous slab configurations, the asymptotic behavior investigated is that in which the cells' optical thicknesses are pushed apart, i.e. the thick is made thicker while the thin is made thinner at a prescribed rate. It has been shown that in this limit the discretized integral transport operator is approximated by a penta-diagonal structure. Notwithstanding, the discrete operator is amenable to algebraic transformations leading to a matrix representation still asymptotically approaching a tri-diagonal structure at a fast exponential rate. The existence of a low order tri-diagonal approximation to the full discrete integral transport operator in the case of a periodically heterogeneous slab might provide a basic understanding of the superior convergence properties of diffusion-based acceleration schemes observed in slab geometry, even in the presence of sharp material discontinuities. The obtained results also suggest that a sparse approximation to the S n -equivalent integral transport operator might itself be used as the low-order operator in an acceleration scheme for the

Determinación experimental de los coeficientes locales de transporte de humedad en almacenes soterrados. // Experimental determination of local humidity transport coefficients in underground warehouses.

Directory of Open Access Journals (Sweden)

Ma. D. Andrade Gregori

2006-05-01

Full Text Available En el trabajo se fundamentan los mecanismos de transporte de humedad que tienen lugar en almacenes soterrados dadas lascaracterísticas climáticas y geohidrològicas de Cuba. Se establece una analogía con la ley de Fick y se propone un modeloteórico que describe este mecanismo de transporte hacia las cavidades. Se determinó experimentalmente los coeficienteslocales de transporte de humedad para diferentes tipos de recubrimiento en paredes y diferentes formas geométricas de losalmacenes.Palabras claves: Almacenes, soterrado, humedad, conservación, coeficientes._______________________________________________________________________________Abstract.In this paper the mechanisms of humidity transport are explained. These mechanisms have place in underground warehousesaccording to the climatic and geohydrological characteristics of Cuba. An analogy with the Fick´s law is stated and it intends atheoretical model that describes this mechanism of transport toward the cavities. It was determined the local coefficients oftransport of humidity experimentally for different recover types in walls and different geometric forms of the warehouses.Key words: Store, buried, humidity, conservation, and coefficients.

Defect chemistry of ''BaCuO2''. Pt. 2. Transport properties and nature of defects

International Nuclear Information System (INIS)

Chiodelli, G.; Consiglio Nazionale delle Ricerche, Pavia; Anselmi-Tamburini, U.; Consiglio Nazionale delle Ricerche, Pavia; Arimondi, M.; Consiglio Nazionale delle Ricerche, Pavia; Spinolo, G.; Consiglio Nazionale delle Ricerche, Pavia; Flor, G.; Consiglio Nazionale delle Ricerche, Pavia

1995-01-01

The charge transport properties of ''BaCuO 2 '' with 88:90 (Ba:Cu) cation ratio were characterized by thermopower, electrical conductivity and ionic transport number measurements in a wide range of temperature and oxygen partial pressure conditions. The nature of carriers is always represented by small polarons due to self-trapping of the electronic holes generated by the oxygen non-stoichiometry equilibrium. Some anomalies in carrier mobility as a function of temperature are shown not to be related to incomplete ionization of oxygen atoms on interstitial sites (orig.)

Transport properties of damaged materials. Cementitious barriers partnership

Energy Technology Data Exchange (ETDEWEB)

Langton, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2014-11-01

The objective of the Cementitious Barriers Partnership (CBP) project is to develop tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers used in low-level waste storage applications. One key concern for the long-term durability of concrete is the degradation of the cementitious matrix, which occurs as a result of aggressive chemical species entering the material or leaching out in the environment, depending on the exposure conditions. The objective of the experimental study described in this report is to provide experimental data relating damage in cementitious materials to changes in transport properties, which can eventually be used to support predictive model development. In order to get results within a reasonable timeframe and to induce as much as possible uniform damage level in materials, concrete samples were exposed to freezing and thawing (F/T) cycles. The methodology consisted in exposing samples to F/T cycles and monitoring damage level with ultrasonic pulse velocity measurements. Upon reaching pre-selected damage levels, samples were tested to evaluate changes in transport properties. Material selection for the study was motivated by the need to get results rapidly, in order to assess the relevance of the methodology. Consequently, samples already available at SIMCO from past studies were used. They consisted in three different concrete mixtures cured for five years in wet conditions. The mixtures had water-to-cement ratios of 0.5, 0.65 and 0.75 and were prepared with ASTM Type I cement only. The results showed that porosity is not a good indicator for damage caused by the formation of microcracks. Some materials exhibited little variations in porosity even for high damage levels. On the other hand, significant variations in tortuosity were measured in all materials. This implies that damage caused by internal pressure does not necessarily create additional pore space in

Transport properties of damaged materials. Cementitious barriers partnership

International Nuclear Information System (INIS)

Langton, C.

2014-01-01

The objective of the Cementitious Barriers Partnership (CBP) project is to develop tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers used in low-level waste storage applications. One key concern for the long-term durability of concrete is the degradation of the cementitious matrix, which occurs as a result of aggressive chemical species entering the material or leaching out in the environment, depending on the exposure conditions. The objective of the experimental study described in this report is to provide experimental data relating damage in cementitious materials to changes in transport properties, which can eventually be used to support predictive model development. In order to get results within a reasonable timeframe and to induce as much as possible uniform damage level in materials, concrete samples were exposed to freezing and thawing (F/T) cycles. The methodology consisted in exposing samples to F/T cycles and monitoring damage level with ultrasonic pulse velocity measurements. Upon reaching pre-selected damage levels, samples were tested to evaluate changes in transport properties. Material selection for the study was motivated by the need to get results rapidly, in order to assess the relevance of the methodology. Consequently, samples already available at SIMCO from past studies were used. They consisted in three different concrete mixtures cured for five years in wet conditions. The mixtures had water-to-cement ratios of 0.5, 0.65 and 0.75 and were prepared with ASTM Type I cement only. The results showed that porosity is not a good indicator for damage caused by the formation of microcracks. Some materials exhibited little variations in porosity even for high damage levels. On the other hand, significant variations in tortuosity were measured in all materials. This implies that damage caused by internal pressure does not necessarily create additional pore space in

Space Transportation System (STS)-133/External Tank (ET)-137 Intertank (IT) Stringer Cracking Issue and Repair Assessment: Proximate Cause Determination and Material Characterization Study

Science.gov (United States)

Piascik, Robert S.

2011-01-01

Several cracks were detected in stringers located beneath the foam on the External Tank (ET) following the launch scrub of Space Transportation System (STS)-133 on November 5, 2010. The stringer material was aluminum-lithium (AL-Li) 2090-T83 fabricated from sheets that were nominally 0.064 inches thick. The mechanical properties of the stringer material were known to vary between different material lots, with the stringers from ET-137 (predominately lots 620853 and 620854) having the highest yield and ultimate stresses. Subsequent testing determined that these same lots also had the lowest fracture toughness properties. The NASA Engineering and Safety Center (NESC) supported the Space Shuttle Program (SSP)-led investigation. The objective of this investigation was to develop a database of test results to provide validation for structural analysis models, independently confirm test results obtained from other investigators, and determine the proximate cause of the anomalous low fracture toughness observed in stringer lots 620853 and 620854. This document contains the outcome of the investigation.

Polycrystalline Mg2Si thin films: A theoretical investigation of their electronic transport properties

International Nuclear Information System (INIS)

Balout, H.; Boulet, P.; Record, M.-C.

2015-01-01

The electronic structures and thermoelectric properties of a polycrystalline Mg 2 Si thin film have been investigated by first-principle density-functional theory (DFT) and Boltzmann transport theory calculations within the constant-relaxation time approximation. The polycrystalline thin film has been simulated by assembling three types of slabs each having the orientation (001), (110) or (111) with a thickness of about 18 Å. The effect of applying the relaxation procedure to the thin film induces disorder in the structure that has been ascertained by calculating radial distribution functions. For the calculations of the thermoelectric properties, the energy gap has been fixed at the experimental value of 0.74 eV. The thermoelectric properties, namely the Seebeck coefficient, the electrical conductivity and the power factor, have been determined at three temperatures of 350 K, 600 K and 900 K with respect to both the energy levels and the p-type and n-type doping levels. The best Seebeck coefficient is obtained at 350 K: the S yy component of the tensor amounts to about ±1000 μV K −1 , depending on the type of charge carriers. However, the electrical conductivity is much too small which results in low values of the figure of merit ZT. Structure–property relationship correlations based on directional radial distribution functions allow us to tentatively draw some explanations regarding the anisotropy of the electrical conductivity. Finally, the low ZT values obtained for the polycrystalline Mg 2 Si thin film are paralleled with those recently reported in the literature for bulk chalcogenide glasses. - Graphical abstract: Structure of the polycrystalline thin film of Mg 2 Si. - Author-Highlights: • Polycrystalline Mg 2 Si film has been modelled by DFT approach. • Thermoelectric properties have been evaluated by semi-classical Boltzmann theory. • The structure was found to be slightly disordered after relaxation. • The highest value of Seebeck

Interpreting equilibrium-conductivity and conductivity-relaxation measurements to establish thermodynamic and transport properties for multiple charged defect conducting ceramics.

Science.gov (United States)

Zhu, Huayang; Ricote, Sandrine; Coors, W Grover; Kee, Robert J

2015-01-01

A model-based interpretation of measured equilibrium conductivity and conductivity relaxation is developed to establish thermodynamic, transport, and kinetics parameters for multiple charged defect conducting (MCDC) ceramic materials. The present study focuses on 10% yttrium-doped barium zirconate (BZY10). In principle, using the Nernst-Einstein relationship, equilibrium conductivity measurements are sufficient to establish thermodynamic and transport properties. However, in practice it is difficult to establish unique sets of properties using equilibrium conductivity alone. Combining equilibrium and conductivity-relaxation measurements serves to significantly improve the quantitative fidelity of the derived material properties. The models are developed using a Nernst-Planck-Poisson (NPP) formulation, which enables the quantitative representation of conductivity relaxations caused by very large changes in oxygen partial pressure.

A whole range hygric material model: Modelling liquid and vapour transport properties in porous media

DEFF Research Database (Denmark)

Scheffler, Gregor Albrecht; Plagge, Rudolf

2010-01-01

This paper addresses the modelling of hygric material coefficients bridging the gap between measured material properties and the non-linear storage and transport coefficients in the transfer equation. The conductivity approach and a bundle of tubes model are the basis. By extending this model wit...

Wet flue gas desulphurisation procedures and relevant solvents thermophysical properties determination

Directory of Open Access Journals (Sweden)

Živković Nikola V.

2014-01-01

Full Text Available In order to mitigate climate change, the priority task is to reduce emissions of greenhouse gases, including sulfur oxides, from stationary power plants. The legal framework of the European Union has limited the allowable emissions of gases with harmful effects and fulfillment of this obligation is also ahead of the Republic of Serbia in the following years. In this paper categorization of wet procedures for sulfur oxides removal is given. Wet procedure with the most widespread industrial application, lime/limestone process, has been described in detail. In addition, the procedures with chemical and physical absorption and solvent thermal regeneration, which recently gained more importance, have been presented. Experimentally determined thermophysical and transport properties of commercially used and alternative solvents, necessary for the equipment design and process optimization, are also given in the paper. The obtained values of densities and viscosities of pure chemicals - solvents, polyethylene glycol 200 (PEG 200, polyethylene glycol 400 (PEG 400, tetraethylene glycol dimethyl ether (TEGDMA, N-methyl-2-pyrolidon (NMP and dimethylaniline (DMA, measured at the atmospheric pressure, are presented as a function of temperature. [Projekat Ministarstva nauke Republike Srbije, br. 172063

Electrochemical Approach for Analyzing Electrolyte Transport Properties and Their Effect on Protonic Ceramic Fuel Cell Performance.

Science.gov (United States)

Danilov, Nikolay; Lyagaeva, Julia; Vdovin, Gennady; Medvedev, Dmitry; Demin, Anatoly; Tsiakaras, Panagiotis

2017-08-16

The design and development of highly conductive materials with wide electrolytic domain boundaries are among the most promising means of enabling solid oxide fuel cells (SOFCs) to demonstrate outstanding performance across low- and intermediate-temperature ranges. While reducing the thickness of the electrolyte is an extensively studied means for diminishing the total resistance of SOFCs, approaches involving an improvement in the transport behavior of the electrolyte membranes have been less-investigated. In the present work, a strategy for analyzing the electrolyte properties and their effect on SOFC output characteristics is proposed. To this purpose, a SOFC based on a recently developed BaCe 0.5 Zr 0.3 Dy 0.2 O 3-δ proton-conducting ceramic material was fabricated and tested. The basis of the strategy consists of the use of traditional SOFC testing techniques combined with the current interruption method and electromotive force measurements with a modified polarization-correction assessment. This allows one to determine simultaneously such important parameters as maximal power density; ohmic and polarization resistances; average ion transport numbers; and total, ionic, and electronic film conductivities and their activation energies. The proposed experimental procedure is expected to expand both fundamental and applied basics that could be further adopted to improve the technology of electrochemical devices based on proton-conducting electrolytes.

Quantum oscillations and the electronic transport properties in multichain nanorings

International Nuclear Information System (INIS)

Racolta, D.

2009-01-01

We consider a system of multichain nanorings in static electric and magnetic field. The magnetic field induces characteristic phase changes. These phase shifts produce interference phenomena in the case of nanosystems for which the coherence length is larger than the sample dimension. We obtain energy solutions that are dependent on the number of sites N α characterizing a chain, of phase on the phase φ α and on the applied voltage. We found rich oscillations structures exhibited by the magnetic flux and we established the transmission probability. This proceeds by applying Landauer conductance formulae which opens the way to study electronic transport properties. (authors)

Current Transport Properties of Monolayer Graphene/n-Si Schottky Diodes

Science.gov (United States)

Pathak, C. S.; Garg, Manjari; Singh, J. P.; Singh, R.

2018-05-01

The present work reports on the fabrication and the detailed macroscopic and nanoscale electrical characteristics of monolayer graphene/n-Si Schottky diodes. The temperature dependent electrical transport properties of monolayer graphene/n-Si Schottky diodes were investigated. Nanoscale electrical characterizations were carried out using Kelvin probe force microscopy and conducting atomic force microscopy. Most the values of ideality factor and barrier height are found to be in the range of 2.0–4.4 and 0.50–0.70 eV for monolayer graphene/n-Si nanoscale Schottky contacts. The tunneling of electrons is found to be responsible for the high value of ideality factor for nanoscale Schottky contacts.

Demand Elasticity on the Transport Market

Directory of Open Access Journals (Sweden)

Teodor Perić

2002-09-01

Full Text Available The elasticity of demand for traffic se1vices is the adaptationof traffic supply to traffic demand. The elasticity of suchdemand is low which is specific of the transport market, especiallyfrom the aspect of designing traffic demand.The essence of the problem of low elasticity can be noticedin three basic properties:First, in the change of place which determines the traffic demandor traffic relation.Second is the continuity of the need to transport goods andpassengers.Third, the needs for transport may vmy according to thechanges in society and economy, and they also change thesources of traffic demand. Therefore, the elasticity of demandfor traffic se1vices is relatively low.

Computer program for obtaining thermodynamic and transport properties of air and products of combustion of ASTM-A-1 fuel and air

Science.gov (United States)

Hippensteele, S. A.; Colladay, R. S.

1978-01-01

A computer program for determining desired thermodynamic and transport property values by means of a three-dimensional (pressure, fuel-air ratio, and either enthalpy or temperature) interpolation routine was developed. The program calculates temperature (or enthalpy), molecular weight, viscosity, specific heat at constant pressure, thermal conductivity, isentropic exponent (equal to the specific heat ratio at conditions where gases do not react), Prandtl number, and entropy for air and a combustion gas mixture of ASTM-A-1 fuel and air over fuel-air ratios from zero to stoichiometric, pressures from 1 to 40 atm, and temperatures from 250 to 2800 K.

Interrelationship between structural, optical and transport properties of InP.sub.1-x./sub.Bi.sub.x./sub.: DFT approach

Czech Academy of Sciences Publication Activity Database

Khan, S.A.; Azam, S.; Šipr, Ondřej

2016-01-01

Roč. 41, Jan (2016), 45-53 ISSN 1369-8001 Institutional support: RVO:68378271 Keywords : electronic structure * optical properties * transport properties Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.359, year: 2016

A Review of Hydrothermal Liquefaction Bio-Crude Properties and Prospects for Upgrading to Transportation Fuels

Directory of Open Access Journals (Sweden)

Jerome A. Ramirez

2015-07-01

Full Text Available Hydrothermal liquefaction (HTL presents a viable route for converting a vast range of materials into liquid fuel, without the need for pre-drying. Currently, HTL studies produce bio-crude with properties that fall short of diesel or biodiesel standards. Upgrading bio-crude improves the physical and chemical properties to produce a fuel corresponding to diesel or biodiesel. Properties such as viscosity, density, heating value, oxygen, nitrogen and sulphur content, and chemical composition can be modified towards meeting fuel standards using strategies such as solvent extraction, distillation, hydrodeoxygenation and catalytic cracking. This article presents a review of the upgrading technologies available, and how they might be used to make HTL bio-crude into a transportation fuel that meets current fuel property standards.

Transport properties of liquids

International Nuclear Information System (INIS)

Rajagopal, K.

1976-07-01

The transport coefficients, self diffusivity, dinamical viscosity,total viscosity (i.e., the first and second viscosity coefficient) and thermal conductivity, are calculated at several temperatures and saturation pressures for the Argon, Krypton and Xenon liquids, from the Mie otential and the hard sphere theory. (L.C.) [pt

Magnetic and transport properties of PrRu.sub.2./sub.Si.sub.2./sub. single crystal under high pressure

Czech Academy of Sciences Publication Activity Database

Vejpravová, J.; Kamarád, Jiří; Prchal, J.; Sechovsky, V.

2007-01-01

Roč. 76, suppl. A (2007), s. 49-50 ISSN 0031-9015 Institutional research plan: CEZ:AV0Z10100521 Keywords : pressure effect * magnetic properties * transport properties * single crystal Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.212, year: 2007

Elastic and transport properties of steam-cured pozzolanic-lime rock composites upon CO2 injection

Science.gov (United States)

Emery, Dan; Vanorio, Tiziana

2016-04-01

Understanding the relationship between pozzolanic ash-lime reactions and the rock physics properties of the resulting rock microstructure is important for monitoring unrest conditions in volcanic-hydrothermal systems as well as devising concrete with enhanced performance. By mixing pozzolanic ash with lime, the ancient Romans incorporated these reactions in the production of concrete. Recently, it has been discovered that a fiber-reinforced, concrete-like rock is forming naturally in the depths of the Campi Flegrei volcanic-hydrothermal systems (Vanorio and Kanitpanyacharoen, 2015). We investigate the physico-chemical conditions contributing to undermine or enhance the laboratory measured properties of the subsurface rocks of volcanic-hydrothermal systems and, in turn, build upon those processes that the ancient Romans unwittingly exploited to create their famous concrete. We prepared samples by mixing the pozzolana volcanic ash, slaked lime, aggregates of Neapolitan Yellow tuff, and seawater from Campi Flegrei in the same ratios as the ancient Romans. To mimic the conditions of the caldera, we used mineral seawater from a well in the Campi Flegrei region rich in sulfate, bicarbonate, calcium, potassium, and magnesium ions. The samples were cured by steam. We measured baseline properties of porosity, permeability, P-wave velocity, and S-wave velocity of the samples. P and S-wave velocities were used to derive bulk, shear, and Young's moduli. Subsequently, half of the samples were injected with CO2-rich aqueous solution and the changes in their microstructure and physical properties measured. One sample was subjected to rapid temperature changes to determine how porosity and permeability changed as a function of the number of thermal shocks. Exposure of CO2 to the concrete-like rock samples destabilized fibrous mineral forming and decreased the samples' ability to deform without breaking. We show that steam- and sulfur-alkaline- rich environments affect both

Investigation of magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures

Science.gov (United States)

Das, Kalipada

2017-10-01

In our present study, we address in detail the magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures. In these core-shell nanostructures, well-known half metallic La0.67Sr0.33MnO3 nanoparticles (average particle size, ˜20 nm) are wrapped by the charge ordered antiferromagnetic Pr0.67Ca0.33MnO3 (PCMO) matrix. The intrinsic properties of PCMO markedly modify it into such a core-shell form. The robustness of the PCMO matrix becomes fragile and melts at an external magnetic field (H) of ˜20 kOe. The analysis of magneto-transport data indicates the systematic reduction of the electron-electron and electron-magnon interactions in the presence of an external magnetic field in these nanostructures. The pronounced training effect appears in this phase separated compound, which was analyzed by considering the second order tunneling through the grain boundaries of the nanostructures. Additionally, the analysis of low field magnetoconductance data supports the second order tunneling and shows the close value of the universal limit (˜1.33).

Transport properties of hydrogen passivated silicon nanotubes and silicon nanotube field effect transistors

KAUST Repository

Montes Muñoz, Enrique

2017-01-24

We investigate the electronic transport properties of silicon nanotubes attached to metallic electrodes from first principles, using density functional theory and the non-equilibrium Green\\'s function method. The influence of the surface termination is studied as well as the dependence of the transport characteristics on the chirality, diameter, and length. Strong electronic coupling between nanotubes and electrodes is found to be a general feature that results in low contact resistance. The conductance in the tunneling regime is discussed in terms of the complex band structure. Silicon nanotube field effect transistors are simulated by applying a uniform potential gate. Our results demonstrate very high values of transconductance, outperforming the best commercial silicon field effect transistors, combined with low values of sub-threshold swing.

Determination of material properties for short fibre reinforced C/C-SiC

Directory of Open Access Journals (Sweden)

Hausherr J.-M.

2015-01-01

Full Text Available Determining the mechanical properties of short fibre reinforced CMC using standard sized coupons has always been a challenge due to a high statistical scattering of the measured values. Although the random orientation of short fibres results in a quasi-isotropic material behavior of 2D-structures with a sufficiently large volume, the small volume typical for test coupons usually results in a non-isotropic fibre orientation in the tested volume. This paper describes a method for manufacturing unidirectional oriented short fibre reinforced CMC materials and presents material properties of UD-C/C-SiC. After verifying the fibre orientation of the CMC using micro-computed tomography, coupons were extracted to determine the orthotropic material properties. These orthotropic material properties were then used to predict the properties of C/C-SiC with randomly distributed short fibres. To validate the method, micro-computed tomography is used to quantitatively determine the fibre orientation within coupons extracted from randomly distributed short fibre C/C-SiC. After mechanical three-point-bending tests, the measured stiffness and bending strength is compared with the predicted properties. Finally, the data are used to devise a method suited for reducing the inherent large spread of material properties associated with the measurement of CMC materials with randomly distributed short fibres.

Electronic properties of wurtzite-phase InP nanowires determined by optical and magneto-optical spectroscopy

Science.gov (United States)

De Luca, Marta; Polimeni, Antonio

2017-12-01

Thanks to their peculiar shape and dimensions, semiconductor nanowires (NWs) are emerging as building components of novel devices. The presence of wurtzite (WZ) phase in the lattice structure of non-nitride III-V NWs is one of the most surprising findings in these nanostructures: this phase, indeed, cannot be found in the same materials in the bulk form, where the zincblende (ZB) structure is ubiquitous, and therefore the WZ properties are poorly known. This review focuses on WZ InP NWs, because growth techniques have reached a high degree of control on the structural properties of this material, and optical studies performed on high-quality samples have allowed determining the most useful electronic properties, which are reviewed here. After an introduction summarizing the reasons for the interest in WZ InP nanowires (Sec. I), we give an overview on growth process and structural and optical properties of WZ InP NWs (Sec. II). In Sec. III, a complete picture of the energy and symmetry of the lowest-energy conduction and valence bands, as assessed by polarization-resolved photoluminescence (PL) and photoluminescence-excitation (PLE) studies is drawn and compared to all the available theoretical information. The elastic properties of WZ InP (determined by PL under hydrostatic pressure) and the radiative recombination dynamics of spatially direct and indirect (namely, occurring across the WZ/ZB interfaces) transitions are also discussed. Section IV, focuses on the magneto-optical studies of WZ InP NWs. The diagram of the energy levels of excitons in WZ materials—with and without magnetic field—is first provided. Then, all theoretical and experimental information available about the changes in the transport properties (i.e., carrier effective mass) caused by the ZB→WZ phase variation are reviewed. Different NW/magnetic field geometrical configurations, sensitive to polarization selection rules, highlight anisotropies in the diamagnetic shifts, Zeeman splitting

Influence of substitutional disorder on the electrical transport and the superconducting properties of Fe{sub 1+z}Te{sub 1−x−y}Se{sub x}S{sub y}

Energy Technology Data Exchange (ETDEWEB)

Rodríguez, M.G. [Laboratorio de Bajas Temperaturas, Departamento de Física, FCEyNUBA and IFIBA-CONICET, Buenos Aires (Argentina); Polla, G.; Ramos, C.P. [Gerencia de Investigación y Aplicaciones, CAC-CNEA, San Martín (Argentina); Acha, C., E-mail: acha@df.uba.ar [Laboratorio de Bajas Temperaturas, Departamento de Física, FCEyNUBA and IFIBA-CONICET, Buenos Aires (Argentina)

2015-11-15

We have carried out an investigation of the structural, magnetic, transport and superconducting properties of Fe{sub 1+z}Te{sub 1−x−y}Se{sub x}S{sub y} ceramic compounds, for z = 0 and some specific Se (0 ≤ x ≤ 0.5) and S (0 ≤ y ≤ 0.12) contents. The incorporation of Se and S to the FeTe structure produces a progressive reduction of the crystallographic parameters as well as different degrees of structural disorder associated with the differences of the ionic radius of the substituting cations. In the present study, we measure transport properties of this family of compounds and we show the direct influence of disorder in the normal and superconductor states. We notice that the structural disorder correlates with a variable range hopping conducting regime observed at temperatures T > 200 K. At lower temperatures, all the samples except the one with the highest degree of disorder show a crossover to a metallic-like regime, probably related to the transport of resilient-quasi-particles associated with the proximity of a Fermi liquid state at temperatures below the superconducting transition. Moreover, the superconducting properties are depressed only for that particular sample, in accordance to the condition that superconductivity is affected by disorder when the electronic localization length ξ{sub L} becomes smaller than the coherence length ξ{sub SC}. - Highlights: • New Fe(1 + z)Te(1−x−y)Se(x)S(y) ceramic samples were synthesized. • Structural, magnetic, transport and superconducting properties are presented. • Nonmagnetic disorder determines a VRH conduction regime near room temperature. • Superconductivity is affected by disorder.

Study of Electrical Transport Properties of Thin Films Used as HTL and as Active Layer in Organic Solar Cells, through Impedance Spectroscopy Measurements

Directory of Open Access Journals (Sweden)

Camilo A. Otalora

2016-01-01

Full Text Available Impedance spectroscopy (IS is used for studying the electrical transport properties of thin films used in organic solar cells with structure ITO/HTL/active layer/cathode, where PEDOT:PSS (poly(3,4-ethylenedioxythiophene:polystyrene sulfonic acid and CuPC (tetrasulfonated copper-phthalocyanine were investigated as HTL (hole transport layer and P3HT:PCBM (poly-3-hexylthiophene:phenyl-C61-butyric acid methyl ester blends prepared from mesitylene and chlorobenzene based solutions were studied as active layer and Ag and Al were used as cathode. The study allowed determining the influence of the type of solvent used for the preparation of the active layer as well as the speed at which the solvents are removed on the carriers mobility. The effect of exposing the layer of P3HT to the air on its mobility was also studied. It was established that samples of P3HT and P3HT:PCBM prepared using mesitylene as a solvent have mobility values significantly higher than those prepared from chlorobenzene which is the solvent most frequently used. It was also determined that the mobility of carriers in P3HT films strongly decreases when this sample is exposed to air. In addition, it was found that the electrical properties of P3HT:PCBM thin films can be improved by removing the solvent slowly which is achieved by increasing the pressure inside the system of spin-coating during the film growth.

Evaluation of transport properties of nanofiltration membranes exposed to radioactive liquid waste

Energy Technology Data Exchange (ETDEWEB)

Oliveira, Elizabeth E.M.; Barbosa, Celina C.R.; Bastos, Edna T.R., E-mail: eemo@ien.gov.br [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeira, RJ (Brazil); Afonso, Julio C., E-mail: Julio@iq.ufrj.br [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Inst. de Quimica. Dept. de Quimica Analitica

2011-07-01

The application of membrane separation processes (PSM) for treatment of radioactive waste requires the selection of a suitable membrane for the treatment of waste, as the membrane will be directly exposed to the radioactive liquid waste, and also exposed to ionizing radiation. The nanofiltration membrane is most suitable for treatment of radioactive waste, since it has high rejection of multivalent ions. Usually the membranes are made of polymers and depending on the composition of the waste, type and dose of radiation absorbed may be changes in the structure of the membrane, resulting in loss of its transport properties. We tested two commercial nanofiltration membranes: NF and SW Dow/Filmtec. The waste liquid used was obtained in the process of conversion of uranium hexafluoride gas to solid uranium dioxide, known as 'carbonated water'. The membranes were characterized as their transport properties (hydraulic permeability, permeate flux and salt rejection) before and after their immersion in the waste for 24 hours. The surface of the membranes was also evaluated by SEM and FTIR. It was observed that in both the porosity of the membrane selective layer was altered, but not the membrane surface charge, which is responsible for the selectivity of the membrane. The NF membranes and SW showed uranium ion rejection of 64% and 55% respectively. (author)

Synthesis and Gas Transport Properties of Hyperbranched Polyimide–Silica Hybrid/Composite Membranes

Directory of Open Access Journals (Sweden)

Masako Miki

2013-12-01

Full Text Available Hyperbranched polyimide–silica hybrids (HBPI–silica HBDs and hyperbranched polyimide–silica composites (HBPI–silica CPTs were prepared, and their general and gas transport properties were investigated to clarify the effect of silica sources and preparation methods. HBPI–silica HBDs and HBPI–silica CPTs were synthesized by two-step polymerization of A2 + B3 monomer system via polyamic acid as precursor, followed by hybridizing or blending silica sources. Silica components were incorporated by the sol-gel reaction with tetramethoxysilane (TMOS or the addition of colloidal silica. In HBPI-silica HBDs, the aggregation of silica components is controlled because of the high affinity of HBPI and silica caused by the formation of covalent bonds between HBPI and silica. Consequently, HBPI-silica HBDs had good film formability, transparency, and mechanical properties compared with HBPI-silica CPTs. HBPI-silica HBD and CPT membranes prepared via the sol-gel reaction with TMOS showed specific gas permeabilities and permselectivities for CO2/CH4 separation, that is, both CO2 permeability and CO2/CH4 selectivity increased with increasing silica content. This result suggests that gas transport can occur through a molecular sieving effect of the porous silica network derived from the sol-gel reaction and/or through the narrow interfacial region between the silica networks and the organic matrix.

The rate-limiting process of hydrogen transport in Mo

Energy Technology Data Exchange (ETDEWEB)

Ohkoshi, Keishiro; Chikazawa, Yoshitaka; Bandourko, V; Yamaguchi, Kenji; Yamawaki, Michio [Tokyo Univ., Tokai, Ibaraki (Japan). Nuclear Engineering Research Lab.

1996-10-01

Hydrogen isotope transport characteristics of Mo, whose refractory properties are considered to be suitable as plasma facing material, was investigated by applying 3 keV D{sub 2}{sup +} beam to the membrane specimen. The Arrhenius plot of deuterium permeation probability showed linear increase against the reciprocal temperature and its apparent activation energy was determined as 41.5 kJ/mol. The simultaneous irradiation of 3 keV Ar{sup +} onto backside surface of specimen had little effect on the deuterium permeation rate. According to these results, the rate-limiting process of deuterium transport in Mo was determined. (author)

Bronchial Mucus as a Complex Fluid: Molecular Interactions and Influence of Nanostructured Particles on Rheological and Transport Properties

Directory of Open Access Journals (Sweden)

Odziomek Marcin

2017-06-01

Full Text Available Transport properties of bronchial mucus are investigated by two-stage experimental approach focused on: (a rheological properties and (b mass transfer rate through the stagnant layer of solutions of mucus components (mucine, DNA, proteins and simulated multi-component mucus. Studies were done using thermostated horizontal diffusion cells with sodium cromoglycate and carminic acid as transferred solutes. Rheological properties of tested liquids was studied by a rotational viscometer and a cone-plate rheometer (dynamic method. First part of the studies demonstrated that inter-molecular interactions in these complex liquids influence both rheological and permeability characteristics. Transfer rate is governed not only by mucus composition and concentration but also by hydrophobic/hydrophilic properties of transported molecules. Second part was focused on the properties of such a layer in presence of selected nanostructured particles (different nanoclays and graphene oxide which may be present in lungs after inhalation. It was shown that most of such particles increase visco-elasticity of the mucus and reduce the rate of mass transfer of model drugs. Measured effects may have adverse impact on health, since they will reduce mucociliary clearance in vivo and slow down drug penetration to the bronchial epithelium during inhalation therapy.

Calculation of electrical transport properties and electron entanglement in inhomogeneous quantum wires

Directory of Open Access Journals (Sweden)

A A Shokri

2013-10-01

Full Text Available In this paper, we have investigated the spin-dependent transport properties and electron entanglement in a mesoscopic system, which consists of two semi-infinite leads (as source and drain separated by a typical quantum wire with a given potential. The properties studied include current-voltage characteristic, electrical conductivity, Fano factor and shot noise, and concurrence. The calculations are based on the transfer matrix method within the effective mass approximation. Using the Landauer formalism and transmission coefficient, the dependence of the considered quantities on type of potential well, length and width of potential well, energy of transmitted electron, temperature and the voltage have been theoretically studied. Also, the effect of the above-mentioned factors has been investigated in the nanostructure. The application of the present results may be useful in designing spintronice devices.

Temperature dependent dielectric properties and ion transportation in solid polymer electrolyte for lithium ion batteries

Energy Technology Data Exchange (ETDEWEB)

Sengwa, R. J., E-mail: rjsengwa@rediffmail.com; Dhatarwal, Priyanka, E-mail: dhatarwalpriyanka@gmail.com; Choudhary, Shobhna, E-mail: shobhnachoudhary@rediffmail.com [Dielectric Research Laboratory, Department of Physics, Jai Narain Vyas University, Jodhpur – 342 005 (India)

2016-05-06

Solid polymer electrolyte (SPE) film consisted of poly(ethylene oxide) (PEO) and poly(methyl methacrylate) (PMMA) blend matrix with lithium tetrafluroborate (LiBF{sub 4}) as dopant ionic salt and poly(ethylene glycol) (PEG) as plasticizer has been prepared by solution casting method followed by melt pressing. Dielectric properties and ionic conductivity of the SPE film at different temperatures have been determined by dielectric relaxation spectroscopy. It has been observed that the dc ionic conductivity of the SPE film increases with increase of temperature and also the decrease of relaxation time. The temperature dependent relaxation time and ionic conductivity values of the electrolyte are governed by the Arrhenius relation. Correlation observed between dc conductivity and relaxation time confirms that ion transportation occurs with polymer chain segmental dynamics through hopping mechanism. The room temperature ionic conductivity is found to be 4 × 10{sup −6} S cm{sup −1} which suggests the suitability of the SPE film for rechargeable lithium batteries.

Atomistic simulations of divacancy defects in armchair graphene nanoribbons: Stability, electronic structure, and electron transport properties

Energy Technology Data Exchange (ETDEWEB)

Zhao, Jun [College of Physical Science and Technology, Yangtze University, Jingzhou, Hubei 434023 (China); Zeng, Hui, E-mail: zenghui@yangtzeu.edu.cn [College of Physical Science and Technology, Yangtze University, Jingzhou, Hubei 434023 (China); Wei, Jianwei [College of Optoelectronic Information, Chongqing University of Technology, Chongqing 400054 (China); Li, Biao; Xu, Dahai [College of Physical Science and Technology, Yangtze University, Jingzhou, Hubei 434023 (China)

2014-01-17

Using the first principles calculations associated with nonequilibrium Green's function, we have studied the electronic structures and quantum transport properties of defective armchair graphene nanoribbon (AGNR) in the presence of divacancy defects. The triple pentagon–triple heptagon (555–777) defect in the defective AGNR is energetically more favorable than the pentagon–octagon–pentagon (5–8–5) defect. Our calculated results reveal that both 5–8–5-like defect and 555–777-like defect in AGNR could improve the electron transport. It is anticipated that defective AGNRs can exhibit large range variations in transport behaviors, which are strongly dependent on the distributions of the divacancy defect.

Electronic transport properties of carbon nanotube metal-semiconductor-metal

Directory of Open Access Journals (Sweden)

F Khoeini

2008-07-01

Full Text Available  In this work, we study electronic transport properties of a quasi-one dimensional pure semi-conducting Zigzag Carbon Nanotube (CNT attached to semi-infinite clean metallic Zigzag CNT leads, taking into account the influence of topological defect in junctions. This structure may behave like a field effect transistor. The calculations are based on the tight-binding model and Green’s function method, in which the local density of states(LDOS in the metallic section to semi-conducting section, and muli-channel conductance of the system are calculated in the coherent and linear response regime, numerically. Also we have introduced a circuit model for the system and investigated its current. The theoretical results obtained, can be a base, for developments in designing nano-electronic devices.

Electronic transport properties of 1D-defects in graphene and other 2D-systems

Energy Technology Data Exchange (ETDEWEB)

Willke, P.; Wenderoth, M. [IV. Physical Institute, Solids and Nanostructures, Georg-August-University Goettingen (Germany); Schneider, M.A. [Lehrstuhl fuer Festkoerperphysik, Universitaet Erlangen-Nuernberg, Erlangen (Germany)

2017-11-15

The continuous progress in device miniaturization demands a thorough understanding of the electron transport processes involved. The influence of defects - discontinuities in the perfect and translational invariant crystal lattice - plays a crucial role here. For graphene in particular, they limit the carrier mobility often demanded for applications by contributing additional sources of scattering to the sample. Due to its two-dimensional nature graphene serves as an ideal system to study electron transport in the presence of defects, because one-dimensional defects like steps, grain boundaries and interfaces are easy to characterize and have profound effects on the transport properties. While their contribution to the resistance of a sample can be extracted by carefully conducted transport experiments, scanning probe methods are excellent tools to study the influence of defects locally. In this letter, the authors review the results of scattering at local defects in graphene and other 2D systems by scanning tunneling potentiometry, 4-point-probe microscopy, Kelvin probe force microscopy and conventional transport measurements. Besides the comparison of the different defect resistances important for device fabrication, the underlying scattering mechanisms are discussed giving insight into the general physics of electron scattering at defects. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Determination of the Mechanical Properties of Rubber by FT-NIR

Directory of Open Access Journals (Sweden)

Rattapol Pornprasit

2016-01-01

Full Text Available Mechanical tests, for example, tensile and hardness tests, are usually used to evaluate the properties of rubber materials. In this work, mechanical properties of selected rubber materials, that is, natural rubber (NR, styrene butadiene rubber (SBR, nitrile butadiene rubber (NBR, and ethylene propylene diene monomer (EPDM, were evaluated using a near infrared (NIR spectroscopy technique. Here, NR/NBR and NR/EPDM blends were first prepared. All of the samples were then scanned using a FT-NIR spectrometer and fitted with an integration sphere working in a diffused reflectance mode. The spectra were correlated with hardness and tensile properties. Partial least square (PLS calibration models were built from the spectra datasets with preprocessing techniques, that is, smoothing and second derivative. This indicated that reasonably accurate models, that is, with a coefficient of determination [R2] of the validation greater than 0.9, could be achieved for the hardness and tensile properties of rubber materials. This study demonstrated that FT-NIR analysis can be applied to determine hardness and tensile values in rubbers and rubber blends effectively.

Exploring emergent properties in cellular homeostasis using OnGuard to model K+ and other ion transport in guard cells.

Science.gov (United States)

Blatt, Michael R; Wang, Yizhou; Leonhardt, Nathalie; Hills, Adrian

2014-05-15

It is widely recognized that the nature and characteristics of transport across eukaryotic membranes are so complex as to defy intuitive understanding. In these circumstances, quantitative mathematical modeling is an essential tool, both to integrate detailed knowledge of individual transporters and to extract the properties emergent from their interactions. As the first, fully integrated and quantitative modeling environment for the study of ion transport dynamics in a plant cell, OnGuard offers a unique tool for exploring homeostatic properties emerging from the interactions of ion transport, both at the plasma membrane and tonoplast in the guard cell. OnGuard has already yielded detail sufficient to guide phenotypic and mutational studies, and it represents a key step toward 'reverse engineering' of stomatal guard cell physiology, based on rational design and testing in simulation, to improve water use efficiency and carbon assimilation. Its construction from the HoTSig libraries enables translation of the software to other cell types, including growing root hairs and pollen. The problems inherent to transport are nonetheless challenging, and are compounded for those unfamiliar with conceptual 'mindset' of the modeler. Here we set out guidelines for the use of OnGuard and outline a standardized approach that will enable users to advance quickly to its application both in the classroom and laboratory. We also highlight the uncanny and emergent property of OnGuard models to reproduce the 'communication' evident between the plasma membrane and tonoplast of the guard cell. Copyright © 2014 The Authors. Published by Elsevier GmbH.. All rights reserved.

Ion Binding Energies Determining Functional Transport of ClC Proteins

Science.gov (United States)

Yu, Tao; Guo, Xu; Zou, Xian-Wu; Sang, Jian-Ping

2014-06-01

The ClC-type proteins, a large family of chloride transport proteins ubiquitously expressed in biological organisms, have been extensively studied for decades. Biological function of ClC proteins can be reflected by analyzing the binding situation of Cl- ions. We investigate ion binding properties of ClC-ec1 protein with the atomic molecular dynamics simulation approach. The calculated electrostatic binding energy results indicate that Cl- at the central binding site Scen has more binding stability than the internal binding site Sint. Quantitative comparison between the latest experimental heat release data isothermal titration calorimetry (ITC) and our calculated results demonstrates that chloride ions prefer to bind at Scen than Sint in the wild-type ClC-ec1 structure and prefer to bind at Sext and Scen than Sint in mutant E148A/E148Q structures. Even though the chloride ions make less contribution to heat release when binding to Sint and are relatively unstable in the Cl- pathway, they are still part contributors for the Cl- functional transport. This work provides a guide rule to estimate the importance of Cl- at the binding sites and how chloride ions have influences on the function of ClC proteins.

Efficient method for computing the electronic transport properties of a multiterminal system

Science.gov (United States)

Lima, Leandro R. F.; Dusko, Amintor; Lewenkopf, Caio

2018-04-01

We present a multiprobe recursive Green's function method to compute the transport properties of mesoscopic systems using the Landauer-Büttiker approach. By introducing an adaptive partition scheme, we map the multiprobe problem into the standard two-probe recursive Green's function method. We apply the method to compute the longitudinal and Hall resistances of a disordered graphene sample, a system of current interest. We show that the performance and accuracy of our method compares very well with other state-of-the-art schemes.

Characterizing and modelling the radionuclide transport properties of fracture zones in plutonic rocks of the Canadian Shield

International Nuclear Information System (INIS)

Davison, C.C.; Kozak, E.T.; Frost, L.H.; Everitt, R.A.; Brown, A.; Gascoyne, M.; Scheier, N.W.

1999-01-01

Plutonic rocks of the Canadian Shield were investigated as a potential host medium for nuclear fuel waste disposal of used CANDU nuclear fuel. Field investigations at several geologic research areas on the Shield have shown that major fracture zones are the dominant pathways for the large scale movement of groundwater and solutes through plutonic rock bodies. Because of this, a significant amount of the geoscience work has focused on methods to identify, characterize and model the radionuclide transport properties of major fracture zones in the fractured plutonic rocks of the Shield. In order to quantify the transport properties of such fracture zones a series of, groundwater tracer tests were performed over a period of several years in several major, low dipping fracture zones. Sixteen tracer tests were performed using dipole recirculation methods to evaluate transport over distance scales ranging from 17 m to 700 m. It was concluded that only tracer tests can provide useful estimates of the effective porosity and dispersivity characteristics of these large fracture zones in plutonic rocks of the Canadian Shield. (author)

Analysis of aerosol absorption properties and transport over North Africa and the Middle East using AERONET data

Directory of Open Access Journals (Sweden)

A. Farahat

2016-11-01

Full Text Available In this paper particle categorization and absorption properties were discussed to understand transport mechanisms at different geographic locations and possible radiative impacts on climate. The long-term Aerosol Robotic Network (AERONET data set (1999–2015 is used to estimate aerosol optical depth (AOD, single scattering albedo (SSA, and the absorption Ångström exponent (αabs at eight locations in North Africa and the Middle East. Average variation in SSA is calculated at four wavelengths (440, 675, 870, and 1020 nm, and the relationship between aerosol absorption and physical properties is used to infer dominant aerosol types at different locations. It was found that seasonality and geographic location play a major role in identifying dominant aerosol types at each location. Analyzing aerosol characteristics among different sites using AERONET Version 2, Level 2.0 data retrievals and the Hybrid Single Particle Lagrangian Integrated Trajectory model (HYSPLIT backward trajectories shows possible aerosol particle transport among different locations indicating the importance of understanding transport mechanisms in identifying aerosol sources.

Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

Science.gov (United States)

Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

2016-11-01

We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

Transport properties and exponential n-values of Fe/MgB2 tapes with various MgB2 particle sizes

International Nuclear Information System (INIS)

Lezza, P.; Abaecherli, V.; Clayton, N.; Senatore, C.; Uglietti, D.; Suo, H.L.; Fluekiger, R.

2004-01-01

Fe/MgB 2 tapes have been prepared starting with pre-reacted binary MgB 2 powders. As shown by resistive and inductive measurements, the reduction of particle size to a few microns by ball milling has little influence on B c2 , while the superconducting properties of the individual MgB 2 grains are essentially unchanged. Reducing the particle size causes an enhancement of B irr from 14 to 16 T, while J c has considerably increased at high fields, its slope J c (B) being reduced. At 4.2 K, values of 5.3 x 10 4 and 1.2 x 10 3 A/cm 2 were measured at 3.5 and 10 T, respectively, suggesting a dominant role of the conditions at the grain interfaces. A systematic variation of these conditions at the interfaces is undertaken in order to determine the limit of transport properties for Fe/MgB 2 tapes. The addition of 5% Mg to MgB 2 powder was found to affect neither J c nor B c2 . For the tapes with the highest J c values, very high exponential n factors were measured: n=148, 89 and 17 at 3.5, 5 and 10 T, respectively and measurements of critical current versus applied strain have been performed. The mechanism leading to high transport critical current densities of filamentary Fe/MgB 2 tapes based on MgB 2 particles is discussed

Lattice dynamics and substrate-dependent transport properties of (In, Yb)-doped CoSb3 skutterudite thin films

KAUST Repository

Sarath Kumar, S. R.; Cha, Dong Kyu; Alshareef, Husam N.

2011-01-01

Lattice dynamics, low-temperature electrical transport, and high-temperature thermoelectric properties of (In, Yb)-doped CoSb3thin films on different substrates are reported. Pulsed laser deposition under optimized conditions yielded single

Role of mesoscopic morphology in charge transport of doped ...

Indian Academy of Sciences (India)

In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent. Molecular recognition plays a significant role in chain conformation and charge delocalization.

Determination of the properties of composite interfaces by an ultrasonic method

Energy Technology Data Exchange (ETDEWEB)

Mal, A K; Karim, M R [Dept. of Mechanical, Aerospace and Nuclear Engineering, School of Engineering and Applied Science, Univ. of California, Los Angeles (USA); Bar-Cohen, Y [Douglas Aircraft Co., McDonnell Douglas Corp., Long Beach, CA (USA)

1990-06-15

The feasibility of using a recently developed ultrasonic technique to determine certain macroscopic properties of the interface zones of composite laminates is studied. The strong influence of the elastic properties and the thickness of the interface zone on the phase velocity of guided waves is demonstrated by means of a simple model of a single fiber embedded in a layer of the matrix material. The overall dynamic elastic moduli of a unidirectional graphite-epoxy composite laminate are determined through inversion of guided wave dispersion data obtained by the leaky Lamb wave experiment. The thickness and elastic properties of the interlaminar interface zone in a cross-ply graphite-epoxy laminate are also estimated by the same approach. (orig.).

Electron transport properties in ZnO nanowires/poly(3-hexylthiophene) hybrid nanostructure

International Nuclear Information System (INIS)

Cheng Ke; Cheng Gang; Wang Shujie; Fu Dongwei; Zou Bingsuo; Du Zuliang

2010-01-01

The ZnO nanowires (NWs) array/poly(3-hexylthiophene) (P3HT) hybrid prototype device was fabricated. An ultraviolet (UV) light of λ = 350 nm is used to investigate the photo-electric properties of the ZnO NWs array and hybrid structure. In this way, we can avoid the excitation of P3HT, which can give us a real electron transport ability of ZnO NWs itself. Our results demonstrated a higher and faster photo-electric response of 3 s for the hybrid structure while 9 s for the ZnO NWs array. The surface states related slow photo-electric response was also observed for them. The charge transfer mechanism and the influence of surface states were discussed. The current work provides us profound understandings on the electron transport ability of ZnO NWs array in a working hybrid polymer solar cell, which is crucial for optimizing the device performance.

Electronic structure and transport properties of hydrogenated graphene and graphene nanoribbons

Energy Technology Data Exchange (ETDEWEB)

Choe, D H; Bang, Junhyeok; Chang, K J, E-mail: kchang@kaist.ac.kr [Department of Physics, Korea Advanced Institute of Science and Technology, Daejeon 305-701 (Korea, Republic of)

2010-12-15

The band gap opening is one of the important issues in applications of graphene and graphene nanoribbons (GNRs) to nanoscale electronic devices. As hydrogen strongly interacts with graphene and creates short-range disorder, the electronic structure is significantly modified by hydrogenation. Based on first-principles and tight-binding calculations, we investigate the electronic and transport properties of hydrogenated graphene and GNRs. In disordered graphene with low doses of H adsorbates, the low-energy states near the neutrality point are localized, and the degree of localization extends to high-energy states with increasing adsorbate density. To characterize the localization of eigenstates, we examine the inverse participation ratio and find that the localization is greatly enhanced for the defect levels, which are accumulated around the neutrality point. Our calculations support the previous result that even with a low dose of H adsorbates, graphene undergoes a metal-insulator transition. In GNRs, relaxations of the edge C atoms play a role in determining the edge structure and the hydrocarbon conformation at low and high H concentrations, respectively. In disordered nanoribbons, we find that the energy states near the neutrality point are localized and conductances through low-energy channels decay exponentially with sample size, similar to disordered graphene. For a given channel energy, the localization length tends to decrease as the adsorbate density increases. Moreover, the energy range of localization exceeds the intrinsic band gap.

A New Approach for Evaluating Charge Transport Properties of Semiconductor Detectors

International Nuclear Information System (INIS)

Kim, Kyung O; Kim, Jong Kyung; Kim, Soon Young; Ha, Jang Ho

2009-01-01

The semiconductor detectors (e.g., CdTe, CdZnTe, and HgI 2 ) have been widely used for radiation detection and medical imaging because of its various outstanding features such as excellent energy resolution, wide bandgap energy, room temperature operation, and so on. Unfortunately, the performance of these detectors is mainly limited by the charge transport properties of semiconductor, especially the mobility-lifetime products (i.e., (μτ) e and ((μτ) h ). Hence, the analysis on the mobility-lifetime products is very important for evaluating correct characteristics of semiconductor detectors. A commonly used method to analyze the mobilitylifetime products is based on their responses to α particle. However, the α particle method cannot evaluate the ((μτ)h product in many cases, because a semiconductor detector operating at positive bias voltages often yields the energy spectrum without the peaks. This method is also known to be very sensitive to the experimental conditions as well as surface conditions of the detector. In this study, a new approach with gamma-ray instead of α particle was carried out to solve the determination difficulty of the ((μτ) h product with common method. The special relation between the two mobility-lifetime products, which we call the 'Nural equation', was also developed to simply obtain each parameter based on Hecht equation

Meta-analysis of the effects of soil properties, site factors and experimental conditions on solute transport

Directory of Open Access Journals (Sweden)

J. K. Koestel

2012-06-01

Full Text Available Preferential flow is a widespread phenomenon that is known to strongly affect solute transport in soil, but our understanding and knowledge is still poor of the site factors and soil properties that promote it. To investigate these relationships, we assembled a database from the peer-reviewed literature containing information on 733 breakthrough curve experiments under steady-state flow conditions. Most of the collected experiments (585 of the 733 datasets had been conducted on undisturbed soil columns, although some experiments on repacked soil, clean sands, and glass beads were also included. In addition to the apparent dispersivity, we focused our attention on three indicators of preferential solute transport: namely the 5%-arrival time, the holdback factor, and the ratio of piston-flow and average transport velocities. Our results suggest that, in contrast to the 5%-arrival time and the holdback factor, the piston-flow to transport velocity ratio is not related to preferential macropore transport but rather to the exclusion or retardation of the applied tracer. Confirming that the apparent longitudinal dispersivity is positively correlated with the travel distance of the tracer, our results also illustrate that this relationship is refined if the normalized 5%-tracer arrival time is also taken into account. In particular, we found that the degree of preferential solute transport increases with apparent dispersivity and decreases with travel distance. A similar but weaker relationship was observed between apparent dispersivity, 5%-tracer arrival time, and lateral observation scale, such that the degree of preferential transport increases with lateral observation scale. However, we also found that the travel distance and the lateral observation scale in the investigated dataset are correlated, which makes it difficult to distinguish their influence on these transport characteristics. We also found that the strength of preferential transport

Magnetic and transport properties of Fe-based nanocrystalline materials

Science.gov (United States)

Barandiarán, J. M.

1994-01-01

Fe-rich amorphous alloys containing late transition metals like Nb, V, Zr,..., sometimes with the addition of Cu, can crystallize in ultrafine grains of a crystalline phase, a few nanometers in diameter, embedded in a disordered matrix. In such state they have shown excellent soft magnetic properties for technical applications, rising the interest for deep studies. In this paper, recent work on some Fe-Nb and Fe-Zr based alloys both in amorphous state and after several degrees of nanocrystallization is presented. The nanocrystallization process has been achieved by conventional heat treatments (about 1 h at temperatures around 400-500 °C in a controlled atmosphere furnance) as well as by Joule heating using an electrical current flowing through the sample. Magnetic measurements, electrical resistivity, x-rays diffraction and 57Fe Mössbauer spectroscopy were used in the study of the crystalline phases appearing after the thermal treatments. The basic magnetic and transport properties of the nanocrystals do not differ appreciably from their bulk values. The magnetic anisotropy, however, is very sensitive to grain size and to the intergranular magnetic coupling. The effect of such coupling is deduced from the coercivity changes at the Curie Temperature of the amorphous matrix remaining after nanocrystallization.

Charge transport properties in microcrystalline KDyFe(China)6

International Nuclear Information System (INIS)

Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.

2007-01-01

Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels

Transport parameters of thin, supported cathode layers in solid oxide fuel cells (SOFCs); Transportparameter duenner, getraegerter Kathodenschichten der oxidkeramischen Brennstoffzelle