WorldWideScience

Sample records for determine transport properties

  1. Simulating liquid water for determining its structural and transport properties

    International Nuclear Information System (INIS)

    Arismendi-Arrieta, Daniel; Medina, Juan S.; Fanourgakis, George S.; Prosmiti, Rita; Delgado-Barrio, Gerardo

    2014-01-01

    Molecular dynamics simulations are carried out for calculating structural and transport properties of pure liquid water, such as radial distribution functions and self-diffusion and viscosity coefficients, respectively. We employed reparameterized versions of the ab initio water potential by Niesar, Clementi and Corongiu (NCC). In order to investigate the role of the electrostatic contribution, the partial charges of the NCC model are adjusted so that to reproduce the dipole moment values of the SPC/E, SPC/Fw and TIP4P/2005 water models. The single and collective transport coefficients are obtained by employing the Green–Kubo relations at various temperatures. Additionally, in order to overcome convergence difficulties arising from the long correlation times of the stress-tensor autocorrelation functions, a previously reported fitting scheme was employed. The present results indicate that there is a significant relationship between the dipole moment value of the model, and the calculated transport coefficients. We found that by adjusting the molecular dipole moment of the NCC to the value of the TIP4P/2005, the obtained values for the self-diffusion and viscosity coefficients are in better agreement with experiment, compared to the values obtained with the original NCC model. Even though the predictions of the present model exhibits an overall correct behavior, we conclude that further improvements are still required. In order to achieve that, a careful reparameterization of the repulsion–dispersion terms of the potential model is proposed. Also, the effect of the inclusion of many-body effects such as polarizability, should also be investigated. - Highlights: ► Transport properties of liquid water are important in bio-simulations. ► Self-diffusion coefficient, shear and bulk viscosities calculations from NVE molecular dynamics simulations. ► Their comparison with experimental data provides information on intermolecular forces, and serve to develop water

  2. Analysis on the moment method for determining the moisture transport properties in porous media

    International Nuclear Information System (INIS)

    Wang, B.X.; Fang, Z.H.

    1987-01-01

    The authors discuss a new unsteady-state method proposed for determining the moisture transport properties in wet porous media. It is based on measurement of the change in moment of gravity caused by the moisture migration. In addition to its high-speed performance, this method may get rid of the difficulty in determination of a changing moisture content or moisture distribution. On this basis, two particular procedures are contrived: a constant heat source method for determining the thermal mass diffusivity and an instantaneous moisture source method for determining the moisture diffusivity

  3. Correction: The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes.

    Science.gov (United States)

    Villanueva-Cab, J; Anta, J A; Oskam, G

    2016-05-28

    Correction for 'The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes' by J. Villanueva-Cab et al., Phys. Chem. Chem. Phys., 2016, 18, 2303-2308.

  4. Electron transport determines the electrochemical properties of tetrahedral amorphous carbon (ta-C) thin films

    International Nuclear Information System (INIS)

    Palomäki, Tommi; Wester, Niklas; Caro, Miguel A.; Sainio, Sami; Protopopova, Vera; Koskinen, Jari; Laurila, Tomi

    2017-01-01

    Amorphous carbon based electrodes are very promising for electrochemical sensing applications. In order to better understand their structure-function relationship, the effect of film thickness on the electrochemical properties of tetrahedral amorphous carbon (ta-C) electrodes was investigated. ta-C thin films of 7, 15, 30, 50 and 100 nm were characterized in detail with Raman spectroscopy, transmission electron microscopy (TEM), conductive atomic force microscopy (c-AFM), scanning tunneling spectroscopy (STS) and X-ray absorption spectroscopy (XAS) to assess (i) the surface properties of the films, (ii) the effect of film thickness on their structure and electrical properties and (iii) the subsequent correlation with their electrochemistry. The electrochemical properties were investigated by cyclic voltammetry (CV) using two different outer-sphere redox probes, Ru(NH 3 ) 6 3+/2+ and FcMeOH, and by electrochemical impedance spectroscopy (EIS). Computational simulations using density functional theory (DFT) were carried out to rationalize the experimental findings. The characterization results showed that the sp 2 /sp 3 ratio increased with decreasing ta-C film thickness. This correlated with a decrease in mobility gap value and an increase in the average current through the films, which was also consistent with the computational results. XAS indicated that the surface of the ta-C films was always identical and composed of a sp 2 -rich layer. The CV measurements indicated reversible reaction kinetics for both outer-sphere redox probes at 7 and 15 nm ta-C films with a change to quasi-reversible behavior at a thickness of around 30 nm. The charge transfer resistance, obtained from EIS measurements, decreased with decreasing film thickness in accordance with the CV results. Based on the characterization and electrochemical results, we conclude that the reaction kinetics in the case of outer-sphere redox systems is determined mainly by the electron transport through the

  5. Atomic transport properties

    International Nuclear Information System (INIS)

    Freyss, M.

    2015-01-01

    As presented in the first chapter of this book, atomic transport properties govern a large panel of nuclear fuel properties, from its microstructure after fabrication to its behaviour under irradiation: grain growth, oxidation, fission product release, gas bubble nucleation. The modelling of the atomic transport properties is therefore the key to understanding and predicting the material behaviour under irradiation or in storage conditions. In particular, it is noteworthy that many modelling techniques within the so-called multi-scale modelling scheme of materials make use of atomic transport data as input parameters: activation energies of diffusion, diffusion coefficients, diffusion mechanisms, all of which are then required to be known accurately. Modelling approaches that are readily used or which could be used to determine atomic transport properties of nuclear materials are reviewed here. They comprise, on the one hand, static atomistic calculations, in which the migration mechanism is fixed and the corresponding migration energy barrier is calculated, and, on the other hand, molecular dynamics calculations and kinetic Monte-Carlo simulations, for which the time evolution of the system is explicitly calculated. (author)

  6. Electronic transport properties

    International Nuclear Information System (INIS)

    Young, W.H.

    1985-01-01

    The theory of the electron transport properties of liquid alkali metals is described. Conductivity coefficients, Boltzmann theory, Ziman theory, alkali form factors, Ziman theory and alkalis, Faber-Ziman alloy theory, Faber-Ziman theory and alkali-alkali methods, status of Ziman theory, and other transport properties, are all discussed. (UK)

  7. Determination of transport properties and optimization of lithium-ion batteries

    Science.gov (United States)

    Stewart, Sarah Grace

    We have adapted the method of restricted diffusion to measure diffusion coefficients in lithium-battery electrolytes using Ultra-Violent-Visible (UV-Vis) absorption. The use of UV-Vis absorption reduces the likelihood of side reactions. Here we describe the measurement of the diffusion coefficient in lithium-battery electrolytic solutions. The diffusion coefficient is seen to decrease with increasing concentration according to the following: D = 3.018·10-5 exp(-0.357c), for LiPF 6 in acetonitrile and D = 2.582·10-5 exp(-2.856c) for LiPF6 in EC:DEC (with D in cm2/s and c in moles per liter). This technique may be useful for any liquid solution with a UV-active species of D greater than 10-6 cm2/s. Activity coefficients were measured in concentration cell and melting-point-depression experiments. Results from concentration-cell experiments are presented for solutions of lithium hexafluorophosphate (LiPF6) in propylene carbonate (PC) as well as in a 1:1 by weight solution of ethylene carbonate (EC) and ethyl methyl carbonate (EMC). Heat capacity results are also presented. The thermodynamic factor of LiPF6 solutions in EC varies between ca. 1.33 and ca. 6.10 in the concentration range ca. 0.06 to 1.25 M (which appears to be a eutectic point). We show that the solutions of LiPF6 investigated are not ideal but that an assumption of ideality for these solutions may overestimate the specific energy of a lithium-ion cell by only 0.6%. The thermodynamic and transport properties that we have measured are used in a system model. We have used this model to optimize the design of an asymmetric-hybrid system. This technology attempts to bridge the gap in energy density between a battery and supercapacitor. In this system, the positive electrode stores charge through a reversible, nonfaradaic adsorption of anions on the surface. The negative electrode is nanostructured Li4Ti 5O12, which reversibly intercalates lithium. We use the properties that we have measured in a system

  8. Transport properties of valsartan, sacubitril and its active metabolite (LBQ657) as determinants of disposition.

    Science.gov (United States)

    Hanna, Imad; Alexander, Natalya; Crouthamel, Matthew H; Davis, John; Natrillo, Adrienne; Tran, Phi; Vapurcuyan, Arpine; Zhu, Bing

    2018-03-01

    1. The potential for drug-drug interactions of LCZ696 (a novel, crystalline complex comprising sacubitril and valsartan) was investigated in vitro. 2. Sacubitril was shown to be a highly permeable P-glycoprotein (P-gp) substrate and was hydrolyzed to the active anionic metabolite LBQ657 by human carboxylesterase 1 (CES1b and 1c). The multidrug resistance-associated protein 2 (MRP2) was shown to be capable of LBQ657 and valsartan transport that contributes to the elimination of either compound. 3. LBQ657 and valsartan were transported by OAT1, OAT3, OATP1B1 and OATP1B3, whereas no OAT- or OATP-mediated sacubitril transport was observed. 4. The contribution of OATP1B3 to valsartan transport (73%) was appreciably higher than that by OATP1B1 (27%), Alternatively, OATP1B1 contribution to the hepatic uptake of LBQ657 (∼70%) was higher than that by OATP1B3 (∼30%). 5. None of the compounds inhibited OCT1/OCT2, MATE1/MATE2-K, P-gp, or BCRP. Sacubitril and LBQ657 inhibited OAT3 but not OAT1, and valsartan inhibited the activity of both OAT1 and OAT3. Sacubitril and valsartan inhibited OATP1B1 and OATP1B3, whereas LBQ657 weakly inhibited OATP1B1 but not OATP1B3. 6. Drug interactions due to the inhibition of transporters are unlikely due to the redundancy of the available transport pathways (LBQ657: OATP1B1/OAT1/3 and valsartan: OATP1B3/OAT1/3) and the low therapeutic concentration of the LCZ696 analytes.

  9. Transport Properties in Nuclear Pasta

    Science.gov (United States)

    Caplan, Matthew; Horowitz, Charles; Berry, Donald; da Silva Schneider, Andre

    2016-09-01

    At the base of the inner crust of neutron stars, where matter is near the nuclear saturation density, nuclear matter arranges itself into exotic shapes such as cylinders and slabs, called `nuclear pasta.' Lepton scattering from these structures may govern the transport properties of the inner crust; electron scattering from protons in the pasta determines the thermal and electrical conductivity, as well as the shear viscosity of the inner crust. These properties may vary in pasta structures which form at various densities, temperatures, and proton fractions. In this talk, we report on our calculations of lepton transport in nuclear pasta and the implication for neutron star observables.

  10. Transport properties of fission product vapors

    International Nuclear Information System (INIS)

    Im, K.H.; Ahluwalia, R.K.

    1983-07-01

    Kinetic theory of gases is used to calculate the transport properties of fission product vapors in a steam and hydrogen environment. Provided in tabular form is diffusivity of steam and hydrogen, viscosity and thermal conductivity of the gaseous mixture, and diffusivity of cesium iodide, cesium hydroxide, diatomic tellurium and tellurium dioxide. These transport properties are required in determining the thermal-hydraulics of and fission product transport in light water reactors

  11. Determination of Transport Properties From Flowing Fluid Temperature Logging In Unsaturated Fractured Rocks: Theory And Semi-Analytical Solution

    International Nuclear Information System (INIS)

    Mukhopadhyay, Sumit; Tsang, Yvonne W.

    2008-01-01

    Flowing fluid temperature logging (FFTL) has been recently proposed as a method to locate flowing fractures. We argue that FFTL, backed up by data from high-precision distributed temperature sensors, can be a useful tool in locating flowing fractures and in estimating the transport properties of unsaturated fractured rocks. We have developed the theoretical background needed to analyze data from FFTL. In this paper, we present a simplified conceptualization of FFTL in unsaturated fractured rock, and develop a semianalytical solution for spatial and temporal variations of pressure and temperature inside a borehole in response to an applied perturbation (pumping of air from the borehole). We compare the semi-analytical solution with predictions from the TOUGH2 numerical simulator. Based on the semi-analytical solution, we propose a method to estimate the permeability of the fracture continuum surrounding the borehole. Using this proposed method, we estimated the effective fracture continuum permeability of the unsaturated rock hosting the Drift Scale Test (DST) at Yucca Mountain, Nevada. Our estimate compares well with previous independent estimates for fracture permeability of the DST host rock. The conceptual model of FFTL presented in this paper is based on the assumptions of single-phase flow, convection-only heat transfer, and negligible change in system state of the rock formation. In a sequel paper (Mukhopadhyay et al., 2008), we extend the conceptual model to evaluate some of these assumptions. We also perform inverse modeling of FFTL data to estimate, in addition to permeability, other transport parameters (such as porosity and thermal conductivity) of unsaturated fractured rocks

  12. Transport properties of liquids

    International Nuclear Information System (INIS)

    Rajagopal, K.

    1976-07-01

    The transport coefficients, self diffusivity, dinamical viscosity,total viscosity (i.e., the first and second viscosity coefficient) and thermal conductivity, are calculated at several temperatures and saturation pressures for the Argon, Krypton and Xenon liquids, from the Mie otential and the hard sphere theory. (L.C.) [pt

  13. Theoretical and experimental determination of matrix diffusion and related solute transport properties of fractured tuffs from the Nevada Test Site

    International Nuclear Information System (INIS)

    Walter, G.R.

    1982-10-01

    Theoretical and experimental studies of the chemical and physical factors which affect molecular diffusion of dissolved substances from fractures into a tuffaceous rock matrix have been made on rocks from G-Tunnel and Yucca Mountain at the Nevada Test Site (NTS). A variety of groundwater tracers, which may be useful in field tests at the NTS, have also been developed and tested. Although a number of physical/chemical processes may cause nonconvective transport of dissolved species from fractures into the tuff matrix, molecular diffusion seems to be the most important process. Molecular diffusion in these rocks is controlled by the composition of the groundwater through multicomponent effects and several rock properties. The porosities of the samples studied ranged from about 0.1 to 0.4. The constrictivity-tortuosity parameter ranged from 0.1 and 0.3 and effective matrix-diffusion coefficients were measured to be between 2 to 17. x 10 -7 c, 2 /s for sodium halides and sodium pentafluorobenzoate. Total porosity was found to be the principle factor accounting for the variation in effective diffusion coefficients. The constrictivity-tortuosity factor was found to have a fair correlation (r = 0.75) with the median pore diameters measured by mercury intrusion. Measurements of bulk-rock electrical impedance changes with frequency indicate that the constrictivity factor has a maximum value of 0.8 to 1, but may be smaller. If the larger values are correct, then the diffusion paths in tuff are more tortuous than in granular media. Computation of the full diffusion-coefficient matrix for various tracers in J-13 well water from the NTS indicates coupling of the diffusion fluxes of all ionic species. These effects are being incorporated into a numerical model of multicomponent-matrix diffusion

  14. Transport properties of molecular junctions

    CERN Document Server

    Zimbovskaya, Natalya A

    2013-01-01

    A comprehensive overview of the physical mechanisms that control electron transport and the characteristics of metal-molecule-metal (MMM) junctions is presented. As far as possible, methods and formalisms presented elsewhere to analyze electron transport through molecules are avoided. This title introduces basic concepts—a description of the electron transport through molecular junctions—and briefly describes relevant experimental methods. Theoretical methods commonly used to analyze the electron transport through molecules are presented. Various effects that manifest in the electron transport through MMMs, as well as the basics of density-functional theory and its applications to electronic structure calculations in molecules are presented. Nanoelectronic applications of molecular junctions and similar systems are discussed as well. Molecular electronics is a diverse and rapidly growing field. Transport Properties of Molecular Junctions presents an up-to-date survey of the field suitable for researchers ...

  15. Colligative thermoelectric transport properties in n-type filled CoSb{sub 3} determined by guest electrons in a host lattice

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Young Soo, E-mail: yslim@pknu.ac.kr, E-mail: wsseo@kicet.re.kr, E-mail: pmoka@lgchem.com [Department of Materials System Engineering, Pukyong National University, Busan 48547 (Korea, Republic of); Park, Kwan-Ho; Tak, Jang Yeul; Lee, Soonil; Seo, Won-Seon, E-mail: yslim@pknu.ac.kr, E-mail: wsseo@kicet.re.kr, E-mail: pmoka@lgchem.com [Energy and Environmental Division, Korea Institute of Ceramic Engineering and Technology (KICET), Jinju 52851 (Korea, Republic of); Park, Cheol-Hee, E-mail: yslim@pknu.ac.kr, E-mail: wsseo@kicet.re.kr, E-mail: pmoka@lgchem.com; Kim, Tae Hoon; Park, PumSuk [LG Chem/Research Park, Daejeon 34122 (Korea, Republic of); Kim, Il-Ho [Department of Materials Science and Engineering, Korea National University of Transportation, Chungju 27909 (Korea, Republic of); Yang, Jihui [Department of Materials Science and Engineering, University of Washington, Seattle, Washington 98195 (United States)

    2016-03-21

    Among many kinds of thermoelectric materials, CoSb{sub 3} has received exceptional attention for automotive waste heat recovery. Its cage structure provides an ideal framework for the realization of phonon-glass electron-crystal strategy, and there have been numerous reports on the enhanced thermoelectric performance through the independent control of the thermal and electrical conductivity by introducing fillers into its cage sites. Herein, we report colligative thermoelectric transport properties in n-type CoSb{sub 3} from the viewpoint of “guest electrons in a host lattice.” Both the Seebeck coefficient and the charge transport properties are fundamentally determined by the concentration of the guest electrons, which are mostly donated by the fillers, in the conduction band of the host CoSb{sub 3}. Comparing this observation to our previous results, colligative relations for both the Seebeck coefficient and the mobility were deduced as functions of the carrier concentration, and thermoelectric transport constants were defined to predict the power factor in filled CoSb{sub 3}. This discovery not only increases the degree of freedom for choosing a filler but also provides the predictability of power factor in designing and engineering the n-type filled CoSb{sub 3} materials.

  16. Colligative thermoelectric transport properties in n-type filled CoSb3 determined by guest electrons in a host lattice

    International Nuclear Information System (INIS)

    Lim, Young Soo; Park, Kwan-Ho; Tak, Jang Yeul; Lee, Soonil; Seo, Won-Seon; Park, Cheol-Hee; Kim, Tae Hoon; Park, PumSuk; Kim, Il-Ho; Yang, Jihui

    2016-01-01

    Among many kinds of thermoelectric materials, CoSb 3 has received exceptional attention for automotive waste heat recovery. Its cage structure provides an ideal framework for the realization of phonon-glass electron-crystal strategy, and there have been numerous reports on the enhanced thermoelectric performance through the independent control of the thermal and electrical conductivity by introducing fillers into its cage sites. Herein, we report colligative thermoelectric transport properties in n-type CoSb 3 from the viewpoint of “guest electrons in a host lattice.” Both the Seebeck coefficient and the charge transport properties are fundamentally determined by the concentration of the guest electrons, which are mostly donated by the fillers, in the conduction band of the host CoSb 3 . Comparing this observation to our previous results, colligative relations for both the Seebeck coefficient and the mobility were deduced as functions of the carrier concentration, and thermoelectric transport constants were defined to predict the power factor in filled CoSb 3 . This discovery not only increases the degree of freedom for choosing a filler but also provides the predictability of power factor in designing and engineering the n-type filled CoSb 3 materials.

  17. TRANSPORT PROPERTIES FOR REFRIGERANT MIXTURES

    Directory of Open Access Journals (Sweden)

    V. Geller

    2014-06-01

    Full Text Available A set of models to predict viscosity and thermal conductivity of refrigerant mixtures is developed. A general model for viscosity and thermal conductivity use the three contributions sum form (the dilute-gas terms, the residual terms, and the liquid terms. The corresponding states model is recommended to predict the dense gas transport properties over a range of reduced density from 0 to 2. It is shown that the RHS model provides the most reliable results for the saturated-liquid and the compressed-liquid transport properties over a range of given temperatures from 0,5 to 0,95.

  18. The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes.

    Science.gov (United States)

    Villanueva-Cab, J; Anta, J A; Oskam, G

    2016-01-28

    We report on the commonly unaccounted for process of recombination under short-circuit conditions in nanostructured photoelectrodes with special attention to the charge collection efficiency. It is observed that when recombination under short circuit conditions is significant, small perturbation methods overestimate the charge-collection efficiency, which is related to the inaccurate determination of the electron diffusion coefficient and diffusion length.

  19. Magnetothermoelectric transport properties in phosphorene

    Science.gov (United States)

    Ma, R.; Liu, S. W.; Deng, M. X.; Sheng, L.; Xing, D. Y.; Sheng, D. N.

    2018-02-01

    We numerically study the electrical and thermoelectric transport properties in phosphorene in the presence of both a magnetic field and disorder. The quantized Hall conductivity is similar to that of a conventional two-dimensional electron gas, but the positions of all the Hall plateaus shift to the left due to the spectral asymmetry, in agreement with the experimental observations. The thermoelectric conductivity and Nernst signal exhibit remarkable anisotropy, and the thermopower is nearly isotropic. When a bias voltage is applied between top and bottom layers of phosphorene, both thermopower and Nernst signal are enhanced and their peak values become large.

  20. Transport properties of alumina nanofluids

    International Nuclear Information System (INIS)

    Wong, Kau-Fui Vincent; Kurma, Tarun

    2008-01-01

    Recent studies have showed that nanofluids have significantly greater thermal conductivity compared to their base fluids. Large surface area to volume ratio and certain effects of Brownian motion of nanoparticles are believed to be the main factors for the significant increase in the thermal conductivity of nanofluids. In this paper all three transport properties, namely thermal conductivity, electrical conductivity and viscosity, were studied for alumina nanofluid (aluminum oxide nanoparticles in water). Experiments were performed both as a function of volumetric concentration (3-8%) and temperature (2-50 deg. C). Alumina nanoparticles with a mean diameter of 36 nm were dispersed in water. The effect of particle size was not studied. The transient hot wire method as described by Nagaska and Nagashima for electrically conducting fluids was used to test the thermal conductivity. In this work, an insulated platinum wire of 0.003 inch diameter was used. Initial calibration was performed using de-ionized water and the resulting data was within 2.5% of standard thermal conductivity values for water. The thermal conductivity of alumina nanofluid increased with both increase in temperature and concentration. A maximum thermal conductivity of 0.7351 W m -1 K -1 was recorded for an 8.47% volume concentration of alumina nanoparticles at 46.6 deg. C. The effective thermal conductivity at this concentration and temperature was observed to be 1.1501, which translates to an increase in thermal conductivity by 22% when compared to water at room temperature. Alumina being a good conductor of electricity, alumina nanofluid displays an increasing trend in electrical conductivity as volumetric concentration increases. A microprocessor-based conductivity/TDS meter was used to perform the electrical conductivity experiments. After carefully calibrating the conductivity meter's glass probe with platinum tip, using a standard potassium chloride solution, readings were taken at various

  1. Transport properties of organic liquids

    CERN Document Server

    Latini, G; Passerini, G

    2006-01-01

    The liquid state is possibly the most difficult and intriguing state of matter to model. Organic liquids are required, mainly as working fluids, in almost all industrial activities and in most appliances (e.g. in air conditioning). Transport properties (namely dynamic viscosity and thermal conductivity) are possibly the most important properties for the design of devices and appliances. The aim of this book is to present both theoretical approaches and the latest experimental advances on the issue, and to merge them into a wider approach. It concentrates on applicability of models.This book is organized into five chapters plus a data collection. The chapters discuss the following topics: the liquid state and some well-know theories able to explain the behaviour of liquids; a rather complete review of models, based on theoretical assumptions and/or upon physical paradigms, to evaluate heat transfer in organic liquids; a review of several well-known semi-empirical methods to predict the thermal conductivity coe...

  2. Transport properties of chiral fermions

    Energy Technology Data Exchange (ETDEWEB)

    Puhr, Matthias

    2017-04-26

    Anomalous transport phenomena have their origin in the chiral anomaly, the anomalous non-conservation of the axial charge, and can arise in systems with chiral fermions. The anomalous transport properties of free fermions are well understood, but little is known about possible corrections to the anomalous transport coefficients that can occur if the fermions are strongly interacting. The main goal of this thesis is to study anomalous transport effects in media with strongly interacting fermions. In particular, we investigate the Chiral Magnetic Effect (CME) in a Weyl Semimetal (WSM) and the Chiral Separation Effect (CSE) in finite-density Quantum Chromodynamics (QCD). The recently discovered WSMs are solid state crystals with low-energy excitations that behave like Weyl fermions. The inter-electron interaction in WSMs is typically very strong and non-perturbative calculations are needed to connect theory and experiment. To realistically model an interacting, parity-breaking WSM we use a tight-binding lattice Hamiltonian with Wilson-Dirac fermions. This model features a non-trivial phase diagram and has a phase (Aoki phase/axionic insulator phase) with spontaneously broken CP symmetry, corresponding to the phase with spontaneously broken chiral symmetry for interacting continuum Dirac fermions. We use a mean-field ansatz to study the CME in spatially modulated magnetic fields and find that it vanishes in the Aoki phase. Moreover, our calculations show that outside of the Aoki phase the electron interaction has only a minor influence on the CME. We observe no enhancement of the magnitude of the CME current. For our non-perturbative study of the CSE in QCD we use the framework of lattice QCD with overlap fermions. We work in the quenched approximation to avoid the sign problem that comes with introducing a finite chemical potential on the lattice. The overlap operator calls for the evaluation of the sign function of a matrix with a dimension proportional to the volume

  3. Electronic transport properties of nanostructured MnSi-films

    Science.gov (United States)

    Schroeter, D.; Steinki, N.; Scarioni, A. Fernández; Schumacher, H. W.; Süllow, S.; Menzel, D.

    2018-05-01

    MnSi, which crystallizes in the cubic B20 structure, shows intriguing magnetic properties involving the existence of skyrmions in the magnetic phase diagram. Bulk MnSi has been intensively investigated and thoroughly characterized, in contrast to MnSi thin film, which exhibits widely varying properties in particular with respect to electronic transport. In this situation, we have set out to reinvestigate the transport properties in MnSi thin films by means of studying nanostructure samples. In particular, Hall geometry nanostructures were produced to determine the intrinsic transport properties.

  4. Transport properties of dense matter

    International Nuclear Information System (INIS)

    Itoh, Naoki; Mitake, Shinichi; Iyetomi, Hiroshi; Ichimaru, Setsuo

    1983-01-01

    Transport coefficients, electrical and thermal conductivities in particular, are essential physical quantities for the theories of stellar structure. Since the discoveries of pulsars and X-ray stars, an accurate evaluation of the transport coefficients in the dense matter has become indispensable to the quantitative understanding of the observed neutron stars. The authors present improved calculations of the electrical and thermal conductivities of the dense matter in the liquid metal phase, appropriate to white dwarfs and neutron stars. (Auth.)

  5. Nanofluidics thermodynamic and transport properties

    CERN Document Server

    Michaelides, Efstathios E (Stathis)

    2014-01-01

    This volume offers a comprehensive examination of the subject of heat and mass transfer with nanofluids as well as a critical review of the past and recent research projects in this area. Emphasis is placed on the fundamentals of the transport processes using particle-fluid suspensions, such as nanofluids. The nanofluid research is examined and presented in a holistic way using a great deal of our experience with the subjects of continuum mechanics, statistical thermodynamics, and non-equilibrium thermodynamics of transport processes. Using a thorough database, the experimental, analytical, and numerical advances of recent research in nanofluids are critically examined and connected to past research with medium and fine particles as well as to functional engineering systems. Promising applications and technological issues of heat/mass transfer system design with nanofluids are also discussed. This book also: Provides a deep scientific analysis of nanofluids using classical thermodynamics and statistical therm...

  6. Optical and transport properties of polyaniline films

    International Nuclear Information System (INIS)

    Tzamalis, Georgios

    2002-01-01

    This thesis presents the results of a comprehensive study on the transport and optical properties of polyaniline (PANI) films. The films are derived by protonation (doping) of the emeraldine base form of polyaniline, as synthesized in Durham, with either 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPSA) or 10-camphorsulfonic acid. Thus, two distinct PANI systems are obtained: PANI-CSA and PANI-AMPSA. The variation of the doping level can affect the metallic properties of the final system, so that samples close to the boundary as well as samples at either side of a disorder induced metal-insulator can be obtained. The relation between the doping level and the degree of disorder, along with the existence of an inherently metallic behaviour in PANI, are investigated through a series of experiments. Temperature dependent dc conductivity measurements ranging from 10-295 K are performed using a closed loop helium cryostat under dynamic vacuum (∼10 -5 mbar). From the conductivity data curves, typical fingerprints of the metallic behaviour are detected for certain samples and an initial estimate of the degree of disorder is implicitly attained. More specific information regarding the microscopic contributions to the transport mechanisms is obtained via low temperature (down to 1.5 K) magnetoconductance measurements on selected samples. The magnetic field dependence of conductivity for fields up to 14 T is measured and the suitability of the localization-interaction model for the understanding of the transport mechanism in PANI is examined. Infrared reflectivity (20-9000 cm -1 ) measurements on samples of both PANI systems are performed. The experimental configuration permits the determination of the sample's absolute reflectivity. The optical constants are deduced from Kramers-Kronig analysis of the reflectivity data. Typical features of metallic behaviour are examined and analysed in the context of the localization modified Drude model. The results are shown to be

  7. DETERMINANTS DESTRUCTIVE TO BUSINESS CONDUCT TRANSPORT

    Directory of Open Access Journals (Sweden)

    Natalia Anatol’evna Loginova

    2017-03-01

    Full Text Available The article examines the determinants of destructive behavior in the transport business with the aim to identify their causes and to clarify the features of influence on them by all business stakeholders in transport. It is shown that the key determinants are: submission to the will of one business entity to another, the implementation of state support only in distressed periods of functioning of transport organizations, business obligations to the state are often perceived as a back-breaking businessmen, unfair, unnecessary. The main conclusions of the work are reduced to the following recommendations: to form a focused pulse of the state in support of the transport business; improve enforcement culture; more efficient use of the transport business capital. The goal – to identify the cause of the destructive business behavior and clarify the characteristics of their research on the part of all stakeholders in the transport sector. Method or methodology of work: in the article used analytical methods, and statistical analysis methods. Results for: received informative pictures that describe deterministic minanaty-destructive conduct business on the road, on the basis of which developed recommendations to neutralize their influence on the behavior of entrepreneurs. Application of results: the results the expediency applied differently businesses and government agencies operating in the field of transport.

  8. Transport Properties of Nanostructured Graphene

    DEFF Research Database (Denmark)

    Jauho, Antti-Pekka

    2017-01-01

    Despite of its many wonderful properties, pristine graphene has one major drawback: it does not have a band gap, which complicates its applications in electronic devices. Many routes have been suggested to overcome this difficulty, such as cutting graphene into nanoribbons, using chemical methods...... device operation. In this talk I elaborate these ideas and review the state-of-the-art both from the theoretical and the experimental points of view. I also introduce two new ideas: (1) triangular antidots, and (2) nanobubbles formed in graphene. Both of these nanostructuring methods are predicted...

  9. Thermodynamic and transport properties of sodium liquid and vapor

    International Nuclear Information System (INIS)

    Fink, J.K.; Leibowitz, L.

    1995-01-01

    Data have been reviewed to obtain thermodynamically consistent equations for thermodynamic and transport properties of saturated sodium liquid and vapor. Recently published Russian recommendations and results of equation of state calculations on thermophysical properties of sodium have been included in this critical assessment. Thermodynamic properties of sodium liquid and vapor that have been assessed include: enthalpy, heat capacity at constant pressure, heat capacity at constant volume, vapor pressure, boiling point, enthalpy of vaporization, density, thermal expansion, adiabatic and isothermal compressibility, speed of sound, critical parameters, and surface tension. Transport properties of liquid sodium that have been assessed include: viscosity and thermal conductivity. For each property, recommended values and their uncertainties are graphed and tabulated as functions of temperature. Detailed discussions of the analyses and determinations of the recommended equations include comparisons with recommendations given in other assessments and explanations of consistency requirements. The rationale and methods used in determining the uncertainties in the recommended values are also discussed

  10. Transport properties of quasi-free Fermions

    CERN Document Server

    Aschbacher, W; Pautrat, Y; Pillet, C A

    2006-01-01

    Using the scattering approach to the construction of Non-Equilibrium Steady States proposed by Ruelle we study the transport properties of systems of independent electrons. We show that Landauer-Buttiker and Green-Kubo formulas hold under very general conditions.

  11. The heat and moisture transport properties of wet porous media

    International Nuclear Information System (INIS)

    Wang, B.X.; Fang, Z.H.; Yu, W.P.

    1989-01-01

    Existing methods for determining heat and moisture transport properties in porous media are briefly reviewed, and their merits and deficiencies are discussed. Emphasis is placed on research in developing new transient methods undertaken in China during the recent years. An attempt has been made to relate the coefficients in the heat and mass transfer equations with inherent properties of the liquid and matrix and then to predict these coefficients based on limited measurements

  12. Unsaturated Zone and Saturated Zone Transport Properties (U0100)

    Energy Technology Data Exchange (ETDEWEB)

    J. Conca

    2000-12-20

    This Analysis/Model Report (AMR) summarizes transport properties for the lower unsaturated zone hydrogeologic units and the saturated zone at Yucca Mountain and provides a summary of data from the Busted Butte Unsaturated Zone Transport Test (UZTT). The purpose of this report is to summarize the sorption and transport knowledge relevant to flow and transport in the units below Yucca Mountain and to provide backup documentation for the sorption parameters decided upon for each rock type. Because of the complexity of processes such as sorption, and because of the lack of direct data for many conditions that may be relevant for Yucca Mountain, data from systems outside of Yucca Mountain are also included. The data reported in this AMR will be used in Total System Performance Assessment (TSPA) calculations and as general scientific support for various Process Model Reports (PMRs) requiring knowledge of the transport properties of different materials. This report provides, but is not limited to, sorption coefficients and other relevant thermodynamic and transport properties for the radioisotopes of concern, especially neptunium (Np), plutonium (Pu), Uranium (U), technetium (Tc), iodine (I), and selenium (Se). The unsaturated-zone (UZ) transport properties in the vitric Calico Hills (CHv) are discussed, as are colloidal transport data based on the Busted Butte UZTT, the saturated tuff, and alluvium. These values were determined through expert elicitation, direct measurements, and data analysis. The transport parameters include information on interactions of the fractures and matrix. In addition, core matrix permeability data from the Busted Butte UZTT are summarized by both percent alteration and dispersion.

  13. Unsaturated Zone and Saturated Zone Transport Properties (U0100)

    International Nuclear Information System (INIS)

    Conca, J.

    2000-01-01

    This Analysis/Model Report (AMR) summarizes transport properties for the lower unsaturated zone hydrogeologic units and the saturated zone at Yucca Mountain and provides a summary of data from the Busted Butte Unsaturated Zone Transport Test (UZTT). The purpose of this report is to summarize the sorption and transport knowledge relevant to flow and transport in the units below Yucca Mountain and to provide backup documentation for the sorption parameters decided upon for each rock type. Because of the complexity of processes such as sorption, and because of the lack of direct data for many conditions that may be relevant for Yucca Mountain, data from systems outside of Yucca Mountain are also included. The data reported in this AMR will be used in Total System Performance Assessment (TSPA) calculations and as general scientific support for various Process Model Reports (PMRs) requiring knowledge of the transport properties of different materials. This report provides, but is not limited to, sorption coefficients and other relevant thermodynamic and transport properties for the radioisotopes of concern, especially neptunium (Np), plutonium (Pu), Uranium (U), technetium (Tc), iodine (I), and selenium (Se). The unsaturated-zone (UZ) transport properties in the vitric Calico Hills (CHv) are discussed, as are colloidal transport data based on the Busted Butte UZTT, the saturated tuff, and alluvium. These values were determined through expert elicitation, direct measurements, and data analysis. The transport parameters include information on interactions of the fractures and matrix. In addition, core matrix permeability data from the Busted Butte UZTT are summarized by both percent alteration and dispersion

  14. Determining the nature of transported material

    International Nuclear Information System (INIS)

    Wykes, J.S.; Surzyn, P.M.; Croke, G.M.; Adsley, I.

    1980-01-01

    An improved method is described of determining the nature of a coal/stone mixture, transported on a conveyor, by measuring the relative transmission of two different energy x-ray beams. Details are given of the collimation, scintillation counters and shielding required to obtain the necessary accuracy to obtain information on the mass and the nature of the material being monitored. Compensation is provided for background radioactivity. (U.K.)

  15. Nonlinear transport properties of non-ideal systems

    International Nuclear Information System (INIS)

    Pavlov, G A

    2009-01-01

    The theory of nonlinear transport is elaborated to determine the Burnett transport properties of non-ideal multi-element plasma and neutral systems. The procedure for the comparison of the phenomenological conservation equations of a continuous dense medium and the microscopic equations for dynamical variable operators is used for the definition of these properties. The Mori algorithm is developed to derive the equations of motion of dynamical value operators of a non-ideal system in the form of the generalized nonlinear Langevin equations. In consequence, the microscopic expressions of transport coefficients corresponding to second-order thermal disturbances (temperature, mass velocity, etc) have been found in the long wavelength and low frequency limits

  16. Thermodynamic and transport properties of gaseous tetrafluoromethane in chemical equilibrium

    Science.gov (United States)

    Hunt, J. L.; Boney, L. R.

    1973-01-01

    Equations and in computer code are presented for the thermodynamic and transport properties of gaseous, undissociated tetrafluoromethane (CF4) in chemical equilibrium. The computer code calculates the thermodynamic and transport properties of CF4 when given any two of five thermodynamic variables (entropy, temperature, volume, pressure, and enthalpy). Equilibrium thermodynamic and transport property data are tabulated and pressure-enthalpy diagrams are presented.

  17. Thermodynamic and transport properties of liquid gallium

    International Nuclear Information System (INIS)

    Park, H.Y.; Jhon, M.S.

    1982-01-01

    The significant structure theory of liquids has been successfully applied to liquid gallium. In this work, we have assumed that two structures exist simultaneously in liquid gallium. One is considerec as loosely close packed β-Ga-like structure and the other is remainder of solid α-Ga or α-Ga-like structure. This two structural model is introduced to construct the liquid partition function. Using the partition function, the thermodynamic and transport properties are calculated ever a wide temperature range. The calculated results are quite satisfactory when compared with the experimental results. (Author)

  18. TRANSPORT PROPERTIES OF THE STRONGLY CORRELATED SYSTEMS

    Directory of Open Access Journals (Sweden)

    T.Domanski

    2004-01-01

    Full Text Available The transport properties of various systems are studied here in the context of three different models. These are: - the disordered Hubbard model applicable to correlated binary alloys with a general disorder, - the Anderson model used in describing the Kondo physics of a quantum dot connected to the external superconducting leads, and - the Ranninger-Robaszkiewicz model applied to the study of optical properties of the system with preformed electron pairs above the temperature of transition to the superconducting state. We calculate the density of states, specific heat, the Wilson ratio and conductivity of the correlated binary alloy with off-diagonal disorder. We investigate the conditions under which the Kondo peak appears in the density of states and in the conductance of a dot coupled to the external superconducting leads. We analyze the effect of the pseudogap on the optical spectra in the high temperature superconductors described by the boson-fermion model.

  19. Electronic transport properties of phenylacetylene molecular junctions

    International Nuclear Information System (INIS)

    Liu Wen; Cheng Jie; Yan Cui-Xia; Li Hai-Hong; Wang Yong-Juan; Liu De-Sheng

    2011-01-01

    Electronic transport properties of a kind of phenylacetylene compound— (4-mercaptophenyl)-phenylacetylene are calculated by the first-principles method in the framework of density functional theory and the nonequilibrium Green's function formalism. The molecular junction shows an obvious rectifying behaviour at a bias voltage larger than 1.0 V. The rectification effect is attributed to the asymmetry of the interface contacts. Moreover, at a bias voltage larger than 2.0 V, which is not referred to in a relevant experiment [Fang L, Park J Y, Ma H, Jen A K Y and Salmeron M 2007 Langmuir 23 11522], we find a negative differential resistance phenomenon. The negative differential resistance effect may originate from the change of the delocalization degree of the molecular orbitals induced by the bias. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  20. The role of correlations in the determination of the transport properties of LaCl_3 in high temperature molten eutectic LiCl-KCl

    International Nuclear Information System (INIS)

    Samin, Adib; Wu, Evan; Zhang, Jinsuo

    2017-01-01

    It is important to develop an accurate assessment of fundamental data of lanthanides in high temperature molten salts to enable an efficient application of pyroprocessing. This requires a careful consideration of uncertainties in the reported results. In this study, cyclic voltammetry (CV) tests of LaCl_3 in KCl-LiCl molten salt were conducted at low concentration levels in the molten salt at 723 K and at several scan rates. The CV signals were subsequently analyzed through the conventional CV analysis and using a BET-based model through a nonlinear least-squares fitting procedure. It was determined that the parameters of the model were strongly correlated and the support plane procedure was implemented to assign joint confidence intervals for the diffusivity of lanthanum. Accounting for the correlations led to a significant increase in the uncertainty of the reported diffusivity which led to better agreement with the literature. Accounting for the correlations may be important for higher concentration levels.

  1. Electron Transport Properties of Ge nanowires

    Science.gov (United States)

    Hanrath, Tobias; Khondaker, Saiful I.; Yao, Zhen; Korgel, Brian A.

    2003-03-01

    Electron Transport Properties of Ge nanowires Tobias Hanrath*, Saiful I. Khondaker, Zhen Yao, Brian A. Korgel* *Dept. of Chemical Engineering, Dept. of Physics, Texas Materials Institute, and Center for Nano- and Molecular Science and Technology University of Texas at Austin, Austin, Texas 78712-1062 e-mail: korgel@mail.che.utexas.edu Germanium (Ge) nanowires with diameters ranging from 6 to 50 nm and several micrometer in length were grown via a supercritical fluid-liquid-solid synthesis. Parallel electron energy loss spectroscopy (PEELS) was employed to study the band structure and electron density in the Ge nanowires. The observed increase in plasmon peak energy and peak width with decreasing nanowire diameter is attributed to quantum confinement effects. For electrical characterization, Ge nanowires were deposited onto a patterned Si/SiO2 substrate. E-beam lithography was then used to form electrode contacts to individual nanowires. The influence of nanowire diameter, surface chemistry and crystallographic defects on electron transport properties were investigated and the comparison of Ge nanowire conductivity with respect to bulk, intrinsic Ge will be presented.

  2. The role of correlations in the determination of the transport properties of LaCl{sub 3} in high temperature molten eutectic LiCl-KCl

    Energy Technology Data Exchange (ETDEWEB)

    Samin, Adib; Wu, Evan; Zhang, Jinsuo [The Ohio State Univ., Columbus, OH (United States). Dept. of Mechanical and Aerospace Engineering

    2017-10-01

    It is important to develop an accurate assessment of fundamental data of lanthanides in high temperature molten salts to enable an efficient application of pyroprocessing. This requires a careful consideration of uncertainties in the reported results. In this study, cyclic voltammetry (CV) tests of LaCl{sub 3} in KCl-LiCl molten salt were conducted at low concentration levels in the molten salt at 723 K and at several scan rates. The CV signals were subsequently analyzed through the conventional CV analysis and using a BET-based model through a nonlinear least-squares fitting procedure. It was determined that the parameters of the model were strongly correlated and the support plane procedure was implemented to assign joint confidence intervals for the diffusivity of lanthanum. Accounting for the correlations led to a significant increase in the uncertainty of the reported diffusivity which led to better agreement with the literature. Accounting for the correlations may be important for higher concentration levels.

  3. Transport processes in partially saturate concrete: Testing and liquid properties

    Science.gov (United States)

    Villani, Chiara

    The measurement of transport properties of concrete is considered by many to have the potential to serve as a performance criterion that can be related to concrete durability. However, the sensitivity of transport tests to several parameters combined with the low permeability of concrete complicates the testing. Gas permeability and diffusivity test methods are attractive due to the ease of testing, their non-destructive nature and their potential to correlate to in-field carbonation of reinforced concrete structures. This work was aimed at investigating the potential of existing gas transport tests as a way to reliably quantify transport properties in concrete. In this study gas permeability and diffusivity test methods were analyzed comparing their performance in terms of repeatability and variability. The influence of several parameters was investigated such as moisture content, mixture proportions and gas flow. A closer look to the influence of pressure revealed an anomalous trend of permeability with respect to pressure. An alternative calculation is proposed in an effort to move towards the determination of intrinsic material properties that can serve as an input for service life prediction models. The impact of deicing salts exposure was also analyzed with respect to their alteration of the degree of saturation as this may affect gas transport in cementitious materials. Limited information were previously available on liquid properties over a wide range of concentrations. To overcome this limitation, this study quantified surface tension, viscosity in presence of deicing salts in a broad concentration range and at different temperatures. Existing models were applied to predict the change of fluid properties during drying. Vapor desorption isotherms were obtained to investigate the influence of deicing salts presence on the non-linear moisture diffusion coefficient. Semi-empirical models were used to quantify the initiation and the rate of drying using liquid

  4. Electronic transport properties of (fluorinated) metal phthalocyanine

    KAUST Repository

    Fadlallah, M M; Eckern, U; Romero, A H; Schwingenschlö gl, Udo

    2015-01-01

    The magnetic and transport properties of the metal phthalocyanine (MPc) and F16MPc (M = Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn and Ag) families of molecules in contact with S–Au wires are investigated by density functional theory within the local density approximation, including local electronic correlations on the central metal atom. The magnetic moments are found to be considerably modified under fluorination. In addition, they do not depend exclusively on the configuration of the outer electronic shell of the central metal atom (as in isolated MPc and F16MPc) but also on the interaction with the leads. Good agreement between the calculated conductance and experimental results is obtained. For M = Ag, a high spin filter efficiency and conductance is observed, giving rise to a potentially high sensitivity for chemical sensor applications.

  5. Electronic transport properties of (fluorinated) metal phthalocyanine

    KAUST Repository

    Fadlallah, M M

    2015-12-21

    The magnetic and transport properties of the metal phthalocyanine (MPc) and F16MPc (M = Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn and Ag) families of molecules in contact with S–Au wires are investigated by density functional theory within the local density approximation, including local electronic correlations on the central metal atom. The magnetic moments are found to be considerably modified under fluorination. In addition, they do not depend exclusively on the configuration of the outer electronic shell of the central metal atom (as in isolated MPc and F16MPc) but also on the interaction with the leads. Good agreement between the calculated conductance and experimental results is obtained. For M = Ag, a high spin filter efficiency and conductance is observed, giving rise to a potentially high sensitivity for chemical sensor applications.

  6. Electronic and transport properties of kinked graphene

    DEFF Research Database (Denmark)

    Rasmussen, Jesper Toft; Gunst, Tue; Bøggild, Peter

    2013-01-01

    Local curvature, or bending, of a graphene sheet is known to increase the chemical reactivity presenting an opportunity for templated chemical functionalisation. Using first-principles calculations based on density functional theory (DFT), we investigate the reaction barrier reduction for the ads......Local curvature, or bending, of a graphene sheet is known to increase the chemical reactivity presenting an opportunity for templated chemical functionalisation. Using first-principles calculations based on density functional theory (DFT), we investigate the reaction barrier reduction...... for the adsorption of atomic hydrogen at linear bends in graphene. We find a significant barrier lowering (≈15%) for realistic radii of curvature (≈20 Å) and that adsorption along the linear bend leads to a stable linear kink. We compute the electronic transport properties of individual and multiple kink lines......, and demonstrate how these act as efficient barriers for electron transport. In particular, two parallel kink lines form a graphene pseudo-nanoribbon structure with a semimetallic/semiconducting electronic structure closely related to the corresponding isolated ribbons; the ribbon band gap translates...

  7. Physical transport properties of marine microplastic pollution

    Science.gov (United States)

    Ballent, A.; Purser, A.; Mendes, P. de Jesus; Pando, S.; Thomsen, L.

    2012-12-01

    Given the complexity of quantitative collection, knowledge of the distribution of microplastic pollution in many regions of the world ocean is patchy, both spatially and temporally, especially for the subsurface environment. However, with knowledge of typical hydrodynamic behavior of waste plastic material, models predicting the dispersal of pelagic and benthic plastics from land sources into the ocean are possible. Here we investigate three aspects of plastic distribution and transport in European waters. Firstly, we assess patterns in the distribution of plastics found in fluvial strandlines of the North Sea and how distribution may be related to flow velocities and distance from source. Second, we model transport of non-buoyant preproduction pellets in the Nazaré Canyon of Portugal using the MOHID system after assessing the density, settling velocity, critical and depositional shear stress characteristics of such waste plastics. Thirdly, we investigate the effect of surface turbulences and high pressures on a range of marine plastic debris categories (various densities, degradation states and shapes tested) in an experimental water column simulator tank and pressure laboratory. Plastics deposited on North Sea strandlines varied greatly spatially, as a function of material composition and distance from source. Model outputs indicated that such dense production pellets are likely transported up and down canyon as a function of tidal forces, with only very minor net down canyon movement. Behaviour of plastic fragments under turbulence varied greatly, with the dimensions of the material, as well as density, playing major determining roles. Pressure was shown to affect hydrodynamic behaviours of only low density foam plastics at pressures ≥ 60 bar.

  8. Transport Gap and exciton binding energy determination in organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Krause, Stefan; Schoell, Achim; Reinert, Friedrich; Umbach, Eberhard [University of Wuerzburg (Germany). Experimental Physics II; Casu, Benedetta [Inst. f. Physik. u. Theor. Chemie, Tuebingen (Germany)

    2008-07-01

    The transport gap of an organic semiconductor is defined as the energy difference between the HOMO and LUMO levels in the presence of a hole or electron, respectively, after relaxation has occurred. Its knowledge is mandatory for the optimisation of electronic devices based on these materials. UV photoelectron spectroscopy (UPS) and inverse photoelectron spectroscopy (IPES) are routinely applied to measure these molecular levels. However, the precise determination of the transport gap on the basis of the respective data is not an easy task. It involves fundamental questions about the properties of organic molecules and their condensates, about their reaction on the experimental probe, and on the evaluation of the spectroscopic data. In particular electronic relaxation processes, which occur on the time scale of the photo excitation, have to be considered adequately. We determined the transport gap for the organic semiconductors PTCDA, Alq3, DIP, CuPc, and PBI-H4. After careful data analysis and comparison to the respective values for the optical gap we obtain values for the exciton binding energies between 0.1-0.5 eV. This is considerably smaller than commonly believed and indicates a significant delocalisation of the excitonic charge over various molecular units.

  9. EquilTheTA: Thermodynamic and transport properties of complex equilibrium plasmas

    International Nuclear Information System (INIS)

    Colonna, G.; D'Angola, A.

    2012-01-01

    EquilTheTA (EQUILibrium for plasma THErmodynamics and Transport Applications) is a web-based software which calculates chemical equilibrium product concentrations from any set of reactants and determines thermodynamic and transport properties for the product mixture in wide temperature and pressure ranges. The program calculates chemical equilibrium by using a hierarchical approach, thermodynamic properties and transport coefficients starting from recent and accurate databases of atomic and molecular energy levels and collision integrals. In the calculations, Debye length and cut-off are consistently updated and virial corrections (up to third order) can be considered. Transport coefficients are calculated by using high order approximations of the Chapman-Enskog method.

  10. Transport properties of high-temperature superconductors: Surface vs bulk effect

    International Nuclear Information System (INIS)

    Burlachkov, L.; Koshelev, A.E.; Vinokur, V.M.

    1996-01-01

    We investigate surface-related transport properties of high-temperature superconductors. We find the mean vortex velocity under applied transport current determined by the activation energies for vortex penetration and exit through the Bean-Livingston barrier. We determine the current distribution between the surfaces of superconductor and the field and current dependencies of the transport activation energies. For a three-dimensional superconductor the transport activation energy, U s 3D , is found to decrease with the external field, H, and transport current, J, as U s 3D ∝H -1/2 and U s 3D ∝J -1/2 , respectively. In the quasi-two-dimensional compounds, U s 2D decays logarithmically with field and current. The interplay between the surface and the bulk contributions to the transport properties, such as current-voltage characteristics, is discussed. copyright 1996 The American Physical Society

  11. Transport properties and specific heat of UTe and USb

    International Nuclear Information System (INIS)

    Ochiai, A.; Suzuki, Y.; Shikama, T.; Suzuki, K.; Hotta, E.; Haga, Y.; Suzuki, T.

    1994-01-01

    Uranium monochalcogenides and monopnictides crystallize in the NaCl-type structure and exhibit ferromagnetic and antiferromagnetic order, respectively. These series reveal interesting properties such as Kondo behavior of UTe. However, such interesting properties are much sample dependent. We grew single crystals of USb and UTe with high purity using the Bridgman technique, and measured transport properties and specific heat. ((orig.))

  12. Fibonacci Identities via the Determinant Sum Property

    Science.gov (United States)

    Spivey, Michael

    2006-01-01

    We use the sum property for determinants of matrices to give a three-stage proof of an identity involving Fibonacci numbers. Cassini's and d'Ocagne's Fibonacci identities are obtained at the ends of stages one and two, respectively. Catalan's Fibonacci identity is also a special case.

  13. Determination of Matrix Diffusion Properties of Granite

    International Nuclear Information System (INIS)

    Holtta, Pirkko; Siitari-Kauppi, Marja; Huittinen, Nina; Poteri, Antti

    2007-01-01

    Rock-core column experiments were introduced to estimate the diffusion and sorption properties of Kuru Grey granite used in block-scale experiments. The objective was to examine the processes causing retention in solute transport through rock fractures, especially matrix diffusion. The objective was also to estimate the importance of retention processes during transport in different scales and flow conditions. Rock-core columns were constructed from cores drilled into the fracture and were placed inside tubes to form flow channels in the 0.5 mm gap between the cores and the tube walls. Tracer experiments were performed using uranin, HTO, 36 Cl, 131 I, 22 Na and 85 Sr at flow rates of 1-50 μL.min -1 . Rock matrix was characterized using 14 C-PMMA method, scanning electron microscopy (SEM), energy dispersive X-ray micro analysis (EDX) and the B.E.T. method. Solute mass flux through a column was modelled by applying the assumption of a linear velocity profile and molecular diffusion. Coupling of the advection and diffusion processes was based on the model of generalised Taylor dispersion in the linear velocity profile. Experiments could be modelled applying a consistent parameterization and transport processes. The results provide evidence that it is possible to investigate matrix diffusion at the laboratory scale. The effects of matrix diffusion were demonstrated on the slightly-sorbing tracer breakthrough curves. Based on scoping calculations matrix diffusion begins to be clearly observable for non-sorbing tracer when the flow rate is 0.1 μL.min -1 . The experimental results presented here cannot be transferred directly to the spatial and temporal scales that prevail in an underground repository. However, the knowledge and understanding of transport and retention processes gained from this study is transferable to different scales from laboratory to in-situ conditions. (authors)

  14. Transport properties site descriptive model. Guidelines for evaluation and modelling

    International Nuclear Information System (INIS)

    Berglund, Sten; Selroos, Jan-Olof

    2004-04-01

    This report describes a strategy for the development of Transport Properties Site Descriptive Models within the SKB Site Investigation programme. Similar reports have been produced for the other disciplines in the site descriptive modelling (Geology, Hydrogeology, Hydrogeochemistry, Rock mechanics, Thermal properties, and Surface ecosystems). These reports are intended to guide the site descriptive modelling, but also to provide the authorities with an overview of modelling work that will be performed. The site descriptive modelling of transport properties is presented in this report and in the associated 'Strategy for the use of laboratory methods in the site investigations programme for the transport properties of the rock', which describes laboratory measurements and data evaluations. Specifically, the objectives of the present report are to: Present a description that gives an overview of the strategy for developing Site Descriptive Models, and which sets the transport modelling into this general context. Provide a structure for developing Transport Properties Site Descriptive Models that facilitates efficient modelling and comparisons between different sites. Provide guidelines on specific modelling issues where methodological consistency is judged to be of special importance, or where there is no general consensus on the modelling approach. The objectives of the site descriptive modelling process and the resulting Transport Properties Site Descriptive Models are to: Provide transport parameters for Safety Assessment. Describe the geoscientific basis for the transport model, including the qualitative and quantitative data that are of importance for the assessment of uncertainties and confidence in the transport description, and for the understanding of the processes at the sites. Provide transport parameters for use within other discipline-specific programmes. Contribute to the integrated evaluation of the investigated sites. The site descriptive modelling of

  15. Low-temperature localization in the transport properties of self ...

    Indian Academy of Sciences (India)

    Transport properties; scattering mechanisms; low temperature localization. 1. Introduction ... Mn4+ appears in these compounds due to the La defi- ciency, leading ... microscopy (SEM) image in figure 1 shows the size and mor- phology of the ...

  16. Density functional theory calculations of charge transport properties ...

    Indian Academy of Sciences (India)

    ZIRAN CHEN

    2017-08-04

    Aug 4, 2017 ... properties of 'plate-like' coronene topological structures ... Keywords. Organic semiconductors; density functional theory; charge carrier mobility; ambipolar transport; ..... nology Department of Sichuan Province (Grant Number.

  17. Computer program for calculating thermodynamic and transport properties of fluids

    Science.gov (United States)

    Hendricks, R. C.; Braon, A. K.; Peller, I. C.

    1975-01-01

    Computer code has been developed to provide thermodynamic and transport properties of liquid argon, carbon dioxide, carbon monoxide, fluorine, helium, methane, neon, nitrogen, oxygen, and parahydrogen. Equation of state and transport coefficients are updated and other fluids added as new material becomes available.

  18. Theoretical approaches to determining the financial provision of public transportation

    Directory of Open Access Journals (Sweden)

    O.A. Vygovska

    2018-03-01

    Full Text Available The work is devoted to the improvement of theoretical approaches in determining the financial provision of transportation by public transport at the regional level. The author summarizes the concept of the «financial security» and defines the main difference from the term «financing». The systematization of key differences in the financial provision of a transport company from other financial entities of the economic sector at the national and regional levels is carried out. The disadvantages and advantages of sources of financial support are analyzed. The purpose of the article is to study theoretical approaches in determining the financial provision of transportation by public transport at the regional level. The prospects for further scientific research are the need to identify new scientific approaches and techniques to substantiate and elaborate the concept of the «financial provision of transportation by public transport». The practical application of the research should be formed in a detailed analysis of cash flow streams in the system of «state – regional authority – economic entity». The financial provision of transportation by public transport at the regional level has not been given the sufficient attention in the scientific research within the country. This fact confirms the need for a thorough analysis of the transport industry as a whole.

  19. Molecular properties of bacterial multidrug transporters

    NARCIS (Netherlands)

    Putman, M; van Veen, HW; Konings, WN

    2000-01-01

    One of the mechanisms that bacteria utilize to evade the toxic effects of antibiotics is the active extrusion of structurally unrelated drugs from the cell. Both intrinsic and acquired multidrug transporters play an important role in antibiotic resistance of several pathogens, including Neisseria

  20. Fluid and ionic transport properties of deformed salt rock

    International Nuclear Information System (INIS)

    Peach, C.J.; Spiers, C.J.; Tankink, A.J.; Zwart, H.J.

    1987-01-01

    This is a final report on work done on the transport properties of salt during the period 1 January 1984 to 30 June 1985. This work was directed largely at the measurement of creep-induced permeability in salt rock, at determining the permeability persistence/decay characteristics of creep-dilated salt rock under hydrostatic conditions, and at ion migration/retention experiments on both deformed and undeformed material. The permeability work was carried out using both gas (argon) and brine, and involved the design and construction of corresponding permeametry systems for use in conjunction with dilatometric triaxial testing apparatus. Ion migration/retention studies involved the use of contaminant species such as Sr 2+ , Cs + , Fe 3+ and TcO 4

  1. Methylxanthines: properties and determination in various objects

    Science.gov (United States)

    Andreeva, Elena Yu; Dmitrienko, Stanislava G.; Zolotov, Yurii A.

    2012-05-01

    Published data on the properties and determination of caffeine, theophylline, theobromine and some other methylxanthines in various objects are surveyed and described systematically. Different sample preparation procedures such as liquid extraction from solid matrices and liquid-liquid, supercritical fluid and solid-phase extraction are compared. The key methods of analysis including chromatography, electrophoresis, spectrometry and electrochemical methods are discussed. Examples of methylxanthine determination in plants, food products, energy beverages, pharmaceuticals, biological fluids and natural and waste waters are given. The bibliography includes 393 references.

  2. Methylxanthines: properties and determination in various objects

    International Nuclear Information System (INIS)

    Andreeva, Elena Yu; Dmitrienko, Stanislava G; Zolotov, Yurii A

    2012-01-01

    Published data on the properties and determination of caffeine, theophylline, theobromine and some other methylxanthines in various objects are surveyed and described systematically. Different sample preparation procedures such as liquid extraction from solid matrices and liquid–liquid, supercritical fluid and solid-phase extraction are compared. The key methods of analysis including chromatography, electrophoresis, spectrometry and electrochemical methods are discussed. Examples of methylxanthine determination in plants, food products, energy beverages, pharmaceuticals, biological fluids and natural and waste waters are given. The bibliography includes 393 references.

  3. Determining Complementary Properties with Quantum Clones

    Science.gov (United States)

    Thekkadath, G. S.; Saaltink, R. Y.; Giner, L.; Lundeen, J. S.

    2017-08-01

    In a classical world, simultaneous measurements of complementary properties (e.g., position and momentum) give a system's state. In quantum mechanics, measurement-induced disturbance is largest for complementary properties and, hence, limits the precision with which such properties can be determined simultaneously. It is tempting to try to sidestep this disturbance by copying the system and measuring each complementary property on a separate copy. However, perfect copying is physically impossible in quantum mechanics. Here, we investigate using the closest quantum analog to this copying strategy, optimal cloning. The coherent portion of the generated clones' state corresponds to "twins" of the input system. Like perfect copies, both twins faithfully reproduce the properties of the input system. Unlike perfect copies, the twins are entangled. As such, a measurement on both twins is equivalent to a simultaneous measurement on the input system. For complementary observables, this joint measurement gives the system's state, just as in the classical case. We demonstrate this experimentally using polarized single photons.

  4. Calculations of the transport properties within the PAW formalism

    Energy Technology Data Exchange (ETDEWEB)

    Mazevet, S.; Torrent, M.; Recoules, V.; Jollet, F. [CEA Bruyeres-le-Chatel, DIF, 91 (France)

    2010-07-01

    We implemented the calculation of the transport properties within the PAW formalism in the ABINIT code. This feature allows the calculation of the electrical and optical properties, including the XANES spectrum, as well as the electronic contribution to the thermal conductivity. We present here the details of the implementation and results obtained for warm dense aluminum plasma. (authors)

  5. Statistical properties of transport in plasma turbulence

    DEFF Research Database (Denmark)

    Naulin, V.; Garcia, O.E.; Nielsen, A.H.

    2004-01-01

    The statistical properties of the particle flux in different types of plasma turbulence models are numerically investigated using probability distribution functions (PDFs). The physics included in the models range from two-dimensional drift wave turbulence to three-dimensional MHD dynamics...

  6. Investigation of electronic transport properties of some liquid transition metals

    Science.gov (United States)

    Patel, H. P.; Sonvane, Y. A.; Thakor, P. B.

    2018-04-01

    We investigated electronic transport properties of some liquid transition metals (V, Cr, Mn, Fe, Co and Pt) using Ziman formalism. Our parameter free model potential which is realized on ionic and atomic radius has been incorporated with the Hard Sphere Yukawa (HSY) reference system to study the electronic transport properties like electrical resistivity (ρ), thermal conductivity (σ) and thermo electrical power (Q). The screening effect on aforesaid properties has been studied by using different screening functions. The correlations of our results and others data with in addition experimental values are profoundly promising to the researchers working in this field. Also, we conclude that our newly constructed parameter free model potential is capable to explain the aforesaid electronic transport properties.

  7. Cell Membrane Transport Mechanisms: Ion Channels and Electrical Properties of Cell Membranes.

    Science.gov (United States)

    Kulbacka, Julita; Choromańska, Anna; Rossowska, Joanna; Weżgowiec, Joanna; Saczko, Jolanta; Rols, Marie-Pierre

    2017-01-01

    Cellular life strongly depends on the membrane ability to precisely control exchange of solutes between the internal and external (environmental) compartments. This barrier regulates which types of solutes can enter and leave the cell. Transmembrane transport involves complex mechanisms responsible for passive and active carriage of ions and small- and medium-size molecules. Transport mechanisms existing in the biological membranes highly determine proper cellular functions and contribute to drug transport. The present chapter deals with features and electrical properties of the cell membrane and addresses the questions how the cell membrane accomplishes transport functions and how transmembrane transport can be affected. Since dysfunctions of plasma membrane transporters very often are the cause of human diseases, we also report how specific transport mechanisms can be modulated or inhibited in order to enhance the therapeutic effect.

  8. Low temperature carrier transport properties in isotopically controlled germanium

    Energy Technology Data Exchange (ETDEWEB)

    Itoh, Kohei [Univ. of California, Berkeley, CA (United States)

    1994-12-01

    Investigations of electronic and optical properties of semiconductors often require specimens with extremely homogeneous dopant distributions and precisely controlled net-carrier concentrations and compensation ratios. The previous difficulties in fabricating such samples are overcome as reported in this thesis by growing high-purity Ge single crystals of controlled 75Ge and 70Ge isotopic compositions, and doping these crystals by the neutron transmutation doping (NTD) technique. The resulting net-impurity concentrations and the compensation ratios are precisely determined by the thermal neutron fluence and the [74Ge]/[70Ge] ratios of the starting Ge materials, respectively. This method also guarantees unprecedented doping uniformity. Using such samples the authors have conducted four types of electron (hole) transport studies probing the nature of (1) free carrier scattering by neutral impurities, (2) free carrier scattering by ionized impurities, (3) low temperature hopping conduction, and (4) free carrier transport in samples close to the metal-insulator transition.

  9. Electronic transport properties of copper and gold at atomic scale

    Energy Technology Data Exchange (ETDEWEB)

    Mohammadzadeh, Saeideh

    2010-11-23

    The factors governing electronic transport properties of copper and gold atomic-size contacts are theoretically examined in the present work. A two-terminal conductor using crystalline electrodes is adopted. The non-equilibrium Green's function combined with the density functional tight-binding method is employed via gDFTB simulation tool to calculate the transport at both equilibrium and non-equilibrium conditions. The crystalline orientation, length, and arrangement of electrodes have very weak influence on the electronic characteristics of the considered atomic wires. The wire width is found to be the most effective geometric aspect determining the number of conduction channels. The obtained conductance oscillation and linear current-voltage curves are interpreted. To analyze the conduction mechanism in detail, the transmission channels and their decomposition to the atomic orbitals are calculated in copper and gold single point contacts. The presented results offer a possible explanation for the relation between conduction and geometric structure. Furthermore, the results are in good agreement with available experimental and theoretical studies. (orig.)

  10. CET89 - CHEMICAL EQUILIBRIUM WITH TRANSPORT PROPERTIES, 1989

    Science.gov (United States)

    Mcbride, B.

    1994-01-01

    Scientists and engineers need chemical equilibrium composition data to calculate the theoretical thermodynamic properties of a chemical system. This information is essential in the design and analysis of equipment such as compressors, turbines, nozzles, engines, shock tubes, heat exchangers, and chemical processing equipment. The substantial amount of numerical computation required to obtain equilibrium compositions and transport properties for complex chemical systems led scientists at NASA's Lewis Research Center to develop CET89, a program designed to calculate the thermodynamic and transport properties of these systems. CET89 is a general program which will calculate chemical equilibrium compositions and mixture properties for any chemical system with available thermodynamic data. Generally, mixtures may include condensed and gaseous products. CET89 performs the following operations: it 1) obtains chemical equilibrium compositions for assigned thermodynamic states, 2) calculates dilute-gas transport properties of complex chemical mixtures, 3) obtains Chapman-Jouguet detonation properties for gaseous species, 4) calculates incident and reflected shock properties in terms of assigned velocities, and 5) calculates theoretical rocket performance for both equilibrium and frozen compositions during expansion. The rocket performance function allows the option of assuming either a finite area or an infinite area combustor. CET89 accommodates problems involving up to 24 reactants, 20 elements, and 600 products (400 of which may be condensed). The program includes a library of thermodynamic and transport properties in the form of least squares coefficients for possible reaction products. It includes thermodynamic data for over 1300 gaseous and condensed species and transport data for 151 gases. The subroutines UTHERM and UTRAN convert thermodynamic and transport data to unformatted form for faster processing. The program conforms to the FORTRAN 77 standard, except for

  11. The PTFE-nanocomposites mechanical properties for transport systems dynamic sealing devices elements

    Science.gov (United States)

    Mashkov, Y. K.; Egorova, V. A.; Chemisenko, O. V.; Maliy, O. V.

    2017-06-01

    The mechanical properties study results of polymer nanocomposites based on polytetrafluoroethylene with modifiers in the form of micro- and nanoscale cryptocrystalline graphite and silicon dioxide powders are determined. The nanocomposites mechanical properties determined values provide high sealing degree of transport systems dynamic sealing devices elements. When the temperature changes from cryogenic to high positive then the elastic modulus, tensile strength decrease significantly and nonlinearly, the latter limits the composite usage in heavily loaded tribosystems operating at elevated temperatures.

  12. First thermochemical property of Seaborgium determined

    Energy Technology Data Exchange (ETDEWEB)

    Tuerler, A. for a LBNL Berkeley - Univ. Bern - FLNR Dubna -GSI Darmstadt - TU Dresden - Chalmers Univ. of Technology Goeteborg - GH Kassel - ITS and LLNL Livermore - Univ. Mainz - Univ. Oslo - FZ Rossendorf - JAERI Tokai - PSI Villigen collaboration

    1997-09-01

    The chemical properties of SgO{sub 2}Cl{sub 2} (element 106 = Seaborgium, Sg) were successfully studied using the On-line Gas Chromatography Apparatus (OLGA III). After chemical separation of Sg the nuclides {sup 265}Sg and {sup 266}Sg were unambiguously identified and their half-lives were determined for the first time. The Sg nuclides were produced from the {sup 248}Cm({sup 22}Ne,4,5n){sup 266,265}Sg reaction at the GSI Darmstadt UNILAC accelerator. Simultaneously, short-lived W nuclides were produced from a small admixture of {sup 152}Gd to the Cm target material. As predicted by relativistic calculations and by extrapolations of chemical properties, it was demonstrated that Sg oxychlorides are indeed less volatile than their lighter homologue Mo- and equally or less volatile than W-oxychlorides. (author) 1 fig., 1 tab., 4 refs.

  13. Transport properties of mesoscopic graphene rings

    International Nuclear Information System (INIS)

    Xu, N.; Ding, J.W.; Wang, B.L.; Shi, D.N.; Sun, H.Q.

    2012-01-01

    Based on a recursive Green's function method, we investigate the conductance of mesoscopic graphene rings in the presence of disorder, in the limit of phase coherent transport. Two models of disorder are considered: edge disorder and surface disorder. Our simulations show that the conductance decreases exponentially with the edge disorder and the surface disorder. In the presence of flux, a clear Aharonov-Bohm conductance oscillation with the period Φ 0 (Φ 0 =h/e) is observed. The edge disorder and the surface disorder have no effect on the period of AB oscillation. The amplitudes of AB oscillations vary with gate voltage and flux, which is consistent with the previous results. Additionally, ballistic rectification and negative differential resistance are observed in I-V curves, with on/off characteristic.

  14. Simultaneous measurements of transport and poroelastic properties of rocks.

    Science.gov (United States)

    Hasanov, Azar K; Prasad, Manika; Batzle, Michael L

    2017-12-01

    A novel laboratory apparatus has been developed for simultaneous measurements of transport and poroelastic rock properties. These transport and poroelastic properties at reservoir pressure and temperature conditions are required inputs for various geoscience applications, such as reservoir simulation, basin modeling, or modeling of pore pressure generation. Traditionally, the transport and poroelastic properties are measured separately using, for example, the oscillating pore pressure method to measure hydraulic transport properties, static strain measurements for elastic properties, and pore volumometry for storage capacity. In addition to time, the separate set of measurements require either aliquot cores or subjecting the same core to multiple pressure tests. We modified the oscillating pore pressure method to build an experimental setup, capable of measuring permeability, storage capacity, and pseudo-bulk modulus of rocks simultaneously. We present here the test method, calibration measurements (capillary tube), and sample measurements (sandstone) of permeability and storage capacity at reservoir conditions. We establish that hydraulically measured storage capacities were overestimated by an order of magnitude when compared to elastically derived ones. Our concurrent measurement of elastic properties during the hydraulic experiment provides an independent constraint on storage capacity.

  15. Properties and determination of the interface stiffness

    International Nuclear Information System (INIS)

    Du Danxu; Zhang Hao; Srolovitz, David J.

    2007-01-01

    The chemical potential of a curved interface contains a term that is proportional to the product of the interface curvature and the interface stiffness. In crystalline materials, the interface stiffness is a tensor. This paper examines several basic issues related to the properties of the interface stiffness, especially the determination of the interface stiffness in particular directions (i.e. the commonly used scalar form of the interface stiffness). Of the five parameters that describe an arbitrary grain boundary, only those describing the inclination are crucial for the scalar stiffness. We also examine the influence of crystal symmetry on the stiffness tensor for both free surfaces and grain boundaries. This results in substantial simplifications for cases in which interfaces possess mirror or rotational symmetries. An efficient method for determining the interface stiffness tensor using atomistic simulations is proposed

  16. Transport properties of different BSCCO wires

    International Nuclear Information System (INIS)

    Metra, P.; Gherardi, L.; Vellego, G.; Masini, R.; Zannella, S.

    1990-01-01

    This paper reports on two classes of solver sheathed BSCCO wires and laminates were prepared from 2223 (Pb substituted) and 2212 powders, respectively, by the powder in tube method. By suitable heat treatments (sintering and annealing below the melting temperature for 2223, melting + annealing for 2212), we obtained sample wires with Tc of ∼110 and ∼85 K respectively, comparable Jc at 77 K (∼10 3 A/cm 2 ), and dramatically different transport behavior. Measurements of critical current at different temperatures and as a function of applied magnetic field were carried out, to characterize the two classes of samples, together with other electrical testing (e.g. d.c. susceptibility) and structural analyses. The granular nature of the higher Tc BSCCO, qualitatively similar to the one of YBCO, was well documented. The melt-processed material showed no apparent granularity, but very strong field dependence of Jc at high temperature. The effect of mechanical deformation on Jc was also investigated by bending samples on different diameters before and after heat treatment. Wires and tapes with 2212 were found to be bendable on very small diameters before treatment, but also the 2223 filled samples were shown to accept significant deformation before sintering

  17. Experimental Determination of Hydraulic Properties of Unsaturated Calcarenites

    Science.gov (United States)

    Turturro, Antonietta Celeste; Andriani, Gioacchino Francesco; Clementina Caputo, Maria; Maggi, Sabino

    2013-04-01

    Understanding hydraulic properties is essential in the modeling of flow and solute transport through the vadose zone, to which problems of soil and groundwater pollution are related. The vadose zone, in fact, is of great importance in controlling groundwater recharge and transport of contaminants into and through the subsoil. The aim of this work is to determine experimentally in laboratory the hydraulic properties of unsaturated calcarenites using an approach including petrophysical determinations and methods for measuring water retention. For this purpose, samples of calcarenites belonging to the Calcarenite di Gravina Fm.(Pliocene-early Pleistocene), came from two different quarry districts located in Southern Italy (Canosa di Puglia and Massafra), were utilized. The water retention function, θ(h), which binds the water content, θ, to water potential, h, was determined in the laboratory by means two different experimental methods: the WP4-T psychrometer and the suction table. At last, a simple mathematical equation represented by van Genuchten's model is fitted to the experimental data and the unknown empirical parameters of this model are determined. Textural analysis on thin sections using optical petrographic microscopy and evaluation of total and effective porosity by means of standard geotechnical laboratory tests, mercury intrusion porosimetry and image analysis were also performed. In particular, a comparison between mercury porosimetry data and results of photomicrograph computer analysis through the methods of quantitative stereology was employed for providing pore size distributions. The results of this study identify the relationship between the hydraulic behavior, described by the water retention function, and pore size distribution for the calcarenites that are not easy to hydraulically characterize. This relationship could represent a useful tool to infer the unsaturated hydraulic properties of calcarenites and in general this approach could be

  18. Industrial Requirements for Thermodynamics and Transport Properties

    DEFF Research Database (Denmark)

    Hendriks, Eric; Kontogeorgis, Georgios; Dohrn, Ralf

    2010-01-01

    the direction for future development. The use of new methods, such as SAFT, is increasing, but they are not yet in position to replace traditional methods such as cubic equations of state (especially in oil and gas industry) and the UNIFAC group contribution approach. A common problem with novel methods is lack...... addressed to or written by industrial colleagues, are discussed initially. This provides the context of the survey and material with which the results of the survey can be compared. The results of the survey have been divided into the themes: data, models, systems, properties, education, and collaboration...... of standardization, reference data, and correct and transparent implementations, especially in commercially available simulation programs. The survey indicates a great variety of systems where further work is required. For instance, for electrolyte systems better models are needed, capable of describing all types...

  19. Carrier mediated transport through supported liquid membranes; determination of transport parameters from a single transport experiment

    NARCIS (Netherlands)

    Chrisstoffels, L.A.J.; Struijk, Wilhelmina; de Jong, Feike; Reinhoudt, David

    1996-01-01

    This paper describes a time-dependent transport model for carrier assisted cation transport through supported liquid membranes. The model describes the flux of salt as a function of time and two parameters viz. the diffusion coefficient of the cation complex (D), and the extraction constant (Kex).

  20. Structure and transport properties of nanostructured materials.

    Science.gov (United States)

    Sonwane, C G; Li, Q

    2005-03-31

    In the present manuscript, we have presented the simulation of nanoporous aluminum oxide using a molecular-dynamics approach with recently developed dynamic charge transfer potential using serial/parallel programming techniques (Streitz and Mintmire Phys. Rev. B 1994, 50, 11996). The structures resembling recently invented ordered nanoporous crystalline material, MCM-41/SBA-15 (Kresge et al. Nature 1992, 359, 710), and inverted porous solids (hollow nanospheres) with up to 10 000 atoms were fabricated and studied in the present work. These materials have been used for separation of gases and catalysis. On several occasions including the design of the reactor, the knowledge of surface diffusion is necessary. In the present work, a new method for estimating surface transport of gases based on a hybrid Monte Carlo method with unbiased random walk of tracer atom on the pore surface has been introduced. The nonoverlapping packings used in the present work were fabricated using an algorithm of very slowly settling rigid spheres from a dilute suspension into a randomly packed bed. The algorithm was modified to obtain unimodal, homogeneous Gaussian and segregated bimodal porous solids. The porosity of these solids was varied by densification using an arbitrary function or by coarsening from a highly densified pellet. The surface tortuosity for the densified solids indicated an inverted bell shape curve consistent with the fact that at very high porosities there is a reduction in the connectivity while at low porosities the pores become inaccessible or dead-end. The first passage time distribution approach was found to be more efficient in terms of computation time (fewer tracer atoms needed for the linearity of Einstein's plot). Results by hybrid discrete-continuum simulations were close to the discrete simulations for a boundary layer thickness of 5lambda.

  1. Transport properties of supercooled confined water

    International Nuclear Information System (INIS)

    Mallamace, F.; Baglioni, P.; Corsaro, C.; Spooren, J.; Stanley, H.E.; Chen, S.-H.

    2011-01-01

    We present an overview of recent experiments performed on water in the deeply supercooled region, a temperature region of fundamental importance in the science of water. We examine data generated by nuclear magnetic resonance, quasi-elastic neutron scattering, Fourier-transform infrared spectroscopy, and Raman spectroscopy, and study water confined in nanometer-scale environments. When contained within small pores, water does not crystallize and can be supercooled well below its homogeneous nucleation temperature T H. On this basis, it is possible to carry out a careful analysis of the well-known thermodynamic anomalies of water. Studying the temperature and pressure dependencies of water dynamics, we show that the liquid-liquid phase transition (LLPT) hypothesis represents a reliable model for describing liquid water. In this model, liquid water is a mixture of two different local structures: a low density liquid (LDL) and a high-density liquid (HDL). The LLPT line terminates at a low-T liquid-liquid critical point. We discuss the following experimental findings: 1.) the crossover from non-Arrhenius behavior at high T to Arrhenius behavior at low T in transport parameters; 2.) the breakdown of the Stokes-Einstein relation; 3.) the existence of a Widom line, which is the locus of points corresponding to a maximum correlation length in the P-T phase diagram and which ends in the liquid-liquid critical point; 4.) the direct observation of the LDL phase; and 5.) the minimum in the density at approximately 70 K below the temperature of the density maximum. In our opinion these results strongly support the LLPT hypothesis. All of the basic science and technology community should be impressed by the fact that, although the few ideas (apparently elementary) developed concerning water approximately 27 centuries ago have changed very little up to now, because of the current expansion in our knowledge in this area, they can begin to change in the near future.

  2. Transport properties of a discrete helical electrostatic quadrupole

    International Nuclear Information System (INIS)

    Meitzler, C.R.; Antes, K.; Datte, P.; Huson, F.R.; Xiu, L.

    1991-01-01

    The helical electrostatic quadrupole (HESQ) lens has been proposed as a low energy beam transport system which permits intense H - beams to be focused into an RFQ without seriously increasing the beam's emittance. A stepwise continuous HESQ lens has been constructed, and preliminary tests have shown that the structure does provide focusing. In order to understand the transport properties of this device, further detailed studies have been performed. Emittances were measured 3.5 cm from the end of the HESQ at two different voltages on the HESQ electrodes. A comparison of these experimental results with a linear model of the HESQ beam transport is made. 4 refs., 5 figs

  3. Investigation of transport properties of colossal magnetoresistive materials

    International Nuclear Information System (INIS)

    Kaurav, Netram

    2006-01-01

    The transport properties, i.e. resistivity, heat capacity, thermal conductivity and optical conductivity have been theoretically analysed for colossal magnetoresistive materials within the framework of double exchange mechanism. Following an effective interaction potential, we deduce acoustic (optical) phonon modes, coupling strength for electron-phonon and phonon-impurities, the phonon (magnon) scattering rate and constants characterise the scattering of charge and heat carriers with various disorders in the crystal. The theoretical models have been developed to account the anomalies observed in the transport phenomenon. It is noticed that electron-electron, electron-phonon and electron-magnon interactions are essential in discussing the transport behaviour of doped magnetites. (author)

  4. Elastic and transport properties of topological semimetal ZrTe

    Science.gov (United States)

    Guo, San-Dong; Wang, Yue-Hua; Lu, Wan-Li

    2017-11-01

    Topological semimetals may have substantial applications in electronics, spintronics, and quantum computation. Recently, ZrTe was predicted as a new type of topological semimetal due to the coexistence of Weyl fermions and massless triply degenerate nodal points. In this work, the elastic and transport properties of ZrTe are investigated by combining the first-principles calculations and semiclassical Boltzmann transport theory. Calculated elastic constants prove the mechanical stability of ZrTe, and the bulk modulus, shear modulus, Young’s modulus, and Poisson’s ratio also are calculated. It is found that spin-orbit coupling (SOC) has slightly enhanced effects on the Seebeck coefficient, which along the a(b) and c directions for pristine ZrTe at 300 K is 46.26 μVK-1 and 80.20 μVK-1, respectively. By comparing the experimental electrical conductivity of ZrTe (300 K) with the calculated value, the scattering time is determined as 1.59 × 10-14 s. The predicted room-temperature electronic thermal conductivity along the a(b) and c directions is 2.37 {{Wm}}-1{{{K}}}-1 and 2.90 {{Wm}}-1{{{K}}}-1, respectively. The room-temperature lattice thermal conductivity is predicted as 17.56 {{Wm}}-1{{{K}}}-1 and 43.08 {{Wm}}-1{{{K}}}-1 along the a(b) and c directions, showing very strong anisotropy. Calculated results show that isotope scattering produces an observable effect on lattice thermal conductivity. To observably reduce lattice thermal conductivity by nanostructures, the characteristic length should be smaller than 70 nm, based on cumulative lattice thermal conductivity with respect to the phonon mean free path (MFP) at 300 K. It is noted that the average room-temperature lattice thermal conductivity of ZrTe is slightly higher than that of isostructural MoP, which is due to larger phonon lifetimes and smaller Grüneisen parameters. Finally, the total thermal conductivity as a function of temperature is predicted for pristine ZrTe. Our works provide valuable

  5. Prediction of transport and other physical properties of fluids

    CERN Document Server

    Bretsznajder, S

    1971-01-01

    Prediction of Transport and Other Physical Properties of Fluids reviews general methods for predicting the transport and other physical properties of fluids such as gases and liquids. Topics covered range from the theory of corresponding states and methods for estimating the surface tension of liquids to some basic concepts of the kinetic theory of gases. Methods of estimating liquid viscosity based on the principle of additivity are also described. This volume is comprised of eight chapters and opens by presenting basic information on gases and liquids as well as intermolecular forces and con

  6. Impact of carbonation on water transport properties of cementitious materials

    International Nuclear Information System (INIS)

    Auroy, Martin

    2014-01-01

    Carbonation is a very well-known cementitious materials pathology. It is the major cause of reinforced concrete structures degradation. It leads to rebar corrosion and consequent concrete cover cracking. In the framework of radioactive waste management, cement-based materials used as building materials for structures or containers would be simultaneously submitted to drying and atmospheric carbonation. Although scientific literature regarding carbonating is vast, it is clearly lacking information about the influence of carbonation on water transport properties. This work then aimed at studying and understanding the change in water transport properties induced by carbonation. Simultaneously, the representativeness of accelerated carbonation (in the laboratory) was also studied. (author) [fr

  7. Identifying the molecular functions of electron transport proteins using radial basis function networks and biochemical properties.

    Science.gov (United States)

    Le, Nguyen-Quoc-Khanh; Nguyen, Trinh-Trung-Duong; Ou, Yu-Yen

    2017-05-01

    The electron transport proteins have an important role in storing and transferring electrons in cellular respiration, which is the most proficient process through which cells gather energy from consumed food. According to the molecular functions, the electron transport chain components could be formed with five complexes with several different electron carriers and functions. Therefore, identifying the molecular functions in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. This work includes two phases for discriminating electron transport proteins from transport proteins and classifying categories of five complexes in electron transport proteins. In the first phase, the performances from PSSM with AAIndex feature set were successful in identifying electron transport proteins in transport proteins with achieved sensitivity of 73.2%, specificity of 94.1%, and accuracy of 91.3%, with MCC of 0.64 for independent data set. With the second phase, our method can approach a precise model for identifying of five complexes with different molecular functions in electron transport proteins. The PSSM with AAIndex properties in five complexes achieved MCC of 0.51, 0.47, 0.42, 0.74, and 1.00 for independent data set, respectively. We suggest that our study could be a power model for determining new proteins that belongs into which molecular function of electron transport proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei; Gao, Nan; Lu, Congyan; Wang, Wei; Ji, Zhuoyu; Bi, Chong; Han, Zhiheng; Lu, Nianduan; Yang, Guanhua; Li, Yuan; Liu, Qi; Li, Ling; Liu, Ming

    2018-01-01

    , the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I

  9. Electrical Transport Properties of Polycrystalline Monolayer Molybdenum Disulfide

    Science.gov (United States)

    2014-07-14

    Lou, Sina Najmaei, Matin Amani, Matthew L. Chin, Zheng Se. TASK NUMBER Liu Sf. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAMES AND ADDRESSES 8...Transport Properties of Polycrystalline Monolayer Molybdenum Disulfide Sina Najmaei,t.§ Matin Ama ni,M Matthew L. Chin,* Zhe ng liu/ ·"·v: A. Gle n

  10. Oxygen transport properties estimation by DSMC-CT simulations

    Energy Technology Data Exchange (ETDEWEB)

    Bruno, Domenico [Istituto di Metodologie Inorganiche e dei Plasmi, Consiglio Nazionale delle Ricerche - Via G. Amendola, 122 - 70125 Bari (Italy); Frezzotti, Aldo; Ghiroldi, Gian Pietro [Dipartimento di Scienze e Tecnologie Aerospaziali, Politecnico di Milano - Via La Masa, 34 - 20156 Milano (Italy)

    2014-12-09

    Coupling DSMC simulations with classical trajectories calculations is emerging as a powerful tool to improve predictive capabilities of computational rarefied gas dynamics. The considerable increase of computational effort outlined in the early application of the method (Koura,1997) can be compensated by running simulations on massively parallel computers. In particular, GPU acceleration has been found quite effective in reducing computing time (Ferrigni,2012; Norman et al.,2013) of DSMC-CT simulations. The aim of the present work is to study rarefied Oxygen flows by modeling binary collisions through an accurate potential energy surface, obtained by molecular beams scattering (Aquilanti, et al.,1999). The accuracy of the method is assessed by calculating molecular Oxygen shear viscosity and heat conductivity following three different DSMC-CT simulation methods. In the first one, transport properties are obtained from DSMC-CT simulations of spontaneous fluctuation of an equilibrium state (Bruno et al, Phys. Fluids, 23, 093104, 2011). In the second method, the collision trajectory calculation is incorporated in a Monte Carlo integration procedure to evaluate the Taxman’s expressions for the transport properties of polyatomic gases (Taxman,1959). In the third, non-equilibrium zero and one-dimensional rarefied gas dynamic simulations are adopted and the transport properties are computed from the non-equilibrium fluxes of momentum and energy. The three methods provide close values of the transport properties, their estimated statistical error not exceeding 3%. The experimental values are slightly underestimated, the percentage deviation being, again, few percent.

  11. Synthesis, structure, thermal, transport and magnetic properties of VN ceramics

    Czech Academy of Sciences Publication Activity Database

    Huber, Š.; Jankovský, O.; Sedmidubský, D.; Luxa, J.; Klimová, K.; Hejtmánek, Jiří; Sofer, Z.

    2016-01-01

    Roč. 42, č. 16 (2016), s. 18779-18784 ISSN 0272-8842 R&D Projects: GA ČR GA13-20507S Institutional support: RVO:68378271 Keywords : vanadium mononitride * phase transition * electronic structure * heat capacity * transport properties Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.986, year: 2016

  12. Transport and Phase Equilibria Properties for Steam Flooding of Heavy Oils

    Energy Technology Data Exchange (ETDEWEB)

    Gabitto, Jorge; Barrufet, Maria

    2002-11-20

    The objectives of this research included experimental determination and rigorous modeling and computation of phase equilibrium diagrams, volumetric, and transport properties of hydrocarbon/CO2/water mixtures at pressures and temperatures typical of steam injection processes for thermal recovery of heavy oils.

  13. Measurement of gas transport properties for chemical vapor infiltration

    Energy Technology Data Exchange (ETDEWEB)

    Starr, T.L.; Hablutzel, N. [Georgia Inst. of Tech., Atlanta, GA (United States). School of Materials Science and Engineering

    1996-12-01

    In the chemical vapor infiltration (CVI) process for fabricating ceramic matrix composites (CMCs), transport of gas phase reactant into the fiber preform is a critical step. The transport can be driven by pressure or by concentration. This report describes methods for measuring this for CVI preforms and partially infiltrated composites. Results are presented for Nicalon fiber cloth layup preforms and composites, Nextel fiber braid preforms and composites, and a Nicalon fiber 3-D weave composite. The results are consistent with a percolating network model for gas transport in CVI preforms and composites. This model predicts inherent variability in local pore characteristics and transport properties, and therefore, in local densification during processing; this may lead to production of gastight composites.

  14. Structural properties of the Chinese air transportation multilayer network

    International Nuclear Information System (INIS)

    Hong, Chen; Zhang, Jun; Cao, Xian-Bin; Du, Wen-Bo

    2016-01-01

    Highlights: • We investigate the structural properties of the Chinese air transportation multilayer network (ATMN). • We compare two main types of layers corresponding to major and low-cost airlines. • It is found that small-world property and rich-club effect of the Chinese ATMN are mainly caused by major airlines. - Abstract: Recently multilayer networks are attracting great attention because the properties of many real-world systems cannot be well understood without considering their different layers. In this paper, we investigate the structural properties of the Chinese air transportation multilayer network (ATMN) by progressively merging layers together, where each commercial airline (company) defines a layer. The results show that the high clustering coefficient, short characteristic path length and large collection of reachable destinations of the Chinese ATMN can only emerge when several layers are merged together. Moreover, we compare two main types of layers corresponding to major and low-cost airlines. It is found that the small-world property and the rich-club effect of the Chinese ATMN are mainly caused by those layers corresponding to major airlines. Our work will highlight a better understanding of the Chinese air transportation network.

  15. Wentzel-Bardeen singularity in coupled Luttinger liquids: Transport properties

    International Nuclear Information System (INIS)

    Martin, T.

    1994-01-01

    The recent progress on 1 D interacting electrons systems and their applications to study the transport properties of quasi one dimensional wires is reviewed. We focus on strongly correlated elections coupled to low energy acoustic phonons in one dimension. The exponents of various response functions are calculated, and their striking sensitivity to the Wentzel-Bardeen singularity is discussed. For the Hubbard model coupled to phonons the equivalent of a phase diagram is established. By increasing the filling factor towards half filling the WB singularity is approached. This in turn suppresses antiferromagnetic fluctuations and drives the system towards the superconducting regime, via a new intermediate (metallic) phase. The implications of this phenomenon on the transport properties of an ideal wire as well as the properties of a wire with weak or strong scattering are analyzed in a perturbative renormalization group calculation. This allows to recover the three regimes predicted from the divergence criteria of the response functions

  16. Structural and transport properties of Sn-Mg alloys

    International Nuclear Information System (INIS)

    Meydaneri, F.; Saatci, E.; Oezdemir, M.; Ari, M.; Durmus, S.

    2010-01-01

    The structural and temperature dependence transport of Sn-Mg alloys have been investigated for five different samples (Pure Sn, Sn-1.0 wt % Mg , Sn-2.0 wt % Mg , Sn-6.0 wt.% Mg and Pure Mg). Scanning Electron Microscopy (SEM), x-ray diffraction (XRD) and Energy Dispersive x-ray Analysis (EDX) measurements were carried out in order to clarify the structural properties of the samples. It has been found that, the samples have tetragonal crystal symmetry except the pure Mg which has hexagonal crystal symmetry. The cell parameters decrease slightly with addition of Mg element. The SEM micrographs of the samples show that, the samples have smooth surfaces with clear grain boundary. There is no crack, porosity or defects on the surfaces. The electrical resistivity of the samples increases almost linearly with the increasing temperature, which were measured by four-point probe technique. The thermal conductivity values are in between 0.60-1.00 W/Km, which are decrease slightly with temperature and increase with composition of Mg. The thermal conductivity values of the alloys are in between the values of the pure samples. Thermal conductivity results of the alloys have been compared with available other studies and a good agreement has been seen between the results. In addition, the temperature coefficients of electrical resistivity and thermal conductivity have been determined, which are independent with the compositions of alloying elements

  17. Interfacial and transport properties of nanoconstrained inorganic and organic materials

    Science.gov (United States)

    Kocherlakota, Lakshmi Suhasini

    Nanoscale constraints impact the material properties of both organic and inorganic systems. The systems specifically studied here are (i) nanoconstrained polymeric systems, poly(l-trimethylsilyl-1-propyne) (PTMSP) and poly(ethylene oxide) (PEO) relevant to gas separation membranes (ii) Zwitterionic polymers poly(sulfobetaine methacrylate)(pSBMA), poly(carboxybetaine acrylamide) (pCBAA), and poly(oligo(ethylene glycol) methyl methacrylate) (PEGMA) brushes critical for reducing bio-fouling (iii) Surface properties of N-layer graphene sheets. Interfacial constraints in ultrathin poly(l-trimethylsilyl-1-propyne) (PTMSP) membranes yielded gas permeabilities and CO2/helium selectivities that exceed bulk PTMSP membrane transport properties by up to three-fold for membranes of submicrometer thickness. Indicative of a free volume increase, a molecular energetic mobility analysis (involving intrinsic friction analysis) revealed enhanced methyl side group mobilities in thin PTMSP membranes with maximum permeation, compared to bulk films. Aging studies conducted over the timescales relevant to the conducted experiments signify that the free volume states in the thin film membranes are highly unstable in the presence of sorbing gases such as CO2. To maintain this high free volume configuration of polymer while improving the temporal stability an "inverse" architecture to conventional polymer nanocomposites was investigated, in which the polymer phase of PTMSP and PEO were interfacially and dimensionally constrained in nanoporous anodic aluminum oxide (AAO) membranes. While with this architecture the benefits of nanocomposite and ultrathin film membranes of PTMSP could be reproduced and improved upon, also the temporal stability could be enhanced substantially. The PEO-AAO nanocomposite membranes also revealed improved gas selectivity properties of CO2 over helium. In the thermal transition studies of zwitterionic pSBMA brushes a reversible critical transition temperature of 60

  18. Charge carrier transport properties in layer structured hexagonal boron nitride

    Directory of Open Access Journals (Sweden)

    T. C. Doan

    2014-10-01

    Full Text Available Due to its large in-plane thermal conductivity, high temperature and chemical stability, large energy band gap (˜ 6.4 eV, hexagonal boron nitride (hBN has emerged as an important material for applications in deep ultraviolet photonic devices. Among the members of the III-nitride material system, hBN is the least studied and understood. The study of the electrical transport properties of hBN is of utmost importance with a view to realizing practical device applications. Wafer-scale hBN epilayers have been successfully synthesized by metal organic chemical deposition and their electrical transport properties have been probed by variable temperature Hall effect measurements. The results demonstrate that undoped hBN is a semiconductor exhibiting weak p-type at high temperatures (> 700 °K. The measured acceptor energy level is about 0.68 eV above the valence band. In contrast to the electrical transport properties of traditional III-nitride wide bandgap semiconductors, the temperature dependence of the hole mobility in hBN can be described by the form of μ ∝ (T/T0−α with α = 3.02, satisfying the two-dimensional (2D carrier transport limit dominated by the polar optical phonon scattering. This behavior is a direct consequence of the fact that hBN is a layer structured material. The optical phonon energy deduced from the temperature dependence of the hole mobility is ħω = 192 meV (or 1546 cm-1, which is consistent with values previously obtained using other techniques. The present results extend our understanding of the charge carrier transport properties beyond the traditional III-nitride semiconductors.

  19. Transport properties of electrons in fractal magnetic-barrier structures

    Science.gov (United States)

    Sun, Lifeng; Fang, Chao; Guo, Yong

    2010-09-01

    Quantum transport properties in fractal magnetically modulated structures are studied by the transfer-matrix method. It is found that the transmission spectra depend sensitively not only on the incident energy and the direction of the wave vector but also on the stage of the fractal structures. Resonance splitting, enhancement, and position shift of the resonance peaks under different magnetic modulation are observed at four different fractal stages, and the relationship between the conductance in the fractal structure and magnetic modulation is also revealed. The results indicate the spectra of the transmission can be considered as fingerprints for the fractal structures, which show the subtle correspondence between magnetic structures and transport behaviors.

  20. Fabrication and Transport Properties of Manganite-Polyacrylamide-Based Composites

    Directory of Open Access Journals (Sweden)

    Viorel Sandu

    2009-01-01

    Full Text Available We present the fabrication and transport properties of a series of composites made of La2/3Sr1/3MnO3 and acrylamide-based copolymers. The most important result is the very narrow transition, of only 27 K, displayed by the peak that appears around the metal-insulator transition of the composites made with poly(acrylamide-vinylacetate. Although the amount of polymer is rather low, different copolymers change drastically the electric transport characteristics.

  1. Determination of chemical solute transport parameters effecting radiostrontium interbed sediments

    International Nuclear Information System (INIS)

    Hemming, C.; Bunde, R.L.; Rosentreter, J.J.

    1993-01-01

    The extent to which radionuclides migrate in an aquifer system is a function of various physical, chemical, and biological processes. A measure of this migration rate is of primary concern when locating suitable storage sites for such species. Parameters including water-rock interactions, infiltration rates, chemical phase modification, and biochemical reactions all affect solute transport. While these different types of chemical reactions can influence solute transport in subsurface waters, distribution coefficients (Kd) can be send to effectively summarize the net chemical factors which dictate transport efficiency. This coefficient describes the partitioning of the solute between the solution and solid phase. Methodology used in determining and interpreting the distribution coefficient for radiostrontium in well characterized sediments will be presented

  2. Anisotropic bias dependent transport property of defective phosphorene layer

    Science.gov (United States)

    Umar Farooq, M.; Hashmi, Arqum; Hong, Jisang

    2015-01-01

    Phosphorene is receiving great research interests because of its peculiar physical properties. Nonetheless, no systematic studies on the transport properties modified due to defects have been performed. Here, we present the electronic band structure, defect formation energy and bias dependent transport property of various defective systems. We found that the defect formation energy is much less than that in graphene. The defect configuration strongly affects the electronic structure. The band gap vanishes in single vacancy layers, but the band gap reappears in divacancy layers. Interestingly, a single vacancy defect behaves like a p-type impurity for transport property. Unlike the common belief, we observe that the vacancy defect can contribute to greatly increasing the current. Along the zigzag direction, the current in the most stable single vacancy structure was significantly increased as compared with that found in the pristine layer. In addition, the current along the armchair direction was always greater than along the zigzag direction and we observed a strong anisotropic current ratio of armchair to zigzag direction. PMID:26198318

  3. Coupled light transport-heat diffusion model for laser dosimetry with dynamic optical properties

    International Nuclear Information System (INIS)

    London, R.A.; Glinsky, M.E.; Zimmerman, G.B.; Eder, D.C.; Jacques, S.L.

    1995-01-01

    The effect of dynamic optical properties on the spatial distribution of light in laser therapy is studied via numerical simulations. A two-dimensional, time dependent computer program called LATIS is used. Laser light transport is simulated with a Monte Carlo technique including anisotropic scattering and absorption. Thermal heat transport is calculated with a finite difference algorithm. Material properties are specified on a 2-D mesh and can be arbitrary functions of space and time. Arrhenius rate equations are solved for tissue damage caused by elevated temperatures. Optical properties are functions of tissue damage, as determined by previous measurements. Results are presented for the time variation of the light distribution and damage within the tissue as the optical properties of the tissue are altered

  4. Transport properties in GaTe under hydrostatic pressure

    International Nuclear Information System (INIS)

    Gouskov, L.; Carvalho, M.

    1980-01-01

    First results of the resistivity rho(perpendicular) and rho(parallel)(perpendicular and parallel to the normal to the cleavage plane) under hydrostatic pressure (1 bar <= P <= 3 kbar) on GaTe grown by the Bridgman method, are given and discussed. The analysis of electrical transport properties of GaTe under pressure, indicates a complex nature of the acceptor level in this material. The activation energy Esub(a) has a negative pressure coefficient which is sample dependent. The comparison of the variations of rho(parallel) and rho(perpendicular) versus pressure shows that the activation energy E of the rho(parallel)/rho(perpendicular) ratio has also a negative pressure coefficient which can be justified in the frame of a one-dimensional disorder model proposed by Maschke and Schmid, in order to explain the transport properties in the direction of the normal to the cleavage plane. (author)

  5. Relaxation and transport properties of liquid n-triacontane

    International Nuclear Information System (INIS)

    Kondratyuk, N D; Lankin, A V; Norman, G E; Stegailov, V V

    2015-01-01

    Molecular modelling is used to calculate transport properties and to study relaxation of liquid n-triacontane (C 30 H 62 ). The problem is important in connection with the behavior of liquid isolators in a pre-breakdown state. Two all-atom models and a united-atom model are used. Shear viscosity is calculated using the Green-Kubo formula. The force fields are compared with each other using the following criteria: the required time for one molecular dynamics step, the compliance of the main physical and transport properties with experimental values. The problem of the system equilibration is considered. The united-atom potential is used to model the n-triacontane liquid with an initial directional orientation. The time of relaxation to the disordered state, when all molecules orientations are randomized, are obtained. The influence of the molecules orientations on the shear viscosity value and the shear viscosity relaxation are treated. (paper)

  6. Transport Properties Of Van Der Waals Hybrid Heterostructures.

    Science.gov (United States)

    Pacheco, M.; Orellana, P. A.; Felix, A. B.; Latge, A.

    Here we study transport properties of van der Waals heterostructures composed of carbon nanotubes adsorbed on nanoribbons of distinct 2D materials. Calculations of the electronic density of states and conductance of the hybrid systems are obtained in single band tight-binding approximation in the Green function formalism by adopting real-space renormalization schemes. We show that an analytical approach may be derived when both systems are formed by the same type of atoms. In the coupled structures the different electronic paths along the ribbons and finite nanotubes lead to quantum interference effects which are reflected as Fano antiresonances in the conductance. The electronic and transport properties of these materials are modulated by changing geometrical and structural parameters, such as the nanotube diameter and the widths and edge type of the ribbons. FONDECYT 1151316-1140571.

  7. Ab Initio Calculations of Transport Properties of Vanadium Oxides

    Science.gov (United States)

    Lamsal, Chiranjivi; Ravindra, N. M.

    2018-04-01

    The temperature-dependent transport properties of vanadium oxides have been studied near the Fermi energy using the Kohn-Sham band structure approach combined with Boltzmann transport equations. V2O5 exhibits significant thermoelectric properties, which can be attributed to its layered structure and stability. Highly anisotropic electrical conduction in V2O5 is clearly manifested in the calculations. Due to specific details of the band structure and anisotropic electron-phonon interactions, maxima and crossovers are also seen in the temperature-dependent Seebeck coefficient of V2O5. During the phase transition of VO2, the Seebeck coefficient changes by 18.9 µV/K, which is close to (within 10% of) the observed discontinuity of 17.3 µV/K.

  8. Transport properties of a ladder with two random dimer chains

    International Nuclear Information System (INIS)

    Hu Dong-Sheng; Zhu Chen-Ping; Zhang Yong-Mei

    2011-01-01

    We investigate the transport properties of a ladder with two random dimer (RD) chains. It is found that there are two extended states in the ladder with identical RD chains and a critical state regarded as an extended state in the ladder with pairing RD chains. Such a critical state is caused by the chiral symmetry. The ladder with identical RD chains can be decoupled into two isolated RD chains and the ladder with pairing RD chains can not. The analytic expressions of the extended states are presented for the ladder with identical RD chains. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  9. Transport Properties of the Metallic State of TMTSF-DMTCNQ

    DEFF Research Database (Denmark)

    Bechgaard, Klaus; Andersen, Jan Rud; Andrieux, A.

    1979-01-01

    The authors report the transport properties (longitudinal and transverse conductivity, magnetoresistance and thermopower) of TMTSF-DMTCNQ for pressures up to 13 kbar and temperatures down to 1.2K together with the phase diagram which results from these measurements. The most striking results...... at any temperature (σ∥≳105 (Ωcm)-1) and an enormous magnetoresistance Δρ/ρ≈15) is found for a field of 75 kOe perpendicular to the conducting chains...

  10. Assessment the effect of homogenized soil on soil hydraulic properties and soil water transport

    Science.gov (United States)

    Mohawesh, O.; Janssen, M.; Maaitah, O.; Lennartz, B.

    2017-09-01

    Soil hydraulic properties play a crucial role in simulating water flow and contaminant transport. Soil hydraulic properties are commonly measured using homogenized soil samples. However, soil structure has a significant effect on the soil ability to retain and to conduct water, particularly in aggregated soils. In order to determine the effect of soil homogenization on soil hydraulic properties and soil water transport, undisturbed soil samples were carefully collected. Five different soil structures were identified: Angular-blocky, Crumble, Angular-blocky (different soil texture), Granular, and subangular-blocky. The soil hydraulic properties were determined for undisturbed and homogenized soil samples for each soil structure. The soil hydraulic properties were used to model soil water transport using HYDRUS-1D.The homogenized soil samples showed a significant increase in wide pores (wCP) and a decrease in narrow pores (nCP). The wCP increased by 95.6, 141.2, 391.6, 3.9, 261.3%, and nCP decreased by 69.5, 10.5, 33.8, 72.7, and 39.3% for homogenized soil samples compared to undisturbed soil samples. The soil water retention curves exhibited a significant decrease in water holding capacity for homogenized soil samples compared with the undisturbed soil samples. The homogenized soil samples showed also a decrease in soil hydraulic conductivity. The simulated results showed that water movement and distribution were affected by soil homogenizing. Moreover, soil homogenizing affected soil hydraulic properties and soil water transport. However, field studies are being needed to find the effect of these differences on water, chemical, and pollutant transport under several scenarios.

  11. Anomalous solute transport in saturated porous media: Relating transport model parameters to electrical and nuclear magnetic resonance properties

    Science.gov (United States)

    Swanson, Ryan D; Binley, Andrew; Keating, Kristina; France, Samantha; Osterman, Gordon; Day-Lewis, Frederick D.; Singha, Kamini

    2015-01-01

    The advection-dispersion equation (ADE) fails to describe commonly observed non-Fickian solute transport in saturated porous media, necessitating the use of other models such as the dual-domain mass-transfer (DDMT) model. DDMT model parameters are commonly calibrated via curve fitting, providing little insight into the relation between effective parameters and physical properties of the medium. There is a clear need for material characterization techniques that can provide insight into the geometry and connectedness of pore spaces related to transport model parameters. Here, we consider proton nuclear magnetic resonance (NMR), direct-current (DC) resistivity, and complex conductivity (CC) measurements for this purpose, and assess these methods using glass beads as a control and two different samples of the zeolite clinoptilolite, a material that demonstrates non-Fickian transport due to intragranular porosity. We estimate DDMT parameters via calibration of a transport model to column-scale solute tracer tests, and compare NMR, DC resistivity, CC results, which reveal that grain size alone does not control transport properties and measured geophysical parameters; rather, volume and arrangement of the pore space play important roles. NMR cannot provide estimates of more-mobile and less-mobile pore volumes in the absence of tracer tests because these estimates depend critically on the selection of a material-dependent and flow-dependent cutoff time. Increased electrical connectedness from DC resistivity measurements are associated with greater mobile pore space determined from transport model calibration. CC was hypothesized to be related to length scales of mass transfer, but the CC response is unrelated to DDMT.

  12. Thermal Transport Properties of Dry Spun Carbon Nanotube Sheets

    Directory of Open Access Journals (Sweden)

    Heath E. Misak

    2016-01-01

    Full Text Available The thermal properties of carbon nanotube- (CNT- sheet were explored and compared to copper in this study. The CNT-sheet was made from dry spinning CNTs into a nonwoven sheet. This nonwoven CNT-sheet has anisotropic properties in in-plane and out-of-plane directions. The in-plane direction has much higher thermal conductivity than the out-of-plane direction. The in-plane thermal conductivity was found by thermal flash analysis, and the out-of-plane thermal conductivity was found by a hot disk method. The thermal irradiative properties were examined and compared to thermal transport theory. The CNT-sheet was heated in the vacuum and the temperature was measured with an IR Camera. The heat flux of CNT-sheet was compared to that of copper, and it was found that the CNT-sheet has significantly higher specific heat transfer properties compared to those of copper. CNT-sheet is a potential candidate to replace copper in thermal transport applications where weight is a primary concern such as in the automobile, aircraft, and space industries.

  13. Linear elastic properties derivation from microstructures representative of transport parameters.

    Science.gov (United States)

    Hoang, Minh Tan; Bonnet, Guy; Tuan Luu, Hoang; Perrot, Camille

    2014-06-01

    It is shown that three-dimensional periodic unit cells (3D PUC) representative of transport parameters involved in the description of long wavelength acoustic wave propagation and dissipation through real foam samples may also be used as a standpoint to estimate their macroscopic linear elastic properties. Application of the model yields quantitative agreement between numerical homogenization results, available literature data, and experiments. Key contributions of this work include recognizing the importance of membranes and properties of the base material for the physics of elasticity. The results of this paper demonstrate that a 3D PUC may be used to understand and predict not only the sound absorbing properties of porous materials but also their transmission loss, which is critical for sound insulation problems.

  14. Interface disorder and transport properties in HTC/CMR superlattices

    International Nuclear Information System (INIS)

    Haberkorn, N.; Guimpel, J.; Sirena, M.; Steren, L.B.; Campillo, G.; Saldarriaga, W.; Gomez, M.E.

    2004-01-01

    The physical properties of superlattices are affected by interface disorder, like roughness and interdiffusion. X-ray diffraction allows its measurement through modeling and structure refinement. The high-T c RBa 2 Cu 3 O 7 (RBCO) and colossal magnetoresistance La x A 1-x MnO 3 (LAMO) perovskites are interesting superlattice partners given their similar lattice parameters and because the combination of magnetic and superconducting properties is interesting for both basic and applied research. We have investigated the structural and transport properties of YBCO/La 2/3 Ca 1/3 MnO 3 and GdBCO/La 0.6 Sr 0.04 MnO 3 superlattices grown by sputtering on (1 0 0)MgO. We find a roughness of 1 RBCO unit cell and a 30% interdiffusion in the same length from the interfaces for all samples. The superconducting behavior is found strongly dependent on the LAMO layer thickness

  15. NUMERICALLY DETERMINED TRANSPORT LAWS FOR FINGERING ('THERMOHALINE') CONVECTION IN ASTROPHYSICS

    International Nuclear Information System (INIS)

    Traxler, A.; Garaud, P.; Stellmach, S.

    2011-01-01

    We present the first three-dimensional simulations of fingering convection performed at parameter values approaching those relevant for astrophysics. Our simulations reveal the existence of simple asymptotic scaling laws for turbulent heat and compositional transport, which can be straightforwardly extrapolated from our numerically tractable values to the true astrophysical regime. Our investigation also indicates that thermo-compositional 'staircases', a key consequence of fingering convection in the ocean, cannot form spontaneously in the fingering regime in stellar interiors. Our proposed empirically determined transport laws thus provide simple prescriptions for mixing by fingering convection in a variety of astrophysical situations, and should, from here on, be used preferentially over older and less accurate parameterizations. They also establish that fingering convection does not provide sufficient extra-mixing to explain observed chemical abundances in red giant branch stars.

  16. Red cell properties after different modes of blood transportation

    Directory of Open Access Journals (Sweden)

    Asya Makhro

    2016-07-01

    Full Text Available Transportation of blood samples is unavoidable for assessment of specific parameters in blood of patients with rare anemias, blood doping testing or for research purposes. Despite the awareness that shipment may substantially alter multiple parameters, no study of that extend has been performed to assess these changes and optimize shipment conditions to reduce transportation-related artifacts. Here we investigate the changes in multiple parameters in blood of healthy donors over 72 hours of simulated shipment conditions. Three different anticoagulants (K3EDTA, Sodium Heparin and citrate-based CPDA for two temperatures (4oC and room temperature were tested to define the optimal transportation conditions. Parameters measured cover common cytology and biochemistry parameters (complete blood count, hematocrit, morphological examination, red blood cell (RBC volume, ion content and density, membrane properties and stability (hemolysis, osmotic fragility, membrane heat stability, patch-clamp investigations and formation of micro vesicles, Ca2+ handling, RBC metabolism, activity of numerous enzymes and O2 transport capacity. Our findings indicate that individual sets of parameter may require different shipment settings (anticoagulants, temperature. Most of the parameters except for ion (Na+, K+, Ca2+ handling and, possibly, reticulocytes counts, tend to favor transportation at 4oC. Whereas plasma and intraerythrocytic Ca2+ cannot be accurately measured in the presence of chelators such as citrate and EDTA, majority of Ca2+-dependent parameters are stabilized in CPDA samples. Even in blood samples from healthy donors transported using optimized shipment protocol the majority of parameters were stable within 24 hours, the condition that may not hold for the samples of patients with rare anemias. This implies for the as short as possible shipping using fast courier services to the closest expert laboratory at reach. Mobile laboratories or the travel of the

  17. Influence of biofilms on transport properties in porous media

    Science.gov (United States)

    Davit, Y.

    2015-12-01

    Microbial activity and biofilm growth in porous media can drastically modify transport properties such as permeability, longitudinal and transverse dispersion or effective reaction rates. Understanding these effects has proven to be a considerable challenge. Advances in this field have been hindered by the difficulty of modeling and visualizing these multi-phase non-linear effects across a broad range of spatial and temporal scales. To address these issues, we are developing a strategy that combines imaging techniques based on x-ray micro-tomography with homogenization of pore-scale transport equations. Here, we review recent progress in x-ray imaging of biofilms in porous media, with a particular focus on the contrast agents that are used to differentiate between the fluid and biofilm phases. We further show how the 3D distribution of the different phases can be used to extract specific information about the biofilm and how effective properties can be calculated via the resolution of closure problems. These closure problems are obtained using the method of volume averaging and must be adapted to the problem of interest. In hydrological systems, we show that a generic formulation for reactive solute transport is based on a domain decomposition approach at the micro-scale yielding macro-scale models reminiscent of multi-rate mass transfer approaches.

  18. Determination of physicomechanical properties of velvet bean ...

    African Journals Online (AJOL)

    Selected physical and mechanical properties of velvet bean (Mucuna pruriens) were studied at two moisture content levels of 13% and 20% (db). Compression strength characteristics were conducted under quasi-static compressive force at longitudinal and latitudinal (lateral) loading positions and the rupture forces, ...

  19. Enhancement of transport properties of a Brownian particle due to quantum effects: Smoluchowski limit

    International Nuclear Information System (INIS)

    Shit, Anindita; Chattopadhyay, Sudip; Chaudhuri, Jyotipratim Ray

    2012-01-01

    Graphical abstract: By invoking physically motivated coordinate transformation into quantum Smoluchowski equation, we have presented a transparent treatment for the determination of the effective diffusion coefficient and current of a quantum Brownian particle. Substantial enhancement in the efficiency of the diffusive transport is envisaged due to the quantum correction effects. Highlights:: ► Transport of a quantum Brownian particle in a periodic potential has been addressed. ► Governing quantum Smoluchowski equation (QSE) includes state dependent diffusion. ► A coordinate transformation is used to recast QSE with constant diffusion. ► Transport properties increases in comparison to the corresponding classical result. ► This enhancement is purely a quantum effect. - Abstract: The transport property of a quantum Brownian particle that interacts strongly with a bath (in which a typical damping constant by far exceeds a characteristic frequency of the isolated system) under the influence of a tilted periodic potential has been studied by solving quantum Smoluchowski equation (QSE). By invoking physically motivated coordinate transformation into QSE, we have presented a transparent treatment for the determination of the effective diffusion coefficient of a quantum Brownian particle and the current (the average stationary velocity). Substantial enhancement in the efficiency of the diffusive transport is envisaged due to the quantum correction effects only if the bath temperature hovers around an appropriate range of intermediate values. Our findings also confirm the results obtained in the classical cases.

  20. Laser patterning: A new approach to measure local magneto-transport properties in multifilamentary superconducting tapes

    International Nuclear Information System (INIS)

    Sanchez Valdes, C.F.; Perez-Penichet, C.; Noda, C.; Arronte, M.; Batista-Leyva, A.J.; Haugen, O.; Johansen, T.H.; Han, Z.; Altshuler, E.

    2007-01-01

    The determination of inter- and intra-filament characteristics in superconducting composites such as BSCCO-Ag tapes is of great importance for material evaluation towards applications. Most attempts to separate the two contributions have relied on indirect methods based on magnetic measurements such as SQUID or magneto-optic imaging techniques. Here we show that laser patterning of superconducting BSCCO-Ag tapes constitutes a simple approach to measure local transport properties in a direct way, even able to separate inter- and intra-filament contributions to the overall transport behavior of the sample

  1. Transport Properties of operational gas mixtures used at LHC

    CERN Document Server

    Assran, Yasser

    2011-01-01

    This report summarizes some useful data on the transport characteristics of gas mixtures which are required for detection of charged particles in gas detectors. We try to replace Freon used for RPC detector in the CMS experiment with another gas while maintaining the good properties of the Freon gas mixture unchanged. We try to switch to freonless gas mixture because Freon is not a green gas, it is very expensive and its availability is decreasing. Noble gases like Ar, He, Ne and Xe (with some quenchers like carbon dioxide, methane, ethane and isobutene) are investigated. Transport parameters like drift velocity, diffusion, Townsend coefficient, attachment coefficient and Lorentz angle are computed using Garfield software for different gas mixtures and compared with experimental data.

  2. Structural and robustness properties of smart-city transportation networks

    Science.gov (United States)

    Zhang, Zhen-Gang; Ding, Zhuo; Fan, Jing-Fang; Meng, Jun; Ding, Yi-Min; Ye, Fang-Fu; Chen, Xiao-Song

    2015-09-01

    The concept of smart city gives an excellent resolution to construct and develop modern cities, and also demands infrastructure construction. How to build a safe, stable, and highly efficient public transportation system becomes an important topic in the process of city construction. In this work, we study the structural and robustness properties of transportation networks and their sub-networks. We introduce a complementary network model to study the relevance and complementarity between bus network and subway network. Our numerical results show that the mutual supplement of networks can improve the network robustness. This conclusion provides a theoretical basis for the construction of public traffic networks, and it also supports reasonable operation of managing smart cities. Project supported by the Major Projects of the China National Social Science Fund (Grant No. 11 & ZD154).

  3. Structural and robustness properties of smart-city transportation networks

    International Nuclear Information System (INIS)

    Zhang Zhen-Gang; Ding Zhuo; Fan Jing-Fang; Chen Xiao-Song; Meng Jun; Ye Fang-Fu; Ding Yi-Min

    2015-01-01

    The concept of smart city gives an excellent resolution to construct and develop modern cities, and also demands infrastructure construction. How to build a safe, stable, and highly efficient public transportation system becomes an important topic in the process of city construction. In this work, we study the structural and robustness properties of transportation networks and their sub-networks. We introduce a complementary network model to study the relevance and complementarity between bus network and subway network. Our numerical results show that the mutual supplement of networks can improve the network robustness. This conclusion provides a theoretical basis for the construction of public traffic networks, and it also supports reasonable operation of managing smart cities. (rapid communication)

  4. Modeling the transport properties of epitaxially grown thermoelectric oxide thin films using spectroscopic ellipsometry

    KAUST Repository

    Sarath Kumar, S. R.

    2012-02-01

    The influence of oxygen vacancies on the transport properties of epitaxial thermoelectric (Sr,La)TiO3 thin films is determined using electrical and spectroscopic ellipsometry (SE) measurements. Oxygen vacancy concentration was varied by ex-situ annealing in Ar and Ar/H2. All films exhibited degenerate semiconducting behavior, and electrical conductivity decreased (258–133 S cm−1) with increasing oxygen content. Similar decrease in the Seebeck coefficient is observed and attributed to a decrease in effective mass (7.8–3.2 me ), as determined by SE. Excellent agreement between transport properties deduced from SE and direct electrical measurements suggests that SE is an effective tool for studying oxide thin film thermoelectrics.

  5. Modeling the transport properties of epitaxially grown thermoelectric oxide thin films using spectroscopic ellipsometry

    KAUST Repository

    Sarath Kumar, S. R.; Abutaha, Anas I.; Hedhili, Mohamed N.; Alshareef, Husam N.

    2012-01-01

    The influence of oxygen vacancies on the transport properties of epitaxial thermoelectric (Sr,La)TiO3 thin films is determined using electrical and spectroscopic ellipsometry (SE) measurements. Oxygen vacancy concentration was varied by ex-situ annealing in Ar and Ar/H2. All films exhibited degenerate semiconducting behavior, and electrical conductivity decreased (258–133 S cm−1) with increasing oxygen content. Similar decrease in the Seebeck coefficient is observed and attributed to a decrease in effective mass (7.8–3.2 me ), as determined by SE. Excellent agreement between transport properties deduced from SE and direct electrical measurements suggests that SE is an effective tool for studying oxide thin film thermoelectrics.

  6. Determination of Bruising Damages of Tomato during Road Transportation Process

    Directory of Open Access Journals (Sweden)

    A Mansouri Alam

    2018-03-01

    Full Text Available Introduction The most important post-harvest mechanical damage is bruising. Bruising occurs during the stages of handling, transporting and packaging due to quasi-static and dynamic loads. Vibrations of tomato fruits during transportation by truck will decrease their quality. More than 2.5 million tons damages have been reported during tomato transportation in Iran. Therefore, it is necessary to recognize different parameters of damages during road transportation in order to detect and prevent bruising injury. Materials and Methods In this study, healthy Super Queen verity of tomatoes devoid of any corrosion and mechanical damage multipliers were used. Aaverage of 7 and 5 pieces of fruit in each length and width, respectively in 13*25*37 cm boxes with a capacity of 8 kg were arranged. The boxes were divided into 2 types of truck suspension (model M2631 AIMCO, manufactured in 2010 with air suspension and Nissan trucks 2400, manufactured in 2010 with suspension spring. Boxes were established in three different heights truck, floor truck, height of middle and top of truck, in addition to two different situation boxes on the front axle (S1 and rear axle (S2. In each situation, three levels of height (H1, floor truck, the truck (H2 and the truck (H3 there. The location of each sample inside the fruit boxes bottom row (Loc1 and top (Loc2 boxes marked with marker. In this study, two types of road, highway asphalt and asphalt secondary road was used for transportation. Trucks and vans had the same distance route about 400 km. Fruits were transferred to Hamadan agricultural college. Rheology lab test was a hit with the pendulum. In this study, the amount of energy absorbed from the index (as a parameter to determine the sensitivity and the fruits bruises were used. Hit test was done after transportation of fruits and transferring those to the laboratory in less than 2 hours. Impact energy products were considered higher than the dynamic submission

  7. Influence of short range ordering and clustering on transport properties

    International Nuclear Information System (INIS)

    Vigier, G.; Pelletier, J.M.

    1982-01-01

    The influence of short range ordering and clustering phenomena on the electrical resistivity p and the thermopower S is investigated both theoretically and experimentally. According to the considered alloys either increases or decreases of transport properties may be observed when deviations from a random distribution of solute atoms occur. These observations are explained with a model based on free electrons and Born approximations the importance of the potential choice is underlined; two kinds of description of the structure factor are investigated. A good semiquantitative agreement is obtained between computed results and experimental observations

  8. 1D-transport properties of single superconducting lead nanowires

    DEFF Research Database (Denmark)

    Michotte, S.; Mátéfi-Tempfli, Stefan; Piraux, L.

    2003-01-01

    of the nanowire is small enough to ensure a 1D superconducting regime in a wide temperature range below T. The non-zero resistance in the superconducting state and its variation caused by fluctuations of the superconducting order parameter were measured versus temperature, magnetic field, and applied DC current......We report on the transport properties of single superconducting lead nanowires grown by an electrodeposition technique, embedded in a nanoporous track-etched polymer membrane. The nanowires are granular, have uniform diameter of ̃40 nm and a very large aspect ratio (̃500). The diameter...

  9. Quantum oscillations and the electronic transport properties in multichain nanorings

    International Nuclear Information System (INIS)

    Racolta, D.

    2009-01-01

    We consider a system of multichain nanorings in static electric and magnetic field. The magnetic field induces characteristic phase changes. These phase shifts produce interference phenomena in the case of nanosystems for which the coherence length is larger than the sample dimension. We obtain energy solutions that are dependent on the number of sites N α characterizing a chain, of phase on the phase φ α and on the applied voltage. We found rich oscillations structures exhibited by the magnetic flux and we established the transmission probability. This proceeds by applying Landauer conductance formulae which opens the way to study electronic transport properties. (authors)

  10. Electrical and thermal transport properties of uranium and plutonium carbides

    International Nuclear Information System (INIS)

    Lewis, H.D.; Kerrisk, J.F.

    1976-09-01

    Contributions of many authors are outlined with respect to the experimental measurement methods used and characteristics of the sample materials. Discussions treat the qualitative effects of sample material composition; oxygen, nitrogen, and nickel concentrations; porosity; microstructural variations; and the variability in transport property values obtained by the various investigators. Temperature-dependent values are suggested for the electrical resistivities and thermal conductivities of selected carbide compositions based on a comparative evaluation of the available data and the effects of variation in the characteristics of sample materials

  11. Soil properties and preferential solute transport at the field scale

    DEFF Research Database (Denmark)

    Koestel, J K; Minh, Luong Nhat; Nørgaard, Trine

    An important fraction of water flow and solute transport through soil takes place through preferential flow paths. Although this had been already observed in the nineteenth century, it had been forgotten by the scientific community until it was rediscovered during the 1970s. The awareness...... of the relevance of preferential flow was broadly re-established in the community by the early 1990s. However, since then, the notion remains widespread among soil scientists that the occurrence and strength of preferential flow cannot be predicted from measurable proxy variables such as soil properties or land...

  12. Stacking dependence of carrier transport properties in multilayered black phosphorous

    Science.gov (United States)

    Sengupta, A.; Audiffred, M.; Heine, T.; Niehaus, T. A.

    2016-02-01

    We present the effect of different stacking orders on carrier transport properties of multi-layer black phosphorous. We consider three different stacking orders AAA, ABA and ACA, with increasing number of layers (from 2 to 6 layers). We employ a hierarchical approach in density functional theory (DFT), with structural simulations performed with generalized gradient approximation (GGA) and the bandstructure, carrier effective masses and optical properties evaluated with the meta-generalized gradient approximation (MGGA). The carrier transmission in the various black phosphorous sheets was carried out with the non-equilibrium green’s function (NEGF) approach. The results show that ACA stacking has the highest electron and hole transmission probabilities. The results show tunability for a wide range of band-gaps, carrier effective masses and transmission with a great promise for lattice engineering (stacking order and layers) in black phosphorous.

  13. Elastic properties and electron transport in InAs nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Migunov, Vadim

    2013-02-22

    The electron transport and elastic properties of InAs nanowires grown by chemical vapor deposition on InAs (001) substrate were studied experimentally, in-situ in a transmission electron microscope (TEM). A TEM holder allowing the measurement of a nanoforce while simultaneous imaging nanowire bending was used. Diffraction images from local areas of the wire were recorded to correlate elastic properties with the atomic structure of the nanowires. Another TEM holder allowing the application of electrical bias between the nanowire and an apex of a metallic needle while simultaneous imaging the nanowire in TEM or performing electron holography was used to detect mechanical vibrations in mechanical study or holographical observation of the nanowire inner potential in the electron transport studies. The combination of the scanning probe methods with TEM allows to correlate the measured electric and elastic properties of the nanowires with direct identification of their atomic structure. It was found that the nanowires have different atomic structures and different stacking fault defect densities that impacts critically on the elastic properties and electric transport. The unique methods, that were applied in this work, allowed to obtain dependencies of resistivity and Young's modulus of left angle 111 right angle -oriented InAs nanowires on defect density and diameter. It was found that the higher is the defect density the higher are the resistivity and the Young's modulus. Regarding the resistivity, it was deduced that the stacking faults increase the scattering of the electrons in the nanowire. These findings are consistent with the literature, however, the effect described by the other groups is not so pronounced. This difference can be attributed to the significant incompleteness of the physical models used for the data analysis. Regarding the elastic modulus, there are several mechanisms affecting the elasticity of the nanowires discussed in the thesis. It

  14. Determination of atmospheric aerosol properties over land using satellite measurements

    NARCIS (Netherlands)

    Kokhanovsky, A.A.; Leeuw, G. de

    2009-01-01

    Mostly, aerosol properties are poorly understood because the aerosol properties are very sparse. The first workshop on the determination of atmospheric aerosol properties over land using satellite measurements is convened in Bremen, Germany. In this workshop, the topics of discussions included a

  15. TASK 7 DEMONSTRATION OF THAMES FOR MICROSTRUCTURE AND TRANSPORT PROPERTIES

    Energy Technology Data Exchange (ETDEWEB)

    Langton, C.; Bullard, J.; Stutzman, P.; Snyder, K.; Garboczi, E.

    2010-03-29

    The goal of the Cementitious Barriers Partnership (CBP) is to develop a reasonable and realible set of tools to reduce the uncertainty in predicting the structural, hydraulic and chemical performance of cement barriers used in nuclear applications that are exposed to dynamic environmental conditions over extended time frames. One of these tools, the responsibility of NIST, is THAMES (Thermodynamic Hydration and Microstructure Evolution Simulator), which is being developed to describe cementitious binder microstructures and calculate important engineering properties during hydration and degradation. THAMES is designed to be a 'micro-probe', used to evaluate changes in microstructure and properties occurring over time because of hydration or degradation reactions in a volume of about 0.001 mm{sup 3}. It will be used to map out microstructural and property changes across reaction fronts, for example, with spatial resolution adequate to be input into other models (e.g., STADIUM{reg_sign}, LeachSX{trademark}) in the integrated CBP package. THAMES leverages thermodynamic predictions of equilibrium phase assemblages in aqueous geochemical systems to estimate 3-D virtual microstructures of a cementitious binder at different times during the hydration process or potentially during degradation phenomena. These virtual microstructures can then be used to calculate important engineering properties of a concrete made from that binder at prescribed times. In this way, the THAMES model provides a way to calculate the time evolution of important material properties such as elastic stiffness, compressive strength, diffusivity, and permeability. Without this model, there would be no way to update microstructure and properties for the barrier materials considered as they are exposed to the environment, thus greatly increasing the uncertainty of long-term transport predictions. This Task 7 report demonstrates the current capabilities of THAMES. At the start of the CBP

  16. Transport properties in monolayer-bilayer-monolayer graphene planar junctions

    Institute of Scientific and Technical Information of China (English)

    Kai-Long Chu; Zi-Bo Wang; Jiao-Jiao Zhou; Hua Jiang

    2017-01-01

    The transport study of graphene based junctions has become one of the focuses in graphene research.There are two stacking configurations for monolayer-bilayer-monolayer graphene planar junctions.One is the two monolayer graphene contacting the same side of the bilayer graphene,and the other is the two-monolayer graphene contacting the different layers of the bilayer graphene.In this paper,according to the Landauer-Büttiker formula,we study the transport properties of these two configurations.The influences of the local gate potential in each part,the bias potential in bilayer graphene,the disorder and external magnetic field on conductance are obtained.We find the conductances of the two configurations can be manipulated by all of these effects.Especially,one can distinguish the two stacking configurations by introducing the bias potential into the bilayer graphene.The strong disorder and the external magnetic field will make the two stacking configurations indistinguishable in the transport experiment.

  17. The Determination of Some Mechanical Properties of Scheffe's ...

    African Journals Online (AJOL)

    The work determined some mechanical properties of fresh and matured concrete. These properties include Slump, Compressive Strength, Static modulus of elasticity and Modulus of rigidity. It applied Scheffe's optimization theory to determine the ratio of the combined constituents of the concrete mix. The results showed that ...

  18. Efficient calculation of dissipative quantum transport properties in semiconductor nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Greck, Peter

    2012-11-26

    We present a novel quantum transport method that follows the non-equilibrium Green's function (NEGF) framework but side steps any self-consistent calculation of lesser self-energies by replacing them by a quasi-equilibrium expression. We termed this method the multi-scattering Buettiker-Probe (MSB) method. It generalizes the so-called Buettiker-Probe model but takes into account all relevant individual scattering mechanisms. It is orders of magnitude more efficient than a fully selfconsistent non-equilibrium Green's function calculation for realistic devices, yet accurately reproduces the results of the latter method as well as experimental data. This method is fairly easy to implement and opens the path towards realistic three-dimensional quantum transport calculations. In this work, we review the fundamentals of the non-equilibrium Green's function formalism for quantum transport calculations. Then, we introduce our novel MSB method after briefly reviewing the original Buettiker-Probe model. Finally, we compare the results of the MSB method to NEGF calculations as well as to experimental data. In particular, we calculate quantum transport properties of quantum cascade lasers in the terahertz (THz) and the mid-infrared (MIR) spectral domain. With a device optimization algorithm based upon the MSB method, we propose a novel THz quantum cascade laser design. It uses a two-well period with alternating barrier heights and complete carrier thermalization for the majority of the carriers within each period. We predict THz laser operation for temperatures up to 250 K implying a new temperature record.

  19. The study of thermodynamic properties and transport properties of multicomponent systems with chemical reactions

    Directory of Open Access Journals (Sweden)

    Samujlov E.

    2013-04-01

    Full Text Available In case of system with chemical reaction the most important properties are heat conductivity and heat capacity. In this work we have considered the equation for estimate the component of these properties caused by chemical reaction and ionization processes. We have evaluated the contribution of this part in heat conductivity and heat capacity too. At the high temperatures contribution in heat conductivity from ionization begins to play an important role. We have created a model, which describe partial and full ionization of gases and gas mixtures. In addition, in this work we present the comparison of our result with experimental data and data from numerical simulation. We was used the data about transport properties of middle composition of Russian coals and the data of thermophysical properties of natural gas for comparison.

  20. Mechanical properties used for the qualification of transport casks

    International Nuclear Information System (INIS)

    Salzbrenner, R.; Crenshaw, T.B.; Sorenson, K.B.

    1993-01-01

    The qualification process that should be sufficient for qualification of a specific cask (material/geometry combination) has been examined. The prototype cask should be tested to determine its overall variation in microstructure, chemistry, and mechanical properties. This prototype may also be subjected to 'proof testing' to demonstrate the validity of the design analysis (including the mechanical properties used in the analysis). The complete mechanical property mapping does not necessarily have to precede the proof testing (i.e., portions of the cask which experience only low (elastic) loads during the drop test are suitable for mechanical test specimens). The behavior of the prototype cask and the production casks are linked by assuring that each cask possesses at least the minimum level of one or more critical mechanical properties. This may be done by measuring the properties of interest directly, or by relying on a secondary measurement (such as subsize mechanical test results or microstructure/compositional measurements) which has been statistically correlated to the critical properties. The database required to show the correlation between the secondary measurement and the valid design property may be established by tests on the material from the prototype cask. The production controls must be demonstrated as being adequate to assure that a uniform product is produced. The testing of coring (or test block or prolongation) samples can only be viewed as providing a valid link to the benchmark results provided by the prototype cask if the process used to create follow-on casks remains essentially similar. The MOSAIK Test Program has demonstrated the qualification method through the benchmarking stage. The program did not establish for qualifying serial production casks through, for example, a correlation between small specimen parameters and valid design fracture toughness properties. Such a correlation would require additional experimental work. (J.P.N.)

  1. Interface disorder and transport properties in HTC/CMR superlattices

    Energy Technology Data Exchange (ETDEWEB)

    Haberkorn, N.; Guimpel, J.; Sirena, M.; Steren, L.B.; Campillo, G.; Saldarriaga, W.; Gomez, M.E

    2004-08-01

    The physical properties of superlattices are affected by interface disorder, like roughness and interdiffusion. X-ray diffraction allows its measurement through modeling and structure refinement. The high-T{sub c} RBa{sub 2}Cu{sub 3}O{sub 7} (RBCO) and colossal magnetoresistance La{sub x}A{sub 1-x}MnO{sub 3} (LAMO) perovskites are interesting superlattice partners given their similar lattice parameters and because the combination of magnetic and superconducting properties is interesting for both basic and applied research. We have investigated the structural and transport properties of YBCO/La{sub 2/3}Ca{sub 1/3}MnO{sub 3} and GdBCO/La{sub 0.6}Sr{sub 0.04}MnO{sub 3} superlattices grown by sputtering on (1 0 0)MgO. We find a roughness of 1 RBCO unit cell and a 30% interdiffusion in the same length from the interfaces for all samples. The superconducting behavior is found strongly dependent on the LAMO layer thickness.

  2. Strategy for the use of laboratory methods in the site investigations programme for the transport properties of the rock

    International Nuclear Information System (INIS)

    Widestrand, Henrik; Byegaard, Johan; Ohlsson, Yvonne; Tullborg, Eva-Lena

    2003-06-01

    This report comprises a strategy for the handling of laboratory investigations of diffusivity and sorption characteristics within the discipline-specific programme 'Transport Properties of the Rock' in the SKB site investigations. The aim of the transport programme is to investigate the solute transport properties at a site in order to acquire data that are required for an assessment of the long-term performance and radiological safety of the deep repository. The result of the transport programme is the Transport Properties Site Descriptive Model, i.e. a description of the site-specific properties for the transport of solutes in the groundwater at a site. A strategy for the methodology, control of sampling and characterisation programme and interpretation of the results, is proposed. The basis for the laboratory investigations is a conceptual geological model based on the geological model produced in the geology programme. Major and minor types of rock and fractures are defined and characterised according to the quality of the general database and site-specific needs. The selection of samples and analyses is determined in close co-operation with the geology, hydrogeology, hydrogeochemistry and rock mechanics programmes. The result of the laboratory investigations is a retardation model, which is used as an input in the Transport Properties Site Descriptive Model. The interpretation and production of a retardation model is described and exemplified. Lastly, method-specific strategies and recommendations are given, including strategies for the selection of tracers in the experiments and for the treatment of the sampled geologic materials

  3. Effective Heat and Mass Transport Properties of Anisotropic Porous Ceria for Solar Thermochemical Fuel Generation

    Directory of Open Access Journals (Sweden)

    Sophia Haussener

    2012-01-01

    Full Text Available High-resolution X-ray computed tomography is employed to obtain the exact 3D geometrical configuration of porous anisotropic ceria applied in solar-driven thermochemical cycles for splitting H2O and CO2. The tomography data are, in turn, used in direct pore-level numerical simulations for determining the morphological and effective heat/mass transport properties of porous ceria, namely: porosity, specific surface area, pore size distribution, extinction coefficient, thermal conductivity, convective heat transfer coefficient, permeability, Dupuit-Forchheimer coefficient, and tortuosity and residence time distributions. Tailored foam designs for enhanced transport properties are examined by means of adjusting morphologies of artificial ceria samples composed of bimodal distributed overlapping transparent spheres in an opaque medium.

  4. A non-Linear transport model for determining shale rock characteristics

    Science.gov (United States)

    Ali, Iftikhar; Malik, Nadeem

    2016-04-01

    Unconventional hydrocarbon reservoirs consist of tight porous rocks which are characterised by nano-scale size porous networks with ultra-low permeability [1,2]. Transport of gas through them is not well understood at the present time, and realistic transport models are needed in order to determine rock properties and for estimating future gas pressure distribution in the reservoirs. Here, we consider a recently developed non-linear gas transport equation [3], ∂p-+ U ∂p- = D ∂2p-, t > 0, (1) ∂t ∂x ∂x2 complimented with suitable initial and boundary conditions, in order to determine shale rock properties such as the permeability K, the porosity φ and the tortuosity, τ. In our new model, the apparent convection velocity, U = U(p,px), and the apparent diffusivity D = D(p), are both highly non-linear functions of the pressure. The model incorporate various flow regimes (slip, surface diffusion, transition, continuum) based upon the Knudsen number Kn, and also includes Forchchiemers turbulence correction terms. In application, the model parameters and associated compressibility factors are fully pressure dependent, giving the model more realism than previous models. See [4]. Rock properties are determined by solving an inverse problem, with model parameters adjustment to minimise the error between the model simulation and available data. It is has been found that the proposed model performs better than previous models. Results and details of the model will be presented at the conference. Corresponding author: namalik@kfupm.edu.sa and nadeem_malik@cantab.net References [1] Cui, X., Bustin, A.M. and Bustin, R., "Measurements of gas permeability and diffusivity of tight reservoir rocks: different approaches and their applications", Geofluids 9, 208-223 (2009). [2] Chiba R., Fomin S., Chugunov V., Niibori Y. and Hashida T., "Numerical Simulation of Non Fickian Diffusion and Advection in a Fractured Porous Aquifer", AIP Conference Proceedings 898, 75 (2007

  5. Two-temperature thermodynamic and transport properties of SF6–Cu plasmas

    International Nuclear Information System (INIS)

    Wu, Yi; Chen, Zhexin; Yang, Fei; Rong, Mingzhe; Sun, Hao; Cressault, Yann; Murphy, Anthony B; Guo, Anxiang; Liu, Zirui

    2015-01-01

    SF 6 and Cu are widely adopted in electrical equipment as a dielectric medium and for conductive components, respectively. SF 6 –Cu plasmas are frequently formed, particularly in high-voltage circuit breaker arcs and fault current arcs, due to erosion of the Cu components. In this paper, calculated values of the thermodynamic and transport properties of plasmas in SF 6 –Cu mixtures are presented for both thermal equilibrium and non-equilibrium conditions. The composition is determined by the two-temperature Saha equation and Guldberg–Waage equation in the form derived by van de Sanden. The composition and the thermodynamic properties are evaluated through a classical statistical mechanics approach. For the transport coefficients, the simplified Chapman–Enskog method developed by Devoto, which decouples the electrons and heavy species, has been applied using the most recent collision integrals. The thermodynamic and transport properties are calculated for different electron temperatures (300–40 000 K), ratios of electron to heavy-species temperature (1–10), pressures (0.1–10 atm) and copper molar proportions (0–50%). It is found that deviations from thermal equilibrium strongly affect the thermodynamic and transport properties of the SF 6 –Cu plasmas. Further, the presence of copper has different effects on some of the properties for plasmas in and out of thermal equilibrium. The main reason for these changes is that dissociation reactions are delayed for non-thermal equilibrium plasmas, which in turn influences the ionization reactions that occur. (paper)

  6. Investigation of transport properties of FeTe compound

    Science.gov (United States)

    Lodhi, Pavitra Devi; Solanki, Neha; Choudhary, K. K.; Kaurav, Netram

    2018-05-01

    Transport properties of FeTe parent compound has been investigated by measurements of electrical resistivity, magnetic susceptibility and Seebeck coefficient. The sample was synthesized through a standard solid state reaction route via vacuum encapsulation and characterized by x-ray diffraction, which indicated a tetragonal phase with space group P4/nmm. The parent FeTe compound does not exhibit superconductivity but shows an anomaly in the resistivity measurement at around 67 K, which corresponds to a structural phase transition along with in the vicinity of a magnetic phase transition. In the low temperature regime, Seebeck coefficient, S(T), exhibited an anomalous dip feature and negative throughout the temperature range, indicating electron-like charge carrier conduction mechanism.

  7. Perovskite solid electrolytes: Structure, transport properties and fuel cell applications

    DEFF Research Database (Denmark)

    Bonanos, N.; Knight, K.S.; Ellis, B.

    1995-01-01

    Doped barium cerate perovskites, first investigated by Iwahara and co-workers, have ionic conductivities of the order of 20 mS/cm at 800 degrees C making them attractive as fuel cell electrolytes for this temperature region. They have been used to construct laboratory scale fuel cells, which...... vapour transfer in a cell in which the perovskite is exposed to wet hydrogen on both sides. The evolution of transport properties with temperature is discussed in relation to structure. Neutron diffraction studies of doped and undoped barium cerate are reported, revealing a series of phase transitions...... between ambient temperature and 1000 degrees C. The available literature on chemical stability of cerate perovskites to reduction and attack by carbon dioxide is reviewed in brief....

  8. Electronic transport properties of carbon nanotube metal-semiconductor-metal

    Directory of Open Access Journals (Sweden)

    F Khoeini

    2008-07-01

    Full Text Available  In this work, we study electronic transport properties of a quasi-one dimensional pure semi-conducting Zigzag Carbon Nanotube (CNT attached to semi-infinite clean metallic Zigzag CNT leads, taking into account the influence of topological defect in junctions. This structure may behave like a field effect transistor. The calculations are based on the tight-binding model and Green’s function method, in which the local density of states(LDOS in the metallic section to semi-conducting section, and muli-channel conductance of the system are calculated in the coherent and linear response regime, numerically. Also we have introduced a circuit model for the system and investigated its current. The theoretical results obtained, can be a base, for developments in designing nano-electronic devices.

  9. Transport properties of ultrathin black phosphorus on hexagonal boron nitride

    Energy Technology Data Exchange (ETDEWEB)

    Doganov, Rostislav A.; Özyilmaz, Barbaros [Centre for Advanced 2D Materials and Graphene Research Centre, National University of Singapore, 6 Science Drive 2, 117546 Singapore (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); Graduate School for Integrative Sciences and Engineering (NGS), National University of Singapore, 28 Medical Drive, 117456 Singapore (Singapore); Koenig, Steven P.; Yeo, Yuting [Centre for Advanced 2D Materials and Graphene Research Centre, National University of Singapore, 6 Science Drive 2, 117546 Singapore (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); Watanabe, Kenji; Taniguchi, Takashi [National Institute for Materials Science, 1-1 Namiki, Tsukuba 305-0044 (Japan)

    2015-02-23

    Ultrathin black phosphorus, or phosphorene, is a two-dimensional material that allows both high carrier mobility and large on/off ratios. Similar to other atomic crystals, like graphene or layered transition metal dichalcogenides, the transport behavior of few-layer black phosphorus is expected to be affected by the underlying substrate. The properties of black phosphorus have so far been studied on the widely utilized SiO{sub 2} substrate. Here, we characterize few-layer black phosphorus field effect transistors on hexagonal boron nitride—an atomically smooth and charge trap-free substrate. We measure the temperature dependence of the field effect mobility for both holes and electrons and explain the observed behavior in terms of charged impurity limited transport. We find that in-situ vacuum annealing at 400 K removes the p-doping of few-layer black phosphorus on both boron nitride and SiO{sub 2} substrates and reduces the hysteresis at room temperature.

  10. Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

    International Nuclear Information System (INIS)

    Barea, Eva M.; Garcia-Belmonte, Germa; Sommer, Michael; Huettner, Sven; Bolink, Henk J.; Thelakkat, Mukundan

    2010-01-01

    Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between ∼ 10 -8 and 10 -6 cm 2 V -1 s -1 are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

  11. Transition phenomena and thermal transport property in LHD plasmas with an electron internal transport barrier

    International Nuclear Information System (INIS)

    Shimozuma, T.; Kubo, S.; Idei, H.

    2005-01-01

    Two kinds of improved core confinement were observed during centrally focused Electron Cyclotron Heating (ECH) into plasmas sustained by Counter (CNTR) and Co Neutral Beam Injections (NBI) in the Large Helical Device (LHD). One shows transition phenomena to the high-electron-temperature state and has a clear electron Internal Transport Barrier (eITB) in CNTR NBI plasma. Another has no clear transition and no ECH power threshold, but shows a broad high temperature profiles with moderate temperature gradient, which indicates the improved core confinement with additional ECH in Co NBI plasma. The electron heat transport characteristics of these plasmas were directly investigated by using the heat pulse propagation excited by Modulated ECH (MECH). The difference of the features could be caused by the existence of the m/n=2/1 rational surface or island determined by the direction of NBI beam-driven current. (author)

  12. Determination of the individual electrical and transport properties of the plasmalemma and the tonoplast of the giant marine alga Ventricaria ventricosa by means of the integrated perfusion/charge-pulse technique: evidence for a multifolded tonoplast.

    Science.gov (United States)

    Ryser, C; Wang, J; Mimietz, S; Zimmermann, U

    1999-03-15

    The charge-pulse relaxation spectrum of nonperfused and perfused (turgescent) cells of the giant marine alga Ventricaria ventricosa showed two main exponential decays with time constants of approximately 0.1 msec and 10 msec, respectively, when the cells were bathed in artificial sea water (pH 8). Variation of the external pH did not change the relaxation pattern (in contrast to other giant marine algae). Addition of nystatin (a membrane-impermeable and pore-forming antibiotic) to the vacuolar perfusion solution resulted in the disappearance of the slow exponential, whereas external nystatin decreased dramatically the time constant of the fast one. This indicated (by analogy to corresponding experiments with Valonia utricularis, J. Wang, I. Spiess, C. Ryser, U. Zimmermann, J. Membrane Biol. 157: 311-321, 1997) that the fast relaxation must be assigned to the RC-properties of the plasmalemma and the slow one to those of the tonoplast. Consistent with this, external variation of [K+]o or of [Cl-]o as well as external addition of K+- or Cl--channel/carrier inhibitors (TEA, Ba2+, DIDS) affected only the fast relaxation, but not the slow one. In contrast, addition of these inhibitors to the vacuolar perfusion solution had no measurable effect on the charge-pulse relaxation spectrum. The analysis of the data in terms of the "two membrane model" showed that K+- and (to a smaller extent) Cl--conducting elements dominated the plasmalemma conductance. The analysis of the charge-pulse relaxation spectra also yielded the following area-specific data for the capacitance and the conductance for the plasmalemma and tonoplast (by assuming that both membranes have a planar surface): (plasmalemma) Cp = 0.82 * 10(-2) F m-2, Rp = 1.69 * 10(-2) Omega m2, Gp = 5.9 * 10(4) mS m-2, (tonoplast) Ct = 7. 1 * 10(-2) F m-2, Rt = 14.9 * 10(-2) Omega m2 and Gt = 0.67 * 10(4) mS m-2. The electrical data for the tonoplast show that (in contrast to the literature) the area-specific membrane

  13. Magnetic and transport properties of Fe-based nanocrystalline materials

    Science.gov (United States)

    Barandiarán, J. M.

    1994-01-01

    Fe-rich amorphous alloys containing late transition metals like Nb, V, Zr,..., sometimes with the addition of Cu, can crystallize in ultrafine grains of a crystalline phase, a few nanometers in diameter, embedded in a disordered matrix. In such state they have shown excellent soft magnetic properties for technical applications, rising the interest for deep studies. In this paper, recent work on some Fe-Nb and Fe-Zr based alloys both in amorphous state and after several degrees of nanocrystallization is presented. The nanocrystallization process has been achieved by conventional heat treatments (about 1 h at temperatures around 400-500 °C in a controlled atmosphere furnance) as well as by Joule heating using an electrical current flowing through the sample. Magnetic measurements, electrical resistivity, x-rays diffraction and 57Fe Mössbauer spectroscopy were used in the study of the crystalline phases appearing after the thermal treatments. The basic magnetic and transport properties of the nanocrystals do not differ appreciably from their bulk values. The magnetic anisotropy, however, is very sensitive to grain size and to the intergranular magnetic coupling. The effect of such coupling is deduced from the coercivity changes at the Curie Temperature of the amorphous matrix remaining after nanocrystallization.

  14. Charge transport properties in microcrystalline KDyFe(China)6

    International Nuclear Information System (INIS)

    Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.

    2007-01-01

    Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels

  15. Thermodynamic and transport properties of YbNi 4Cd

    Science.gov (United States)

    Lee, J.; Park, H.; Lee-Hone, N. R.; Broun, D. M.; Mun, E.

    2018-05-01

    The single crystal growth and the physical properties of the intermetallic compounds R Ni4Cd (R =Y and Yb) which crystallize in the face-centered cubic (fcc) MgCu4Sn -type structure (space group F 4 ¯3 m ) are discussed. Thermodynamic and transport properties of YbNi4Cd are studied by measuring the magnetization, electrical resistivity, and specific heat. The magnetic susceptibility measurement shows that the 4 f electrons of Yb3 + ions are well localized. The electrical resistivity and specific heat exhibits an antiferromagnetic ordering below TN=0.97 K. Applying the field along the [111] direction results in the suppression of TN below 0.4 K at the critical field Hc˜4.5 kOe. No non-Fermi liquid behavior has been observed in the vicinity of Hc. Above Hc, the magnetoresistivity shows an unconventional temperature dependence ρ (T ) =ρ0+A Tn with n >2 , suggesting that an additional scattering mechanism in the resistivity needs to be considered. Based on the analysis of experimental results, we conclude that the Yb3 + moments and conduction electrons are weakly coupled. Despite the antiferromagnetic ordering below TN, YbNi4Cd exhibits a large frustration parameter | θp/TN|˜16 , where the magnetic Yb3 + ions occupy the tetrahedra on the fcc lattice.

  16. Anomalous Transport Properties of Dense QCD in a Magnetic Field

    Science.gov (United States)

    de la Incera, Vivian

    2017-06-01

    Despite recent advancements in the study and understanding of the phase diagram of strongly interacting matter, the region of high baryonic densities and low temperatures has remained difficult to reach in the lab. Things are expected to change with the planned HIC experiments at FAIR in Germany and NICA in Russia, which will open a window to the high-density-low-temperature segment of the QCD phase map, providing a unique opportunity to test the validity of model calculations that have predicted the formation of spatially inhomogeneous phases with broken chiral symmetry at intermediate-to-high densities. Such a density region is also especially relevant for the physics of neutron stars, as they have cores that can have several times the nuclear saturation density. On the other hand, strong magnetic fields, whose presence is fairly common in HIC and in neutron stars, can affect the properties of these exotic phases and lead to signatures potentially observable in these two settings. In this paper, I examine the anomalous transport properties produced by the spectral asymmetry of the lowest Landau level (LLL) in a QCD-inspired NJL model with a background magnetic field that exhibits chiral symmetry breaking at high density via the formation of a Dual Chiral Density Wave (DCDW) condensate. It turns out that in this model the electromagnetic interactions are described by the axion electrodynamics equations and there is a dissipationless Hall current.

  17. Electrical and optical transport properties of single layer WSe2

    Science.gov (United States)

    Tahir, M.

    2018-03-01

    The electronic properties of single layer WSe2 are distinct from the famous graphene due to strong spin orbit coupling, a huge band gap and an anisotropic lifting of the degeneracy of the valley degree of freedom under Zeeman field. In this work, band structure of the monolayer WSe2 is evaluated in the presence of spin and valley Zeeman fields to study the electrical and optical transport properties. Using Kubo formalism, an explicit expression for the electrical Hall conductivity is examined at finite temperatures. The electrical longitudinal conductivity is also evaluated. Further, the longitudinal and Hall optical conductivities are analyzed. It is observed that the contributions of the spin-up and spin-down states to the power absorption spectrum depend on the valley index. The numerical results exhibit absorption peaks as a function of photon energy, ℏ ω, in the range ∼ 1.5 -2 eV. Also, the optical response lies in the visible frequency range in contrast to the conventional two-dimensional electron gas or graphene where the response is limited to terahertz regime. This ability to isolate carriers in spin-valley coupled structures may make WSe2 a promising candidate for future spintronics, valleytronics and optical devices.

  18. Elastic and transport properties in polycrystals of crackedgrains: Cross-property relations and microstructure

    Energy Technology Data Exchange (ETDEWEB)

    Berryman, J.G.

    2007-10-02

    Some arguments of Bristow (1960) concerning the effects of cracks on elastic and transport (i.e., electrical or thermal conduction) properties of cold-worked metals are reexamined. The discussion is posed in terms of a modern understanding of bounds and estimates for physical properties of polycrystals--in contrast to Bristow's approach using simple mixture theory. One type of specialized result emphasized here is the cross-property estimates and bounds that can be obtained using the methods presented. Our results ultimately agree with those of Bristow, i.e., confirming that microcracking is not likely to be the main cause of the observed elastic behavior of cold-worked metals. However, it also becomes clear that the mixture theory approach to the analysis is too simple and that crack-crack interactions are necessary for proper quantitative study of Bristow's problem.

  19. Atomistic Force Field for Pyridinium-Based Ionic Liquids: Reliable Transport Properties

    DEFF Research Database (Denmark)

    Voroshylova, I. V.; Chaban, V. V.

    2014-01-01

    Reliable force field (FF) is a central issue in successful prediction of physical chemical properties via computer simulations. This work introduces refined FF parameters for six popular ionic liquids (ILs) of the pyridinium family (butylpyridinium tetrafluoroborate, bis(trifluoromethanesulfonyl)......Reliable force field (FF) is a central issue in successful prediction of physical chemical properties via computer simulations. This work introduces refined FF parameters for six popular ionic liquids (ILs) of the pyridinium family (butylpyridinium tetrafluoroborate, bis......(trifluoromethanesulfonyl)imide, dicyanamide, hexafluorophosphate, triflate, chloride). We elaborate a systematic procedure, which allows accounting for specific cationanion interactions in the liquid phase. Once these interactions are described accurately, all experimentally determined transport properties can be reproduced. We prove...... and elevated temperature. The developed atomistic models provide a systematic refinement upon the well-known Canongia LopesPadua (CL&P) FF. Together with the original CL&P parameters the present models foster a computational investigation of ionic liquids....

  20. Fluctuation theory for transport properties in multicomponent mixtures: thermodiffusion and heat conductivity

    DEFF Research Database (Denmark)

    Shapiro, Alexander

    2004-01-01

    The theory of transport properties in multicomponent gas and liquid mixtures, which was previously developed for diffusion coefficients, is extended onto thermodiffusion coefficients and heat conductivities. The derivation of the expressions for transport properties is based on the general statis...... of the heat conductivity coefficient for ideal gas. (C) 2003 Elsevier B.V. All rights reserved.......The theory of transport properties in multicomponent gas and liquid mixtures, which was previously developed for diffusion coefficients, is extended onto thermodiffusion coefficients and heat conductivities. The derivation of the expressions for transport properties is based on the general...

  1. Transport properties of olivine grain boundaries from electrical conductivity experiments

    Science.gov (United States)

    Pommier, Anne; Kohlstedt, David L.; Hansen, Lars N.; Mackwell, Stephen; Tasaka, Miki; Heidelbach, Florian; Leinenweber, Kurt

    2018-05-01

    Grain boundary processes contribute significantly to electronic and ionic transports in materials within Earth's interior. We report a novel experimental study of grain boundary conductivity in highly strained olivine aggregates that demonstrates the importance of misorientation angle between adjacent grains on aggregate transport properties. We performed electrical conductivity measurements of melt-free polycrystalline olivine (Fo90) samples that had been previously deformed at 1200 °C and 0.3 GPa to shear strains up to γ = 7.3. The electrical conductivity and anisotropy were measured at 2.8 GPa over the temperature range 700-1400 °C. We observed that (1) the electrical conductivity of samples with a small grain size (3-6 µm) and strong crystallographic preferred orientation produced by dynamic recrystallization during large-strain shear deformation is a factor of 10 or more larger than that measured on coarse-grained samples, (2) the sample deformed to the highest strain is the most conductive even though it does not have the smallest grain size, and (3) conductivity is up to a factor of 4 larger in the direction of shear than normal to the shear plane. Based on these results combined with electrical conductivity data for coarse-grained, polycrystalline olivine and for single crystals, we propose that the electrical conductivity of our fine-grained samples is dominated by grain boundary paths. In addition, the electrical anisotropy results from preferential alignment of higher-conductivity grain boundaries associated with the development of a strong crystallographic preferred orientation of the grains.

  2. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei

    2018-02-22

    Charge transport governs the operation and performance of organic diodes. Illuminating the charge-transfer/transport processes across the interfaces and the bulk organic semiconductors is at the focus of intensive investigations. Traditionally, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I–V characteristics, still represents a major challenge. Here, the electrical potential distribution in planar organic diodes is investigated by using the scanning Kelvin probe force microscopy technique, a method that can clearly separate the contact and bulk regimes of charge transport. Interestingly, by applying to devices based on novel, high mobility organic materials, the space-charge-limited-current-like I–V curves, which are previously believed to be a result of the bulk transport, are surprisingly but unambiguously demonstrated to be caused by contact-limited conduction. A model accounting is developed for the transport properties of both the two metal/organic interfaces and the bulk. The results indicate that pure interface-dominated transport can indeed give rise to I–V curves similar to those caused by bulk transport. These findings provide a new insight into the charge injection and transport processes in organic diodes.

  3. Determination of prestress and elastic properties of virus capsids

    Science.gov (United States)

    Aggarwal, Ankush

    2018-03-01

    Virus capsids are protein shells that protect the virus genome, and determination of their mechanical properties has been a topic of interest because of their potential use in nanotechnology and therapeutics. It has been demonstrated that stresses exist in virus capsids, even in their equilibrium state, due to their construction. These stresses, termed "prestresses" in this study, closely affect the capsid's mechanical behavior. Three methods—shape-based metric, atomic force microscope indentation, and molecular dynamics—have been proposed to determine the capsid elastic properties without fully accounting for prestresses. In this paper, we theoretically analyze the three methods used for mechanical characterization of virus capsids and numerically investigate how prestresses affect the capsid's mechanical properties. We consolidate all the results and propose that by using these techniques collectively, it is possible to accurately determine both the mechanical properties and prestresses in capsids.

  4. Charge transport properties of CdMnTe radiation detectors

    Energy Technology Data Exchange (ETDEWEB)

    Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.

    2012-04-11

    Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

  5. Modeling charge transport properties of cyano-substituted PPV

    International Nuclear Information System (INIS)

    Correia, Helena M.G.; Ramos, Marta M.D.

    2003-01-01

    In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility

  6. Transport properties of damaged materials. Cementitious barriers partnership

    Energy Technology Data Exchange (ETDEWEB)

    Langton, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2014-11-01

    The objective of the Cementitious Barriers Partnership (CBP) project is to develop tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers used in low-level waste storage applications. One key concern for the long-term durability of concrete is the degradation of the cementitious matrix, which occurs as a result of aggressive chemical species entering the material or leaching out in the environment, depending on the exposure conditions. The objective of the experimental study described in this report is to provide experimental data relating damage in cementitious materials to changes in transport properties, which can eventually be used to support predictive model development. In order to get results within a reasonable timeframe and to induce as much as possible uniform damage level in materials, concrete samples were exposed to freezing and thawing (F/T) cycles. The methodology consisted in exposing samples to F/T cycles and monitoring damage level with ultrasonic pulse velocity measurements. Upon reaching pre-selected damage levels, samples were tested to evaluate changes in transport properties. Material selection for the study was motivated by the need to get results rapidly, in order to assess the relevance of the methodology. Consequently, samples already available at SIMCO from past studies were used. They consisted in three different concrete mixtures cured for five years in wet conditions. The mixtures had water-to-cement ratios of 0.5, 0.65 and 0.75 and were prepared with ASTM Type I cement only. The results showed that porosity is not a good indicator for damage caused by the formation of microcracks. Some materials exhibited little variations in porosity even for high damage levels. On the other hand, significant variations in tortuosity were measured in all materials. This implies that damage caused by internal pressure does not necessarily create additional pore space in

  7. Transport properties of damaged materials. Cementitious barriers partnership

    International Nuclear Information System (INIS)

    Langton, C.

    2014-01-01

    The objective of the Cementitious Barriers Partnership (CBP) project is to develop tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers used in low-level waste storage applications. One key concern for the long-term durability of concrete is the degradation of the cementitious matrix, which occurs as a result of aggressive chemical species entering the material or leaching out in the environment, depending on the exposure conditions. The objective of the experimental study described in this report is to provide experimental data relating damage in cementitious materials to changes in transport properties, which can eventually be used to support predictive model development. In order to get results within a reasonable timeframe and to induce as much as possible uniform damage level in materials, concrete samples were exposed to freezing and thawing (F/T) cycles. The methodology consisted in exposing samples to F/T cycles and monitoring damage level with ultrasonic pulse velocity measurements. Upon reaching pre-selected damage levels, samples were tested to evaluate changes in transport properties. Material selection for the study was motivated by the need to get results rapidly, in order to assess the relevance of the methodology. Consequently, samples already available at SIMCO from past studies were used. They consisted in three different concrete mixtures cured for five years in wet conditions. The mixtures had water-to-cement ratios of 0.5, 0.65 and 0.75 and were prepared with ASTM Type I cement only. The results showed that porosity is not a good indicator for damage caused by the formation of microcracks. Some materials exhibited little variations in porosity even for high damage levels. On the other hand, significant variations in tortuosity were measured in all materials. This implies that damage caused by internal pressure does not necessarily create additional pore space in

  8. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    Science.gov (United States)

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  9. Operando XRD studies as a tool for determination of transport parameters of mobile ions in electrode materials

    Science.gov (United States)

    Kondracki, Łukasz; Kulka, Andrzej; Świerczek, Konrad; Ziąbka, Magdalena; Molenda, Janina

    2017-11-01

    In this work a detailed operando XRD investigations of structural properties of LixMn2O4 manganese spinel are shown to be a complementary, successful method of determination of diffusion coefficient D and surface exchange coefficient k in the working electrode. Kinetics of lithium ions transport are estimated on the basis of rate of structural changes of the cathode material during a relaxation stage after a high current charge, i.e. during structural relaxation of the material. The presented approach seems to be applicable as a complementary method of determination of transport coefficients for all intercalation-type electrode materials.

  10. Laboratory-determined transport properties of Berea sandstone

    International Nuclear Information System (INIS)

    Daily, W.D.; Lin, W.

    1985-01-01

    The authors report laboratory measurements of electrical resistivity water permeability k, and compressional wave velocity V/sub p/ for both intact and fractured Berea sandstone samples as functions of temperature from 20 C to 200 C and effective pressure P/sub e/ from 2.5 MPa to 50 MPa. For the intact sample, V/sub p/ increases from 3.52 km/s to 4.16 km/s as P/sub e/ goes from 3 to 50 MPa. With increasing temperature, V/sub p/ decreases at rates of about 3% per 100 C at P/sub e/ of 5 MPa and about 1.5% per 100 C at P/sub e/ of 38 MPa. Data from the fractured sample are qualitatively similar, but velocities are about 10% lower. For both intact and fractured samples, p increases less than 15% as P/sub e/ increases from 2.5 MPa to 50 MPa. Although both samples show a larger decrease in resistivity with increasing temperature, most of this change is attributed to the decrease in resistivity of the pore fluid over that temperature range. For both samples, k decreases with increasing pressure and temperature. The intact sample permeability varies from 23 mD at 3 MPa and 20 C to less than 1 mD at 50 MPa and 150 C. The permeability of the fractured sample varies from 676 mD at 3 MPa and 20 C to less than 1 mD at 40 MPa and 190 C. The effect of the fracture on k vanishes after several pressure cycles and above about 100 C. These laboratory data are used to demonstrate the possibility of using resistivity and velocity measurements to estimate in-situ permeability of a reservoir. 25 references, 10 figures

  11. Predicting Soil-Air and Soil-Water Transport Properties During Soil Vapor Extraction

    DEFF Research Database (Denmark)

    Poulsen, Tjalfe

    Increased application of in-situ technology for control and removal of volatile organic compounds (VOC) in the subsurface has made the understanding of soil physical properties and their impact upon contaminant transport even more important. Knowledge of contaminant transport is important when...... properties of undisturbed soil from more easily measurable soil properties are developed. The importance of soil properties with respect to contaminant migration during remediation by soil vapor extraction (SVE) in the unsaturated zone was investigated using numerical simulations....

  12. Determining the Mechanical Properties of Lattice Block Structures

    Science.gov (United States)

    Wilmoth, Nathan

    2013-01-01

    Lattice block structures and shape memory alloys possess several traits ideal for solving intriguing new engineering problems in industries such as aerospace, military, and transportation. Recent testing at the NASA Glenn Research Center has investigated the material properties of lattice block structures cast from a conventional aerospace titanium alloy as well as lattice block structures cast from nickel-titanium shape memory alloy. The lattice block structures for both materials were sectioned into smaller subelements for tension and compression testing. The results from the cast conventional titanium material showed that the expected mechanical properties were maintained. The shape memory alloy material was found to be extremely brittle from the casting process and only compression testing was completed. Future shape memory alloy lattice block structures will utilize an adjusted material composition that will provide a better quality casting. The testing effort resulted in baseline mechanical property data from the conventional titanium material for comparison to shape memory alloy materials once suitable castings are available.

  13. Interface and transport properties of GaN/graphene junction in GaN-based LEDs

    International Nuclear Information System (INIS)

    Wang Liancheng; Zhang Yiyun; Liu Zhiqiang; Guo Enqing; Yi Xiaoyan; Wang Junxi; Wang Guohong; Li Xiao; Zhu Hongwei

    2012-01-01

    A normalized circular transmission line method pattern with uniform interface area was developed to obtain contact resistances of p-, u-, n-GaN/graphene contacts (p, u and n represent p-type doped, unintentionally doped and n-type doped, respectively) and N-polar u-, n-GaN/graphene contacts in GaN-based LEDs. The resistances of the graphene/GaN contacts were mainly determined by the work function gap and the carrier concentration in GaN. Annealing caused diffusion of metal atoms and significantly influenced the interface transport properties.

  14. Transport properties of ruthenophanes – A theoretical insight

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Leone C., E-mail: leoqmc@ifsc.edu.br [Departamento de Química, Universidade Federal de Santa Catarina, Campus Universitário Trindade, CP 476, Florianópolis, SC 88040-900 (Brazil); Instituto Federal de Educação Ciência e Tecnologia de Santa Catarina – Campus São José, São José, SC 88103-310 (Brazil); Caramori, Giovanni F. [Departamento de Química, Universidade Federal de Santa Catarina, Campus Universitário Trindade, CP 476, Florianópolis, SC 88040-900 (Brazil); Bergamo, Pedro A.S. [Núcleo de Pesquisa em Ciências Exatas e Tecnológicas, Universidade de Franca, Franca, SP 14404-600 (Brazil); Parreira, Renato L.T., E-mail: renato.parreira@unifran.edu.br [Departamento de Química, Universidade Federal de Santa Catarina, Campus Universitário Trindade, CP 476, Florianópolis, SC 88040-900 (Brazil)

    2016-10-20

    In this article, the electron transport properties of a series of ruthenophanes, 1–4, containing electron-donor and electron-acceptor substituents are studied. The electronic transmission at zero bias is mainly driven by only one eigenchannel. The substitutions constrain the energies in which the probability of electronic transmission is significant. The results suggest that the conductance at zero bias is dependent on the nature of the employed substituent. The eigenchannel wave functions show that the central molecules are preferentially coupled with right electrode. The calculated molecular projected self-consistent hamiltonian states also suggest that there is a dependence of the conductance at zero bias with the nature of the employed substituent. The current–voltage analyses suggest that the negative differential resistance effect is present in ruthenophanes, but it is dependent on both the nature of the substituent and the bias. Despite the moderate rectification ratio of the ruthenophanes, they present non-ohmic behaviour, indicating that they can be used as potential candidates in electronic molecular devices such as switches, oscillators, and frequency multipliers.

  15. Oxygen nonstoichiometry and transport properties of strontium substituted lanthanum cobaltite

    DEFF Research Database (Denmark)

    Søgaard, Martin; Hendriksen, Peter Vang; Mogensen, Mogens Bjerg

    2006-01-01

    Oxygen nonstoichiometry, structure and transport properties of the two compositions (La-0.6 Sr-0.4)(0.99)CoO3-delta (LSC40) and La0.85Sr0.15CoO3-delta (LSC15) were measured. It was found that the oxygen nonstoichiometry as a function of the temperature and oxygen partial pressure could be described...... using the itinerant electron model. The electrical conductivity, sigma, of the materials is high (sigma > 500 S cm(-1)) in the measured temperature range (650 - 1000 degrees C) and oxygen partial pressure range (0.209-10(-4) atm). At 900 degrees C the electrical conductivity is 1365 and 1491 S cm(-1......) in air for LSC40 and LSC15, respectively. A linear correlation between the electrical conductivity and the oxygen vacancy concentration was found for both samples. The mobility of the electron-holes was inversely proportional with the absolute temperature indicating a metallic type conductivity for LSC40...

  16. Landau levels and magneto-transport property of monolayer phosphorene

    Science.gov (United States)

    Zhou, X. Y.; Zhang, R.; Sun, J. P.; Zou, Y. L.; Zhang, D.; Lou, W. K.; Cheng, F.; Zhou, G. H.; Zhai, F.; Chang, Kai

    2015-01-01

    We investigate theoretically the Landau levels (LLs) and magneto-transport properties of phosphorene under a perpendicular magnetic field within the framework of the effective k·p Hamiltonian and tight-binding (TB) model. At low field regime, we find that the LLs linearly depend both on the LL index n and magnetic field B, which is similar with that of conventional semiconductor two-dimensional electron gas. The Landau splittings of conduction and valence band are different and the wavefunctions corresponding to the LLs are strongly anisotropic due to the different anisotropic effective masses. An analytical expression for the LLs in low energy regime is obtained via solving the decoupled Hamiltonian, which agrees well with the numerical calculations. At high magnetic regime, a self-similar Hofstadter butterfly (HB) spectrum is obtained by using the TB model. The HB spectrum is consistent with the LL fan calculated from the effective k·p theory in a wide regime of magnetic fields. We find the LLs of phosphorene nanoribbon depend strongly on the ribbon orientation due to the anisotropic hopping parameters. The Hall and the longitudinal conductances (resistances) clearly reveal the structure of LLs. PMID:26159856

  17. Strain dependence of the heat transport properties of graphene nanoribbons

    International Nuclear Information System (INIS)

    Emmeline Yeo, Pei Shan; Loh, Kian Ping; Gan, Chee Kwan

    2012-01-01

    Using a combination of accurate density-functional theory and a nonequilibrium Green’s function method, we calculate the ballistic thermal conductance characteristics of tensile-strained armchair (AGNR) and zigzag (ZGNR) edge graphene nanoribbons, with widths between 3 and 50 Å. The optimized lateral lattice constants for AGNRs of different widths display a three-family behavior when the ribbons are grouped according to N modulo 3, where N represents the number of carbon atoms across the width of the ribbon. Two lowest-frequency out-of-plane acoustic modes play a decisive role in increasing the thermal conductance of AGNR-N at low temperatures. At high temperatures the effect of tensile strain is to reduce the thermal conductance of AGNR-N and ZGNR-N. These results could be explained by the changes in force constants in the in-plane and out-of-plane directions with the application of strain. This fundamental atomistic understanding of the heat transport in graphene nanoribbons paves a way to effect changes in their thermal properties via strain at various temperatures. (paper)

  18. Modeling silica aerogel optical performance by determining its radiative properties

    Directory of Open Access Journals (Sweden)

    Lin Zhao

    2016-02-01

    Full Text Available Silica aerogel has been known as a promising candidate for high performance transparent insulation material (TIM. Optical transparency is a crucial metric for silica aerogels in many solar related applications. Both scattering and absorption can reduce the amount of light transmitted through an aerogel slab. Due to multiple scattering, the transmittance deviates from the Beer-Lambert law (exponential attenuation. To better understand its optical performance, we decoupled and quantified the extinction contributions of absorption and scattering separately by identifying two sets of radiative properties. The radiative properties are deduced from the measured total transmittance and reflectance spectra (from 250 nm to 2500 nm of synthesized aerogel samples by solving the inverse problem of the 1-D Radiative Transfer Equation (RTE. The obtained radiative properties are found to be independent of the sample geometry and can be considered intrinsic material properties, which originate from the aerogel’s microstructure. This finding allows for these properties to be directly compared between different samples. We also demonstrate that by using the obtained radiative properties, we can model the photon transport in aerogels of arbitrary shapes, where an analytical solution is difficult to obtain.

  19. Modeling silica aerogel optical performance by determining its radiative properties

    Science.gov (United States)

    Zhao, Lin; Yang, Sungwoo; Bhatia, Bikram; Strobach, Elise; Wang, Evelyn N.

    2016-02-01

    Silica aerogel has been known as a promising candidate for high performance transparent insulation material (TIM). Optical transparency is a crucial metric for silica aerogels in many solar related applications. Both scattering and absorption can reduce the amount of light transmitted through an aerogel slab. Due to multiple scattering, the transmittance deviates from the Beer-Lambert law (exponential attenuation). To better understand its optical performance, we decoupled and quantified the extinction contributions of absorption and scattering separately by identifying two sets of radiative properties. The radiative properties are deduced from the measured total transmittance and reflectance spectra (from 250 nm to 2500 nm) of synthesized aerogel samples by solving the inverse problem of the 1-D Radiative Transfer Equation (RTE). The obtained radiative properties are found to be independent of the sample geometry and can be considered intrinsic material properties, which originate from the aerogel's microstructure. This finding allows for these properties to be directly compared between different samples. We also demonstrate that by using the obtained radiative properties, we can model the photon transport in aerogels of arbitrary shapes, where an analytical solution is difficult to obtain.

  20. Fundamental investigation of the transport properties of superacids in aqueous and non-aqueous media

    Science.gov (United States)

    Suarez, Sophia

    In the quest to develop more efficient energy providers one of the main focus of research has been on the improvement of ion transport. In lithium battery research this has led to the incorporation of various lithium salts, ceramics and plasticizers into the poly(ethylene)oxide (PEO) matrix, the polymer most used In Proton Conduction Membrane (PCM) fuel cell research this has led to the development of new membranes, which are designed with to replicate Nafion's ((c)DuPont) proton transport but also improve upon its deficiency of transporting intact fuel molecules and its dependence upon the presence of solvating water molecules. To better understand the process of ion transport, NMR was used to investigate dynamic properties such as D (self-diffusion coefficient) and T1 (spin-lattice relaxation time) of various proton and lithium ion-conducting systems. Ionic conductivity and viscosity measurements were also performed. The systems studied includes aqueous superacid solutions (trifluoromethanesulfonic (TFSA), para-toluenesulfonic (PTSA) and bis(trifluoromethanesulfonyl)imide (TFSI)); nano-porous (NP-) PCM's incorporating various ceramics and 3M fuel/2M H2SO4 solutions; and P(EO)20LiBETI (LiN(SO 2CF2CF3)2 composite incorporating SiO 2 ceramic nano particles. The objective of the study of the superacid solutions was to determine the effect of concentration on the transport. It was found that beyond the ionic conductivity maximum, fluctuations in both D and T1 supports the existence of local ordering in the ionic network, caused by the reduced solvent dielectric coefficient and increasing viscosity. Of the three superacids TFSA was the most conductive and most affected by reduced solvent concentration. For the P(EO)20LiBETI composite the aim was to determine the effect of the ceramic on the ion transport of the composite in a solvent free environment. Results show that the ceramic causes only modest increase in the lithium transport below 90°C. The objective in the

  1. Research Update: Structural and transport properties of (Ca,La)FeAs{sub 2} single crystal

    Energy Technology Data Exchange (ETDEWEB)

    Caglieris, F.; Pallecchi, I.; Lamura, G.; Putti, M. [CNR-SPIN and Università di Genova, Via Dodecaneso 33, I-16146 Genova (Italy); Sala, A. [CNR-SPIN and Università di Genova, Via Dodecaneso 33, I-16146 Genova (Italy); Department of Applied Chemistry, The University of Tokyo, Bunkyo, Tokyo 113-8656 (Japan); National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8565 (Japan); Fujioka, M. [National Institute for Materials Science (NIMS), Tsukuba, Ibaraki 305-0047 (Japan); Hokkaido University, Sapporo, Hokkaido 001-0020 (Japan); Hummel, F.; Johrendt, D. [Ludwig-Maximilians-Universität München, Department Chemie, Butenandtstr. 5-13, 81377 München (Germany); Takano, Y. [National Institute for Materials Science (NIMS), Tsukuba, Ibaraki 305-0047 (Japan); Ishida, S.; Iyo, A.; Eisaki, H. [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8565 (Japan); Ogino, H.; Yakita, H. [Department of Applied Chemistry, The University of Tokyo, Bunkyo, Tokyo 113-8656 (Japan); Shimoyama, J. [Department of Applied Chemistry, The University of Tokyo, Bunkyo, Tokyo 113-8656 (Japan); Department of Physics and Mathematics, Aoyama Gakuin University, 5-10-1 Fuchinobe, Chuo-ku, Sagamihara 252-5258 (Japan)

    2016-02-01

    Structural and transport properties in the normal and superconducting states are investigated in a Ca{sub 0.8}La{sub 0.2}FeAs{sub 2} single crystal with T{sub c} = 27 K, belonging to the newly discovered 112 family of iron based superconductors. The transport critical current density J{sub c} for both field directions measured in a focused ion beam patterned microbridge reveals a weakly field dependent and low anisotropic behaviour with a low temperature value as high as J{sub c}(B = 0) ∼ 10{sup 5} A/cm{sup 2}. This demonstrates not only bulk superconductivity but also the potential of 112 superconductors towards applications. Interestingly, this superconducting compound undergoes a structural transition below 100 K which is evidenced by temperature-dependent X-ray diffraction measurements. Data analysis of Hall resistance and magnetoresistivity indicate that magnetotransport properties are largely dominated by an electron band, with a change of regime observed in correspondence of the onset of a structural transition. In the low temperature regime, the contribution of a hole band to transport is suggested, possibly playing a role in determining the superconducting state.

  2. Transport and Fatigue Properties of Ferroelectric Polymer P(VDF-TrFE) For Nonvolatile Memory Applications

    KAUST Repository

    Hanna, Amir

    2012-01-01

    injection and transport are believed to affect various properties of ferroelectric films such as remnant polarization values and polarization fatigue behavior.. Thus, this thesis aims to study charge injection in P(VDF-TrFE) and its transport properties as a

  3. Computer program for calculation of complex chemical equilibrium compositions and applications. Supplement 1: Transport properties

    Science.gov (United States)

    Gordon, S.; Mcbride, B.; Zeleznik, F. J.

    1984-01-01

    An addition to the computer program of NASA SP-273 is given that permits transport property calculations for the gaseous phase. Approximate mixture formulas are used to obtain viscosity and frozen thermal conductivity. Reaction thermal conductivity is obtained by the same method as in NASA TN D-7056. Transport properties for 154 gaseous species were selected for use with the program.

  4. A new methodology for determination of macroscopic transport parameters in drying porous media

    Science.gov (United States)

    Attari Moghaddam, A.; Kharaghani, A.; Tsotsas, E.; Prat, M.

    2015-12-01

    Two main approaches have been used to model the drying process: The first approach considers the partially saturated porous medium as a continuum and partial differential equations are used to describe the mass, momentum and energy balances of the fluid phases. The continuum-scale models (CM) obtained by this approach involve constitutive laws which require effective material properties, such as the diffusivity, permeability, and thermal conductivity which are often determined by experiments. The second approach considers the material at the pore scale, where the void space is represented by a network of pores (PN). Micro- or nanofluidics models used in each pore give rise to a large system of ordinary differential equations with degrees of freedom at each node of the pore network. In this work, the moisture transport coefficient (D), the pseudo desorption isotherm inside the network and at the evaporative surface are estimated from the post-processing of the three-dimensional pore network drying simulations for fifteen realizations of the pore space geometry from a given probability distribution. A slice sampling method is used in order to extract these parameters from PN simulations. The moisture transport coefficient obtained in this way is shown in Fig. 1a. The minimum of average D values demonstrates the transition between liquid dominated moisture transport region and vapor dominated moisture transport region; a similar behavior has been observed in previous experimental findings. A function is fitted to the average D values and then is fed into the non-linear moisture diffusion equation. The saturation profiles obtained from PN and CM simulations are shown in Fig. 1b. Figure 1: (a) extracted moisture transport coefficient during drying for fifteen realizations of the pore network, (b) average moisture profiles during drying obtained from PN and CM simulations.

  5. Opto-electronic and quantum transport properties of semiconductor nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Sabathil, M.

    2005-01-01

    In this work a novel and efficient method for the calculation of the ballistic transport properties of open semiconductor nanostructures connected to external reservoirs is presented. It is based on the Green's function formalism and reduces the effort to obtain the transmission and the carrier density to a single solution of a hermitian eigenvalue problem with dimensions proportional to the size of the decoupled device and the multiple inversion of a small matrix with dimensions proportional to the size of the contacts to the leads. Using this method, the 4-band GaAs hole transport through a 2-dimensional three-terminal T-junction device, and the resonant tunneling current through a 3-dimensional InAs quantum dot molecule embedded into an InP heterostructure have been calculated. The further extension of the method into a charge self-consistent scheme enables the efficient prediction of the IV-characteristics of highly doped nanoscale field effect transistors in the ballistic regime, including the influence of quasi bound states and the exchange-correlation interaction. Buettiker probes are used to emulate the effect of inelastic scattering on the current for simple 1D devices, systematically analyzing the dependence of the density of states and the resulting self-consistent potential on the scattering strength. The second major topic of this work is the modeling of the optical response of quantum confined neutral and charged excitons in single and coupled self-assembled InGaAs quantum dots. For this purpose the existing device simulator nextnano{sup 3} has been extended to incorporate particle-particle interactions within the means of density functional theory in local density approximation. In this way the exciton transition energies for neutral and charged excitons as a function of an externally applied electric field have been calculated, revealing a systematic reduction of the intrinsic dipole with the addition of extra holes to the exciton, a finding

  6. The phase diagram and transport properties of MgO from theory and experiment

    Science.gov (United States)

    Shulenburger, Luke

    2013-06-01

    Planetary structure and the formation of terrestrial planets have received tremendous interest due to the discovery of so called super-earth exoplanets. MgO is a major constituent of Earth's mantle, the rocky cores of gas giants and is a likely component of the interiors of many of these exoplanets. The high pressure - high temperature behavior of MgO directly affects equation of state models for planetary structure and formation. In this work, we examine MgO under extreme conditions using experimental and theoretical methods to determine its phase diagram and transport properties. Using plate impact experiments on Sandia's Z facility the solid-solid phase transition from B1 to B2 is clearly determined. The melting transition, on the other hand, is subtle, involving little to no signal in us-up space. Theoretical work utilizing density functional theory (DFT) provides a complementary picture of the phase diagram. The solid-solid phase transition is identified through a series of quasi-harmonic phonon calculations and thermodynamic integration, while the melt boundary is found using phase coexistence calculations. One issue of particular import is the calculation of reflectivity along the Hugoniot and the influence of the ionic structure on the transport properties. Particular care is necessary because of the underestimation of the band gap and attendant overestimation of transport properties due to the use of semi-local density functional theory. We will explore the impact of this theoretical challenge and its potential solutions in this talk. The integrated use of DFT simulations and high-accuracy shock experiments together provide a comprehensive understanding of MgO under extreme conditions. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Company, for the U.S. DOE's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  7. Determination of standards for transportation of radioactive material by aircrafts

    International Nuclear Information System (INIS)

    1978-01-01

    These provisions are established on the basis of the Enforcement Regulation for the Law on Aviation. Terms are explained, such as exclusive loading and containers. Spontaneously ignitable liquid radioactive materials and the radioactive substances required to be contained in special vessels and others particularly operated during the transport, are excluded from the radioactive materials permissible for transport. The radioactive substances required to be transported as radioactive loadings don't include empty vessels used to contain radioactive materials and other things contaminated by such materials, when they conform to the prescriptions. The technical standards on radioactive loadings are defined, such as maximum radiation dose rate of 0.5 millirem per hour on the surface of L type loadings, 200 millirem per hour for A, and 1000 millirem per hour at the distance of 1 m for BM and BU types, respectively. Confirmation of the safeness of radioactive loadings may be made through the written documents prepared by the competent persons acknowledged by the Minister of Transport. The requisite of fissile loadings is that such loadings shall not reach critical state during the transport in the specified cases. Radioactive loadings or the containers with such loadings shall be loaded so that the safeness of such loadings is not injured by movement, overturn and fall during the transport. The maximum radiation dose rate of the containers with radioactive loadings shall not be more than 200 millirem per hour on the surface. The written documents describing the handling method and other matters for attention and the measures to be taken on accidents shall be carried with for the transport of radioactive loadings. (Okada, K.)

  8. Novel electrical transport properties in conducting polymers such as polythiophene and Poly(3-Methylthiophene)

    International Nuclear Information System (INIS)

    Kazama, Shigeo; Masubuchi, Shin-ichi; Matsuyama, Tomochika; Matsushita, Rokuji.

    1994-01-01

    Electric transport properties in most of the conducting organic polymers have provided a riddle that prevents a thorough physical understanding of the conduction mechanism. Major difficulties for approaching the most substantial aspect in the electrical transport properties underlie in complicated higher order structure inherent to polymeric materials consisting of crystalline regions entangled with disordered amorphous regions. In order to clearly understand the origin of the metallic nature of conducting polymers, we have to extract the proper transport properties characteristics of the ordered crystalline regions. We have made a series of experimental studies of the transport properties in conductive polythiophene and poly(3-methylthiophene) obtained with the electrochemical polymerization. For polythiophene, we have investigated both the as-grown samples and the ones that contain controlled amount of dopant species exchanged after the neutralization aiming to see the effect of dopant concentration on the transport properties. (author)

  9. Moisture transport properties of mortar and mortar joint: A NMR study

    OpenAIRE

    Brocken, H.J.P.; Adant, O.C.G.; Pel, L.

    1997-01-01

    The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick laying, curing conditions of mortar in mortar joint differ from curing conditions of separately cured mortar. Consequently, the moisture transport properties of mortar joint differ. In addition to the ...

  10. Moisture transport properties of mortar and mortar joint: a NMR study

    OpenAIRE

    Brocken, H.J.P.; Adan, O.C.G.; Pel, L.

    1997-01-01

    The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick laying, curing conditions of mortar in mortar joint differ from curing conditions of separately cured mortar. Consequently, the moisture transport properties of mortar joint differ. In addition to the ...

  11. Thermodynamic and transport properties of uranium dioxide and related phases

    International Nuclear Information System (INIS)

    1965-01-01

    The high melting point of uranium dioxide and its stability under irradiation have led to its use as a fuel in a variety of types of nuclear reactors. A wide range of chemical and physical studies has been stimulated by this circumstances and by the complex nature of the uranium dioxide phase itself. The boundaries of this phase widen as the temperature is increased; at 2000 deg. K a single, homogeneous phase exists from U 2.27 to a hypostoichiometric (UO 2-x ) composition, depending on the oxygen potential of the surroundings. Since there is often an incentive to operate a reactor at the maximum practicable heat rating and, therefore, maximum thermal gradient in the fuel, the determination of the physical properties of the UO 2-x phase becomes a matter of great technological importance. In addition a complex sequence of U-O phases may be formed during the preparation of powder feed material or during the sintering process; these affect the microstructure and properties of the final product and have also received much attention. 184 refs, 33 figs, 15 tabs

  12. Charge Carrier Transport Properties of Vacuum Evaporated Anthrylvinylbenzene Thin Films

    Directory of Open Access Journals (Sweden)

    Haikel HRICHI

    2014-05-01

    Full Text Available The charge carrier conduction processes and dielectric properties of two new materials based on anthracene core structure, 1-(9 anthrylvinyl-4-benzyloxybenzene (AVB and 1,4- bis(9-anthrylvinylbenzene (AV2B diodes have been investigated using dc current density–voltage (J–V and AC impedance spectroscopy (100 Hz–10 MHz. The DC electrical properties of ITO/anthracene derivative /Al device showing an ohmic behavior at low voltages and switches to space charge limited current (SCLC conduction with exponential trap distribution at higher voltages. The best performance device was achieved from ITO/AVB/Al structure showing the high charge carrier mobility which has also been evaluated from SCLC as 6.55´10-6 cm/Vs. According to the impedance spectroscopy results the structures were modeled by equivalent circuit designed as a parallel resistor Rp and capacitor Cp network in series with resistor Rs. The evolution of the electrical parameters with frequency and bias voltage of these anthracene-based systems has been discussed. The conductivity s(w evolution with frequency and bias voltage was studied for ITO/anthracene derivatives/Al devices. The dc conductivity sdc for these devices has been determined. The ac conductivity sac showed a variation in angular frequency as A.ws with a critical exponent s< 1 suggesting a hopping conduction mechanism at high frequency.

  13. Electronic transport properties of 4f shell elements of liquid metal using hard sphere Yukawa system

    Science.gov (United States)

    Patel, H. P.; Sonvane, Y. A.; Thakor, P. B.

    2018-04-01

    The electronic transport properties are analyzed for 4f shell elements of liquid metals. To examine the electronic transport properties like electrical resistivity (ρ), thermal conductivity (σ) and thermo electrical power (Q), we used our own parameter free model potential with the Hard Sphere Yukawa (HSY) reference system. The screening effect on aforesaid properties has been examined by using different screening functions like Hartree (H), Taylor (T) and Sarkar (S). The correlations of our resultsand other data with available experimental values are intensely promising. Also, we conclude that our newly constructed parameter free model potential is capable of explaining the above mentioned electronic transport properties.

  14. Transport properties near the superfluid transition in helium

    International Nuclear Information System (INIS)

    Ikushima, Akira

    1980-01-01

    Description are given primarily on recent experimental results and related topics of acoustic attenuation and dispersion, and of thermal transport properties near the superfluid transition in pure 4 He and 3 He- 4 He mixtures ( 3 He). Attenuation and dispersion of sound above the lambda point T sub(lambda) can well be understood fundamentally from the dynamic scaling hypothesis with the mode coupling theory. Attenuation and dispersion at T sub(lambda) as a function of frequency is expressed with the exponent which is slightly dependent on frequency and on 3 He concentration. The situation below T sub(lambda) would still have problems since at higher frequencies the simple splitting of observed attenuation and dispersion into that due to order-parameter fluctuation and that due to order-parameter relaxation proposed by Pokrovskii and Khalatnikov does not work. The possibility that the recent theory of Ferrell and Bhattacharjee offers explanations for the results above and below T sub(lambda) is discussed. Thermal conductivity in 4 He and mixtures, and thermo-diffusion ratio in mixtures are measured near the superfluid transition points. Thermal conductivity in the absence of a concentration gradient and its corresponding thermal diffusivity are then calculated. The critical exponent of this thermal diffusivity is approximately 1/3, irrespective of 3 He concentration. The thermo-diffusion ratio has very weak divergence, if any, when T sub(lambda) is approached. Two damping modes in mixtures in non-stationary condition are then calculated. Only the mode corresponding to the Brillouin linewidth does diverge with critical exponent approximately equal to 1/3, irrespective of 3 He concentration. (author)

  15. Thermodynamic and transport properties of two-temperature SF6 plasmas

    International Nuclear Information System (INIS)

    Wang Weizong; Rong Mingzhe; Wu Yi; Spencer, Joseph W.; Yan, Joseph D.; Mei, DanHua

    2012-01-01

    This paper deals with thermodynamic and transport properties of SF 6 plasmas in a two-temperature model for both thermal equilibrium and non-equilibrium conditions. The species composition and thermodynamic properties are numerically determined using the two-temperature Saha equation and Guldberg-Waage equation according to deviation of van de Sanden et al. Transport properties including diffusion coefficient, viscosity, thermal conductivity, and electrical conductivity are calculated with most recent collision interaction potentials by adopting Devoto’s electron and heavy particle decoupling approach but expanded to the third-order approximation (second-order for viscosity) in the frame of Chapman–Enskog method. The results are computed for various values of pressures from 0.1 atm to 10 atm and ratios of the electron temperature to the heavy particle temperature from 1 to 20 with electron temperature range from 300 to 40 000 K. In the local thermodynamic equilibrium regime, results are compared with available results of previously published studies.

  16. Experimental characterization of the water transport properties of PEM fuel cells diffusion media

    Science.gov (United States)

    Ramos-Alvarado, Bladimir; Sole, Joshua D.; Hernandez-Guerrero, Abel; Ellis, Michael W.

    2012-11-01

    A full experimental characterization of the liquid water transport properties of Toray TGP-090 paper is carried out in this work. Porosity, capillary pressure curves (capillary pressure-saturation relationships), absolute permeability, and relative permeability are obtained via experimental procedures. Porosity was determined using two methods, both aimed to obtain the solid volume of the network of fibers comprising the carbon paper. Capillary pressure curves were obtained using a gas displacement porosimeter where liquid water is injected using a syringe pump and the capillary pressure is recorded using a differential pressure transducer. Absolute and relative permeability were also measured with an apparatus designed at Virginia Tech. Absolute permeability was calculated at different flow rates using nitrogen. On the other hand, relative permeability was a more complicated task to carry out giving the complexity (two-phase flow condition) of this property. All of the water transport properties of Toray TGP-090 were studied under the effects of wet-proofing (PTFE treatment) and compression. Some observations were that wet-proofing reduces the porosity of the raw material, increases the hydrophobicity (Pc-S curves), and reduces the permeability of the material. Similar effects were observed for compression, where compressed material exhibited trends similar to those of wet-proofing effects. The results presented here will allow a more accurate modeling of PEMFCs, providing an experimentally verified alternative to the assumptions frequently employed.

  17. 40 CFR 93.106 - Content of transportation plans and timeframe of conformity determinations.

    Science.gov (United States)

    2010-07-01

    ... transportation analysis in use by the MPO. Transit facilities, equipment, and services envisioned for the future... plans which meet those requirements. Otherwise, the transportation system envisioned for the future must... determination; (iv) The last year of the transportation plan's forecast period must be a horizon year; and (v...

  18. Determining the production capacity of train transportation for overburden removal

    Energy Technology Data Exchange (ETDEWEB)

    Knahl, G; Szabados, L; Nowotny, A

    1980-02-01

    Details of two computer programs developed at the Institute of Energetics in Leipzig, GDR for use on large BESM-6 computer of the Institute are provided. One is the so-called time funds program concentrating on coal and overburden output, production time requirements and time losses. The other is a simulation program for overburden removal by train. It includes 14 pieces of heavy mining equipment, six industrial consumers and a rail network with 80 connections and 40 trains. The program was used with success in 1979 and will be further developed. Additional utilization is seen in projecting transportation in new surface mines, optimizing rail transport in existing mines for the preparation of annual train transportation plans. (In German)

  19. Identifying the Critical Links in Road Transportation Networks: Centrality-based approach utilizing structural properties

    Energy Technology Data Exchange (ETDEWEB)

    Chinthavali, Supriya [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-04-01

    Surface transportation road networks share structural properties similar to other complex networks (e.g., social networks, information networks, biological networks, and so on). This research investigates the structural properties of road networks for any possible correlation with the traffic characteristics such as link flows those determined independently. Additionally, we define a criticality index for the links of the road network that identifies the relative importance in the network. We tested our hypotheses with two sample road networks. Results show that, correlation exists between the link flows and centrality measures of a link of the road (dual graph approach is followed) and the criticality index is found to be effective for one test network to identify the vulnerable nodes.

  20. Comparison of Themodynamic and Transport Property Models for Computing Equilibrium High Enthalpy Flows

    Science.gov (United States)

    Ramasahayam, Veda Krishna Vyas; Diwakar, Anant; Bodi, Kowsik

    2017-11-01

    To study the flow of high temperature air in vibrational and chemical equilibrium, accurate models for thermodynamic state and transport phenomena are required. In the present work, the performance of a state equation model and two mixing rules for determining equilibrium air thermodynamic and transport properties are compared with that of curve fits. The thermodynamic state model considers 11 species which computes flow chemistry by an iterative process and the mixing rules considered for viscosity are Wilke and Armaly-Sutton. The curve fits of Srinivasan, which are based on Grabau type transition functions, are chosen for comparison. A two-dimensional Navier-Stokes solver is developed to simulate high enthalpy flows with numerical fluxes computed by AUSM+-up. The accuracy of state equation model and curve fits for thermodynamic properties is determined using hypersonic inviscid flow over a circular cylinder. The performance of mixing rules and curve fits for viscosity are compared using hypersonic laminar boundary layer prediction on a flat plate. It is observed that steady state solutions from state equation model and curve fits match with each other. Though curve fits are significantly faster the state equation model is more general and can be adapted to any flow composition.

  1. Basic properties of fuel determining its behavior under irradiation

    International Nuclear Information System (INIS)

    Konovalov, I.I.

    2000-01-01

    The theoretical model describing a swelling of nuclear fuel at low irradiation temperatures is considered. The critical physical parameters of substances determining behavior of point defects, gas fission atoms, dislocation density, nucleation and growth of gas-contained pores are determined. The correlation between meanings of critical parameters and physical properties of substance is offered. The accounts of swelling of various dense fuels with reference to work in conditions of research reactors are given. (author)

  2. Modifying zirconia solid electrolyte surface property to enhance oxide transport

    Energy Technology Data Exchange (ETDEWEB)

    Liaw, B.Y.; Song, S.Y. [Univ. of Hawaii, Honolulu, HI (United States)

    1996-12-31

    Bismuth-strontium-calcium-copper oxide (Bi{sub 2}Sr{sub 2}CaCu{sub 2}O{sub 8}, BSCCO) is known for its high T{sub c} superconducting behavior and mixed conducting property. The applicability of similar high T{sub c} cuprates for intermediate-temperature solid oxide fuel cell (SOFC) application has been studied recently. We investigated the electrochemical behavior of several Ag{vert_bar}BSCCO{vert_bar}10 mol% yttria-stabilized zirconia (YSZ){vert_bar}Ag and Ag{vert_bar}YSZ{vert_bar}Ag cells using complex impedance spectroscopy. A highly uniform and porous microstructure was observed at the interface of the YSZ and BSCCO. The ionic conductivity determined from the Nyquest plots in the temperature range of 200-700{degrees}C agrees with the values reported in the literature. The specific resistance of the BSCCO{vert_bar}YSZ interface was also determined to be lower than those of the conventional manganite electrode, suggesting that BSCCO seems attractive for cathode applications in SOFC.

  3. the determinants of demand for public transport services in kumasi

    African Journals Online (AJOL)

    dmosman.admin

    The objective of the study was to establish the major factors influencing demand as well as de- velop a demand model for urban passenger transport services in Kumasi, Ghana. ... Cities in developing countries often spend be- ... the total urban road network was in “Good” ... several other functions of a national, regional.

  4. System-wide organization of actin cytoskeleton determines organelle transport in hypocotyl plant cells

    Science.gov (United States)

    Nowak, Jacqueline; Ivakov, Alexander; Somssich, Marc; Persson, Staffan; Nikoloski, Zoran

    2017-01-01

    The actin cytoskeleton is an essential intracellular filamentous structure that underpins cellular transport and cytoplasmic streaming in plant cells. However, the system-level properties of actin-based cellular trafficking remain tenuous, largely due to the inability to quantify key features of the actin cytoskeleton. Here, we developed an automated image-based, network-driven framework to accurately segment and quantify actin cytoskeletal structures and Golgi transport. We show that the actin cytoskeleton in both growing and elongated hypocotyl cells has structural properties facilitating efficient transport. Our findings suggest that the erratic movement of Golgi is a stable cellular phenomenon that might optimize distribution efficiency of cell material. Moreover, we demonstrate that Golgi transport in hypocotyl cells can be accurately predicted from the actin network topology alone. Thus, our framework provides quantitative evidence for system-wide coordination of cellular transport in plant cells and can be readily applied to investigate cytoskeletal organization and transport in other organisms. PMID:28655850

  5. determination of some physical properties of three groundnut varieties

    African Journals Online (AJOL)

    Dr Obe

    groundnuts. Three varieties of groundnuts namely ICGV-SM-93523, RMP-9 and RMP- 12 were collected and some of the physical properties, such as weight, angle of repose, coefficient of friction, bulk density, size, shape and moisture content were determined. The angle of repose for the three varieties was found to range ...

  6. Determination of the Thermophysical Properties of Nsukkanut: A ...

    African Journals Online (AJOL)

    The thermophysical properties of 'Nsukkanut', - a CaCl2/CaSO4 absorbent mixture used in solid absorption solar refrigeration [1], were studied in this report. The transient experimental technique of Beck and Al-Araji [12] was used in determining the effective thermal conductivity, specific heat and bulk thermal diffusivity of ...

  7. Electrical transport properties of calcium and barium aluminates

    NARCIS (Netherlands)

    Metselaar, R.; Hoefsloot, A.M.

    1987-01-01

    Electrical conductivity and ionic transport numbers have been measured of barium and calcium aluminates with composition CaO·nAl2O3 (n=7/12, 1, 2, 6) and 0.82 BaO·6Al2O3. At room temperatures these compounds are insulators, but at high temperatures mixed conductivity is observed. Ionic transport

  8. Structural Properties of the Brazilian Air Transportation Network

    Directory of Open Access Journals (Sweden)

    GUILHERME S. COUTO

    2015-09-01

    Full Text Available The air transportation network in a country has a great impact on the local, national and global economy. In this paper, we analyze the air transportation network in Brazil with complex network features to better understand its characteristics. In our analysis, we built networks composed either by national or by international flights. We also consider the network when both types of flights are put together. Interesting conclusions emerge from our analysis. For instance, Viracopos Airport (Campinas City is the most central and connected airport on the national flights network. Any operational problem in this airport separates the Brazilian national network into six distinct subnetworks. Moreover, the Brazilian air transportation network exhibits small world characteristics and national connections network follows a power law distribution. Therefore, our analysis sheds light on the current Brazilian air transportation infrastructure, bringing a novel understanding that may help face the recent fast growth in the usage of the Brazilian transport network.

  9. Structural Properties of the Brazilian Air Transportation Network.

    Science.gov (United States)

    Couto, Guilherme S; da Silva, Ana Paula Couto; Ruiz, Linnyer B; Benevenuto, Fabrício

    2015-09-01

    The air transportation network in a country has a great impact on the local, national and global economy. In this paper, we analyze the air transportation network in Brazil with complex network features to better understand its characteristics. In our analysis, we built networks composed either by national or by international flights. We also consider the network when both types of flights are put together. Interesting conclusions emerge from our analysis. For instance, Viracopos Airport (Campinas City) is the most central and connected airport on the national flights network. Any operational problem in this airport separates the Brazilian national network into six distinct subnetworks. Moreover, the Brazilian air transportation network exhibits small world characteristics and national connections network follows a power law distribution. Therefore, our analysis sheds light on the current Brazilian air transportation infrastructure, bringing a novel understanding that may help face the recent fast growth in the usage of the Brazilian transport network.

  10. Strategy for the use of laboratory methods in the site investigations programme for the transport properties of the rock

    Energy Technology Data Exchange (ETDEWEB)

    Widestrand, Henrik; Byegaard, Johan [Geosigma AB, Kungaelv (Sweden); Ohlsson, Yvonne [SWECO VIAK AB, Stockholm (Sweden); Tullborg, Eva-Lena [Terralogica AB, Graabo (Sweden)

    2003-06-01

    This report comprises a strategy for the handling of laboratory investigations of diffusivity and sorption characteristics within the discipline-specific programme 'Transport Properties of the Rock' in the SKB site investigations. The aim of the transport programme is to investigate the solute transport properties at a site in order to acquire data that are required for an assessment of the long-term performance and radiological safety of the deep repository. The result of the transport programme is the Transport Properties Site Descriptive Model, i.e. a description of the site-specific properties for the transport of solutes in the groundwater at a site. A strategy for the methodology, control of sampling and characterisation programme and interpretation of the results, is proposed. The basis for the laboratory investigations is a conceptual geological model based on the geological model produced in the geology programme. Major and minor types of rock and fractures are defined and characterised according to the quality of the general database and site-specific needs. The selection of samples and analyses is determined in close co-operation with the geology, hydrogeology, hydrogeochemistry and rock mechanics programmes. The result of the laboratory investigations is a retardation model, which is used as an input in the Transport Properties Site Descriptive Model. The interpretation and production of a retardation model is described and exemplified. Lastly, method-specific strategies and recommendations are given, including strategies for the selection of tracers in the experiments and for the treatment of the sampled geologic materials.

  11. Magnetoelectric and transport properties of (GaMn)Sb thin films: A ferrimagnetic phase in dilute alloys

    Energy Technology Data Exchange (ETDEWEB)

    Calderón, Jorge A. [Universidad Nacional de Colombia – Bogotá, Dpto. de Física, Grupo de Materiales Nanoestructurados y sus Aplicaciones, Cra. 30 No. 45-03 Edificio 404 Lab. 121C Ciudad Universitaria, Bogotá (Colombia); Mesa, F., E-mail: fredy.mesa@urosario.edu.co [Grupo NanoTech, Facultad de Ciencias Naturales y Matemáticas, Universidad del Rosario, Cra. 24 No. 63C-69, Bogotá (Colombia); Dussan, A. [Universidad Nacional de Colombia – Bogotá, Dpto. de Física, Grupo de Materiales Nanoestructurados y sus Aplicaciones, Cra. 30 No. 45-03 Edificio 404 Lab. 121C Ciudad Universitaria, Bogotá (Colombia)

    2017-02-28

    Highlights: • (GaMn)Sb thin films were fabricated using the direct current (DC) magnetron co-sputtering. • Presence of ferrimagnetic (Mn{sub 2}Sb) and ferromagnetic (Mn{sub 2}Sb{sub 2}) phases. • A minor difference of 1% was found with respect to percolation theory, which confirmed the validity of the diffusional model in semiconductor alloys with magnetic properties. • Increase in the localized states density (N{sub F}) with increasing substrate temperature. - Abstract: We studied the electrical, magnetic, and transport properties of (GaMn)Sb thin films fabricated by the direct current magnetron co-sputtering method. Using X-ray powder diffraction measurements, we identified the presence of ferrimagnetic (Mn{sub 2}Sb) and ferromagnetic (Mn{sub 2}Sb{sub 2}) phases within the films. We also measured the magnetization of the films versus an applied magnetic field as well as their hysteresis curves at room temperature. We determined the electrical and transport properties of the films through temperature-dependent resistivity measurements using the Van Der Pauw method. The main contribution to the transport process was variable range hopping. Hopping parameters were calculated using percolation theory and refined using the diffusional model. In addition, we determined that all samples had p type semiconductor behavior, that there was an increase in the density of localized states near the Fermi level, and that the binary magnetic phases influenced the electrical properties and transport mechanisms.

  12. Preparation and transport properties of novel lithium ionic liquids

    International Nuclear Information System (INIS)

    Shobukawa, Hitoshi; Tokuda, Hiroyuki; Tabata, Sei-Ichiro; Watanabe, Masayoshi

    2004-01-01

    Novel lithium salts of borates having two electron-withdrawing groups (either 1,1,1,3,3,3-hexafluoro-2-propoxy or pentafluorophenoxy group) and two methoxy-oligo(ethylene oxide) groups (number of repeating unit: n = 3, 4, 7.2) were prepared by successive substitution-reactions from LiBH 4 . The obtained lithium salts were clear and colorless liquids at room temperature. The density, thermal property, viscosity, and ionic conductivity were measured for the lithium ionic liquids. The pulsed-gradient spin-echo NMR (PGSE-NMR) method was used to independently determine self-diffusion coefficients of the lithium cation ( 7 Li NMR) and the anion ( 19 F NMR) in the bulk. The ionic conductivity of the new lithium salts was 10 -5 to 10 -4 S cm -1 at 30 deg. C, which was lower than that of typical ionic liquids by two orders of magnitude. However, the degree of self-dissociation of the lithium ionic liquids; the ratio of the molar conductivity determined by the complex impedance method to that calculated from the self-diffusion coefficients and the Nernst-Einstein equation, ranged from 0.1 to 0.4, which are comparable values to those of a highly dissociable salt in an aprotic polar solvent and of typical ionic liquids. The main reason for the meager conductivity was high viscosities of the lithium ionic liquids. It should be noted that the lithium ionic liquids have self-dissociation ability and conduct the ions in the absence of organic solvents

  13. Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

    Energy Technology Data Exchange (ETDEWEB)

    Barea, Eva M. [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Garcia-Belmonte, Germa, E-mail: garciag@uji.e [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Sommer, Michael; Huettner, Sven [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany); Bolink, Henk J. [Molecular Science Institute-Universitat de Valencia, Poligon La Coma s/n, 46980 Paterna, Valencia (Spain); Thelakkat, Mukundan, E-mail: mukundan.thelakkat@uni-bayreuth.d [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany)

    2010-04-02

    Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between {approx} 10{sup -8} and 10{sup -6} cm{sup 2} V{sup -1} s{sup -1} are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

  14. Electrolytes: transport properties and non-equilibrium thermodynamics

    International Nuclear Information System (INIS)

    Miller, D.G.

    1980-12-01

    This paper presents a review on the application of non-equilibrium thermodynamics to transport in electrolyte solutions, and some recent experimental work and results for mutual diffusion in electrolyte solutions

  15. Reference dataset of volcanic ash physicochemical and optical properties for atmospheric measurement retrievals and transport modelling

    Science.gov (United States)

    Vogel, Andreas; Durant, Adam; Sytchkova, Anna; Diplas, Spyros; Bonadonna, Costanza; Scarnato, Barbara; Krüger, Kirstin; Kylling, Arve; Kristiansen, Nina; Stohl, Andreas

    2016-04-01

    Explosive volcanic eruptions emit up to 50 wt.% (total erupted mass) of fine ash particles (estimates of the volcanic source term and the nature of the constituent volcanic ash properties. Consequently, it is important to include a quantitative assessment of measurement uncertainties of ash properties to provide realistic ash forecast uncertainty. Currently, information on volcanic ash physicochemical and optical properties is derived from a small number of somewhat dated publications. In this study, we provide a reference dataset for physical (size distribution and shape), chemical (bulk vs. surface chemistry) and optical properties (complex refractive index in the UV-vis-NIR range) of a representative selection of volcanic ash samples from 10 different volcanic eruptions covering the full variability in silica content (40-75 wt.% SiO2). Through the combination of empirical analytical methods (e.g., image analysis, Energy Dispersive Spectroscopy, X-ray Photoelectron Spectroscopy, Transmission Electron Microscopy and UV/Vis/NIR/FTIR Spectroscopy) and theoretical models (e.g., Bruggeman effective medium approach), it was possible to fully capture the natural variability of ash physicochemical and optical characteristics. The dataset will be applied in atmospheric measurement retrievals and atmospheric transport modelling to determine the sensitivity to uncertainty in ash particle characteristics.

  16. Determination of prerequisites for the estimation of transportation cost of spent fuels

    International Nuclear Information System (INIS)

    Choi, Heui Joo; Lee, Jong Youl; Kim, Seong Ki; Cha, Jeong Hoon; Choi, Jong Won

    2007-10-01

    The cost for the spent fuel management includes the costs for the interim storage, the transportation, and the permanent disposal of the spent fuels. The scope of this report is limited to the cost for the spent fuel transportation. KAERI is developing a cost estimation method for the spent fuel transportation through a joint study with the French AREVA TN. Several prerequisites should be fixed in order to estimate the cost for the spent fuel transportation properly. In this report we produced them considering the Korean current status on the management of spent fuels. The representative characteristics of a spent fuel generated from the six nuclear reactors at the YG site were determined. Total 7,200 tons of spent fuels are projected with the lifespan of 60 years. As the transportation mode, sea transportation and road transportation is recommended considering the location of the YG site and the hypothetical Centralized Interim Storage Facility (CISF) and Final Repository (FR). The sea route and transportation time were analyzed by using a sea distance analysis program which the NORI (National Oceanographic Research Institute) supplies on a web. Based on the results of the analysis, the shipping rates were determined. The regulations related to the spent fuel transportation were reviewed. The characteristics of the transportation vessel and a trailer were suggested. The handling and transportation systems at the YG site, Centralized Interim Storage Facility, and the Final Repository were described in detail for the purpose of the cost estimation of the spent fuel transportation. From the detail description the major components of the transportation system were determined for the conceptual design. It is believed that the conceptual design of the transportation system developed in this report will be used for the analysis of transportation logistics and the cost estimation of spent fuels

  17. Effective interactions, transport properties, and elementary excitations in helium three-helium four mixtures

    International Nuclear Information System (INIS)

    Hsu, W.

    1984-01-01

    A unified theory of effective interaction, elementary excitations, transport properties, and possible superfluidity of 3 He- 4 He mixtures was developed. The basic approach is patterned after that of Aldrich and Pines (AP) for pure 4 He and 3 He, in which the consequence of the strong interactions in 3 He and 4 He is described in terms of self-consistent fields. The strength of these fields are determined by physical arguments, static measurement, and sum rule considerations. A set of pseudopotentials was developed to describe the 3 He- 3 He and 3 He- 4 He interactions. In the long wavelength and zero concentration limit, these potentials are obtained by the thermodynamic argument of Bardeen, Baym, and Pines. At finite concentration and finite momentum transfer, these potentials are obtained with the aids of a scaling law and the AP pseudopotential theory. From these pseudopotentials, the scattering amplitudes, transport coefficients, and normal-superfluid transition temperature are calculated as functions of 3 He concentration. Good agreement is obtained between theory and experiment for low temperature transport coefficients, and the 3 He superfluid transition temperature is predicted to be approx. -80 K. The change in the density fluctuation excitation spectrum of 4 He atoms in 3 He- 4 He mixtures is calculated

  18. Psychometric properties of the assessment of quality of working life scale in the urban transport sector

    Directory of Open Access Journals (Sweden)

    Hernán Alberto Figueroa-Chaves

    2017-12-01

    Full Text Available Introduction: The Quality of Working Life (QWL is the degree of satisfaction, physical, mental and social well-being experienced by people in their working environment; it contains the objective and subjective dimensions. For this study, the subjective dimension of the QWL was addressed, which is formed by occupational health, labor welfare and perception of the work. Objective: To determine the psychometric properties of the assessment of quality of life scale at work in the transport sector. Materials and methods: A quantitative descriptive-instrumental study of the scale was made, which consists of 108 items and was applied to 468 drivers of the strategic system of public transport in the city of San Juan de Pasto. The evidence of Kaiser Meyer Olkin and roundness of Bartlett, the factorial analysis and Cronbach Alpha were calculated. Results: The scale presented appropriate features of validity and reliability. It evaluates two factors: labor welfare and healthy life styles, and the respective scales to be applied are presented. Conclusions: The factorial analysis allows us to affirm that the Scale of Quality of Working Life in the transport sector can be applied in subsequent studies.

  19. Ionic structures and transport properties of hot dense W and U plasmas

    Science.gov (United States)

    Hou, Yong; Yuan, Jianmin

    2016-10-01

    We have combined the average-atom model with the hyper-netted chain approximation (AAHNC) to describe the electronic and ionic structure of uranium and tungsten in the hot dense matter regime. When the electronic structure is described within the average-atom model, the effects of others ions on the electronic structure are considered by the correlation functions. And the ionic structure is calculated though using the hyper-netted chain (HNC) approximation. The ion-ion pair potential is calculated using the modified Gordon-Kim model based on the electronic density distribution in the temperature-depended density functional theory. And electronic and ionic structures are determined self-consistently. On the basis of the ion-ion pair potential, we perform the classical (CMD) and Langevin (LMD) molecular dynamics to simulate the ionic transport properties, such as ionic self-diffusion and shear viscosity coefficients, through the ionic velocity correlation functions. Due that the free electrons become more and more with increasing the plasma temperature, the influence of the electron-ion collisions on the transport properties become more and more important.

  20. D2O, Computation of Thermodynamic and Transport Properties of Heavy Water

    International Nuclear Information System (INIS)

    Durmayaz, Ahmet

    2000-01-01

    1 - Description of program or function: A computer program for the fast computation of the thermodynamic and transport properties of heavy water (D 2 O) at saturation, in subcooled liquid and superheated vapor states. Specific volume (or density), specific enthalpy, specific entropy, constant-pressure specific heat and temperature at saturation are calculated by a number of piecewise continuous approximation functions of (and their derivatives are calculated with respect to) pressure whereas pressure at saturation is calculated by a piecewise continuous approximation function of temperature for heavy water. Density in subcooled liquid state, specific volume in super-heated vapor state, specific enthalpy, specific entropy and constant-pressure specific heat in both of these states are calculated by some piecewise continuous approximation functions of pressure and temperature for heavy water. The correlations used in the calculation of these thermodynamic properties of heavy water were derived by fitting some appropriate curves to the data given in the steam tables by Hill et al (1981). The whole set of correlations and the approximation method used in their derivation are presented by Durmayaz (1997). Dynamic viscosity and thermal conductivity for heavy water are calculated as functions of temperature and density with the correlations given by Hill et al (1981), by Matsunaga and Nagashima (1983) and by Kestin et al (1984). Surface tension for heavy water is calculated as a function of temperature with the correlation given by Crabtree and Siman-Tov (1993). 2 - Methods: A group of pressure-enthalpy (P-h) pairs can be given in an input data file or assigned in the main program without knowing the state in which fluid takes place. In this case, first, the enthalpies at saturation corresponding to the given pressure are computed. Second, the state is determined by comparing the given enthalpy to the saturation enthalpies. Then, the properties are computed. Program D 2 O

  1. First-Principles Calculations of Electronic, Optical, and Transport Properties of Materials for Energy Applications

    Science.gov (United States)

    Shi, Guangsha

    theoretical upper limit of the figure of merit. I also determined the electronic structures and thermoelectric properties of Mg2Si, Mg2Ge, and Mg2Sn, a family of Earth-abundant thermoelectric compounds. I uncovered the importance of quasiparticle corrections and the proper treatment of pseudopotentials in the determination of the band gaps and the thermoelectric transport properties at high temperatures. The methods and codes I developed in my research form a general predictive toolbox for the design and optimization of the functional properties of materials for energy applications.

  2. Detecting the local transport properties and the dimensionality of transport of epitaxial graphene by a multi-point probe approach

    DEFF Research Database (Denmark)

    Barreto, Lucas; Perkins, Edward; Johannsen, Jens

    2013-01-01

    The electronic transport properties of epitaxial monolayer graphene (MLG) and hydrogen-intercalated quasi free-standing bilayer graphene (QFBLG) on SiC(0001) are investigated by micro multi-point probes. Using a probe with 12 contacts, we perform four-point probe measurements with the possibility...

  3. Determination of physical properties of fibrous thermal insulation

    Directory of Open Access Journals (Sweden)

    Jeandel G.

    2012-10-01

    Full Text Available The objective of this study is to characterize both experimentally and theoretically, conductive and radiative heat transfer within polyester batting. This material is derived from recycled bottles (PET with fibres of constant diameters. Two other mineral and plant fibrous insulation materials, (glass wool and hemp wool are also characterized for comparative purposes. To determine the overall thermophysical properties of the tested materials, heat flux measurement are carried out using a device developed in house. The radiative properties of the material are determined by an inverse method based on measurements of transmittance and reflectance using a FTIR spectrometer and by solving the equation of radiative heat transfer. These measures are compared to results of numerical simulations.

  4. Transport properties of hydrogen passivated silicon nanotubes and silicon nanotube field effect transistors

    KAUST Repository

    Montes Muñ oz, Enrique; Schwingenschlö gl, Udo

    2017-01-01

    We investigate the electronic transport properties of silicon nanotubes attached to metallic electrodes from first principles, using density functional theory and the non-equilibrium Green's function method. The influence of the surface termination

  5. Synthesis, transport and dielectric properties of polyaniline/Co3O4 ...

    Indian Academy of Sciences (India)

    TECS

    Synthesis, transport and dielectric properties of polyaniline/Co3O4 composites ... Initial increment in conductivity is due to extended chain length of polyaniline where polarons possess .... Figure 3 displays the scanning electron micrograph of.

  6. Physicochemical properties and transport of steroids across Caco-2 cells

    NARCIS (Netherlands)

    Faassen, F.; Kelder, J.; Lenders, J.; Onderwater, R.; Vromans, H.

    2003-01-01

    Purpose. The purpose of this work was to study the relevant physicochemical properties for the absorption of steroids. Methods. Various physicochemical properties of steroids were calculated (molecular weight, ClogP, static polar surface area [PSA], etc.). Within this series of steroids, different

  7. Tunable electronic transport properties of silicon-fullerene-linked nanowires: Semiconductor, conducting wire, and tunnel diode

    OpenAIRE

    Nishio, Kengo; Ozaki, Taisuke; Morishita, Tetsuya; Mikami, Masuhiro

    2010-01-01

    We explore the possibility of controllable tuning of the electronic transport properties of silicon-fullerene-linked nanowires by encapsulating guest atoms into their cages. Our first-principles calculations demonstrate that the guest-free nanowires are semiconductors, and do not conduct electricity. The iodine or sodium doping improves the transport properties, and makes the nanowires metallic. In the junctions of I-doped and Na-doped NWs, the current travels through the boundary by quantum ...

  8. First-principles-based study of transport properties of Fe thin films on Cu surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Kishi, Tomoya [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Kasai, Hideaki [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Nakanishi, Hiroshi [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Dino, Wilson Agerico [Department of Applied Physics, Osaka University, Suita, Osaka 565-0871 (Japan); Komori, Fumio [Institute for Solid State Physics, University of Tokyo, Kashiwa, Chiba 277-8587 (Japan)

    2004-12-08

    We investigate the transport properties of Fe thin films on Cu(111) based on first principles calculation. We calculate the electron current through these Fe thin films, which can be observed by using a double-tipped scanning tunnelling microscope. We find that the conductance is majority spin polarized. On the basis of the band structures for this system, we discuss the origin of these interesting transport properties.

  9. First-principles-based study of transport properties of Fe thin films on Cu surfaces

    International Nuclear Information System (INIS)

    Kishi, Tomoya; Kasai, Hideaki; Nakanishi, Hiroshi; Dino, Wilson Agerico; Komori, Fumio

    2004-01-01

    We investigate the transport properties of Fe thin films on Cu(111) based on first principles calculation. We calculate the electron current through these Fe thin films, which can be observed by using a double-tipped scanning tunnelling microscope. We find that the conductance is majority spin polarized. On the basis of the band structures for this system, we discuss the origin of these interesting transport properties

  10. Core transport properties in JT-60U and JET identity plasmas

    NARCIS (Netherlands)

    Litaudon, X.; Sakamoto, Y.; de Vries, P. C.; Salmi, A.; Tala, T.; Angioni, C.; Benkadda, S.; Beurskens, M. N. A.; Bourdelle, C.; Brix, M.; Crombe, K.; Fujita, T.; Futatani, S.; Garbet, X.; Giroud, C.; Hawkes, N. C.; Hayashi, N.; Hoang, G. T.; Hogeweij, G. M. D.; Matsunaga, G.; Nakano, T.; Oyama, N.; Parail, V.; Shinohara, K.; Suzuki, T.; Takechi, M.; Takenaga, H.; Takizuka, T.; Urano, H.; Voitsekhovitch, I.; Yoshida, M.

    2011-01-01

    The paper compares the transport properties of a set of dimensionless identity experiments performed between JET and JT-60U in the advanced tokamak regime with internal transport barrier, ITB. These International Tokamak Physics Activity, ITPA, joint experiments were carried out with the same plasma

  11. Moisture transport properties of mortar and mortar joint: A NMR study

    NARCIS (Netherlands)

    Brocken, H.J.P.; Adant, O.C.G.; Pel, L.

    1997-01-01

    The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick

  12. Moisture transport properties of mortar and mortar joint: a NMR study

    NARCIS (Netherlands)

    Brocken, H.J.P.; Adan, O.C.G.; Pel, L.

    1997-01-01

    The moisture transport in mortar and mortar joint often is an important parameter in degeneration of brick masonry and other block constructions. In this study, the influence of single additives on the moisture transport properties of mortar is investigated. Due to water extraction during brick

  13. A comparative study of the proton transport properties of metal (IV ...

    Indian Academy of Sciences (India)

    Unknown

    study the transport properties of these materials.5,6 The mechanism of diffusion and ionic transport in crystalline ... Cu-Kα radiation with a nickel filter. Chemical ... All the tungstates were hard and white except TiW which is yellow. The chemical.

  14. Prediction of Thermal Transport Properties of Materials with Microstructural Complexity

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Youping

    2017-10-10

    This project aims at overcoming the major obstacle standing in the way of progress in dynamic multiscale simulation, which is the lack of a concurrent atomistic-continuum method that allows phonons, heat and defects to pass through the atomistic-continuum interface. The research has led to the development of a concurrent atomistic-continuum (CAC) methodology for multiscale simulations of materials microstructural, mechanical and thermal transport behavior. Its efficacy has been tested and demonstrated through simulations of dislocation dynamics and phonon transport coupled with microstructural evolution in a variety of materials and through providing visual evidences of the nature of phonon transport, such as showing the propagation of heat pulses in single and polycrystalline solids is partially ballistic and partially diffusive. In addition to providing understanding on phonon scattering with phase interface and with grain boundaries, the research has contributed a multiscale simulation tool for understanding of the behavior of complex materials and has demonstrated the capability of the tool in simulating the dynamic, in situ experimental studies of nonequilibrium transient transport processes in material samples that are at length scales typically inaccessible by atomistically resolved methods.

  15. Transport properties and electronic structure of epitaxial tunnel junctions

    Czech Academy of Sciences Publication Activity Database

    Freyss, M.; Papanikolaou, N.; Bellini, V.; Zeller, R.; Dederichs, P.; Turek, Ilja

    2002-01-01

    Roč. 240, 1/3 (2002), s. 117-120 ISSN 0304-8853 R&D Projects: GA ČR GA106/02/0943; GA MŠk ME 374 Institutional research plan: CEZ:AV0Z2041904 Keywords : junctions * transport Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.046, year: 2002

  16. Transport in Halobacterium Halobium: Light-Induced Cation-Gradients, Amino Acid Transport Kinetics, and Properties of Transport Carriers

    Science.gov (United States)

    Lanyi, Janos K.

    1977-01-01

    Cell envelope vesicles prepared from H. halobium contain bacteriorhodopsin and upon illumination protons are ejected. Coupled to the proton motive force is the efflux of Na(+). Measurements of Na-22 flux, exterior pH change, and membrane potential, Delta(psi) (with the dye 3,3'-dipentyloxadicarbocyanine) indicate that the means of Na(+) transport is sodium/proton exchange. The kinetics of the pH changes and other evidence suggests that the antiport is electrogenic (H(+)/Na(++ greater than 1). The resulting large chemical gradient for Na(+) (outside much greater than inside), as well as the membrane potential, will drive the transport of 18 amino acids. The I9th, glutamate, is unique in that its accumulation is indifferent to Delta(psi): this amino acid is transported only when a chemical gradient for Na(+) is present. Thus, when more and more NaCl is included in the vesicles glutamate transport proceeds with longer and longer lags. After illumination the gradient of H+() collapses within 1 min, while the large Na(+) gradient and glutamate transporting activity persists for 10- 15 min, indicating that proton motive force is not necessary for transport. A chemical gradient of Na(+), arranged by suspending vesicles loaded with KCl in NaCl, drives glutamate transport in the dark without other sources of energy, with V(sub max) and K(sub m) comparable to light-induced transport. These and other lines of evidence suggest that the transport of glutamate is facilitated by symport with Na(+), in an electrically neutral fashion, so that only the chemical component of the Na(+) gradient is a driving force.

  17. Thermodynamic properties and transport coefficients of a two-temperature polytetrafluoroethylene vapor plasma for ablation-controlled discharge applications

    Science.gov (United States)

    Wang, Haiyan; Wang, Weizong; Yan, Joseph D.; Qi, Haiyang; Geng, Jinyue; Wu, Yaowu

    2017-10-01

    Ablation-controlled plasmas have been used in a range of technical applications where local thermodynamic equilibrium (LTE) is often violated near the wall due to the strong cooling effect caused by the ablation of wall materials. The thermodynamic and transport properties of ablated polytetrafluoroethylene (PTFE) vapor, which determine the flowing plasma behavior in such applications, are calculated based on a two-temperature model at atmospheric pressure. To our knowledge, no data for PTFE have been reported in the literature. The species composition and thermodynamic properties are numerically determined using the two-temperature Saha equation and the Guldberg-Waage equation according to van de Sanden et al’s derivation. The transport coefficients, including viscosity, thermal conductivity and electrical conductivity, are calculated with the most recent collision interaction potentials using Devoto’s electron and heavy-particle decoupling approach but expanded to the third-order approximation (second-order for viscosity) in the frame of the Chapman-Enskog method. Results are computed for different degrees of thermal non-equilibrium, i.e. the ratio of electron to heavy-particle temperatures, from 1 to 10, with electron temperature ranging from 300 to 40 000 K. Plasma transport properties in the LTE state obtained from the present work are compared with existing published results and the causes for the discrepancy analyzed. The two-temperature plasma properties calculated in the present work enable the modeling of wall ablation-controlled plasma processes.

  18. Thermodynamic properties and transport coefficients of a two-temperature polytetrafluoroethylene vapor plasma for ablation-controlled discharge applications

    International Nuclear Information System (INIS)

    Wang, Haiyan; Qi, Haiyang; Wang, Weizong; Yan, Joseph D; Geng, Jinyue; Wu, Yaowu

    2017-01-01

    Ablation-controlled plasmas have been used in a range of technical applications where local thermodynamic equilibrium (LTE) is often violated near the wall due to the strong cooling effect caused by the ablation of wall materials. The thermodynamic and transport properties of ablated polytetrafluoroethylene (PTFE) vapor, which determine the flowing plasma behavior in such applications, are calculated based on a two-temperature model at atmospheric pressure. To our knowledge, no data for PTFE have been reported in the literature. The species composition and thermodynamic properties are numerically determined using the two-temperature Saha equation and the Guldberg–Waage equation according to van de Sanden et al ’s derivation. The transport coefficients, including viscosity, thermal conductivity and electrical conductivity, are calculated with the most recent collision interaction potentials using Devoto’s electron and heavy-particle decoupling approach but expanded to the third-order approximation (second-order for viscosity) in the frame of the Chapman–Enskog method. Results are computed for different degrees of thermal non-equilibrium, i.e. the ratio of electron to heavy-particle temperatures, from 1 to 10, with electron temperature ranging from 300 to 40 000 K. Plasma transport properties in the LTE state obtained from the present work are compared with existing published results and the causes for the discrepancy analyzed. The two-temperature plasma properties calculated in the present work enable the modeling of wall ablation-controlled plasma processes. (paper)

  19. Charge transport properties of metal/metal-phthalocyanine/n-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Afzal

    2010-12-16

    In present work the charge transport properties of metal/metal-phthalocyanine/n-Si structures with low (N{sub D} = 4 x 10{sup 14} cm{sup -3}), medium (N{sub D}=1 x 10{sup 16} cm{sup -3}) and high (N{sub D}=2 x 10{sup 19} cm{sup -3}) doped n-Si as injecting electrode and the effect of air exposure of the vacuum evaporated metal-phthalocyanine film in these structures is investigated. The results obtained through temperature dependent electrical characterizations of the structures suggest that in terms of dominant conduction mechanism in the corresponding devices Schottky-type conduction mechanism dominates the charge transport in low-bias region of these devices up to 0.8 V, 0.302 V and 0.15 V in case of low, medium and high doped n-Silicon devices. For higher voltages, in each case of devices, the space-charge-limited conduction, controlled by exponential trap distribution, is found to dominate the charge transport properties of the devices. The interface density of states at the CuPc/n-Si interface of the devices are found to be lower in case of lower work function difference at the CuPc/n-Si interface of the devices. The results also suggest that the work function difference at the CuPc/n-Si interface of these devices causes charge transfer at the interface and these phenomena results in formation of interface dipole. The width of the Schottky depletion region at the CuPc/n-Si interface of these devices is found to be higher with higher work function difference at the interface. The investigation of charge transport properties of Al/ZnPc/medium n-Si and Au/ZnPc/ medium n-Si devices suggest that the Schottky depletion region formed at the ZnPc/n-Si interface of these devices determines the charge transport in the low-bias region of both the devices. Therefore, the Schottky-type (injection limited) and the space-charge-limited (bulk limited) conduction are observed in the low and the high bias regions of these devices, respectively. The determined width of the

  20. Contaminant transport in aquifers: improving the determination of model parameters

    International Nuclear Information System (INIS)

    Sabino, C.V.S.; Moreira, R.M.; Lula, Z.L.; Chausson, Y.; Magalhaes, W.F.; Vianna, M.N.

    1998-01-01

    Parameters conditioning the migration behavior of cesium and mercury are measured with their tracers 137 Cs and 203 Hg in the laboratory, using both batch and column experiments. Batch tests were used to define the sorption isotherm characteristics. Also investigated were the influences of some test parameters, in particular those due to the volume of water to mass of soil ratio (V/m). A provisional relationship between V/m and the distribution coefficient, K d , has been advanced, and a procedure to estimate K d 's valid for environmental values of the ratio V/m has been suggested. Column tests provided the parameters for a transport model. A major problem to be dealt with in such tests is the collimation of the radioactivity probe. Besides mechanically optimizing the collimator, a deconvolution procedure has been suggested and tested, with statistical criteria, to filter off both noise and spurious tracer signals. Correction procedures for the integrating effect introduced by sampling at the exit of columns have also been developed. These techniques may be helpful in increasing the accuracy required in the measurement of parameters conditioning contaminant migration in soils, thus allowing more reliable predictions based on mathematical model applications. (author)

  1. Transport properties at 3C-SiC interfaces

    OpenAIRE

    Eriksson, Gustav Jens Peter

    2011-01-01

    For years cubic (3C) silicon carbide (SiC) has been believed to be a very promising wide bandgap semiconductor for high frequency and high power electronics. However, 3C-SiC is fraught with large concentrations of various defects, which have so far hindered the achievement of the predicted properties at a macroscopic level. These defects have properties that are inherently nanoscale and that will have a strong influence on the electrical behavior of the material, particularly at interfaces c...

  2. Mechanical Properties of Nanostructured Materials Determined Through Molecular Modeling Techniques

    Science.gov (United States)

    Clancy, Thomas C.; Gates, Thomas S.

    2005-01-01

    The potential for gains in material properties over conventional materials has motivated an effort to develop novel nanostructured materials for aerospace applications. These novel materials typically consist of a polymer matrix reinforced with particles on the nanometer length scale. In this study, molecular modeling is used to construct fully atomistic models of a carbon nanotube embedded in an epoxy polymer matrix. Functionalization of the nanotube which consists of the introduction of direct chemical bonding between the polymer matrix and the nanotube, hence providing a load transfer mechanism, is systematically varied. The relative effectiveness of functionalization in a nanostructured material may depend on a variety of factors related to the details of the chemical bonding and the polymer structure at the nanotube-polymer interface. The objective of this modeling is to determine what influence the details of functionalization of the carbon nanotube with the polymer matrix has on the resulting mechanical properties. By considering a range of degree of functionalization, the structure-property relationships of these materials is examined and mechanical properties of these models are calculated using standard techniques.

  3. Risk methodology for geologic disposal of radioactive waste: asymptotic properties of the environmental transport model

    International Nuclear Information System (INIS)

    Helton, J.C.; Brown, J.B.; Iman, R.L.

    1981-02-01

    The Environmental Transport Model is a compartmental model developed to represent the surface movement of radionuclides. The purpose of the present study is to investigate the asymptotic behavior of the model and to acquire insight with respect to such behavior and the variables which influence it. For four variations of a hypothetical river receiving a radionuclide discharge, the following properties are considered: predicted asymptotic values for environmental radionuclide concentrations and time required for environmental radionuclide concentrations to reach 90% of their predicted asymptotic values. Independent variables of two types are used to define each variation of the river: variables which define physical properties of the river system (e.g., soil depth, river discharge and sediment resuspension) and variables which summarize radionuclide properties (i.e., distribution coefficients). Sensitivity analysis techniques based on stepwise regression are used to determine the dominant variables influencing the behavior of the model. This work constitutes part of a project at Sandia National Laboratories funded by the Nuclear Regulatory Commission to develop a methodology to assess the risk associated with geologic disposal of radioactive waste

  4. Molecular dynamics studies of transport properties and equation of state of supercritical fluids

    Science.gov (United States)

    Nwobi, Obika C.

    Many chemical propulsion systems operate with one or more of the reactants above the critical point in order to enhance their performance. Most of the computational fluid dynamics (CFD) methods used to predict these flows require accurate information on the transport properties and equation of state at these supercritical conditions. This work involves the determination of transport coefficients and equation of state of supercritical fluids by equilibrium molecular dynamics (MD) simulations on parallel computers using the Green-Kubo formulae and the virial equation of state, respectively. MD involves the solution of equations of motion of a system of molecules that interact with each other through an intermolecular potential. Provided that an accurate potential can be found for the system of interest, MD can be used regardless of the phase and thermodynamic conditions of the substances involved. The MD program uses the effective Lennard-Jones potential, with system sizes of 1000-1200 molecules and, simulations of 2,000,000 time-steps for computing transport coefficients and 200,000 time-steps for pressures. The computer code also uses linked cell lists for efficient sorting of molecules, periodic boundary conditions, and a modified velocity Verlet algorithm for particle displacement. Particle decomposition is used for distributing the molecules to different processors of a parallel computer. Simulations have been carried out on pure argon, nitrogen, oxygen and ethylene at various supercritical conditions, with self-diffusion coefficients, shear viscosity coefficients, thermal conductivity coefficients and pressures computed for most of the conditions. Results compare well with experimental and the National Institute of Standards and Technology (NIST) values. The results show that the number of molecules and the potential cut-off radius have no significant effect on the computed coefficients, while long-time integration is necessary for accurate determination of the

  5. Temperature dependence of electronic transport property in ferroelectric polymer films

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, X.L.; Wang, J.L., E-mail: jlwang@mail.sitp.ac.cn; Tian, B.B.; Liu, B.L.; Zou, Y.H.; Wang, X.D.; Sun, S.; Sun, J.L., E-mail: jlsun@mail.sitp.ac.cn; Meng, X.J.; Chu, J.H.

    2014-10-15

    Highlights: • The ferroelectric polymer was fabricated by Langmuir–Blodgett method. • The electrons as the dominant injected carrier were conformed in the ferroelectric polymer films. • The leakage current conduction mechanisms in ferroelectric polymer were investigated. - Abstract: The leakage current mechanism of ferroelectric copolymer of polyvinylidene fluoride with trifluoroethylene prepared by Langmuir–Blodgett was investigated in the temperature range from 100 K to 350 K. The electron as the dominant injected carrier was observed in the ferroelectric copolymer films. The transport mechanisms in copolymer strongly depend on the temperature and applied voltage. From 100 K to 200 K, Schottky emission dominates the conduction. With temperature increasing, the Frenkel–Poole emission instead of the Schottky emission to conduct the carrier transport. When the temperature gets to 260 K, the leakage current becomes independent of temperature, and the space charge limited current conduction was observed.

  6. Comparison on thermal transport properties of graphene and phosphorene nanoribbons

    Science.gov (United States)

    Peng, Xiao-Fang; Chen, Ke-Qiu

    2015-01-01

    We investigate ballistic thermal transport at low temperatures in graphene and phosphorene nanoribbons (PNRS) modulated with a double-cavity quantum structure. A comparative analysis for thermal transport in these two kinds of nanomaterials is made. The results show that the thermal conductance in PNRS is greater than that in graphene nanoribbons (GNRS). The ratio kG/kP (kG is the thermal conductivity in GNRS and kP is the thermal conductivity in PNRS) decreases with lower temperature or for narrower nanoribbons, and increases with higher temperature or for wider nanoribbons. The greater thermal conductance and thermal conductivity in PNRS originate from the lower cutoff frequencies of the acoustic modes. PMID:26577958

  7. Thermoelectric transport properties of high mobility organic semiconductors

    Science.gov (United States)

    Venkateshvaran, Deepak; Broch, Katharina; Warwick, Chris N.; Sirringhaus, Henning

    2016-09-01

    Transport in organic semiconductors has traditionally been investigated using measurements of the temperature and gate voltage dependent mobility of charge carriers within the channel of organic field-effect transistors (OFETs). In such measurements, the behavior of charge carrier mobility with temperature and gate voltage, studied together with carrier activation energies, provide a metric to quantify the extent of disorder within these van der Waals bonded materials. In addition to the mobility and activation energy, another potent but often-overlooked transport coefficient useful in understanding disorder is the Seebeck coefficient (also known as thermoelectric power). Fundamentally, the Seebeck coefficient represents the entropy per charge carrier in the solid state, and thus proves powerful in distinguishing materials in which charge carriers move freely from those where a high degree of disorder causes the induced carriers to remain trapped. This paper briefly covers the recent highlights in the field of organic thermoelectrics, showing how significant strides have been made both from an applied standpoint as well as from a viewpoint of fundamental thermoelectric transport physics. It shall be illustrated how thermoelectric transport parameters in organic semiconductors can be tuned over a significant range, and how this tunability facilitates an enhanced performance for heat-to-electricity conversion as well as quantifies energetic disorder and the nature of the density of states (DOS). The work of the authors shall be spotlighted in this context, illustrating how Seebeck coefficient measurements in the polymer indacenodithiophene-co-benzothiadiazole (IDTBT) known for its ultra-low degree of torsion within the polymer backbone, has a trend consistent with low disorder. 1 Finally, using examples of the small molecules C8-BTBT and C10-DNTT, it shall be discussed how the Seebeck coefficient can aid the estimation of the density and distribution of trap states

  8. Formation and electrical transport properties of pentacene nanorod crystal

    International Nuclear Information System (INIS)

    Akai-Kasaya, M; Ohmori, C; Kawanishi, T; Nashiki, M; Saito, A; Kuwahara, Y; Aono, M

    2010-01-01

    The monophasic formation of an uncharted pentacene crystal, the pentacene nanorod, has been investigated. The restricted formation of the pentacene nanorod on a bare mica surface reveals a peculiar surface catalytic crystal growth mode of the pentacene. We demonstrated the charge transport measurements through a single pentacene nanorod and analyzed the data using a periodic hopping conduction model. The results revealed that the pentacene nanorod has a periodic conductive node within their one-dimensional crystal.

  9. Formation and electrical transport properties of pentacene nanorod crystal.

    Science.gov (United States)

    Akai-Kasaya, M; Ohmori, C; Kawanishi, T; Nashiki, M; Saito, A; Aono, M; Kuwahara, Y

    2010-09-10

    The monophasic formation of an uncharted pentacene crystal, the pentacene nanorod, has been investigated. The restricted formation of the pentacene nanorod on a bare mica surface reveals a peculiar surface catalytic crystal growth mode of the pentacene. We demonstrated the charge transport measurements through a single pentacene nanorod and analyzed the data using a periodic hopping conduction model. The results revealed that the pentacene nanorod has a periodic conductive node within their one-dimensional crystal.

  10. Characterization of transport properties in uranium dioxide: the case of the oxygen auto-diffusion

    International Nuclear Information System (INIS)

    Fraczkiewicz, M.; Baldinozzi, G.

    2008-01-01

    Point defects in uranium dioxide which control the transport phenomena are still badly known. The aim of this work is to show how in carrying out several experimental techniques, it is possible to demonstrate both the existence and to determine the nature (charge and localization) of predominant defects responsible of the transport phenomena in a fluorite-type structure oxide. The oxygen diffusion in the uranium dioxide illustrates this. In the first part of this work, the accent is put on the electric properties of uranium dioxide and more particularly on the variation laws of the electric conductivity in terms of temperature, of oxygen potential and of the impurities amounts present in the material. These evolutions are connected to point and charged complex defects models and the pertinence of these models is discussed. Besides, it is shown how the electric conductivity measurements can allow to define oxygen potential domains in which the concentrations in electronic carriers are controlled. This characterization being made, it is shown that the determination of the oxygen intrinsic diffusion coefficient and particularly its dependence to the oxygen potential and to the amount of impurity, allows to determine the main defect responsible to the atomic diffusion as well as its nature and its charge. In the second part, the experimental techniques to determine the oxygen diffusion coefficient are presented: there are the isotopic exchange technique for introducing the tracer in the material, and two techniques to characterize the diffusion profiles (SIMS and NRA). Examples of preliminary results are given for mono and polycrystalline samples. At last, from this methodology on uranium dioxide, studies considered to quantify the thermal and physicochemical effects are presented. Experiments considered with the aim to characterize the radiation diffusion in uranium dioxide are presented too. (O.M.)

  11. Determinants of the property damage costs of tanker accidents

    International Nuclear Information System (INIS)

    Talley, W.K.

    1999-01-01

    This study investigates determinants of the vessel, oil cargo spillage, and other-property damage costs of tanker accidents. Tobit estimation of a three-equation recursive model suggests that, among types of tanker accidents, fire/explosion accidents incur the largest vessel damage costs, but the smallest oil cargo spillage costs. Alternatively, grounding accidents incur the smallest vessel damage costs, but the largest oil cargo spillage costs, reflecting the difficulty of controlling oil cargo spillage subsequent to such accidents. Also, oil cargo spillage costs are lower for US flag tanker accidents. A dollar of vessel damage cost increases other-property damage cost by 0.06 dollars, whereas a dollar of oil cargo spillage increases this cost by 1.55 dollars

  12. Determination of hydraulic properties of unsaturated soil via inverse modeling

    International Nuclear Information System (INIS)

    Kodesova, R.

    2004-01-01

    The method for determining the hydraulic properties of unsaturated soil with inverse modeling is presented. A modified cone penetrometer has been designed to inject water into the soil through a screen, and measure the progress of the wetting front with two tensiometer rings positioned above the screen. Cumulative inflow and pressure head readings are analyzed to obtain estimates of the hydraulic parameters describing K(h) and θ(h). Optimization results for tests at one side are used to demonstrate the possibility to evaluate either the wetting branches of the soil hydraulic properties, or the wetting and drying curves simultaneously, via analysis of different parts of the experiment. The optimization results are compared to the results of standard laboratory and field methods. (author)

  13. EFFECT OF SANDSTONE ANISOTROPY ON ITS HEAT AND MOISTURE TRANSPORT PROPERTIES

    Directory of Open Access Journals (Sweden)

    Jan Fořt

    2015-09-01

    Full Text Available Each type of natural stone has its own geological history, formation conditions, different chemical and mineralogical composition, which influence its possible anisotropy. Knowledge in the natural stones anisotropy represents crucial information for the process of stone quarrying, its correct usage and arrangement in building applications. Because of anisotropy, many natural stones exhibit different heat and moisture transport properties in various directions. The main goal of this study is to analyse several anisotropy indices and their effect on heat transport and capillary absorption. For the experimental determination of the anisotropy effect, five types of sandstone coming from different operating quarries in the Czech Republic are chosen. These materials are often used for restoration of culture heritage monuments as well as for other building applications where they are used as facing slabs, facade panels, decoration stones, paving, etc. For basic characterization of studied materials, determination of their bulk density, matrix density and total open porosity is done. Chemical composition of particular sandstones is analysed by X-Ray Fluorescence. Anisotropy is examined by the non-destructive measurement of velocity of ultrasonic wave propagation. On the basis of ultrasound testing data, the relative anisotropy, total anisotropy and anisotropy coefficient are calculated. Then, the measurement of thermal conductivity and thermal diffusivity in various directions of samples orientation is carried out. The obtained results reveal significant differences between the parameters characterizing the heat transport in various directions, whereas these values are in accordance with the indices of anisotropy. Capillary water transport is described by water absorption coefficient measured using a sorption experiment, which is performed for distilled water and 1M NaCl water solution.  The measured data confirm the effect of anisotropy which is

  14. Thermophysical Properties of Ammonium-Based Bis{(trifluoromethyl)sulfonyl}imide Ionic Liquids: Volumetric and Transport Properties

    Czech Academy of Sciences Publication Activity Database

    Machanová, Karolina; Boisset, A.; Sedláková, Zuzana; Anouti, M.; Bendová, Magdalena; Jacquemin, J.

    2012-01-01

    Roč. 57, č. 8 (2012), s. 2227-2235 ISSN 0021-9568. [European Conference on Thermophysical Properties /19./. Thessaloniki, 28.08.2011-01.09.2011] R&D Projects: GA ČR GP203/09/P141; GA MŠk(CZ) MEB021009 Grant - others:Égide PHC(FR) 22000XB Institutional support: RVO:67985858 Keywords : ionic liquids * density * transport properties Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.004, year: 2012

  15. Formulation of confinement matrices and characterization of their transport properties from solid to melt state

    International Nuclear Information System (INIS)

    Grandjean, A.

    2006-07-01

    The author gives an overview of his research activity during which she worked on three main subjects. The first one dealt with the investigation of transport mechanisms in metal alloys (experimental investigation of diffusion in amorphous alloys, oxidation mechanism of Zircaloy-4 under temperature and in water or in dry oxygen). The second one dealt with the synthesis and properties of specific confinement matrices (effect of chemical composition on sintering of a carbonate powder, effect of microstructure of high Mo and P content vitro-crystals on lixiviation properties, incorporation of fluorine compounds in the case of borosilicate systems). The third one dealt with the transport in borosilicate glasses and melts (ionic transport, properties, and electrical transport glass-RuO 2 particles composites)

  16. Influence of deformation on the fluid transport properties of salt rocks

    NARCIS (Netherlands)

    Peach, C.J.

    1991-01-01

    While the fluid transport properties of rocks are well understood under hydrostatic conditions, little is known regarding these properties in rocks undergoing crystal plastic deformation. However, such data are needed as input in the field of radioactive waste disposal in salt formations. They are

  17. Influence of deformation on the fluid transport properties of salt rocks

    NARCIS (Netherlands)

    Peach, C.J.

    1991-01-01

    While the fluid transport properties of rocks are well understood under hydrostatic conditions, little is known regarding these properties in rocks undergoing crystal plastic deformation. However, such data are needed as input in the field of radioactive waste disposal in salt formations. They

  18. Equation of state and transport properties of uranium and plutonium carbides in the liquid region

    International Nuclear Information System (INIS)

    Sheth, A.; Leibowitz, L.

    1975-09-01

    By the use of available low-temperature data for various thermophysical and transport properties for uranium and plutonium carbides, values above the melting point were estimated. Sets of recommended values have been prepared for the compounds UC, PuC, and (U,Pu)C. The properties that have been evaluated are density, heat capacity, enthalpy, vapor pressure, thermal conductivity, viscosity, and emissivity

  19. Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations

    DEFF Research Database (Denmark)

    Fürst, Joachim Alexander; Hashemi, J.; Markussen, Troels

    2009-01-01

    Fullerene functionalized carbon nanotubes-NanoBuds-form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab init...

  20. Electronic transport properties of pentacene single crystals upon exposure to air

    NARCIS (Netherlands)

    Jurchescu, OD; Baas, J; Palstra, TTM; Jurchescu, Oana D.

    2005-01-01

    We report the effect of air exposure on the electronic properties of pentacene single crystals. Air can diffuse reversibly in and out of the crystals and influences the physical properties. We discern two competing mechanisms that modulate the electronic transport. The presence of oxygen increases

  1. Humidity effects on the electronic transport properties in carbon based nanoscale device

    International Nuclear Information System (INIS)

    He, Jun; Chen, Ke-Qiu

    2012-01-01

    By applying nonequilibrium Green's functions in combination with the density functional theory, we investigate the effect of humidity on the electronic transport properties in carbon based nanoscale device. The results show that different humidity may form varied localized potential barrier, which is a very important factor to affect the stability of electronic transport in the nanoscale system. A mechanism for the humidity effect is suggested. -- Highlights: ► Electronic transport in carbon based nanoscale device. ► Humidity affects the stability of electronic transport. ► Different humidity may form varied localized potential barrier.

  2. How Are Property Investment Returns Determined? : Estimating the Micro-Structure of Asset Prices, Property Income, and Discount Rates

    OpenAIRE

    Shimizu, Chihiro

    2014-01-01

    How exactly should one estimate property investment returns? Investors in property aim to maximize capital gains from price increases and income generated by the property. How are the returns on investment in property determined based on its characteristics, and what kind of market characteristics does it have? Focusing on the Tokyo commercial property market and residential property market, the purpose of this paper was to break down and measure the micro-structure of property investment ret...

  3. The Improvement of Foam Concrete Geoecoprotective Properties in Transport Construction

    Science.gov (United States)

    Svatovskaya, Larisa; Kabanov, Alexander; Sychov, Maxim

    2017-10-01

    The article analyses 2 kinds of properties of silica sol foam concrete: technical and geoecoprotective ones. Foam concrete stabilized with silica sol foam has lower heat conductivity resulting in fuel saving. Foam concrete obtained according to sol absorption technology has lower water absorption and is good enough for blocking to prevent the environment pollution. Pollution blocking can be achieved by two methods. The first method is saturation of an article affected by oil products with silica sol. The second method is to create a special preventive protection using silica sol screen. The article shows geoecoprotective properties of protein foam soil systems.

  4. How to determine composite material properties using numerical homogenization

    DEFF Research Database (Denmark)

    Andreassen, Erik; Andreasen, Casper Schousboe

    2014-01-01

    Numerical homogenization is an efficient way to determine effective macroscopic properties, such as the elasticity tensor, of a periodic composite material. In this paper an educational description of the method is provided based on a short, self-contained Matlab implementation. It is shown how...... the basic code, which computes the effective elasticity tensor of a two material composite, where one material could be void, is easily extended to include more materials. Furthermore, extensions to homogenization of conductivity, thermal expansion, and fluid permeability are described in detail. The unit...

  5. Resilient Design Properties in a Driverless Transport System

    DEFF Research Database (Denmark)

    Wied, Morten; Oehmen, Josef; Welo, Torgeir

    2018-01-01

    From its origin in ecology, resilient system properties have attracted wider interest for their applications to man-made systems. Previous research has shown that a simple conceptual model seems to capture much resilience thinking across disciplines and system types. In this paper, we apply...

  6. Cross sections and transport properties for Na+ in (DXE gas

    Directory of Open Access Journals (Sweden)

    Nikitović Željka D.

    2016-01-01

    Full Text Available In this work we select most probable reactions of alkali metal ion Na+ with dimethoxyethane (DXE molecule. Appropriate gas phase enthalpies of formation for the products were used to calculate scattering cross section as a function of kinetic energy with Denpoh-Nanbu theory. Calculated cross sections were compared with existing experimental results obtained by guided ion beam tandem mass spectrometry. Three body association reactions of ions with DXE is studied and compared to experimental results. Calculated cross sections were used to obtain transport parameters for alkali metal ion in DXE gas. [Projekat Ministarstva nauke Republike Srbije, br. ON 171037 i br. III 410011

  7. Electronic transport properties in [n]cycloparaphenylenes molecular devices

    Science.gov (United States)

    Hu, Lizhi; Guo, Yandong; Yan, Xiaohong; Zeng, Hongli; Zhou, Jie

    2017-07-01

    The electronic transport of [n]cycloparaphenylenes ([n]CPPs) is investigated based on nonequilibrium Green's function formalism in combination with the density-functional theory. Negative differential resistance (NDR) phenomenon is observed. Further analysis shows that the reduction of the transmission peak induced by the bias changing near Fermi energy results in the NDR effect. Replacing the electrode (from carbon chain to Au electrode), doping with N atom and changing the size of the nanohoop (n = 5, 6, 8, 10) have also been studied and the NDR still exists, suggesting the NDR behavior is the intrinsic feature of such [n]CPPs systems, which would be quite useful in future nanoelectronic devices.

  8. Self-consistent determination of quasiparticle properties in nuclear matter

    International Nuclear Information System (INIS)

    Oset, E.; Palanques-Mestre, A.

    1981-01-01

    The self-energy of nuclear matter is calculated by directing the attention to the energy and momentum dependent pieces which determine the quasiparticle properties. A microscopic approach is followed which starts from the boson exchange picture for the NN interaction, then the π-and p-mesons are shown to play a major role in the nucleon renormalization. The calculation is done self-consistently and the effective mass and pole strength determined as a function of the nuclear density and momentum. Particular emphasis is put on the non-static character of the interaction and its consequences. Finally a comparison is made with other calculations and with experimental results. The consequences of the nucleon renormalization in pion condensation are also examined with the result that the critical density is pushed up appreciably. (orig.)

  9. Growth and quantum transport properties of vertical Bi2Se3 nanoplate films on Si substrates.

    Science.gov (United States)

    Li, M Z; Wang, Z H; Yang, L; Pan, D S; Li, Da; Gao, Xuan; Zhang, Zhi-Dong

    2018-05-14

    Controlling the growth direction (planar vs. vertical) and surface-to-bulk ratio can lead to lots of unique properties for two-dimensional (2D) layered materials. We report a simple method to fabricate continuous films of vertical Bi2Se3 nanoplates on Si substrate and investigate the quantum transport properties of such films. In contrast to (001) oriented planar Bi2Se3 nanoplate film, vertical Bi2Se3 nanoplate films are enclosed by (015) facets, which possess high surface-to-bulk ratio that can enhance the quantum transport property of topological surface states. And by controlling the compactness of vertical Bi2Se3 nanoplates, we realized an effective tuning of the weak antilocalization (WAL) effect from topological surface states in Bi2Se3 films. Our work paves a way for exploring the unique transport properties of this unconventional structure topological insulator film. © 2018 IOP Publishing Ltd.

  10. Magnetic property effect on transport processes in resistance spot welding

    Energy Technology Data Exchange (ETDEWEB)

    Wei, P S [Department of Mechanical and Electro-Mechanical Engineering, National Sun Yat-Sen University, Kaohsiung, Taiwan 80424 (China); Wu, T H, E-mail: pswei@mail.nsysu.edu.tw, E-mail: wux0064@gmail.com [Department of Mechanical Engineering, Yung Ta Institute of Technology and Commerce, Pintong, Taiwan 909 (China)

    2011-08-17

    This study investigates the effects of the Curie temperature and magnetic permeability on transport variables, solute distribution and nugget shapes during resistance spot welding. The Curie temperature is the temperature below which a metal or alloy is ferromagnetic with a high magnetic permeability, and above which it is paramagnetic with a small magnetic permeability. The model proposed here accounts for electromagnetic force, heat generation and contact resistance at the faying surface and electrode-workpiece interfaces and bulk resistance in workpieces. Contact resistance includes constriction and film resistances, which are functions of hardness, temperature, electrode force and surface condition. The computed results show that transport variables and nugget shapes can be consistently interpreted from the delay of response time and jump of electric current density as a result of finite magnetic diffusion, rather than through the examination of the variations of dynamic electrical resistance with time. The molten nugget on the faying surface is initiated earlier with increasing magnetic permeability and Curie temperature. A high Curie temperature enhances convection and solute mixing, and readily melts through the workpiece surface near the electrode edge. Any means to reduce the Curie temperature or magnetic permeability, such as adjusting the solute content, can be a good way to control weld quality. This study can also be applied to interpret the contact problems encountered in various electronics and packaging technologies, and so on.

  11. Studies of Transport Properties of Fractures: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Stephen R. Brown

    2006-06-30

    We proposed to study several key factors controlling the character and evolution of fracture system permeability and transport processes. We suggest that due to surface roughness and the consequent channeling in single fractures and in fracture intersections, the tendency of a fracture system to plug up, remain permeable, or for permeability to increase due to chemical dissolution/precipitation conditions will depend strongly on the instantaneous flow channel geometry. This geometry will change as chemical interaction occurs, thus changing the permeability through time. To test this hypothesis and advance further understanding toward a predictive capability, we endeavored to physically model and analyze several configurations of flow and transport of inert and chemically active fluids through channels in single fractures and through fracture intersections. This was an integrated program utilizing quantitative observations of fractures and veins in drill core, quantitative and visual observations of flow and chemical dissolution and precipitation within replicas of real rough-walled fractures and fracture intersections, and numerical modeling via lattice Boltzmann methods.

  12. Properties of internal transport barrier formation in JT-60U

    International Nuclear Information System (INIS)

    Sakamoto, Yoshiteru; Suzuki, T.; Ide, S.

    2003-01-01

    The dependence of the ion thermal diffusivity (χ i ) on the radial electric field (E r ) shear has been investigated in JT-60U plasmas. In positive magnetic shear (PS) plasmas, χ i in the core region generally increases with the heating power, similar to the L mode at low heating power. However, as a result of the intensive central heating, which is relevant to the enhancement of the E γ shear, a weak internal transport barrier (ITB) is formed, and χ i in the core region starts to decrease. Corresponding to a further increase of the heating power, a strong ITB is formed and χ i is reduced substantially. In the case of reversed magnetic shear (RS) plasmas, on the other hand, no power degradation of χ i is observed in any of heating regimes. The electron thermal diffusivity (χ e ) is strongly correlated with χ i in PS and RS plasmas. There exists a threshold in the effective E γ shear to change the state from a weak to a strong ITB. It is found that the threshold of the effective E γ shear in the case of a PS plasma depends on the poloidal magnetic field at the ITB. There are multiple levels of reduced transport in the strong ITB for RS plasmas. (author)

  13. Properties of internal transport barrier formation in JT-60U

    International Nuclear Information System (INIS)

    Sakamoto, Y.; Suzuki, T.; Ide, S.

    2003-01-01

    The dependence of the ion thermal diffusivity (χ i ) on the radial electric field (E r ) shear has been investigated in JT-60U plasmas. In positive magnetic shear (PS) plasmas, χ i in the core region generally increases with the heating power, similar to the L mode at low heating power. However, as a result of the intensive central heating, which is relevant to the enhancement of the E r shear, a weak internal transport barrier (ITB) is formed, and χ i in the core region starts to decrease. Corresponding to a further increase of the heating power, a strong ITB is formed and χ i is reduced substantially. In the case of reversed magnetic shear (RS) plasmas, on the other hand, no power degradation of χ i is observed in any of the heating regimes. The electron thermal diffusivity (χ e ) is strongly correlated with χ i in PS and RS plasmas. There exists a threshold in the effective E r shear to change the state from a weak to a strong ITB. It is found that the threshold of the effective E r shear in the case of a PS plasma depends on the poloidal magnetic field at the ITB. There are multiple levels of reduced transport in the strong ITB for RS plasmas. (author)

  14. Computing and the electrical transport properties of coupled quantum networks

    Science.gov (United States)

    Cain, Casey Andrew

    In this dissertation a number of investigations were conducted on ballistic quantum networks in the mesoscopic range. In this regime, the wave nature of electron transport under the influence of transverse magnetic fields leads to interesting applications for digital logic and computing circuits. The work specifically looks at characterizing a few main areas that would be of interest to experimentalists who are working in nanostructure devices, and is organized as a series of papers. The first paper analyzes scaling relations and normal mode charge distributions for such circuits in both isolated and open (terminals attached) form. The second paper compares the flux-qubit nature of quantum networks to the well-established spintronics theory. The results found exactly contradict the conventional school of thought for what is required for quantum computation. The third paper investigates the requirements and limitations of extending the Thevenin theorem in classic electric circuits to ballistic quantum transport. The fourth paper outlines the optimal functionally complete set of quantum circuits that can completely satisfy all sixteen Boolean logic operations for two variables.

  15. Communication: Electronic and transport properties of molecular junctions under a finite bias: A dual mean field approach

    International Nuclear Information System (INIS)

    Liu, Shuanglong; Feng, Yuan Ping; Zhang, Chun

    2013-01-01

    We show that when a molecular junction is under an external bias, its properties cannot be uniquely determined by the total electron density in the same manner as the density functional theory for ground state properties. In order to correctly incorporate bias-induced nonequilibrium effects, we present a dual mean field (DMF) approach. The key idea is that the total electron density together with the density of current-carrying electrons are sufficient to determine the properties of the system. Two mean fields, one for current-carrying electrons and the other one for equilibrium electrons can then be derived. Calculations for a graphene nanoribbon junction show that compared with the commonly used ab initio transport theory, the DMF approach could significantly reduce the electric current at low biases due to the non-equilibrium corrections to the mean field potential in the scattering region

  16. Electrochemical Approach for Analyzing Electrolyte Transport Properties and Their Effect on Protonic Ceramic Fuel Cell Performance.

    Science.gov (United States)

    Danilov, Nikolay; Lyagaeva, Julia; Vdovin, Gennady; Medvedev, Dmitry; Demin, Anatoly; Tsiakaras, Panagiotis

    2017-08-16

    The design and development of highly conductive materials with wide electrolytic domain boundaries are among the most promising means of enabling solid oxide fuel cells (SOFCs) to demonstrate outstanding performance across low- and intermediate-temperature ranges. While reducing the thickness of the electrolyte is an extensively studied means for diminishing the total resistance of SOFCs, approaches involving an improvement in the transport behavior of the electrolyte membranes have been less-investigated. In the present work, a strategy for analyzing the electrolyte properties and their effect on SOFC output characteristics is proposed. To this purpose, a SOFC based on a recently developed BaCe 0.5 Zr 0.3 Dy 0.2 O 3-δ proton-conducting ceramic material was fabricated and tested. The basis of the strategy consists of the use of traditional SOFC testing techniques combined with the current interruption method and electromotive force measurements with a modified polarization-correction assessment. This allows one to determine simultaneously such important parameters as maximal power density; ohmic and polarization resistances; average ion transport numbers; and total, ionic, and electronic film conductivities and their activation energies. The proposed experimental procedure is expected to expand both fundamental and applied basics that could be further adopted to improve the technology of electrochemical devices based on proton-conducting electrolytes.

  17. Determination of the functional properties of Kappaphycus alvarezii seaweed powder

    International Nuclear Information System (INIS)

    Sjamsiah; Nazaruddin Ramli; Rusli Daik; Mohd Ambar Yarmo

    2013-01-01

    Seaweed Kappaphycus alvarezii powder prepared by spray drying (SD), freeze drying (FD) and sun drying(SND) were determined their functional properties such as swelling capacity (SWC), water holding capacity (WHC), oil holding capacity (OHC), viscosity and gel strength. The study showed that the Kappaphycus alvarezii seaweed powder obtained by FD and SND have the ability to swell to 25 mL/ g and 50 mL/ g respectively, while the SD powder formed a homogeneous solution and it exhibited highly viscous solution (SWC 100 mL/ g). The WHC of SND powder (30.67 g/ g) was higher (p<0.05) than the FD (21.33 g/ g) and SD (4.67 g/ g) powders. The OHC of FD powder (19.81 g/ g) was higher (p<0.05) than the SD (5.11 g/ g) and SND (4.67 g/ g) powders. While the viscosity of the FD, SND and SD powders were 0.22, 0.17 and 0.06 Pa.s respectively. Meanwhile, the gel strength of the SD powder (82.77 gf) was higher (p<0.05) than the FD (57.1 gf) and SND (35.01 gf) powders. These results on determination of functional properties shows that the SD powder had the most potential to be applied as a viscosity modifier in the manufacturing of beverages.(author)

  18. Transport properties of graphene under periodic and quasiperiodic magnetic superlattices

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Wei-Tao, E-mail: luweitao@lyu.edu.cn [School of Science, Linyi University, 276005 Linyi (China); Institute of Condensed Matter Physics, Linyi University, 276005 Linyi (China); Wang, Shun-Jin [Department of Physics, Sichuan University, 610064 Chengdu (China); Wang, Yong-Long; Jiang, Hua [School of Science, Linyi University, 276005 Linyi (China); Institute of Condensed Matter Physics, Linyi University, 276005 Linyi (China); Li, Wen [School of Science, Linyi University, 276005 Linyi (China)

    2013-08-15

    We study the transmission of Dirac electrons through the one-dimensional periodic, Fibonacci, and Thue–Morse magnetic superlattices (MS), which can be realized by two different magnetic blocks arranged in certain sequences in graphene. The numerical results show that the transmission as a function of incident energy presents regular resonance splitting effect in periodic MS due to the split energy spectrum. For the quasiperiodic MS with more layers, they exhibit rich transmission patterns. In particular, the transmission in Fibonacci MS presents scaling property and fragmented behavior with self-similarity, while the transmission in Thue–Morse MS presents more perfect resonant peaks which are related to the completely transparent states. Furthermore, these interesting properties are robust against the profile of MS, but dependent on the magnetic structure parameters and the transverse wave vector.

  19. Properties of Douglas Point Generating Station heat transport corrosion products

    International Nuclear Information System (INIS)

    Montford, B.; Rummery, T.E.

    1975-09-01

    Chemical, radiochemical and structural properties of circulating and fixed corrosion products from the Douglas Point Generating Station are documented. Interaction of Monel-400 and carbon steel corrosion products is described, and the mechanisms of Monel-400 surface deposit release, and activity buildup in the coolant system, are briefly discussed. Efficiencies of filters and ion-exchangers for the removal of released radionuclides are given. (author)

  20. Optical properties and electron transport in low-dimensional nanostructures

    Czech Academy of Sciences Publication Activity Database

    Král, Karel; Menšík, Miroslav

    2011-01-01

    Roč. 54, 2-2 (2011), s. 4-13 ISSN 0021-3411 R&D Projects: GA MŠk(CZ) OC10007 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505 Keywords : quantum dots * electron -photon interaction * optical properties * electron relaxation * DNA molecule Subject RIV: BE - The oretical Physics http://elibrary.ru/contents.asp?issueid=1010336

  1. Electronic, Magnetic, and Transport Properties of Polyacrylonitrile-Based Carbon Nanofibers of Various Widths: Density-Functional Theory Calculations

    Science.gov (United States)

    Partovi-Azar, P.; Panahian Jand, S.; Kaghazchi, P.

    2018-01-01

    Edge termination of graphene nanoribbons is a key factor in determination of their physical and chemical properties. Here, we focus on nitrogen-terminated zigzag graphene nanoribbons resembling polyacrylonitrile-based carbon nanofibers (CNFs) which are widely studied in energy research. In particular, we investigate magnetic, electronic, and transport properties of these CNFs as functions of their widths using density-functional theory calculations together with the nonequilibrium Green's function method. We report on metallic behavior of all the CNFs considered in this study and demonstrate that the narrow CNFs show finite magnetic moments. The spin-polarized electronic states in these fibers exhibit similar spin configurations on both edges and result in spin-dependent transport channels in the narrow CNFs. We show that the partially filled nitrogen dangling-bond bands are mainly responsible for the ferromagnetic spin ordering in the narrow samples. However, the magnetic moment becomes vanishingly small in the case of wide CNFs where the dangling-bond bands fall below the Fermi level and graphenelike transport properties arising from the π orbitals are recovered. The magnetic properties of the CNFs as well as their stability have also been discussed in the presence of water molecules and the hexagonal boron nitride substrate.

  2. Bayesian estimation of the hydraulic and solute transport properties of a small-scale unsaturated soil column

    Directory of Open Access Journals (Sweden)

    Moreira Paulo H. S.

    2016-03-01

    Full Text Available In this study the hydraulic and solute transport properties of an unsaturated soil were estimated simultaneously from a relatively simple small-scale laboratory column infiltration/outflow experiment. As governing equations we used the Richards equation for variably saturated flow and a physical non-equilibrium dual-porosity type formulation for solute transport. A Bayesian parameter estimation approach was used in which the unknown parameters were estimated with the Markov Chain Monte Carlo (MCMC method through implementation of the Metropolis-Hastings algorithm. Sensitivity coefficients were examined in order to determine the most meaningful measurements for identifying the unknown hydraulic and transport parameters. Results obtained using the measured pressure head and solute concentration data collected during the unsaturated soil column experiment revealed the robustness of the proposed approach.

  3. Impact of carbonation on the durability of cementitious materials: water transport properties characterization

    Directory of Open Access Journals (Sweden)

    Le Bescop P.

    2013-07-01

    Full Text Available Within the context of long-lived intermediate level radioactive waste geological disposal, reinforced concrete would be used. In service life conditions, the concrete structures would be subjected to drying and carbonation. Carbonation relates to the reaction between carbon dioxide (CO2 and the main hydrates of the cement paste (portlandite and C-S-H. Beyond the fall of the pore solution pH, indicative of steel depassivation, carbonation induces mineralogical and microstructural changes (due to portlandite and C-S-H dissolution and calcium carbonate precipitation. This results in the modification of the transport properties, which can impact the structure durability. Because concrete durability depends on water transport, this study focuses on the influence of carbonation on water transport properties. In fact, the transport properties of sound materials are known but they still remain to be assessed for carbonated ones. An experimental program has been designed to investigate the transport properties in carbonated materials. Four hardened cement pastes, differing in mineralogy, are carbonated in an accelerated carbonation device (in controlled environmental conditions at CO2 partial pressure of about 3%. Once fully carbonated, all the data needed to describe water transport, using a simplified approach, will be evaluated.

  4. Which key properties controls the preferential transport in the vadose zone under transient hydrological conditions

    Science.gov (United States)

    Groh, J.; Vanderborght, J.; Puetz, T.; Gerke, H. H.; Rupp, H.; Wollschlaeger, U.; Stumpp, C.; Priesack, E.; Vereecken, H.

    2015-12-01

    Understanding water flow and solute transport in the unsaturated zone is of great importance for an appropriate land use management strategy. The quantification and prediction of water and solute fluxes through the vadose zone can help to improve management practices in order to limit potential risk on our fresh water resources. Water related solute transport and residence time is strongly affected by preferential flow paths in the soil. Water flow in soils depends on soil properties and site factors (climate or experiment conditions, land use) and are therefore important factors to understand preferential solute transport in the unsaturated zone. However our understanding and knowledge of which on-site properties or conditions define and enhance preferential flow and transport is still poor and mostly limited onto laboratory experimental conditions (small column length and steady state boundary conditions). Within the TERENO SOILCan lysimeter network, which was designed to study the effects of climate change on soil functions, a bromide tracer was applied on 62 lysimeter at eight different test sites between Dec. 2013 and Jan. 2014. The TERENO SOILCan infrastructure offers the unique possibility to study the occurrence of preferential flow and transport of various soil types under different natural transient hydrological conditions and land use (crop, bare and grassland) at eight TERENO SOILCan observatories. Working with lysimeter replicates at each observatory allows defining the spatial variability of preferential transport and flow. Additionally lysimeters in the network were transferred within and between observatories in order to subject them to different rainfall and temperature regimes and enable us to relate the soil type susceptibility of preferential flow and transport not only to site specific physical and land use properties, but also to different transient boundary conditions. Comparison and statistical analysis between preferential flow indicators 5

  5. Seasonal transport - A study to determine the seasonal effects of transporting fish from the Snake River to optimize a transportation strategy

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goal of this U.S. Army Corps of Engineers (USACE) - funded study that began in 2004 is to determine if the smolt-to-adult return rates (SARs), transport/in-river...

  6. Direct measurements of transport properties are essential for site characterization

    International Nuclear Information System (INIS)

    Wright, J.; Conca, J.L.

    1994-08-01

    Direct measurements of transport parameters on subsurface sediments using, the UFA method provided detailed hydrostratigraphic mapping, and subsurface flux distributions at a mixed-waste disposal site at Hanford. Seven hundred unsaturated conductivity measurements on fifty samples were obtained in only six months total of UFA run time. These data are used to provide realistic information to conceptual models, predictive models and restoration strategies. The UFA instrument consists of an ultracentrifuge with a constant, ultralow flow pump that provides fluid to the sample surface through a rotating seal assembly and microdispersal system. Effluent from the sample is collected in a transparent, volumetrically-calibrated chamber at the bottom of the sample assembly. Using a strobe light, an observer can check the chamber while the sample is being centrifuged. Materials can be run in the UFA as recomposited samples or in situ samples can be subcored directly into the sample UFA chamber

  7. Charge transport properties of CdMnTe radiation detectors

    Directory of Open Access Journals (Sweden)

    Prokopovich D. A.

    2012-10-01

    Full Text Available Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading charge collection is reduced with increasing values of bias voltage. The electron drift velocity was calculated from the rise time distribution of the preamplifier output pulses at each measured bias. From the dependence of drift velocity on applied electric field the electron mobility was found to be μn = (718 ± 55 cm2/Vs at room temperature.

  8. Notification determining details of technical standards concerning transport of radioisotopes or goods contaminated by radioisotopes in works or enterprises

    International Nuclear Information System (INIS)

    1981-01-01

    This rule is established under the provisions of the regulation for the execution of the law on the prevention of radiation injuries by radioisotopes. Terms are used in this rule for the same meanings as in the regulation. The limit of the concentration of radioisotopes in the goods contaminated by these isotopes which are not required to be sealed in containers defined by the Director General of the Science and Technology Agency is 1/10,000 of the value A 2 under the notification determining the details of technical standards concerning the transport of radioisotopes or the goods contaminated by radioisotopes outside works or enterprises. The application for the permission of transporting the goods which are highly difficult to be sealed in containers shall list names and addresses, the kinds, quantities, shapes and properties of the transported goods contaminated by radioisotopes, etc. The radiation dose rate of transported goods and vehicles under the regulation is 200 milli-rem an hour on the surfaces of these goods, vehicles and containers, and 10 milli-rem an hour at the distance of 1 meter from their surfaces. The permissible exposure dose of the persons engaging in transport is 1.5 rem a year. Dangerous goods, signs, and the application for the approval of special measures are specified, respectively. (Okada, K.)

  9. Establishing the transport properties of QCD with heavy ion reactions. Final Scientific Report for DE-FG02-07ER41524

    International Nuclear Information System (INIS)

    Teaney, Derek

    2008-01-01

    During the time period from 9/1/07 - 3/1/08 the principle investigator was awarded a federal grant from the Department of Energy (DE-FG02-07ER41524) to establish the transport properties of QCD through heavy ion reactions. A relativistic viscous hydrodynamic computer code was developed in 2+1 dimensions which is suitable for extracting the shear viscosity from available heavy ion data. In addition, the transport coefficients of heavy mesons in strongly coupled N = 4 plasmas were determined using the gauge gravity duality. These transport coefficients are suppressed by 1/N c 2 which stymied previous efforts to determine the kinetics of these mesons.

  10. Transition phenomena and thermal transport properties in LHD plasmas with an electron internal transport barrier

    International Nuclear Information System (INIS)

    Shimozuma, T.; Kubo, S.; Idei, H.; Inagaki, S.; Tamura, N.; Tokuzawa, T.; Morisaki, T.; Watanabe, K.Y.; Ida, K.; Yamada, I.; Narihara, K.; Muto, S.; Yokoyama, M.; Yoshimura, Y.; Notake, T.; Ohkubo, K.; Seki, T.; Saito, K.; Kumazawa, R.; Mutoh, T.; Watari, T.; Komori, A.

    2005-01-01

    Two types of improved core confinement were observed during centrally focused electron cyclotron heating (ECH) into plasmas sustained by counter (CNTR) and Co neutral beam injections (NBI) in the Large Helical Device. The CNTR NBI plasma displayed transition phenomena to the high-electron-temperature state and had a clear electron internal transport barrier, while the Co NBI plasma did not show a clear transition or an ECH power threshold but showed broad high temperature profiles with moderate temperature gradient. This indicated that the Co NBI plasma with additional ECH also had an improved core confinement. The electron heat transport characteristics of these plasmas were directly investigated using heat pulse propagation excited by modulated ECH. These effects appear to be related to the m/n = 2/1 rational surface or the island induced by NBI beam-driven current

  11. Correlating substituent parameter values to electron transport properties of molecules

    International Nuclear Information System (INIS)

    Vedova-Brook, Natalie; Matsunaga, Nikita; Sohlberg, Karl

    2004-01-01

    There are a vast number of organic compounds that could be considered for use in molecular electronics. Because of this, the need for efficient and economical screening tools has emerged. We demonstrate that the substituent parameter values (σ), commonly found in advanced organic chemistry textbooks, correlate strongly with features of the charge migration process, establishing them as useful indicators of electronic properties. Specifically, we report that ab initio derived electronic charge transfer values for 16 different substituted aromatic molecules for molecular junctions correlate to the σ values with a correlation coefficient squared (R 2 ) of 0.863

  12. Thin film separators with ion transport properties for energy applications

    Science.gov (United States)

    Li, Zhongyuan

    2017-09-01

    Recent years, along with the increasing need of energy, energy storage also becomes a challenging problem which we need to deal with. The batterieshave a good developing prospect among energy storage system in storing energy such as wind, solar and geothermal energy. One hurdle between the lab-scale experiment and industry-scale application of the advanced batteries is the urgent need for limiting charging capacity degradation and improving cycling stability, known as the shuttle effect in lithium-sulfur batteries or electroosmotic drag coefficient in fuel-cell batteries. The microporous separator between the cathode and anode could be molecular engineered to possessesion selective permeation properties, which can greatly improves the energy efficiency and extends application range of the battery. The present review offers the fundamental fabrication methods of separator film with different material. The review also contains the chemical or physical structure of different materials which are used in making separator film. A table offers the reader a summary of properties such as ionic conductivity, ionic exchange capacity and current density etc.

  13. Node-node correlations and transport properties in scale-free networks

    Science.gov (United States)

    Obregon, Bibiana; Guzman, Lev

    2011-03-01

    We study some transport properties of complex networks. We focus our attention on transport properties of scale-free and small-world networks and compare two types of transport: Electric and max-flow cases. In particular, we construct scale-free networks, with a given degree sequence, to estimate the distribution of conductances for different values of assortative/dissortative mixing. For the electric case we find that the distributions of conductances are affect ed by the assortative mixing of the network whereas for the max-flow case, the distributions almost do not show changes when node-node correlations are altered. Finally, we compare local and global transport in terms of the average conductance for the small-world (Watts-Strogatz) model

  14. The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.

    Science.gov (United States)

    Experton, Juliette; Martin, Charles R

    2018-05-01

    Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Transport properties for some atom-ion interactions in air

    International Nuclear Information System (INIS)

    Biolsi, L.; Holland, P.M.; Procter and Gamble Co., Cincinnati, OH)

    1985-01-01

    The thermal conductivity and viscosity for the N-N(+) and O-O(+) interactions have been calculated, using the kinetic theory of gases, from 500 K-20,000 K. Accurate spectroscopically determined potentials have been used for the calculations. The results are compared with previous results obtained using less accurate potentials. 62 references

  16. Cross Sections and Transport Properties of BR- Ions in AR

    Science.gov (United States)

    Jovanovic, Jasmina; Stojanovic, Vladimir; Raspopovic, Zoran; Petrovic, Zoran

    2014-10-01

    We have used a combination of a simple semi-analytic theory - Momentum Transfer Theory (MTT) and exact Monte Carlo (MC) simulations to develop Br- in Ar momentum transfer cross section based on the available data for reduced mobility at the temperature T = 300 K over the range 10 Td higher energies based on behavior of similar ions in similar gases and by the addition of the total detachment cross section that was used from the threshold around 7.7 eV. Relatively complete set was derived which can be used in modeling of plasmas by both hybrid, particle in cell (PIC) and fluid codes. A good agreement between calculated and measured ion mobilities and longitudinal diffusion coefficients is an independent proof of the validity of the cross sections that were derived for the negative ion mobility data. In addition to transport coefficients we have also calculated the net rate coefficients of elastic scattering and detachment. Author acknowledge Ministry of Education, Science and Technology, Proj. Nos. 171037 and 410011.

  17. Experimental study of tungsten transport properties in T-10 plasma

    Science.gov (United States)

    Krupin, V. A.; Nurgaliev, M. R.; Klyuchnikov, L. A.; Nemets, A. R.; Zemtsov, I. A.; Dnestrovskij, A. Yu.; Sarychev, D. V.; Lisitsa, V. S.; Shurygin, V. A.; Leontiev, D. S.; Borschegovskij, A. A.; Grashin, S. A.; Ryjakov, D. V.; Sergeev, D. S.; Mustafin, N. A.; Trukhin, V. M.; Solomatin, R. Yu.; Tugarinov, S. N.; Naumenko, N. N.

    2017-06-01

    First experimental results of tungsten transport investigation in OH and ECRH plasmas in the T-10 tokamak with W-limiter and movable Li-limiter are presented. It is shown that tungsten tends to accumulate (a joint process of cumulation and peaking) near the plasma axis in ohmic regimes. The cumulation of W is enhanced in discharges with high values of the parameter γ ={{\\bar{n}}\\text{e}}\\centerdot {{\\bar{Z}}\\text{eff}}\\centerdot I\\text{pl}-1.5 that coincides with accumulation conditions of light and medium impurities in T-10 plasmas. Experiments with Li-limiter show the immeasurable level of Li3+ (0.3-0.5% of n e) of T-10 CXRS diagnostics because of the low inflow of Li with respect to other light impurities. Nevertheless, the strong influence of lithium on inflow of light and tungsten impurities is observed. In discharges with lithized walls, vanishing of light impurities occurs and values of {{Z}\\text{eff}}≈ 1 are obtained. It is also shown that the tungsten density in the plasma center decreases by 15 to 20 times while the W inflow reduces only by 2 to 4 times. In lithized discharges with high γ, the flattening of the tungsten density profile occurs and its central concentration decreases up to 10 times during the on-axis ECRH. This effect is observed together with the increase of the W inflow by 3 to 4 times at the ECRH stage.

  18. Spin-polarized quantum transport properties through flexible phosphorene

    Science.gov (United States)

    Chen, Mingyan; Yu, Zhizhou; Xie, Yiqun; Wang, Yin

    2016-10-01

    We report a first-principles study on the tunnel magnetoresistance (TMR) and spin-injection efficiency (SIE) through phosphorene with nickel electrodes under the mechanical tension and bending on the phosphorene region. Both the TMR and SIE are largely improved under these mechanical deformations. For the uniaxial tension (ɛy) varying from 0% to 15% applied along the armchair transport (y-)direction of the phosphorene, the TMR ratio is enhanced with a maximum of 107% at ɛy = 10%, while the SIE increases monotonously from 8% up to 43% with the increasing of the strain. Under the out-of-plane bending, the TMR overall increases from 7% to 50% within the bending ratio of 0%-3.9%, and meanwhile the SIE is largely improved to around 70%, as compared to that (30%) of the flat phosphorene. Such behaviors of the TMR and SIE are mainly affected by the transmission of spin-up electrons in the parallel configuration, which is highly dependent on the applied mechanical tension and bending. Our results indicate that the phosphorene based tunnel junctions have promising applications in flexible electronics.

  19. Transport properties of the topological Kondo insulator SmB6 under the irradiation of light

    International Nuclear Information System (INIS)

    Zhu Guo-Bao; Yang Hui-Min

    2016-01-01

    In this paper, we study transport properties of the X point in the Brillouin zone of the topological Kondo insulator SmB 6 under the application of a circularly polarized light. The transport properties at high-frequency regime and low-frequency regime as a function of the ratio ( κ ) of the Dresselhaus-like and Rashba-like spin–orbit parameter are studied based on the Floquet theory and Boltzmann equation respectively. The sign of Hall conductivity at high-frequency regime can be reversed by the ratio κ and the amplitude of the light. The amplitude of the current can be enhanced by the ratio κ . Our findings provide a way to control the transport properties of the Dirac materials at low-frequency regime. (paper)

  20. Hydration effect on the electronic transport properties of oligomeric phenylene ethynylene molecular junctions

    International Nuclear Information System (INIS)

    Zong-Liang, Li; Huai-Zhi, Li; Yong, Ma; Guang-Ping, Zhang; Chuan-Kui, Wang

    2010-01-01

    A first-principles computational method based on the hybrid density functional theory is developed to simulate the electronic transport properties of oligomeric phenylene ethynylene molecular junctions with H 2 O molecules accumulated in the vicinity as recently reported by Na et al. [Nanotechnology 18 424001 (2007)]. The numerical results show that the hydrogen bonds between the oxygen atoms of the oligomeric phenylene ethynylene molecule and H 2 O molecules result in the localisation of the molecular orbitals and lead to the lower transition peaks. The H 2 O molecular chains accumulated in the vicinity of the molecular junction can not only change the electronic structure of the molecular junctions, but also open additional electronic transport pathways. The obvious influence of H 2 O molecules on the electronic structure of the molecular junction and its electronic transport properties is thus demonstrated. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  1. Electronic, magnetic and transport properties of graphene ribbons terminated by nanotubes

    International Nuclear Information System (INIS)

    Akhukov, M A; Yuan Shengjun; Fasolino, A; Katsnelson, M I

    2012-01-01

    We study, by density functional and large-scale tight-binding transport calculations, the electronic structure, magnetism and transport properties of the recently proposed graphene ribbons with edges rolled to form nanotubes. Edges with armchair nanotubes present magnetic moments localized either in the tube or the ribbon and of metallic or half-metallic character, depending on the symmetry of the junction. These properties have potential for spin valve and spin filter devices with advantages over other proposed systems. Edges with zigzag nanotubes are either metallic or semiconducting without affecting the intrinsic mobility of the ribbon. Varying the type and size of the nanotubes and ribbons offers the possibility to tailor the magnetic and transport properties, making these systems very promising for applications. (paper)

  2. Tuning of Transport and Magnetic Properties in Epitaxial LaMnO3+δ Thin Films

    Directory of Open Access Journals (Sweden)

    J. Chen

    2014-01-01

    Full Text Available The effect of compressive strain on the transport and magnetic properties of epitaxial LaMnO3+δ thin films has been investigated. It is found that the transport and magnetic properties of the LaMnO3+δ thin films grown on the LaAlO3 substrates can be tuned by the compressive strain through varying film thickness. And the insulator-metal transition, charge/orbital ordering transition, and paramagnetic-ferromagnetic transition are suppressed by the compressive strain. Consequently, the related electronic and magnetic transition temperatures decrease with an increase in the compressive strain. The present results can be explained by the strain-controlled lattice deformation and the consequent orbital occupation. It indicates that the lattice degree of freedom is crucial for understanding the transport and magnetic properties of the strongly correlated LaMnO3+δ.

  3. 40 CFR 93.122 - Procedures for determining regional transportation-related emissions.

    Science.gov (United States)

    2010-07-01

    ... of transit currently is anticipated to be a significant factor in satisfying transportation demand... in the latest conforming TIP) with design concept and scope adequate to determine its contribution to... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Procedures for determining regional...

  4. Evaluating the hydraulic and transport properties of peat soil using pore network modeling and X-ray micro computed tomography

    Science.gov (United States)

    Gharedaghloo, Behrad; Price, Jonathan S.; Rezanezhad, Fereidoun; Quinton, William L.

    2018-06-01

    Micro-scale properties of peat pore space and their influence on hydraulic and transport properties of peat soils have been given little attention so far. Characterizing the variation of these properties in a peat profile can increase our knowledge on the processes controlling contaminant transport through peatlands. As opposed to the common macro-scale (or bulk) representation of groundwater flow and transport processes, a pore network model (PNM) simulates flow and transport processes within individual pores. Here, a pore network modeling code capable of simulating advective and diffusive transport processes through a 3D unstructured pore network was developed; its predictive performance was evaluated by comparing its results to empirical values and to the results of computational fluid dynamics (CFD) simulations. This is the first time that peat pore networks have been extracted from X-ray micro-computed tomography (μCT) images of peat deposits and peat pore characteristics evaluated in a 3D approach. Water flow and solute transport were modeled in the unstructured pore networks mapped directly from μCT images. The modeling results were processed to determine the bulk properties of peat deposits. Results portray the commonly observed decrease in hydraulic conductivity with depth, which was attributed to the reduction of pore radius and increase in pore tortuosity. The increase in pore tortuosity with depth was associated with more decomposed peat soil and decreasing pore coordination number with depth, which extended the flow path of fluid particles. Results also revealed that hydraulic conductivity is isotropic locally, but becomes anisotropic after upscaling to core-scale; this suggests the anisotropy of peat hydraulic conductivity observed in core-scale and field-scale is due to the strong heterogeneity in the vertical dimension that is imposed by the layered structure of peat soils. Transport simulations revealed that for a given solute, the effective

  5. Novel evaporation experiment to determine soil hydraulic properties

    Directory of Open Access Journals (Sweden)

    K. Schneider

    2006-01-01

    Full Text Available A novel experimental approach to determine soil hydraulic material properties for the dry and very dry range is presented. Evaporation from the surface of a soil column is controlled by a constant flux of preconditioned air and the resulting vapour flux is measured by infrared absorption spectroscopy. The data are inverted under the assumptions that (i the simultaneous movement of water in the liquid and vapour is represented by Richards' equation with an effective hydraulic conductivity and that (ii the coupling between the soil and the well-mixed atmosphere can be modelled by a boundary layer with a constant transfer resistance. The optimised model fits the data exceptionally well. Remaining deviations during the initial phase of an experiment are thought to be well-understood and are attributed to the onset of the heat flow through the column which compensates the latent heat of evaporation.

  6. Determination of Properties of Selected Fresh and Processed Medicinal Plants

    Directory of Open Access Journals (Sweden)

    Shirley G. Cabrera

    2015-11-01

    Full Text Available The study aimed to determine the chemical properties, bioactive compounds, antioxidant activity and toxicity level of fresh and processed medicinal plants such as corn (Zea mays silk, pancitpancitan (Peperomiapellucida leaves, pandan (Pandanus amaryllifolius leaves, and commercially available tea. The toxicity level of the samples was measured using the Brine Shrimp Lethality Assay (BSLA. Statistical analysis was done using Statistical Package for Social Sciences (SPSS. Results showed that in terms of chemical properties there is significant difference between fresh and processed corn silk except in crude fiber content was noted. Based on proximate analyses of fresh and processed medicinal plants specifically in terms of % moisture, %crude protein and % total carbohydrates were also observed. In addition, there is also significant difference on bioactive compound contents such as total flavonoids and total phenolics between fresh and processed corn silk except in total vitamin E (TVE content. Pandan and pancit-pancitan showed significant difference in all bioactive compounds except in total antioxidant content (TAC. Fresh pancit-pancitan has the highest total phenolics content (TPC and TAC, while the fresh and processed corn silk has the lowest TAC and TVE content, respectively. Furthermore, results of BSLA for the three medicinal plants and commercially available tea extract showed after 24 hours exposure significant difference in toxicity level was observed. The percentage mortality increased with an increase in exposure time of the three medicinal plants and tea extract. The results of the study can served as baseline data for further processing and commercialization of these medicinal plants.

  7. Determination of magnetic properties of multilayer metallic thin films

    International Nuclear Information System (INIS)

    Birlikseven, C.

    2000-01-01

    In recent year, Giant Magnetoresistance Effect has been attracting an increasingly high interest. High sensitivity magnetic field detectors and high sensitivity read heads of magnetic media can be named as important applications of these films. In this work, magnetic and electrical properties of single layer and thin films were investigated. Multilayer thin films were supplied by Prof. Dr. A. Riza Koeymen from Texas University. Multilayer magnetic thin films are used especially for magnetic reading and magnetic writing. storing of large amount of information into small areas become possible with this technology. Single layer films were prepared using the electron beam evaporation technique. For the exact determination of film thicknesses, a careful calibration of the thicknesses was made. Magnetic properties of the multilayer films were studied using the magnetization, magnetoresistance measurements and ferromagnetic resonance technique. Besides, by fitting the experimental results to the theoretical models, effective magnetization and angles between the ferromagnetic layers were calculated. The correspondence between magnetization and magnetoresistance was evaluated. To see the effect of anisotropic magnetoresistance in the magnetoresistance measurements, a new experimental set-up was build and measurements were taken in this set-up. A series of soft permalloy thin films were made, and temperature dependent resistivity, magnetoresistance, anisotropic magnetoresistance and magnetization measurements were taken

  8. Neighborhood properties are important determinants of temperature sensitive mutations.

    Directory of Open Access Journals (Sweden)

    Svetlana Lockwood

    Full Text Available Temperature-sensitive (TS mutants are powerful tools to study gene function in vivo. These mutants exhibit wild-type activity at permissive temperatures and reduced activity at restrictive temperatures. Although random mutagenesis can be used to generate TS mutants, the procedure is laborious and unfeasible in multicellular organisms. Further, the underlying molecular mechanisms of the TS phenotype are poorly understood. To elucidate TS mechanisms, we used a machine learning method-logistic regression-to investigate a large number of sequence and structure features. We developed and tested 133 features, describing properties of either the mutation site or the mutation site neighborhood. We defined three types of neighborhood using sequence distance, Euclidean distance, and topological distance. We discovered that neighborhood features outperformed mutation site features in predicting TS mutations. The most predictive features suggest that TS mutations tend to occur at buried and rigid residues, and are located at conserved protein domains. The environment of a buried residue often determines the overall structural stability of a protein, thus may lead to reversible activity change upon temperature switch. We developed TS prediction models based on logistic regression and the Lasso regularized procedure. Through a ten-fold cross-validation, we obtained the area under the curve of 0.91 for the model using both sequence and structure features. Testing on independent datasets suggested that the model predicted TS mutations with a 50% precision. In summary, our study elucidated the molecular basis of TS mutants and suggested the importance of neighborhood properties in determining TS mutations. We further developed models to predict TS mutations derived from single amino acid substitutions. In this way, TS mutants can be efficiently obtained through experimentally introducing the predicted mutations.

  9. Designing and Determining Psychometric Properties of the Elder Neglect Checklist

    Directory of Open Access Journals (Sweden)

    Majideh Heravi-Karimooi

    2013-10-01

    Full Text Available Objectives: The purpose of this study was to design and determine the psychometric properties of a checklist for assessing domestic elder neglect. Methods & Materials: This study was conducted in four phases. In the first phase, the meaning of domestic elder neglect explored using the qualitative method of phenomenology. In the second phase, a checklist was created, based on the results obtained in the first phase, in conjunction with the inductions from the expert panel. In the third and fourth phases, the psychometric properties including face validity, content validity, construct validity, convergent validity, internal consistency, and Inter- rater reliability were measured. 110 elderly people participated in the this study. Results: The initial 26 item checklist designed using the results of first and second phases of study, reduced to 11 items and 2 factors including the health and care needs neglect, and neglect in providing healthy environment in the process of determining the face and content validity. Acceptable convergent validity was identified in the elder neglect checklist and care neglect scale of the domestic elder abuse questionnaire (r=0.862. The results of known groups' comparisons showed that this checklist could successfully discriminate between subgroups of elderly people in the index of re-hospitalization. The internal consistency (Kuder-Richardson Formula 20 was 0.824. Inter- rater reliability of the checklist was 0.850. Conclusion: The elder neglect checklist with 11 items appears to be a promising tool, providing reliable and valid data helping to detect neglect among elders in different settings such as clinical settings, homes and research environments by health care providers and researchers.

  10. properties of the SN - equivalent integral transport operator in slab geometry and the iterative acceleration of neutron transport methods

    International Nuclear Information System (INIS)

    Massimiliano, Rosa; Azmy, Y.Y.; Morel, J.E.

    2005-01-01

    The general expressions for the matrix elements of the discrete Sn-equivalent integral transport operator have been derived in slab geometry. Their asymptotic behavior has been investigated both for a homogeneous slab and for a heterogeneous slab characterized by a periodic material discontinuity wherein each optically thick cell is surrounded by two optically thin cells in a repeating pattern. In the case of a homogeneous slab, the asymptotic analysis conducted in a diffusive limit obtained as the thick limit of computational cell size for a highly scattering medium, has shown that the discretized integral transport operator is approximated by a sparse matrix characterized by a tri-diagonal diffusion-like coupling stencil. Also, the tri-diagonal matrix structure, characteristic of the diffusion coupling stencil, is approached at a fast exponential rate. In the case of periodically heterogeneous slab configurations, the asymptotic behavior investigated is that in which the cells' optical thicknesses are pushed apart, i.e. the thick is made thicker while the thin is made thinner at a prescribed rate. It has been shown that in this limit the discretized integral transport operator is approximated by a penta-diagonal structure. Notwithstanding, the discrete operator is amenable to algebraic transformations leading to a matrix representation still asymptotically approaching a tri-diagonal structure at a fast exponential rate. The existence of a low order tri-diagonal approximation to the full discrete integral transport operator in the case of a periodically heterogeneous slab might provide a basic understanding of the superior convergence properties of diffusion-based acceleration schemes observed in slab geometry, even in the presence of sharp material discontinuities. The obtained results also suggest that a sparse approximation to the S n -equivalent integral transport operator might itself be used as the low-order operator in an acceleration scheme for the

  11. Transport Properties of ZnSe- ITO Hetero Junction

    Science.gov (United States)

    Ichibakase, Tsuyoshi

    In this report, ITO(Indium Tin Oxide) was used on the glass substrates as the transparent electrode, and ZnSe layer was prepared by the vacuum deposition on this ITO. Then, the electrical characteristics of this sample were investigated by mans of the electric current transport analysis. The sample that ZnSe was prepared as 3.4 μm in case of ITO-ZnSe sample, has high density level at the junction surface. The ITO-ZnSe junction has two type of diffusion current. However, the ITO-ZnSe sample that ZnSe layer was prepared as 0.1 μm can be assumed as the ohmic contact, and ITO-ZnSe(0.1μm) -CdTe sample shows the avalanche breakdown, and it is considered that the avalanche breakdown occurs in CdTe layer. It is difficult to occur the avalanche breakdown, if ZnSe-CdTe junction has high-density level and CdTe layer has high-density defect. Hence, the ZnSe-CdTe sample that CdTe layer was prepared on ITO-ZnSe(0.1μm) substrate has not high-density level at the junction surface, and the CdTe layer with little lattice imperfection can be prepared. It found that ITO-ZnSe(0.1μm) substrate is available for the II-VI compounds semiconductor device through above analysis result.

  12. Electrical transport properties in Co nanocluster-assembled granular film

    Science.gov (United States)

    Zhang, Qin-Fu; Wang, Lai-Sen; Wang, Xiong-Zhi; Zheng, Hong-Fei; Liu, Xiang; Xie, Jia; Qiu, Yu-Long; Chen, Yuanzhi; Peng, Dong-Liang

    2017-03-01

    A Co nanocluster-assembled granular film with three-dimensional cross-connection paralleled conductive paths was fabricated by using the plasma-gas-condensation method in a vacuum environment. The temperature-dependent longitudinal resistivity and anomalous Hall effect of this new type granular film were systematically studied. The longitudinal resistivity of the Co nanocluster-assembled granular film first decreased and then increased with increasing measuring temperature, revealing a minimum value at certain temperature, T min . In a low temperature region ( T governed the electrical transport process, and the temperature coefficient of resistance (TCR) showed an insulator-type behavior. The thermal fluctuation-induced tunneling conduction progressively increased with increasing temperature, which led to a decrease in the longitudinal resistivity. In a high temperature region, the TCR showed a metallic-type behavior, which was primarily attributed to the temperature-dependent scattering. Different from the longitudinal resistivity behavior, the saturated anomalous Hall resistivity increased monotonically with increasing measuring temperature. The value of the anomalous Hall coefficient ( R S ) reached 2.3 × 10-9 (Ω cm)/G at 300 K, which was about three orders of magnitude larger than previously reported in blocky single-crystal Co [E. N. Kondorskii, Sov. Phys. JETP 38, 977 (1974)]. Interestingly, the scaling relation ( ρx y A ∝ ρx x γ ) between saturated anomalous Hall resistivity ( ρx y A ) and longitudinal resistivity ( ρ x x ) was divided into two regions by T min . However, after excluding the contribution of tunneling, the scaling relation followed the same rule. The corresponding physical mechanism was also proposed to explain these phenomena.

  13. Transport properties of Dirac fermions in two dimensions

    Science.gov (United States)

    DaSilva, Ashley M.

    The Dirac equation in particle physics is used to describe spin 1/2 fermions (such as electrons) moving at relativistic speeds. In condensed matter physics, this is usually not relevant, since particles in matter move slowly compared to the speed of light. However, recent progress has revealed two-dimensional realizations of Dirac fermions in condensed matter systems with zero mass and a redefined "speed of light." One of these systems, graphene, has been studied theoretically for decades as a building block of graphite. The other, the topological insulator, is quite new; this state of matter was predicted less than 10 years ago. Graphene was first isolated in 2004, and since then there has been an explosion of graphene research in the physics community. Much of the recent excitement has to do with the potential applications of graphene in devices. In this dissertation, I will discuss two problems related to graphene devices, and in particular how to use the strong interaction of graphene with its surroundings as an asset. I will show that a Boltzmann transport theory with all scattering mechanisms describes the current vs voltage of a graphene sheet extremely well using no adjustable parameters. One crucial element of this model is the transfer of energy from electrons directly to the substrate via scattering with optical phonons at the interface. The interaction is due to an electric field that is set up by these optical phonons, which is so strongly interacting in part due to the two dimensionality of the graphene. I will also discuss the adsorption of He atoms on a graphene sheet. This causes a change in the graphene conductivity which is large enough to be measurable. Work in this direction could provide a route to graphene sensors. The topological insulator is a recently predicted state of matter which is nominally an insulator but has metallic surface states which are topologically protected. This topological protection arises from the symmetry of the system

  14. The shielding properties of the newly developed container for transport of samples contaminated with CBRN substances

    International Nuclear Information System (INIS)

    Fisera, O.; Kares, J.

    2014-01-01

    A container for transport of environmental samples to the analytical laboratory is being developed as part of the development of system for collection and transport of samples contaminated with chemical, biological, radioactive and nuclear (CBRN) substances after CBRN incidents. The proposed system corresponds with current requirements of NATO publication AEP-66. The proposed container will meet the requirements of mechanical stability and tightness for the packaging of the chemical, biological and radioactive substances. Verification of shielding properties and satisfaction of requirements of radiation protection during transport of potentially relatively high active samples was the aim of this part of research. The results, together with a wall thickness of the inner steel container, the inner lining and the outer transport package, give excellent assumption that the radiation protection requirements for the proposed container and transport package will be satisfied. (authors)

  15. Human skeletal muscle drug transporters determine local exposure and toxicity of statins.

    Science.gov (United States)

    Knauer, Michael J; Urquhart, Bradley L; Meyer zu Schwabedissen, Henriette E; Schwarz, Ute I; Lemke, Christopher J; Leake, Brenda F; Kim, Richard B; Tirona, Rommel G

    2010-02-05

    The 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors, or statins, are important drugs used in the treatment and prevention of cardiovascular disease. Although statins are well tolerated, many patients develop myopathy manifesting as muscle aches and pain. Rhabdomyolysis is a rare but severe toxicity of statins. Interindividual differences in the activities of hepatic membrane drug transporters and metabolic enzymes are known to influence statin plasma pharmacokinetics and risk for myopathy. Interestingly, little is known regarding the molecular determinants of statin distribution into skeletal muscle and its relevance to toxicity. We sought to identify statin transporters in human skeletal muscle and determine their impact on statin toxicity in vitro. We demonstrate that the uptake transporter OATP2B1 (human organic anion transporting polypeptide 2B1) and the efflux transporters, multidrug resistance-associated protein (MRP)1, MRP4, and MRP5 are expressed on the sarcolemmal membrane of human skeletal muscle fibers and that atorvastatin and rosuvastatin are substrates of these transporters when assessed using a heterologous expression system. In an in vitro model of differentiated, primary human skeletal muscle myoblast cells, we demonstrate basal membrane expression and drug efflux activity of MRP1, which contributes to reducing intracellular statin accumulation. Furthermore, we show that expression of human OATP2B1 in human skeletal muscle myoblast cells by adenoviral vectors increases intracellular accumulation and toxicity of statins and such effects were abrogated when cells overexpressed MRP1. These results identify key membrane transporters as modulators of skeletal muscle statin exposure and toxicity.

  16. Magneto-transport properties of a random distribution of few-layer graphene patches

    International Nuclear Information System (INIS)

    Iacovella, Fabrice; Mitioglu, Anatolie; Pierre, Mathieu; Raquet, Bertrand; Goiran, Michel; Plochocka, Paulina; Escoffier, Walter; Trinsoutrot, Pierre; Vergnes, Hugues; Caussat, Brigitte; Conédéra, Véronique

    2014-01-01

    In this study, we address the electronic properties of conducting films constituted of an array of randomly distributed few layer graphene patches and investigate on their most salient galvanometric features in the moderate and extreme disordered limit. We demonstrate that, in annealed devices, the ambipolar behaviour and the onset of Landau level quantization in high magnetic field constitute robust hallmarks of few-layer graphene films. In the strong disorder limit, however, the magneto-transport properties are best described by a variable-range hopping behaviour. A large negative magneto-conductance is observed at the charge neutrality point, in consistency with localized transport regime

  17. Spin-polarized transport properties of a pyridinium-based molecular spintronics device

    Science.gov (United States)

    Zhang, J.; Xu, B.; Qin, Z.

    2018-05-01

    By applying a first-principles approach based on non-equilibrium Green's functions combined with density functional theory, the transport properties of a pyridinium-based "radical-π-radical" molecular spintronics device are investigated. The obvious negative differential resistance (NDR) and spin current polarization (SCP) effect, and abnormal magnetoresistance (MR) are obtained. Orbital reconstruction is responsible for novel transport properties such as that the MR increases with bias and then decreases and that the NDR being present for both parallel and antiparallel magnetization configurations, which may have future applications in the field of molecular spintronics.

  18. Transport properties of magnetic atom bridges controlled by a scanning tunneling microscope

    International Nuclear Information System (INIS)

    Nakanishi, H.; Kishi, T.; Kasai, H.; Komori, F.; Okiji, A.

    2003-01-01

    We have investigated the transport and magnetic properties of the atom bridge made from magnetic materials, which is the atom-scale wire constructed between a scanning tunneling microscope (STM) tip and a solid surface, by the use of ab initio calculations. In the case of the twisted ladder structure atom bridge made of Fe, we have found that the magnetic state of the bridge changes from ferromagnetic to paramagnetic, as we compress the bridge in length. We report the spin dependent quantized conductance of the bridge. And we discuss the origin of a change in transport properties as we compress the bridge in length

  19. Spintronic and transport properties of linear atomic strings of transition metals (Fe, Co, Ni)

    Energy Technology Data Exchange (ETDEWEB)

    Tyagi, Neha, E-mail: nehatyagi.phy@gmail.com [Department of Applied Physics, Delhi Technological University, New Delhi (India); Jaiswal, Neeraj K. [Discipline of Physics, PDPM-Indian Institute of Information Technology, Design & Manufacturing, Jabalpur (India); Srivastava, Pankaj [Nanomaterials Research Group, ABV-Indian Institute of Information Technology & Management, Gwalior (India)

    2016-05-06

    In the present work, first-principles investigations have been performed to study the spintronic and transport properties of linear atomic strings of Fe, Co and Ni. The structural stabilities of the considered strings were compared on the basis of binding energies which revealed that all the strings are energetically feasible to be achieved. Further, all the considered strings are found to be ferromagnetic and the observed magnetic moment ranges from 1.38 to 1.71 μ{sub B}. The observed transport properties and high spin polarization points towards their potential for nano interconnects and spintronic applications.

  20. The application of radioactive tracers for determination of bed-load transport in alluvial rivers

    International Nuclear Information System (INIS)

    Thomsen, T.

    1980-01-01

    Radioactive isotopes have been applied for determining the transport rate of bed load in an alluvial river on the basis of: centroid velocity of the tracer particles, size and material-transporting width of mobile layer. These parameters were found by detailed measurements in the field. Computed values were produced on the basis of Engelund and Fredsoee's model on sediment transport and on the propagation of bed forms. When comparing measured and computed values, the difference was about 25%. Finally, the applicability of tracer methods for solving practical problem is discussed. (author)

  1. Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.

    Science.gov (United States)

    Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J

    2018-03-21

    Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.

  2. High-field thermal transports properties of REBCO coated conductors

    CERN Document Server

    Bonura, M

    2015-01-01

    The use of REBCO coated conductors is envisaged for many applications, extending from power cables to high-field magnets. Whatever the case, thermal properties of REBCO tapes play a key role for the stability of superconducting devices. In this work, we present the first study on the longitudinal thermal conductivity (k) of REBCO coated conductors in magnetic fields up to 19 T applied both parallelly and perpendicularly to the thermal-current direction. Copper-stabilized tapes from six industrial manufacturers have been investigated. We show that zero-field k of coated conductors can be calculated with an accuracy of ‡ 15% from the residual resistivity ratio of the stabilizer and the Cu/non-Cu ratio. Measurements performed at high fields have allowed us to evaluate the consistency of the procedures generally used for estimating in-field k in the framework of the Wiedemann-Franz law from an electrical characterization of the materials. In-field data are intended to provide primary ingredients for the ...

  3. Structure and transport properties of polymer grafted nanoparticles

    KAUST Repository

    Goyal, Sushmit; Escobedo, Fernando A.

    2011-01-01

    We perform molecular dynamics simulations on a bead-spring model of pure polymer grafted nanoparticles (PGNs) and of a blend of PGNs with a polymer melt to investigate the correlation between PGN design parameters (such as particle core concentration, polymer grafting density, and polymer length) and properties, such as microstructure, particle mobility, and viscous response. Constant strain-rate simulations were carried out to calculate viscosities and a constant-stress ensemble was used to calculate yield stresses. The PGN systems are found to have less structural order, lower viscosity, and faster diffusivity with increasing length of the grafted chains for a given core concentration or grafting density. Decreasing grafting density causes depletion effects associated with the chains leading to close contacts between some particle cores. All systems were found to shear thin, with the pure PGN systems shear thinning more than the blend; also, the pure systems exhibited a clear yielding behavior that was absent in the blend. Regarding the mechanism of shear thinning at the high shear rates examined, it was found that the shear-induced decrease of Brownian stresses and increase in chain alignment, both correlate with the reduction of viscosity in the system with the latter being more dominant. A coupling between Brownian stresses and chain alignment was also observed wherein the non-equilibrium particle distribution itself promotes chain alignment in the direction of shear. © 2011 American Institute of Physics.

  4. RR Tel: Determination of Dust Properties During Minimum Obscuration

    Directory of Open Access Journals (Sweden)

    Jurkić T.

    2012-06-01

    Full Text Available the ISO infrared spectra and the SAAO long-term JHKL photometry of RR Tel in the epochs during minimum obscuration are studied in order to construct a circumstellar dust model. the spectral energy distribution in the near- and the mid-IR spectral range (1–15 μm was obtained for an epoch without the pronounced dust obscuration. the DUSTY code was used to solve the radiative transfer through the dust and to determine the circumstellar dust properties of the inner dust regions around the Mira component. Dust temperature, maximum grain size, dust density distribution, mass-loss rate, terminal wind velocity and optical depth are determined. the spectral energy distribution and the long-term JHKL photometry during an epoch of minimum obscuration show almost unattenuated stellar source and strong dust emission which cannot be explained by a single dust shell model. We propose a two-component model consisting of an optically thin circmustellar dust shell and optically thick dust outside the line of sight in some kind of a flattened geometry, which is responsible for most of the observed dust thermal emission.

  5. Transport characteristics of n-ZnO/p-Si heterojunction as determined from temperature dependent current–voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.

    2016-01-01

    Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.

  6. Transport timescales and tracer properties in the extratropical UTLS

    Science.gov (United States)

    Hoor, P.; Wernli, H.; Hegglin, M. I.

    2010-05-01

    A comprehensive evaluation of seasonal backward trajectories initialized in the Northern Hemisphere lowermost stratosphere (LMS) has been performed to investigate the origin of air parcels and the main mechanisms determining characteristic structures in H2O and CO within the LMS. In particular we explain the fundamental role of the transit time since last tropopause crossing (tTST) for the chemical structure of the LMS as well as the feature of the extra-tropical tropopause transition layer (ExTL) as identified from CO profiles. The distribution of H2O in the background LMS above Θ=320 K and 340 K in northern winter and summer, respectively, is found to be governed mainly by the saturation mixing ratio, which in turn is determined by the Lagrangian Cold Point (LCP) encountered by each trajectory. Most of the backward trajectories from this region in the LMS experienced their LCP in the tropics and sub-tropics. The transit time since crossing the tropopause from the troposphere to the stratosphere (tTST) is independent of the H2O value of the air parcel. TST often occurs 20 days after trajectories have encountered their LCP. CO, on the other hand, depends strongly on tTST due to its finite lifetime. The ExTL as identified from CO measurements is then explained as a layer of air just above the tropopause, which on average encountered TST fairly recently.

  7. Impact of carbonation on water transport properties of cement-based materials

    International Nuclear Information System (INIS)

    Auroy, M.; Poyet, S.; Le Bescop, P.; Torrenti, J.M.

    2015-01-01

    Cement-based materials would be commonly used for nuclear waste management and, particularly for geological disposal vaults as well as containers in France. Under service conditions, the structures would be subjected to simultaneous drying and carbonation. Carbonation relates to the reaction between CO 2 and the hydrated cement phases (mainly portlandite and C-S-H). It induces mineralogical and microstructural changes (due to hydrates dissolution and calcium carbonate precipitation). It results in transport properties modifications, which can have important consequences on the durability of reinforced concrete structures. Concrete durability is greatly influenced by water: water is necessary for chemical reactions to occur and significantly impacts transport. The evaluation of the unsaturated water transport properties in carbonated materials is then an important issue. That is the aim of this study. A program has been established to assess the water transport properties in carbonated materials. In this context, four mature hardened cement pastes (CEM I, CEM III/A, CEM V/A according to European standards and a Low-pH blend) are carbonated. Accelerated carbonation tests are performed in a specific device, controlling environmental conditions: (i) CO 2 content of 3%, to ensure representativeness of the mineralogical evolution compared to natural carbonation and (ii) 25 C. degrees and 55% RH, to optimize carbonation rate. After carbonation, the data needed to describe water transport are evaluated in the framework of simplified approach. Three physical parameters are required: (1) the concrete porosity, (2) the water retention curve and, (3) the effective permeability. The obtained results allow creating link between water transport properties of non-carbonated materials to carbonated ones. They also provide a better understanding of the effect of carbonation on water transport in cementitious materials and thus, complement literature data. (authors)

  8. Electrical conductivity and transport properties of cement-based materials measured by impedance spectroscopy

    Science.gov (United States)

    Shane, John David

    The use of Impedance Spectroscopy (IS) as a tool to evaluate the electrical and transport properties of cement-based materials was critically evaluated. Emphasis was placed on determining the efficacy of IS by applying it as a tool to investigate several families of cement-based materials. Also, the functional aspects of electroding and null corrections were also addressed. The technique was found to be advantageous for these analyses, especially as a non-destructive, in-situ, rapid test. Moreover, key insights were gained into several cement-based systems (e.g., cement mortars and oil-well grouts) as well as the effect that certain testing techniques can have on materials (e.g., the rapid chloride permeability test). However, some limitations of IS were identified. For instance, improper electroding of samples can lead to erroneous results and incorrect interpretations for both two-point and multi-point measurements. This is an area of great importance, but it has received very little attention in the literature. Although the analysis of cement/electrode techniques is in its infancy, much progress was made in gaining a full understand of how to properly and reliably connect electrodes to cement-based materials. Through the application of IS to materials such as oil-well grouts, cement mortars and concretes, a great deal of valuable information about the effectiveness of IS has been gained. Oil-well cementing is somewhat limited by the inability to make measurements in the well-bore. By applying IS to oil-well grouts in a laboratory environment, it was demonstrated that IS is a viable technique with which to test the electrical and transport properties of these materials in-situ. Also, IS was shown to have the ability to measure the electrical conductivity of cement mortars with such accuracy, that very subtle changes in properties can be monitored and quantified. Through the use of IS and theoretical models, the complex interplay between the interfacial transition

  9. Semiquantum molecular dynamics simulation of thermal properties and heat transport in low-dimensional nanostructures

    Science.gov (United States)

    Savin, Alexander V.; Kosevich, Yuriy A.; Cantarero, Andres

    2012-08-01

    We present a detailed description of semiquantum molecular dynamics simulation of stochastic dynamics of a system of interacting particles. Within this approach, the dynamics of the system is described with the use of classical Newtonian equations of motion in which the effects of phonon quantum statistics are introduced through random Langevin-like forces with a specific power spectral density (the color noise). The color noise describes the interaction of the molecular system with the thermostat. We apply this technique to the simulation of thermal properties and heat transport in different low-dimensional nanostructures. We describe the determination of temperature in quantum lattice systems, to which the equipartition limit is not applied. We show that one can determine the temperature of such a system from the measured power spectrum and temperature- and relaxation-rate-independent density of vibrational (phonon) states. We simulate the specific heat and heat transport in carbon nanotubes, as well as the heat transport in molecular nanoribbons with perfect (atomically smooth) and rough (porous) edges, and in nanoribbons with strongly anharmonic periodic interatomic potentials. We show that the effects of quantum statistics of phonons are essential for the carbon nanotube in the whole temperature range T<500K, in which the values of the specific heat and thermal conductivity of the nanotube are considerably less than that obtained within the description based on classical statistics of phonons. This conclusion is also applicable to other carbon-based materials and systems with high Debye temperature like graphene, graphene nanoribbons, fullerene, diamond, diamond nanowires, etc. We show that the existence of rough edges and quantum statistics of phonons change drastically the low-temperature thermal conductivity of the nanoribbon in comparison with that of the nanoribbon with perfect edges and classical phonon dynamics and statistics. The semiquantum molecular

  10. Polycrystalline Mg2Si thin films: A theoretical investigation of their electronic transport properties

    International Nuclear Information System (INIS)

    Balout, H.; Boulet, P.; Record, M.-C.

    2015-01-01

    The electronic structures and thermoelectric properties of a polycrystalline Mg 2 Si thin film have been investigated by first-principle density-functional theory (DFT) and Boltzmann transport theory calculations within the constant-relaxation time approximation. The polycrystalline thin film has been simulated by assembling three types of slabs each having the orientation (001), (110) or (111) with a thickness of about 18 Å. The effect of applying the relaxation procedure to the thin film induces disorder in the structure that has been ascertained by calculating radial distribution functions. For the calculations of the thermoelectric properties, the energy gap has been fixed at the experimental value of 0.74 eV. The thermoelectric properties, namely the Seebeck coefficient, the electrical conductivity and the power factor, have been determined at three temperatures of 350 K, 600 K and 900 K with respect to both the energy levels and the p-type and n-type doping levels. The best Seebeck coefficient is obtained at 350 K: the S yy component of the tensor amounts to about ±1000 μV K −1 , depending on the type of charge carriers. However, the electrical conductivity is much too small which results in low values of the figure of merit ZT. Structure–property relationship correlations based on directional radial distribution functions allow us to tentatively draw some explanations regarding the anisotropy of the electrical conductivity. Finally, the low ZT values obtained for the polycrystalline Mg 2 Si thin film are paralleled with those recently reported in the literature for bulk chalcogenide glasses. - Graphical abstract: Structure of the polycrystalline thin film of Mg 2 Si. - Author-Highlights: • Polycrystalline Mg 2 Si film has been modelled by DFT approach. • Thermoelectric properties have been evaluated by semi-classical Boltzmann theory. • The structure was found to be slightly disordered after relaxation. • The highest value of Seebeck

  11. Electronic structure and transport properties of quasi-one-dimensional carbon nanomaterials

    Directory of Open Access Journals (Sweden)

    Y. N. Wu

    2017-09-01

    Full Text Available Based on the density functional theory combined with the nonequilibrium Green’s function, the influence of the wrinkle on the electronic structures and transport properties of quasi-one-dimensional carbon nanomaterials have been investigated, in which the wrinkled armchair graphene nanoribbons (wAGNRs and the composite of AGNRs and single walled carbon nanotubes (SWCNTs were considered with different connection of ripples. The wrinkle adjusts the electronic structures and transport properties of AGNRs. With the change of the strain, the wAGNRs for three width families reveal different electrical behavior. The band gap of AGNR(6 increases in the presence of the wrinkle, which is opposite to that of AGNR(5 and AGNR(7. The transport of AGNRs with the widths 6 or 7 has been modified by the wrinkle, especially by the number of isolated ripples, but it is insensitive to the strain. The nanojunctions constructed by AGNRs and SWCNTs can form the quantum wells, and some specific states are confined in wAGNRs. Although these nanojunctions exhibit the metallic, they have poor conductance due to the wrinkle. The filling of C20 into SWCNT has less influence on the electronic structure and transport of the junctions. The width and connection type of ripples have greatly influenced on the electronic structures and transport properties of quasi-one-dimensional nanomaterials.

  12. Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers

    Science.gov (United States)

    Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco

    2011-03-01

    The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.

  13. Electronic structure and transport properties of quasi-one-dimensional carbon nanomaterials

    Science.gov (United States)

    Wu, Y. N.; Cheng, P.; Wu, M. J.; Zhu, H.; Xiang, Q.; Ni, J.

    2017-09-01

    Based on the density functional theory combined with the nonequilibrium Green's function, the influence of the wrinkle on the electronic structures and transport properties of quasi-one-dimensional carbon nanomaterials have been investigated, in which the wrinkled armchair graphene nanoribbons (wAGNRs) and the composite of AGNRs and single walled carbon nanotubes (SWCNTs) were considered with different connection of ripples. The wrinkle adjusts the electronic structures and transport properties of AGNRs. With the change of the strain, the wAGNRs for three width families reveal different electrical behavior. The band gap of AGNR(6) increases in the presence of the wrinkle, which is opposite to that of AGNR(5) and AGNR(7). The transport of AGNRs with the widths 6 or 7 has been modified by the wrinkle, especially by the number of isolated ripples, but it is insensitive to the strain. The nanojunctions constructed by AGNRs and SWCNTs can form the quantum wells, and some specific states are confined in wAGNRs. Although these nanojunctions exhibit the metallic, they have poor conductance due to the wrinkle. The filling of C20 into SWCNT has less influence on the electronic structure and transport of the junctions. The width and connection type of ripples have greatly influenced on the electronic structures and transport properties of quasi-one-dimensional nanomaterials.

  14. Determinants of satisfaction with campus transportation services: Implications for service quality

    Directory of Open Access Journals (Sweden)

    Felix Charbatzadeh

    2016-04-01

    Full Text Available Background: In a number of countries, buses are a critical element of public transportation, providing the most inclusive and sustainable mode of transportation to all forms of citizenry, including staff and students of universities. Objectives: The study examines the determinants of satisfaction with campus bus transportation. The article is primarily discursive and based on the synthesis of existing service literature supported by data obtained from a survey of 847 respondents. Method: Structural equation modelling is undertaken using AMOS 19, allowing for the examination of compound relationships between service engagement variables. Results: Results show statistically significant differences between perceived service quality and travel routes. The authors argue that managerial attention to service user experiences does not only hold the key to ongoing competitive success in campus transportation services but also that those services can be significantly enriched through greater managerial attention to the interface between risk of financial loss (which increases when the campus bus transportation service provider becomes less able to compete and service quality. Conclusion: The authors argue that if providers of campus bus transportation services are to rise to their service delivery challenges and also maintain or improve upon their market positions, they must conceptualise their services in a manner that takes into consideration the two-way interrelationship between risk of financial loss and service quality. It must also be noted that, although this study may have relevance for firm–firm scenarios, its focus is primarily on service supplier firm–customer service engagements. Keywords: Modelling; Transportation; Service

  15. On calculating phase shifts and performing fits to scattering cross sections or transport properties

    International Nuclear Information System (INIS)

    Hepburn, J.W.; Roy, R.J. Le

    1978-01-01

    Improved methods of calculating quantum mechanical phase shifts and for performing least-squares fits to scattering cross sections or transport properties, are described. Their use in a five-parameter fit to experimental differential cross sections reduces the computer time by a factor of 4-7. (Auth.)

  16. Frictional behaviour and transport properties of simulated fault gouges derived from a natural CO2 reservoir

    NARCIS (Netherlands)

    Bakker, E.; Hangx, S.J.T.|info:eu-repo/dai/nl/30483579X; Niemeijer, A.R.|info:eu-repo/dai/nl/370832132; Spiers, C.J.|info:eu-repo/dai/nl/304829323

    2016-01-01

    We investigated the effects of long-term CO2-brine-rock interactions on the frictional and transport properties of reservoir-derived fault gouges, prepared from both unexposed and CO2-exposed sandstone, and from aragonite-cemented fault rock of an active CO2-leaking conduit, obtained from a natural

  17. Pressure and irradiation effects on transport properties of samarium compounds with instable valence

    International Nuclear Information System (INIS)

    Morillo, J.

    1981-01-01

    Electron transport properties in samarium compounds with instable valence are studied in this thesis: from SmS in its integer valence phases at common pressure to SmB 6 compound IV at common pressure through SmSsub(1-x)Psub(x) (x 6 is presented [fr

  18. Conduction band splitting and transport properties of Bi2Se3

    Czech Academy of Sciences Publication Activity Database

    Navrátil, Jiří; Horák, Jaromír; Plecháček, T.; Kamba, Stanislav; Lošťák, P.; Dyck, J. S.; Chen, W.; Uher, C.

    2004-01-01

    Roč. 177, č. 4-5 (2004), s. 1704-1712 ISSN 0022-4596 R&D Projects: GA AV ČR KSK2050602; GA AV ČR KSK1010104 Keywords : transport properties * carrier scattering Subject RIV: CA - Inorganic Chemistry Impact factor: 1.815, year: 2004

  19. Dc-transport properties of ferromagnetic (Ga,Mn)As semiconductors

    Czech Academy of Sciences Publication Activity Database

    Jungwirth, Tomáš; Sinova, J.; Wang, K. Y.; Edmonds, K. W.; Campion, R. P.; Gallagher, B. L.; Foxon, C. T.; Niu, Q.; MacDonald, A. H.

    2003-01-01

    Roč. 83, č. 2 (2003), s. 320-322 ISSN 0003-6951 R&D Projects: GA ČR GA202/02/0912 Institutional research plan: CEZ:AV0Z1010914 Keywords : ferromagnetic semiconductors * dc transport properties * (Ga, Mn)As Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.049, year: 2003

  20. Static transport properties of random alloys: Vertex corrections in conserving approximations

    Czech Academy of Sciences Publication Activity Database

    Turek, Ilja

    2016-01-01

    Roč. 93, č. 24 (2016), 245114-1-245114-6 ISSN 2469-9950 R&D Projects: GA ČR GA15-13436S Institutional support: RVO:68081723 Keywords : transport properties * random alloys * coherent-potential approximation Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.836, year: 2016

  1. A whole range hygric material model: Modelling liquid and vapour transport properties in porous media

    DEFF Research Database (Denmark)

    Scheffler, Gregor Albrecht; Plagge, Rudolf

    2010-01-01

    This paper addresses the modelling of hygric material coefficients bridging the gap between measured material properties and the non-linear storage and transport coefficients in the transfer equation. The conductivity approach and a bundle of tubes model are the basis. By extending this model wit...

  2. Theoretical and Numerical Properties of a Gyrokinetic Plasma: Issues Related to Transport Time Scale Simulation

    International Nuclear Information System (INIS)

    Lee, W.W.

    2003-01-01

    Particle simulation has played an important role for the recent investigations on turbulence in magnetically confined plasmas. In this paper, theoretical and numerical properties of a gyrokinetic plasma as well as its relationship with magnetohydrodynamics (MHD) are discussed with the ultimate aim of simulating microturbulence in transport time scale using massively parallel computers

  3. Local charge transport properties of hydrazine reduced monolayer graphene oxide sheets prepared under pressure condition

    DEFF Research Database (Denmark)

    Ryuzaki, Sou; Meyer, Jakob Abild Stengaard; Petersen, Søren Vermehren

    2014-01-01

    Charge transport properties of chemically reduced graphene oxide (RGO) sheets prepared by treatment with hydrazine were examined using conductive atomic force microscopy. The current-voltage (I-V) characteristics of monolayer RGO sheets prepared under atmospheric pressure followed an exponentially...

  4. Response matrix method for neutron transport in reactor lattices using group symmetry properties

    International Nuclear Information System (INIS)

    Mund, E.H.

    1991-01-01

    This paper describes a response matrix method for the approximate solution of one-velocity, multi-dimensional transport problems in reactor lattices, with isotropic neutron scattering. The transport equation is solved on a homogeneous cell by using a Petrov-Galerkin technique based on a set of trial and test functions (including polynomials and exponential functions) closely related to transport problems in infinite media. The number of non-zero elements of the response matrices reduces to a minimum when the symmetry properties of the cell are included ab initio in the span of the basis functions. To include these properties, use is made of projection operations which are performed very efficiently on symbolic manipulation programs. Numerical results of model problems in square geometry show a good agreement with reference solutions

  5. Statistical properties of turbulent transport and fluctuations in tokamak and stellarator devices

    Energy Technology Data Exchange (ETDEWEB)

    Hidalgo, C; Pedrosa, M A; Milligen, B Van; Sanchez, E; Balbin, R; Garcia-Cortes, I [Euratom-CIEMAT Association, Madrid (Spain); Bleuel, J; Giannone, L.; Niedermeyer, H [Euratom-IPP Association, Garching (Germany)

    1997-05-01

    The statistical properties of fluctuations and turbulent transport have been studied in the plasma boundary region of stellarator (TJ-IU, W7-AS) and tokamak (TJ-I) devices. The local flux probability distribution function shows the bursty character of the flux and presents a systematic change as a function of the radial location. There exist large amplitude transport bursts that account for a significant part of the total flux. There is a strong similarity between the statistical properties of the turbulent fluxes in different devices. The value of the radial coherence associated with fluctuations and turbulent transport is strongly intermittent. This result emphasizes the importance of measurements with time resolution in understanding the interplay between the edge and the core regions in the plasma. For measurements in the plasma edge region of the TJ-IU torsatron, the turbulent flux does not, in general, show a larger radial coherence than the one associated with the fluctuations. (author). 14 refs, 6 figs.

  6. Electronic transport properties of nano-scale Si films: an ab initio study

    Science.gov (United States)

    Maassen, Jesse; Ke, Youqi; Zahid, Ferdows; Guo, Hong

    2010-03-01

    Using a recently developed first principles transport package, we study the electronic transport properties of Si films contacted to heavily doped n-type Si leads. The quantum transport analysis is carried out using density functional theory (DFT) combined with nonequilibrium Green's functions (NEGF). This particular combination of NEGF-DFT allows the investigation of Si films with thicknesses in the range of a few nanometers and lengths up to tens of nanometers. We calculate the conductance, the momentum resolved transmission, the potential profile and the screening length as a function of length, thickness, orientation and surface structure. Moreover, we compare the properties of Si films with and without a top surface passivation by hydrogen.

  7. Flow and transport in unsaturated fractured rock: Effects of multiscale heterogeneity of hydrogeologic properties

    International Nuclear Information System (INIS)

    Zhou, Quanlin; Liu, Hui-Hai; Bodvarsson, Gudmundur S.; Oldenburg, Curtis M.

    2002-01-01

    The heterogeneity of hydrogeologic properties at different scales may have different effects on flow and transport processes in a subsurface system. A model for the unsaturated zone of Yucca Mountain, Nevada, is developed to represent complex heterogeneity at two different scales: (1) layer scale corresponding to geologic layering and (2) local scale. The layer-scale hydrogeologic properties are obtained using inverse modeling, based on the available measurements collected from the Yucca Mountain site. Calibration results show a significant lateral and vertical variability in matrix and fracture properties. Hydrogeologic property distributions in a two-dimensional, vertical cross section of the site are generated by combining the average layer-scale matrix and fracture properties with local-scale perturbations generated using a stochastic simulation method. The unsaturated water flow and conservative (nonsorbing) tracer transport through the cross section are simulated for different sets of matrix and fracture property fields. Comparison of simulation results indicates that the local-scale heterogeneity of matrix and fracture properties has a considerable effect on unsaturated flow processes, leading to fast flow paths in fractures and the matrix. These paths shorten the travel time of a conservative tracer from the source (repository) horizon in the unsaturated zone to the water table for small fractions of total released tracer mass. As a result, the local-scale heterogeneity also has a noticeable effect on global tracer transport processes, characterized by an average breakthrough curve at the water table, especially at the early arrival time of tracer mass. However, the effect is not significant at the later time after 20 percent tracer mass reaches the water table. The simulation results also verify that matrix diffusion plays an important role in overall solute transport processes in the unsaturated zone at Yucca Mountain

  8. CHARACTERIZATION OF NATURAL ZEOLITE AND DETERMINATION ITS ADSORPTION PROPERTIES

    Directory of Open Access Journals (Sweden)

    Marian HOLUB

    Full Text Available Pollution of water by toxic substances is one of the major reason concerning human health as well as the environmental quality. In terms of pollution, mining activities represent a serious threat. Countries of the middle Europe, where extraction of mineral resources takes place a long period, have to solve the problems of wastewater containing whole spectra of heavy metals, which are dangerous to the environment. Finding of the new and cheap ways of wastewater contaminated by heavy metals treatment can increase the quality of the environment in the affected localities and thus prevent adverse effects on fauna, flora or human beings. Sorption techniques belong to a cost effective methods that are able to effectively remove heavy metals. For the overall understanding of the sorption process, it is necessary to characterize and determine the properties of the used adsorbents. The paper deals with characterization of natural zeolite before and after sorption process under acidic conditions. The zeolite was characterized using Fourier transform infrared spectroscopy, X – ray diffraction, scanning electron microscopy and N2 adsorption/desorption isotherms.

  9. Electronic structure and quantum transport properties of metallic and semiconducting nanowires

    Science.gov (United States)

    Simbeck, Adam J.

    The future of the semiconductor industry hinges upon new developments to combat the scaling issues that currently afflict two main chip components: transistors and interconnects. For transistors this means investigating suitable materials to replace silicon for both the insulating gate and the semiconducting channel in order to maintain device performance with decreasing size. For interconnects this equates to overcoming the challenges associated with copper when the wire dimensions approach the confinement limit, as well as continuing to develop low-k dielectric materials that can assure minimal cross-talk between lines. In addition, such challenges make it increasingly clear that device design must move from a top-down to a bottom-up approach in which the desired electronic characteristics are tailored from first-principles. It is with such fundamental hurdles in mind that ab initio calculations on the electronic and quantum transport properties of nanoscale metallic and semiconducting wires have been performed. More specifically, this study seeks to elaborate on the role played by confinement, contacts, dielectric environment, edge decoration, and defects in altering the electronic and transport characteristics of such systems. As experiments continue to achieve better control over the synthesis and design of nanowires, these results are expected to become increasingly more important for not only the interpretation of electronic and transport trends, but also in engineering the electronic structure of nanowires for the needs of the devices of the future. For the metallic atomic wires, the quantum transport properties are first investigated by considering finite, single-atom chains of aluminum, copper, gold, and silver sandwiched between gold contacts. Non-equilibrium Green's function based transport calculations reveal that even in the presence of the contact the conductivity of atomic-scale aluminum is greater than that of the other metals considered. This is

  10. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    Science.gov (United States)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  11. A review of reaction rates and thermodynamic and transport properties for the 11-species air model for chemical and thermal nonequilibrium calculations to 30000 K

    Science.gov (United States)

    Gupta, Roop N.; Yos, Jerrold M.; Thompson, Richard A.

    1989-01-01

    Reaction rate coefficients and thermodynamic and transport properties are provided for the 11-species air model which can be used for analyzing flows in chemical and thermal nonequilibrium. Such flows will likely occur around currently planned and future hypersonic vehicles. Guidelines for determining the state of the surrounding environment are provided. Approximate and more exact formulas are provided for computing the properties of partially ionized air mixtures in such environments.

  12. Applications of asymmetric nanotextured parylene surface using its wetting and transport properties

    Science.gov (United States)

    Sekeroglu, Koray

    In this thesis, basic digital fluidics devices were introduced using polymeric nanorods (nano-PPX) inspired from nature. Natural inspiration ignited this research by observing butterfly wings, water strider legs, rye grass leaves, and their asymmetric functions. Nano-PPX rods, manufactured by an oblique angle polymerization (OAP) method, are asymmetrically aligned structures that have unidirectional wetting properties. Nano-PPX demonstrates similar functions to the directional textured surfaces of animals and plants in terms of wetting, adhesion, and transport. The water pin-release mechanism on the asymmetric nano-PPX surface with adhesion function provides a great transport property. How the asymmetry causes transport is discussed in terms of hysteresis and interface contact of water droplets. In this study, the transport property of nano-PPX rods is used to guide droplets as well as transporting cargo such as microgels. With the addition of tracks on the nano-PPX rods, the surfaces were transformed into basic digital fluidics devices. The track-assisted nano-PPX has been employed to applications (i.e. sorting, mixing, and carrying cargo particles). Thus, digital fluidics devices fabricated on nano-PPX surface is a promising pathway to assemble microgels in the field of bioengineering. The characterization of the nano textured surface was completed using methods such as Scanning Electron Microscopy, Atomic Force Microscopy, Contact Angle Goniometry, and Fourier Transform Infra-Red Spectroscopy. These methods helped to understand the physical and chemical properties of nano-PPX. Parameters such as advancing and receding contact angles, nanorod tilt angle, and critical drop volumes were utilized to investigate the anisotropic wetting properties of nano-PPX surface. This investigation explained the directional wetting behavior of the surface as well as approaching new design parameters for adjusting surface properties. The nanorod tilt angle was a key parameter

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. Electronic contributions to the transport properties and specific heat of solid UO2: an empirical, self-consistent analysis

    International Nuclear Information System (INIS)

    Hyland, G.J.; Ralph, J.

    1982-07-01

    From an empirical, self-consistent analysis of new high temperature data on the thermo-electric Seebeck coefficient and d.c. electrical conductivity, the value of the free energy controlling the equilibrium of the thermally induced reaction, 2U 4+ reversible U 3+ + U 5+ is determined (treating the U 3+ and U 5+ as small polarons) and used to calculate the contribution of the process to the high temperature thermal conductivity and specific heat of UO 2 . It is found that the transport properties can be completely accounted for in this way, but not the anomalous rise in specific heat - the origin of which remains obscure. (U.K.)

  15. FY:15 Transport Properties of Run-of-Mine Salt Backfill ? Unconsolidated to Consolidated.

    Energy Technology Data Exchange (ETDEWEB)

    Dewers, Thomas [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Heath, Jason E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Leigh, Christi D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-09-28

    The nature of geologic disposal of nuclear waste in salt formations requires validated and verified two-phase flow models of transport of brine and gas through intact, damaged, and consolidating crushed salt. Such models exist in other realms of subsurface engineering for other lithologic classes (oil and gas, carbon sequestration etc. for clastics and carbonates) but have never been experimentally validated and parameterized for salt repository scenarios or performance assessment. Models for waste release scenarios in salt back-fill require phenomenological expressions for capillary pressure and relative permeability that are expected to change with degree of consolidation, and require experimental measurement to parameterize and validate. This report describes a preliminary assessment of the influence of consolidation (i.e. volume strain or porosity) on capillary entry pressure in two phase systems using mercury injection capillary pressure (MICP). This is to both determine the potential usefulness of the mercury intrusion porosimetry method, but also to enable a better experimental design for these tests. Salt consolidation experiments are performed using novel titanium oedometers, or uniaxial compression cells often used in soil mechanics, using sieved run-of-mine salt from the Waste Isolation Pilot Plant (WIPP) as starting material. Twelve tests are performed with various starting amounts of brine pore saturation, with axial stresses up to 6.2 MPa (~900 psi) and temperatures to 90°C. This corresponds to UFD Work Package 15SN08180211 milestone “FY:15 Transport Properties of Run-of-Mine Salt Backfill – Unconsolidated to Consolidated”. Samples exposed to uniaxial compression undergo time-dependent consolidation, or creep, to various degrees. Creep volume strain-time relations obey simple log-time behavior through the range of porosities (~50 to 2% as measured); creep strain rate increases with temperature and applied stress as expected. Mercury porosimetry

  16. Review and assessment of thermodynamic and transport properties for the CONTAIN Code

    International Nuclear Information System (INIS)

    Valdez, G.D.

    1988-12-01

    A study was carried out to review available data and correlations on the thermodynamic and transport properties of materials applicable to the CONTAIN computer code. CONTAIN is the NRC's best-estimate, mechanistic computer code for modeling containment response to a severe accident. Where appropriate, recommendations have been made for suitable approximations for material properties of interests. Based on a modified Benedict-Webb-Rubin (BWR) equation of state, a procedure is introduced for calculating thermodynamic properties for common gases in the CONTAIN code. These gases are nitrogen, oxygen, hydrogen, carbon dioxide, carbon monoxide, steam, helium, and argon. The thermodynamic equations for density, currently represented in CONTAIN by relatively simple fits, were independently checked and are recommended to be replaced by the Lee-Kesler equation of state which substantially improves accuracy without too much sacrifice in computational efficiency. The accuracy of the calculated values have been found to be generally acceptable. Various correlations and models for single component gas transport properties, viscosity and thermal conductivity, were also assessed with available experimental data. When a suitable correlation or model was not available, transport properties were obtained by performing least-squares fit on experimental data. 50 refs., 126 figs., 3 tabs

  17. DETERMINATION AND ANALYSIS OF CHANGE POWER CHARACTER AND POWER PARAMETERS OF EARTHMOVING- TRANSPORT WORKING PROCESS MACHINES OF CYCLIC ACTION

    Directory of Open Access Journals (Sweden)

    KHMARA L. A.

    2017-05-01

    Full Text Available Summary. Raising of problem. Efficiency of implementation working process an earthmoving-transport machine on digging of soil depends on complete realization of power equipment and hauling properties working equipment during implementation this operation. Most effective will be the mode of digging when from his beginning to the final stage a power equipment will realize nominal power, and working equipment maximal KKD at that skidding of mover does not exceed the defined possible value. However, for the traditional constructions of earthmoving-transport machines cyclic action, for such, as a drag shovel, bulldozer, realizing these terms is heavy. The feature of process digging consists in the increase of resistance to digging soil from the ego of the initial stage to eventual when hauling possibilities of machine will be maximally realized. Therefore the calculation of power equipment takes into account the power indexes of machine on the final stage of digging. Thus the unstationarity of working process results in the under exploitation of power equipment machine and hereupon appearance her bits and pieces. The size of bits and pieces power depends on the stage digging of soil, his physical and mechanical properties, terms cooperation of working equipment with the surface of motion. One of methods realization surplus power, this use it for the drive intensifiers working process of earthmoving-transport machines. Therefore for the effective choice parameters of intensifier, his office hours it is necessary to know the size of bits and pieces of power and character her change during digging of soil. The purpose of the article. Development of methodology determination remaining power equipment an earthmoving-transport machine on the example self-propelled drags hovel, character her change at digging of soil taking into account physical and mechanical properties of soil and terms cooperation working equipment with the surface of motion. Conclusion

  18. Electron transport properties in InAs four-terminal ballistic junctions under weak magnetic fields

    International Nuclear Information System (INIS)

    Koyama, M.; Fujiwara, K.; Amano, N.; Maemoto, T.; Sasa, S.; Inoue, M.

    2009-01-01

    We report on the electron transport properties based on ballistic electrons under magnetic fields in four-terminal ballistic junctions fabricated on an InAs/AlGaSb heterostructure. The four-terminal junction structure is composed of two longitudinal stems with two narrow wires slanted with 30 degree from the perpendicular axis. The electron focusing peak was obtained with the bend resistance measurement. Then it was investigated the nonlinear electron transport property of potential difference between longitudinal stems due to ballistic electrons with applying direct current from narrow wires. Observed nonlinearity showed clear rectification effects which have negative polarity regardless of input voltage polarity. Although this nonlinearity was qualitatively changed due to the Lorentz force under magnetic fields, the degradation of ballistic effects on nonlinear properties were observed when the current increased to higher strength. (copyright 2009 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Investigation of thermodynamic and transport properties of liquid transition metals using Wills-Harrison potentials

    International Nuclear Information System (INIS)

    Khaleque, M.A.; Bhuiyan, G.M.; Rashid, R.I.M.A.

    1998-01-01

    Thermodynamic properties such as entropy, specific heat capacity at constant pressure and isothermal compressibility have been calculated for liquid 3d, 4d and 5d transition metals near melting temperature. The hard sphere diameter for all such systems is estimated from the potential profile generated from the Wills and Harrison's prescription using linearized WCA theory of liquid. Evaluated values of entropy and specific heat capacity are found to be in good agreement with the experimental data. Transport property like shear viscosity for these liquid metals is obtained using the same potential profile. Lack of experimental data at melting temperatures hampers detailed comparison for all such systems. However, for the case of transport property, the results obtained are found to compare qualitatively well with the available experimental data. (author)

  20. Effect of Fast Neutron Irradiation on Current Transport Properties of HTS Materials

    CERN Document Server

    Ballarino, A; Kruglov, V S; Latushkin, S T; Lubimov, A N; Ryazanov, A I; Shavkin, S V; Taylor, T M; Volkov, P V

    2004-01-01

    The effect of fast neutron irradiation with energy up to 35 MeV and integrated fluence of up to 5 x 10**15 cm-2 on the current transport properties of HTS materials Bi-2212 and Bi-2223 has been studied, both at liquid nitrogen and at room temperatures. The samples irradiated were selected after verification of the stability of their superconducting properties after temperature cycling in the range of 77 K - 293 K. It has been found that the irradiation by fast neutrons up to the above dose does not produce a significant degradation of critical current. The effect of room temperature annealing on the recovery of transport properties of the irradiated samples is also reported, as is a preliminary microstructure investigation of the effect of irradiation on the soldered contacts.

  1. The influence of Ga{sup +} irradiation on the transport properties of mesoscopic conducting thin films

    Energy Technology Data Exchange (ETDEWEB)

    Barzola-Quiquia, J; Dusari, S; Bridoux, G; Bern, F; Molle, A; Esquinazi, P, E-mail: j.barzola@physik.uni-leipzig.de, E-mail: esquin@physik.uni-leipzig.de [Division of Superconductivity and Magnetism, Universitaet Leipzig, Linnestrasse 5, D-04103 Leipzig (Germany)

    2010-04-09

    We studied the influence of 30 keV Ga{sup +}-ions-commonly used in focused-ion-beam (FIB) devices-on the transport properties of thin crystalline graphite flakes, and La{sub 0.7}Ca{sub 0.3}MnO{sub 3} and Co thin films. The changes in electrical resistance were measured in situ during irradiation and also the temperature and magnetic field dependence before and after irradiation. Our results show that the transport properties of these materials strongly change at Ga{sup +} fluences much below those used for patterning and ion-beam-induced deposition (IBID), seriously limiting the use of FIB when the intrinsic properties of the materials of interest are of importance. We present a method that can be used to protect the sample as well as to produce selectively irradiation-induced changes.

  2. A New Approach for Evaluating Charge Transport Properties of Semiconductor Detectors

    International Nuclear Information System (INIS)

    Kim, Kyung O; Kim, Jong Kyung; Kim, Soon Young; Ha, Jang Ho

    2009-01-01

    The semiconductor detectors (e.g., CdTe, CdZnTe, and HgI 2 ) have been widely used for radiation detection and medical imaging because of its various outstanding features such as excellent energy resolution, wide bandgap energy, room temperature operation, and so on. Unfortunately, the performance of these detectors is mainly limited by the charge transport properties of semiconductor, especially the mobility-lifetime products (i.e., (μτ) e and ((μτ) h ). Hence, the analysis on the mobility-lifetime products is very important for evaluating correct characteristics of semiconductor detectors. A commonly used method to analyze the mobilitylifetime products is based on their responses to α particle. However, the α particle method cannot evaluate the ((μτ)h product in many cases, because a semiconductor detector operating at positive bias voltages often yields the energy spectrum without the peaks. This method is also known to be very sensitive to the experimental conditions as well as surface conditions of the detector. In this study, a new approach with gamma-ray instead of α particle was carried out to solve the determination difficulty of the ((μτ) h product with common method. The special relation between the two mobility-lifetime products, which we call the 'Nural equation', was also developed to simply obtain each parameter based on Hecht equation

  3. Study of thermodynamic and transport properties of phosphonium-based ionic liquids

    International Nuclear Information System (INIS)

    Deive, Francisco J.; Rivas, Miguel A.; Rodríguez, Ana

    2013-01-01

    Highlights: ► Physical and transport properties of three hydrophilic phoshonium ILs were determined. ► Experimental density, viscosity, refractive index and speed of sound were correlated. ► Predictive equations were successfully employed to predict density of the three ILs. -- Abstract: In this work, the experimental values of density, speed of sound, refractive index and dynamic viscosity have been obtained from T = (293.15 to 343.15) K for the three phosphonium-based ionic liquids: tributyl methyl phoshponium methylsulfate (P 4441 C 1 SO 4 ), tributyl ethyl phosphonium diethylphosphate (P 4442 (C 2 ) 2 PO 4 ) and tributyl octyl phosphonium chloride (P 4448 Cl). The isentropic compressibility has been calculated by means of the Laplace equation from the experimental speed of sound results for the three ionic liquids at different temperatures. Density, speed of sound, refractive index and isentropic compressibility have been correlated by polynomial equations. The Lorentz–Lorenz, Dale–Gladstone, Eykman, Oster, Arago–Biot, Newton and modified Eykman equations were the empirical models used to correlate satisfactorily the relationship between the densities and refractive indices of the ionic liquids selected. The temperature dependence of the experimental dynamic viscosities for the ionic liquids selected can be described by an Arrhenius-like law and by VFT equations. The Riedel, Narsimham, Bradford–Thodos, Yen–Woods, Rackett, Spencer–Danner, Gunn–Yamada, Hankinson–Thomson (COSTALD model), VSY, VSD, MH and LGM equations were employed to predict the densities of the pure ionic liquids

  4. Electronic structure and transport properties of hydrogenated graphene and graphene nanoribbons

    Energy Technology Data Exchange (ETDEWEB)

    Choe, D H; Bang, Junhyeok; Chang, K J, E-mail: kchang@kaist.ac.kr [Department of Physics, Korea Advanced Institute of Science and Technology, Daejeon 305-701 (Korea, Republic of)

    2010-12-15

    The band gap opening is one of the important issues in applications of graphene and graphene nanoribbons (GNRs) to nanoscale electronic devices. As hydrogen strongly interacts with graphene and creates short-range disorder, the electronic structure is significantly modified by hydrogenation. Based on first-principles and tight-binding calculations, we investigate the electronic and transport properties of hydrogenated graphene and GNRs. In disordered graphene with low doses of H adsorbates, the low-energy states near the neutrality point are localized, and the degree of localization extends to high-energy states with increasing adsorbate density. To characterize the localization of eigenstates, we examine the inverse participation ratio and find that the localization is greatly enhanced for the defect levels, which are accumulated around the neutrality point. Our calculations support the previous result that even with a low dose of H adsorbates, graphene undergoes a metal-insulator transition. In GNRs, relaxations of the edge C atoms play a role in determining the edge structure and the hydrocarbon conformation at low and high H concentrations, respectively. In disordered nanoribbons, we find that the energy states near the neutrality point are localized and conductances through low-energy channels decay exponentially with sample size, similar to disordered graphene. For a given channel energy, the localization length tends to decrease as the adsorbate density increases. Moreover, the energy range of localization exceeds the intrinsic band gap.

  5. Structural, magnetic and magneto-transport properties of thermally evaporated Fe/Cu multilayers

    Energy Technology Data Exchange (ETDEWEB)

    Bouziane, K.; Al-Busaidi, M.; Gismelseed, A.; Al-Rawas, A. [Physics Department, College of Science, Sultan Qabos University, P. O. Box 36, Postal Code 123, Al-Khodh, Muscat (Oman)

    2004-05-01

    Structural, magnetic and magneto-transport properties of thermally evaporated Fe/Cu multilayers (MLs) have been investigated. Although multilayered structure has been successfully obtained, a substantial interfacial roughness ranging from 0.6 nm to 1.2 nm has been determined. All Fe/Cu MLs were polycrystalline with an average grain size of about 10 nm. Fe was bcc and textured (110) whereas Cu was fcc(111). Transmission electron microscopy analysis showed that the fcc Cu layer was rather textured (110) and (100) at least in the first stage of growth of the Fe/Cu MLs. Conversion electron Moessbauer (CEMS) measurements indicated the existence of three phases. Two of them were magnetic with a dominant bcc Fe phase, followed by fcc Fe phase. The third phase was superparamagnetic. The CEMS results were explained in terms of the partial diffusion of Fe into Cu with three different zones. The small magnetoresistance (MR<0.2%) was correlated to Fe clusters located at Fe-Cu interfaces. (Abstract Copyright [2004], Wiley Periodicals, Inc.)

  6. Facile synthesis and electron transport properties of NiO nanostructures investigated by scanning tunneling microscopy

    Directory of Open Access Journals (Sweden)

    Govind Mallick

    2017-08-01

    Full Text Available Due to their unique chemical, thermal, electronic and photonic properties, low -dimensional transition metal oxides, especially NiO, have attracted great deal of attention for potential applications in a wide range of technologies, such as, sensors, electrochromic coatings and self-healing materials. However, their synthesis involves multi-step complex procedures that in addition to being expensive, further introduce impurities. Here we present a low cost facile approach to synthesize uniform size NiO nanoparticles (NPs from hydrothermally grown Ni(OH2. Detailed transmission electron microscopic analysis reveal the average size of NiO NPs to be around 29 nm. The dimension of NiO NP is also corroborated by the small area scanning tunneling microscope (STM measurements. Further, we investigate electron transport characteristics of newly synthesized Ni(OH2 and NiO nanoparticles on p-type Si substrate using scanning tunneling microscopy. The conductivity of Ni(OH2 and NiO are determined to be 1.46x10-3 S/cm and 2.37x10-5 S/cm, respectively. The NiO NPs exhibit a lower voltage window (∼0.7 V electron tunneling than the parent Ni(OH2.

  7. Temperature dependent dielectric properties and ion transportation in solid polymer electrolyte for lithium ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Sengwa, R. J., E-mail: rjsengwa@rediffmail.com; Dhatarwal, Priyanka, E-mail: dhatarwalpriyanka@gmail.com; Choudhary, Shobhna, E-mail: shobhnachoudhary@rediffmail.com [Dielectric Research Laboratory, Department of Physics, Jai Narain Vyas University, Jodhpur – 342 005 (India)

    2016-05-06

    Solid polymer electrolyte (SPE) film consisted of poly(ethylene oxide) (PEO) and poly(methyl methacrylate) (PMMA) blend matrix with lithium tetrafluroborate (LiBF{sub 4}) as dopant ionic salt and poly(ethylene glycol) (PEG) as plasticizer has been prepared by solution casting method followed by melt pressing. Dielectric properties and ionic conductivity of the SPE film at different temperatures have been determined by dielectric relaxation spectroscopy. It has been observed that the dc ionic conductivity of the SPE film increases with increase of temperature and also the decrease of relaxation time. The temperature dependent relaxation time and ionic conductivity values of the electrolyte are governed by the Arrhenius relation. Correlation observed between dc conductivity and relaxation time confirms that ion transportation occurs with polymer chain segmental dynamics through hopping mechanism. The room temperature ionic conductivity is found to be 4 × 10{sup −6} S cm{sup −1} which suggests the suitability of the SPE film for rechargeable lithium batteries.

  8. Acropetal Auxin Transport Inhibition Is Involved in Indeterminate But Not Determinate Nodule Formation

    Directory of Open Access Journals (Sweden)

    Jason L. P. Ng

    2018-02-01

    Full Text Available Legumes enter into a symbiotic relationship with nitrogen-fixing rhizobia, leading to nodule development. Two main types of nodules have been widely studied, indeterminate and determinate, which differ in the location of the first cell division in the root cortex, and persistency of the nodule meristem. Here, we compared the control of auxin transport, content, and response during the early stages of indeterminate and determinate nodule development in the model legumes Medicago truncatula and Lotus japonicus, respectively, to investigate whether differences in auxin transport control could explain the differences in the location of cortical cell divisions. While auxin responses were activated in dividing cortical cells during nodulation of both nodule types, auxin (indole-3-acetic acid content at the nodule initiation site was transiently increased in M. truncatula, but transiently reduced in L. japonicus. Root acropetal auxin transport was reduced in M. truncatula at the very start of nodule initiation, in contrast to a prolonged increase in acropetal auxin transport in L. japonicus. The auxin transport inhibitors 2,3,5-triiodobenzoic acid and 1-N-naphthylphthalamic acid (NPA only induced pseudonodules in legume species forming indeterminate nodules, but failed to elicit such structures in a range of species forming determinate nodules. The development of these pseudonodules in M. truncatula exhibited increased auxin responses in a small primordium formed from the pericycle, endodermis, and inner cortex, similar to rhizobia-induced nodule primordia. In contrast, a diffuse cortical auxin response and no associated cortical cell divisions were found in L. japonicus. Collectively, we hypothesize that a step of acropetal auxin transport inhibition is unique to the process of indeterminate nodule development, leading to auxin responses in pericycle, endodermis, and inner cortex cells, while increased auxin responses in outer cortex cells likely

  9. THE NETWORK OF CITY PUBLIC TRANSPORT AS THE BASE FOR TRIP LENGTH DISTRIBUTION DETERMINING

    Directory of Open Access Journals (Sweden)

    P. Horbachov

    2015-07-01

    Full Text Available The up-to-date methods of modelling the demand for public transport services require an objective estimation and improvement. Such an improvement can be achieved by taking into account the trip length distribution during trip matrix calculation that requires determining the reasons of regularities occurance in city population trip lengths.

  10. Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

    International Nuclear Information System (INIS)

    Zabadal, J.; Vilhena, M.T.; Segatto, C.F.; Pazos, R.P.Ruben Panta.

    2002-01-01

    In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations

  11. Determination of a closed-form solution for the multidimensional transport equation using a fractional derivative

    Energy Technology Data Exchange (ETDEWEB)

    Zabadal, J. E-mail: jorge.zabadal@ufrgs.br; Vilhena, M.T. E-mail: vilhena@mat.ufrgs.br; Segatto, C.F. E-mail: cynthia@mat.ufrgs.br; Pazos, R.P.Ruben Panta. E-mail: rpp@mat.pucrgs.br

    2002-07-01

    In this work we construct a closed-form solution for the multidimensional transport equation rewritten in integral form which is expressed in terms of a fractional derivative of the angular flux. We determine the unknown order of the fractional derivative comparing the kernel of the integral equation with the one of the Riemann-Liouville definition of fractional derivative. We report numerical simulations.

  12. Determination of albumin transport rate between plasma and peritoneal space in decompensated cirrhosis

    DEFF Research Database (Denmark)

    Ring-Larsen, H; Henriksen, Jens Henrik Sahl

    1984-01-01

    Plasma-to-peritoneal transport rate of albumin (TERperit.space) was determined in eighteen patients with decompensated cirrhosis by sampling ascitic fluid after i.v. injection of 125I-labelled serum albumin. Median TERperit.space was 0.30% of the intravascular albumin mass (IVM) per hour (range 0...

  13. Determining the mechanical properties of high porosity nickel

    International Nuclear Information System (INIS)

    Frappier, J.C.; Poirier, J.

    1975-01-01

    The following tests were carried out on high porosity (40 to 70%) sintered nickel: tensile tests, compression tests, diametral crushing tests, using strain gauges and extensometers. Results were obtained on the relationship elastic properties - porosity, Poisson coefficient in relation to deformation, variations of yield strength, and breaking stress. these various properties were also studied in relation to the sintering methods and the properties of the powders used [fr

  14. Fluorescein transport properties across artificial lipid membranes, Caco-2 cell monolayers and rat jejunum.

    Science.gov (United States)

    Berginc, Katja; Zakelj, Simon; Levstik, Lea; Ursic, Darko; Kristl, Albin

    2007-05-01

    Membrane transport characteristics of a paracellular permeability marker fluorescein were evaluated using artificial membrane, Caco-2 cell monolayers and rat jejunum, all mounted in side-by-side diffusion cells. Modified Ringer buffers with varied pH values were applied as incubation salines on both sides of artificial membrane, cell culture monolayers or rat jejunum. Passive transport according to pH partition theory was determined using all three permeability models. In addition to that, active transport of fluorescein in the M-S (mucosal-to-serosal) direction through rat jejunum was observed. The highest M-S P(app) values regarding the active transport through the rat jejunum were observed in incubation saline with pH 6.5. Fluorescein transport through the rat jejunum was inhibited by DIDS (4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid) and alpha-CHC (alpha-cyano-4-hydroxycinnamic acid). Thus, we assume that two pH-dependent influx transporters could be involved in the fluorescein membrane transport through the intestinal (jejunal) epithelium. One is very likely an MCT (monocarboxylic acid cotransporter) isoform, inhibited by specific MCT inhibitor alpha-CHC, while the involvement of the second one with overlapping substrate/inhibitor specificities (most probably a member of the organic anion-transporting polypeptide family, inhibited at least partially by DIDS) could not be excluded.

  15. A 'range test' for determining scatterers with unknown physical properties

    Science.gov (United States)

    Potthast, Roland; Sylvester, John; Kusiak, Steven

    2003-06-01

    We describe a new scheme for determining the convex scattering support of an unknown scatterer when the physical properties of the scatterers are not known. The convex scattering support is a subset of the scatterer and provides information about its location and estimates for its shape. For convex polygonal scatterers the scattering support coincides with the scatterer and we obtain full shape reconstructions. The method will be formulated for the reconstruction of the scatterers from the far field pattern for one or a few incident waves. The method is non-iterative in nature and belongs to the type of recently derived generalized sampling schemes such as the 'no response test' of Luke-Potthast. The range test operates by testing whether it is possible to analytically continue a far field to the exterior of any test domain Omegatest. By intersecting the convex hulls of various test domains we can produce a minimal convex set, the convex scattering support of which must be contained in the convex hull of the support of any scatterer which produces that far field. The convex scattering support is calculated by testing the range of special integral operators for a sampling set of test domains. The numerical results can be used as an approximation for the support of the unknown scatterer. We prove convergence and regularity of the scheme and show numerical examples for sound-soft, sound-hard and medium scatterers. We can apply the range test to non-convex scatterers as well. We can conclude that an Omegatest which passes the range test has a non-empty intersection with the infinity-support (the complement of the unbounded component of the complement of the support) of the true scatterer, but cannot find a minimal set which must be contained therein.

  16. The Arabidopsis MTP8 transporter determines the localization of manganese and iron in seeds

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Heng-Hsuan; Car, Suzana; Socha, Amanda L.; Hindt, Maria N.; Punshon, Tracy; Guerinot, Mary Lou

    2017-09-08

    Understanding how seeds obtain and store nutrients is key to developing crops with higher agronomic and nutritional value. We have uncovered unique patterns of micronutrient localization in seeds using synchrotron X-ray fluorescence (SXRF). Although all four members of the Arabidopsis thaliana Mn-CDF family can transport Mn, here we show that only mtp8-2 has an altered Mn distribution pattern in seeds. In an mtp8-2 mutant, Mn no longer accumulates in hypocotyl cortex cells and sub-epidermal cells of the embryonic cotyledons, but rather accumulates with Fe in the cells surrounding the vasculature, a pattern previously shown to be determined by the vacuolar transporter VIT1. We also show that MTP8, unlike the other three Mn-CDF family members, can transport Fe and is responsible for localization of Fe to the same cells that store Mn. When both the VIT1 and MTP8 transporters are non-functional, there is no accumulation of Fe or Mn in specific cell types; rather these elements are distributed amongst all cell types in the seed. Disruption of the putative Fe binding sites in MTP8 resulted in loss of ability to transport Fe but did not affect the ability to transport Mn.

  17. Nanostructured ZnO films: A study of molecular influence on transport properties by impedance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sappia, Luciano D.; Trujillo, Matias R. [Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET, Chacabuco 461, T4000ILI San Miguel de Tucumán (Argentina); Laboratorio de Medios e Interfases (LAMEIN), Departamento de Bioingeniería, Fac. de Cs. Exactas y Tecnología, Universidad Nacional de Tucumán, Av. Independencia 1800, 4000 San Miguel de Tucumán (Argentina); Lorite, Israel [Division of Superconductivity and Magnetism, Institute for Experimental Physics II, University of Leipzig, Linnéstrasse 5, 04103 Leipzig (Germany); Madrid, Rossana E., E-mail: rmadrid@herrera.unt.edu.ar [Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET, Chacabuco 461, T4000ILI San Miguel de Tucumán (Argentina); Laboratorio de Medios e Interfases (LAMEIN), Departamento de Bioingeniería, Fac. de Cs. Exactas y Tecnología, Universidad Nacional de Tucumán, Av. Independencia 1800, 4000 San Miguel de Tucumán (Argentina); Tirado, Monica [NanoProject and Laboratorio de Nanomateriales y Propiedades Dieléctricas, Departamento de Física, Universidad Nacional de Tucumán, Avenida Independencia 1800, Tucumán (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) (Argentina); and others

    2015-10-15

    Graphical abstract: - Highlights: • We study electrical transport in nanostructured ZnO films by impedance spectroscopy. • Bioaggregates on the surface produce strong changes in film transport properties. • This behavior is explained by modeling data with RC parallel circuits. • Electrical responses of ZnO films to aggregates are promising for biosensing. - Abstract: Nanomaterials based on ZnO have been used to build glucose sensors due to its high isoelectric point, which is important when a protein like Glucose Oxidase (GOx) is attached to a surface. It also creates a biologically friendly environment to preserve the activity of the enzyme. In this work we study the electrical transport properties of ZnO thin films (TFs) and single crystals (SC) in contact with different solutions by using impedance spectroscopy. We have found that the composition of the liquid, by means of the charge of the ions, produces strong changes in the transport properties of the TF. The enzyme GOx and phosphate buffer solutions have the major effect in the conduction through the films, which can be explained by the entrapment of carriers at the grain boundaries of the TFs. These results can help to design a new concept in glucose biosensing.

  18. 78 FR 9451 - Academy Express, L.L.C.-Acquisition of Property-Golden Ring Travel & Transportation, Inc.

    Science.gov (United States)

    2013-02-08

    ..., L.L.C.--Acquisition of Property--Golden Ring Travel & Transportation, Inc. AGENCY: Surface... authority under 49 U.S.C. 14303 to acquire the property of Golden Ring Travel & Transportation, Inc. (Golden... approximately 400 motor coaches and more than 500 drivers. Academy is indirectly controlled by the Tedesco...

  19. Property Valuation: Integration of Methods and Determination of Depreciation

    NARCIS (Netherlands)

    Tempelmans Plat, H.; Verhaegh, M.

    2000-01-01

    Property valuation up to now is a global guess. On the one hand we have the Investment Method which regards a property as just a sum of money, on the other hand we have the Contractor's Method which is based on the actual new construction costs of the building and the actual value of the land. Both

  20. Determination of Some Mechanical Properties of Almond Seed ...

    African Journals Online (AJOL)

    Akorede

    I. INTRODUCTION. Information on mechanical properties of agricultural products as a function of moisture content is needed in the design and adjustment of machines used during harvest, separation, cleaning, handling and storage. It is also used in processing these agricultural materials into food. The properties useful for ...

  1. Tuning the Transport Properties of Layered Materials for Thermoelectric Applications using First-Principles Calculations

    KAUST Repository

    Saeed, Yasir

    2014-05-11

    Thermoelectric materials can convert waste heat into electric power and thus provide a way to reduce the dependence on fossil fuels. Our aim is to model the underlying materials properties and, in particular, the transport as controlled by electrons and lattice vibrations. The goal is to develop an understanding of the thermoelectric properties of selected materials at a fundamental level. The structural, electronic, optical, and phononic properties are studied in order to tune the transport, focusing on KxRhO2, NaxRhO2, PtSb2 and Bi2Se3. The investigations are based on density functional theory as implemented in the all electron linearized augmented plane wave plus local orbitals WIEN2k and pseudo potential Quantum-ESPRESSO codes. The thermoelectric properties are derived from Boltzmann transport theory under the constant relaxation time approximation, using the BoltzTraP code. We will discuss first the changes in the electronic band structure under variation of the cation concentration in layered KxRhO2 in the 2H phase and NaxRhO2 in the 3R phase. We will also study the hydrated phase. The deformations of the RhO6 octahedra turn out to govern the thermoelectric properties, where the high Seebeck coefficient results from ”pudding mold" bands. We investigate the thermoelectric properties of electron and hole doped PtSb2, which is not a layered material but shares “pudding mold" bands. PtSb2 has a high Seebeck coefficient at room temperature, which increases significantly under As alloying by bandgap opening and reduction of the lattice thermal conductivity. Bi2Se3 (bulk and thin film) has a larger bandgap then the well-known thermoelectric material Bi2Te3, which is important at high temperature. The structural stability, electronic structure, and transport properties of one to six quintuple layers of Bi2Se3 will be discussed. We also address the effect of strain on a single quintuple layer by phonon band structures. We will analyze the electronic and transport

  2. Determination of the properties of magnetic turbulence in radio sources

    International Nuclear Information System (INIS)

    Spangler, S.R.

    1983-01-01

    We have considered the transport of polarized synchrotron radiation in a source possessing a highly irregular magnetic field, as proposed by Laing. The transport equation has been solved in a special case, relating the observable correlation functions in the Stokes parameters Q and U to the correlation functions of magnetic field and plasma density in the source. A rough application of our results to observations of the radio galaxy 3C 166 indicates that the turbulent scale length may be a few percent of the lobe size

  3. Characterisation of advanced windows. Determination of thermal properties by measurements

    Energy Technology Data Exchange (ETDEWEB)

    Duer, K.

    2001-04-01

    optically inhomogeneous materials). Therefor an outdoor test facility has been constructed in order to facilitate the measurement of direct solar transmittance of optically inhomogeneous samples under natural solar radiation and under any chosen angle of incidence. The test facility is based on a scanning pyranometer mounted in a tracking device. Utilising the equipment and the procedures for measurements and data treatment described in this report will in most cases allow a full thermal characterisation of advanced windows and glazings to be carried out by measurements and with good accuracy. As an example of this the thermal and optical properties of a prototypical aerogel glazing have been determined by means of measurements. (au)

  4. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  5. Improving charge transport property and energy transfer with carbon quantum dots in inverted polymer solar cells

    International Nuclear Information System (INIS)

    Liu, Chunyu; Chang, Kaiwen; Guo, Wenbin; Li, Hao; Shen, Liang; Chen, Weiyou; Yan, Dawei

    2014-01-01

    Carbon quantum dots (Cdots) are synthesized by a simple method and introduced into active layer of polymer solar cells (PSCs). The performance of doped devices was apparently improved, and the highest power conversion efficiency of 7.05% was obtained, corresponding to a 28.2% enhancement compared with that of the contrast device. The charge transport properties, resistance, impedance, and transient absorption spectrum are systematically investigated to explore how the Cdots affect on PSCs performance. This study reveals the importance of Cdots in enhancing the efficiency of PSCs and gives insight into the mechanism of charge transport improvement.

  6. Poly(o-aminophenol) film electrodes synthesis, transport properties and practical applications

    CERN Document Server

    Tucceri, Ricardo

    2014-01-01

    This review book is concerned with the synthesis, charge transport properties and practical applications of poly (o-aminophenol) (POAP) film electrodes. It is divided into three parts. The first one has a particular emphasis on problems of synthesis and structure of POAP. The second part deals with the mechanism of charge transfer and charge transport processes occurring in the course of the redox reactions of POAP. The third part describes the promising applications of POAP in the different fields of sensors, electrocatalysis, bioelectrochemistry, corrosion protection, among others. This review covers the literature on POAP in the time period comprised between 1987 and 2013.

  7. Defect chemistry of ''BaCuO2''. Pt. 2. Transport properties and nature of defects

    International Nuclear Information System (INIS)

    Chiodelli, G.; Consiglio Nazionale delle Ricerche, Pavia; Anselmi-Tamburini, U.; Consiglio Nazionale delle Ricerche, Pavia; Arimondi, M.; Consiglio Nazionale delle Ricerche, Pavia; Spinolo, G.; Consiglio Nazionale delle Ricerche, Pavia; Flor, G.; Consiglio Nazionale delle Ricerche, Pavia

    1995-01-01

    The charge transport properties of ''BaCuO 2 '' with 88:90 (Ba:Cu) cation ratio were characterized by thermopower, electrical conductivity and ionic transport number measurements in a wide range of temperature and oxygen partial pressure conditions. The nature of carriers is always represented by small polarons due to self-trapping of the electronic holes generated by the oxygen non-stoichiometry equilibrium. Some anomalies in carrier mobility as a function of temperature are shown not to be related to incomplete ionization of oxygen atoms on interstitial sites (orig.)

  8. High-pressure transport properties of CrB{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Regnat, Alexander; Becker, Julian; Spallek, Jan; Bauer, Andreas; Chacon, Alfonso; Ritz, Robert; Pfleiderer, Christian [Physik-Department, Technische Universitaet Muenchen, D-85748 Garching (Germany); Blum, Christian; Wurmehl, Sabine [Leibniz Institute for Solid State and Materials Research IFW, D-01171 Dresden (Germany)

    2015-07-01

    High quality single crystals of the itinerant antiferromagnet CrB{sub 2}, T{sub N} = 88 K, were grown by means of optical float zoning. Bulk, transport and de Haas-van Alphen measurements were carried out. Here, we present a comprehensive study of the high-pressure transport properties. Samples were investigated under hydrostatic, uniaxial and quasi-hydrostatic conditions. As a result we are able to attribute contradictory reports for the pressure dependence of T{sub N} to uniaxial strain. Perhaps most interestingly, we find a pronounced low temperature resistivity anomaly around 3 GPa in the quasi-hydrostatic case.

  9. Thermal transport properties in dilute 3He-4He mixtures near the superfluid transition

    International Nuclear Information System (INIS)

    Tuttle, J.G.

    1991-01-01

    The author describes measurements of various transport properties of dilute liquid 3 He- 4 He mixtures in two different sample cells. One cell was designed to measure the temperature drop ΔT across a fluid layer due to an applied heat flux Q, and the other allowed measurement of both ΔT and ΔX, the molar concentration drop. He studied the anomalous boundary resistance, ΔR b , in superfluid 4 He near T λ for Q between 4 and 100μW/cm 2 . He presents results for both the weakly divergent and the heat dependent, more strongly divergent contributions. He compares his data with those of Duncan and Ahlers and with theoretical predictions by Frank and Dohm. He also presents similar R b data for a mixture with X = 2.5 x 10 -6 . He determined the relaxation time τ for transients observed during thermal conductivity κ eff and thermal diffusion k T * measurements in superfluid mixtures between 1.7K and T λ with X ranging from 10 -6 to 5 x 10 -2 . He compares these results, taken with a fluid layer thickness h = 1.81 mm, with theoretical predictions and with earlier data for h = 1.47 mm. He shows the mass diffusion coefficient D computed both from τ and from κ eff data for 0.001 λ , and he compares the results of these two different determinations. In addition, he presents the 3 He-roton scattering cross section calculated using D results. In the normal phase he measured the thermal diffusion ratio k T and the thermal conductivity κ for 0.009 ≤ X ≤ 0.05 near T λ , and he compares these results with predictions by Dohm and Folk

  10. Experimental proposals for procedures to investigate the water chemistry, sorption and transport properties of marl

    International Nuclear Information System (INIS)

    Bradbury, M.H.; Baeyens, B.; Alexander, W.R.

    1990-11-01

    The aim of this report is to describe a framework within which laboratory studies on groundwater chemistry, sorption and transport properties might be conducted on samples from rock formations being considered as potential 'host rocks' for the disposal of radioactive waste. Here, Valanginian marl, has been taken as a specific example, but the general principles should be applicable to other systems. Some brief notes are given on sampling and handling procedures and mineralogical characterisation. This is followed by a detailed discussion of the procedures considered necessary to determine a groundwater chemistry of a specific rock matrix. The methods described are particularly appropriate to rocks such as marl i.e. low water content rocks (essentially 'dry') with appreciable clay and carbonate contents. An important conclusion drawn is that simple aqueous phase extractions at different liquid to solid ratios, followed by extrapolation procedures, are not always appropriate and can lead to incorrect water compositions. Some of the uncertainties and difficulties inherently involved in determining sorption parameters from batch, infiltration and diffusion based methods are presented. These methods are then individually discussed in greater detail with some illustrative examples. In the relatively few studies where sorption has been measured in crushed rock tests and compared with the results from intact rock experiments, it is often found that there are discrepancies. An outline for an experiment is described in which results from the two types of test could be quantitatively related to one another via cation exchange capacity measurements. Using this method it might be possible to explain the reasons for such discrepancies. Finally, a brief discussion is given on the possible consequences for experimental studies of gas in Valanginian marl and the swelling of the clay rich components. (author) 8 figs., 4 tabs., 46 refs

  11. Influence of structural properties on ballistic transport in nanoscale epitaxial graphene cross junctions

    International Nuclear Information System (INIS)

    Bock, Claudia; Weingart, Sonja; Karaissaridis, Epaminondas; Kunze, Ulrich; Speck, Florian; Seyller, Thomas

    2012-01-01

    In this paper we investigate the influence of material and device properties on the ballistic transport in epitaxial monolayer graphene and epitaxial quasi-free-standing monolayer graphene. Our studies comprise (a) magneto-transport in two-dimensional (2D) Hall bars, (b) temperature- and magnetic-field-dependent bend resistance of unaligned and step-edge-aligned orthogonal cross junctions, and (c) the influence of the lead width of the cross junctions on ballistic transport. We found that ballistic transport is highly sensitive to scattering at the step edges of the silicon carbide substrate. A suppression of the ballistic transport is observed if the lead width of the cross junction is reduced from 50 nm to 30 nm. In a 50 nm wide device prepared on quasi-free-standing graphene we observe a gradual transition from the ballistic into the diffusive transport regime if the temperature is increased from 4.2 to about 50 K, although 2D Hall bars show a temperature-independent mobility. Thus, in 1D devices additional temperature-dependent scattering mechanisms play a pivotal role. (paper)

  12. FRACTEX: an experiment aiming at characterizing the transport properties of a secondary fault

    International Nuclear Information System (INIS)

    Wittebroodt, C.; Matray, J.M.; Dick, P.; Cabrera, J.; Barnichon, J.D.

    2012-01-01

    Document available in extended abstract form only. Because of their favourable transport and retention properties, argillaceous rocks are considered as potential host rocks for radioactive waste repositories. At the request of the French Authority of Nuclear Safety (ASN), the French Institute for Radioprotection and Nuclear Safety (IRSN) is in charge of an independent expertise of the French industrial (Andra's) project. Therefore, IRSN develops experimental research programs in such geological formations at the Tournemire Underground Research Laboratory (URL, Aveyron, France). One of the objectives of this project is to evaluate the occurrence and the driving processes controlling the radionuclide migration through an argillaceous formation similar to those studied elsewhere for nuclear waste disposal. Since undisturbed argillaceous rocks display very low values for both hydraulic conductivity (K h ) and water content (θ e ), diffusion is considered to be the main transport mechanism governing radionuclide migration through the argillite. On the other hand, in the presence of fracture in the argillaceous formation, the flux of water through this preferential pathway could dramatically accelerate the migration of the radionuclide it contains. Thus, the implementation of a radwaste disposal facility requires a precise sedimentary and structural characterization of the preselected site to guarantee the presence of a regular, homogenous and fault-free clay layer over a large area and so to determine its ability to ensure an effective radionuclide confinement. The site characterization and fracture detection can be performed using complementary approaches such as geological studies, in situ measurements and non-destructive geophysical methods. In order to evaluate both the capacity and the limit of these seismic methods to detect a secondary fault in an argillaceous media, IRSN performed a 3D HR seismic survey from the surface of its Tournemire URL. Due to the weak

  13. Interactive FORTRAN IV computer programs for the thermodynamic and transport properties of selected cryogens (fluids pack)

    Science.gov (United States)

    Mccarty, R. D.

    1980-01-01

    The thermodynamic and transport properties of selected cryogens had programmed into a series of computer routines. Input variables are any two of P, rho or T in the single phase regions and either P or T for the saturated liquid or vapor state. The output is pressure, density, temperature, entropy, enthalpy for all of the fluids and in most cases specific heat capacity and speed of sound. Viscosity and thermal conductivity are also given for most of the fluids. The programs are designed for access by remote terminal; however, they have been written in a modular form to allow the user to select either specific fluids or specific properties for particular needs. The program includes properties for hydrogen, helium, neon, nitrogen, oxygen, argon, and methane. The programs include properties for gaseous and liquid states usually from the triple point to some upper limit of pressure and temperature which varies from fluid to fluid.

  14. A Review of Hydrothermal Liquefaction Bio-Crude Properties and Prospects for Upgrading to Transportation Fuels

    Directory of Open Access Journals (Sweden)

    Jerome A. Ramirez

    2015-07-01

    Full Text Available Hydrothermal liquefaction (HTL presents a viable route for converting a vast range of materials into liquid fuel, without the need for pre-drying. Currently, HTL studies produce bio-crude with properties that fall short of diesel or biodiesel standards. Upgrading bio-crude improves the physical and chemical properties to produce a fuel corresponding to diesel or biodiesel. Properties such as viscosity, density, heating value, oxygen, nitrogen and sulphur content, and chemical composition can be modified towards meeting fuel standards using strategies such as solvent extraction, distillation, hydrodeoxygenation and catalytic cracking. This article presents a review of the upgrading technologies available, and how they might be used to make HTL bio-crude into a transportation fuel that meets current fuel property standards.

  15. From Cell to Tissue Properties-Modeling Skin Electroporation With Pore and Local Transport Region Formation.

    Science.gov (United States)

    Dermol-Cerne, Janja; Miklavcic, Damijan

    2018-02-01

    Current models of tissue electroporation either describe tissue with its bulk properties or include cell level properties, but model only a few cells of simple shapes in low-volume fractions or are in two dimensions. We constructed a three-dimensional model of realistically shaped cells in realistic volume fractions. By using a 'unit cell' model, the equivalent dielectric properties of whole tissue could be calculated. We calculated the dielectric properties of electroporated skin. We modeled electroporation of single cells by pore formation on keratinocytes and on the papillary dermis which gave dielectric properties of the electroporated epidermis and papillary dermis. During skin electroporation, local transport regions are formed in the stratum corneum. We modeled local transport regions and increase in their radii or density which affected the dielectric properties of the stratum corneum. The final model of skin electroporation accurately describes measured electric current and voltage drop on the skin during electroporation with long low-voltage pulses. The model also accurately describes voltage drop on the skin during electroporation with short high-voltage pulses. However, our results indicate that during application of short high-voltage pulses additional processes may occur which increase the electric current. Our model connects the processes occurring at the level of cell membranes (pore formation), at the level of a skin layer (formation of local transport region in the stratum corneum) with the tissue (skin layers) and even level of organs (skin). Using a similar approach, electroporation of any tissue can be modeled, if the morphology of the tissue is known.

  16. A review of reaction rates and thermodynamic and transport properties for an 11-species air model for chemical and thermal nonequilibrium calculations to 30000 K

    Science.gov (United States)

    Gupta, Roop N.; Yos, Jerrold M.; Thompson, Richard A.; Lee, Kam-Pui

    1990-01-01

    Reaction rate coefficients and thermodynamic and transport properties are reviewed and supplemented for the 11-species air model which can be used for analyzing flows in chemical and thermal nonequilibrium up to temperatures of 3000 K. Such flows will likely occur around currently planned and future hypersonic vehicles. Guidelines for determining the state of the surrounding environment are provided. Curve fits are given for the various species properties for their efficient computation in flowfield codes. Approximate and more exact formulas are provided for computing the properties of partially ionized air mixtures in a high energy environment. Limitations of the approximate mixing laws are discussed for a mixture of ionized species. An electron number-density correction for the transport properties of the charged species is obtained. This correction has been generally ignored in the literature.

  17. Transport Properties of the Nuclear Pasta Phase with Quantum Molecular Dynamics

    Science.gov (United States)

    Nandi, Rana; Schramm, Stefan

    2018-01-01

    We study the transport properties of nuclear pasta for a wide range of density, temperature, and proton fractions, relevant for different astrophysical scenarios adopting a quantum molecular dynamics model. In particular, we estimate the values of shear viscosity as well as electrical and thermal conductivities by calculating the static structure factor S(q) using simulation data. In the density and temperature range where the pasta phase appears, the static structure factor shows irregular behavior. The presence of a slab phase greatly enhances the peak in S(q). However, the effect of irregularities in S(q) on the transport coefficients is not very dramatic. The values of all three transport coefficients are found to have the same orders of magnitude as found in theoretical calculations for the inner crust matter of neutron stars without the pasta phase; therefore, the values are in contrast to earlier speculations that a pasta layer might be highly resistive, both thermally and electrically.

  18. Atomistic simulations of divacancy defects in armchair graphene nanoribbons: Stability, electronic structure, and electron transport properties

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Jun [College of Physical Science and Technology, Yangtze University, Jingzhou, Hubei 434023 (China); Zeng, Hui, E-mail: zenghui@yangtzeu.edu.cn [College of Physical Science and Technology, Yangtze University, Jingzhou, Hubei 434023 (China); Wei, Jianwei [College of Optoelectronic Information, Chongqing University of Technology, Chongqing 400054 (China); Li, Biao; Xu, Dahai [College of Physical Science and Technology, Yangtze University, Jingzhou, Hubei 434023 (China)

    2014-01-17

    Using the first principles calculations associated with nonequilibrium Green's function, we have studied the electronic structures and quantum transport properties of defective armchair graphene nanoribbon (AGNR) in the presence of divacancy defects. The triple pentagon–triple heptagon (555–777) defect in the defective AGNR is energetically more favorable than the pentagon–octagon–pentagon (5–8–5) defect. Our calculated results reveal that both 5–8–5-like defect and 555–777-like defect in AGNR could improve the electron transport. It is anticipated that defective AGNRs can exhibit large range variations in transport behaviors, which are strongly dependent on the distributions of the divacancy defect.

  19. Transport, Structural and Mechanical Properties of Quaternary FeVTiAl Alloy

    Science.gov (United States)

    Bhat, Tahir Mohiuddin; Gupta, Dinesh C.

    2016-11-01

    The electronic, structural, magnetic and transport properties of FeVTiAl quaternary alloy have been investigated within the framework of density functional theory. The material is a completely spin-polarized half-metallic ferromagnet in its ground state with F-43m structure. The structural stability was further confirmed by elastic constants in the cubic phase with high Young's modulus and brittle nature. The present study predicts an energy band gap of 0.72 eV in a localized minority spin channel at equilibrium lattice parameter of 6.00 Å. The transport properties of the material are discussed based on the Seebeck coefficient, and electrical and thermal conductivity coefficients. The alloy presents large values of Seebeck coefficients, ~39 μV K-1 at room temperature (300 K), and has an excellent thermoelectric performance with ZT = ~0.8.

  20. On the statistical and transport properties of a non-dissipative Fermi-Ulam model

    Science.gov (United States)

    Livorati, André L. P.; Dettmann, Carl P.; Caldas, Iberê L.; Leonel, Edson D.

    2015-10-01

    The transport and diffusion properties for the velocity of a Fermi-Ulam model were characterized using the decay rate of the survival probability. The system consists of an ensemble of non-interacting particles confined to move along and experience elastic collisions with two infinitely heavy walls. One is fixed, working as a returning mechanism of the colliding particles, while the other one moves periodically in time. The diffusion equation is solved, and the diffusion coefficient is numerically estimated by means of the averaged square velocity. Our results show remarkably good agreement of the theory and simulation for the chaotic sea below the first elliptic island in the phase space. From the decay rates of the survival probability, we obtained transport properties that can be extended to other nonlinear mappings, as well to billiard problems.

  1. Theoretical study of electronic transport properties of a graphene-silicene bilayer

    Energy Technology Data Exchange (ETDEWEB)

    Berdiyorov, G. R. [Qatar Environment and Energy Research Institute, Qatar Foundation, P.O. Box 5825, Doha (Qatar); Bahlouli, H. [Department of Physics, King Fahd University of Petroleum and Minerals, 31261 Dhahran (Saudi Arabia); Saudi Center for Theoretical Physics, 31261 Dhahran (Saudi Arabia); Peeters, F. M. [Departement Fysica, Universiteit Antwerpen, Groenenborgerlaan 171, B-2020 Antwerpen (Belgium)

    2015-06-14

    Electronic transport properties of a graphene-silicene bilayer system are studied using density-functional theory in combination with the nonequilibrium Green's function formalism. Depending on the energy of the electrons, the transmission can be larger in this system as compared to the sum of the transmissions of separated graphene and silicene monolayers. This effect is related to the increased electron density of states in the bilayer sample. At some energies, the electronic states become localized in one of the layers, resulting in the suppression of the electron transmission. The effect of an applied voltage on the transmission becomes more pronounced in the layered sample as compared to graphene due to the larger variation of the electrostatic potential profile. Our findings will be useful when creating hybrid nanoscale devices where enhanced transport properties will be desirable.

  2. Thermal transport properties of niobium and some niobium-based alloys from 80 to 1600 K

    Energy Technology Data Exchange (ETDEWEB)

    Moore, J P; Graves, R S; Williams, R K [Oak Ridge National Lab., TN (USA)

    1980-01-01

    The electric resistivity, rho, and Seebeck coefficient, S, of 99.8 at% niobium, and Nb-4.8 at% W, Nb-5 at% Mo, Nb-10 at% Mo, and Nb-2.4 at% Mo-2.4 at% Zr alloys were measured from 80 to 1600 K, and the thermal conductivity, lambda, of the niobium and the Nb-5 at% W alloy was measured from 80 to 1300 K. A technique is described for measuring rho and S of a specimen during radial-heat-flow measurements of lambda. The transport property results, which had uncertainties of +-0.4% for rho and +-1.4% for lambda, showed the influence of tungsten and molybdenum solutes on the transport properties of niobium and were used to obtain the electronic Lorenz function of pure niobium, which was found to approach the Sommerfeld value at high temperatures.

  3. Thermal transport properties of niobium and some niobium base alloys from 80 to 16000K

    International Nuclear Information System (INIS)

    Moore, J.P.; Graves, R.S.; Williams, R.K.

    1980-01-01

    The electrical resistivities and absolute Seebeck coefficients of 99.8 at. % niobium with a RRR of 36, Nb-4.8 at. % W, Nb-5 at. % Mo, Nb-10 at. % Mo, and Nb-2.4 at. % Mo-2.4 at. % Zr were measured from 80 to 1600 0 K, and the thermal conductivities of the niobium and Nb-5 at. % W were measured from 80 to 1300 0 K. A technique is described for measuring the electrical resistivity and Seebeck coefficient of a specimen during radial heat flow measurements of the thermal conductivity. The transport property results, which had uncertainties of +-0.4%for electrical resistivity and +-1.4% for thermal conductivity, showed the influence of tungsten and molybdenum solutes on the transport properties of niobium and were used to obtain the electronic Lorenz function of pure niobium, which was found to approach the Sommerfeld value at high temperatures

  4. Effect of surface roughness scattering on the transport properties of a 2DEG

    International Nuclear Information System (INIS)

    Yarar, Z.

    2004-01-01

    In this work surface roughness scattering of electrons in a two dimensional electron gas (2DEG) formed at heterojunction interfaces is investigated for various auto-correlation functions. Gaussian, exponential and Lorentzian auto-correlation functions are used to represent surface roughness. Poisson and Schrodinger equations are solved self consistently at the hetero interface to find the energy levels, the wave functions corresponding to each level and electron concentrations at each level. Using these wave functions and the auto-correlation functions mentioned above, the scattering rates due to surface roughness are calculated. Scattering rates resulting from acoustic and optical phonons are also calculated. These rates are used to study the transport properties of the two dimensional electrons using ensemble Monte Carlo method at various temperatures. Emphasis is given to the effect of surface roughness scattering on the transport properties of the electrons

  5. Edge modulation of electronics and transport properties of cliff-edge phosphorene nanoribbons

    Science.gov (United States)

    Guo, Caixia; Wang, Tianxing; Xia, Congxin; Liu, Yufang

    2017-12-01

    Based on the first-principles calculations, we study the electronic structures and transport properties of cliff-like edge phosphorene nanoribbons (CPNRs), considering different types of edge passivation. The band structures of bare CPNRs possess the metallic features; while hydrogen (H), fluorine (F), chlorine (Cl) and oxygen (O) atoms-passivated CPNRs are semiconductor materials, and the band gap values monotonically decrease when the ribbon width increases. Moreover, the H and F-passivated CPNRs exhibit the direct band gap characteristics, while the Cl and O-passivated cases show the features of indirect band gap. In addition, the edge passivated CPNRs are more energetically stable than bare edge case. Meanwhile, our results also show that the transport properties of the CPNRs can be obviously influenced by the different edge passivation.

  6. Electron transport properties of indium oxide - indium nitride metal-oxide-semiconductor heterostructures

    International Nuclear Information System (INIS)

    Wang, C.Y.; Hauguth, S.; Polyakov, V.; Schwierz, F.; Cimalla, V.; Kups, T.; Himmerlich, M.; Schaefer, J.A.; Krischok, S.; Ambacher, O.; Morales, F.M.; Lozano, J.G.; Gonzalez, D.; Lebedev, V.

    2008-01-01

    The structural, chemical and electron transport properties of In 2 O 3 /InN heterostructures and oxidized InN epilayers are reported. It is shown that the accumulation of electrons at the InN surface can be manipulated by the formation of a thin surface oxide layer. The epitaxial In 2 O 3 /InN heterojunctions show an increase in the electron concentration due to the increasing band banding at the heterointerface. The oxidation of InN results in improved transport properties and in a reduction of the sheet carrier concentration of the InN epilayer very likely caused by a passivation of surface donors. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  7. Microstructural effects on the magnetic and magneto-transport properties of electrodeposited Ni nanowire arrays

    International Nuclear Information System (INIS)

    Chen, Shu-Fang; Wei, Hao Han; Liu, Chuan-Pu; Hsu, C Y; Huang, J C A

    2010-01-01

    The magnetic and magneto-transport properties of Ni nanowire (NW) arrays, fabricated by electrodeposition in anodic-aluminum-oxide (AAO) templates, have been investigated. The AAO pores have diameters ranging from 35 to 75 nm, and the crystallinity of the Ni NW arrays could change from poly-crystalline to single-crystalline with the [111] and [110] orientations based on the electrodeposition potential. Notably, double switching magnetization loops and double-peaked magnetoresistance curves were observed in [110]-oriented NWs. The crystalline orientation of the Ni NW arrays is found to influence the corresponding magnetic and magneto-transport properties significantly. These magnetic behaviors are dominated by the competition between the magneto-crystalline and shape anisotropy.

  8. A numerical model of non-equilibrium thermal plasmas. I. Transport properties

    Science.gov (United States)

    Zhang, Xiao-Ning; Li, He-Ping; Murphy, Anthony B.; Xia, Wei-Dong

    2013-03-01

    A self-consistent and complete numerical model for investigating the fundamental processes in a non-equilibrium thermal plasma system consists of the governing equations and the corresponding physical properties of the plasmas. In this paper, a new kinetic theory of the transport properties of two-temperature (2-T) plasmas, based on the solution of the Boltzmann equation using a modified Chapman-Enskog method, is presented. This work is motivated by the large discrepancies between the theories for the calculation of the transport properties of 2-T plasmas proposed by different authors in previous publications. In the present paper, the coupling between electrons and heavy species is taken into account, but reasonable simplifications are adopted, based on the physical fact that me/mh ≪ 1, where me and mh are, respectively, the masses of electrons and heavy species. A new set of formulas for the transport coefficients of 2-T plasmas is obtained. The new theory has important physical and practical advantages over previous approaches. In particular, the diffusion coefficients are complete and satisfy the mass conversation law due to the consideration of the coupling between electrons and heavy species. Moreover, this essential requirement is satisfied without increasing the complexity of the transport coefficient formulas. Expressions for the 2-T combined diffusion coefficients are obtained. The expressions for the transport coefficients can be reduced to the corresponding well-established expressions for plasmas in local thermodynamic equilibrium for the case in which the electron and heavy-species temperatures are equal.

  9. A numerical model of non-equilibrium thermal plasmas. I. Transport properties

    Energy Technology Data Exchange (ETDEWEB)

    Zhang XiaoNing; Xia WeiDong [Department of Thermal Science and Energy Engineering, University of Science and Technology of China, Hefei, Anhui Province 230026 (China); Li HePing [Department of Engineering Physics, Tsinghua University, Beijing 100084 (China); Murphy, Anthony B. [CSIRO Materials Science and Engineering, PO Box 218, Lindfield NSW 2070 (Australia)

    2013-03-15

    A self-consistent and complete numerical model for investigating the fundamental processes in a non-equilibrium thermal plasma system consists of the governing equations and the corresponding physical properties of the plasmas. In this paper, a new kinetic theory of the transport properties of two-temperature (2-T) plasmas, based on the solution of the Boltzmann equation using a modified Chapman-Enskog method, is presented. This work is motivated by the large discrepancies between the theories for the calculation of the transport properties of 2-T plasmas proposed by different authors in previous publications. In the present paper, the coupling between electrons and heavy species is taken into account, but reasonable simplifications are adopted, based on the physical fact that m{sub e}/m{sub h} Much-Less-Than 1, where m{sub e} and m{sub h} are, respectively, the masses of electrons and heavy species. A new set of formulas for the transport coefficients of 2-T plasmas is obtained. The new theory has important physical and practical advantages over previous approaches. In particular, the diffusion coefficients are complete and satisfy the mass conversation law due to the consideration of the coupling between electrons and heavy species. Moreover, this essential requirement is satisfied without increasing the complexity of the transport coefficient formulas. Expressions for the 2-T combined diffusion coefficients are obtained. The expressions for the transport coefficients can be reduced to the corresponding well-established expressions for plasmas in local thermodynamic equilibrium for the case in which the electron and heavy-species temperatures are equal.

  10. A polymorphism in a transporter of testosterone is a determinant of androgen independence in prostate cancer.

    Science.gov (United States)

    Sharifi, Nima; Hamada, Akinobu; Sissung, Tristan; Danesi, Romano; Venzon, David; Baum, Caitlin; Gulley, James L; Price, Douglas K; Dahut, William L; Figg, William D

    2008-08-05

    To determine if patients with advanced prostate cancer carrying a polymorphism that codes for a more active testosterone transporter have less durable responses to androgen-deprivation therapy (ADT) than patients not carrying this polymorphism. We previously determined that a polymorphism in SLCO1B3 affects testosterone transport and that those men who have at least one wild-type T allele at the 334 T > G polymorphism in this gene have a shorter survival. We hypothesized that the T allele which increases testosterone transport would be associated with a shorter interval from ADT to androgen independence. We examined the association between this SLCO1B3 polymorphism and time from ADT to androgen independence, ADT to prostate-specific antigen (PSA) nadir and PSA nadir to androgen independence in 68 Caucasian patients with advanced prostate cancer who were treated with ADT with metastatic disease (D2) or biochemical failure with no metastatic disease (D0). When examined separately, patients in the individual stages tended to have a shorter time to androgen independence with the T allele in the D0 (P = 0.11) and D2 (P = 0.18) groups. Combining these groups and stratifying by stage yielded a statistically significant shorter time to androgen independence with the T allele (P = 0.048). A polymorphism in a transporter that increases testosterone import is associated with a shorter time to androgen independence in patients with prostate cancer who are treated with ADT.

  11. Transport properties and Raman spectra of impurity substituted MgB2

    International Nuclear Information System (INIS)

    Masui, T.

    2007-01-01

    Recent advances in the study of MgB 2 are reviewed, with focus on the transport properties and Raman scattering measurements for impurity substituted crystals. Carbon and Aluminium substitution change band filling, introduce intraband and interband scattering. These effects are seen in the temperature dependence of resistivity, Hall coefficients, and phonon peak of Raman spectra. Manganese substitution introduces magnetic scattering, that increases resistivity but gives little change in Raman spectra. The effect of disorder in neutron irradiated samples is also discussed

  12. Electronic properties of mesoscopic graphene structures: Charge confinement and control of spin and charge transport

    Energy Technology Data Exchange (ETDEWEB)

    Rozhkov, A.V., E-mail: arozhkov@gmail.co [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412, Moscow (Russian Federation); Giavaras, G. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Bliokh, Yury P. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Technion-Israel Institute of Technology, Haifa 32000 (Israel); Freilikher, Valentin [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Bar-Ilan University, Ramat-Gan 52900 (Israel); Nori, Franco [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, University of Michigan, Ann Arbor, MI 48109-1040 (United States)

    2011-06-15

    This brief review discusses electronic properties of mesoscopic graphene-based structures. These allow controlling the confinement and transport of charge and spin; thus, they are of interest not only for fundamental research, but also for applications. The graphene-related topics covered here are: edges, nanoribbons, quantum dots, pn-junctions, pnp-structures, and quantum barriers and waveguides. This review is partly intended as a short introduction to graphene mesoscopics.

  13. Study of structural and electronic transport properties of Ce-doped ...

    Indian Academy of Sciences (India)

    Abstract. The structural and electronic transport properties of La1−x Cex MnO3 (x =0.0–1.0) have been studied. All the samples exhibit orthorhombic crystal symmetry and the unit cell volume de- creases with Ce doping. They also make a metal–insulator transition (MIT) and transition temper- ature increases with increase in ...

  14. Tritium permeation evaluation through vertical target of divertor based on recent tritium transport properties

    OpenAIRE

    中村 博文; 西 正孝

    2003-01-01

    Re-evaluation of tritium permeation through vertical target of divertor under the ITER operation condition was carried out using tritium transport properties in the candidate materials such as the diffusion coefficient and the trapping factors in tungsten for armor, and the surface recombination coefficient on copper for the heat sink obtained by authors' recent investigation (authors' data), which simulated the plasma-facing conditions of ITER. Evaluation with the data set of previous evalua...

  15. Transport properties of a piecewise linear transformation and deterministic Levy flights

    International Nuclear Information System (INIS)

    Miyaguchi, Tomoshige

    2006-01-01

    The transport properties of a 1-dimensional piecewise linear dynamical system are investigated through the spectrum of its Frobenius-Perron operator. For a class of initial densities, eigenvalues and eigenfunctions of the Frobenius-Perron operator are obtained explicitly. It is also found that in the long length wave limit, this system exhibits normal diffusion and super diffusion called Levy flight. The diffusion constant and stable index are derived from the eigenvalues. (author)

  16. Transport properties through graphene grain boundaries: strain effects versus lattice symmetry

    Science.gov (United States)

    Hung Nguyen, V.; Hoang, Trinh X.; Dollfus, P.; Charlier, J.-C.

    2016-06-01

    As most materials available at the macroscopic scale, graphene samples usually appear in a polycrystalline form and thus contain grain boundaries. In the present work, the effect of uniaxial strain on the electronic transport properties through graphene grain boundaries is investigated using atomistic simulations. A systematic picture of transport properties with respect to the strain and lattice symmetry of graphene domains on both sides of the boundary is provided. In particular, it is shown that strain engineering can be used to open a finite transport gap in all graphene systems where the two domains are arranged in different orientations. This gap value is found to depend on the strain magnitude, on the strain direction and on the lattice symmetry of graphene domains. By choosing appropriately the strain direction, a large transport gap of a few hundred meV can be achieved when applying a small strain of only a few percents. For a specific class of graphene grain boundary systems, strain engineering can also be used to reduce the scattering on defects and thus to significantly enhance the conductance. With a large strain-induced gap, these graphene heterostructures are proposed to be promising candidates for highly sensitive strain sensors, flexible electronic devices and p-n junctions with non-linear I-V characteristics.

  17. Spatial and temporal variations of the callus mechanical properties during bone transport

    Energy Technology Data Exchange (ETDEWEB)

    Mora-Macias, J.; Reina-Romo, E.; Pajares, A.; Miranda, P.; Dominguez, J.

    2016-07-01

    Nanoindentation allows obtaining the elastic modulus and the hardness of materials point by point. This technique has been used to assess the mechanical propeties of the callus during fracture healing. However, as fas as the authors know, the evaluation of mechanical properties by this technique of the distraction and the docking-site calluses generated during bone transport have not been reported yet. Therefore, the aim of this work is using nanoindentation to assess the spatial and temporal variation of the elastic modulus of the woven bone generated during bone transport. Nanoindentation measurements were carried out using 6 samples from sheep sacrificed at different stages of the bone transport experiments. The results obtained show an important heterogeneity of the elastic modulus of the woven bone without spatial trends. In the case of temporal variation, a clear increase of the mean elastic modulus with time after surgery was observed (from 7±2GPa 35 days after surgery to 14±2GPa 525 days after surgery in the distraction callus and a similar increase in the docking site callus). Comparison with the evolution of the elastic modulus in the woven bone generated during fracture healing shows that mechanical properties increase slower in the case of the woven bone generated during bone transport. (Author)

  18. State-specific transport properties of electronically excited Ar and C

    Science.gov (United States)

    Istomin, V. A.; Kustova, E. V.

    2018-05-01

    In the present study, a theoretical model of state-resolved transport properties in electronically excited atomic species developed earlier is applied to argon and carbon atomic species. It is shown that for Ar and C, similarly to the case of atomic nitrogen and oxygen, the Slater-like models can be applied to calculate diameters of electronically excited atoms. Using the Slater-like model it is shown that for half-filled N (2 px1py1pz1) and full-filled Ar (3 px2py2pz2) electronic shells the growth of atomic radius goes slowly compared to C (2 px1py1) and O (2 px2py1pz1). The effect of collision diameters on the transport properties of Ar and C is evaluated. The influence of accounted number of electronic levels on the transport coefficients is examined for the case of Boltzmann distributions over electronic energy levels. It is emphasized that in the temperature range 1000-14000 K, for Boltzmann-like distributions over electronic states the number of accounted electronic levels do not influence the transport coefficients. Contrary to this, for higher temperatures T > 14000 K this effect becomes of importance, especially for argon.

  19. Spin-polarized transport properties of Fe atomic chain adsorbed on zigzag graphene nanoribbons

    International Nuclear Information System (INIS)

    Zhang, Z L; Chen, Y P; Xie, Y E; Zhang, M; Zhong, J X

    2011-01-01

    The spin-polarized transport properties of Fe atomic chain adsorbed on zigzag graphene nanoribbons (ZGNRs) are investigated using the density-functional theory in combination with the nonequilibrium Green's function method. We find that the Fe chain has drastic effects on spin-polarized transport properties of ZGNRs compared with a single Fe atom adsorbed on the ZGNRs. When the Fe chain is adsorbed on the centre of the ZGNR, the original semiconductor transforms into metal, showing a very wide range of spin-polarized transport. Particularly, the spin polarization around the Fermi level is up to 100%. This is because the adsorbed Fe chain not only induces many localized states but also has effects on the edge states of ZGNR, which can effectively modulate the spin-polarized transports. The spin polarization of ZGNRs is sensitive to the adsorption site of the Fe chain. When the Fe chain is adsorbed on the edge of ZGNR, the spin degeneracy of conductance is completely broken. The spin polarization is found to be more pronounced because the edge state of one edge is destroyed by the additional Fe chain. These results have direct implications for the control of the spin-dependent conductance in ZGNRs with the adsorption of Fe chains.

  20. Tuning transport properties of graphene three-terminal structures by mechanical deformation

    Science.gov (United States)

    Torres, V.; Faria, D.; Latgé, A.

    2018-04-01

    Straintronic devices made of carbon-based materials have been pushed up due to the graphene high mechanical flexibility and the possibility of interesting changes in transport properties. Properly designed strained systems have been proposed to allow optimized transport responses that can be explored in experimental realizations. In multiterminal systems, comparisons between schemes with different geometries are important to characterize the modifications introduced by mechanical deformations, especially if the deformations are localized at a central part of the system or extended in a large region. Then, in the present analysis, we study the strain effects on the transport properties of triangular and hexagonal graphene flakes, with zigzag and armchair edges, connected to three electronic terminals, formed by semi-infinite graphene nanoribbons. Using the Green's function formalism with circular renormalization schemes, and a single band tight-binding approximation, we find that resonant tunneling transport becomes relevant and is more affected by localized deformations in the hexagonal graphene flakes. Moreover, triangular systems with deformation extended to the leads, like longitudinal three-folded type, are shown as an interesting scenario for building nanoscale waveguides for electronic current.

  1. Analytical and laser scanning techniques to determine shape properties of mineral aggregates

    CSIR Research Space (South Africa)

    Komba, Julius J

    2013-01-01

    Full Text Available processed to reconstruct 3-D models of the aggregate particles. The models were further analyzed to determine the form properties. In this paper, two analysis approaches, based on aggregate physical properties and spherical harmonic analysis, were employed...

  2. Studies on transport properties of copper doped tungsten diselenide single crystals

    Science.gov (United States)

    Deshpande, M. P.; Parmar, M. N.; Pandya, Nilesh N.; Chaki, Sunil; Bhatt, Sandip V.

    2012-02-01

    During recent years, transition metal dichalcogenides of groups IVB, VB and VIB have received considerable attention because of the great diversity in their transport properties. 2H-WSe 2 (Tungsten diselenide) is an interesting member of the transition metal dichalcogenide (TMDC's) family and known to be a semiconductor useful for photovoltaic and optoelectronic applications. The anisotropy usually observed in this diamagnetic semiconductor material is a result of the sandwich structure of Se-W-Se layers interacting with each other, loosely bonded by the weak Van der Waals forces. Recent efforts in studying the influence of the anisotropic electrical and optical properties of this layered-type transition metal dichalcogenides have been implemented by doping the samples with different alkali group elements. Unfortunately, little work is reported on doping of metals in WSe 2. Therefore, it is proposed in this work to carry out a systematic growth of single crystals of WSe 2 by doping it with copper in different proportions i.e. Cu xWSe 2 ( x=0, 0.5, 1.0) by direct vapour transport technique. Transport properties like low and high temperature resistivity measurements, high pressure resistivity, Seebeck coefficient measurements at low temperature and Hall Effect at room temperature were studied in detail on all these samples. These measurements show that tungsten diselenide single crystals are p-type whereas doped with copper makes it n-type in nature. The results obtained and their implications are discussed in this paper.

  3. The ESASSI-08 cruise in the South Scotia Ridge region: An inverse model property-transport analysis over the Ridge

    Science.gov (United States)

    Palmer, Margarita; Gomis, Damià; Del Mar Flexas, Maria; Jordà, Gabriel; Naveira-Garabato, Alberto; Jullion, Loic; Tsubouchi, Takamasa

    2010-05-01

    The ESASSI-08 oceanographic cruise carried out in January 2008 was the most significant milestone of the ESASSI project. ESASSI is the Spanish component of the Synoptic Antarctic Shelf-Slope Interactions (SASSI) study, one of the core projects of the International Polar Year. Hydrographical and biochemical (oxygen, CFCs, nutrients, chlorophyll content, alkalinity, pH, DOC) data were obtained along 11 sections in the South Scotia Ridge (SSR) region, between Elephant and South Orkney Islands. One of the aims of the ESASSI project is to determine the northward outflow of cold and ventilated waters from the Weddell Sea into the Scotia Sea. For that purpose, the accurate estimation of mass, heat, salt, and oxygen transport over the Ridge is requested. An initial analysis of transports across the different sections was first obtained from CTD and ADCP data. The following step has been the application of an inverse method, in order to obtain a better estimation of the net flow for the different water masses present in the region. The set of property-conservation equations considered by the inverse model includes mass, heat and salinity fluxes. The "box" is delimited by the sections along the northern flank of the SSR, between Elephant Island and 50°W, the southern flank of the Ridge, between 51.5°W and 50°W, the 50°W meridian and a diagonal line between Elephant Island and 51.5°W, 61.75°S. Results show that the initial calculations of transports suffered of a significant volume imbalance, due to the inherent errors of ship-ADCP data, the complicated topography and the presence of strong tidal currents in some sections. We present the post-inversion property transports across the rim of the box (and their error bars) for the different water masses.

  4. Determining the thermal and physicals properties of oil processing products

    Directory of Open Access Journals (Sweden)

    Viktoria I. Kryvda

    2015-03-01

    Full Text Available In the last decades both technological process’ improvement and primary energy resources saving are the main tasks of oil refineries. Using various oil products does impose an accurate knowledge of their properties. The dispersion analysis applied makes possible to construct a model simulating the primary oil refining products’ and raw materials’ thermal physical properties. As a result of data approximation there were obtained polynomials with coefficients differing from attributable to the studied oil products fractions. The research represents graphic dependences of thermal physical properties on temperature values for diesel oil fraction. The linear character of density and calorific capacity dependencies from temperature is represented with a proportional error in calculations. The relative minimum error is below 2% that confirms the implemented calculations’ adequacy. The resulting model can be used in calculations for further technological process improvements.

  5. Determination of the transport levels in thin films of organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Krause, Stefan

    2009-07-27

    The approach of using the combination of Ultraviolet (UPS) and Inverse Photoemission (IPS) to determine the transport levels in thin films of organic semiconductors is the scope of this work. For this matter all influences on the peak position and width in Photoelectron Spectroscopy are discussed with a special focus on organic semiconductors. Many of these influences are shown with experimental results of the investigation of diindenoperylene on Ag(111). These findings are applied to inorganic semiconductors silicon in order to establish the use of UPS and IPS on a well-understood system. Finally, the method is used to determine the transport level of several organic semiconductors (PTCDA, Alq3, CuPc, DIP, PBI-H4) and the corresponding exciton binding energies are calculated by comparison to optical absorption data. (orig.)

  6. Functional size of photosynthetic electron transport chain determined by radiation inactivation

    International Nuclear Information System (INIS)

    Pan, R.S.; Chen, L.F.; Wang, M.Y.; Tsal, M.Y.; Pan, R.L.; Hsu, B.D.

    1987-01-01

    Radiation inactivation technique was employed to determine the functional size of photosynthetic electron transport chain of spinach chloroplasts. The functional size for photosystem I+II(H 2 O to methylviologen) was 623 +/- 37 kilodaltons; for photosystem II (H 2 O to dimethylquinone/ferricyanide), 174 +/- 11 kilodaltons; and for photosystem I (reduced diaminodurene to methylviologen), 190 +/- 11 kilodaltons. The difference between 364 +/- 22 (the sum of 174 +/- 11 and 190 +/- 11) kilodaltons and 623 +/- 37 kilodaltons is partially explained to be due to the presence of two molecules of cytochrome b 6 /f complex of 280 kilodaltons. The molecular mass for other partial reactions of photosynthetic electron flow, also measured by radiation inactivation, is reported. The molecular mass obtained by this technique is compared with that determined by other conventional biochemical methods. A working hypothesis for the composition, stoichiometry, and organization of polypeptides for photosynthetic electron transport chain is proposed

  7. Effect of spin-orbit interactions on the structural stability, thermodynamic properties, and transport properties of lead under pressure

    Science.gov (United States)

    Smirnov, N. A.

    2018-03-01

    The paper investigates the role of spin-orbit interaction in the prediction of structural stability, lattice dynamics, elasticity, thermodynamic and transport properties (electrical resistivity and thermal conductivity) of lead under pressure with the FP-LMTO (full-potential linear-muffin-tin orbital) method for the first-principles band structure calculations. Our calculations were carried out for three polymorphous lead modifications (fcc, hcp, and bcc) in generalized gradient approximation with the exchange-correlation functional PBEsol. They suggest that compared to the scalar-relativistic calculation, the account for the SO effects insignificantly influences the compressibility of Pb. At the same time, in the calculation of phonon spectra and transport properties, the role of SO interaction is important, at least, for P ≲150 GPa. At higher pressures, the contribution from SO interaction reduces but not vanishes. As for the relative structural stability, our studies show that SO effects influence weakly the pressure of the fcc →hcp transition and much higher the pressure of the hcp →bcc transition.

  8. Electronic band structure, magnetic, transport and thermodynamic properties of In-filled skutterudites InxCo4Sb12

    International Nuclear Information System (INIS)

    Leszczynski, J; Da Ros, V; Lenoir, B; Dauscher, A; Candolfi, C; Masschelein, P; Hejtmanek, J; Kutorasinski, K; Tobola, J; Smith, R I; Stiewe, C; Müller, E

    2013-01-01

    The thermoelectric and thermodynamic properties of polycrystalline In x Co 4 Sb 12 (0.0 ⩽ x ⩽ 0.26) skutterudites were investigated and analysed between 2 and 800 K by means of electrical resistivity, thermopower, thermal conductivity and specific heat measurements. Hall effect, sound velocity and thermal expansion measurements were also made in order to gain insights into the transport and elastic properties of these compounds. The impact of the In filling on the crystal structure as well as the thermal dynamics of the In atoms were tracked down to 4 K using powder neutron diffraction experiments. Analyses of the transport data were compared with the evolution of the electronic band structure with x determined theoretically within the Korringa–Kohn–Rostoker method with the coherent potential approximation. These calculations indicate that In gives rise to a remarkably large p-like density of states located at the conduction band edge. The electrical properties show typical trends of heavily doped semiconductors regardless of the In content. The thermal transport in CoSb 3 is strongly influenced by the presence of In in the voids of the crystal structure resulting in a drop in the lattice thermal conductivity values in the whole temperature range. The low value of the Grüneisen parameter suggests that this decrease mainly originates from enhanced mass-fluctuations and point-defect scattering mechanisms. The highest thermoelectric figure of merit ZT ∼ 1.0 at 750 K was achieved at the maximum In filling fraction, i.e. for x = 0.26. (paper)

  9. The use of modern data about the composition and properties of soils for the development of transport infrastructure of Tyumen

    Science.gov (United States)

    Eremin, Dmitry

    2017-10-01

    Sedimentary properties territory Tura-Pyshma interfluve, where Tyumen is located are determined by the general course of ancient and especially the newest tectonic movements. Active development of the transport network on the territory of the Tour-Pyshma interfluve has created the need for a contemporary study of regional peculiarities of grounds. This will allow you to create roads with the quality meet the international standards. The use of average values of indicators of the properties of silty-clay soils during the development of the transport infrastructure projects of the city of Tyumen and its environs is ineffective due to the genetic characteristics of the rocks located at the depth of 1.5-5.0 meters. Detailed analysis showed that the studied soil belongs to the covering carbonate loams and clays, differing in its characteristics from loess-like sediments of the European part of Russia. The thickness of the covering rocks is not more than 5 meters. It’s low-carbonate, non-saline and often has a layered structure. The upper three meters of sediments contain the minimum quantity of water-soluble salts (dry residue less than 0.1%). Studied covering loams are characterized by favorable physical properties: the density of the bulk and the particle is 1.44 to 1.62 and 2.70-2.78 g/cm3, respectively. Water permeability is high - the filtration coefficient varies from 3.4 to 6.4 m/day, the minimum water velocity observed in the clay types of soil. The presence of sand layers adversely affects the permeability of soil. Therefore, the design and construction of transport infrastructure of the city and the surrounding territories it is necessary to consider regional features of grounds.

  10. Multi-scales modeling of reactive transport mechanisms. Impact on petrophysical properties during CO2 storage

    International Nuclear Information System (INIS)

    Varloteaux, C.

    2012-01-01

    The geo-sequestration of carbon dioxide (CO 2 ) is an attractive option to reduce the emission of greenhouse gases. Within carbonate reservoirs, acidification of brine in place can occur during CO 2 injection. This acidification leads to mineral dissolution which can modify the transport properties of a solute in porous media. The aim of this study is to quantify the impact of reactive transport on a solute distribution and on the structural modification induced by the reaction from the pore to the reservoir scale. This study is focused on reactive transport problem in the case of single phase flow in the limit of long time. To do so, we used a multi-scale up-scaling method that takes into account (i) the local scale, where flow, reaction and transport are known; (ii) the pore scale, where the reactive transport is addressed by using averaged formulation of the local equations; (iii) the Darcy scale (also called core scale), where the structure of the rock is taken into account by using a three-dimensions network of pore-bodies connected by pore-throats; and (iv) the reservoir scale, where physical phenomenon, within each cell of the reservoir model, are taken into account by introducing macroscopic coefficients deduced from the study of these phenomenon at the Darcy scale, such as the permeability, the apparent reaction rate, the solute apparent velocity and dispersion. (author)

  11. Blue emitting 1,8-naphthalimides with electron transport properties for organic light emitting diode applications

    Science.gov (United States)

    Ulla, Hidayath; Kiran, M. Raveendra; Garudachari, B.; Ahipa, T. N.; Tarafder, Kartick; Adhikari, Airody Vasudeva; Umesh, G.; Satyanarayan, M. N.

    2017-09-01

    In this article, the synthesis, characterization and use of two novel naphthalimides as electron-transporting emitter materials for organic light emitting diode (OLED) applications are reported. The molecules were obtained by substituting electron donating chloro-phenoxy group at the C-4 position. A detailed optical, thermal, electrochemical and related properties were systematically studied. Furthermore, theoretical calculations (DFT) were performed to get a better understanding of the electronic structures. The synthesized molecules were used as electron transporters and emitters in OLEDs with three different device configurations. The devices with the molecules showed blue emission with efficiencies of 1.89 cdA-1, 0.98 lmW-1, 0.71% at 100 cdm-2. The phosphorescent devices with naphthalimides as electron transport materials displayed better performance in comparison to the device without any electron transporting material and were analogous with the device using standard electron transporting material, Alq3. The results demonstrate that the naphthalimides could play a significant part in the progress of OLEDs.

  12. Electronic transport properties of 1D-defects in graphene and other 2D-systems

    Energy Technology Data Exchange (ETDEWEB)

    Willke, P.; Wenderoth, M. [IV. Physical Institute, Solids and Nanostructures, Georg-August-University Goettingen (Germany); Schneider, M.A. [Lehrstuhl fuer Festkoerperphysik, Universitaet Erlangen-Nuernberg, Erlangen (Germany)

    2017-11-15

    The continuous progress in device miniaturization demands a thorough understanding of the electron transport processes involved. The influence of defects - discontinuities in the perfect and translational invariant crystal lattice - plays a crucial role here. For graphene in particular, they limit the carrier mobility often demanded for applications by contributing additional sources of scattering to the sample. Due to its two-dimensional nature graphene serves as an ideal system to study electron transport in the presence of defects, because one-dimensional defects like steps, grain boundaries and interfaces are easy to characterize and have profound effects on the transport properties. While their contribution to the resistance of a sample can be extracted by carefully conducted transport experiments, scanning probe methods are excellent tools to study the influence of defects locally. In this letter, the authors review the results of scattering at local defects in graphene and other 2D systems by scanning tunneling potentiometry, 4-point-probe microscopy, Kelvin probe force microscopy and conventional transport measurements. Besides the comparison of the different defect resistances important for device fabrication, the underlying scattering mechanisms are discussed giving insight into the general physics of electron scattering at defects. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. Confinement and transport properties during current ramps in the ASDEX Upgrade tokamak

    Science.gov (United States)

    Fable, E.; Angioni, C.; Hobirk, J.; Pereverzev, G.; Fietz, S.; Hein, T.; ASDEX Upgrade Team

    2011-04-01

    A detailed analysis of experimental data from the ASDEX Upgrade tokamak is carried out to shed light on the properties of confinement and transport in the current ramp-up and ramp-down phases of the plasma discharge. The experimental database is used to identify the relevant ranges of parameters explored during the ramp-up and the ramp-down. The energy confinement time observed in the two ramps displays interesting evolution, in many cases attaining different values at the same current level between ramp-up and ramp-down. The possible reasons for this behaviour are investigated. Interpretative transport simulations are used as a tool to clarify the interplay between different parameters, which are coupled in a non-linear way. In addition, a theory-based transport model is used to understand the behaviour of confinement as observed in the experiment, evidencing the role of both turbulent and neoclassical transport. Linear gyrokinetic calculations are performed to identify the relevant turbulence regime, showing that a broad range of frequencies, in the trapped electron modes (TEMs) and in the ion temperature gradient modes (ITGs) regimes, is explored during both the ramp-up and ramp-down. In the same framework, a quasi-linear model is applied to calculate the value of the local logarithmic density gradient and compare it with the experimental value. Finally, first non-linear simulations of heat transport during the current ramps are presented.

  14. Thermoelectric transport properties of BaBiTe{sub 3}-based materials

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yiming; Zhao, Li-Dong, E-mail: zhaolidong@buaa.edu.cn

    2017-05-15

    BaBiTe{sub 3}, a material with low thermal conductivity, is an inferior thermoelectric material due to the poor electrical properties originated from its narrow band gap. We choose two types of dopants, K and La, trying to optimize its electrical transport properties. The minority carriers, which harm the Seebeck coefficient in this system, are suppressed by La doping. With the increase of both electrical conductivity and Seebeck coefficient, the power factor of 3% La doped BaBiTe{sub 3} reaches 3.7 μW cm{sup −1} K{sup −2} which increased by 40% from undoped BaBiTe{sub 3}. Besides high power factor, the thermal conductivity is also reduced in it. Eventually, a high ZT value, 0.25 at 473 K, for n-type BaBiTe{sub 3} is achieved in 3% La doped BaBiTe{sub 3}. - Graphical abstract: BaBiTe{sub 3} possesses a low thermal conductivity. However, it is an inferior thermoelectric material due to the poor electrical properties originated from its narrow band gap. A high ZT value of 0.25 at 473 K for n-type BaBiTe{sub 3} can be achieved through optimizing electrical transport properties via La doping. - Highlights: • BaBiTe{sub 3} is an analogue of these promising thermoelectric materials: such as CsBi{sub 4}Te{sub 6} and K{sub 2}Bi{sub 8}Se{sub 13}, etc. • BaBiTe{sub 3} possesses a low thermal conductivity. • La is an effective dopant to enhance electrical transport properties. • A high ZT value of 0.25 at 473 K can be achieved in n-type La-doped BaBiTe{sub 3}.

  15. Magnetic and transport properties of Co–Cu microwires with granular structure

    Energy Technology Data Exchange (ETDEWEB)

    Zhukova, V., E-mail: valentina.zhukova@ehu.es [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); Garcia, C. [Bogazici Univ., Dept Phys, TR-34342 Istanbul (Turkey); Departamento de Fisica, Universidad Técnica Federico Santa María, P.O. Box 110-V, Valparaiso (Chile); Val, J.J. del; Ilyn, M. [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); Granovsky, A. [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); Moscow State University, Moscow, Phys. Faculty, 119991 (Russian Federation); Zhukov, A. [Dpto. de Física de Materiales, Fac. Químicas, UPV/EHU, 20018, San Sebastián (Spain); IKERBASQUE, Basque Foundation for Science, 48011 Bilbao (Spain)

    2013-09-30

    Magnetic, transport and structural properties of granular Co{sub x}–Cu{sub 100−x} (5 < x < 40 at.%) glass-coated microwires were studied. Co–Cu microwires exhibited giant magnetoresistance (GMR) effect. For x = 5% we observed the resistivity minimum at 40 K associated with the Kondo effect. For x > 10 partial evidences of granular structure have been observed. For x ≥ 30 anisotropic contribution to GMR has been observed giving rise to non-monotonic dependence of GMR on the field. Temperature dependence of magnetization measured during a cooling regime without external magnetic field and in the presence of the field shows considerable difference at low temperatures, being attributed to the presence of small Co grains embedded in the Cu matrix. By X-ray diffraction we found, that the structure of the metallic nucleus is granular consisting of two phases: fcc Cu appearing in all the samples and fcc α-Co presented only in microwires with higher Co content. For low Co content (x ≤ 10%) X-ray diffraction technique indicates that Co atoms are distributed within the Cu crystals. The quantity and the crystallite size of the formed phases strongly depend on the geometry of the microwire. The structure, magnetic and transport properties were affected by the glass coating inducing the internal stresses and affecting the quenching rate. - Highlights: ► Systematic study of magnetic and transport properties of Co-Cu microwires. ► Observation of Giant Magnetoresistance effect in Co{sub x}Cu100{sub −x} microwires. ► Observation of Kondo-like behavior in Co{sub x}Cu100{sub −x} at lower Co content (5%). ► Discussions of the effect of internal stresses on the properties of Co-Cu microwires. ► Discussion of the effect of composition on the properties of Co-Cu microwires.

  16. On the effects of pressure and irradiation on the transport properties of samarium compounds with unstable valence

    International Nuclear Information System (INIS)

    Morillo, J.

    1983-06-01

    We present the first extensive study of electronic transport properties of ''quasi-stoichiometric'' SmS as a function of pressure P, temperature T, magnetic field B and defect concentration C. SmS which is a semiconductor, undergoes with increasing P a first order transition towards an homogeneous intermediate valence state. In the semiconducting phase (s.c.), the energie epsilon(f) necessary to delocalize a 4f electron increases greatly with T and is about 250meV at 300K. The phase diagram for the first order electronic transition Sm 2 + →Smsup(2+epsilon) with P has been determined for T 6 has been investigated by resistivity measurements under irradiation at 21K. The threshold energy Ed for displacement of Sm in SmS has been determined: Ed(Sm) = 20 +- 2 eV, and the observed effects of irradiation have been associated to samarium displacements (vacancies and interstitials) [fr

  17. Determinants of Residential Property Value in Nigeria – A Neural ...

    African Journals Online (AJOL)

    impact on market values (prices) and to that extent influence the sales and purchase decisions of sellers and buyers in Nigeria. The results of the study should enable Real Estate Professionals to make fair estimates of the market values of residential real estate properties given the features/characteristics of such housing ...

  18. Determination of Phytochemical and Antioxidant Properties of Some ...

    African Journals Online (AJOL)

    A preliminary step to investigating the phytochemical and vitamin B contents of eleven rice lines designated as IWA (IRRI - WARDA - AGRA) lines, together with two popular and most preferred varieties (FARO 44 and R8) were carried-out. The phytochemical properties investigated included flavonoid, phenol and saponin ...

  19. Determination of some mechanical properties of Ugu seed ( Telfairia ...

    African Journals Online (AJOL)

    products. Before the oil can be extracted, it has to pass through some processes like depoding, size reduction, cracking etc. The parameters needed in form of engineering properties of the seed to design and construct the processing, storage and ...

  20. Estimated Interest Rate Rules: Do they Determine Determinacy Properties?

    DEFF Research Database (Denmark)

    Jensen, Henrik

    2011-01-01

    I demonstrate that econometric estimations of nominal interest rate rules may tell little, if anything, about an economy's determinacy properties. In particular, correct inference about the interest-rate response to inflation provides no information about determinacy. Instead, it could reveal...

  1. Depolarization Lidar Determination of Cloud-Base Microphysical Properties

    NARCIS (Netherlands)

    Donovan, D.P.; Klein Baltink, H; Henzing, J. S.; de Roode, S.R.; Siebesma, A.P.

    2016-01-01

    The links between multiple-scattering induced depolarization and cloud microphysical properties (e.g. cloud particle number density, effective radius, water content) have long been recognised. Previous efforts to use depolarization information in a quantitative manner to retrieve cloud

  2. Acoustic Determination of Near-Surface Soil Properties

    Science.gov (United States)

    2008-12-01

    requiring geostatistical analysis, while nearby others are spatially independent. In studies involving many different soil properties and chemistry ...Am 116(6), p. 3354-3369. Kravchenko, N., C.W. Boast, D.G. Bullock, 1991. Fractal analysis of soil spatial variability. Agronomy Journal 91

  3. determination of personal and common property during dissolution

    African Journals Online (AJOL)

    Marriage as one of the most important social institutions is a bedrock for a ... *This article is a substantially modified version of an extract from an earlier work. The ... property, the application of which shall strictly be adhered to by the family ...... For example, an insurance policy purchased by the husband on his life and in.

  4. Structural determinants of NH3 and NH4+ transport by mouse Rhbg, a renal Rh glycoprotein.

    Science.gov (United States)

    Abdulnour-Nakhoul, Solange; Le, Trang; Rabon, Edd; Hamm, L Lee; Nakhoul, Nazih L

    2016-12-01

    Renal Rhbg is localized to the basolateral membrane of intercalated cells and is involved in NH 3 /NH 4 + transport. The structure of Rhbg is not yet resolved; however, a high-resolution crystal structure of AmtB, a bacterial homolog of Rh, has been determined. We aligned the sequence of Rhbg to that of AmtB and identified important sites of Rhbg that may affect transport. Our analysis positioned three conserved amino acids, histidine 183 (H183), histidine 342 (H342), and tryptophan 230 (W230), within the hydrophobic pore where they presumably serve to control NH 3 transport. A fourth residue, phenylalanine 128 (F128) was positioned at the upper vestibule, presumably contributing to recruitment of NH 4 + We generated three mutations each of H183, H342, W230, and F128 and expressed them in frog oocytes. Immunolabeling showed that W230 and F128 mutants were localized to the cell membrane, whereas H183 and H342 staining was diffuse and mostly intracellular. To determine function, we compared measurements of NH 3 /NH 4 + and methyl amine (MA)/methyl ammonium (MA + )-induced currents, intracellular pH, and surface pH (pHs) among oocytes expressing the mutants, Rhbg, or injected with H 2 O. In H183 and W230 mutants, NH 4 + -induced current and intracellular acidification were inhibited compared with that of Rhbg, and MA-induced intracellular alkalinization was completely absent. Expression of H183A or W230A mutants inhibited NH 3 /NH 4 + - and MA/MA + -induced decrease in pHs to the level observed in H 2 O-injected oocytes. Mutations of F128 did not significantly affect transport of NH 3 or NH 4 + These data demonstrated that mutating H183 or W230 caused loss of function but not F128. H183 and H342 may affect membrane expression of the transporter.

  5. Non-interferometric determination of optical anisotropy in highly-oriented fibres using transport intensity equation technique

    Science.gov (United States)

    Sokkar, T. Z. N.; El-Farahaty, K. A.; El-Bakary, M. A.; Raslan, M. I.; Omar, E. Z.; Hamza, A. A.

    2018-03-01

    The optical setup of the transport intensity equation (TIE) technique is developed to be valid for measuring the optical properties of the highly-oriented anisotropic fibres. This development is based on the microstructure models of the highly-oriented anisotropic fibres and the principle of anisotropy. We provide the setup of TIE technique with polarizer which is controlled via stepper motor. This developed technique is used to investigate the refractive indices in the parallel and perpendicular polarization directions of light for the highly-oriented poly (ethylene terephthalate) (PET) fibres and hence its birefringence. The obtained results through the developed TIE technique for PET fibre are compared with that determined experimentally using the Mach-Zehnder interferometer under the same conditions. The comparison shows a good agreement between the obtained results from the developed technique and that obtained from the Mach-Zehnder interferometer technique.

  6. Anisotropic surface hole-transport property of triphenylamine-derivative single crystal prepared by solution method

    Energy Technology Data Exchange (ETDEWEB)

    Umeda, Minoru, E-mail: mumeda@vos.nagaokaut.ac.jp [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Katagiri, Mitsuhiko; Shironita, Sayoko [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Nagayama, Norio [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Ricoh Company, Ltd., Nishisawada, Numazu, Shizuoka 410-0007 (Japan)

    2016-12-01

    Highlights: • A hole transport molecule was investigated based on its electrochemical redox characteristics. • The solubility and supersolubility curves of the molecule were measured in order to prepare a large crystal. • The polarization micrograph and XRD results revealed that a single crystal was obtained. • An anisotropic surface conduction, in which the long-axis direction exceeds that of the amorphous layer, was observed. • The anisotropic surface conduction was well explained by the molecular stacked structure. - Abstract: This paper reports the anisotropic hole transport at the triphenylamine-derivative single crystal surface prepared by a solution method. Triphenylamine derivatives are commonly used in a hole-transport material for organic photoconductors of laser-beam printers, in which the materials are used as an amorphous form. For developing organic photovoltaics using the photoconductor’s technology, preparation of a single crystal seems to be a specific way by realizing the high mobility of an organic semiconductor. In this study, a single crystal of 4-(2,2-diphenylethenyl)-N,N-bis(4-methylphenyl)-benzenamine (TPA) was prepared and its anisotropic hole-transport property measured. First, the hole-transport property of the TPA was investigated based on its chemical structure and electrochemical redox characteristics. Next, a large-scale single crystal formation at a high rate was developed by employing a solution method based on its solubility and supersolubility curves. The grown TPA was found to be a single crystal based on the polarization micrograph observation and crystallographic analysis. For the TPA single crystal, an anisotropic surface conduction was found, which was well explained by its molecular stack structure. The measured current in the long-axis direction is one order of magnitude greater than that of amorphous TPA.

  7. Electrical properties of zirconium diselenide single crystals grown by iodine transport method

    International Nuclear Information System (INIS)

    Patel, S.G.; Agarwal, M.K.; Batra, N.M.; Lakshminarayana, D.

    1998-01-01

    Single crystals of zirconium diselenide (ZrSe 2 ) were grown by chemical vapour transport method using iodine as the transporting agent. The crystals were found to exhibit metallic behaviour in the temperature range 77-300 K and semiconducting nature in 300-443 K range. The measurements of thermoelectric power and conductivity enabled the determination of both carrier mobility and carrier concentration. The variation of carrier mobility and carrier concentration with temperature indicates the presence of deep trapping centres and their reduction with temperature in these crystals. (author)

  8. Computer codes for the evaluation of thermodynamic and transport properties for equilibrium air to 30000 K

    Science.gov (United States)

    Thompson, Richard A.; Lee, Kam-Pui; Gupta, Roop N.

    1991-01-01

    The computer codes developed here provide self-consistent thermodynamic and transport properties for equilibrium air for temperatures from 500 to 30000 K over a temperature range of 10 (exp -4) to 10 (exp -2) atm. These properties are computed through the use of temperature dependent curve fits for discrete values of pressure. Interpolation is employed for intermediate values of pressure. The curve fits are based on mixture values calculated from an 11-species air model. Individual species properties used in the mixture relations are obtained from a recent study by the present authors. A review and discussion of the sources and accuracy of the curve fitted data used herein are given in NASA RP 1260.

  9. Direct determination of the resonance properties of metallic conical nanoantennas

    KAUST Repository

    Tuccio, Salvatore; Razzari, Luca; Alabastri, Alessandro; Toma, Andrea; Liberale, Carlo; De Angelis, Francesco De; Candeloro, Patrizio; Das, Gobind; Giugni, Andrea; Di Fabrizio, Enzo M.; Proietti Zaccaria, Remo

    2014-01-01

    We present a simple method that is able to predict the resonant frequencies of a metallic conical nanoantenna. The alculation is based on an integral relation that takes into account the dependence of the effective refractive index of the plasmonic mode on the cone radius. Numerical simulations retrieving the near field properties of nanocones with different lengths are also performed for comparison. The fine agreement between the two approaches demonstrates the validity of our method. © 2014 Optical Society of America.

  10. Integrated simulation of ELM energy loss determined by pedestal MHD and SOL transport

    International Nuclear Information System (INIS)

    Hayashi, N.; Takizuka, T.; Ozeki, T.; Aiba, N.; Oyama, N.

    2007-01-01

    An integrated simulation code TOPICS-IB based on a transport code with a stability code for the peeling-ballooning modes and a scrape-off-layer (SOL) model has been developed to clarify self-consistent effects of edge localized modes (ELMs) and the SOL on the plasma performance. Experimentally observed collisionality dependence of the ELM energy loss is found to be caused by both the edge bootstrap current and the SOL transport. The bootstrap current decreases with an increase in collisionality and intensifies the magnetic shear at the pedestal region. The increase in the magnetic shear reduces the width of eigenfunctions of unstable modes, which results in the reduction of both the area of the ELM enhanced transport and the ELM enhanced transport near the separatrix. On the other hand, when an ELM crash occurs, the energy flows into the SOL and the SOL temperature rapidly increases. The increase in the SOL temperature lowers the ELM energy loss due to the flattening of the radial edge gradient. The parallel electron heat conduction determines how the SOL temperature increases. For higher collisionality, the conduction becomes lower and the SOL electron temperature increases more. By the above two mechanisms, the ELM energy loss decreases with increasing collisionality

  11. Process and appliance for determining the nature of transported substances by measuring the radiations transmitted

    International Nuclear Information System (INIS)

    Wykes, J.S.; Surzyn, P.M.; Croke, G.M.; Adsley, Ian.

    1980-01-01

    The invention relates to a process for determining the nature of a substance transported, comprising the collimation of the radiation of not less than two energies so that they form beams; the irradiation of the matter transported by the beams, the detection of the non-scattered radiations for the two energies at least, after passing in the transported matter, and the deduction of the nature of the transported matter according to the radiations detected. The radiations are collimated by placing a shield around the gamma source (americium 241 or cesium 137). The detector is protected by a shield so that it prevents any significant interference due to the reactions near the surface provoked by those radiations not of the lowest energy, with detection of those radiations of lesser energy. In a variation, a source of relatively higher energy radiations is placed at a distance from the source of relatively lesser energy radiations. The latter have a component taken from natural ionizing radiation and this component is withdrawn to a predetermined calibration [fr

  12. Molecular determinants of transport stimulation of EAAT2 are located at interface between the trimerization and substrate transport domains.

    Science.gov (United States)

    Mortensen, Ole V; Liberato, José L; Coutinho-Netto, Joaquim; Dos Santos, Wagner F; Fontana, Andréia C K

    2015-04-01

    Excitatory amino acid transporters (EAATs) regulate glutamatergic signal transmission by clearing extracellular glutamate. Dysfunction of these transporters has been implicated in the pathogenesis of various neurological disorders. Previous studies have shown that venom from the spider Parawixia bistriata and a purified compound (Parawixin1) stimulate EAAT2 activity and protect retinal tissue from ischemic damage. In the present study, the EAAT2 subtype specificity of this compound was explored, employing chimeric proteins between EAAT2 and EAAT3 transporter subtypes and mutants to characterize the structural region targeted by the compound. This identified a critical residue (Histidine-71 in EAAT2 and Serine-45 in EAAT3) in transmembrane domain 2 (TM2) to be important for the selectivity between EAAT2 and EAAT3 and for the activity of the venom. Using the identified residue in TM2 as a structural anchor, several neighboring amino acids within TM5 and TM8 were identified to also be important for the activity of the venom. This structural domain of the transporter lies at the interface of the rigid trimerization domain and the central substrate-binding transport domain. Our studies suggest that the mechanism of glutamate transport enhancement involves an interaction with the transporter that facilitates the movement of the transport domain. We identified a domain (purple star) in the glutamate transporter EAAT2 that is important for transport stimulation through a spider venom, and suggest a mechanism for enhanced transporter function through facilitated substrate translocation (arrow). Because the dysfunction of glutamate transporters is implicated in the pathogenesis of neurological disorders, understanding the mechanisms of enhanced transport could have therapeutic implications. © 2015 International Society for Neurochemistry.

  13. Mixing rules for optical and transport properties of warm, dense matter

    International Nuclear Information System (INIS)

    Kress, Joel D.; Horner, Daniel A.; Collins, Lee A.

    2009-01-01

    The warm, dense matter (WDM) regime requires a sophisticated treatment since neither ideal gas laws or fully ionized plasma models apply. Mixtures represent the predominant form of matter throughout the universe and the ability to predict the properties of a mixture, though direct simulation or from convolution of the properties of the constituents is both a challenging prospect and an important goal. Through quantum molecular dynamics (QMD), we accurately simulate WDM and compute equations of state, transport, and optical properties of such materials, including mixtures, in a self-consistent manner from a single simulation. With the ability to directly compute the mixture properties, we are able to validate mixing rules for combining the optical and dynamical properties of Li and H separately to predict the properties of lithium hydride (LiH). We have examined two such mixing rules and extend them to morphologies beyond a simple liquid alloy. We have also studied a mixture of polyethylene and aluminum at T = 1 eV.

  14. Determination of thermal-diffusive properties of lyophilized food products

    International Nuclear Information System (INIS)

    Kaplon, J.; Kramkowski, R.; Berdzik, M.

    1998-01-01

    Experimental results of vacuum freeze drying were presented. Water solutions of skim milk were dried under various pressures and distribution of temperature and moisture as a function of drying time were determined. Unilateral radiant heating of the material was applied. On the basis of experiment results and URIF model of vacuum freeze drying the thermal conductivity and vapour diffusion coefficients in dry layer were determined

  15. Identification of the key determinant of the transport promiscuity in Na+-translocating rhodopsins.

    Science.gov (United States)

    Mamedov, Adalyat M; Bertsova, Yulia V; Anashkin, Viktor A; Mamedov, Mahir D; Baykov, Alexander A; Bogachev, Alexander V

    2018-05-15

    Bacterial Na + -transporting rhodopsins convert solar energy into transmembrane ion potential difference. Typically, they are strictly specific for Na + , but some can additionally transport H + . To determine the structural basis of cation promiscuity in Na + -rhodopsins, we compared their primary structures and found a single position that harbors a cysteine in strictly specific Na + -rhodopsins and a serine in the promiscuous Krokinobacter eikastus Na + -rhodopsin (Kr2). A Cys253Ser variant of the strictly specific Dokdonia sp. PRO95 Na + -rhodopsin (NaR) was indeed found to transport both Na + and H + in a light-dependent manner when expressed in retinal-producing Escherichia coli cells. The dual specificity of the NaR variant was confirmed by analysis of its photocycle, which revealed an acceleration of the cation-capture step by comparison with the wild-type NaR in a Na + -deficient medium. The structural basis for the dependence of the Na + /H + specificity in Na + -rhodopsin on residue 253 remains to be determined. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. The Determinants of Transportation Mode Choice in the Middle Eastern Cities: the Kerman Case, Iran

    Directory of Open Access Journals (Sweden)

    Hamid Soltanzadeh

    2014-07-01

    Full Text Available Having a precise understanding of the determinants of transportation mode choices and decisions can be under the influence of regional and cultural aspects. This paper outlines such determinants in the Iranian city of Kerman as a representative of the similar Middle Eastern cities located in hot-arid climates and Moslem cultures. The descriptive analysis of the results derived from a short survey that was a part of a larger study conducted in the second half of 2013 indicated that adding to accessibility to public transportation and the convenience of using it can persuade people to shift from car driving to public transit use. The main barriers to bicycling are socio-cultural aspects, while for walking the obstacles are physical and objective. Increasing the quality of pedestrian infrastructure and spaces is a stronger deterrent than personal attitudes against walking. Such findings show slight dissimilarities from the results of some of the western studies that find the built environment more effective. These findings can be a general guide for the Middle Eastern planners to promote walking, biking, and public transport use.

  17. Methodology for determining time-dependent mechanical properties of tuff subjected to near-field repository conditions

    International Nuclear Information System (INIS)

    Blacic, J.D.; Andersen, R.

    1983-01-01

    We have established a methodology to determine the time dependence of strength and transport properties of tuff under conditions appropriate to a nuclear waste repository. Exploratory tests to determine the approximate magnitudes of thermomechanical property changes are nearly complete. In this report we describe the capabilities of an apparatus designed to precisely measure the time-dependent deformation and permeability of tuff at simulated repository conditions. Preliminary tests with this new apparatus indicate that microclastic creep failure of tuff occurs over a narrow strain range with little precursory Tertiary creep behavior. In one test, deformation under conditions of slowly decreasing effective pressure resulted in failure, whereas some strain indicators showed a decreasing rate of strain

  18. Methodology for determining time-dependent mechanical properties of tuff subjected to near-field repository conditions

    Energy Technology Data Exchange (ETDEWEB)

    Blacic, J.D.; Andersen, R.

    1983-01-01

    We have established a methodology to determine the time dependence of strength and transport properties of tuff under conditions appropriate to a nuclear waste repository. Exploratory tests to determine the approximate magnitudes of thermomechanical property changes are nearly complete. In this report we describe the capabilities of an apparatus designed to precisely measure the time-dependent deformation and permeability of tuff at simulated repository conditions. Preliminary tests with this new apparatus indicate that microclastic creep failure of tuff occurs over a narrow strain range with little precursory Tertiary creep behavior. In one test, deformation under conditions of slowly decreasing effective pressure resulted in failure, whereas some strain indicators showed a decreasing rate of strain.

  19. Empirical investigation of topological and weighted properties of a bus transport network from China

    Science.gov (United States)

    Shu-Min, Feng; Bao-Yu, Hu; Cen, Nie; Xiang-Hao, Shen; Yu-Sheng, Ci

    2016-03-01

    Many bus transport networks (BTNs) have evolved into directed networks. A new representation model for BTNs is proposed, called directed-space P. The bus transport network of Harbin (BTN-H) is described as a directed and weighted complex network by the proposed representation model and by giving each node weights. The topological and weighted properties are revealed in detail. In-degree and out-degree distributions, in-weight and out-weight distributions are presented as an exponential law, respectively. There is a strong relation between in-weight and in-degree (also between out-weight and out-degree), which can be fitted by a power function. Degree-degree and weight-weight correlations are investigated to reveal that BTN-H has a disassortative behavior as the nodes have relatively high degree (or weight). The disparity distributions of out-degree and in-degree follow an approximate power-law. Besides, the node degree shows a near linear increase with the number of routes that connect to the corresponding station. These properties revealed in this paper can help public transport planners to analyze the status quo of the BTN in nature. Project supported by the National High Technology Research and Development Program of China (Grant No. 2014AA110304).

  20. Literature Survey of Crude Oil Properties Relevant to Handling and Fire Safety in Transport.

    Energy Technology Data Exchange (ETDEWEB)

    Lord, David [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Luketa, Anay [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Wocken, Chad [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Schlasner, Steve [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Aulich, Ted [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Allen, Ray [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Rudeen, David Keith [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-03-01

    Several fiery rail accidents in 2013-2015 in the U.S. and Canada carrying crude oil produced from the Bakken region of North Dakota have raised questions at many levels on the safety of transporting this, and other types of crude oil, by rail. Sandia National Laboratories was commissioned by the U.S. Department of Energy to investigate the material properties of crude oils, and in particular the so-called "tight oils" like Bakken that comprise the majority of crude oil rail shipments in the U.S. at the current time. The current report is a literature survey of public sources of information on crude oil properties that have some bearing on the likelihood or severity of combustion events that may occur around spills associated with rail transport. The report also contains background information including a review of the notional "tight oil" field operating environment, as well a basic description of crude oils and potential combustion events in rail transport. This page intentionally blank

  1. The obtaining and properties of asymmetric ion transport membrane for separating of oxygen from air

    Science.gov (United States)

    Solovieva, A. A.; Kulbakin, I. V.

    2018-04-01

    The bilayer oxygen-permeable membrane, consisting of a thin-film dense composite based on Co3O4 - 36 wt. % Bi2O3, and of a porous ceramic substrate of Co2SiO4, was synthesized and characterized. The way for obtaining of porous ceramic based on cobalt silicate was found, while the microstructure and the mechanical properties of porous ceramic were studied. Layered casting with post-pressing was used to cover the surface of porous support of Co2SiO4 by the Co3O4 - 36 wt. % Bi2O3 - based film. Transport properties of the asymmetric membrane have been studied, the kinetic features of oxygen transport have been established, and the characteristic thickness of the membrane has been estimated. The methods to prevent the high-temperature creep of ion transport membranes based on solid/molten oxides, which are the promising ones for obtaining of pure oxygen from air, are proposed and discussed.

  2. The local structure, magnetic, and transport properties of Cr-doped In2O3 films

    International Nuclear Information System (INIS)

    Wang Shiqi; An Yukai; Feng Deqiang; Liu Jiwen; Wu Zhonghua

    2013-01-01

    Cr-doped In 2 O 3 films were deposited on Si (100) substrates by RF-magnetron sputtering technique. The local structure, magnetic, and transport properties of films are investigated by X-ray diffraction, X-ray photoelectron spectroscopy, X-ray absorption fine structure, Hall effect, R-T, and magnetic measurements. Structural analysis clearly indicates that Cr ions substitute for In 3+ sites of the In 2 O 3 lattice in the valence of +2 states and Cr-related secondary phases or clusters as the source of ferromagnetism is safely ruled out. The films with low Cr concentration show a crossover from semiconducting to metallic transport behavior, whereas only semiconducting behavior is observed in high Cr concentration films. The transport property of all films is governed by Mott variable range hopping behavior, suggesting that the carriers are strongly localized. Magnetic characterizations show that the saturated magnetization of films increases first, and then decreases with Cr doping, while carrier concentration n c decreases monotonically, implying that the ferromagnetism is not directly induced by the mediated carriers. It can be concluded the ferromagnetism of films is intrinsic and originates from electrons bound in defect states associated with oxygen vacancies.

  3. Intellectual property: A strong determinant of economic growth

    Directory of Open Access Journals (Sweden)

    Munmun Rai

    2009-01-01

    Full Text Available The returns from almost all human endeavors can ultimately be translated into monetary gains. The past few years have seen increased attention paid to the strengthening of intellectual property rights due to globalization. The development of Intellectual property rights (IPR over the years has invariably brought an upsurge in the outlook of nations toward the aspect of societal and cultural growth, this being said with the preliminary assumption that economic growth has been the most affected realm and that it requires a separate spectrum of analysis. The artifacts between the IP regime and the national economy can be easily interpreted by the fact that India′s independence had itself brought an era where the enactment of the national IP laws were considered to stand on the touchstone of the market economy. The aim of the present article is to investigate the impact of a strong IP regime on the economic development of a nation and also a light is raised into Indian economy, and the creation of an efficient innovative system is discussed. A strong relation of the IPR with the pharma and biotech sectors has been discussed. Undoubtedly, the Intellectual property (IP systems must be developed so as to bring in socioeconomic well-being. The fact that a strong IPR actually provokes IPR infringements in many developing nations also seems to be an issue that needs to be analyzed while understanding the need of the former. The trade-off between unfair competition laws and IP also assumes importance of high magnitude and hence needs to be particularly emphasized. With the growing recognition of IPR, the importance of worldwide forums on IPR has been realized. Companies, universities, and industries want to protect their IPR internationally. In order to reach this goal, countries have signed numerous agreements and treaties.

  4. Determining Symmetry Properties of Gravitational Fields of Terrestrial Group Planets

    Directory of Open Access Journals (Sweden)

    R.A. Kascheev

    2016-09-01

    Full Text Available Numerous models of gravity fields of the Solar system bodies have been constructed recently owing to successful space missions. These models are sets of harmonic coefficients of gravity potential expansion in series of spherical functions, which is Laplace series. The sets of coefficients are different in quantity of numerical parameters, sources and composition of the initial observational data, methods to obtain and process them, and, consequently, in a variety of properties and accuracy characteristics. For this reason, the task of comparison of different models of celestial bodies considered in the paper is of interest and relevant. The main purpose of this study is comparison of the models of gravitational potential of the Earth, Moon, Mars, and Venus with the quantitative criteria of different types of symmetries developed by us. It is assumed that some particular symmetry of the density distribution function of the planetary body causes similar symmetry of its gravitational potential. The symmetry of gravitational potential, in its turn, imposes additional conditions (restrictions, which must be satisfied by the harmonic coefficients. The paper deals with seven main types of symmetries: central, axial, two symmetries specular relative to the equatorial planes and prime meridian, as well as three rotational symmetries (at π angle around the coordinate system axes. According to the results of calculations carried out for the Earth, Moon, Mars, and Venus, the values of the criteria vary considerably for different types of symmetries and for different planets. It means that the specific value of each criterion corresponding to a particular celestial body is indicative of the properties and internal structure characteristics of the latter and, therefore, it can be used as a tool for comparative planetology. On the basis of the performed calculations, it is possible to distinguish two groups of celestial bodies having similar properties of

  5. Improved Flow Property Determination from Nanotomography of Porous Media

    DEFF Research Database (Denmark)

    Jha, Diwaker

    tomogram often contains ring artifacts, which have no physical significance but that introduce false pores or solids when the image is segmented. I developed an algorithm that successfully suppresses these artifacts and can be operated automatically over large SXCT datasets. Another hindrance for an SXCT......, the extracted properties show a higher dependence on image resolution than sample volume. This indicates that high resolution tomography is not always needed for some rock types. A straightforward application of 3D tomograms for a pore scale NMR simulation gave a false estimation of available surfaces...

  6. Determining thin film properties by fitting optical transmittance

    International Nuclear Information System (INIS)

    Klein, J.D.; Yen, A.; Cogan, S.F.

    1990-01-01

    The optical transmission spectra of rf sputtered tungsten oxide films on glass substrates were modeled to determine absorption edge behavior, film thickness, and index of refraction. Removal of substrate reflection and absorption phenomena from the experimental spectra allowed direct examination of thin film optical characteristics. The interference fringe pattern allows determination of the film thickness and the dependence of the real index of refraction on wavelength. Knowledge of the interference fringe behavior in the vicinity of the absorption edge was found essential to unambiguous determination of the optical band gap. In particular, the apparently random deviations commonly observed in the extrapolation of as-acquired data are eliminated by explicitly considering interference fringe phenomena. The multivariable optimization fitting scheme employed allows air-film-substrate reflection losses to be compensated without making reflectance measurements

  7. Effects of antidiuretic hormone on kinetic and energetic determinants of active sodium transport in frog skin.

    Science.gov (United States)

    Lau, Y T; Lang, M A; Essig, A

    1981-10-02

    The effects of antidiuretic hormone (ADH) on the rate of transepithelial active Na transport JaNa and the rate of suprabasal O2 consumption of Jsbr were studied in paired hemiskins of frog. Within some 30 min following administration of ADH both JaNa and Jsbr increased to near-maximal levels and then remained stable for at least an hour. On symmetric perturbation of the transepithelial electrical potential delta psi at 6-min intervals, the dependence of JaNa and Jsbr on delta psi was near-linear, both in control and experimental hemi-skins. The stability and near-linearity of the system permitted systematic analysis of the parameters of linear non-equilibrium thermodynamic (NET) and electrical equivalent circuit (EC) formulations. ADH (100 mU/ml) stimulated two of the three NET phenomenological L coefficients, as well as A, the affinity (negative Gibbs free energy) of a metabolic reaction driving transport. Observations at partially depressed levels of transport indicated that the effects of kinetic and energetic factors are to some extent discrete. EC analysis showed stimulation of the amiloride-sensitive conductance Ka, but not of the apparent electromitive force of Na transport 'ENa'. Similar effects were produced by 10 mU/ml of ADH or by 10 mM dibutyryl cyclic AMP, although less marked effects on the L coefficients were noted with the lower concentration of hormone. It is suggested that, in contrast to EC analysis, the NET formulation distinguishes between kinetic and energetic determinants of transport, supporting a dual mechanism of action of ADH.

  8. Ab initio calculation of transport properties between PbSe quantum dots facets with iodide ligands

    Science.gov (United States)

    Wang, B.; Patterson, R.; Chen, W.; Zhang, Z.; Yang, J.; Huang, S.; Shrestha, S.; Conibeer, G.

    2018-01-01

    The transport properties between Lead Selenide (PbSe) quantum dots decorated with iodide ligands has been studied using density functional theory (DFT). Quantum conductance at each selected energy levels has been calculated along with total density of states and projected density of states. The DFT calculation is carried on using a grid-based planar augmented wave (GPAW) code incorporated with the linear combination of atomic orbital (LCAO) mode and Perdew Burke Ernzerhof (PBE) exchange-correlation functional. Three iodide ligand attached low index facets including (001), (011), (111) are investigated in this work. P-orbital of iodide ligand majorly contributes to density of state (DOS) at near top valence band resulting a significant quantum conductance, whereas DOS of Pb p-orbital shows minor influence. Various values of quantum conductance observed along different planes are possibly reasoned from a combined effect electrical field over topmost surface and total distance between adjacent facets. Ligands attached to (001) and (011) planes possess similar bond length whereas it is significantly shortened in (111) plane, whereas transport between (011) has an overall low value due to newly formed electric field. On the other hand, (111) plane with a net surface dipole perpendicular to surface layers leading to stronger electron coupling suggests an apparent increase of transport probability. Apart from previously mentioned, the maximum transport energy levels located several eVs (1 2 eVs) from the edge of valence band top.

  9. The properties of the wood-polystyrene interphase determined by inverse gas chromatography

    Science.gov (United States)

    John Simonsen; Zhenqiu Hong; Timothy G. Rials

    1997-01-01

    The properties of the interphase in wood-polymer composites are important determinants of the properties of the final composite. This study used inverse gas chromatography (IGC) to measure interphasal properties of composites of polystyrene and two types of wood fiber fillers and an inoranic substrate (CW) with varying amounts of surface coverage of polystyrene. Glass...

  10. Theoretical prediction of the electronic transport properties of the Al-Cu alloys based on the first-principle calculation and Boltzmann transport equation

    Science.gov (United States)

    Choi, Garam; Lee, Won Bo

    Metal alloys, especially Al-based, are commonly-used materials for various industrial applications. In this paper, the Al-Cu alloys with varying the Al-Cu ratio were investigated based on the first-principle calculation using density functional theory. And the electronic transport properties of the Al-Cu alloys were carried out using Boltzmann transport theory. From the results, the transport properties decrease with Cu-containing ratio at the temperature from moderate to high, but with non-linearity. It is inferred by various scattering effects from the calculation results with relaxation time approximation. For the Al-Cu alloy system, where it is hard to find the reliable experimental data for various alloys, it supports understanding and expectation for the thermal electrical properties from the theoretical prediction. Theoretical and computational soft matters laboratory.

  11. Transportation

    National Research Council Canada - National Science Library

    Adams, James; Carr, Ron; Chebl, Maroun; Coleman, Robert; Costantini, William; Cox, Robert; Dial, William; Jenkins, Robert; McGovern, James; Mueller, Peter

    2006-01-01

    ...., trains, ships, etc.) and maximizing intermodal efficiency. A healthy balance must be achieved between the flow of international commerce and security requirements regardless of transportation mode...

  12. Lattice dynamics and substrate-dependent transport properties of (In, Yb)-doped CoSb3 skutterudite thin films

    KAUST Repository

    Sarath Kumar, S. R.; Cha, Dong Kyu; Alshareef, Husam N.

    2011-01-01

    Lattice dynamics, low-temperature electrical transport, and high-temperature thermoelectric properties of (In, Yb)-doped CoSb3thin films on different substrates are reported. Pulsed laser deposition under optimized conditions yielded single

  13. A Model for Deterring the Determined Thief of Patron Property

    Science.gov (United States)

    McKay, Richard

    2008-01-01

    Ongoing theft from library patrons may be the work of a determined thief, one who will not be deterred by the crimeproofing techniques that often stop less committed criminals. This type of theft can be deterred when the library staff makes their patrons aware that successful deterrence depends on them not abandoning their valuables. Other staff…

  14. Pressure tuning of the electrical transport properties of the Weyl semimetal NbP

    Energy Technology Data Exchange (ETDEWEB)

    Reis, Ricardo dos; Ajeesh, M.O.; Sun, Yan; Shekhar, Chandra; Schmidt, Marcus; Felser, Claudia; Yan, Binghai; Nicklas, Michael [Max Planck Institute for Chemical Physics of Solids, Dresden (Germany)

    2016-07-01

    Recently enormous attention has been given to a class of material called Weyl semimetal (WSM) due to the prediction of many exotic phenomena, in particular exceptional transport properties, making these systems not only interesting for fundamental research, but also promising materials for novel applications. WSM can be viewed as the hybrid of 3D graphene and topological insulators. The band crossing point, the so-called Weyl point, acts as a magnetic monopole (a singular point of Berry curvature) in momentum space, which always comes in a pairs. If the time-reversal and inversion symmetries are respected, a pair of Weyl points is degenerate in energy, forming another topological phase called Dirac semimetal. Owing this complex band structure the details of the electronic structure can play a significant role in the electrical transport properties of these materials. In this context, external pressure is an important control parameter to effectively tune lattice structures and the corresponding electronic states in a systematic fashion, avoiding the complexity brought by chemical doping. Here, we present a high pressure study of the magnetotransport properties of the Weyl semimetal NbP, which are particularly important to explore novel phenomena and understand the physics behind.

  15. Effect of spin reorientation on magnetocaloric and transport properties of NdAl{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Souza, M.V. de, E-mail: marcos_vinicios@hotmail.com [Núcleo de Pós-Graduação em Física, Campus Prof. José Aloísio de Campos, UFS, 49100-000 São Cristóvão, SE (Brazil); Silva, J.A. da [Núcleo de Pós-Graduação em Física, Campus Prof. José Aloísio de Campos, UFS, 49100-000 São Cristóvão, SE (Brazil); Silva, L.S. [Núcleo de Pós-Graduação em Física, Campus Prof. José Aloísio de Campos, UFS, 49100-000 São Cristóvão, SE (Brazil); Instituto Federal de Tocantins, IFTO – Campus Colinas do Tocantins, AV. Bernardo Sayao S/N, Chácara Raio de Sol, Setor Santa Maria, CEP 77760-000 Colinas do Tocantins, TO (Brazil)

    2017-01-01

    We report the magneto-thermal and resistive properties of rare-earth dialuminide NdAl{sub 2}, including spin reorientation transition. To this purpose, we used a theoretical model that considers the interactions of exchange and Zeeman, besides the anisotropy due to the electrical crystal field. The theoretical results obtained were compared to experimental data of the NdAl{sub 2} in single crystal and bulk forms. Explicitly, we have calculated the anisotropic variation of magnetic entropy with the magnetic field oriented along the three principal crystallographic directions: [100], [110], and [111] of NdAl{sub 2} single crystal, where a signature of the spin reorientation is observed in the [110] and [111] directions. Moreover, of magnetoresistivity we consider the applied magnetic field along the crystallographic directions [100] and [110]. In turn, for the polycrystalline form, the good agreement between theory and experiment confirms the presence of spin reorientation, which was predicted theoretically in magnetization curves. - Highlights: • Modeling of the thermodynamics quantities in NdAl{sub 2} single crystal and policrystal. • Modeling of the transport properties in NdAl{sub 2} single crystal. • Effect of reorientation of spin on caloric and transport properties.

  16. Enhancement in transport properties of seeded melt-textured YBCO by Cu-site doping

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yu X. [Department of Physics, Hong Kong Baptist University, Kowloon (China); Texas Center for Superconductivity and Department of Mechanical Engineering, University of Houston, Houston, TX (United States); Lo, W.; Salama, Kamel [Texas Center for Superconductivity and Department of Mechanical Engineering, University of Houston, Houston, TX (United States); Tang, Tong B. [Department of Physics, Hong Kong Baptist University, Kowloon (China)

    2002-05-01

    A significant research effort has been made worldwide to introduce nanometre-scale weak superconducting regions into seeded melt-textured superconductors to enhance their critical current density, trapped magnetic field and levitation force. The enhancement in these properties is dependent on the pinning forces exerted on the magnetic flux lines. In this paper we present a substantial improvement in the transport properties of these materials by optimizing the fabrication conditions, controlling the oxygen deficiency, as well as adjusting the doping level of Zn in YBa{sub 2}(Cu{sub 1-x}Zn{sub x}){sub 3}O{sub 7-}{delta} large grains. The enhancement is found to be as much as 30% by doping between about x=0.001 25 and 0.002 53. The results strongly indicate that the introduction of local nanometre-scale weak superconducting regions by Zn substitution for Cu in the CuO{sub 2} plane enhances the transport properties. Due to the simplicity of the processing conditions, these doping techniques can have a significant potential for a variety of engineering applications. (author)

  17. The role of free carbon in the transport and magnetic properties of boron carbide

    International Nuclear Information System (INIS)

    Bandyopadhyay, A.K.; Beuneu, F.; Zuppiroli, L.; Beauvy, M.

    1984-01-01

    Boron carbide is a ceramic which has a wide field of application because of its mechanical and nuclear properties. This material is difficult to characterise due to the presence of different levels of disorder and inhomogeneities which are found in the usual available samples. The transport and magnetic properties of several samples of boron carbide have been measured from liquid helium to room temperature as a function of temperature and composition. We have attempted to attribute the different features of these properties to the different levels of disorder. The role of free carbon, in form of thin layers of graphite within the disordered semi-conducting matrix, was investigated in particular details, because it was either ignored or neglected by others. Free carbon is found to dominate the D.C. transport when its concentration is larger than 5%; while the principal features of the electron spin resonance (E.S.R.) line show a dominance of free carbon when the concentration is larger than 3.5%. Below these concentrations conductivities as well as spin relaxation rates do not depend very much on free carbon; neither these have been found to be correlated in a simple way to the stoichiometry. (author)

  18. Modification of Local Urban Aerosol Properties by Long-Range Transport of Biomass Burning Aerosol

    Directory of Open Access Journals (Sweden)

    Iwona S. Stachlewska

    2018-03-01

    Full Text Available During August 2016, a quasi-stationary high-pressure system spreading over Central and North-Eastern Europe, caused weather conditions that allowed for 24/7 observations of aerosol optical properties by using a complex multi-wavelength PollyXT lidar system with Raman, polarization and water vapour capabilities, based at the European Aerosol Research Lidar Network (EARLINET network urban site in Warsaw, Poland. During 24–30 August 2016, the lidar-derived products (boundary layer height, aerosol optical depth, Ångström exponent, lidar ratio, depolarization ratio were analysed in terms of air mass transport (HYSPLIT model, aerosol load (CAMS data and type (NAAPS model and confronted with active and passive remote sensing at the ground level (PolandAOD, AERONET, WIOS-AQ networks and aboard satellites (SEVIRI, MODIS, CATS sensors. Optical properties for less than a day-old fresh biomass burning aerosol, advected into Warsaw’s boundary layer from over Ukraine, were compared with the properties of long-range transported 3–5 day-old aged biomass burning aerosol detected in the free troposphere over Warsaw. Analyses of temporal changes of aerosol properties within the boundary layer, revealed an increase of aerosol optical depth and Ångström exponent accompanied by an increase of surface PM10 and PM2.5. Intrusions of advected biomass burning particles into the urban boundary layer seem to affect not only the optical properties observed but also the top height of the boundary layer, by moderating its increase.

  19. Effect of d-wave pairing symmetry in transport properties of silicene-based superconductor junction

    Science.gov (United States)

    Vosoughi-nia, S.; Rashedi, G.; hajati, Y.

    2018-06-01

    We theoretically study the tunneling conductance of a normal/d-wave superconductor silicene junction using Blonder-Tinkham-Klapwijk (BTK) formalism. We discuss how the conductance spectra are affected by changing the chemical potential (μN) in the normal silicene region. It is obtained that the amplitude of the spin/valley-dependent Andreev reflection (AR) and charge conductance (G) of the junction can be strongly modulated by the orientation angle of superconductive gap (β) and perpendicular electric field (Ez). We demonstrate that the charge conductance exhibits an oscillatory behavior as a function of β by a period of π/2. Remarkably, variation of μN strongly modifies the amplitude of the oscillations and periodically there are transport gaps in the G - β oscillations for a range of μN. These findings suggest that one may experimentally tune the transport properties of the junction through changing β, Ez and μN.

  20. Electron transport properties in ZnO nanowires/poly(3-hexylthiophene) hybrid nanostructure

    International Nuclear Information System (INIS)

    Cheng Ke; Cheng Gang; Wang Shujie; Fu Dongwei; Zou Bingsuo; Du Zuliang

    2010-01-01

    The ZnO nanowires (NWs) array/poly(3-hexylthiophene) (P3HT) hybrid prototype device was fabricated. An ultraviolet (UV) light of λ = 350 nm is used to investigate the photo-electric properties of the ZnO NWs array and hybrid structure. In this way, we can avoid the excitation of P3HT, which can give us a real electron transport ability of ZnO NWs itself. Our results demonstrated a higher and faster photo-electric response of 3 s for the hybrid structure while 9 s for the ZnO NWs array. The surface states related slow photo-electric response was also observed for them. The charge transfer mechanism and the influence of surface states were discussed. The current work provides us profound understandings on the electron transport ability of ZnO NWs array in a working hybrid polymer solar cell, which is crucial for optimizing the device performance.

  1. Mechanical properties of ductile cast iron and cast steel for intermediate level waste transport containers

    International Nuclear Information System (INIS)

    Gray, I.L.S.; Sievwright, R.W.T.; Egid, B.; Ajayi, F.; Donelan, P.

    1994-01-01

    UK Nirex Ltd is developing Type B re-usable shielded transport containers (RSTCs) in a range of shielding thicknesses to transport intermediate level radioactive waste (ILW) to a deep repository. The designs are of an essentially monolithic construction and rely principally on the plastic flow of their material to absorb the energies involved in impact events. Nirex has investigated the feasibility of manufacturing the RSTCs from ductile cast iron (DCI) or cast steel instead of from forgings, since this would bring advantages of reduced manufacturing time and costs. However, cast materials are perceived to lack toughness and ductility and it is necessary to show that sufficient fracture toughness can be obtained to preclude brittle failure modes, particularly at low temperatures. The mechanical testing carried out as part of that programme is described. It shows how the measured properties have been used to demonstrate avoidance of brittle fracture and provide input to computer modelling of the drop tests. (author)

  2. Transport properties of hydrogen passivated silicon nanotubes and silicon nanotube field effect transistors

    KAUST Repository

    Montes Muñoz, Enrique

    2017-01-24

    We investigate the electronic transport properties of silicon nanotubes attached to metallic electrodes from first principles, using density functional theory and the non-equilibrium Green\\'s function method. The influence of the surface termination is studied as well as the dependence of the transport characteristics on the chirality, diameter, and length. Strong electronic coupling between nanotubes and electrodes is found to be a general feature that results in low contact resistance. The conductance in the tunneling regime is discussed in terms of the complex band structure. Silicon nanotube field effect transistors are simulated by applying a uniform potential gate. Our results demonstrate very high values of transconductance, outperforming the best commercial silicon field effect transistors, combined with low values of sub-threshold swing.

  3. Optical and transport properties of single crystal rubrene: A theoretical study

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Lipeng [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Lu, Jing [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Faculty of Chemistry, Northeast Normal University, Changchun (China); Long, Guankui; Zheng, Fulu [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Zhang, Jingping [Faculty of Chemistry, Northeast Normal University, Changchun (China); Zhao, Yang, E-mail: YZhao@ntu.edu.sg [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore)

    2016-12-20

    Optical and charge transport properties of single crystal rubrene are investigated using the multi-mode Brownian oscillator (MBO) model, the charge hopping model with quantum nuclear tunneling, and the Munn–Silbey approach. The MBO model is adopted to calculate absorption and photoluminescence spectra, yielding results in excellent agreement with measurements. In addition, temperature dependence of zero phonon lines (ZPL) and phonon sidebands (PSBs) of absorption spectra is also examined using the MBO model, revealing a nearly linear dependence of line widths of the ZPL and the PSBs on temperature. Model parameters obtained from MBO fitting and TD-DFT computation are then utilized for hole mobility calculations. It is found that temperature dependence of the calculated mobility is in general agreement with measurements, exhibiting “band-like” transport behavior.

  4. Size distribution and optical properties of mineral dust aerosols transported in the western Mediterranean

    Directory of Open Access Journals (Sweden)

    C. Denjean

    2016-02-01

    Full Text Available This study presents in situ aircraft measurements of Saharan mineral dust transported over the western Mediterranean basin in June–July 2013 during the ChArMEx/ADRIMED (the Chemistry-Aerosol Mediterranean Experiment/Aerosol Direct Radiative Impact on the regional climate in the MEDiterranean region airborne campaign. Dust events differing in terms of source region (Algeria, Tunisia and Morocco, time of transport (1–5 days and height of transport were sampled. Mineral dust were transported above the marine boundary layer, which conversely was dominated by pollution and marine aerosols. The dust vertical structure was extremely variable and characterized by either a single layer or a more complex and stratified structure with layers originating from different source regions. Mixing of mineral dust with pollution particles was observed depending on the height of transport of the dust layers. Dust layers carried a higher concentration of pollution particles below 3 km above sea level (a.s.l. than above 3 km a.s.l., resulting in a scattering Ångström exponent up to 2.2 below 3 km a.s.l. However, the optical properties of the dust plumes remained practically unchanged with respect to values previously measured over source regions, regardless of the altitude. Moderate absorption of light by the dust plumes was observed with values of aerosol single scattering albedo at 530 nm ranging from 0.90 to 1.00. Concurrent calculations from the aerosol chemical composition revealed a negligible contribution of pollution particles to the absorption properties of the dust plumes that was due to a low contribution of refractory black carbon in regards to the fraction of dust and sulfate particles. This suggests that, even in the presence of moderate pollution, likely a persistent feature in the Mediterranean, the optical properties of the dust plumes could be assumed similar to those of native dust in radiative transfer simulations, modelling

  5. High-Throughput Nanoindentation for Statistical and Spatial Property Determination

    Science.gov (United States)

    Hintsala, Eric D.; Hangen, Ude; Stauffer, Douglas D.

    2018-04-01

    Standard nanoindentation tests are "high throughput" compared to nearly all other mechanical tests, such as tension or compression. However, the typical rates of tens of tests per hour can be significantly improved. These higher testing rates enable otherwise impractical studies requiring several thousands of indents, such as high-resolution property mapping and detailed statistical studies. However, care must be taken to avoid systematic errors in the measurement, including choosing of the indentation depth/spacing to avoid overlap of plastic zones, pileup, and influence of neighboring microstructural features in the material being tested. Furthermore, since fast loading rates are required, the strain rate sensitivity must also be considered. A review of these effects is given, with the emphasis placed on making complimentary standard nanoindentation measurements to address these issues. Experimental applications of the technique, including mapping of welds, microstructures, and composites with varying length scales, along with studying the effect of surface roughness on nominally homogeneous specimens, will be presented.

  6. Determination of Surface Properties of Liquid Transition Metals

    International Nuclear Information System (INIS)

    Korkmaz, S. D.

    2008-01-01

    Certain surface properties of liquid simple metals are reported. Using the expression derived by Gosh and coworkers we investigated the surface entropy of liquid transition metals namely Fe, Co and Ni. We have also computed surface tensions of the metals concerned. The pair distribution functions are calculated from the solution of Ornstein-Zernike integral equation with Rogers-Young closure using the individual version of the electron-ion potential proposed by Fioalhais and coworkers which was originally developed for solid state. The predicted values of surface tension and surface entropy are in very good agreement with available experimental data. The present study results show that the expression derived by Gosh and coworkers is very useful for the surface entropy by using Fioalhais pseudopotential and Rogers-Young closure

  7. Determination of Weight Suspension Rigidity in the Transport-Erector Aggregates

    Directory of Open Access Journals (Sweden)

    V. A. Zverev

    2016-01-01

    Full Text Available The aim is to determine weight suspension rigidity in aggregates designed to perform technological transport-erector operations at the miscellaneous launch complexes.We consider the weight suspension comprising the following distinctive structural components: the executive weight-lowering mechanism, polyspast mechanism, rope, traverse, and rods. A created structural dynamic model of suspension allowed us to define weight suspension rigidity. Within the framework of design analysis of a dynamic model we determined the rigidity of its structural units, i.e. traverse, rope, and polyspast.Known analytical relationships were used to calculate the rope rigidity. To determine rigidity of polyspast and traverse have been created special models based on the finite element method. For each model deformation in the specific points under the test load have been defined. Data obtained were used to determine trigidity of traverses and polyspast, and also rigidity of suspension in total. The rigidity models of polispast mechanism and traverse have been developed and calculated using the software complex "Zenit-95".As the research results, the paper presents a dynamic model of the weight suspension of the transport-erector aggregate, the finite element models of the polispast mechanism and traverse, an algorithm for determining the weight suspension rigidity and relevant analytical relationships.Independent calculation of weight suspension rigidity enables us to simplify further dynamic calculation of the aggregate-weight system because it allows attaining a simpler model of the aggregate-weight system that uses the weight suspension model as an element of equivalent rigidity. Despite this simplification the model allows us to determine correctly weight movement parameters and overloads in the aggregate-weight system in the process of technical operations.

  8. Functional properties and differential mode of regulation of the nitrate transporter from a plant symbiotic ascomycete

    Science.gov (United States)

    Montanini, Barbara; Viscomi, Arturo R.; Bolchi, Angelo; Martin, Yusé; Siverio, José M.; Balestrini, Raffaella; Bonfante, Paola; Ottonello, Simone

    2005-01-01

    Nitrogen assimilation by plant symbiotic fungi plays a central role in the mutualistic interaction established by these organisms, as well as in nitrogen flux in a variety of soils. In the present study, we report on the functional properties, structural organization and distinctive mode of regulation of TbNrt2 (Tuber borchii NRT2 family transporter), the nitrate transporter of the mycorrhizal ascomycete T. borchii. As revealed by experiments conducted in a nitrate-uptake-defective mutant of the yeast Hansenula polymorpha, TbNrt2 is a high-affinity transporter (Km=4.7 μM nitrate) that is bispecific for nitrate and nitrite. It is expressed in free-living mycelia and in mycorrhizae, where it preferentially accumulates in the plasma membrane of root-contacting hyphae. The TbNrt2 mRNA, which is transcribed from a single-copy gene clustered with the nitrate reductase gene in the T. borchii genome, was specifically up-regulated following transfer of mycelia to nitrate- (or nitrite)-containing medium. However, at variance with the strict nitrate-dependent induction commonly observed in other organisms, TbNrt2 was also up-regulated (at both the mRNA and the protein level) following transfer to a nitrogen-free medium. This unusual mode of regulation differs from that of the adjacent nitrate reductase gene, which was expressed at basal levels under nitrogen deprivation conditions and required nitrate for induction. The functional and expression properties, described in the present study, delineate TbNrt2 as a versatile transporter that may be especially suited to cope with the fluctuating (and often low) mineral nitrogen concentrations found in most natural, especially forest, soils. PMID:16201972

  9. Proton transport properties in zwitterion blends with Brønsted acids.

    Science.gov (United States)

    Yoshizawa-Fujita, Masahiro; Byrne, Nolene; Forsyth, Maria; MacFarlane, Douglas R; Ohno, Hiroyuki

    2010-12-16

    We describe zwitterion, 3-(1-butyl-1H-imidazol-3-ium-3-yl)propane-1-sulfonate (Bimps), mixtures with 1,1,1-trifluoro-N-(trifluoromethylsulfonyl)methanesulfoneamide (HN(Tf)(2)) as new proton transport electrolytes. We report proton transport mechanisms in the mixtures based on results from several methods including thermal analyses, the complex-impedance method, and the pulsed field gradient spin echo NMR (pfg-NMR) method. The glass transition temperature (Tg) of the mixtures decreased with increasing HN(Tf)(2) concentration up to 50 mol %. The Tg remained constant at -55 °C with further acid doping. The ionic conductivity of HN(Tf)(2) mixtures increased with the HN(Tf)(2) content up to 50 mol %. Beyond that ratio, the mixtures showed no increase in ionic conductivity (10(-4) S cm(-1) at room temperature). This tendency agrees well with that of Tg. However, the self-diffusion coefficients obtained from the pfg-NMR method increased with HN(Tf)(2) content even above 50 mol % for all component ions. At HN(Tf)(2) 50 mol %, the proton diffusion of HN(Tf)(2) was the fastest in the mixture. These results suggest that Bimps cannot dissociate excess HN(Tf)(2), that is, the excess HN(Tf)(2) exists as molecular HN(Tf)(2) in the mixtures. The zwitterion, Bimps, forms a 1:1 complex with HN(Tf)(2) and the proton transport property in this mixture is superior to those of other mixing ratios. Furthermore, CH(3)SO(3)H and CF(3)SO(3)H were mixed with Bimps for comparison. Both systems showed a similar tendency, which differed from that of the HN(Tf)(2) system. The Tg decreased linearly with increasing acid content for every mixing ratio, while the ionic conductivity increased linearly. Proton transport properties in zwitterion/acid mixtures were strongly affected by the acid species added.

  10. Transport Properties of the Organic Conductor (TMTSF)2BrO4: Evidence of Variable Range Hopping

    DEFF Research Database (Denmark)

    Mortensen, Kell; Jacobsen, Claus Schelde; Bechgaard, Klaus

    1984-01-01

    A study of d.c. and microwave conductivity and thermoelectric power of the organic conductor (TMTSF)2BrO4 is presented. The transport properties are in qualitative agreement with charge transport via variable-range hopping among localized states. The localization is attributed to the anions, which...

  11. Controlling In–Ga–Zn–O thin films transport properties through density changes

    Energy Technology Data Exchange (ETDEWEB)

    Kaczmarski, Jakub, E-mail: kaczmarski@ite.waw.pl [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Boll, Torben [Department of Applied Physics, Chalmers University of Technology, Fysikgränd 3, SE-412 96 Gothenburg (Sweden); Borysiewicz, Michał A. [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Taube, Andrzej [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Institute of Microelectronics & Optoelectronics, Warsaw University of Technology, ul. Koszykowa 75, 00-662 Warsaw (Poland); Thuvander, Mattias; Law, Jia Yan [Department of Applied Physics, Chalmers University of Technology, Fysikgränd 3, SE-412 96 Gothenburg (Sweden); Kamińska, Eliana [Institute of Electron Technology, al. Lotników 32/46, 02-668 Warsaw (Poland); Stiller, Krystyna [Department of Applied Physics, Chalmers University of Technology, Fysikgränd 3, SE-412 96 Gothenburg (Sweden)

    2016-06-01

    In the following study we investigate the effect of the magnetron cathode current (I{sub c}) during reactive sputtering of In–Ga–Zn–O (a-IGZO) on thin-films nanostructure and transport properties. All fabricated films are amorphous, according to X-ray diffraction measurements. However, High Resolution Transmission Electron Microscopy revealed the a-IGZO fabricated at I{sub C} = 70 mA to contain randomly-oriented nanocrystals dispersed in amorphous matrix, which disappear in films deposited at higher cathode current. These nanocrystals have the same composition as the amorphous matrix. One can observe that, while I{sub C} is increased from 70 to 150 mA, the carrier mobility improves from μ{sub Hall} = 6.9 cm{sup 2}/Vs to μ{sub Hall} = 9.1 cm{sup 2}/Vs. Additionally, the increase of I{sub C} caused a reduction of the depletion region trap states density of the Ru–Si–O/In–Ga–Zn–O Schottky barrier. This enhancement in transport properties is attributed to the greater overlapping of s-orbitals of the film-forming cations caused by increased density, evidenced by X-ray reflectivity, at a fixed chemical composition, regardless nanostructure of thin films. - Highlights: • Magnetron cathode current (I{sub C}) controls the transport properties of In–Ga–Zn–O (IGZO). • Low I{sub C} results in IGZO films with nanocrystalline inclusions in amorphous matrix. • High I{sub C} reduces the number of trap states in depletion region of Schottky contacts.

  12. Transport and Fatigue Properties of Ferroelectric Polymer P(VDF-TrFE) For Nonvolatile Memory Applications

    KAUST Repository

    Hanna, Amir

    2012-06-01

    Organic ferroelectrics polymers have recently received much interest for use in nonvolatile memory devices. The ferroelectric copolymer poly(vinylidene fluoride- trifluoroethylene) , P(VDF-TrFE), is a promising candidate due to its relatively high remnant polarization, low coercive field, fast switching times, easy processability, and low Curie transition. However, no detailed study of charge injection and current transport properties in P(VDF-TrFE) have been reported in the literature yet. Charge injection and transport are believed to affect various properties of ferroelectric films such as remnant polarization values and polarization fatigue behavior.. Thus, this thesis aims to study charge injection in P(VDF-TrFE) and its transport properties as a function of electrode material. Injection was studied for Al, Ag, Au and Pt electrodes. Higher work function metals such as Pt have shown less leakage current compared to lower work function metals such as Al for more than an order of magnitude. That implied n-type conduction behavior for P(VDF-TrFE), as well as electrons being the dominant injected carrier type. Charge transport was also studied as a function of temperature, and two major transport regimes were identified: 1) Thermionic emission over a Schottky barrier for low fields (E < 25 MV/m). 2) Space-Charge-Limited regime at higher fields (25 < E <120 MV/m). We have also studied the optical imprint phenomenon, the polarization fatigue resulting from a combination of broad band optical illumination and DC bias near the switching field. A setup was designed for the experiment, and validated by reproducing the reported effect in polycrystalline Pb(Zr,Ti)O3 , PZT, film. On the other hand, P(VDF-TrFE) film showed no polarization fatigue as a result of optical imprint test, which could be attributed to the large band gap of the material, and the low intensity of the UV portion of the arc lamp white light used for the experiment. Results suggest using high work

  13. Properties of C4F7N–CO2 thermal plasmas: thermodynamic properties, transport coefficients and emission coefficients

    Science.gov (United States)

    Wu, Yi; Wang, Chunlin; Sun, Hao; Murphy, Anthony B.; Rong, Mingzhe; Yang, Fei; Chen, Zhexin; Niu, Chunpin; Wang, Xiaohua

    2018-04-01

    The thermophysical properties, including composition, thermodynamic properties, transport coefficients and net emission coefficients, of thermal plasmas formed from pure iso-C4 perfluoronitrile C4F7N and C4F7N–CO2 mixtures are calculated for temperatures from 300 to 30 000 K and pressures from 0.1 to 20 atm. These gases have received much attention as alternatives to SF6 for use in circuit breakers, due to the low global warming potential and good dielectric properties of C4F7N. Since the parameters of the large molecules formed in the dissociation of C4F7N are unavailable, the partition function and enthalpy of formation were calculated using computational chemistry methods. From the equilibrium composition calculations, it was found that when C4F7N is mixed with CO2, CO2 can capture C atoms from C4F7N, producing CO, since the system consisting of small molecules such as CF4 and CO has lower energy at room temperature. This is in agreement with previous experimental results, which show that CO dominates the decomposition products of C4F7N–CO2 mixtures; it could limit the repeated breaking performance of C4F7N. From the point of view of chemical stability, the mixing ratio of CO2 should therefore be chosen carefully. Through comparison with common arc quenching gases (including SF6, CF3I and C5F10O), it is found that for the temperature range for which electrical conductivity remains low, pure C4F7N has similar ρC p (product of mass density and specific heat) properties to SF6, and higher radiative emission coefficient, properties that are correlated with good arc extinguishing capability. For C4F7N–CO2 mixtures, the electrical conductivity is very close to that of SF6 while the ρC p peak at 7000 K caused by decomposition of CO implies inferior interruption capability to that of SF6. The calculated properties will be useful in arc simulations.

  14. Determination of the piezoelectric properties of fine scale PZT fibres

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, L.J.; Bowen, C.R. [Bath Univ. (United Kingdom). Dept. of Engineering and Applied Science

    2002-07-01

    Finite element (FE) modelling is used to determine the effect of fibre volume fraction, aspect ratio and polymer matrix stiffness on the d{sub 33} coefficients of 1-3 connectivity piezoelectric fibre composites. The aim is to use these observations as a means of determining the d{sub 33} of fine scale lead zirconate titanate (PZT) fibres. Results from a 1-D analytical model fit well with FE predictions for low aspect ratios. Two commercially available PZT-5A fibres, produced via the viscous suspension spinning process (VSSP) and an extrusion process, were fabricated into 1-3 composites with varying fibre volume fractions. The composite d{sub 33} measurements are compared to the model predictions and used to determine the d{sub 33} coefficients of the fibers. The d{sub 33} of the VSSP fibres and extruded fibres is measured as 365 pCN{sup -1} and 235 pCN{sup -1} respectively using this method. The large difference in the piezoelectric coefficients is possibly linked to the grain size and porosity, which is examined using scanning electron microscopy. (orig.)

  15. Transportation

    International Nuclear Information System (INIS)

    Anon.

    1998-01-01

    Here is the decree of the thirtieth of July 1998 relative to road transportation, to trade and brokerage of wastes. It requires to firms which carry out a road transportation as well as to traders and to brokers of wastes to declare their operations to the prefect. The declaration has to be renewed every five years. (O.M.)

  16. Structural, magnetic, and electronic transport properties of pyrochlore iridate Pr2Ir2O7

    Science.gov (United States)

    Kumar, Harish; Chaurasia, Rachna; Kumari, Pratibha; Paramanik, A. K.

    2018-04-01

    We have studied the structural, magnetic, and electronic transport properties of pyrochlore iridate Pr2Ir2O7. Structural investigation has been done using x-ray powder diffraction and Rietveld analysis. Pr2Ir2O7 crystallize in cubic crystallographic phase with Fd-3m space group. Temperature dependent magnetization data does not show magnetic bifurcation down to 2 K. Electrical resistivity data of Pr2Ir2O7 exhibits metallic behavior throughout temperature range. Below 50 K, a small rise in resistivity data of Pr2Ir2O7 is observed down to 12 K.

  17. Comment on ''Walker diffusion method for calculation of transport properties of composite materials''

    International Nuclear Information System (INIS)

    Kim, In Chan; Cule, Dinko; Torquato, Salvatore

    2000-01-01

    In a recent paper [C. DeW. Van Siclen, Phys. Rev. E 59, 2804 (1999)], a random-walk algorithm was proposed as the best method to calculate transport properties of composite materials. It was claimed that the method is applicable both to discrete and continuum systems. The limitations of the proposed algorithm are analyzed. We show that the algorithm does not capture the peculiarities of continuum systems (e.g., ''necks'' or ''choke points'') and we argue that it is the stochastic analog of the finite-difference method. (c) 2000 The American Physical Society

  18. First-principles study of the electronic transport properties of the anthraquinone-based molecular switch

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, P., E-mail: ss_zhaop@ujn.edu.c [School of Science, University of Jinan, Jinan 250022 (China); Liu, D.S. [School of Physics, State Key Laboratory of Crystal Materials, Shandong University, Jinan 250100 (China); Department of Physics, Jining University, Qufu 273155 (China); Wang, P.J.; Zhang, Z. [School of Science, University of Jinan, Jinan 250022 (China); Fang, C.F.; Ji, G.M. [School of Physics, State Key Laboratory of Crystal Materials, Shandong University, Jinan 250100 (China)

    2011-02-15

    By applying non-equilibrium Green's function (NEGF) formalism combined with first-principles density functional theory (DFT), we have investigated the electronic transport properties of the anthraquinone-based molecular switch. The molecule that comprises the switch can be converted between the hydroquinone (HQ) and anthraquinone (AQ) forms via redox reactions. The transmission spectra of these two forms are remarkably distinctive. Our results show that the current through the HQ form is significantly larger than that through the AQ form, which suggests that this system has attractive potential application in future molecular switch technology.

  19. First-principles study of the electronic transport properties of the anthraquinone-based molecular switch

    International Nuclear Information System (INIS)

    Zhao, P.; Liu, D.S.; Wang, P.J.; Zhang, Z.; Fang, C.F.; Ji, G.M.

    2011-01-01

    By applying non-equilibrium Green's function (NEGF) formalism combined with first-principles density functional theory (DFT), we have investigated the electronic transport properties of the anthraquinone-based molecular switch. The molecule that comprises the switch can be converted between the hydroquinone (HQ) and anthraquinone (AQ) forms via redox reactions. The transmission spectra of these two forms are remarkably distinctive. Our results show that the current through the HQ form is significantly larger than that through the AQ form, which suggests that this system has attractive potential application in future molecular switch technology.

  20. Correlation of nanostructure and charge transport properties of oxidized a -SiC:H films

    Energy Technology Data Exchange (ETDEWEB)

    Gordienko, S.O.; Nazarov, A.N.; Vasin, A.V.; Rusavsky, A.V.; Lysenko, V.S. [Lashkaryov Institute of Semiconductor Physics, National Academy of Sciences of Ukraine, Prospekt Nauki 41, 03028 Kyiv (Ukraine)

    2012-06-15

    This paper considers the influence of low temperature oxidation on structural and electrical properties of amorphous carbon-rich a -Si{sub 1-x}C{sub x}:H thin films fabricated by reactive RF magnetron sputtering. It is shown that oxidation leads to formation of SiO{sub x} matrix with graphite-like carbon inclusions. Such conductive precipitates has a strong effect on charge transport in oxidized a -Si{sub 1-x}C{sub x}:H films (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)